test: Convert statics to constants

Additionally, add lots of tests for new functionality around statics and
`static mut`.

74 files changed, 535 insertions, 172 deletions

diff --git a/src/test/auxiliary/cci_const.rs b/src/test/auxiliary/cci_const.rs
index 17029b9d377..945004ede6d 100644
--- a/src/test/auxiliary/cci_const.rs
+++ b/src/test/auxiliary/cci_const.rs
@@ -11,6 +11,6 @@
 pub extern fn bar() {
 }
 
-pub static foopy: &'static str = "hi there";
-pub static uint_val: uint = 12;
-pub static uint_expr: uint = (1 << uint_val) - 1;
+pub const foopy: &'static str = "hi there";
+pub const uint_val: uint = 12;
+pub const uint_expr: uint = (1 << uint_val) - 1;
diff --git a/src/test/auxiliary/iss.rs b/src/test/auxiliary/iss.rs
index 75728c075d1..3a9d76406e1 100644
--- a/src/test/auxiliary/iss.rs
+++ b/src/test/auxiliary/iss.rs
@@ -17,7 +17,7 @@ pub struct C<'a> {
 }
 
 fn no_op() { }
-pub static D : C<'static> = C {
+pub const D : C<'static> = C {
     k: no_op
 };
 
diff --git a/src/test/auxiliary/issue-13620-1.rs b/src/test/auxiliary/issue-13620-1.rs
index ddd1012017f..e373421fabf 100644
--- a/src/test/auxiliary/issue-13620-1.rs
+++ b/src/test/auxiliary/issue-13620-1.rs
@@ -14,6 +14,6 @@ pub struct Foo {
 
 extern fn the_foo() {}
 
-pub static FOO: Foo = Foo {
+pub const FOO: Foo = Foo {
     foo: the_foo
 };
diff --git a/src/test/auxiliary/issue-17718-const-privacy.rs b/src/test/auxiliary/issue-17718-const-privacy.rs
new file mode 100644
index 00000000000..3657d39ff77
--- /dev/null
+++ b/src/test/auxiliary/issue-17718-const-privacy.rs
@@ -0,0 +1,18 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+pub use foo::FOO2;
+
+pub const FOO: uint = 3;
+const BAR: uint = 3;
+
+mod foo {
+    pub const FOO2: uint = 3;
+}
diff --git a/src/test/auxiliary/issue-17718.rs b/src/test/auxiliary/issue-17718.rs
new file mode 100644
index 00000000000..f0b431b1db9
--- /dev/null
+++ b/src/test/auxiliary/issue-17718.rs
@@ -0,0 +1,22 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::sync::atomic;
+
+pub const C1: uint = 1;
+pub const C2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+pub const C3: fn() = foo;
+pub const C4: uint = C1 * C1 + C1 / C1;
+pub const C5: &'static uint = &C4;
+
+pub static S1: uint = 3;
+pub static S2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+
+fn foo() {}
diff --git a/src/test/auxiliary/issue13213aux.rs b/src/test/auxiliary/issue13213aux.rs
index ad8c823b991..5bd52ef5010 100644
--- a/src/test/auxiliary/issue13213aux.rs
+++ b/src/test/auxiliary/issue13213aux.rs
@@ -21,7 +21,7 @@ mod private {
     pub struct P {
         p: i32,
     }
-    pub static THREE: P = P { p: 3 };
+    pub const THREE: P = P { p: 3 };
 }
 
 pub static A: S = S { p: private::THREE };
diff --git a/src/test/bench/shootout-fasta-redux.rs b/src/test/bench/shootout-fasta-redux.rs
index b8af76ce17c..e151369ff38 100644
--- a/src/test/bench/shootout-fasta-redux.rs
+++ b/src/test/bench/shootout-fasta-redux.rs
@@ -45,16 +45,16 @@ use std::io::{stdout, IoResult};
 use std::os;
 use std::slice::bytes::copy_memory;
 
-static LINE_LEN: uint = 60;
-static LOOKUP_SIZE: uint = 4 * 1024;
-static LOOKUP_SCALE: f32 = (LOOKUP_SIZE - 1) as f32;
+const LINE_LEN: uint = 60;
+const LOOKUP_SIZE: uint = 4 * 1024;
+const LOOKUP_SCALE: f32 = (LOOKUP_SIZE - 1) as f32;
 
 // Random number generator constants
-static IM: u32 = 139968;
-static IA: u32 = 3877;
-static IC: u32 = 29573;
+const IM: u32 = 139968;
+const IA: u32 = 3877;
+const IC: u32 = 29573;
 
-static ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
+const ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
                             GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA\
                             GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA\
                             AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT\
@@ -62,7 +62,7 @@ static ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
                             CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG\
                             CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
-static NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 };
+const NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 };
 
 static IUB: [AminoAcid, ..15] = [
     AminoAcid { c: 'a' as u8, p: 0.27 },
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index 7565525bc8c..77311edba4e 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -45,8 +45,8 @@ use std::io::{BufferedWriter, File};
 use std::cmp::min;
 use std::os;
 
-static LINE_LENGTH: uint = 60;
-static IM: u32 = 139968;
+const LINE_LENGTH: uint = 60;
+const IM: u32 = 139968;
 
 struct MyRandom {
     last: u32
diff --git a/src/test/bench/shootout-mandelbrot.rs b/src/test/bench/shootout-mandelbrot.rs
index 28db9ed14a7..66fe52d9ec7 100644
--- a/src/test/bench/shootout-mandelbrot.rs
+++ b/src/test/bench/shootout-mandelbrot.rs
@@ -49,9 +49,9 @@ use std::os;
 use std::simd::f64x2;
 use std::sync::{Arc, Future};
 
-static ITER: int = 50;
-static LIMIT: f64 = 2.0;
-static WORKERS: uint = 16;
+const ITER: int = 50;
+const LIMIT: f64 = 2.0;
+const WORKERS: uint = 16;
 
 #[inline(always)]
 fn mandelbrot<W: io::Writer>(w: uint, mut out: W) -> io::IoResult<()> {
@@ -144,7 +144,7 @@ fn mandelbrot<W: io::Writer>(w: uint, mut out: W) -> io::IoResult<()> {
 fn write_line(init_i: f64, vec_init_r: &[f64], res: &mut Vec<u8>) {
     let v_init_i : f64x2 = f64x2(init_i, init_i);
     let v_2 : f64x2 = f64x2(2.0, 2.0);
-    static LIMIT_SQUARED: f64 = LIMIT * LIMIT;
+    const LIMIT_SQUARED: f64 = LIMIT * LIMIT;
 
     for chunk_init_r in vec_init_r.chunks(8) {
         let mut cur_byte = 0xff;
diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs
index 6a39d2fdbb1..a945e0f7796 100644
--- a/src/test/bench/shootout-nbody.rs
+++ b/src/test/bench/shootout-nbody.rs
@@ -38,10 +38,10 @@
 // ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED
 // OF THE POSSIBILITY OF SUCH DAMAGE.
 
-static PI: f64 = 3.141592653589793;
-static SOLAR_MASS: f64 = 4.0 * PI * PI;
-static YEAR: f64 = 365.24;
-static N_BODIES: uint = 5;
+const PI: f64 = 3.141592653589793;
+const SOLAR_MASS: f64 = 4.0 * PI * PI;
+const YEAR: f64 = 365.24;
+const N_BODIES: uint = 5;
 
 static BODIES: [Planet, ..N_BODIES] = [
     // Sun
diff --git a/src/test/compile-fail/check-static-immutable-mut-slices.rs b/src/test/compile-fail/check-static-immutable-mut-slices.rs
index 73ce488cbc6..2945a050247 100644
--- a/src/test/compile-fail/check-static-immutable-mut-slices.rs
+++ b/src/test/compile-fail/check-static-immutable-mut-slices.rs
@@ -11,6 +11,6 @@
 // Checks that immutable static items can't have mutable slices
 
 static TEST: &'static mut [int] = &mut [];
-//~^ ERROR static items are not allowed to have mutable slices
+//~^ ERROR statics are not allowed to have mutable references
 
 pub fn main() { }
diff --git a/src/test/compile-fail/check-static-values-constraints.rs b/src/test/compile-fail/check-static-values-constraints.rs
index e29be22ca9a..d23aa317247 100644
--- a/src/test/compile-fail/check-static-values-constraints.rs
+++ b/src/test/compile-fail/check-static-values-constraints.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-// Verifies all possible restrictions for static items values.
+// Verifies all possible restrictions for statics values.
 
 use std::kinds::marker;
 
@@ -21,7 +21,7 @@ impl Drop for WithDtor {
 // This enum will be used to test the following rules:
 // 1. Variants are safe for static
 // 2. Expr calls are allowed as long as they arguments are safe
-// 3. Expr calls with unsafe arguments for static items are rejected
+// 3. Expr calls with unsafe arguments for statics are rejected
 enum SafeEnum {
     Variant1,
     Variant2(int),
@@ -35,7 +35,7 @@ static STATIC2: SafeEnum = Variant2(0);
 
 // This one should fail
 static STATIC3: SafeEnum = Variant3(WithDtor);
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 
 // This enum will be used to test that variants
@@ -52,9 +52,9 @@ impl Drop for UnsafeEnum {
 
 
 static STATIC4: UnsafeEnum = Variant5;
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 static STATIC5: UnsafeEnum = Variant6(0);
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 
 struct SafeStruct {
@@ -68,7 +68,7 @@ static STATIC6: SafeStruct = SafeStruct{field1: Variant1, field2: Variant2(0)};
 
 // field2 has an unsafe value, hence this should fail
 static STATIC7: SafeStruct = SafeStruct{field1: Variant1, field2: Variant3(WithDtor)};
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 // Test variadic constructor for structs. The base struct should be examined
 // as well as every field present in the constructor.
@@ -79,7 +79,7 @@ static STATIC8: SafeStruct = SafeStruct{field1: Variant1,
 // This example should fail because field1 in the base struct is not safe
 static STATIC9: SafeStruct = SafeStruct{field1: Variant1,
                                         ..SafeStruct{field1: Variant3(WithDtor), field2: Variant1}};
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 struct UnsafeStruct;
 
@@ -89,44 +89,48 @@ impl Drop for UnsafeStruct {
 
 // Types with destructors are not allowed for statics
 static STATIC10: UnsafeStruct = UnsafeStruct;
-//~^ ERROR static items are not allowed to have destructor
+//~^ ERROR statics are not allowed to have destructor
 
 struct MyOwned;
 
 static STATIC11: Box<MyOwned> = box MyOwned;
-//~^ ERROR static items are not allowed to have custom pointers
+//~^ ERROR statics are not allowed to have custom pointers
 
 // The following examples test that mutable structs are just forbidden
 // to have types with destructors
 // These should fail
 static mut STATIC12: UnsafeStruct = UnsafeStruct;
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
+//~^^ ERROR statics are not allowed to have destructors
 
 static mut STATIC13: SafeStruct = SafeStruct{field1: Variant1, field2: Variant3(WithDtor)};
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
+//~^^ ERROR: statics are not allowed to have destructors
 
 static mut STATIC14: SafeStruct = SafeStruct {
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
     field1: Variant1,
     field2: Variant4("str".to_string())
 };
 
-static STATIC15: &'static [Box<MyOwned>] = &[box MyOwned, box MyOwned];
-//~^ ERROR static items are not allowed to have custom pointers
-//~^^ ERROR static items are not allowed to have custom pointers
+static STATIC15: &'static [Box<MyOwned>] = &[
+    box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+    box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+];
 
-static STATIC16: (&'static Box<MyOwned>, &'static Box<MyOwned>) =
-    (&box MyOwned, &box MyOwned);
-//~^ ERROR static items are not allowed to have custom pointers
-//~^^ ERROR static items are not allowed to have custom pointers
+static STATIC16: (&'static Box<MyOwned>, &'static Box<MyOwned>) = (
+    &box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+    &box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+);
 
 static mut STATIC17: SafeEnum = Variant1;
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
 
-static STATIC19: Box<int> = box 3;
-//~^ ERROR static items are not allowed to have custom pointers
+static STATIC19: Box<int> =
+    box 3;
+//~^ ERROR statics are not allowed to have custom pointers
 
 pub fn main() {
     let y = { static x: Box<int> = box 3; x };
-    //~^ ERROR static items are not allowed to have custom pointers
+    //~^ ERROR statics are not allowed to have custom pointers
 }
diff --git a/src/test/compile-fail/issue-15524.rs b/src/test/compile-fail/issue-15524.rs
index 1e7bd6fc623..6d9657ab289 100644
--- a/src/test/compile-fail/issue-15524.rs
+++ b/src/test/compile-fail/issue-15524.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static N: int = 1;
+const N: int = 1;
 
 enum Foo {
     A = 1,
diff --git a/src/test/compile-fail/issue-16149.rs b/src/test/compile-fail/issue-16149.rs
index c52c53ec2e9..aa586e58f70 100644
--- a/src/test/compile-fail/issue-16149.rs
+++ b/src/test/compile-fail/issue-16149.rs
@@ -15,7 +15,7 @@ extern {
 fn main() {
     let boolValue = match 42 {
         externalValue => true,
-        //~^ ERROR extern statics cannot be referenced in patterns
+        //~^ ERROR static variables cannot be referenced in a pattern
         _ => false
     };
 }
diff --git a/src/test/compile-fail/issue-17718-borrow-interior.rs b/src/test/compile-fail/issue-17718-borrow-interior.rs
new file mode 100644
index 00000000000..1f763dbdc9f
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-borrow-interior.rs
@@ -0,0 +1,24 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+struct S { a: uint }
+static A: S  = S { a: 3 };
+static B: &'static uint = &A.a;
+//~^ ERROR: cannot refer to the interior of another static
+static C: &'static uint = &(A.a);
+//~^ ERROR: cannot refer to the interior of another static
+
+static D: [uint, ..1] = [1];
+static E: uint = D[0];
+//~^ ERROR: cannot refer to other statics by value
+static F: &'static uint = &D[0];
+//~^ ERROR: cannot refer to the interior of another static
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-bad-values.rs b/src/test/compile-fail/issue-17718-const-bad-values.rs
new file mode 100644
index 00000000000..6425dbda5c6
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-bad-values.rs
@@ -0,0 +1,20 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const C1: &'static mut [uint] = &mut [];
+//~^ ERROR: constants are not allowed to have mutable references
+
+static mut S: uint = 3;
+const C2: &'static mut uint = &mut S;
+//~^ ERROR: constants cannot refer to other statics
+//~^^ ERROR: are not allowed to have mutable references
+
+fn main() {}
+
diff --git a/src/test/compile-fail/issue-17718-const-borrow.rs b/src/test/compile-fail/issue-17718-const-borrow.rs
new file mode 100644
index 00000000000..21cc9a757cf
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-borrow.rs
@@ -0,0 +1,24 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::cell::UnsafeCell;
+
+const A: UnsafeCell<uint> = UnsafeCell { value: 1 };
+const B: &'static UnsafeCell<uint> = &A;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+
+struct C { a: UnsafeCell<uint> }
+const D: C = C { a: UnsafeCell { value: 1 } };
+const E: &'static UnsafeCell<uint> = &D.a;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+const F: &'static C = &D;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-destructors.rs b/src/test/compile-fail/issue-17718-const-destructors.rs
index dffbfe15564..e888f917741 100644
--- a/src/test/compile-fail/issue-17718-const-destructors.rs
+++ b/src/test/compile-fail/issue-17718-const-destructors.rs
@@ -14,6 +14,6 @@ impl Drop for A {
 }
 
 const FOO: A = A;
-//~ ERROR: constants are not allowed to have destructors
+//~^ ERROR: constants are not allowed to have destructors
 
 fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-naming.rs b/src/test/compile-fail/issue-17718-const-naming.rs
new file mode 100644
index 00000000000..046f038847b
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-naming.rs
@@ -0,0 +1,16 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+#[deny(warnings)]
+
+const foo: int = 3;
+//~^ ERROR: should have an uppercase name such as
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-privacy.rs b/src/test/compile-fail/issue-17718-const-privacy.rs
new file mode 100644
index 00000000000..d3be9f3dd3f
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-privacy.rs
@@ -0,0 +1,26 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+// aux-build:issue-17718-const-privacy.rs
+
+extern crate "issue-17718-const-privacy" as other;
+
+use a::B; //~ ERROR: const `B` is private
+use other::{
+    FOO,
+    BAR, //~ ERROR: const `BAR` is private
+    FOO2,
+};
+
+mod a {
+    const B: uint = 3;
+}
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-constants-not-static.rs b/src/test/compile-fail/issue-17718-constants-not-static.rs
new file mode 100644
index 00000000000..8c51b592054
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-constants-not-static.rs
@@ -0,0 +1,17 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const FOO: uint = 3;
+
+fn foo() -> &'static uint { &FOO }
+//~^ ERROR: borrowed value does not live long enough
+
+fn main() {
+}
diff --git a/src/test/compile-fail/issue-17718-extern-const.rs b/src/test/compile-fail/issue-17718-extern-const.rs
new file mode 100644
index 00000000000..235d1222d81
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-extern-const.rs
@@ -0,0 +1,15 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+extern {
+    const FOO: uint; //~ ERROR: unexpected token: `const`
+}
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-patterns.rs b/src/test/compile-fail/issue-17718-patterns.rs
new file mode 100644
index 00000000000..01dfb1b4af9
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-patterns.rs
@@ -0,0 +1,22 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+static A1: uint = 1;
+static mut A2: uint = 1;
+const A3: uint = 1;
+
+fn main() {
+    match 1u {
+        A1 => {} //~ ERROR: static variables cannot be referenced in a pattern
+        A2 => {} //~ ERROR: static variables cannot be referenced in a pattern
+        A3 => {}
+        _ => {}
+    }
+}
diff --git a/src/test/compile-fail/issue-17718-recursive.rs b/src/test/compile-fail/issue-17718-recursive.rs
new file mode 100644
index 00000000000..a13dfe639c1
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-recursive.rs
@@ -0,0 +1,14 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const A: uint = B; //~ ERROR: recursive constant
+const B: uint = A; //~ ERROR: recursive constant
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-references.rs b/src/test/compile-fail/issue-17718-references.rs
new file mode 100644
index 00000000000..7b272e1610c
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-references.rs
@@ -0,0 +1,33 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+struct Struct { a: uint }
+
+const C: uint = 1;
+static S: uint = 1;
+
+const T1: &'static uint = &C;
+const T2: &'static uint = &S; //~ ERROR: constants cannot refer to other statics
+static T3: &'static uint = &C;
+static T4: &'static uint = &S;
+
+const T5: uint = C;
+const T6: uint = S; //~ ERROR: constants cannot refer to other statics
+//~^ cannot refer to other statics
+static T7: uint = C;
+static T8: uint = S; //~ ERROR: cannot refer to other statics by value
+
+const T9: Struct = Struct { a: C };
+const T10: Struct = Struct { a: S }; //~ ERROR: cannot refer to other statics by value
+//~^ ERROR: constants cannot refer to other statics
+static T11: Struct = Struct { a: C };
+static T12: Struct = Struct { a: S }; //~ ERROR: cannot refer to other statics by value
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-static-move.rs b/src/test/compile-fail/issue-17718-static-move.rs
new file mode 100644
index 00000000000..c57df9a3af4
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-static-move.rs
@@ -0,0 +1,19 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::kinds::marker;
+
+struct Foo { nc: marker::NoCopy }
+const INIT: Foo = Foo { nc: marker::NoCopy };
+static FOO: Foo = INIT;
+
+fn main() {
+    let _a = FOO; //~ ERROR: cannot move out of static item
+}
diff --git a/src/test/compile-fail/issue-17718-static-sync.rs b/src/test/compile-fail/issue-17718-static-sync.rs
new file mode 100644
index 00000000000..2304b18adb6
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-static-sync.rs
@@ -0,0 +1,19 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::kinds::marker;
+
+struct Foo { marker: marker::NoSync }
+
+static FOO: uint = 3;
+static BAR: Foo = Foo { marker: marker::NoSync };
+//~^ ERROR: shared static items must have a type which implements Sync
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-4968.rs b/src/test/compile-fail/issue-4968.rs
index 220fb76411a..a181215f418 100644
--- a/src/test/compile-fail/issue-4968.rs
+++ b/src/test/compile-fail/issue-4968.rs
@@ -10,7 +10,7 @@
 
 // Regression test for issue #4968
 
-static A: (int,int) = (4,2);
+const A: (int,int) = (4,2);
 fn main() {
     match 42 { A => () }
     //~^ ERROR mismatched types: expected `<generic integer #0>`, found `(int,int)`
diff --git a/src/test/compile-fail/issue-7364.rs b/src/test/compile-fail/issue-7364.rs
index e29b8bc04d8..7f0d9ef3b11 100644
--- a/src/test/compile-fail/issue-7364.rs
+++ b/src/test/compile-fail/issue-7364.rs
@@ -13,6 +13,7 @@ use std::cell::RefCell;
 
 // Regresion test for issue 7364
 static boxed: Box<RefCell<int>> = box RefCell::new(0);
-//~^ ERROR static items are not allowed to have custom pointers
+//~^ ERROR statics are not allowed to have custom pointers
+//~^^ ERROR: shared static items must have a type which implements Sync
 
 fn main() { }
diff --git a/src/test/compile-fail/issue-9243.rs b/src/test/compile-fail/issue-9243.rs
index f1400c06ca2..eb3618c9f04 100644
--- a/src/test/compile-fail/issue-9243.rs
+++ b/src/test/compile-fail/issue-9243.rs
@@ -14,7 +14,7 @@ struct Test {
     mem: int,
 }
 
-pub static g_test: Test = Test {mem: 0}; //~ ERROR static items are not allowed to have destructors
+pub static g_test: Test = Test {mem: 0}; //~ ERROR statics are not allowed to have destructors
 
 impl Drop for Test {
     fn drop(&mut self) {}
diff --git a/src/test/compile-fail/lint-dead-code-1.rs b/src/test/compile-fail/lint-dead-code-1.rs
index 45380235a2a..a4320b8dc77 100644
--- a/src/test/compile-fail/lint-dead-code-1.rs
+++ b/src/test/compile-fail/lint-dead-code-1.rs
@@ -13,14 +13,12 @@
 #![allow(non_camel_case_types)]
 #![allow(non_uppercase_statics)]
 #![deny(dead_code)]
-#![feature(lang_items)]
 
 #![crate_type="lib"]
 
-pub use foo2::Bar2;
+extern crate core;
 
-#[lang="sized"]
-pub trait Sized {}
+pub use foo2::Bar2;
 
 mod foo {
     pub struct Bar; //~ ERROR: struct is never used
@@ -32,10 +30,10 @@ mod foo2 {
 
 pub static pub_static: int = 0;
 static priv_static: int = 0; //~ ERROR: static item is never used
-static used_static: int = 0;
+const used_static: int = 0;
 pub static used_static2: int = used_static;
-static USED_STATIC: int = 0;
-static STATIC_USED_IN_ENUM_DISCRIMINANT: int = 10;
+const USED_STATIC: int = 0;
+const STATIC_USED_IN_ENUM_DISCRIMINANT: int = 10;
 
 pub type typ = *const UsedStruct4;
 pub struct PubStruct;
@@ -107,7 +105,3 @@ fn bar() { //~ ERROR: function is never used
 #[allow(dead_code)]
 fn g() { h(); }
 fn h() {}
-
-// Similarly, lang items are live
-#[lang="fail"]
-fn fail(_: *const u8, _: *const u8, _: uint) -> ! { loop {} }
diff --git a/src/test/compile-fail/match-arm-statics.rs b/src/test/compile-fail/match-arm-statics.rs
index 69cb626b75a..cedc0098c00 100644
--- a/src/test/compile-fail/match-arm-statics.rs
+++ b/src/test/compile-fail/match-arm-statics.rs
@@ -17,7 +17,7 @@ enum Direction {
     West
 }
 
-static TRUE_TRUE: (bool, bool) = (true, true);
+const TRUE_TRUE: (bool, bool) = (true, true);
 
 fn nonexhaustive_1() {
     match (true, false) {
@@ -39,8 +39,8 @@ fn unreachable_1() {
     }
 }
 
-static NONE: Option<Direction> = None;
-static EAST: Direction = East;
+const NONE: Option<Direction> = None;
+const EAST: Direction = East;
 
 fn nonexhaustive_2() {
     match Some(Some(North)) {
@@ -66,13 +66,13 @@ fn unreachable_2() {
     }
 }
 
-static NEW_FALSE: NewBool = NewBool(false);
+const NEW_FALSE: NewBool = NewBool(false);
 struct Foo {
     bar: Option<Direction>,
     baz: NewBool
 }
 
-static STATIC_FOO: Foo = Foo { bar: None, baz: NEW_FALSE };
+const STATIC_FOO: Foo = Foo { bar: None, baz: NEW_FALSE };
 
 fn nonexhaustive_3() {
     match (Foo { bar: Some(North), baz: NewBool(true) }) {
diff --git a/src/test/compile-fail/match-static-const-lc.rs b/src/test/compile-fail/match-static-const-lc.rs
index a5dce6ecc6f..af7938948a7 100644
--- a/src/test/compile-fail/match-static-const-lc.rs
+++ b/src/test/compile-fail/match-static-const-lc.rs
@@ -14,7 +14,7 @@
 #![deny(non_uppercase_statics)]
 
 #[allow(non_uppercase_statics)]
-pub static a : int = 97;
+pub const a : int = 97;
 
 fn f() {
     let r = match (0,0) {
@@ -27,7 +27,7 @@ fn f() {
 
 mod m {
     #[allow(non_uppercase_statics)]
-    pub static aha : int = 7;
+    pub const aha : int = 7;
 }
 
 fn g() {
@@ -41,7 +41,7 @@ fn g() {
 }
 
 mod n {
-    pub static OKAY : int = 8;
+    pub const OKAY : int = 8;
 }
 
 fn h() {
diff --git a/src/test/compile-fail/static-mut-not-constant.rs b/src/test/compile-fail/static-mut-not-constant.rs
index 927006adc9e..84c72de5548 100644
--- a/src/test/compile-fail/static-mut-not-constant.rs
+++ b/src/test/compile-fail/static-mut-not-constant.rs
@@ -10,6 +10,7 @@
 
 
 static mut a: Box<int> = box 3;
-//~^ ERROR mutable static items are not allowed to have owned pointers
+//~^ ERROR statics are not allowed to have custom pointers
+//~^^ ERROR mutable statics are not allowed to have owned pointers
 
 fn main() {}
diff --git a/src/test/compile-fail/static-mut-not-pat.rs b/src/test/compile-fail/static-mut-not-pat.rs
index b3e93daccab..b3ffcb0b989 100644
--- a/src/test/compile-fail/static-mut-not-pat.rs
+++ b/src/test/compile-fail/static-mut-not-pat.rs
@@ -20,7 +20,7 @@ fn main() {
     // instead of spitting out a custom error about some identifier collisions
     // (we should allow shadowing)
     match 4i {
-        a => {} //~ ERROR mutable static variables cannot be referenced in a pattern
+        a => {} //~ ERROR static variables cannot be referenced in a pattern
         _ => {}
     }
 }
@@ -32,7 +32,7 @@ enum Direction {
     South,
     West
 }
-static NEW_FALSE: NewBool = NewBool(false);
+const NEW_FALSE: NewBool = NewBool(false);
 struct Foo {
     bar: Option<Direction>,
     baz: NewBool
@@ -44,7 +44,7 @@ fn mutable_statics() {
     match (Foo { bar: Some(North), baz: NewBool(true) }) {
         Foo { bar: None, baz: NewBool(true) } => (),
         STATIC_MUT_FOO => (),
-        //~^ ERROR mutable static variables cannot be referenced in a pattern
+        //~^ ERROR static variables cannot be referenced in a pattern
         Foo { bar: Some(South), .. } => (),
         Foo { bar: Some(EAST), .. } => (),
         Foo { bar: Some(North), baz: NewBool(true) } => (),
diff --git a/src/test/compile-fail/std-uncopyable-atomics.rs b/src/test/compile-fail/std-uncopyable-atomics.rs
index 0e8c2f38afb..c0122b8a2a9 100644
--- a/src/test/compile-fail/std-uncopyable-atomics.rs
+++ b/src/test/compile-fail/std-uncopyable-atomics.rs
@@ -16,11 +16,11 @@ use std::sync::atomic::*;
 use std::ptr;
 
 fn main() {
-    let x = INIT_ATOMIC_BOOL; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_BOOL;
     let x = *&x; //~ ERROR: cannot move out of dereference
-    let x = INIT_ATOMIC_INT; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_INT;
     let x = *&x; //~ ERROR: cannot move out of dereference
-    let x = INIT_ATOMIC_UINT; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_UINT;
     let x = *&x; //~ ERROR: cannot move out of dereference
     let x: AtomicPtr<uint> = AtomicPtr::new(ptr::null_mut());
     let x = *&x; //~ ERROR: cannot move out of dereference
diff --git a/src/test/pretty/issue-4264.pp b/src/test/pretty/issue-4264.pp
index 2bc09d7e96e..c5229f0f9f9 100644
--- a/src/test/pretty/issue-4264.pp
+++ b/src/test/pretty/issue-4264.pp
@@ -25,7 +25,7 @@ use std::prelude::*;
 pub fn foo(_: [int, ..(3 as uint)]) { }
 
 pub fn bar() {
-    static FOO: uint = ((5u as uint) - (4u as uint) as uint);
+    const FOO: uint = ((5u as uint) - (4u as uint) as uint);
     let _: [(), ..(FOO as uint)] = ([(() as ())] as [(), ..1]);
 
     let _: [(), ..(1u as uint)] = ([(() as ())] as [(), ..1]);
diff --git a/src/test/pretty/issue-4264.rs b/src/test/pretty/issue-4264.rs
index ad407f48a7a..ad0954e6eab 100644
--- a/src/test/pretty/issue-4264.rs
+++ b/src/test/pretty/issue-4264.rs
@@ -17,7 +17,7 @@
 pub fn foo(_: [int, ..3]) {}
 
 pub fn bar() {
-    static FOO: uint = 5u - 4u;
+    const FOO: uint = 5u - 4u;
     let _: [(), ..FOO] = [()];
 
     let _ : [(), ..1u] = [()];
diff --git a/src/test/run-make/sepcomp-cci-copies/Makefile b/src/test/run-make/sepcomp-cci-copies/Makefile
index fdb39f85197..65db841b0c0 100644
--- a/src/test/run-make/sepcomp-cci-copies/Makefile
+++ b/src/test/run-make/sepcomp-cci-copies/Makefile
@@ -7,4 +7,3 @@ all:
 	$(RUSTC) cci_lib.rs
 	$(RUSTC) foo.rs --emit=ir -C codegen-units=3
 	[ "$$(cat "$(TMPDIR)"/foo.?.ll | grep -c define\ .*cci_fn)" -eq "2" ]
-	[ "$$(cat "$(TMPDIR)"/foo.?.ll | grep -c CCI_STATIC.*=.*constant)" -eq "2" ]
diff --git a/src/test/run-make/sepcomp-cci-copies/cci_lib.rs b/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
index 099101d6f26..a7cd85db4a2 100644
--- a/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
+++ b/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
@@ -14,6 +14,3 @@
 pub fn cci_fn() -> uint {
     1234
 }
-
-#[inline]
-pub static CCI_STATIC: uint = 2345;
diff --git a/src/test/run-make/sepcomp-cci-copies/foo.rs b/src/test/run-make/sepcomp-cci-copies/foo.rs
index c702e578c09..b0642b64cda 100644
--- a/src/test/run-make/sepcomp-cci-copies/foo.rs
+++ b/src/test/run-make/sepcomp-cci-copies/foo.rs
@@ -9,10 +9,10 @@
 // except according to those terms.
 
 extern crate cci_lib;
-use cci_lib::{cci_fn, CCI_STATIC};
+use cci_lib::{cci_fn};
 
 fn call1() -> uint {
-    cci_fn() + CCI_STATIC
+    cci_fn()
 }
 
 mod a {
@@ -23,9 +23,8 @@ mod a {
 }
 
 mod b {
-    use cci_lib::CCI_STATIC;
     pub fn call3() -> uint {
-        CCI_STATIC
+        0
     }
 }
 
diff --git a/src/test/run-pass/bytes-macro-static.rs b/src/test/run-pass/bytes-macro-static.rs
index 7f4bbda8e30..2ce8c40c771 100644
--- a/src/test/run-pass/bytes-macro-static.rs
+++ b/src/test/run-pass/bytes-macro-static.rs
@@ -11,7 +11,7 @@
 static FOO: &'static [u8] = bytes!("hello, world");
 
 pub fn main() {
-    let b = match true {
+    let b: &'static [u8] = match true {
         true => bytes!("test"),
         false => unreachable!()
     };
diff --git a/src/test/run-pass/cast-in-array-size.rs b/src/test/run-pass/cast-in-array-size.rs
index 13e5b89b84e..aaffb013ad8 100644
--- a/src/test/run-pass/cast-in-array-size.rs
+++ b/src/test/run-pass/cast-in-array-size.rs
@@ -10,7 +10,7 @@
 
 
 // issues #10618 and #16382
-static SIZE: int = 25;
+const SIZE: int = 25;
 
 fn main() {
     let _a: [bool, ..1 as uint];
diff --git a/src/test/run-pass/check-static-slice.rs b/src/test/run-pass/check-static-slice.rs
index 17957dbcc13..60daedec4c7 100644
--- a/src/test/run-pass/check-static-slice.rs
+++ b/src/test/run-pass/check-static-slice.rs
@@ -11,12 +11,12 @@
 // Check that the various ways of getting to a reference to a vec (both sized
 // and unsized) work properly.
 
-static aa: [int, ..3] = [1, 2, 3];
-static ab: &'static [int, ..3] = &aa;
-static ac: &'static [int] = ab;
-static ad: &'static [int] = &aa;
-static ae: &'static [int, ..3] = &[1, 2, 3];
-static af: &'static [int] = &[1, 2, 3];
+const aa: [int, ..3] = [1, 2, 3];
+const ab: &'static [int, ..3] = &aa;
+const ac: &'static [int] = ab;
+const ad: &'static [int] = &aa;
+const ae: &'static [int, ..3] = &[1, 2, 3];
+const af: &'static [int] = &[1, 2, 3];
 
 static ca: int = aa[0];
 static cb: int = ab[1];
diff --git a/src/test/run-pass/const-cast.rs b/src/test/run-pass/const-cast.rs
index 87a4fd1153f..5d8e31f9344 100644
--- a/src/test/run-pass/const-cast.rs
+++ b/src/test/run-pass/const-cast.rs
@@ -12,9 +12,9 @@ extern crate libc;
 
 extern fn foo() {}
 
-static x: extern "C" fn() = foo;
+const x: extern "C" fn() = foo;
 static y: *const libc::c_void = x as *const libc::c_void;
-static a: &'static int = &10;
+const a: &'static int = &10;
 static b: *const int = a as *const int;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-const.rs b/src/test/run-pass/const-const.rs
index bdb2b3d2110..ba2947f7367 100644
--- a/src/test/run-pass/const-const.rs
+++ b/src/test/run-pass/const-const.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static a: int = 1;
-static b: int = a + 2;
+const a: int = 1;
+const b: int = a + 2;
 
 pub fn main() {
     assert_eq!(b, 3);
diff --git a/src/test/run-pass/const-deref.rs b/src/test/run-pass/const-deref.rs
index 7c2771c3544..480fb50a1ff 100644
--- a/src/test/run-pass/const-deref.rs
+++ b/src/test/run-pass/const-deref.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static C: &'static int = &1000;
+const C: &'static int = &1000;
 static D: int = *C;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-enum-vec-index.rs b/src/test/run-pass/const-enum-vec-index.rs
index 5be21696bd1..2a00daa3c03 100644
--- a/src/test/run-pass/const-enum-vec-index.rs
+++ b/src/test/run-pass/const-enum-vec-index.rs
@@ -9,10 +9,10 @@
 // except according to those terms.
 
 enum E { V1(int), V0 }
-static C: &'static [E] = &[V0, V1(0xDEADBEE)];
+const C: &'static [E] = &[V0, V1(0xDEADBEE)];
 static C0: E = C[0];
 static C1: E = C[1];
-static D: &'static [E, ..2] = &[V0, V1(0xDEADBEE)];
+const D: &'static [E, ..2] = &[V0, V1(0xDEADBEE)];
 static D0: E = C[0];
 static D1: E = C[1];
 
diff --git a/src/test/run-pass/const-expr-in-fixed-length-vec.rs b/src/test/run-pass/const-expr-in-fixed-length-vec.rs
index 0440a771e98..317a54e927f 100644
--- a/src/test/run-pass/const-expr-in-fixed-length-vec.rs
+++ b/src/test/run-pass/const-expr-in-fixed-length-vec.rs
@@ -13,7 +13,7 @@
 
 pub fn main() {
 
-    static FOO: uint = 2;
+    const FOO: uint = 2;
     let _v: [int, ..FOO*3];
 
 }
diff --git a/src/test/run-pass/const-expr-in-vec-repeat.rs b/src/test/run-pass/const-expr-in-vec-repeat.rs
index 5dd9f829d0a..54386b33dd9 100644
--- a/src/test/run-pass/const-expr-in-vec-repeat.rs
+++ b/src/test/run-pass/const-expr-in-vec-repeat.rs
@@ -12,7 +12,7 @@
 
 pub fn main() {
 
-    static FOO: uint = 2;
+    const FOO: uint = 2;
     let _v = [0i, ..FOO*3*2/2];
 
 }
diff --git a/src/test/run-pass/const-fields-and-indexing.rs b/src/test/run-pass/const-fields-and-indexing.rs
index ff44c76048f..fc098ff9357 100644
--- a/src/test/run-pass/const-fields-and-indexing.rs
+++ b/src/test/run-pass/const-fields-and-indexing.rs
@@ -10,20 +10,20 @@
 
 extern crate debug;
 
-static x : [int, ..4] = [1,2,3,4];
+const x : [int, ..4] = [1,2,3,4];
 static p : int = x[2];
-static y : &'static [int] = &[1,2,3,4];
+const y : &'static [int] = &[1,2,3,4];
 static q : int = y[2];
 
 struct S {a: int, b: int}
 
-static s : S = S {a: 10, b: 20};
+const s : S = S {a: 10, b: 20};
 static t : int = s.b;
 
 struct K {a: int, b: int, c: D}
 struct D { d: int, e: int }
 
-static k : K = K {a: 10, b: 20, c: D {d: 30, e: 40}};
+const k : K = K {a: 10, b: 20, c: D {d: 30, e: 40}};
 static m : int = k.c.e;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-region-ptrs-noncopy.rs b/src/test/run-pass/const-region-ptrs-noncopy.rs
index 36fe021b97e..5e417efb4b5 100644
--- a/src/test/run-pass/const-region-ptrs-noncopy.rs
+++ b/src/test/run-pass/const-region-ptrs-noncopy.rs
@@ -10,8 +10,8 @@
 
 type Big = [u64, ..8];
 struct Pair<'a> { a: int, b: &'a Big }
-static x: &'static Big = &([13, 14, 10, 13, 11, 14, 14, 15]);
-static y: &'static Pair<'static> = &Pair {a: 15, b: x};
+const x: &'static Big = &([13, 14, 10, 13, 11, 14, 14, 15]);
+const y: &'static Pair<'static> = &Pair {a: 15, b: x};
 
 pub fn main() {
     assert_eq!(x as *const Big, y.b as *const Big);
diff --git a/src/test/run-pass/const-region-ptrs.rs b/src/test/run-pass/const-region-ptrs.rs
index 113f13dc4bf..e5d3f0ece0c 100644
--- a/src/test/run-pass/const-region-ptrs.rs
+++ b/src/test/run-pass/const-region-ptrs.rs
@@ -10,9 +10,9 @@
 
 struct Pair<'a> { a: int, b: &'a int }
 
-static x: &'static int = &10;
+const x: &'static int = &10;
 
-static y: &'static Pair<'static> = &Pair {a: 15, b: x};
+const y: &'static Pair<'static> = &Pair {a: 15, b: x};
 
 pub fn main() {
     println!("x = {}", *x);
diff --git a/src/test/run-pass/const-str-ptr.rs b/src/test/run-pass/const-str-ptr.rs
index 0fef3dd4aac..7395a997a05 100644
--- a/src/test/run-pass/const-str-ptr.rs
+++ b/src/test/run-pass/const-str-ptr.rs
@@ -10,9 +10,9 @@
 
 use std::{str, string};
 
-static A: [u8, ..2] = ['h' as u8, 'i' as u8];
-static B: &'static [u8, ..2] = &A;
-static C: *const u8 = B as *const u8;
+const A: [u8, ..2] = ['h' as u8, 'i' as u8];
+const B: &'static [u8, ..2] = &A;
+const C: *const u8 = B as *const u8;
 
 pub fn main() {
     unsafe {
diff --git a/src/test/run-pass/const-struct.rs b/src/test/run-pass/const-struct.rs
index 0a83d007a06..f2db1191569 100644
--- a/src/test/run-pass/const-struct.rs
+++ b/src/test/run-pass/const-struct.rs
@@ -22,10 +22,10 @@ impl cmp::PartialEq for foo {
     fn ne(&self, other: &foo) -> bool { !(*self).eq(other) }
 }
 
-static x : foo = foo { a:1, b:2, c: 3 };
-static y : foo = foo { b:2, c:3, a: 1 };
-static z : &'static foo = &foo { a: 10, b: 22, c: 12 };
-static w : foo = foo { a:5, ..x };
+const x : foo = foo { a:1, b:2, c: 3 };
+const y : foo = foo { b:2, c:3, a: 1 };
+const z : &'static foo = &foo { a: 10, b: 22, c: 12 };
+const w : foo = foo { a:5, ..x };
 
 pub fn main() {
     assert_eq!(x.b, 2);
diff --git a/src/test/run-pass/consts-in-patterns.rs b/src/test/run-pass/consts-in-patterns.rs
index 2a15774fb17..87b7fcad385 100644
--- a/src/test/run-pass/consts-in-patterns.rs
+++ b/src/test/run-pass/consts-in-patterns.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static FOO: int = 10;
-static BAR: int = 3;
+const FOO: int = 10;
+const BAR: int = 3;
 
 pub fn main() {
     let x: int = 3i;
diff --git a/src/test/run-pass/enum-vec-initializer.rs b/src/test/run-pass/enum-vec-initializer.rs
index b04f5e11042..d51562d2490 100644
--- a/src/test/run-pass/enum-vec-initializer.rs
+++ b/src/test/run-pass/enum-vec-initializer.rs
@@ -12,13 +12,13 @@ enum Flopsy {
     Bunny = 2
 }
 
-static BAR:uint = Bunny as uint;
-static BAR2:uint = BAR;
+const BAR:uint = Bunny as uint;
+const BAR2:uint = BAR;
 
 pub fn main() {
     let _v = [0i, .. Bunny as uint];
     let _v = [0i, .. BAR];
     let _v = [0i, .. BAR2];
-    static BAR3:uint = BAR2;
+    const BAR3:uint = BAR2;
     let _v = [0i, .. BAR3];
 }
diff --git a/src/test/run-pass/issue-11940.rs b/src/test/run-pass/issue-11940.rs
index bbe7eff229b..1540679b099 100644
--- a/src/test/run-pass/issue-11940.rs
+++ b/src/test/run-pass/issue-11940.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static TEST_STR: &'static str = "abcd";
+const TEST_STR: &'static str = "abcd";
 
 fn main() {
     let s = "abcd";
diff --git a/src/test/run-pass/issue-13763.rs b/src/test/run-pass/issue-13763.rs
index 242836dbe02..8b2b732415e 100644
--- a/src/test/run-pass/issue-13763.rs
+++ b/src/test/run-pass/issue-13763.rs
@@ -10,7 +10,7 @@
 
 use std::u8;
 
-static NUM: uint = u8::BITS as uint;
+const NUM: uint = u8::BITS as uint;
 
 struct MyStruct { nums: [uint, ..8] }
 
diff --git a/src/test/run-pass/issue-17074.rs b/src/test/run-pass/issue-17074.rs
index e346148691d..d35c3a587c5 100644
--- a/src/test/run-pass/issue-17074.rs
+++ b/src/test/run-pass/issue-17074.rs
@@ -8,8 +8,10 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static X: u64 = -1 as u16 as u64;
-static Y: u64 = -1 as u32 as u64;
+static X2: u64 = -1 as u16 as u64;
+static Y2: u64 = -1 as u32 as u64;
+const X: u64 = -1 as u16 as u64;
+const Y: u64 = -1 as u32 as u64;
 
 fn main() {
     assert_eq!(match 1 {
diff --git a/src/test/compile-fail/borrowck-forbid-static-unsafe-interior.rs b/src/test/run-pass/issue-17718-static-unsafe-interior.rs
index 01a6e33467e..8f76d95c548 100644
--- a/src/test/compile-fail/borrowck-forbid-static-unsafe-interior.rs
+++ b/src/test/run-pass/issue-17718-static-unsafe-interior.rs
@@ -8,9 +8,6 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-// Verify that it is not possible to take the address of
-// static items with unsafe interior.
-
 use std::kinds::marker;
 use std::cell::UnsafeCell;
 
@@ -30,10 +27,10 @@ enum UnsafeEnum<T> {
 static STATIC1: UnsafeEnum<int> = VariantSafe;
 
 static STATIC2: UnsafeCell<int> = UnsafeCell { value: 1 };
-static STATIC3: MyUnsafe<int> = MyUnsafe{value: STATIC2};
+const CONST: UnsafeCell<int> = UnsafeCell { value: 1 };
+static STATIC3: MyUnsafe<int> = MyUnsafe{value: CONST};
 
 static STATIC4: &'static UnsafeCell<int> = &STATIC2;
-//~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
 struct Wrap<T> {
     value: T
@@ -41,14 +38,11 @@ struct Wrap<T> {
 
 static UNSAFE: UnsafeCell<int> = UnsafeCell{value: 1};
 static WRAPPED_UNSAFE: Wrap<&'static UnsafeCell<int>> = Wrap { value: &UNSAFE };
-//~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
 fn main() {
     let a = &STATIC1;
-    //~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
     STATIC3.forbidden()
-    //~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 }
 
 
diff --git a/src/test/run-pass/issue-17718.rs b/src/test/run-pass/issue-17718.rs
new file mode 100644
index 00000000000..90a102222ba
--- /dev/null
+++ b/src/test/run-pass/issue-17718.rs
@@ -0,0 +1,83 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+// aux-build:issue-17718.rs
+
+extern crate "issue-17718" as other;
+
+use std::sync::atomic;
+
+const C1: uint = 1;
+const C2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+const C3: fn() = foo;
+const C4: uint = C1 * C1 + C1 / C1;
+const C5: &'static uint = &C4;
+const C6: uint = {
+    const C: uint = 3;
+    C
+};
+
+static S1: uint = 3;
+static S2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+
+mod test {
+    static A: uint = 4;
+    static B: &'static uint = &A;
+    static C: &'static uint = &(A);
+}
+
+fn foo() {}
+
+fn main() {
+    assert_eq!(C1, 1);
+    assert_eq!(C3(), ());
+    assert_eq!(C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(C4, 2);
+    assert_eq!(*C5, 2);
+    assert_eq!(C6, 3);
+    assert_eq!(S1, 3);
+    assert_eq!(S2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(S2.fetch_add(1, atomic::SeqCst), 1);
+
+    match 1 {
+        C1 => {}
+        _ => unreachable!(),
+    }
+
+    let _a = C1;
+    let _a = C2;
+    let _a = C3;
+    let _a = C4;
+    let _a = C5;
+    let _a = C6;
+    let _a = S1;
+
+    assert_eq!(other::C1, 1);
+    assert_eq!(other::C3(), ());
+    assert_eq!(other::C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::C4, 2);
+    assert_eq!(*other::C5, 2);
+    assert_eq!(other::S1, 3);
+    assert_eq!(other::S2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::S2.fetch_add(1, atomic::SeqCst), 1);
+
+    let _a = other::C1;
+    let _a = other::C2;
+    let _a = other::C3;
+    let _a = other::C4;
+    let _a = other::C5;
+
+    match 1 {
+        other::C1 => {}
+        _ => unreachable!(),
+    }
+}
diff --git a/src/test/run-pass/issue-2428.rs b/src/test/run-pass/issue-2428.rs
index 8c8b9d5df13..b2ebbf3b148 100644
--- a/src/test/run-pass/issue-2428.rs
+++ b/src/test/run-pass/issue-2428.rs
@@ -10,7 +10,7 @@
 
 pub fn main() {
     let _foo = 100i;
-    static quux: int = 5;
+    const quux: int = 5;
 
     enum Stuff {
         Bar = quux
diff --git a/src/test/run-pass/issue-5353.rs b/src/test/run-pass/issue-5353.rs
index 2d729f8ced8..1f6493d961c 100644
--- a/src/test/run-pass/issue-5353.rs
+++ b/src/test/run-pass/issue-5353.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static INVALID_ENUM : u32 = 0;
-static INVALID_VALUE : u32 = 1;
+const INVALID_ENUM : u32 = 0;
+const INVALID_VALUE : u32 = 1;
 
 fn gl_err_str(err: u32) -> String
 {
diff --git a/src/test/run-pass/issue-7222.rs b/src/test/run-pass/issue-7222.rs
index b86b9a83e35..65ea895c2c8 100644
--- a/src/test/run-pass/issue-7222.rs
+++ b/src/test/run-pass/issue-7222.rs
@@ -9,7 +9,7 @@
 // except according to those terms.
 
 pub fn main() {
-    static FOO: f64 = 10.0;
+    const FOO: f64 = 10.0;
 
     match 0.0 {
         0.0 ... FOO => (),
diff --git a/src/test/run-pass/issue-9942.rs b/src/test/run-pass/issue-9942.rs
index aa86f488906..b9410ffdb43 100644
--- a/src/test/run-pass/issue-9942.rs
+++ b/src/test/run-pass/issue-9942.rs
@@ -9,5 +9,5 @@
 // except according to those terms.
 
 pub fn main() {
-    static S: uint = 23 as uint; [0i, ..S]; ()
+    const S: uint = 23 as uint; [0i, ..S]; ()
 }
diff --git a/src/test/run-pass/match-arm-statics.rs b/src/test/run-pass/match-arm-statics.rs
index 6eb0a4dad1b..29972c0efd0 100644
--- a/src/test/run-pass/match-arm-statics.rs
+++ b/src/test/run-pass/match-arm-statics.rs
@@ -29,19 +29,19 @@ enum EnumWithStructVariants {
     }
 }
 
-static TRUE_TRUE: (bool, bool) = (true, true);
-static NONE: Option<Direction> = None;
-static EAST: Direction = East;
-static NEW_FALSE: NewBool = NewBool(false);
-static STATIC_FOO: Foo = Foo { bar: Some(South), baz: NEW_FALSE };
-static VARIANT2_NORTH: EnumWithStructVariants = Variant2 { dir: North };
+const TRUE_TRUE: (bool, bool) = (true, true);
+const NONE: Option<Direction> = None;
+const EAST: Direction = East;
+const NEW_FALSE: NewBool = NewBool(false);
+const STATIC_FOO: Foo = Foo { bar: Some(South), baz: NEW_FALSE };
+const VARIANT2_NORTH: EnumWithStructVariants = Variant2 { dir: North };
 
 pub mod glfw {
     pub struct InputState(uint);
 
-    pub static RELEASE  : InputState = InputState(0);
-    pub static PRESS    : InputState = InputState(1);
-    pub static REPEAT   : InputState = InputState(2);
+    pub const RELEASE  : InputState = InputState(0);
+    pub const PRESS    : InputState = InputState(1);
+    pub const REPEAT   : InputState = InputState(2);
 }
 
 fn issue_6533() {
@@ -63,7 +63,7 @@ fn issue_6533() {
 }
 
 fn issue_13626() {
-    static VAL: [u8, ..1] = [0];
+    const VAL: [u8, ..1] = [0];
     match [1] {
         VAL => unreachable!(),
         _ => ()
@@ -72,8 +72,8 @@ fn issue_13626() {
 
 fn issue_14576() {
     type Foo = (i32, i32);
-    static ON: Foo = (1, 1);
-    static OFF: Foo = (0, 0);
+    const ON: Foo = (1, 1);
+    const OFF: Foo = (0, 0);
 
     match (1, 1) {
         OFF => unreachable!(),
@@ -82,14 +82,14 @@ fn issue_14576() {
     }
 
     enum C { D = 3, E = 4 }
-    static F : C = D;
+    const F : C = D;
 
     assert_eq!(match D { F => 1i, _ => 2, }, 1);
 }
 
 fn issue_13731() {
     enum A { AA(()) }
-    static B: A = AA(());
+    const B: A = AA(());
 
     match AA(()) {
         B => ()
@@ -102,8 +102,8 @@ fn issue_15393() {
         bits: uint
     }
 
-    static FOO: Flags = Flags { bits: 0x01 };
-    static BAR: Flags = Flags { bits: 0x02 };
+    const FOO: Flags = Flags { bits: 0x01 };
+    const BAR: Flags = Flags { bits: 0x02 };
     match (Flags { bits: 0x02 }) {
         FOO => unreachable!(),
         BAR => (),
diff --git a/src/test/run-pass/match-range-static.rs b/src/test/run-pass/match-range-static.rs
index 08875699245..0feeea70221 100644
--- a/src/test/run-pass/match-range-static.rs
+++ b/src/test/run-pass/match-range-static.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static s: int = 1;
-static e: int = 42;
+const s: int = 1;
+const e: int = 42;
 
 pub fn main() {
     match 7 {
diff --git a/src/test/run-pass/match-static-const-rename.rs b/src/test/run-pass/match-static-const-rename.rs
index 9028e68da1f..f3fe93650af 100644
--- a/src/test/run-pass/match-static-const-rename.rs
+++ b/src/test/run-pass/match-static-const-rename.rs
@@ -18,7 +18,7 @@
 
 #![deny(non_uppercase_statics)]
 
-pub static A : int = 97;
+pub const A : int = 97;
 
 fn f() {
     let r = match (0,0) {
@@ -35,7 +35,7 @@ fn f() {
 
 mod m {
     #[allow(non_uppercase_statics)]
-    pub static aha : int = 7;
+    pub const aha : int = 7;
 }
 
 fn g() {
diff --git a/src/test/run-pass/resolve-issue-2428.rs b/src/test/run-pass/resolve-issue-2428.rs
index 57f6596d1d7..8aa12aa3e98 100644
--- a/src/test/run-pass/resolve-issue-2428.rs
+++ b/src/test/run-pass/resolve-issue-2428.rs
@@ -8,6 +8,6 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static foo: int = 4 >> 1;
+const foo: int = 4 >> 1;
 enum bs { thing = foo }
 pub fn main() { assert!((thing as int == foo)); }
diff --git a/src/test/run-pass/sepcomp-statics.rs b/src/test/run-pass/sepcomp-statics.rs
index 26a652ae0ea..26a5c4d1c50 100644
--- a/src/test/run-pass/sepcomp-statics.rs
+++ b/src/test/run-pass/sepcomp-statics.rs
@@ -14,7 +14,7 @@
 
 fn pad() -> uint { 0 }
 
-static ONE: uint = 1;
+const ONE: uint = 1;
 
 mod b {
     // Separate compilation always switches to the LLVM module with the fewest
@@ -28,7 +28,7 @@ mod b {
 mod a {
     fn pad() -> uint { 0 }
 
-    pub static TWO: uint = ::ONE + ::ONE;
+    pub const TWO: uint = ::ONE + ::ONE;
 }
 
 fn main() {
diff --git a/src/test/run-pass/syntax-extension-bytes.rs b/src/test/run-pass/syntax-extension-bytes.rs
index 8d5333e5b3f..1f92677fb6f 100644
--- a/src/test/run-pass/syntax-extension-bytes.rs
+++ b/src/test/run-pass/syntax-extension-bytes.rs
@@ -11,15 +11,15 @@
 static static_vec: &'static [u8] = bytes!("abc", 0xFF, '!');
 
 pub fn main() {
-    let vec = bytes!("abc");
+    let vec: &'static [u8] = bytes!("abc");
     let expected: &[u8] = &[97_u8, 98_u8, 99_u8];
     assert_eq!(vec, expected);
 
-    let vec = bytes!("null", 0);
+    let vec: &'static [u8] = bytes!("null", 0);
     let expected: &[u8] = &[110_u8, 117_u8, 108_u8, 108_u8, 0_u8];
     assert_eq!(vec, expected);
 
-    let vec = bytes!(' ', " ", 32, 32u8);
+    let vec: &'static [u8] = bytes!(' ', " ", 32, 32u8);
     let expected: &[u8] = &[32_u8, 32_u8, 32_u8, 32_u8];
     assert_eq!(vec, expected);
 
diff --git a/src/test/run-pass/vector-sort-failure-safe.rs b/src/test/run-pass/vector-sort-failure-safe.rs
index 542f4dbdf23..a8ab0e48ccf 100644
--- a/src/test/run-pass/vector-sort-failure-safe.rs
+++ b/src/test/run-pass/vector-sort-failure-safe.rs
@@ -11,7 +11,7 @@
 use std::task;
 use std::rand::{task_rng, Rng};
 
-static MAX_LEN: uint = 20;
+const MAX_LEN: uint = 20;
 static mut drop_counts: [uint, .. MAX_LEN] = [0, .. MAX_LEN];
 static mut clone_count: uint = 0;
 
diff --git a/src/test/run-pass/xcrate-unit-struct.rs b/src/test/run-pass/xcrate-unit-struct.rs
index f66caa5fbfc..7eb73968db5 100644
--- a/src/test/run-pass/xcrate-unit-struct.rs
+++ b/src/test/run-pass/xcrate-unit-struct.rs
@@ -11,7 +11,7 @@
 // aux-build:xcrate_unit_struct.rs
 extern crate xcrate_unit_struct;
 
-static s1: xcrate_unit_struct::Struct = xcrate_unit_struct::Struct;
+const s1: xcrate_unit_struct::Struct = xcrate_unit_struct::Struct;
 static s2: xcrate_unit_struct::Unit = xcrate_unit_struct::UnitVariant;
 static s3: xcrate_unit_struct::Unit =
                 xcrate_unit_struct::Argument(xcrate_unit_struct::Struct);