about summary refs log tree commit diff
diff options
context:
space:
mode:
authorBrian Anderson <banderson@mozilla.com>2011-08-19 15:16:48 -0700
committerBrian Anderson <banderson@mozilla.com>2011-08-20 11:04:00 -0700
commit518dc52f85c2efb67aaa1208c02e9a7e0bdaca49 (patch)
tree9af4f631455ff5ba42b233819fe4bb9f3b9ac194
parent4aa165553bfb2a74e2e54f08fd9507e23bc24708 (diff)
Reformat
This changes the indexing syntax from .() to [], the vector syntax from ~[] to
[] and the extension syntax from #fmt() to #fmt[]
-rw-r--r--src/comp/back/link.rs32
-rw-r--r--src/comp/back/upcall.rs74
-rw-r--r--src/comp/driver/rustc.rs192
-rw-r--r--src/comp/driver/session.rs7
-rw-r--r--src/comp/front/attr.rs27
-rw-r--r--src/comp/front/config.rs2
-rw-r--r--src/comp/front/test.rs91
-rw-r--r--src/comp/lib/llvm.rs85
-rw-r--r--src/comp/metadata/creader.rs59
-rw-r--r--src/comp/metadata/cstore.rs12
-rw-r--r--src/comp/metadata/decoder.rs93
-rw-r--r--src/comp/metadata/encoder.rs99
-rw-r--r--src/comp/metadata/tydecode.rs94
-rw-r--r--src/comp/metadata/tyencode.rs13
-rw-r--r--src/comp/middle/alias.rs261
-rw-r--r--src/comp/middle/ast_map.rs55
-rw-r--r--src/comp/middle/check_alt.rs21
-rw-r--r--src/comp/middle/freevars.rs127
-rw-r--r--src/comp/middle/gc.rs166
-rw-r--r--src/comp/middle/kind.rs51
-rw-r--r--src/comp/middle/resolve.rs184
-rw-r--r--src/comp/middle/shape.rs399
-rw-r--r--src/comp/middle/trans.rs1681
-rw-r--r--src/comp/middle/trans_alt.rs190
-rw-r--r--src/comp/middle/trans_common.rs324
-rw-r--r--src/comp/middle/trans_objects.rs278
-rw-r--r--src/comp/middle/tstate/annotate.rs14
-rw-r--r--src/comp/middle/tstate/auxiliary.rs197
-rw-r--r--src/comp/middle/tstate/bitvectors.rs22
-rw-r--r--src/comp/middle/tstate/ck.rs17
-rw-r--r--src/comp/middle/tstate/collect_locals.rs38
-rw-r--r--src/comp/middle/tstate/pre_post_conditions.rs144
-rw-r--r--src/comp/middle/tstate/states.rs187
-rw-r--r--src/comp/middle/tstate/tritv.rs35
-rw-r--r--src/comp/middle/ty.rs513
-rw-r--r--src/comp/middle/typeck.rs829
-rw-r--r--src/comp/syntax/ast.rs67
-rw-r--r--src/comp/syntax/codemap.rs55
-rw-r--r--src/comp/syntax/ext/base.rs33
-rw-r--r--src/comp/syntax/ext/concat_idents.rs17
-rw-r--r--src/comp/syntax/ext/env.rs13
-rw-r--r--src/comp/syntax/ext/expand.rs9
-rw-r--r--src/comp/syntax/ext/fmt.rs57
-rw-r--r--src/comp/syntax/ext/ident_to_str.rs13
-rw-r--r--src/comp/syntax/ext/log_syntax.rs2
-rw-r--r--src/comp/syntax/ext/simplext.rs137
-rw-r--r--src/comp/syntax/fold.rs158
-rw-r--r--src/comp/syntax/parse/eval.rs15
-rw-r--r--src/comp/syntax/parse/lexer.rs92
-rw-r--r--src/comp/syntax/parse/parser.rs618
-rw-r--r--src/comp/syntax/parse/token.rs3
-rw-r--r--src/comp/syntax/print/pp.rs101
-rw-r--r--src/comp/syntax/print/pprust.rs300
-rw-r--r--src/comp/syntax/util/interner.rs8
-rw-r--r--src/comp/syntax/visit.rs81
-rw-r--r--src/comp/util/common.rs7
-rw-r--r--src/comp/util/ppaux.rs111
-rw-r--r--src/fuzzer/ast_match.rs12
-rw-r--r--src/fuzzer/fuzzer.rs185
-rw-r--r--src/fuzzer/ivec_fuzz.rs46
-rw-r--r--src/lib/aio.rs58
-rw-r--r--src/lib/bitv.rs27
-rw-r--r--src/lib/char.rs80
-rw-r--r--src/lib/comm.rs42
-rw-r--r--src/lib/deque.rs33
-rw-r--r--src/lib/ebml.rs38
-rw-r--r--src/lib/either.rs19
-rw-r--r--src/lib/extfmt.rs52
-rw-r--r--src/lib/fs.rs8
-rw-r--r--src/lib/generic_os.rs2
-rw-r--r--src/lib/getopts.rs66
-rw-r--r--src/lib/int.rs2
-rw-r--r--src/lib/io.rs133
-rw-r--r--src/lib/list.rs21
-rw-r--r--src/lib/map.rs73
-rw-r--r--src/lib/net.rs23
-rw-r--r--src/lib/option.rs5
-rw-r--r--src/lib/rand.rs13
-rw-r--r--src/lib/run_program.rs38
-rw-r--r--src/lib/sha1.rs96
-rw-r--r--src/lib/sio.rs42
-rw-r--r--src/lib/smallintmap.rs4
-rw-r--r--src/lib/sort.rs32
-rw-r--r--src/lib/str.rs77
-rw-r--r--src/lib/task.rs146
-rw-r--r--src/lib/term.rs10
-rw-r--r--src/lib/test.rs102
-rw-r--r--src/lib/time.rs2
-rw-r--r--src/lib/u64.rs2
-rw-r--r--src/lib/ufind.rs12
-rw-r--r--src/lib/uint.rs8
-rw-r--r--src/lib/vec.rs109
-rw-r--r--src/lib/win32_fs.rs4
-rw-r--r--src/lib/win32_os.rs15
-rw-r--r--src/test/bench/99bob-iter.rs2
-rw-r--r--src/test/bench/99bob-pattern.rs2
-rw-r--r--src/test/bench/99bob-simple.rs4
-rw-r--r--src/test/bench/99bob-tail.rs2
-rw-r--r--src/test/bench/shootout-ackermann.rs2
-rw-r--r--src/test/bench/shootout-binarytrees.rs14
-rw-r--r--src/test/bench/shootout-fannkuchredux.rs26
-rw-r--r--src/test/bench/shootout-fasta.rs28
-rw-r--r--src/test/bench/shootout-fibo.rs2
-rw-r--r--src/test/bench/shootout-nbody.rs33
-rw-r--r--src/test/bench/shootout-pfib.rs12
-rw-r--r--src/test/bench/task-perf-spawnalot.rs22
-rw-r--r--src/test/bench/task-perf-word-count.rs28
-rw-r--r--src/test/compile-fail/alias-mismatch.rs4
-rw-r--r--src/test/compile-fail/aliasness-mismatch.rs2
-rw-r--r--src/test/compile-fail/alt-join.rs9
-rw-r--r--src/test/compile-fail/and-init.rs2
-rw-r--r--src/test/compile-fail/arg-count-mismatch.rs2
-rw-r--r--src/test/compile-fail/arg-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/assign-alias.rs2
-rw-r--r--src/test/compile-fail/auto-deref-bind.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann-2.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann-3.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture2.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture3.rs2
-rw-r--r--src/test/compile-fail/bad-main.rs2
-rw-r--r--src/test/compile-fail/bad-module.rs2
-rw-r--r--src/test/compile-fail/bad-record-pat-2.rs2
-rw-r--r--src/test/compile-fail/bad-record-pat.rs2
-rw-r--r--src/test/compile-fail/bang-tailexpr.rs2
-rw-r--r--src/test/compile-fail/binop-add-tup-assign.rs2
-rw-r--r--src/test/compile-fail/binop-add-tup.rs2
-rw-r--r--src/test/compile-fail/binop-bitxor-str.rs2
-rw-r--r--src/test/compile-fail/binop-logic-float.rs2
-rw-r--r--src/test/compile-fail/binop-logic-int.rs2
-rw-r--r--src/test/compile-fail/binop-mul-bool.rs2
-rw-r--r--src/test/compile-fail/binop-sub-obj.rs2
-rw-r--r--src/test/compile-fail/binop-typeck.rs2
-rw-r--r--src/test/compile-fail/block-coerce-no.rs8
-rw-r--r--src/test/compile-fail/block-copy.rs4
-rw-r--r--src/test/compile-fail/block-uninit.rs4
-rw-r--r--src/test/compile-fail/break-outside-loop.rs2
-rw-r--r--src/test/compile-fail/break-uninit.rs2
-rw-r--r--src/test/compile-fail/break-uninit2.rs2
-rw-r--r--src/test/compile-fail/capture1.rs2
-rw-r--r--src/test/compile-fail/constructor-as-cast.rs4
-rw-r--r--src/test/compile-fail/copy-a-resource.rs2
-rw-r--r--src/test/compile-fail/cross-crate-glob-collision.rs2
-rw-r--r--src/test/compile-fail/direct-obj-fn-call.rs2
-rw-r--r--src/test/compile-fail/do-while-constraints.rs2
-rw-r--r--src/test/compile-fail/do-while-pred-constraints.rs26
-rw-r--r--src/test/compile-fail/dup-link-name.rs2
-rw-r--r--src/test/compile-fail/export-fully-qualified.rs2
-rw-r--r--src/test/compile-fail/export-import.rs2
-rw-r--r--src/test/compile-fail/export-no-tag-variants.rs2
-rw-r--r--src/test/compile-fail/export-tag-variant.rs2
-rw-r--r--src/test/compile-fail/export.rs2
-rw-r--r--src/test/compile-fail/export2.rs2
-rw-r--r--src/test/compile-fail/ext-nonexistent.rs2
-rw-r--r--src/test/compile-fail/extend-non-object.rs2
-rw-r--r--src/test/compile-fail/extenv-no-args.rs4
-rw-r--r--src/test/compile-fail/extenv-not-string-literal.rs2
-rw-r--r--src/test/compile-fail/extenv-too-many-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-missing-type.rs2
-rw-r--r--src/test/compile-fail/extfmt-no-args.rs4
-rw-r--r--src/test/compile-fail/extfmt-non-literal.rs4
-rw-r--r--src/test/compile-fail/extfmt-non-literal2.rs4
-rw-r--r--src/test/compile-fail/extfmt-not-enough-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-too-many-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-unknown-type.rs2
-rw-r--r--src/test/compile-fail/extfmt-unsigned-plus.rs4
-rw-r--r--src/test/compile-fail/extfmt-unsigned-space.rs4
-rw-r--r--src/test/compile-fail/extfmt-unterminated-conv.rs2
-rw-r--r--src/test/compile-fail/fail-expr.rs2
-rw-r--r--src/test/compile-fail/fail-type-err.rs2
-rw-r--r--src/test/compile-fail/fn-bad-block-type.rs2
-rw-r--r--src/test/compile-fail/fn-compare-mismatch.rs2
-rw-r--r--src/test/compile-fail/fn-constraint.rs2
-rw-r--r--src/test/compile-fail/fn-expr-type-state.rs2
-rw-r--r--src/test/compile-fail/fn-expr-typestate-2.rs2
-rw-r--r--src/test/compile-fail/for-each-over-bs.rs2
-rw-r--r--src/test/compile-fail/forgot-ret.rs2
-rw-r--r--src/test/compile-fail/fru-extra-field.rs2
-rw-r--r--src/test/compile-fail/fru-typestate.rs2
-rw-r--r--src/test/compile-fail/if-branch-types.rs2
-rw-r--r--src/test/compile-fail/if-check-precond-fail.rs4
-rw-r--r--src/test/compile-fail/if-typeck.rs2
-rw-r--r--src/test/compile-fail/import-from-dup.rs6
-rw-r--r--src/test/compile-fail/import-from-missing.rs7
-rw-r--r--src/test/compile-fail/import-glob-0.rs2
-rw-r--r--src/test/compile-fail/import-glob-circular.rs2
-rw-r--r--src/test/compile-fail/import-glob-export.rs2
-rw-r--r--src/test/compile-fail/import-glob-multiple.rs2
-rw-r--r--src/test/compile-fail/import-loop-2.rs2
-rw-r--r--src/test/compile-fail/import-loop.rs2
-rw-r--r--src/test/compile-fail/import5.rs2
-rw-r--r--src/test/compile-fail/impure-pred.rs2
-rw-r--r--src/test/compile-fail/infinite-vec-type-recursion.rs2
-rw-r--r--src/test/compile-fail/lambda-mutate-nested.rs5
-rw-r--r--src/test/compile-fail/lambda-mutate.rs5
-rw-r--r--src/test/compile-fail/let-destruct-refutable.rs9
-rw-r--r--src/test/compile-fail/macro-2.rs10
-rw-r--r--src/test/compile-fail/macro.rs5
-rw-r--r--src/test/compile-fail/main-wrong-type-2.rs2
-rw-r--r--src/test/compile-fail/main-wrong-type.rs2
-rw-r--r--src/test/compile-fail/minus-string.rs4
-rw-r--r--src/test/compile-fail/missing-main.rs2
-rw-r--r--src/test/compile-fail/missing-return2.rs2
-rw-r--r--src/test/compile-fail/move-arg.rs10
-rw-r--r--src/test/compile-fail/native-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/nested-ty-params.rs2
-rw-r--r--src/test/compile-fail/no-constraint-prop.rs2
-rw-r--r--src/test/compile-fail/no-self-dispatch.rs2
-rw-r--r--src/test/compile-fail/not-a-pred-2.rs3
-rw-r--r--src/test/compile-fail/not-a-pred-3.rs2
-rw-r--r--src/test/compile-fail/not-a-pred-check.rs2
-rw-r--r--src/test/compile-fail/not-a-pred.rs4
-rw-r--r--src/test/compile-fail/not-pred-args.rs2
-rw-r--r--src/test/compile-fail/occurs-check-2.rs6
-rw-r--r--src/test/compile-fail/occurs-check.rs5
-rw-r--r--src/test/compile-fail/or-init.rs2
-rw-r--r--src/test/compile-fail/or-patter-mismatch.rs2
-rw-r--r--src/test/compile-fail/output-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/pred-assign.rs4
-rw-r--r--src/test/compile-fail/pred-not-bool.rs2
-rw-r--r--src/test/compile-fail/pred-on-wrong-slots.rs4
-rw-r--r--src/test/compile-fail/pred-swap.rs4
-rw-r--r--src/test/compile-fail/rec-extend.rs2
-rw-r--r--src/test/compile-fail/rec-missing-fields.rs2
-rw-r--r--src/test/compile-fail/ret-non-nil.rs2
-rw-r--r--src/test/compile-fail/return-uninit.rs2
-rw-r--r--src/test/compile-fail/self-call-non-obj.rs2
-rw-r--r--src/test/compile-fail/slot-as-pred.rs4
-rw-r--r--src/test/compile-fail/spawn-non-nil-fn.rs2
-rw-r--r--src/test/compile-fail/swap-no-lval.rs2
-rw-r--r--src/test/compile-fail/swap-uninit.rs2
-rw-r--r--src/test/compile-fail/tail-typeck.rs2
-rw-r--r--src/test/compile-fail/type-arg-out-of-scope.rs2
-rw-r--r--src/test/compile-fail/type-mismatch-multiple.rs2
-rw-r--r--src/test/compile-fail/type-mismatch.rs2
-rw-r--r--src/test/compile-fail/type-recursive.rs2
-rw-r--r--src/test/compile-fail/type-shadow.rs2
-rw-r--r--src/test/compile-fail/unreachable-arm.rs2
-rw-r--r--src/test/compile-fail/unsafe-alias-2.rs2
-rw-r--r--src/test/compile-fail/unsafe-alias.rs4
-rw-r--r--src/test/compile-fail/unsafe-alt.rs2
-rw-r--r--src/test/compile-fail/unsafe-for.rs4
-rw-r--r--src/test/compile-fail/unsafe-mutable-alias.rs2
-rw-r--r--src/test/compile-fail/use-after-move.rs2
-rw-r--r--src/test/compile-fail/use-after-send.rs10
-rw-r--r--src/test/compile-fail/use-meta-dup.rs2
-rw-r--r--src/test/compile-fail/use-meta-mismatch.rs2
-rw-r--r--src/test/compile-fail/use-uninit-2.rs2
-rw-r--r--src/test/compile-fail/use-uninit-3.rs2
-rw-r--r--src/test/compile-fail/use-uninit.rs2
-rw-r--r--src/test/compile-fail/vec-field.rs2
-rw-r--r--src/test/compile-fail/vector-no-ann.rs2
-rw-r--r--src/test/compile-fail/while-bypass.rs2
-rw-r--r--src/test/compile-fail/while-expr.rs2
-rw-r--r--src/test/compile-fail/while-loop-constraints.rs2
-rw-r--r--src/test/compile-fail/while-loop-pred-constraints.rs2
-rw-r--r--src/test/compile-fail/writing-through-read-alias.rs2
-rw-r--r--src/test/compile-fail/writing-through-uninit-vec.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-obj.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-rec.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-vec.rs2
-rw-r--r--src/test/compile-fail/wrong-ret-type.rs2
-rw-r--r--src/test/compiletest/common.rs34
-rw-r--r--src/test/compiletest/compiletest.rs94
-rw-r--r--src/test/compiletest/procsrv.rs93
-rw-r--r--src/test/compiletest/runtest.rs193
-rw-r--r--src/test/compiletest/util.rs2
-rw-r--r--src/test/pretty/block-disambig.rs52
-rw-r--r--src/test/pretty/empty-lines.rs2
-rw-r--r--src/test/pretty/example2.rs6
-rw-r--r--src/test/pretty/unary-op-disambig.rs44
-rw-r--r--src/test/pretty/vec-comments.rs50
-rw-r--r--src/test/pretty/vec-type.rs2
-rw-r--r--src/test/run-fail/alt-bot-fail.rs6
-rw-r--r--src/test/run-fail/alt-disc-bot.rs2
-rw-r--r--src/test/run-fail/args-fail.rs2
-rw-r--r--src/test/run-fail/bug-811.rs11
-rw-r--r--src/test/run-fail/do-while-body-fails.rs4
-rw-r--r--src/test/run-fail/explicit-fail-msg.rs2
-rw-r--r--src/test/run-fail/explicit-fail.rs2
-rw-r--r--src/test/run-fail/expr-alt-fail-fn.rs2
-rw-r--r--src/test/run-fail/expr-alt-fail.rs2
-rw-r--r--src/test/run-fail/expr-fn-fail.rs2
-rw-r--r--src/test/run-fail/expr-if-fail-fn.rs2
-rw-r--r--src/test/run-fail/expr-if-fail.rs2
-rw-r--r--src/test/run-fail/fail-arg.rs2
-rw-r--r--src/test/run-fail/fail-main.rs2
-rw-r--r--src/test/run-fail/fail.rs2
-rw-r--r--src/test/run-fail/fmt-fail.rs2
-rw-r--r--src/test/run-fail/fn-constraint-claim.rs7
-rw-r--r--src/test/run-fail/fn-constraint.rs2
-rw-r--r--src/test/run-fail/if-check-fail.rs4
-rw-r--r--src/test/run-fail/non-exhaustive-match.rs2
-rw-r--r--src/test/run-fail/pred.rs2
-rw-r--r--src/test/run-fail/rhs-type.rs2
-rw-r--r--src/test/run-fail/str-overrun.rs6
-rw-r--r--src/test/run-fail/vec-overrun.rs6
-rw-r--r--src/test/run-fail/vec-underrun.rs6
-rw-r--r--src/test/run-pass/alloca-from-derived-tydesc.rs4
-rw-r--r--src/test/run-pass/alt-bot.rs6
-rw-r--r--src/test/run-pass/alt-join.rs4
-rw-r--r--src/test/run-pass/alt-path.rs2
-rw-r--r--src/test/run-pass/alt-pattern-drop.rs2
-rw-r--r--src/test/run-pass/alt-pattern-lit.rs2
-rw-r--r--src/test/run-pass/alt-pattern-simple.rs2
-rw-r--r--src/test/run-pass/alt-str.rs2
-rw-r--r--src/test/run-pass/alt-tag.rs2
-rw-r--r--src/test/run-pass/anon-obj-backwarding-2.rs20
-rw-r--r--src/test/run-pass/anon-obj-cats.rs56
-rw-r--r--src/test/run-pass/anon-obj-degenerate.rs2
-rw-r--r--src/test/run-pass/anon-obj-no-inner-obj-simple.rs55
-rw-r--r--src/test/run-pass/anon-obj-overriding-reduced.rs2
-rw-r--r--src/test/run-pass/anon-obj-overriding.rs2
-rw-r--r--src/test/run-pass/anon-obj-with-self-call-2.rs2
-rw-r--r--src/test/run-pass/anon-obj-with-self-call.rs2
-rw-r--r--src/test/run-pass/argv.rs4
-rw-r--r--src/test/run-pass/arith-0.rs2
-rw-r--r--src/test/run-pass/arith-1.rs2
-rw-r--r--src/test/run-pass/arith-2.rs2
-rw-r--r--src/test/run-pass/arith-unsigned.rs2
-rw-r--r--src/test/run-pass/artificial-block.rs2
-rw-r--r--src/test/run-pass/assign-assign.rs2
-rw-r--r--src/test/run-pass/auto-deref-fn.rs2
-rw-r--r--src/test/run-pass/auto-loop.rs2
-rw-r--r--src/test/run-pass/autobind.rs8
-rw-r--r--src/test/run-pass/autoderef-objfn.rs2
-rw-r--r--src/test/run-pass/bind-interior.rs4
-rw-r--r--src/test/run-pass/bind-obj-ctor.rs2
-rw-r--r--src/test/run-pass/bind-parameterized-args-2.rs2
-rw-r--r--src/test/run-pass/bind-parameterized-args.rs4
-rw-r--r--src/test/run-pass/bind-thunk.rs4
-rw-r--r--src/test/run-pass/bind-trivial.rs4
-rw-r--r--src/test/run-pass/binops.rs16
-rw-r--r--src/test/run-pass/bitwise.rs2
-rw-r--r--src/test/run-pass/block-fn-coerce.rs4
-rw-r--r--src/test/run-pass/block-iter-1.rs10
-rw-r--r--src/test/run-pass/block-iter-2.rs9
-rw-r--r--src/test/run-pass/block-vec-map2.rs8
-rw-r--r--src/test/run-pass/bool-not.rs2
-rw-r--r--src/test/run-pass/box-compare.rs2
-rw-r--r--src/test/run-pass/box-in-tup.rs5
-rw-r--r--src/test/run-pass/box-pattern.rs2
-rw-r--r--src/test/run-pass/box.rs2
-rw-r--r--src/test/run-pass/break-value.rs2
-rw-r--r--src/test/run-pass/break.rs7
-rw-r--r--src/test/run-pass/call-autoderef-tag.rs6
-rw-r--r--src/test/run-pass/cast.rs2
-rw-r--r--src/test/run-pass/chan-leak.rs5
-rw-r--r--src/test/run-pass/char.rs2
-rw-r--r--src/test/run-pass/child-outlives-parent.rs2
-rw-r--r--src/test/run-pass/claim-nonterm.rs2
-rw-r--r--src/test/run-pass/command-line-args.rs2
-rw-r--r--src/test/run-pass/complex.rs2
-rw-r--r--src/test/run-pass/const.rs2
-rw-r--r--src/test/run-pass/constrained-type.rs4
-rw-r--r--src/test/run-pass/constraint-prop-expr-move.rs2
-rw-r--r--src/test/run-pass/constraint-prop-move.rs2
-rw-r--r--src/test/run-pass/constraint-prop-swap.rs2
-rw-r--r--src/test/run-pass/constraint-prop.rs2
-rw-r--r--src/test/run-pass/crate-attributes-src/foo.rs2
-rw-r--r--src/test/run-pass/dead-code-one-arm-if.rs2
-rw-r--r--src/test/run-pass/deep.rs2
-rw-r--r--src/test/run-pass/deref-lval.rs2
-rw-r--r--src/test/run-pass/deref.rs2
-rw-r--r--src/test/run-pass/div-mod.rs2
-rw-r--r--src/test/run-pass/double-unbox.rs2
-rw-r--r--src/test/run-pass/drop-bind-thunk-args.rs2
-rw-r--r--src/test/run-pass/drop-on-empty-block-exit.rs2
-rw-r--r--src/test/run-pass/drop-on-ret.rs2
-rw-r--r--src/test/run-pass/early-ret-binop-add.rs6
-rw-r--r--src/test/run-pass/early-ret-binop.rs6
-rw-r--r--src/test/run-pass/else-if.rs10
-rw-r--r--src/test/run-pass/empty-mutable-vec.rs2
-rw-r--r--src/test/run-pass/export-abstract-tag.rs2
-rw-r--r--src/test/run-pass/export-multi.rs11
-rw-r--r--src/test/run-pass/export-non-interference2.rs2
-rw-r--r--src/test/run-pass/export-non-interference3.rs2
-rw-r--r--src/test/run-pass/export-tag-variant.rs2
-rw-r--r--src/test/run-pass/export-unexported-dep.rs2
-rw-r--r--src/test/run-pass/expr-alt-box.rs2
-rw-r--r--src/test/run-pass/expr-alt-fail-all.rs2
-rw-r--r--src/test/run-pass/expr-alt-fail.rs6
-rw-r--r--src/test/run-pass/expr-alt-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-alt-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-alt-generic.rs2
-rw-r--r--src/test/run-pass/expr-alt-struct.rs2
-rw-r--r--src/test/run-pass/expr-alt.rs2
-rw-r--r--src/test/run-pass/expr-block-box.rs2
-rw-r--r--src/test/run-pass/expr-block-fn.rs4
-rw-r--r--src/test/run-pass/expr-block-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-block-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-block-generic.rs2
-rw-r--r--src/test/run-pass/expr-block-ref.rs2
-rw-r--r--src/test/run-pass/expr-block-slot.rs2
-rw-r--r--src/test/run-pass/expr-block.rs2
-rw-r--r--src/test/run-pass/expr-copy.rs6
-rw-r--r--src/test/run-pass/expr-elseif-ref.rs2
-rw-r--r--src/test/run-pass/expr-elseif-ref2.rs4
-rw-r--r--src/test/run-pass/expr-empty-ret.rs2
-rw-r--r--src/test/run-pass/expr-fn.rs4
-rw-r--r--src/test/run-pass/expr-if-box.rs2
-rw-r--r--src/test/run-pass/expr-if-fail-all.rs2
-rw-r--r--src/test/run-pass/expr-if-fail.rs4
-rw-r--r--src/test/run-pass/expr-if-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-if-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-if-generic.rs2
-rw-r--r--src/test/run-pass/expr-if-struct.rs2
-rw-r--r--src/test/run-pass/expr-if.rs8
-rw-r--r--src/test/run-pass/expr-scope.rs2
-rw-r--r--src/test/run-pass/exterior.rs2
-rw-r--r--src/test/run-pass/fact.rs2
-rw-r--r--src/test/run-pass/fixed-point-bind-box.rs6
-rw-r--r--src/test/run-pass/float-signature.rs2
-rw-r--r--src/test/run-pass/float.rs2
-rw-r--r--src/test/run-pass/float2.rs2
-rw-r--r--src/test/run-pass/floatlits.rs2
-rw-r--r--src/test/run-pass/fn-constraint.rs2
-rw-r--r--src/test/run-pass/fn-expr.rs2
-rw-r--r--src/test/run-pass/fn-lval.rs4
-rw-r--r--src/test/run-pass/fn-type-infer.rs2
-rw-r--r--src/test/run-pass/for-destruct.rs4
-rw-r--r--src/test/run-pass/for-each-destruct.rs9
-rw-r--r--src/test/run-pass/for-loop-fail.rs2
-rw-r--r--src/test/run-pass/foreach-nested-2.rs20
-rw-r--r--src/test/run-pass/foreach-nested.rs12
-rw-r--r--src/test/run-pass/fun-call-variants.rs10
-rw-r--r--src/test/run-pass/fun-indirect-call.rs2
-rw-r--r--src/test/run-pass/generic-ivec-leak.rs2
-rw-r--r--src/test/run-pass/generic-ivec.rs2
-rw-r--r--src/test/run-pass/generic-temporary.rs6
-rw-r--r--src/test/run-pass/generic-tup.rs5
-rw-r--r--src/test/run-pass/hashmap-memory.rs6
-rw-r--r--src/test/run-pass/hello.rs2
-rw-r--r--src/test/run-pass/i32-sub.rs2
-rw-r--r--src/test/run-pass/i8-incr.rs2
-rw-r--r--src/test/run-pass/if-bot.rs2
-rw-r--r--src/test/run-pass/if-check-precond.rs4
-rw-r--r--src/test/run-pass/if-check.rs4
-rw-r--r--src/test/run-pass/if-ret.rs2
-rw-r--r--src/test/run-pass/import-from-native.rs9
-rw-r--r--src/test/run-pass/import-from.rs9
-rw-r--r--src/test/run-pass/import-glob-0.rs2
-rw-r--r--src/test/run-pass/import-glob-1.rs52
-rw-r--r--src/test/run-pass/import-glob-circular.rs2
-rw-r--r--src/test/run-pass/import-glob-crate.rs4
-rw-r--r--src/test/run-pass/import.rs2
-rw-r--r--src/test/run-pass/import2.rs2
-rw-r--r--src/test/run-pass/import3.rs2
-rw-r--r--src/test/run-pass/import6.rs2
-rw-r--r--src/test/run-pass/import8.rs2
-rw-r--r--src/test/run-pass/infer-fn-tail-expr.rs2
-rw-r--r--src/test/run-pass/inner-module.rs2
-rw-r--r--src/test/run-pass/int.rs2
-rw-r--r--src/test/run-pass/integral-indexing.rs2
-rw-r--r--src/test/run-pass/interior-vec.rs17
-rw-r--r--src/test/run-pass/issue-506.rs9
-rw-r--r--src/test/run-pass/issue-687.rs13
-rw-r--r--src/test/run-pass/item-attributes.rs2
-rw-r--r--src/test/run-pass/item-name-overload.rs2
-rw-r--r--src/test/run-pass/ivec-add.rs12
-rw-r--r--src/test/run-pass/ivec-pass-by-value.rs2
-rw-r--r--src/test/run-pass/ivec-tag.rs5
-rw-r--r--src/test/run-pass/join.rs2
-rw-r--r--src/test/run-pass/lambda-infer-unresolved.rs6
-rw-r--r--src/test/run-pass/lambda-no-leak.rs4
-rw-r--r--src/test/run-pass/large-records.rs2
-rw-r--r--src/test/run-pass/lazy-and-or.rs2
-rw-r--r--src/test/run-pass/lazy-init.rs2
-rw-r--r--src/test/run-pass/leak-tag-copy.rs2
-rw-r--r--src/test/run-pass/let-destruct-fresh-mem.rs10
-rw-r--r--src/test/run-pass/let-destruct.rs8
-rw-r--r--src/test/run-pass/linear-for-loop.rs2
-rw-r--r--src/test/run-pass/list.rs2
-rw-r--r--src/test/run-pass/log-err-phi.rs2
-rw-r--r--src/test/run-pass/long-while.rs2
-rw-r--r--src/test/run-pass/loop-scope.rs2
-rw-r--r--src/test/run-pass/macro-2.rs10
-rw-r--r--src/test/run-pass/macro-3.rs4
-rw-r--r--src/test/run-pass/macro-by-example-1.rs4
-rw-r--r--src/test/run-pass/macro-by-example-2.rs27
-rw-r--r--src/test/run-pass/macro.rs5
-rw-r--r--src/test/run-pass/main-ivec.rs4
-rw-r--r--src/test/run-pass/many.rs28
-rw-r--r--src/test/run-pass/maybe-mutable.rs4
-rw-r--r--src/test/run-pass/mlist.rs2
-rw-r--r--src/test/run-pass/move-1.rs2
-rw-r--r--src/test/run-pass/move-2.rs2
-rw-r--r--src/test/run-pass/move-4.rs2
-rw-r--r--src/test/run-pass/move-arg-2.rs8
-rw-r--r--src/test/run-pass/move-arg.rs9
-rw-r--r--src/test/run-pass/move-scalar.rs2
-rw-r--r--src/test/run-pass/multi-let.rs5
-rw-r--r--src/test/run-pass/multi-src/bar.rs2
-rw-r--r--src/test/run-pass/multi-src/foo.rs2
-rw-r--r--src/test/run-pass/multiline-comment.rs2
-rw-r--r--src/test/run-pass/mutable-alias-vec.rs4
-rw-r--r--src/test/run-pass/mutable-vec-drop.rs2
-rw-r--r--src/test/run-pass/mutual-recursion-group.rs2
-rw-r--r--src/test/run-pass/native-mod-src/inner.rs2
-rw-r--r--src/test/run-pass/native-opaque-type.rs2
-rw-r--r--src/test/run-pass/native-src/native.rs2
-rw-r--r--src/test/run-pass/nested-obj-self.rs2
-rw-r--r--src/test/run-pass/newtype-polymorphic.rs8
-rw-r--r--src/test/run-pass/newtype.rs4
-rw-r--r--src/test/run-pass/nil-pattern.rs2
-rw-r--r--src/test/run-pass/obj-docs.rs41
-rw-r--r--src/test/run-pass/obj-drop.rs2
-rw-r--r--src/test/run-pass/obj-recursion.rs4
-rw-r--r--src/test/run-pass/obj-self-2.rs2
-rw-r--r--src/test/run-pass/obj-self-3.rs2
-rw-r--r--src/test/run-pass/obj-self-4.rs2
-rw-r--r--src/test/run-pass/obj-self.rs2
-rw-r--r--src/test/run-pass/obj-with-vec.rs4
-rw-r--r--src/test/run-pass/opeq.rs2
-rw-r--r--src/test/run-pass/operator-associativity.rs2
-rw-r--r--src/test/run-pass/or-pattern.rs2
-rw-r--r--src/test/run-pass/output-slot-variants.rs2
-rw-r--r--src/test/run-pass/over-constrained-vregs.rs2
-rw-r--r--src/test/run-pass/paren-free.rs2
-rw-r--r--src/test/run-pass/parse-fail.rs2
-rw-r--r--src/test/run-pass/polymorphic-iter.rs4
-rw-r--r--src/test/run-pass/pred-check.rs2
-rw-r--r--src/test/run-pass/pred.rs2
-rw-r--r--src/test/run-pass/readalias.rs2
-rw-r--r--src/test/run-pass/rebind-fn.rs9
-rw-r--r--src/test/run-pass/rec-auto.rs2
-rw-r--r--src/test/run-pass/rec-extend.rs2
-rw-r--r--src/test/run-pass/rec-tup.rs10
-rw-r--r--src/test/run-pass/rec.rs2
-rw-r--r--src/test/run-pass/record-pat.rs2
-rw-r--r--src/test/run-pass/resource-destruct.rs2
-rw-r--r--src/test/run-pass/resource-generic.rs2
-rw-r--r--src/test/run-pass/resource-in-struct.rs8
-rw-r--r--src/test/run-pass/ret-bang.rs2
-rw-r--r--src/test/run-pass/return-nil.rs2
-rw-r--r--src/test/run-pass/rt-circular-buffer.rs14
-rw-r--r--src/test/run-pass/self-shadowing-import.rs2
-rw-r--r--src/test/run-pass/seq-compare.rs20
-rw-r--r--src/test/run-pass/shadow.rs13
-rw-r--r--src/test/run-pass/simple-alt-generic-tag.rs3
-rw-r--r--src/test/run-pass/simple-anon-objs.rs2
-rw-r--r--src/test/run-pass/simple-infer.rs2
-rw-r--r--src/test/run-pass/simple-obj.rs2
-rw-r--r--src/test/run-pass/size-and-align.rs4
-rw-r--r--src/test/run-pass/spawn-fn.rs2
-rw-r--r--src/test/run-pass/spawn-module-qualified.rs9
-rw-r--r--src/test/run-pass/spawn.rs5
-rw-r--r--src/test/run-pass/standalone-method.rs16
-rw-r--r--src/test/run-pass/stateful-obj.rs2
-rw-r--r--src/test/run-pass/str-append.rs4
-rw-r--r--src/test/run-pass/str-concat.rs4
-rw-r--r--src/test/run-pass/str-growth.rs14
-rw-r--r--src/test/run-pass/str-idx.rs2
-rw-r--r--src/test/run-pass/str-multiline.rs2
-rw-r--r--src/test/run-pass/string-self-append.rs2
-rw-r--r--src/test/run-pass/structured-compare-recursive.rs2
-rw-r--r--src/test/run-pass/structured-compare.rs2
-rw-r--r--src/test/run-pass/swap-1.rs2
-rw-r--r--src/test/run-pass/swap-2.rs12
-rw-r--r--src/test/run-pass/syntax-extension-fmt.rs300
-rw-r--r--src/test/run-pass/syntax-extension-minor.rs6
-rw-r--r--src/test/run-pass/tag.rs2
-rw-r--r--src/test/run-pass/tail-call-arg-leak.rs2
-rw-r--r--src/test/run-pass/tail-cps.rs6
-rw-r--r--src/test/run-pass/tail-direct.rs2
-rw-r--r--src/test/run-pass/task-comm-11.rs2
-rw-r--r--src/test/run-pass/task-comm-13.rs2
-rw-r--r--src/test/run-pass/task-comm-15.rs2
-rw-r--r--src/test/run-pass/task-comm-16.rs40
-rw-r--r--src/test/run-pass/task-comm-3.rs5
-rw-r--r--src/test/run-pass/task-comm-4.rs2
-rw-r--r--src/test/run-pass/task-comm-5.rs4
-rw-r--r--src/test/run-pass/task-comm-6.rs10
-rw-r--r--src/test/run-pass/task-comm-8.rs2
-rw-r--r--src/test/run-pass/task-comm-9.rs5
-rw-r--r--src/test/run-pass/task-comm.rs27
-rw-r--r--src/test/run-pass/task-pin.rs2
-rw-r--r--src/test/run-pass/ternary.rs2
-rw-r--r--src/test/run-pass/test-runner-hides-main.rs2
-rw-r--r--src/test/run-pass/threads.rs13
-rw-r--r--src/test/run-pass/tup.rs2
-rw-r--r--src/test/run-pass/type-in-nested-module.rs2
-rw-r--r--src/test/run-pass/type-namespace.rs2
-rw-r--r--src/test/run-pass/type-param-constraints.rs6
-rw-r--r--src/test/run-pass/type-param.rs2
-rw-r--r--src/test/run-pass/type-params-in-for-each.rs4
-rw-r--r--src/test/run-pass/typestate-cfg-nesting.rs2
-rw-r--r--src/test/run-pass/typestate-multi-decl.rs6
-rw-r--r--src/test/run-pass/typestate-transitive.rs2
-rw-r--r--src/test/run-pass/u32-decr.rs2
-rw-r--r--src/test/run-pass/u8-incr-decr.rs2
-rw-r--r--src/test/run-pass/u8-incr.rs2
-rw-r--r--src/test/run-pass/uint.rs2
-rw-r--r--src/test/run-pass/unify-return-ty.rs4
-rw-r--r--src/test/run-pass/unit.rs2
-rw-r--r--src/test/run-pass/use-import-export.rs2
-rw-r--r--src/test/run-pass/utf8.rs2
-rw-r--r--src/test/run-pass/utf8_chars.rs8
-rw-r--r--src/test/run-pass/vec-append.rs28
-rw-r--r--src/test/run-pass/vec-concat.rs12
-rw-r--r--src/test/run-pass/vec-drop.rs2
-rw-r--r--src/test/run-pass/vec-growth.rs22
-rw-r--r--src/test/run-pass/vec-ivec-deadlock.rs2
-rw-r--r--src/test/run-pass/vec-late-init.rs4
-rw-r--r--src/test/run-pass/vec-push.rs4
-rw-r--r--src/test/run-pass/vec.rs4
-rw-r--r--src/test/run-pass/vector-no-ann-2.rs2
-rw-r--r--src/test/run-pass/while-and-do-while.rs2
-rw-r--r--src/test/run-pass/while-flow-graph.rs2
-rw-r--r--src/test/run-pass/while-loop-constraints-2.rs2
-rw-r--r--src/test/run-pass/while-prelude-drop.rs2
-rw-r--r--src/test/run-pass/while-with-break.rs2
-rw-r--r--src/test/run-pass/wierd-exprs.rs38
-rw-r--r--src/test/run-pass/writealias.rs2
-rw-r--r--src/test/run-pass/x86stdcall.rs2
-rw-r--r--src/test/run-pass/yield.rs2
-rw-r--r--src/test/run-pass/yield1.rs3
-rw-r--r--src/test/stdtest/bitv.rs122
-rw-r--r--src/test/stdtest/comm.rs6
-rw-r--r--src/test/stdtest/deque.rs13
-rw-r--r--src/test/stdtest/either.rs34
-rw-r--r--src/test/stdtest/getopts.rs160
-rw-r--r--src/test/stdtest/int.rs2
-rw-r--r--src/test/stdtest/io.rs2
-rw-r--r--src/test/stdtest/list.rs12
-rw-r--r--src/test/stdtest/net.rs4
-rw-r--r--src/test/stdtest/path.rs2
-rw-r--r--src/test/stdtest/ptr.rs4
-rw-r--r--src/test/stdtest/qsort.rs29
-rw-r--r--src/test/stdtest/qsort3.rs20
-rw-r--r--src/test/stdtest/rand.rs2
-rw-r--r--src/test/stdtest/run.rs20
-rw-r--r--src/test/stdtest/sha1.rs48
-rw-r--r--src/test/stdtest/sort.rs16
-rw-r--r--src/test/stdtest/str.rs62
-rw-r--r--src/test/stdtest/str_buf.rs2
-rw-r--r--src/test/stdtest/task.rs8
-rw-r--r--src/test/stdtest/test.rs42
-rw-r--r--src/test/stdtest/uint.rs2
-rw-r--r--src/test/stdtest/vec.rs280
-rw-r--r--src/test/stdtest/vec_str_conversions.rs4
642 files changed, 6788 insertions, 7387 deletions
diff --git a/src/comp/back/link.rs b/src/comp/back/link.rs
index 11df59a7f43..d8fd682387b 100644
--- a/src/comp/back/link.rs
+++ b/src/comp/back/link.rs
@@ -137,10 +137,9 @@ mod write {
                                                                    False);
 
             if threshold != 0u {
-                llvm::LLVMPassManagerBuilderUseInlinerWithThreshold(MPMB,
-                                                                   threshold);
+                llvm::LLVMPassManagerBuilderUseInlinerWithThreshold(
+                    MPMB, threshold);
             }
-
             llvm::LLVMPassManagerBuilderPopulateModulePassManager(MPMB,
                                                                   pm.llpm);
 
@@ -293,21 +292,21 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str,
        provided_metas {
         let name: option::t<str> = none;
         let vers: option::t<str> = none;
-        let cmh_items: [@ast::meta_item] = ~[];
+        let cmh_items: [@ast::meta_item] = [];
         let linkage_metas = attr::find_linkage_metas(c.node.attrs);
         attr::require_unique_names(sess, linkage_metas);
         for meta: @ast::meta_item in linkage_metas {
             if attr::get_meta_item_name(meta) == "name" {
                 alt attr::get_meta_item_value_str(meta) {
                   some(v) { name = some(v); }
-                  none. { cmh_items += ~[meta]; }
+                  none. { cmh_items += [meta]; }
                 }
-            } else if (attr::get_meta_item_name(meta) == "vers") {
+            } else if attr::get_meta_item_name(meta) == "vers" {
                 alt attr::get_meta_item_value_str(meta) {
                   some(v) { vers = some(v); }
-                  none. { cmh_items += ~[meta]; }
+                  none. { cmh_items += [meta]; }
                 }
-            } else { cmh_items += ~[meta]; }
+            } else { cmh_items += [meta]; }
         }
         ret {name: name, vers: vers, cmh_items: cmh_items};
     }
@@ -316,7 +315,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str,
     fn crate_meta_extras_hash(sha: sha1, _crate: &ast::crate,
                               metas: &provided_metas) -> str {
         fn len_and_str(s: &str) -> str {
-            ret #fmt("%u_%s", str::byte_len(s), s);
+            ret #fmt["%u_%s", str::byte_len(s), s];
         }
 
         fn len_and_str_lit(l: &ast::lit) -> str {
@@ -345,8 +344,8 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str,
 
     fn warn_missing(sess: &session::session, name: str, default: str) {
         if !sess.get_opts().library { ret; }
-        sess.warn(#fmt("missing crate link meta '%s', using '%s' as default",
-                       name, default));
+        sess.warn(#fmt["missing crate link meta '%s', using '%s' as default",
+                       name, default]);
     }
 
     fn crate_meta_name(sess: &session::session, _crate: &ast::crate,
@@ -356,8 +355,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str,
               none. {
                 let name =
                     {
-                        let os =
-                            str::split(fs::basename(output), '.' as u8);
+                        let os = str::split(fs::basename(output), '.' as u8);
                         assert (vec::len(os) >= 2u);
                         vec::pop(os);
                         str::connect(os, ".")
@@ -429,7 +427,7 @@ fn mangle(ss: &[str]) -> str {
 
     let n = "_ZN"; // Begin name-sequence.
 
-    for s: str in ss { n += #fmt("%u%s", str::byte_len(s), s); }
+    for s: str in ss { n += #fmt["%u%s", str::byte_len(s), s]; }
     n += "E"; // End name-sequence.
 
     ret n;
@@ -438,7 +436,7 @@ fn mangle(ss: &[str]) -> str {
 fn exported_name(path: &[str], hash: &str, _vers: &str) -> str {
     // FIXME: versioning isn't working yet
 
-    ret mangle(path + ~[hash]); //  + "@" + vers;
+    ret mangle(path + [hash]); //  + "@" + vers;
 
 }
 
@@ -451,12 +449,12 @@ fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: &ty::t, name: &str)
    -> str {
     let s = util::ppaux::ty_to_short_str(ccx.tcx, t);
     let hash = get_symbol_hash(ccx, t);
-    ret mangle(~[name, s, hash]);
+    ret mangle([name, s, hash]);
 }
 
 fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[str],
                                         flav: &str) -> str {
-    ret mangle(path + ~[ccx.names.next(flav)]);
+    ret mangle(path + [ccx.names.next(flav)]);
 }
 
 fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[str]) -> str {
diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs
index 40e365612d6..eb1741767ad 100644
--- a/src/comp/back/upcall.rs
+++ b/src/comp/back/upcall.rs
@@ -51,72 +51,68 @@ type upcalls =
 
 fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef,
                    taskptr_type: TypeRef, llmod: ModuleRef) -> @upcalls {
-    fn decl(llmod: ModuleRef, name: str, tys: [TypeRef],
-          rv: TypeRef) -> ValueRef {
-        let arg_tys: [TypeRef] = ~[];
-        for t: TypeRef in tys { arg_tys += ~[t]; }
+    fn decl(llmod: ModuleRef, name: str, tys: [TypeRef], rv: TypeRef) ->
+       ValueRef {
+        let arg_tys: [TypeRef] = [];
+        for t: TypeRef in tys { arg_tys += [t]; }
         let fn_ty = T_fn(arg_tys, rv);
         ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty);
     }
-    fn decl_with_taskptr(taskptr_type: TypeRef,
-                         llmod: ModuleRef, name: str, tys: [TypeRef],
-                         rv: TypeRef) -> ValueRef {
-        ret decl(llmod, name, ~[taskptr_type] + tys, rv);
+    fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef, name: str,
+                         tys: [TypeRef], rv: TypeRef) -> ValueRef {
+        ret decl(llmod, name, [taskptr_type] + tys, rv);
     }
     let dv = bind decl_with_taskptr(taskptr_type, llmod, _, _, T_void());
     let d = bind decl_with_taskptr(taskptr_type, llmod, _, _, _);
     let dr = bind decl(llmod, _, _, _);
 
-    let empty_vec: [TypeRef] = ~[];
-    ret @{grow_task: dv("grow_task", ~[T_size_t()]),
+    let empty_vec: [TypeRef] = [];
+    ret @{grow_task: dv("grow_task", [T_size_t()]),
           _yield: dv("yield", empty_vec),
-          sleep: dv("sleep", ~[T_size_t()]),
-          _fail: dv("fail", ~[T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]),
-          kill: dv("kill", ~[taskptr_type]),
+          sleep: dv("sleep", [T_size_t()]),
+          _fail: dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]),
+          kill: dv("kill", [taskptr_type]),
           exit: dv("exit", empty_vec),
           malloc:
-              d("malloc", ~[T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())),
-          free: dv("free", ~[T_ptr(T_i8()), T_int()]),
+              d("malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())),
+          free: dv("free", [T_ptr(T_i8()), T_int()]),
           shared_malloc:
-              d("shared_malloc", ~[T_size_t(), T_ptr(tydesc_type)],
+              d("shared_malloc", [T_size_t(), T_ptr(tydesc_type)],
                 T_ptr(T_i8())),
-          shared_free: dv("shared_free", ~[T_ptr(T_i8())]),
-          mark: d("mark", ~[T_ptr(T_i8())], T_int()),
-          new_str: d("new_str", ~[T_ptr(T_i8()), T_size_t()], T_ptr(T_str())),
+          shared_free: dv("shared_free", [T_ptr(T_i8())]),
+          mark: d("mark", [T_ptr(T_i8())], T_int()),
+          new_str: d("new_str", [T_ptr(T_i8()), T_size_t()], T_ptr(T_str())),
           evec_append:
               d("evec_append",
-                ~[T_ptr(tydesc_type), T_ptr(tydesc_type),
-                  T_ptr(T_opaque_vec_ptr()), T_opaque_vec_ptr(), T_bool()],
+                [T_ptr(tydesc_type), T_ptr(tydesc_type),
+                 T_ptr(T_opaque_vec_ptr()), T_opaque_vec_ptr(), T_bool()],
                 T_void()),
           get_type_desc:
               d("get_type_desc",
-                ~[T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(),
-                  T_ptr(T_ptr(tydesc_type))], T_ptr(tydesc_type)),
+                [T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(),
+                 T_ptr(T_ptr(tydesc_type))], T_ptr(tydesc_type)),
           ivec_resize:
-              d("ivec_resize", ~[T_ptr(T_opaque_ivec()), T_int()], T_void()),
+              d("ivec_resize", [T_ptr(T_opaque_ivec()), T_int()], T_void()),
           ivec_spill:
-              d("ivec_spill", ~[T_ptr(T_opaque_ivec()), T_int()], T_void()),
+              d("ivec_spill", [T_ptr(T_opaque_ivec()), T_int()], T_void()),
           ivec_resize_shared:
-              d("ivec_resize_shared", ~[T_ptr(T_opaque_ivec()), T_int()],
+              d("ivec_resize_shared", [T_ptr(T_opaque_ivec()), T_int()],
                 T_void()),
           ivec_spill_shared:
-              d("ivec_spill_shared", ~[T_ptr(T_opaque_ivec()), T_int()],
+              d("ivec_spill_shared", [T_ptr(T_opaque_ivec()), T_int()],
                 T_void()),
           cmp_type:
-              dr("cmp_type", ~[T_ptr(T_i1()), taskptr_type,
-                 T_ptr(tydesc_type), T_ptr(T_ptr(tydesc_type)),
-                 T_ptr(T_i8()), T_ptr(T_i8()), T_i8()],
-                 T_void()),
+              dr("cmp_type",
+                 [T_ptr(T_i1()), taskptr_type, T_ptr(tydesc_type),
+                  T_ptr(T_ptr(tydesc_type)), T_ptr(T_i8()), T_ptr(T_i8()),
+                  T_i8()], T_void()),
           log_type:
-              dr("log_type", ~[taskptr_type, T_ptr(tydesc_type),
-                 T_ptr(T_i8()), T_i32()],
+              dr("log_type",
+                 [taskptr_type, T_ptr(tydesc_type), T_ptr(T_i8()), T_i32()],
                  T_void()),
-          dynastack_mark:
-              d("dynastack_mark", ~[], T_ptr(T_i8())),
-          dynastack_alloc:
-              d("dynastack_alloc", ~[T_size_t()], T_ptr(T_i8())),
-          dynastack_free:
-              d("dynastack_free", ~[T_ptr(T_i8())], T_void())};
+          dynastack_mark: d("dynastack_mark", [], T_ptr(T_i8())),
+          dynastack_alloc: d("dynastack_alloc", [T_size_t()], T_ptr(T_i8())),
+          dynastack_free: d("dynastack_free", [T_ptr(T_i8())], T_void())};
 }
 //
 // Local Variables:
diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs
index 6c125f0e176..a75a46e64c7 100644
--- a/src/comp/driver/rustc.rs
+++ b/src/comp/driver/rustc.rs
@@ -53,11 +53,11 @@ fn default_configuration(sess: session::session, argv0: str, input: str) ->
 
     let mk = attr::mk_name_value_item_str;
 
-    ret ~[ // Target bindings.
-          mk("target_os", std::os::target_os()), mk("target_arch", "x86"),
-          mk("target_libc", libc),
-          // Build bindings.
-          mk("build_compiler", argv0), mk("build_input", input)];
+    ret [ // Target bindings.
+         mk("target_os", std::os::target_os()), mk("target_arch", "x86"),
+         mk("target_libc", libc),
+         // Build bindings.
+         mk("build_compiler", argv0), mk("build_input", input)];
 }
 
 fn build_configuration(sess: session::session, argv0: str, input: str) ->
@@ -71,8 +71,8 @@ fn build_configuration(sess: session::session, argv0: str, input: str) ->
         {
             if sess.get_opts().test && !attr::contains_name(user_cfg, "test")
                {
-                ~[attr::mk_word_item("test")]
-            } else { ~[] }
+                [attr::mk_word_item("test")]
+            } else { [] }
         };
     ret user_cfg + gen_cfg + default_cfg;
 }
@@ -81,8 +81,8 @@ fn build_configuration(sess: session::session, argv0: str, input: str) ->
 fn parse_cfgspecs(cfgspecs: &[str]) -> ast::crate_cfg {
     // FIXME: It would be nice to use the parser to parse all varieties of
     // meta_item here. At the moment we just support the meta_word variant.
-    let words = ~[];
-    for s: str in cfgspecs { words += ~[attr::mk_word_item(s)]; }
+    let words = [];
+    for s: str in cfgspecs { words += [attr::mk_word_item(s)]; }
     ret words;
 }
 
@@ -92,31 +92,29 @@ fn parse_input(sess: session::session, cfg: &ast::crate_cfg, input: str) ->
    @ast::crate {
     if !input_is_stdin(input) {
         parser::parse_crate_from_file(input, cfg, sess.get_parse_sess())
-    } else {
-        parse_input_src(sess, cfg, input).crate
-    }
+    } else { parse_input_src(sess, cfg, input).crate }
 }
 
-fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg,
-                   infile: str) -> {crate: @ast::crate, src: str} {
-    let srcbytes = if infile != "-" {
-        io::file_reader(infile)
-    } else {
-        io::stdin()
-    }.read_whole_stream();
+fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, infile: str)
+   -> {crate: @ast::crate, src: str} {
+    let srcbytes =
+        if infile != "-" {
+            io::file_reader(infile)
+        } else { io::stdin() }.read_whole_stream();
     let src = str::unsafe_from_bytes(srcbytes);
-    let crate = parser::parse_crate_from_source_str(infile, src, cfg,
-                                                    sess.get_parse_sess());
+    let crate =
+        parser::parse_crate_from_source_str(infile, src, cfg,
+                                            sess.get_parse_sess());
     ret {crate: crate, src: src};
 }
 
-fn time<T>(do_it: bool, what: str, thunk: fn() -> T ) -> T {
+fn time<T>(do_it: bool, what: str, thunk: fn() -> T) -> T {
     if !do_it { ret thunk(); }
     let start = std::time::precise_time_s();
     let rv = thunk();
     let end = std::time::precise_time_s();
-    log_err #fmt("time: %s took %s s", what,
-                 common::float_to_str(end - start, 3u));
+    log_err #fmt["time: %s took %s s", what,
+                 common::float_to_str(end - start, 3u)];
     ret rv;
 }
 
@@ -143,7 +141,7 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str,
              bind middle::ast_map::map_crate(*crate));
     time(time_passes, "external crate/lib resolution",
          bind creader::read_crates(sess, *crate));
-    let {def_map, ext_map} =
+    let {def_map: def_map, ext_map: ext_map} =
         time(time_passes, "resolution",
              bind resolve::resolve_crate(sess, ast_map, crate));
     let freevars =
@@ -151,9 +149,9 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str,
              bind freevars::annotate_freevars(sess, def_map, crate));
     let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, ast_map, freevars);
     time::<()>(time_passes, "typechecking",
-             bind typeck::check_crate(ty_cx, crate));
+               bind typeck::check_crate(ty_cx, crate));
     time::<()>(time_passes, "alt checking",
-             bind middle::check_alt::check_crate(ty_cx, crate));
+               bind middle::check_alt::check_crate(ty_cx, crate));
     if sess.get_opts().run_typestate {
         time(time_passes, "typestate checking",
              bind middle::tstate::ck::check_crate(ty_cx, crate));
@@ -161,15 +159,15 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str,
     time(time_passes, "alias checking",
          bind middle::alias::check_crate(ty_cx, crate));
     time::<()>(time_passes, "kind checking",
-             bind kind::check_crate(ty_cx, crate));
+               bind kind::check_crate(ty_cx, crate));
     if sess.get_opts().no_trans { ret; }
     let llmod =
         time::<llvm::llvm::ModuleRef>(time_passes, "translation",
-                                    bind trans::trans_crate(sess, crate,
-                                                            ty_cx, output,
-                                                            ast_map));
+                                      bind trans::trans_crate(sess, crate,
+                                                              ty_cx, output,
+                                                              ast_map));
     time::<()>(time_passes, "LLVM passes",
-             bind link::write::run_passes(sess, llmod, output));
+               bind link::write::run_passes(sess, llmod, output));
 }
 
 fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str,
@@ -222,7 +220,8 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str,
     alt ppm {
       ppm_typed. {
         let amap = middle::ast_map::map_crate(*crate);
-        let {def_map, ext_map} = resolve::resolve_crate(sess, amap, crate);
+        let {def_map: def_map, ext_map: ext_map} =
+            resolve::resolve_crate(sess, amap, crate);
         let freevars = freevars::annotate_freevars(sess, def_map, crate);
         let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, amap, freevars);
         typeck::check_crate(ty_cx, crate);
@@ -239,14 +238,14 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str,
 
 fn version(argv0: str) {
     let vers = "unknown version";
-    let env_vers = #env("CFG_VERSION");
+    let env_vers = #env["CFG_VERSION"];
     if str::byte_len(env_vers) != 0u { vers = env_vers; }
-    io::stdout().write_str(#fmt("%s %s\n", argv0, vers));
+    io::stdout().write_str(#fmt["%s %s\n", argv0, vers]);
 }
 
 fn usage(argv0: str) {
-    io::stdout().write_str(#fmt("usage: %s [options] <input>\n", argv0) +
-                                   "
+    io::stdout().write_str(#fmt["usage: %s [options] <input>\n", argv0] +
+                               "
 options:
 
     -h --help          display this message
@@ -287,9 +286,9 @@ fn get_os(triple: str) -> session::os {
     ret if str::find(triple, "win32") >= 0 ||
                str::find(triple, "mingw32") >= 0 {
             session::os_win32
-        } else if (str::find(triple, "darwin") >= 0) {
+        } else if str::find(triple, "darwin") >= 0 {
             session::os_macos
-        } else if (str::find(triple, "linux") >= 0) {
+        } else if str::find(triple, "linux") >= 0 {
             session::os_linux
         } else { log_err "Unknown operating system!"; fail };
 }
@@ -300,10 +299,10 @@ fn get_arch(triple: str) -> session::arch {
                str::find(triple, "i686") >= 0 ||
                str::find(triple, "i786") >= 0 {
             session::arch_x86
-        } else if (str::find(triple, "x86_64") >= 0) {
+        } else if str::find(triple, "x86_64") >= 0 {
             session::arch_x64
-        } else if (str::find(triple, "arm") >= 0 ||
-                       str::find(triple, "xscale") >= 0) {
+        } else if str::find(triple, "arm") >= 0 ||
+                      str::find(triple, "xscale") >= 0 {
             session::arch_arm
         } else { log_err "Unknown architecture! " + triple; fail };
 }
@@ -331,9 +330,9 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str)
     let library = opt_present(match, "lib");
     let static = opt_present(match, "static");
 
-    let library_search_paths = ~[binary_dir + "/lib"];
+    let library_search_paths = [binary_dir + "/lib"];
     let lsp_vec = getopts::opt_strs(match, "L");
-    for lsp: str in lsp_vec { library_search_paths += ~[lsp]; }
+    for lsp: str in lsp_vec { library_search_paths += [lsp]; }
 
     let parse_only = opt_present(match, "parse-only");
     let no_trans = opt_present(match, "no-trans");
@@ -341,11 +340,11 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str)
     let output_type =
         if parse_only || no_trans {
             link::output_type_none
-        } else if (opt_present(match, "S")) {
+        } else if opt_present(match, "S") {
             link::output_type_assembly
-        } else if (opt_present(match, "c")) {
+        } else if opt_present(match, "c") {
             link::output_type_object
-        } else if (opt_present(match, "emit-llvm")) {
+        } else if opt_present(match, "emit-llvm") {
             link::output_type_bitcode
         } else { link::output_type_exe };
     let verify = !opt_present(match, "noverify");
@@ -363,7 +362,7 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str)
                 fail;
             }
             2u
-        } else if (opt_present(match, "OptLevel")) {
+        } else if opt_present(match, "OptLevel") {
             alt getopts::opt_str(match, "OptLevel") {
               "0" { 0u }
               "1" { 1u }
@@ -417,24 +416,23 @@ fn build_session(sopts: @session::options) -> session::session {
 fn parse_pretty(sess: session::session, name: &str) -> pp_mode {
     if str::eq(name, "normal") {
         ret ppm_normal;
-    } else if (str::eq(name, "typed")) {
+    } else if str::eq(name, "typed") {
         ret ppm_typed;
-    } else if (str::eq(name, "identified")) { ret ppm_identified; }
+    } else if str::eq(name, "identified") { ret ppm_identified; }
     sess.fatal("argument to `pretty` or `expand` must be one of `normal`, " +
                    "`typed`, or `identified`");
 }
 
 fn opts() -> [getopts::opt] {
-    ret ~[optflag("h"), optflag("help"), optflag("v"), optflag("version"),
-          optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"),
-          optflagopt("expand"), optflag("ls"), optflag("parse-only"),
-          optflag("no-trans"),
-          optflag("O"), optopt("OptLevel"), optmulti("L"), optflag("S"),
-          optflag("c"), optopt("o"), optflag("g"), optflag("save-temps"),
-          optopt("sysroot"), optflag("stats"), optflag("time-passes"),
-          optflag("time-llvm-passes"), optflag("no-typestate"),
-          optflag("noverify"), optmulti("cfg"), optflag("test"),
-          optflag("lib"), optflag("static"), optflag("gc")];
+    ret [optflag("h"), optflag("help"), optflag("v"), optflag("version"),
+         optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"),
+         optflagopt("expand"), optflag("ls"), optflag("parse-only"),
+         optflag("no-trans"), optflag("O"), optopt("OptLevel"), optmulti("L"),
+         optflag("S"), optflag("c"), optopt("o"), optflag("g"),
+         optflag("save-temps"), optopt("sysroot"), optflag("stats"),
+         optflag("time-passes"), optflag("time-llvm-passes"),
+         optflag("no-typestate"), optflag("noverify"), optmulti("cfg"),
+         optflag("test"), optflag("lib"), optflag("static"), optflag("gc")];
 }
 
 fn main(args: [str]) {
@@ -444,7 +442,7 @@ fn main(args: [str]) {
         alt getopts::getopts(args, opts()) {
           getopts::success(m) { m }
           getopts::failure(f) {
-            log_err #fmt("error: %s", getopts::fail_str(f));
+            log_err #fmt["error: %s", getopts::fail_str(f)];
             fail
           }
         };
@@ -471,10 +469,10 @@ fn main(args: [str]) {
     }
     if n_inputs == 0u {
         sess.fatal("No input filename given.");
-    } else if (n_inputs > 1u) {
+    } else if n_inputs > 1u {
         sess.fatal("Multiple input filenames provided.");
     }
-    let ifile = match.free.(0);
+    let ifile = match.free[0];
     let saved_out_filename: str = "";
     let cfg = build_configuration(sess, binary, ifile);
     let expand =
@@ -502,10 +500,7 @@ fn main(args: [str]) {
       none::<pp_mode>. {/* continue */ }
     }
     let ls = opt_present(match, "ls");
-    if ls {
-        metadata::creader::list_file_metadata(ifile, io::stdout());
-        ret;
-    }
+    if ls { metadata::creader::list_file_metadata(ifile, io::stdout()); ret; }
 
     let stop_after_codegen =
         sopts.output_type != link::output_type_exe ||
@@ -516,29 +511,31 @@ fn main(args: [str]) {
         // "-" as input file will cause the parser to read from stdin so we
         // have to make up a name
         // We want to toss everything after the final '.'
-        let parts = if !input_is_stdin(ifile) {
-            str::split(ifile, '.' as u8)
-        } else {
-            ~["default", "rs"]
-        };
+        let parts =
+            if !input_is_stdin(ifile) {
+                str::split(ifile, '.' as u8)
+            } else { ["default", "rs"] };
         vec::pop(parts);
         saved_out_filename = str::connect(parts, ".");
-        let suffix = alt sopts.output_type {
-          link::output_type_none. { "none" }
-          link::output_type_bitcode. { "bc" }
-          link::output_type_assembly. { "s" }
-          // Object and exe output both use the '.o' extension here
-          link::output_type_object. | link::output_type_exe. { "o" }
-        };
+        let suffix =
+            alt sopts.output_type {
+              link::output_type_none. { "none" }
+              link::output_type_bitcode. { "bc" }
+              link::output_type_assembly. { "s" }
+
+              // Object and exe output both use the '.o' extension here
+              link::output_type_object. | link::output_type_exe. {
+                "o"
+              }
+            };
         let ofile = saved_out_filename + "." + suffix;
         compile_input(sess, cfg, ifile, ofile);
       }
       some(ofile) {
         // FIXME: what about windows? This will create a foo.exe.o.
         saved_out_filename = ofile;
-        let temp_filename = if !stop_after_codegen {
-            ofile + ".o"
-        } else { ofile };
+        let temp_filename =
+            if !stop_after_codegen { ofile + ".o" } else { ofile };
         compile_input(sess, cfg, ifile, temp_filename);
       }
     }
@@ -556,8 +553,8 @@ fn main(args: [str]) {
     // The invocations of gcc share some flags across platforms
 
     let gcc_args =
-        ~[stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename,
-          saved_out_filename + ".o"];
+        [stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename,
+         saved_out_filename + ".o"];
     let lib_cmd;
 
     let os = sess.get_targ_cfg().os;
@@ -591,46 +588,45 @@ fn main(args: [str]) {
     let cstore = sess.get_cstore();
     for cratepath: str in cstore::get_used_crate_files(cstore) {
         if str::ends_with(cratepath, ".rlib") {
-            gcc_args += ~[cratepath];
+            gcc_args += [cratepath];
             cont;
         }
         let dir = fs::dirname(cratepath);
-        if dir != "" { gcc_args += ~["-L" + dir]; }
+        if dir != "" { gcc_args += ["-L" + dir]; }
         let libarg = unlib(sess.get_targ_cfg(), fs::basename(cratepath));
-        gcc_args += ~["-l" + libarg];
+        gcc_args += ["-l" + libarg];
     }
 
     let ula = cstore::get_used_link_args(cstore);
-    for arg: str in ula { gcc_args += ~[arg]; }
+    for arg: str in ula { gcc_args += [arg]; }
 
     let used_libs = cstore::get_used_libraries(cstore);
-    for l: str in used_libs { gcc_args += ~["-l" + l]; }
+    for l: str in used_libs { gcc_args += ["-l" + l]; }
 
     if sopts.library {
-        gcc_args += ~[lib_cmd];
+        gcc_args += [lib_cmd];
     } else {
         // FIXME: why do we hardcode -lm?
-        gcc_args += ~["-lm", main];
+        gcc_args += ["-lm", main];
     }
     // We run 'gcc' here
 
     let err_code = run::run_program(prog, gcc_args);
     if 0 != err_code {
-        sess.err(#fmt("linking with gcc failed with code %d", err_code));
-        sess.note(#fmt("gcc arguments: %s",
-                       str::connect(gcc_args, " ")));
+        sess.err(#fmt["linking with gcc failed with code %d", err_code]);
+        sess.note(#fmt["gcc arguments: %s", str::connect(gcc_args, " ")]);
         sess.abort_if_errors();
     }
     // Clean up on Darwin
 
     if sess.get_targ_cfg().os == session::os_macos {
-        run::run_program("dsymutil", ~[saved_out_filename]);
+        run::run_program("dsymutil", [saved_out_filename]);
     }
 
 
     // Remove the temporary object file if we aren't saving temps
     if !sopts.save_temps {
-        run::run_program("rm", ~[saved_out_filename + ".o"]);
+        run::run_program("rm", [saved_out_filename + ".o"]);
     }
 }
 
@@ -641,7 +637,7 @@ mod test {
     #[test]
     fn test_switch_implies_cfg_test() {
         let match =
-            alt getopts::getopts(~["--test"], opts()) {
+            alt getopts::getopts(["--test"], opts()) {
               getopts::success(m) { m }
             };
         let sessopts = build_session_options("whatever", match, "whatever");
@@ -655,7 +651,7 @@ mod test {
     #[test]
     fn test_switch_implies_cfg_test_unless_cfg_test() {
         let match =
-            alt getopts::getopts(~["--test", "--cfg=test"], opts()) {
+            alt getopts::getopts(["--test", "--cfg=test"], opts()) {
               getopts::success(m) { m }
             };
         let sessopts = build_session_options("whatever", match, "whatever");
diff --git a/src/comp/driver/session.rs b/src/comp/driver/session.rs
index ea3eae60767..5a2b26739aa 100644
--- a/src/comp/driver/session.rs
+++ b/src/comp/driver/session.rs
@@ -43,8 +43,7 @@ type options =
      test: bool,
      parse_only: bool,
      no_trans: bool,
-     do_gc: bool
-     };
+     do_gc: bool};
 
 type crate_metadata = {name: str, data: [u8]};
 
@@ -90,10 +89,10 @@ obj session(targ_cfg: @config,
     }
     fn note(msg: str) { codemap::emit_note(none, msg, parse_sess.cm); }
     fn span_bug(sp: span, msg: str) -> ! {
-        self.span_fatal(sp, #fmt("internal compiler error %s", msg));
+        self.span_fatal(sp, #fmt["internal compiler error %s", msg]);
     }
     fn bug(msg: str) -> ! {
-        self.fatal(#fmt("internal compiler error %s", msg));
+        self.fatal(#fmt["internal compiler error %s", msg]);
     }
     fn span_unimpl(sp: span, msg: str) -> ! {
         self.span_bug(sp, "unimplemented " + msg);
diff --git a/src/comp/front/attr.rs b/src/comp/front/attr.rs
index c06e1810497..0f3eb354d9e 100644
--- a/src/comp/front/attr.rs
+++ b/src/comp/front/attr.rs
@@ -30,7 +30,7 @@ export mk_attr;
 // From a list of crate attributes get only the meta_items that impact crate
 // linkage
 fn find_linkage_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] {
-    let metas: [@ast::meta_item] = ~[];
+    let metas: [@ast::meta_item] = [];
     for attr: ast::attribute in find_attrs_by_name(attrs, "link") {
         alt attr.node.value.node {
           ast::meta_list(_, items) { metas += items; }
@@ -95,8 +95,8 @@ fn attr_meta(attr: &ast::attribute) -> @ast::meta_item { @attr.node.value }
 
 // Get the meta_items from inside a vector of attributes
 fn attr_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] {
-    let mitems = ~[];
-    for a: ast::attribute in attrs { mitems += ~[attr_meta(a)]; }
+    let mitems = [];
+    for a: ast::attribute in attrs { mitems += [attr_meta(a)]; }
     ret mitems;
 }
 
@@ -122,11 +122,11 @@ fn eq(a: @ast::meta_item, b: @ast::meta_item) -> bool {
 }
 
 fn contains(haystack: &[@ast::meta_item], needle: @ast::meta_item) -> bool {
-    log #fmt("looking for %s",
-             syntax::print::pprust::meta_item_to_str(*needle));
+    log #fmt["looking for %s",
+             syntax::print::pprust::meta_item_to_str(*needle)];
     for item: @ast::meta_item in haystack {
-        log #fmt("looking in %s",
-                 syntax::print::pprust::meta_item_to_str(*item));
+        log #fmt["looking in %s",
+                 syntax::print::pprust::meta_item_to_str(*item)];
         if eq(item, needle) { log "found it!"; ret true; }
     }
     log "found it not :(";
@@ -152,13 +152,13 @@ fn sort_meta_items(items: &[@ast::meta_item]) -> [@ast::meta_item] {
     }
 
     // This is sort of stupid here, converting to a vec of mutables and back
-    let v: [mutable @ast::meta_item] = ~[mutable];
-    for mi: @ast::meta_item in items { v += ~[mutable mi]; }
+    let v: [mutable @ast::meta_item] = [mutable];
+    for mi: @ast::meta_item in items { v += [mutable mi]; }
 
     std::sort::quick_sort(lteq, v);
 
-    let v2: [@ast::meta_item] = ~[];
-    for mi: @ast::meta_item in v { v2 += ~[mi]; }
+    let v2: [@ast::meta_item] = [];
+    for mi: @ast::meta_item in v { v2 += [mi]; }
     ret v2;
 }
 
@@ -176,14 +176,13 @@ fn remove_meta_items_by_name(items: &[@ast::meta_item], name: str) ->
     ret vec::filter_map(filter, items);
 }
 
-fn require_unique_names(sess: &session::session,
-                        metas: &[@ast::meta_item]) {
+fn require_unique_names(sess: &session::session, metas: &[@ast::meta_item]) {
     let map = map::mk_hashmap::<str, ()>(str::hash, str::eq);
     for meta: @ast::meta_item in metas {
         let name = get_meta_item_name(meta);
         if map.contains_key(name) {
             sess.span_fatal(meta.span,
-                            #fmt("duplicate meta item `%s`", name));
+                            #fmt["duplicate meta item `%s`", name]);
         }
         map.insert(name, ());
     }
diff --git a/src/comp/front/config.rs b/src/comp/front/config.rs
index 4a9eeac0d22..4aa1c07be57 100644
--- a/src/comp/front/config.rs
+++ b/src/comp/front/config.rs
@@ -115,7 +115,7 @@ fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool {
                 }
             }
             let cfg_metas = attr::attr_metas(item_cfg_attrs);
-            vec::foldl(extract_metas, ~[], cfg_metas)
+            vec::foldl(extract_metas, [], cfg_metas)
         };
 
     for cfg_mi: @ast::meta_item in item_cfg_metas {
diff --git a/src/comp/front/test.rs b/src/comp/front/test.rs
index 5bb5912630f..93ddaa54559 100644
--- a/src/comp/front/test.rs
+++ b/src/comp/front/test.rs
@@ -9,7 +9,7 @@ import front::attr;
 
 export modify_for_testing;
 
-type node_id_gen = @fn() -> ast::node_id ;
+type node_id_gen = @fn() -> ast::node_id;
 
 type test = {path: [ast::ident], ignore: bool};
 
@@ -36,8 +36,8 @@ fn modify_for_testing(crate: @ast::crate) -> @ast::crate {
 
     let cx: test_ctxt =
         @{next_node_id: next_node_id_fn,
-          mutable path: ~[],
-          mutable testfns: ~[]};
+          mutable path: [],
+          mutable testfns: []};
 
     let precursor =
         {fold_crate: bind fold_crate(cx, _, _),
@@ -51,8 +51,8 @@ fn modify_for_testing(crate: @ast::crate) -> @ast::crate {
     ret res;
 }
 
-fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold)
-    -> ast::_mod {
+fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold) ->
+   ast::_mod {
 
     // Remove any defined main function from the AST so it doesn't clash with
     // the one we're going to add.  FIXME: This is sloppy. Instead we should
@@ -87,14 +87,14 @@ fn fold_crate(cx: &test_ctxt, c: &ast::crate_, fld: fold::ast_fold) ->
 fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) ->
    @ast::item {
 
-    cx.path += ~[i.ident];
-    log #fmt("current path: %s", ast::path_name_i(cx.path));
+    cx.path += [i.ident];
+    log #fmt["current path: %s", ast::path_name_i(cx.path)];
 
     if is_test_fn(i) {
         log "this is a test function";
         let test = {path: cx.path, ignore: is_ignored(i)};
-        cx.testfns += ~[test];
-        log #fmt("have %u test functions", vec::len(cx.testfns));
+        cx.testfns += [test];
+        log #fmt["have %u test functions", vec::len(cx.testfns)];
     }
 
     let res = fold::noop_fold_item(i, fld);
@@ -127,7 +127,7 @@ fn is_ignored(i: &@ast::item) -> bool {
 
 fn add_test_module(cx: &test_ctxt, m: &ast::_mod) -> ast::_mod {
     let testmod = mk_test_module(cx);
-    ret {items: m.items + ~[testmod] with m};
+    ret {items: m.items + [testmod] with m};
 }
 
 /*
@@ -154,16 +154,16 @@ fn mk_test_module(cx: &test_ctxt) -> @ast::item {
     // The synthesized main function which will call the console test runner
     // with our list of tests
     let mainfn = mk_main(cx);
-    let testmod: ast::_mod = {view_items: ~[], items: ~[mainfn, testsfn]};
+    let testmod: ast::_mod = {view_items: [], items: [mainfn, testsfn]};
     let item_ = ast::item_mod(testmod);
     let item: ast::item =
         {ident: "__test",
-         attrs: ~[],
+         attrs: [],
          id: cx.next_node_id(),
          node: item_,
          span: ast::dummy_sp()};
 
-    log #fmt("Synthetic test module:\n%s\n", pprust::item_to_str(@item));
+    log #fmt["Synthetic test module:\n%s\n", pprust::item_to_str(@item)];
 
     ret @item;
 }
@@ -176,27 +176,27 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item {
     let ret_ty = mk_test_desc_vec_ty(cx);
 
     let decl: ast::fn_decl =
-        {inputs: ~[],
+        {inputs: [],
          output: ret_ty,
          purity: ast::impure_fn,
          il: ast::il_normal,
          cf: ast::return,
-         constraints: ~[]};
+         constraints: []};
     let proto = ast::proto_fn;
 
     // The vector of test_descs for this crate
     let test_descs = mk_test_desc_vec(cx);
 
     let body_: ast::blk_ =
-        {stmts: ~[], expr: option::some(test_descs), id: cx.next_node_id()};
+        {stmts: [], expr: option::some(test_descs), id: cx.next_node_id()};
     let body = nospan(body_);
 
     let fn_ = {decl: decl, proto: proto, body: body};
 
-    let item_ = ast::item_fn(fn_, ~[]);
+    let item_ = ast::item_fn(fn_, []);
     let item: ast::item =
         {ident: "tests",
-         attrs: ~[],
+         attrs: [],
          id: cx.next_node_id(),
          node: item_,
          span: ast::dummy_sp()};
@@ -205,10 +205,10 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item {
 
 fn empty_fn_ty() -> ast::ty {
     let proto = ast::proto_fn;
-    let input_ty = ~[];
+    let input_ty = [];
     let ret_ty = @nospan(ast::ty_nil);
     let cf = ast::return;
-    let constrs = ~[];
+    let constrs = [];
     ret nospan(ast::ty_fn(proto, input_ty, ret_ty, cf, constrs));
 }
 
@@ -216,8 +216,8 @@ fn empty_fn_ty() -> ast::ty {
 fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty {
     let test_desc_ty_path: ast::path =
         nospan({global: false,
-                idents: ~["std", "test", "test_desc"],
-                types: ~[]});
+                idents: ["std", "test", "test_desc"],
+                types: []});
 
     let test_desc_ty: ast::ty =
         nospan(ast::ty_path(test_desc_ty_path, cx.next_node_id()));
@@ -228,11 +228,11 @@ fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty {
 }
 
 fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr {
-    log #fmt("building test vector from %u tests", vec::len(cx.testfns));
-    let descs = ~[];
+    log #fmt["building test vector from %u tests", vec::len(cx.testfns)];
+    let descs = [];
     for test: test in cx.testfns {
         let test_ = test; // Satisfy alias analysis
-        descs += ~[mk_test_desc_rec(cx, test_)];
+        descs += [mk_test_desc_rec(cx, test_)];
     }
 
     ret @{id: cx.next_node_id(),
@@ -243,7 +243,7 @@ fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr {
 fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
     let path = test.path;
 
-    log #fmt("encoding %s", ast::path_name_i(path));
+    log #fmt["encoding %s", ast::path_name_i(path)];
 
     let name_lit: ast::lit =
         nospan(ast::lit_str(ast::path_name_i(path), ast::sk_rc));
@@ -255,8 +255,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
     let name_field: ast::field =
         nospan({mut: ast::imm, ident: "name", expr: @name_expr});
 
-    let fn_path: ast::path =
-        nospan({global: false, idents: path, types: ~[]});
+    let fn_path: ast::path = nospan({global: false, idents: path, types: []});
 
     let fn_expr: ast::expr =
         {id: cx.next_node_id(),
@@ -277,7 +276,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
         nospan({mut: ast::imm, ident: "ignore", expr: @ignore_expr});
 
     let desc_rec_: ast::expr_ =
-        ast::expr_rec(~[name_field, fn_field, ignore_field], option::none);
+        ast::expr_rec([name_field, fn_field, ignore_field], option::none);
     let desc_rec: ast::expr =
         {id: cx.next_node_id(), node: desc_rec_, span: ast::dummy_sp()};
     ret @desc_rec;
@@ -294,28 +293,28 @@ fn mk_main(cx: &test_ctxt) -> @ast::item {
     let ret_ty = nospan(ast::ty_nil);
 
     let decl: ast::fn_decl =
-        {inputs: ~[args_arg],
+        {inputs: [args_arg],
          output: @ret_ty,
          purity: ast::impure_fn,
          il: ast::il_normal,
          cf: ast::return,
-         constraints: ~[]};
+         constraints: []};
     let proto = ast::proto_fn;
 
     let test_main_call_expr = mk_test_main_call(cx);
 
     let body_: ast::blk_ =
-        {stmts: ~[],
+        {stmts: [],
          expr: option::some(test_main_call_expr),
          id: cx.next_node_id()};
     let body = {node: body_, span: ast::dummy_sp()};
 
     let fn_ = {decl: decl, proto: proto, body: body};
 
-    let item_ = ast::item_fn(fn_, ~[]);
+    let item_ = ast::item_fn(fn_, []);
     let item: ast::item =
         {ident: "main",
-         attrs: ~[],
+         attrs: [],
          id: cx.next_node_id(),
          node: item_,
          span: ast::dummy_sp()};
@@ -326,38 +325,32 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr {
 
     // Get the args passed to main so we can pass the to test_main
     let args_path: ast::path =
-        nospan({global: false, idents: ~["args"], types: ~[]});
+        nospan({global: false, idents: ["args"], types: []});
 
     let args_path_expr_: ast::expr_ = ast::expr_path(args_path);
 
     let args_path_expr: ast::expr =
-        {id: cx.next_node_id(),
-         node: args_path_expr_,
-         span: ast::dummy_sp()};
+        {id: cx.next_node_id(), node: args_path_expr_, span: ast::dummy_sp()};
 
     // Call __test::test to generate the vector of test_descs
     let test_path: ast::path =
-        nospan({global: false, idents: ~["tests"], types: ~[]});
+        nospan({global: false, idents: ["tests"], types: []});
 
     let test_path_expr_: ast::expr_ = ast::expr_path(test_path);
 
     let test_path_expr: ast::expr =
-        {id: cx.next_node_id(),
-         node: test_path_expr_,
-         span: ast::dummy_sp()};
+        {id: cx.next_node_id(), node: test_path_expr_, span: ast::dummy_sp()};
 
-    let test_call_expr_: ast::expr_ = ast::expr_call(@test_path_expr, ~[]);
+    let test_call_expr_: ast::expr_ = ast::expr_call(@test_path_expr, []);
 
     let test_call_expr: ast::expr =
-        {id: cx.next_node_id(),
-         node: test_call_expr_,
-         span: ast::dummy_sp()};
+        {id: cx.next_node_id(), node: test_call_expr_, span: ast::dummy_sp()};
 
     // Call std::test::test_main
     let test_main_path: ast::path =
         nospan({global: false,
-                idents: ~["std", "test", "test_main"],
-                types: ~[]});
+                idents: ["std", "test", "test_main"],
+                types: []});
 
     let test_main_path_expr_: ast::expr_ = ast::expr_path(test_main_path);
 
@@ -368,7 +361,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr {
 
     let test_main_call_expr_: ast::expr_ =
         ast::expr_call(@test_main_path_expr,
-                       ~[@args_path_expr, @test_call_expr]);
+                       [@args_path_expr, @test_call_expr]);
 
     let test_main_call_expr: ast::expr =
         {id: cx.next_node_id(),
diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs
index 9d80972ffb5..5a4dcdc5e0d 100644
--- a/src/comp/lib/llvm.rs
+++ b/src/comp/lib/llvm.rs
@@ -81,20 +81,20 @@ const LLVMOptimizeForSizeAttribute: uint = 8192u;
 const LLVMStackProtectAttribute: uint = 16384u;
 const LLVMStackProtectReqAttribute: uint = 32768u;
 const LLVMAlignmentAttribute: uint = 2031616u;
- // 31 << 16
+// 31 << 16
 const LLVMNoCaptureAttribute: uint = 2097152u;
 const LLVMNoRedZoneAttribute: uint = 4194304u;
 const LLVMNoImplicitFloatAttribute: uint = 8388608u;
 const LLVMNakedAttribute: uint = 16777216u;
 const LLVMInlineHintAttribute: uint = 33554432u;
 const LLVMStackAttribute: uint = 469762048u;
- // 7 << 26
+// 7 << 26
 const LLVMUWTableAttribute: uint = 1073741824u;
- // 1 << 30
+// 1 << 30
 
 
- // Consts for the LLVM IntPredicate type, pre-cast to uint.
- // FIXME: as above.
+// Consts for the LLVM IntPredicate type, pre-cast to uint.
+// FIXME: as above.
 
 
 const LLVMIntEQ: uint = 32u;
@@ -276,9 +276,9 @@ native "cdecl" mod llvm = "rustllvm" {
 
     /* Operations on constants of any type */
     fn LLVMConstNull(Ty: TypeRef) -> ValueRef;
-     /* all zeroes */
+    /* all zeroes */
     fn LLVMConstAllOnes(Ty: TypeRef) -> ValueRef;
-     /* only for int/vector */
+    /* only for int/vector */
     fn LLVMGetUndef(Ty: TypeRef) -> ValueRef;
     fn LLVMIsConstant(Val: ValueRef) -> Bool;
     fn LLVMIsNull(Val: ValueRef) -> Bool;
@@ -809,19 +809,19 @@ native "cdecl" mod llvm = "rustllvm" {
                                                    Value: Bool);
     fn LLVMPassManagerBuilderSetDisableUnrollLoops(PMB: PassManagerBuilderRef,
                                                    Value: Bool);
-    fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls(PMB:
-                                                        PassManagerBuilderRef,
-                                                        Value: Bool);
-    fn LLVMPassManagerBuilderUseInlinerWithThreshold(PMB:
-                                                     PassManagerBuilderRef,
-                                                     threshold: uint);
-    fn LLVMPassManagerBuilderPopulateModulePassManager(PMB:
-                                                       PassManagerBuilderRef,
-                                                       PM: PassManagerRef);
-
-    fn LLVMPassManagerBuilderPopulateFunctionPassManager(PMB:
-                                                        PassManagerBuilderRef,
-                                                         PM: PassManagerRef);
+    fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls(
+        PMB: PassManagerBuilderRef,
+        Value: Bool);
+    fn LLVMPassManagerBuilderUseInlinerWithThreshold(
+        PMB: PassManagerBuilderRef,
+        threshold: uint);
+    fn LLVMPassManagerBuilderPopulateModulePassManager(
+        PMB: PassManagerBuilderRef,
+        PM: PassManagerRef);
+
+    fn LLVMPassManagerBuilderPopulateFunctionPassManager(
+        PMB: PassManagerBuilderRef,
+        PM: PassManagerRef);
 
     /** Destroys a memory buffer. */
     fn LLVMDisposeMemoryBuffer(MemBuf: MemoryBufferRef);
@@ -905,68 +905,68 @@ native "cdecl" mod llvm = "rustllvm" {
  * it's attached to.
  */
 
-resource BuilderRef_res(B: BuilderRef) {
-    llvm::LLVMDisposeBuilder(B);
-}
+resource BuilderRef_res(B: BuilderRef) { llvm::LLVMDisposeBuilder(B); }
+
+obj builder(B: BuilderRef,
+            terminated: @mutable bool,
 
-obj builder(B: BuilderRef, terminated: @mutable bool,
             // Stored twice so that we don't have to constantly deref
             res: @BuilderRef_res) {
     /* Terminators */
     fn RetVoid() -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildRetVoid(B);
     }
 
     fn Ret(V: ValueRef) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildRet(B, V);
     }
 
     fn AggregateRet(RetVals: &[ValueRef]) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildAggregateRet(B, vec::to_ptr(RetVals),
                                         vec::len(RetVals));
     }
 
     fn Br(Dest: BasicBlockRef) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildBr(B, Dest);
     }
 
     fn CondBr(If: ValueRef, Then: BasicBlockRef, Else: BasicBlockRef) ->
        ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildCondBr(B, If, Then, Else);
     }
 
     fn Switch(V: ValueRef, Else: BasicBlockRef, NumCases: uint) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildSwitch(B, V, Else, NumCases);
     }
 
     fn IndirectBr(Addr: ValueRef, NumDests: uint) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildIndirectBr(B, Addr, NumDests);
     }
 
     fn Invoke(Fn: ValueRef, Args: &[ValueRef], Then: BasicBlockRef,
               Catch: BasicBlockRef) -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildInvoke(B, Fn, vec::to_ptr(Args), vec::len(Args),
                                   Then, Catch, str::buf(""));
     }
 
     fn Unreachable() -> ValueRef {
-        assert (!*terminated);
+        assert (!*terminated);;
         *terminated = true;
         ret llvm::LLVMBuildUnreachable(B);
     }
@@ -1402,14 +1402,12 @@ obj builder(B: BuilderRef, terminated: @mutable bool,
         let T: ValueRef =
             llvm::LLVMGetNamedFunction(M, str::buf("llvm.trap"));
         assert (T as int != 0);
-        let Args: [ValueRef] = ~[];
+        let Args: [ValueRef] = [];
         ret llvm::LLVMBuildCall(B, T, vec::to_ptr(Args), vec::len(Args),
                                 str::buf(""));
     }
 
-    fn is_terminated() -> bool {
-        ret *terminated;
-    }
+    fn is_terminated() -> bool { ret *terminated; }
 }
 
 fn new_builder(llbb: BasicBlockRef) -> builder {
@@ -1454,7 +1452,7 @@ fn mk_type_names() -> type_names {
 }
 
 fn type_to_str(names: type_names, ty: TypeRef) -> str {
-    ret type_to_str_inner(names, ~[], ty);
+    ret type_to_str_inner(names, [], ty);
 }
 
 fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
@@ -1462,7 +1460,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
 
     if names.type_has_name(ty) { ret names.get_name(ty); }
 
-    let outer = outer0 + ~[ty];
+    let outer = outer0 + [ty];
 
     let kind: int = llvm::LLVMGetTypeKind(ty);
 
@@ -1480,6 +1478,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
     alt kind {
 
 
+
       // FIXME: more enum-as-int constants determined from Core::h;
       // horrible, horrible. Complete as needed.
 
@@ -1494,11 +1493,13 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
       6 { ret "Label"; }
 
 
+
       7 {
         ret "i" + std::int::str(llvm::LLVMGetIntTypeWidth(ty) as int);
       }
 
 
+
       8 {
         let s = "fn(";
         let out_ty: TypeRef = llvm::LLVMGetReturnType(ty);
@@ -1512,6 +1513,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
       }
 
 
+
       9 {
         let s: str = "{";
         let n_elts: uint = llvm::LLVMCountStructElementTypes(ty);
@@ -1523,12 +1525,14 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
       }
 
 
+
       10 {
         let el_ty = llvm::LLVMGetElementType(ty);
         ret "[" + type_to_str_inner(names, outer, el_ty) + "]";
       }
 
 
+
       11 {
         let i: uint = 0u;
         for tout: TypeRef in outer0 {
@@ -1543,12 +1547,13 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
       }
 
 
+
       12 {
         ret "Opaque";
       }
       13 { ret "Vector"; }
       14 { ret "Metadata"; }
-      _ { log_err #fmt("unknown TypeKind %d", kind as int); fail; }
+      _ { log_err #fmt["unknown TypeKind %d", kind as int]; fail; }
     }
 }
 
diff --git a/src/comp/metadata/creader.rs b/src/comp/metadata/creader.rs
index 4adceacdfde..fd233ad4443 100644
--- a/src/comp/metadata/creader.rs
+++ b/src/comp/metadata/creader.rs
@@ -67,7 +67,7 @@ fn visit_item(e: env, i: &@ast::item) {
         }
         let cstore = e.sess.get_cstore();
         if !cstore::add_used_library(cstore, m.native_name) { ret; }
-        for a: ast::attribute  in
+        for a: ast::attribute in
             attr::find_attrs_by_name(i.attrs, "link_args") {
             alt attr::get_meta_item_value_str(attr::attr_meta(a)) {
               some(linkarg) { cstore::add_used_link_args(cstore, linkarg); }
@@ -93,12 +93,12 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool {
     let attrs = decoder::get_crate_attributes(crate_data);
     let linkage_metas = attr::find_linkage_metas(attrs);
 
-    log #fmt("matching %u metadata requirements against %u items",
-             vec::len(metas), vec::len(linkage_metas));
+    log #fmt["matching %u metadata requirements against %u items",
+             vec::len(metas), vec::len(linkage_metas)];
 
     for needed: @ast::meta_item in metas {
         if !attr::contains(linkage_metas, needed) {
-            log #fmt("missing %s", pprust::meta_item_to_str(*needed));
+            log #fmt["missing %s", pprust::meta_item_to_str(*needed)];
             ret false;
         }
     }
@@ -116,26 +116,26 @@ fn default_native_lib_naming(sess: session::session, static: bool) ->
 }
 
 fn find_library_crate(sess: &session::session, ident: &ast::ident,
-                      metas: &[@ast::meta_item],
-                      library_search_paths: &[str]) ->
-   option::t<{ident: str, data: @[u8]}> {
+                      metas: &[@ast::meta_item], library_search_paths: &[str])
+   -> option::t<{ident: str, data: @[u8]}> {
 
     attr::require_unique_names(sess, metas);
 
     // FIXME: Probably want a warning here since the user
     // is using the wrong type of meta item
-    let crate_name = {
-        let name_items = attr::find_meta_items_by_name(metas, "name");
-        alt vec::last(name_items) {
-          some(i) {
-            alt attr::get_meta_item_value_str(i) {
-              some(n) { n }
-              _ { ident }
+    let crate_name =
+        {
+            let name_items = attr::find_meta_items_by_name(metas, "name");
+            alt vec::last(name_items) {
+              some(i) {
+                alt attr::get_meta_item_value_str(i) {
+                  some(n) { n }
+                  _ { ident }
+                }
+              }
+              none. { ident }
             }
-          }
-          none. { ident }
-        }
-    };
+        };
 
     let nn = default_native_lib_naming(sess, sess.get_opts().static);
     let x =
@@ -157,23 +157,23 @@ fn find_library_crate_aux(nn: &{prefix: str, suffix: str}, crate_name: str,
     // manually filtering fs::list_dir here.
 
     for library_search_path: str in library_search_paths {
-        log #fmt("searching %s", library_search_path);
+        log #fmt["searching %s", library_search_path];
         for path: str in fs::list_dir(library_search_path) {
-            log #fmt("searching %s", path);
+            log #fmt["searching %s", path];
             let f: str = fs::basename(path);
             if !(str::starts_with(f, prefix) && str::ends_with(f, nn.suffix))
                {
-                log #fmt("skipping %s, doesn't look like %s*%s", path, prefix,
-                         nn.suffix);
+                log #fmt["skipping %s, doesn't look like %s*%s", path, prefix,
+                         nn.suffix];
                 cont;
             }
             alt get_metadata_section(path) {
               option::some(cvec) {
                 if !metadata_matches(cvec, metas) {
-                    log #fmt("skipping %s, metadata doesn't match", path);
+                    log #fmt["skipping %s, metadata doesn't match", path];
                     cont;
                 }
-                log #fmt("found %s with matching metadata", path);
+                log #fmt["found %s with matching metadata", path];
                 ret some({ident: path, data: cvec});
               }
               _ { }
@@ -204,15 +204,14 @@ fn get_metadata_section(filename: str) -> option::t<@[u8]> {
 }
 
 fn load_library_crate(sess: &session::session, span: span, ident: &ast::ident,
-                      metas: &[@ast::meta_item],
-                      library_search_paths: &[str]) ->
-   {ident: str, data: @[u8]} {
+                      metas: &[@ast::meta_item], library_search_paths: &[str])
+   -> {ident: str, data: @[u8]} {
 
 
     alt find_library_crate(sess, ident, metas, library_search_paths) {
       some(t) { ret t; }
       none. {
-        sess.span_fatal(span, #fmt("can't find crate for '%s'", ident));
+        sess.span_fatal(span, #fmt["can't find crate for '%s'", ident]);
       }
     }
 }
@@ -253,7 +252,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map {
     for dep: decoder::crate_dep in decoder::get_crate_deps(cdata) {
         let extrn_cnum = dep.cnum;
         let cname = dep.ident;
-        log #fmt("resolving dep %s", cname);
+        log #fmt["resolving dep %s", cname];
         if e.crate_cache.contains_key(cname) {
             log "already have it";
             // We've already seen this crate
@@ -264,7 +263,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map {
             // This is a new one so we've got to load it
             // FIXME: Need better error reporting than just a bogus span
             let fake_span = ast::dummy_sp();
-            let local_cnum = resolve_crate(e, cname, ~[], fake_span);
+            let local_cnum = resolve_crate(e, cname, [], fake_span);
             cnum_map.insert(extrn_cnum, local_cnum);
         }
     }
diff --git a/src/comp/metadata/cstore.rs b/src/comp/metadata/cstore.rs
index 155597f94fa..ed737e046ec 100644
--- a/src/comp/metadata/cstore.rs
+++ b/src/comp/metadata/cstore.rs
@@ -56,9 +56,9 @@ fn mk_cstore() -> cstore {
     let crate_map = map::new_int_hash::<ast::crate_num>();
     ret private(@{metas: meta_cache,
                   use_crate_map: crate_map,
-                  mutable used_crate_files: ~[],
-                  mutable used_libraries: ~[],
-                  mutable used_link_args: ~[]});
+                  mutable used_crate_files: [],
+                  mutable used_libraries: [],
+                  mutable used_link_args: []});
 }
 
 fn get_crate_data(cstore: &cstore, cnum: ast::crate_num) -> crate_metadata {
@@ -76,7 +76,7 @@ fn have_crate_data(cstore: &cstore, cnum: ast::crate_num) -> bool {
 
 iter iter_crate_data(cstore: &cstore) ->
      @{key: ast::crate_num, val: crate_metadata} {
-    for each kv: @{key: ast::crate_num, val: crate_metadata}  in
+    for each kv: @{key: ast::crate_num, val: crate_metadata} in
              p(cstore).metas.items() {
         put kv;
     }
@@ -84,7 +84,7 @@ iter iter_crate_data(cstore: &cstore) ->
 
 fn add_used_crate_file(cstore: &cstore, lib: &str) {
     if !vec::member(lib, p(cstore).used_crate_files) {
-        p(cstore).used_crate_files += ~[lib];
+        p(cstore).used_crate_files += [lib];
     }
 }
 
@@ -97,7 +97,7 @@ fn add_used_library(cstore: &cstore, lib: &str) -> bool {
 
     if vec::member(lib, p(cstore).used_libraries) { ret false; }
 
-    p(cstore).used_libraries += ~[lib];
+    p(cstore).used_libraries += [lib];
     ret true;
 }
 
diff --git a/src/comp/metadata/decoder.rs b/src/comp/metadata/decoder.rs
index dcb5fa2488d..972334ddfc7 100644
--- a/src/comp/metadata/decoder.rs
+++ b/src/comp/metadata/decoder.rs
@@ -33,9 +33,9 @@ export external_resolver;
 // def_id for an item defined in another crate, somebody needs to figure out
 // what crate that's in and give us a def_id that makes sense for the current
 // build.
-type external_resolver = fn(&ast::def_id) -> ast::def_id ;
+type external_resolver = fn(&ast::def_id) -> ast::def_id;
 
-fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool , hash: uint) ->
+fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool, hash: uint) ->
    [ebml::doc] {
     let index = ebml::get_doc(d, tag_index);
     let table = ebml::get_doc(index, tag_index_table);
@@ -44,19 +44,18 @@ fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool , hash: uint) ->
     let bucket = ebml::doc_at(d.data, pos);
     // Awkward logic because we can't ret from foreach yet
 
-    let result: [ebml::doc] = ~[];
+    let result: [ebml::doc] = [];
     let belt = tag_index_buckets_bucket_elt;
     for each elt: ebml::doc in ebml::tagged_docs(bucket, belt) {
         let pos = ebml::be_uint_from_bytes(elt.data, elt.start, 4u);
         if eq_fn(vec::slice::<u8>(*elt.data, elt.start + 4u, elt.end)) {
-            result += ~[ebml::doc_at(d.data, pos)];
+            result += [ebml::doc_at(d.data, pos)];
         }
     }
     ret result;
 }
 
-fn maybe_find_item(item_id: int, items: &ebml::doc) ->
-   option::t<ebml::doc> {
+fn maybe_find_item(item_id: int, items: &ebml::doc) -> option::t<ebml::doc> {
     fn eq_item(bytes: &[u8], item_id: int) -> bool {
         ret ebml::be_uint_from_bytes(@bytes, 0u, 4u) as int == item_id;
     }
@@ -64,7 +63,7 @@ fn maybe_find_item(item_id: int, items: &ebml::doc) ->
     let found = lookup_hash(items, eqer, hash_node_id(item_id));
     if vec::len(found) == 0u {
         ret option::none::<ebml::doc>;
-    } else { ret option::some::<ebml::doc>(found.(0)); }
+    } else { ret option::some::<ebml::doc>(found[0]); }
 }
 
 fn find_item(item_id: int, items: &ebml::doc) -> ebml::doc {
@@ -115,19 +114,20 @@ fn item_type(item: &ebml::doc, this_cnum: ast::crate_num, tcx: ty::ctxt,
 }
 
 fn item_ty_param_kinds(item: &ebml::doc) -> [ast::kind] {
-    let ks: [ast::kind] = ~[];
+    let ks: [ast::kind] = [];
     let tp = tag_items_data_item_ty_param_kinds;
     for each p: ebml::doc in ebml::tagged_docs(item, tp) {
-        let dat : [u8] = ebml::doc_data(p);
+        let dat: [u8] = ebml::doc_data(p);
         let vi = ebml::vint_at(dat, 0u);
         let i = 0u;
         while i < vi.val {
-            let k = alt dat.(vi.next + i) as char {
-              'u' { ast::kind_unique }
-              's' { ast::kind_shared }
-              'p' { ast::kind_pinned }
-            };
-            ks += ~[k];
+            let k =
+                alt dat[vi.next + i] as char {
+                  'u' { ast::kind_unique }
+                  's' { ast::kind_shared }
+                  'p' { ast::kind_pinned }
+                };
+            ks += [k];
             i += 1u;
         }
     }
@@ -136,11 +136,11 @@ fn item_ty_param_kinds(item: &ebml::doc) -> [ast::kind] {
 
 fn tag_variant_ids(item: &ebml::doc, this_cnum: ast::crate_num) ->
    [ast::def_id] {
-    let ids: [ast::def_id] = ~[];
+    let ids: [ast::def_id] = [];
     let v = tag_items_data_item_variant;
     for each p: ebml::doc in ebml::tagged_docs(item, v) {
         let ext = parse_def_id(ebml::doc_data(p));
-        ids += ~[{crate: this_cnum, node: ext.node}];
+        ids += [{crate: this_cnum, node: ext.node}];
     }
     ret ids;
 }
@@ -155,10 +155,10 @@ fn resolve_path(path: &[ast::ident], data: @[u8]) -> [ast::def_id] {
     let md = ebml::new_doc(data);
     let paths = ebml::get_doc(md, tag_paths);
     let eqer = bind eq_item(_, s);
-    let result: [ast::def_id] = ~[];
+    let result: [ast::def_id] = [];
     for doc: ebml::doc in lookup_hash(paths, eqer, hash_path(s)) {
         let did_doc = ebml::get_doc(doc, tag_def_id);
-        result += ~[parse_def_id(ebml::doc_data(did_doc))];
+        result += [parse_def_id(ebml::doc_data(did_doc))];
     }
     ret result;
 }
@@ -203,12 +203,12 @@ fn get_type(data: @[u8], def: ast::def_id, tcx: &ty::ctxt,
     let node_id = def.node;
     let item = lookup_item(node_id, data);
     let t = item_type(item, this_cnum, tcx, extres);
-    let tp_kinds : [ast::kind];
+    let tp_kinds: [ast::kind];
     let fam_ch = item_family(item);
     let has_ty_params = family_has_type_params(fam_ch);
     if has_ty_params {
         tp_kinds = item_ty_param_kinds(item);
-    } else { tp_kinds = ~[]; }
+    } else { tp_kinds = []; }
     ret {kinds: tp_kinds, ty: t};
 }
 
@@ -231,22 +231,22 @@ fn get_tag_variants(_data: &@[u8], def: ast::def_id, tcx: &ty::ctxt,
         cstore::get_crate_data(tcx.sess.get_cstore(), external_crate_id).data;
     let items = ebml::get_doc(ebml::new_doc(data), tag_items);
     let item = find_item(def.node, items);
-    let infos: [ty::variant_info] = ~[];
+    let infos: [ty::variant_info] = [];
     let variant_ids = tag_variant_ids(item, external_crate_id);
     for did: ast::def_id in variant_ids {
         let item = find_item(did.node, items);
         let ctor_ty = item_type(item, external_crate_id, tcx, extres);
-        let arg_tys: [ty::t] = ~[];
+        let arg_tys: [ty::t] = [];
         alt ty::struct(tcx, ctor_ty) {
           ty::ty_fn(_, args, _, _, _) {
-            for a: ty::arg in args { arg_tys += ~[a.ty]; }
+            for a: ty::arg in args { arg_tys += [a.ty]; }
           }
           _ {
             // Nullary tag variant.
 
           }
         }
-        infos += ~[{args: arg_tys, ctor_ty: ctor_ty, id: did}];
+        infos += [{args: arg_tys, ctor_ty: ctor_ty, id: did}];
     }
     ret infos;
 }
@@ -295,14 +295,14 @@ fn item_family_to_str(fam: u8) -> str {
 }
 
 fn get_meta_items(md: &ebml::doc) -> [@ast::meta_item] {
-    let items: [@ast::meta_item] = ~[];
-    for each meta_item_doc: ebml::doc  in
+    let items: [@ast::meta_item] = [];
+    for each meta_item_doc: ebml::doc in
              ebml::tagged_docs(md, tag_meta_item_word) {
         let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name);
         let n = str::unsafe_from_bytes(ebml::doc_data(nd));
-        items += ~[attr::mk_word_item(n)];
+        items += [attr::mk_word_item(n)];
     }
-    for each meta_item_doc: ebml::doc  in
+    for each meta_item_doc: ebml::doc in
              ebml::tagged_docs(md, tag_meta_item_name_value) {
         let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name);
         let vd = ebml::get_doc(meta_item_doc, tag_meta_item_value);
@@ -310,32 +310,32 @@ fn get_meta_items(md: &ebml::doc) -> [@ast::meta_item] {
         let v = str::unsafe_from_bytes(ebml::doc_data(vd));
         // FIXME (#611): Should be able to decode meta_name_value variants,
         // but currently they can't be encoded
-        items += ~[attr::mk_name_value_item_str(n, v)];
+        items += [attr::mk_name_value_item_str(n, v)];
     }
-    for each meta_item_doc: ebml::doc  in
+    for each meta_item_doc: ebml::doc in
              ebml::tagged_docs(md, tag_meta_item_list) {
         let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name);
         let n = str::unsafe_from_bytes(ebml::doc_data(nd));
         let subitems = get_meta_items(meta_item_doc);
-        items += ~[attr::mk_list_item(n, subitems)];
+        items += [attr::mk_list_item(n, subitems)];
     }
     ret items;
 }
 
 fn get_attributes(md: &ebml::doc) -> [ast::attribute] {
-    let attrs: [ast::attribute] = ~[];
+    let attrs: [ast::attribute] = [];
     alt ebml::maybe_get_doc(md, tag_attributes) {
       option::some(attrs_d) {
-        for each attr_doc: ebml::doc  in
+        for each attr_doc: ebml::doc in
                  ebml::tagged_docs(attrs_d, tag_attribute) {
             let meta_items = get_meta_items(attr_doc);
             // Currently it's only possible to have a single meta item on
             // an attribute
             assert (vec::len(meta_items) == 1u);
-            let meta_item = meta_items.(0);
+            let meta_item = meta_items[0];
             attrs +=
-                ~[{node: {style: ast::attr_outer, value: *meta_item},
-                   span: ast::dummy_sp()}];
+                [{node: {style: ast::attr_outer, value: *meta_item},
+                  span: ast::dummy_sp()}];
         }
       }
       option::none. { }
@@ -345,7 +345,7 @@ fn get_attributes(md: &ebml::doc) -> [ast::attribute] {
 
 fn list_meta_items(meta_items: &ebml::doc, out: io::writer) {
     for mi: @ast::meta_item in get_meta_items(meta_items) {
-        out.write_str(#fmt("%s\n", pprust::meta_item_to_str(*mi)));
+        out.write_str(#fmt["%s\n", pprust::meta_item_to_str(*mi)]);
     }
 }
 
@@ -353,7 +353,7 @@ fn list_crate_attributes(md: &ebml::doc, out: io::writer) {
     out.write_str("=Crate Attributes=\n");
 
     for attr: ast::attribute in get_attributes(md) {
-        out.write_str(#fmt("%s\n", pprust::attribute_to_str(attr)));
+        out.write_str(#fmt["%s\n", pprust::attribute_to_str(attr)]);
     }
 
     out.write_str("\n\n");
@@ -366,14 +366,13 @@ fn get_crate_attributes(data: @[u8]) -> [ast::attribute] {
 type crate_dep = {cnum: ast::crate_num, ident: str};
 
 fn get_crate_deps(data: @[u8]) -> [crate_dep] {
-    let deps: [crate_dep] = ~[];
+    let deps: [crate_dep] = [];
     let cratedoc = ebml::new_doc(data);
     let depsdoc = ebml::get_doc(cratedoc, tag_crate_deps);
     let crate_num = 1;
-    for each depdoc: ebml::doc  in
-             ebml::tagged_docs(depsdoc, tag_crate_dep) {
+    for each depdoc: ebml::doc in ebml::tagged_docs(depsdoc, tag_crate_dep) {
         let depname = str::unsafe_from_bytes(ebml::doc_data(depdoc));
-        deps += ~[{cnum: crate_num, ident: depname}];
+        deps += [{cnum: crate_num, ident: depname}];
         crate_num += 1;
     }
     ret deps;
@@ -383,7 +382,7 @@ fn list_crate_deps(data: @[u8], out: io::writer) {
     out.write_str("=External Dependencies=\n");
 
     for dep: crate_dep in get_crate_deps(data) {
-        out.write_str(#fmt("%d %s\n", dep.cnum, dep.ident));
+        out.write_str(#fmt["%d %s\n", dep.cnum, dep.ident]);
     }
 
     out.write_str("\n");
@@ -395,7 +394,7 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) {
     let items = ebml::get_doc(md, tag_items);
     let index = ebml::get_doc(paths, tag_index);
     let bs = ebml::get_doc(index, tag_index_buckets);
-    for each bucket: ebml::doc  in
+    for each bucket: ebml::doc in
              ebml::tagged_docs(bs, tag_index_buckets_bucket) {
         let et = tag_index_buckets_bucket_elt;
         for each elt: ebml::doc in ebml::tagged_docs(bucket, et) {
@@ -403,8 +402,8 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) {
             let def = ebml::doc_at(bytes, data.pos);
             let did_doc = ebml::get_doc(def, tag_def_id);
             let did = parse_def_id(ebml::doc_data(did_doc));
-            out.write_str(#fmt("%s (%s)\n", data.path,
-                               describe_def(items, did)));
+            out.write_str(#fmt["%s (%s)\n", data.path,
+                               describe_def(items, did)]);
         }
     }
     out.write_str("\n");
diff --git a/src/comp/metadata/encoder.rs b/src/comp/metadata/encoder.rs
index 32c21d116a9..babfc2ce77c 100644
--- a/src/comp/metadata/encoder.rs
+++ b/src/comp/metadata/encoder.rs
@@ -51,14 +51,13 @@ fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant],
 
 fn add_to_index(ebml_w: &ebml::writer, path: &[str],
                 index: &mutable [entry<str>], name: &str) {
-    let full_path = path + ~[name];
+    let full_path = path + [name];
     index +=
-        ~[{val: str::connect(full_path, "::"),
-           pos: ebml_w.writer.tell()}];
+        [{val: str::connect(full_path, "::"), pos: ebml_w.writer.tell()}];
 }
 
-fn encode_native_module_item_paths(ebml_w: &ebml::writer,
-                                   nmod: &native_mod, path: &[str],
+fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod,
+                                   path: &[str],
                                    index: &mutable [entry<str>]) {
     for nitem: @native_item in nmod.items {
         add_to_index(ebml_w, path, index, nitem.ident);
@@ -93,7 +92,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
             ebml::start_tag(ebml_w, tag_paths_data_mod);
             encode_name(ebml_w, it.ident);
             encode_def_id(ebml_w, local_def(it.id));
-            encode_module_item_paths(ebml_w, _mod, path + ~[it.ident], index);
+            encode_module_item_paths(ebml_w, _mod, path + [it.ident], index);
             ebml::end_tag(ebml_w);
           }
           item_native_mod(nmod) {
@@ -101,7 +100,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
             ebml::start_tag(ebml_w, tag_paths_data_mod);
             encode_name(ebml_w, it.ident);
             encode_def_id(ebml_w, local_def(it.id));
-            encode_native_module_item_paths(ebml_w, nmod, path + ~[it.ident],
+            encode_native_module_item_paths(ebml_w, nmod, path + [it.ident],
                                             index);
             ebml::end_tag(ebml_w);
           }
@@ -148,10 +147,9 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
     }
 }
 
-fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) ->
-   [entry<str>] {
-    let index: [entry<str>] = ~[];
-    let path: [str] = ~[];
+fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<str>] {
+    let index: [entry<str>] = [];
+    let path: [str] = [];
     ebml::start_tag(ebml_w, tag_paths);
     encode_module_item_paths(ebml_w, crate.node.module, path, index);
     ebml::end_tag(ebml_w);
@@ -162,28 +160,29 @@ fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) ->
 // Item info table encoding
 fn encode_family(ebml_w: &ebml::writer, c: u8) {
     ebml::start_tag(ebml_w, tag_items_data_item_family);
-    ebml_w.writer.write(~[c]);
+    ebml_w.writer.write([c]);
     ebml::end_tag(ebml_w);
 }
 
 fn encode_inlineness(ebml_w: &ebml::writer, c: u8) {
     ebml::start_tag(ebml_w, tag_items_data_item_inlineness);
-    ebml_w.writer.write(~[c]);
+    ebml_w.writer.write([c]);
     ebml::end_tag(ebml_w);
 }
 
-fn def_to_str(did: &def_id) -> str { ret #fmt("%d:%d", did.crate, did.node); }
+fn def_to_str(did: &def_id) -> str { ret #fmt["%d:%d", did.crate, did.node]; }
 
 fn encode_type_param_kinds(ebml_w: &ebml::writer, tps: &[ty_param]) {
     ebml::start_tag(ebml_w, tag_items_data_item_ty_param_kinds);
     ebml::write_vint(ebml_w.writer, vec::len::<ty_param>(tps));
     for tp: ty_param in tps {
-        let c = alt tp.kind {
-          kind_unique. { 'u' }
-          kind_shared. { 's' }
-          kind_pinned. { 'p' }
-        };
-        ebml_w.writer.write(~[c as u8]);
+        let c =
+            alt tp.kind {
+              kind_unique. { 'u' }
+              kind_shared. { 's' }
+              kind_pinned. { 'p' }
+            };
+        ebml_w.writer.write([c as u8]);
     }
     ebml::end_tag(ebml_w);
 }
@@ -229,7 +228,7 @@ fn encode_tag_variant_info(ecx: &@encode_ctxt, ebml_w: &ebml::writer,
                            index: &mutable [entry<int>],
                            ty_params: &[ty_param]) {
     for variant: variant in variants {
-        index += ~[{val: variant.node.id, pos: ebml_w.writer.tell()}];
+        index += [{val: variant.node.id, pos: ebml_w.writer.tell()}];
         ebml::start_tag(ebml_w, tag_items_data_item);
         encode_def_id(ebml_w, local_def(variant.node.id));
         encode_family(ebml_w, 'v' as u8);
@@ -245,8 +244,8 @@ fn encode_tag_variant_info(ecx: &@encode_ctxt, ebml_w: &ebml::writer,
     }
 }
 
-fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer,
-                        item: @item, index: &mutable [entry<int>]) {
+fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, item: @item,
+                        index: &mutable [entry<int>]) {
     alt item.node {
       item_const(_, _) {
         ebml::start_tag(ebml_w, tag_items_data_item);
@@ -260,8 +259,10 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer,
         ebml::start_tag(ebml_w, tag_items_data_item);
         encode_def_id(ebml_w, local_def(item.id));
         encode_family(ebml_w,
-                    alt fd.decl.purity { pure_fn. { 'p' } impure_fn. { 'f' } }
-                        as u8);
+                      alt fd.decl.purity {
+                        pure_fn. { 'p' }
+                        impure_fn. { 'f' }
+                      } as u8);
         encode_inlineness(ebml_w,
                           alt fd.decl.il {
                             il_normal. { 'n' }
@@ -315,7 +316,7 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer,
         encode_symbol(ecx, ebml_w, item.id);
         ebml::end_tag(ebml_w);
 
-        index += ~[{val: ctor_id, pos: ebml_w.writer.tell()}];
+        index += [{val: ctor_id, pos: ebml_w.writer.tell()}];
         ebml::start_tag(ebml_w, tag_items_data_item);
         encode_def_id(ebml_w, local_def(ctor_id));
         encode_family(ebml_w, 'f' as u8);
@@ -334,7 +335,7 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer,
         encode_type(ecx, ebml_w, ty::ty_fn_ret(ecx.ccx.tcx, fn_ty));
         ebml::end_tag(ebml_w);
 
-        index += ~[{val: ctor_id, pos: ebml_w.writer.tell()}];
+        index += [{val: ctor_id, pos: ebml_w.writer.tell()}];
         ebml::start_tag(ebml_w, tag_items_data_item);
         encode_def_id(ebml_w, local_def(ctor_id));
         encode_family(ebml_w, 'f' as u8);
@@ -369,17 +370,17 @@ fn encode_info_for_native_item(ecx: &@encode_ctxt, ebml_w: &ebml::writer,
 
 fn encode_info_for_items(ecx: &@encode_ctxt, ebml_w: &ebml::writer) ->
    [entry<int>] {
-    let index: [entry<int>] = ~[];
+    let index: [entry<int>] = [];
     ebml::start_tag(ebml_w, tag_items_data);
-    for each kvp: @{key: node_id, val: middle::ast_map::ast_node}  in
+    for each kvp: @{key: node_id, val: middle::ast_map::ast_node} in
              ecx.ccx.ast_map.items() {
         alt kvp.val {
           middle::ast_map::node_item(i) {
-            index += ~[{val: kvp.key, pos: ebml_w.writer.tell()}];
+            index += [{val: kvp.key, pos: ebml_w.writer.tell()}];
             encode_info_for_item(ecx, ebml_w, i, index);
           }
           middle::ast_map::node_native_item(i) {
-            index += ~[{val: kvp.key, pos: ebml_w.writer.tell()}];
+            index += [{val: kvp.key, pos: ebml_w.writer.tell()}];
             encode_info_for_native_item(ecx, ebml_w, i);
           }
           _ { }
@@ -392,30 +393,30 @@ fn encode_info_for_items(ecx: &@encode_ctxt, ebml_w: &ebml::writer) ->
 
 // Path and definition ID indexing
 
-fn create_index<T>(index: &[entry<T>], hash_fn: fn(&T) -> uint ) ->
+fn create_index<T>(index: &[entry<T>], hash_fn: fn(&T) -> uint) ->
    [@[entry<T>]] {
-    let buckets: [@mutable [entry<T>]] = ~[];
-    for each i: uint in uint::range(0u, 256u) { buckets += ~[@mutable ~[]]; }
+    let buckets: [@mutable [entry<T>]] = [];
+    for each i: uint in uint::range(0u, 256u) { buckets += [@mutable []]; }
     for elt: entry<T> in index {
         let h = hash_fn(elt.val);
-        *buckets.(h % 256u) += ~[elt];
+        *buckets[h % 256u] += [elt];
     }
 
-    let buckets_frozen = ~[];
+    let buckets_frozen = [];
     for bucket: @mutable [entry<T>] in buckets {
-        buckets_frozen += ~[@*bucket];
+        buckets_frozen += [@*bucket];
     }
     ret buckets_frozen;
 }
 
 fn encode_index<T>(ebml_w: &ebml::writer, buckets: &[@[entry<T>]],
-                   write_fn: fn(&io::writer, &T) ) {
+                   write_fn: fn(&io::writer, &T)) {
     let writer = io::new_writer_(ebml_w.writer);
     ebml::start_tag(ebml_w, tag_index);
-    let bucket_locs: [uint] = ~[];
+    let bucket_locs: [uint] = [];
     ebml::start_tag(ebml_w, tag_index_buckets);
     for bucket: @[entry<T>] in buckets {
-        bucket_locs += ~[ebml_w.writer.tell()];
+        bucket_locs += [ebml_w.writer.tell()];
         ebml::start_tag(ebml_w, tag_index_buckets_bucket);
         for elt: entry<T> in *bucket {
             ebml::start_tag(ebml_w, tag_index_buckets_bucket_elt);
@@ -508,30 +509,30 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] {
                 attr::remove_meta_items_by_name(tmp, "vers")
             };
 
-        let meta_items = ~[name_item, vers_item] + other_items;
+        let meta_items = [name_item, vers_item] + other_items;
         let link_item = attr::mk_list_item("link", meta_items);
 
         ret attr::mk_attr(link_item);
     }
 
-    let attrs: [attribute] = ~[];
+    let attrs: [attribute] = [];
     let found_link_attr = false;
     for attr: attribute in crate.node.attrs {
         attrs +=
             if attr::get_attr_name(attr) != "link" {
-                ~[attr]
+                [attr]
             } else {
                 alt attr.node.value.node {
                   meta_list(n, l) {
                     found_link_attr = true;
-                    ~[synthesize_link_attr(ecx, l)]
+                    [synthesize_link_attr(ecx, l)]
                   }
-                  _ { ~[attr] }
+                  _ { [attr] }
                 }
             }
     }
 
-    if !found_link_attr { attrs += ~[synthesize_link_attr(ecx, ~[])]; }
+    if !found_link_attr { attrs += [synthesize_link_attr(ecx, [])]; }
 
     ret attrs;
 }
@@ -543,9 +544,9 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) {
         type numname = {crate: crate_num, ident: str};
 
         // Pull the cnums and names out of cstore
-        let pairs: [mutable numname] = ~[mutable];
+        let pairs: [mutable numname] = [mutable];
         for each hashkv: hashkv in cstore::iter_crate_data(cstore) {
-            pairs += ~[mutable {crate: hashkv.key, ident: hashkv.val.name}];
+            pairs += [mutable {crate: hashkv.key, ident: hashkv.val.name}];
         }
 
         // Sort by cnum
@@ -612,7 +613,7 @@ fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> str {
     // Pad this, since something (LLVM, presumably) is cutting off the
     // remaining % 4 bytes.
 
-    buf_w.write(~[0u8, 0u8, 0u8, 0u8]);
+    buf_w.write([0u8, 0u8, 0u8, 0u8]);
     ret string_w.get_str();
 }
 
diff --git a/src/comp/metadata/tydecode.rs b/src/comp/metadata/tydecode.rs
index a9a85e1190b..31034b7a6ae 100644
--- a/src/comp/metadata/tydecode.rs
+++ b/src/comp/metadata/tydecode.rs
@@ -19,17 +19,17 @@ export parse_ty_data;
 // data buffer. Whatever format you choose should not contain pipe characters.
 
 // Callback to translate defs to strs or back:
-type str_def = fn(str) -> ast::def_id ;
+type str_def = fn(str) -> ast::def_id;
 
 type pstate =
     {data: @[u8], crate: int, mutable pos: uint, len: uint, tcx: ty::ctxt};
 
 tag ty_or_bang { a_ty(ty::t); a_bang; }
 
-fn peek(st: @pstate) -> u8 { ret st.data.(st.pos); }
+fn peek(st: @pstate) -> u8 { ret st.data[st.pos]; }
 
 fn next(st: @pstate) -> u8 {
-    let ch = st.data.(st.pos);
+    let ch = st.data[st.pos];
     st.pos = st.pos + 1u;
     ret ch;
 }
@@ -39,7 +39,7 @@ fn parse_ident(st: @pstate, sd: str_def, last: char) -> ast::ident {
     ret parse_ident_(st, sd, bind is_last(last, _));
 }
 
-fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool ) ->
+fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool) ->
    ast::ident {
     let rslt = "";
     while !is_last(peek(st) as char) {
@@ -65,14 +65,14 @@ fn parse_ty_or_bang(st: @pstate, sd: str_def) -> ty_or_bang {
 }
 
 fn parse_constrs(st: @pstate, sd: str_def) -> [@ty::constr] {
-    let rslt: [@ty::constr] = ~[];
+    let rslt: [@ty::constr] = [];
     alt peek(st) as char {
       ':' {
         do  {
             next(st);
             let one: @ty::constr =
                 parse_constr::<uint>(st, sd, parse_constr_arg);
-            rslt += ~[one];
+            rslt += [one];
         } while peek(st) as char == ';'
       }
       _ { }
@@ -82,14 +82,14 @@ fn parse_constrs(st: @pstate, sd: str_def) -> [@ty::constr] {
 
 // FIXME less copy-and-paste
 fn parse_ty_constrs(st: @pstate, sd: str_def) -> [@ty::type_constr] {
-    let rslt: [@ty::type_constr] = ~[];
+    let rslt: [@ty::type_constr] = [];
     alt peek(st) as char {
       ':' {
         do  {
             next(st);
             let one: @ty::type_constr =
                 parse_constr::<path>(st, sd, parse_ty_constr_arg);
-            rslt += ~[one];
+            rslt += [one];
         } while peek(st) as char == ';'
       }
       _ { }
@@ -98,24 +98,24 @@ fn parse_ty_constrs(st: @pstate, sd: str_def) -> [@ty::type_constr] {
 }
 
 fn parse_path(st: @pstate, sd: str_def) -> ast::path {
-    let idents: [ast::ident] = ~[];
+    let idents: [ast::ident] = [];
     fn is_last(c: char) -> bool { ret c == '(' || c == ':'; }
-    idents += ~[parse_ident_(st, sd, is_last)];
+    idents += [parse_ident_(st, sd, is_last)];
     while true {
         alt peek(st) as char {
           ':' { next(st); next(st); }
           c {
             if c == '(' {
                 ret respan(ast::dummy_sp(),
-                           {global: false, idents: idents, types: ~[]});
-            } else { idents += ~[parse_ident_(st, sd, is_last)]; }
+                           {global: false, idents: idents, types: []});
+            } else { idents += [parse_ident_(st, sd, is_last)]; }
           }
         }
     }
     fail "parse_path: ill-formed path";
 }
 
-type arg_parser<T> = fn(@pstate, str_def) -> ast::constr_arg_general_<T> ;
+type arg_parser<T> = fn(@pstate, str_def) -> ast::constr_arg_general_<T>;
 
 fn parse_constr_arg(st: @pstate, _sd: str_def) -> ast::fn_constr_arg {
     alt peek(st) as char {
@@ -153,7 +153,7 @@ fn parse_ty_constr_arg(st: @pstate, sd: str_def) ->
 fn parse_constr<@T>(st: @pstate, sd: str_def, pser: arg_parser<T>) ->
    @ty::constr_general<T> {
     let sp = ast::dummy_sp(); // FIXME: use a real span
-    let args: [@sp_constr_arg<T>] = ~[];
+    let args: [@sp_constr_arg<T>] = [];
     let pth: path = parse_path(st, sd);
     let ignore: char = next(st) as char;
     assert (ignore as char == '(');
@@ -162,7 +162,7 @@ fn parse_constr<@T>(st: @pstate, sd: str_def, pser: arg_parser<T>) ->
     do  {
         an_arg = pser(st, sd);
         // FIXME use a real span
-        args += ~[@respan(sp, an_arg)];
+        args += [@respan(sp, an_arg)];
         ignore = next(st) as char;
     } while ignore == ';'
     assert (ignore == ')');
@@ -197,21 +197,23 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
       't' {
         assert (next(st) as char == '[');
         let def = parse_def(st, sd);
-        let params: [ty::t] = ~[];
-        while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; }
+        let params: [ty::t] = [];
+        while peek(st) as char != ']' { params += [parse_ty(st, sd)]; }
         st.pos = st.pos + 1u;
         ret ty::mk_tag(st.tcx, def, params);
       }
       'p' {
-        let k = alt next(st) as char {
-          'u' { kind_unique }
-          's' { kind_shared }
-          'p' { kind_pinned }
-          c {
-            log_err "unexpected char in encoded type param: ";
-            log_err c; fail
-          }
-        };
+        let k =
+            alt next(st) as char {
+              'u' { kind_unique }
+              's' { kind_shared }
+              'p' { kind_pinned }
+              c {
+                log_err "unexpected char in encoded type param: ";
+                log_err c;
+                fail
+              }
+            };
         ret ty::mk_param(st.tcx, parse_int(st) as uint, k);
       }
       '@' { ret ty::mk_box(st.tcx, parse_mt(st, sd)); }
@@ -220,22 +222,22 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
       'I' { ret ty::mk_vec(st.tcx, parse_mt(st, sd)); }
       'R' {
         assert (next(st) as char == '[');
-        let fields: [ty::field] = ~[];
+        let fields: [ty::field] = [];
         while peek(st) as char != ']' {
             let name = "";
             while peek(st) as char != '=' {
                 name += str::unsafe_from_byte(next(st));
             }
             st.pos = st.pos + 1u;
-            fields += ~[{ident: name, mt: parse_mt(st, sd)}];
+            fields += [{ident: name, mt: parse_mt(st, sd)}];
         }
         st.pos = st.pos + 1u;
         ret ty::mk_rec(st.tcx, fields);
       }
       'T' {
         assert (next(st) as char == '[');
-        let params = ~[];
-        while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; }
+        let params = [];
+        while peek(st) as char != ']' { params += [parse_ty(st, sd)]; }
         st.pos = st.pos + 1u;
         ret ty::mk_tup(st.tcx, params);
       }
@@ -268,7 +270,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
       }
       'O' {
         assert (next(st) as char == '[');
-        let methods: [ty::method] = ~[];
+        let methods: [ty::method] = [];
         while peek(st) as char != ']' {
             let proto;
             alt next(st) as char {
@@ -281,12 +283,12 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
             }
             let func = parse_ty_fn(st, sd);
             methods +=
-                ~[{proto: proto,
-                   ident: name,
-                   inputs: func.args,
-                   output: func.ty,
-                   cf: func.cf,
-                   constrs: func.cs}];
+                [{proto: proto,
+                  ident: name,
+                  inputs: func.args,
+                  output: func.ty,
+                  cf: func.cf,
+                  constrs: func.cs}];
         }
         st.pos += 1u;
         ret ty::mk_obj(st.tcx, methods);
@@ -295,8 +297,8 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
         assert (next(st) as char == '[');
         let def = parse_def(st, sd);
         let inner = parse_ty(st, sd);
-        let params: [ty::t] = ~[];
-        while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; }
+        let params: [ty::t] = [];
+        while peek(st) as char != ']' { params += [parse_ty(st, sd)]; }
         st.pos = st.pos + 1u;
         ret ty::mk_res(st.tcx, def, inner, params);
       }
@@ -375,7 +377,7 @@ fn parse_hex(st: @pstate) -> uint {
 fn parse_ty_fn(st: @pstate, sd: str_def) ->
    {args: [ty::arg], ty: ty::t, cf: ast::controlflow, cs: [@ty::constr]} {
     assert (next(st) as char == '[');
-    let inputs: [ty::arg] = ~[];
+    let inputs: [ty::arg] = [];
     while peek(st) as char != ']' {
         let mode = ty::mo_val;
         if peek(st) as char == '&' {
@@ -389,7 +391,7 @@ fn parse_ty_fn(st: @pstate, sd: str_def) ->
             mode = ty::mo_move;
             st.pos += 1u;
         }
-        inputs += ~[{mode: mode, ty: parse_ty(st, sd)}];
+        inputs += [{mode: mode, ty: parse_ty(st, sd)}];
     }
     st.pos += 1u; // eat the ']'
     let cs = parse_constrs(st, sd);
@@ -406,7 +408,7 @@ fn parse_ty_fn(st: @pstate, sd: str_def) ->
 fn parse_def_id(buf: &[u8]) -> ast::def_id {
     let colon_idx = 0u;
     let len = vec::len::<u8>(buf);
-    while colon_idx < len && buf.(colon_idx) != ':' as u8 { colon_idx += 1u; }
+    while colon_idx < len && buf[colon_idx] != ':' as u8 { colon_idx += 1u; }
     if colon_idx == len {
         log_err "didn't find ':' when parsing def id";
         fail;
@@ -414,10 +416,10 @@ fn parse_def_id(buf: &[u8]) -> ast::def_id {
     let crate_part = vec::slice::<u8>(buf, 0u, colon_idx);
     let def_part = vec::slice::<u8>(buf, colon_idx + 1u, len);
 
-    let crate_part_vec = ~[];
-    let def_part_vec = ~[];
-    for b: u8 in crate_part { crate_part_vec += ~[b]; }
-    for b: u8 in def_part { def_part_vec += ~[b]; }
+    let crate_part_vec = [];
+    let def_part_vec = [];
+    for b: u8 in crate_part { crate_part_vec += [b]; }
+    for b: u8 in def_part { def_part_vec += [b]; }
 
     let crate_num = uint::parse_buf(crate_part_vec, 10u) as int;
     let def_num = uint::parse_buf(def_part_vec, 10u) as int;
diff --git a/src/comp/metadata/tyencode.rs b/src/comp/metadata/tyencode.rs
index dbde5991558..5568804c056 100644
--- a/src/comp/metadata/tyencode.rs
+++ b/src/comp/metadata/tyencode.rs
@@ -17,9 +17,10 @@ export ac_no_abbrevs;
 export ac_use_abbrevs;
 export enc_ty;
 
-type ctxt =  // Def -> str Callback:
+type ctxt =
+     // Def -> str Callback:
      // The type context.
-    {ds: fn(&def_id) -> str , tcx: ty::ctxt, abbrevs: abbrev_ctxt};
+     {ds: fn(&def_id) -> str, tcx: ty::ctxt, abbrevs: abbrev_ctxt};
 
 // Compact string representation for ty.t values. API ty_str & parse_from_str.
 // Extra parameters are for converting to/from def_ids in the string rep.
@@ -151,7 +152,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
           native_abi_llvm. { w.write_char('l'); }
           native_abi_x86stdcall. { w.write_char('s'); }
         }
-        enc_ty_fn(w, cx, args, out, return, ~[]);
+        enc_ty_fn(w, cx, args, out, return, []);
       }
       ty::ty_obj(methods) {
         w.write_str("O[");
@@ -176,7 +177,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
         w.write_str(cx.ds(def));
         w.write_char('|');
       }
-      ty::ty_param(id,k) {
+      ty::ty_param(id, k) {
         alt k {
           kind_unique. { w.write_str("pu"); }
           kind_shared. { w.write_str("ps"); }
@@ -210,9 +211,7 @@ fn enc_ty_fn(w: &io::writer, cx: &@ctxt, args: &[ty::arg], out: &ty::t,
             w.write_char('&');
             if mut { w.write_char('m'); }
           }
-          ty::mo_move. {
-            w.write_char('-');
-          }
+          ty::mo_move. { w.write_char('-'); }
           ty::mo_val. { }
         }
         enc_ty(w, cx, arg.ty);
diff --git a/src/comp/middle/alias.rs b/src/comp/middle/alias.rs
index 5d0afd7154d..738489bb400 100644
--- a/src/comp/middle/alias.rs
+++ b/src/comp/middle/alias.rs
@@ -42,12 +42,13 @@ fn check_crate(tcx: ty::ctxt, crate: &@ast::crate) {
     // Stores information about object fields and function
     // arguments that's otherwise not easily available.
     let cx = @{tcx: tcx, local_map: std::map::new_int_hash()};
-    let v = @{visit_fn: bind visit_fn(cx, _, _, _, _, _, _, _),
-              visit_item: bind visit_item(cx, _, _, _),
-              visit_expr: bind visit_expr(cx, _, _, _),
-              visit_decl: bind visit_decl(cx, _, _, _)
-              with *visit::default_visitor::<scope>()};
-    visit::visit_crate(*crate, @~[], visit::mk_vt(v));
+    let v =
+        @{visit_fn: bind visit_fn(cx, _, _, _, _, _, _, _),
+          visit_item: bind visit_item(cx, _, _, _),
+          visit_expr: bind visit_expr(cx, _, _, _),
+          visit_decl: bind visit_decl(cx, _, _, _)
+             with *visit::default_visitor::<scope>()};
+    visit::visit_crate(*crate, @[], visit::mk_vt(v));
     tcx.sess.abort_if_errors();
 }
 
@@ -57,27 +58,36 @@ fn visit_fn(cx: &@ctx, f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span,
     for arg_: ast::arg in f.decl.inputs {
         cx.local_map.insert(arg_.id, arg(arg_.mode));
     }
-    let scope = alt (f.proto) {
-      // Blocks need to obey any restrictions from the enclosing scope.
-      ast::proto_block. { sc }
-      // Closures need to prohibit writing to any of the upvars.
-      // This doesn't seem like a particularly clean way to do this.
-      ast::proto_closure. {
-        let dnums = ~[];
-        for each nid in freevars::get_freevar_defs(cx.tcx, id).keys() {
-            dnums += ~[nid];
-        }
-        @~[@{root_vars: ~[],
-             // I'm not sure if there is anything sensical to put here
-             block_defnum: 0,
-             bindings: dnums,
-             tys: ~[],
-             depends_on: ~[],
-             mutable ok: valid}]
-      }
-      // Non capturing functions start out fresh.
-      _ { @~[] }
-    };
+    let scope =
+        alt f.proto {
+
+          // Blocks need to obey any restrictions from the enclosing scope.
+          ast::proto_block. {
+            sc
+          }
+
+          // Closures need to prohibit writing to any of the upvars.
+          // This doesn't seem like a particularly clean way to do this.
+          ast::proto_closure. {
+            let dnums = [];
+            for each nid in freevars::get_freevar_defs(cx.tcx, id).keys() {
+                dnums += [nid];
+            };
+            @[
+              // I'm not sure if there is anything sensical to put here
+              @{root_vars: [],
+                block_defnum: 0,
+                bindings: dnums,
+                tys: [],
+                depends_on: [],
+                mutable ok: valid}]
+          }
+
+          // Non capturing functions start out fresh.
+          _ {
+            @[]
+          }
+        };
 
     v.visit_block(f.body, scope, v);
 }
@@ -168,14 +178,14 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
    {root_vars: [node_id], unsafe_ts: [ty::t]} {
     let fty = ty::expr_ty(cx.tcx, f);
     let arg_ts = fty_args(cx, fty);
-    let roots: [node_id] = ~[];
-    let mut_roots: [{arg: uint, node: node_id}] = ~[];
-    let unsafe_ts: [ty::t] = ~[];
-    let unsafe_t_offsets: [uint] = ~[];
+    let roots: [node_id] = [];
+    let mut_roots: [{arg: uint, node: node_id}] = [];
+    let unsafe_ts: [ty::t] = [];
+    let unsafe_t_offsets: [uint] = [];
     let i = 0u;
     for arg_t: ty::arg in arg_ts {
         if arg_t.mode != ty::mo_val {
-            let arg = args.(i);
+            let arg = args[i];
             let root = expr_root(cx, arg, false);
             if arg_t.mode == ty::mo_alias(true) {
                 alt path_def(cx, arg) {
@@ -183,24 +193,27 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
                     let dnum = ast::def_id_of_def(def).node;
                     if def_is_local(def, true) {
                         if is_immutable_alias(cx, sc, dnum) {
-                            cx.tcx.sess.span_err
-                                (arg.span, "passing an immutable alias \
-                                            by mutable alias");
+                            cx.tcx.sess.span_err(
+                                arg.span,
+                                "passing an immutable alias \
+                                 by mutable alias");
                         } else if is_immutable_objfield(cx, dnum) {
-                            cx.tcx.sess.span_err
-                                (arg.span, "passing an immutable object \
-                                            field by mutable alias");
+                            cx.tcx.sess.span_err(
+                                arg.span,
+                                "passing an immutable object \
+                                 field by mutable alias");
                         }
                     } else {
-                        cx.tcx.sess.span_err
-                            (arg.span,
-                             "passing a static item by mutable alias");
+                        cx.tcx.sess.span_err(
+                            arg.span,
+                            "passing a static item by mutable alias");
                     }
-                    mut_roots += ~[{arg: i, node: dnum}];
+                    mut_roots += [{arg: i, node: dnum}];
                   }
                   _ {
                     if !mut_field(root.ds) {
-                        let m = "passing a temporary value or \
+                        let m =
+                            "passing a temporary value or \
                                  immutable field by mutable alias";
                         cx.tcx.sess.span_err(arg.span, m);
                     }
@@ -208,11 +221,11 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
                 }
             }
             alt path_def_id(cx, root.ex) {
-              some(did) { roots += ~[did.node]; }
+              some(did) { roots += [did.node]; }
               _ { }
             }
             alt inner_mut(root.ds) {
-              some(t) { unsafe_ts += ~[t]; unsafe_t_offsets += ~[i]; }
+              some(t) { unsafe_ts += [t]; unsafe_t_offsets += [i]; }
               _ { }
             }
         }
@@ -223,9 +236,9 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
           ast::expr_path(_) {
             if def_is_local(cx.tcx.def_map.get(f.id), true) {
                 cx.tcx.sess.span_err(f.span,
-                                     #fmt("function may alias with \
+                                     #fmt["function may alias with \
                          argument %u, which is not immutably rooted",
-                                          unsafe_t_offsets.(0)));
+                                          unsafe_t_offsets[0]]);
             }
           }
           _ { }
@@ -233,17 +246,17 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
     }
     let j = 0u;
     for unsafe: ty::t in unsafe_ts {
-        let offset = unsafe_t_offsets.(j);
+        let offset = unsafe_t_offsets[j];
         j += 1u;
         let i = 0u;
         for arg_t: ty::arg in arg_ts {
             let mut_alias = arg_t.mode == ty::mo_alias(true);
             if i != offset &&
                    ty_can_unsafely_include(cx, unsafe, arg_t.ty, mut_alias) {
-                cx.tcx.sess.span_err(args.(i).span,
-                                     #fmt("argument %u may alias with \
+                cx.tcx.sess.span_err(args[i].span,
+                                     #fmt["argument %u may alias with \
                      argument %u, which is not immutably rooted",
-                                          i, offset));
+                                          i, offset]);
             }
             i += 1u;
         }
@@ -265,7 +278,7 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
 
 
         if mut_alias_to_root {
-            cx.tcx.sess.span_err(args.(root.arg).span,
+            cx.tcx.sess.span_err(args[root.arg].span,
                                  "passing a mutable alias to a \
                  variable that roots another alias");
         }
@@ -281,14 +294,14 @@ fn check_tail_call(cx: &ctx, call: &@ast::expr) {
         if arg_t.mode != ty::mo_val {
             let mut_a = arg_t.mode == ty::mo_alias(true);
             let ok = true;
-            alt args.(i).node {
+            alt args[i].node {
               ast::expr_path(_) {
-                let def = cx.tcx.def_map.get(args.(i).id);
+                let def = cx.tcx.def_map.get(args[i].id);
                 let dnum = ast::def_id_of_def(def).node;
                 alt cx.local_map.find(dnum) {
                   some(arg(ast::alias(mut))) {
                     if mut_a && !mut {
-                        cx.tcx.sess.span_err(args.(i).span,
+                        cx.tcx.sess.span_err(args[i].span,
                                              "passing an immutable \
                                      alias by mutable alias");
                     }
@@ -299,7 +312,7 @@ fn check_tail_call(cx: &ctx, call: &@ast::expr) {
               _ { ok = false; }
             }
             if !ok {
-                cx.tcx.sess.span_err(args.(i).span,
+                cx.tcx.sess.span_err(args[i].span,
                                      "can not pass a local value by \
                                      alias to a tail call");
             }
@@ -313,26 +326,28 @@ fn check_alt(cx: &ctx, input: &@ast::expr, arms: &[ast::arm], sc: &scope,
     visit::visit_expr(input, sc, v);
     let root = expr_root(cx, input, true);
     let roots =
-        alt path_def_id(cx, root.ex) { some(did) { ~[did.node] } _ { ~[] } };
+        alt path_def_id(cx, root.ex) { some(did) { [did.node] } _ { [] } };
     let forbidden_tp: [ty::t] =
-        alt inner_mut(root.ds) { some(t) { ~[t] } _ { ~[] } };
+        alt inner_mut(root.ds) { some(t) { [t] } _ { [] } };
     for a: ast::arm in arms {
         let dnums = arm_defnums(a);
         let new_sc = sc;
         if vec::len(dnums) > 0u {
-            new_sc = @(*sc + ~[@{root_vars: roots,
-                                 block_defnum: dnums.(vec::len(dnums) - 1u),
-                                 bindings: dnums,
-                                 tys: forbidden_tp,
-                                 depends_on: deps(sc, roots),
-                                 mutable ok: valid}]);
+            new_sc =
+                @(*sc +
+                      [@{root_vars: roots,
+                         block_defnum: dnums[vec::len(dnums) - 1u],
+                         bindings: dnums,
+                         tys: forbidden_tp,
+                         depends_on: deps(sc, roots),
+                         mutable ok: valid}]);
         }
         visit::visit_arm(a, new_sc, v);
     }
 }
 
 fn arm_defnums(arm: &ast::arm) -> [node_id] {
-    ret ast::pat_binding_ids(arm.pats.(0));
+    ret ast::pat_binding_ids(arm.pats[0]);
 }
 
 fn check_for_each(cx: &ctx, local: &@ast::local, call: &@ast::expr,
@@ -342,13 +357,14 @@ fn check_for_each(cx: &ctx, local: &@ast::local, call: &@ast::expr,
       ast::expr_call(f, args) {
         let data = check_call(cx, f, args, sc);
         let bindings = ast::pat_binding_ids(local.node.pat);
-        let new_sc = @{root_vars: data.root_vars,
-                       block_defnum: bindings.(vec::len(bindings) - 1u),
-                       bindings: bindings,
-                       tys: data.unsafe_ts,
-                       depends_on: deps(sc, data.root_vars),
-                       mutable ok: valid};
-        visit::visit_block(blk, @(*sc + ~[new_sc]), v);
+        let new_sc =
+            @{root_vars: data.root_vars,
+              block_defnum: bindings[vec::len(bindings) - 1u],
+              bindings: bindings,
+              tys: data.unsafe_ts,
+              depends_on: deps(sc, data.root_vars),
+              mutable ok: valid};
+        visit::visit_block(blk, @(*sc + [new_sc]), v);
       }
     }
 }
@@ -358,15 +374,13 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk,
     visit::visit_expr(seq, sc, v);
     let root = expr_root(cx, seq, false);
     let root_def =
-        alt path_def_id(cx, root.ex) { some(did) { ~[did.node] } _ { ~[] } };
-    let unsafe = alt inner_mut(root.ds) { some(t) { ~[t] } _ { ~[] } };
+        alt path_def_id(cx, root.ex) { some(did) { [did.node] } _ { [] } };
+    let unsafe = alt inner_mut(root.ds) { some(t) { [t] } _ { [] } };
 
     // If this is a mutable vector, don't allow it to be touched.
     let seq_t = ty::expr_ty(cx.tcx, seq);
     alt ty::struct(cx.tcx, seq_t) {
-      ty::ty_vec(mt) {
-        if mt.mut != ast::imm { unsafe = ~[seq_t]; }
-      }
+      ty::ty_vec(mt) { if mt.mut != ast::imm { unsafe = [seq_t]; } }
       ty::ty_str. | ty::ty_istr. {/* no-op */ }
       _ {
         cx.tcx.sess.span_unimpl(seq.span,
@@ -375,13 +389,14 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk,
       }
     }
     let bindings = ast::pat_binding_ids(local.node.pat);
-    let new_sc = @{root_vars: root_def,
-                   block_defnum: bindings.(vec::len(bindings) - 1u),
-                   bindings: bindings,
-                   tys: unsafe,
-                   depends_on: deps(sc, root_def),
-                   mutable ok: valid};
-    visit::visit_block(blk, @(*sc + ~[new_sc]), v);
+    let new_sc =
+        @{root_vars: root_def,
+          block_defnum: bindings[vec::len(bindings) - 1u],
+          bindings: bindings,
+          tys: unsafe,
+          depends_on: deps(sc, root_def),
+          mutable ok: valid};
+    visit::visit_block(blk, @(*sc + [new_sc]), v);
 }
 
 fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id,
@@ -391,6 +406,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id,
     let my_defnum = ast::def_id_of_def(def).node;
     let var_t = ty::expr_ty(cx.tcx, ex);
     for r: restrict in *sc {
+
         // excludes variables introduced since the alias was made
         // FIXME This does not work anymore, now that we have macros.
         if my_defnum < r.block_defnum {
@@ -399,7 +415,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id,
                     r.ok = val_taken(ex.span, p);
                 }
             }
-        } else if (vec::member(my_defnum, r.bindings)) {
+        } else if vec::member(my_defnum, r.bindings) {
             test_scope(cx, sc, r, p);
         }
     }
@@ -411,7 +427,7 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) {
         let dnum = ast::def_id_of_def(cx.tcx.def_map.get(dest.id)).node;
         if is_immutable_alias(*cx, sc, dnum) {
             cx.tcx.sess.span_err(dest.span, "assigning to immutable alias");
-        } else if (is_immutable_objfield(*cx, dnum)) {
+        } else if is_immutable_objfield(*cx, dnum) {
             cx.tcx.sess.span_err(dest.span,
                                  "assigning to immutable obj field");
         }
@@ -425,9 +441,9 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) {
         let root = expr_root(*cx, dest, false);
         if vec::len(*root.ds) == 0u {
             cx.tcx.sess.span_err(dest.span, "assignment to non-lvalue");
-        } else if (!root.ds.(0).mut) {
+        } else if !root.ds[0].mut {
             let name =
-                alt root.ds.(0).kind {
+                alt root.ds[0].kind {
                   unbox. { "box" }
                   field. { "field" }
                   index. { "vec content" }
@@ -475,9 +491,7 @@ fn is_immutable_alias(cx: &ctx, sc: &scope, dnum: node_id) -> bool {
       some(arg(ast::alias(false))) { ret true; }
       _ { }
     }
-    for r: restrict in *sc {
-        if vec::member(dnum, r.bindings) { ret true; }
-    }
+    for r: restrict in *sc { if vec::member(dnum, r.bindings) { ret true; } }
     ret false;
 }
 
@@ -489,17 +503,18 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) {
     let prob = r.ok;
     for dep: uint in r.depends_on {
         if prob != valid { break; }
-        prob = sc.(dep).ok;
+        prob = sc[dep].ok;
     }
     if prob != valid {
-        let msg = alt prob {
-          overwritten(sp, wpt) {
-            {span: sp, msg: "overwriting " + ast::path_name(wpt)}
-          }
-          val_taken(sp, vpt) {
-            {span: sp, msg: "taking the value of " + ast::path_name(vpt)}
-          }
-        };
+        let msg =
+            alt prob {
+              overwritten(sp, wpt) {
+                {span: sp, msg: "overwriting " + ast::path_name(wpt)}
+              }
+              val_taken(sp, vpt) {
+                {span: sp, msg: "taking the value of " + ast::path_name(vpt)}
+              }
+            };
         cx.tcx.sess.span_err(msg.span,
                              msg.msg + " will invalidate alias " +
                                  ast::path_name(p) + ", which is still used");
@@ -508,10 +523,10 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) {
 
 fn deps(sc: &scope, roots: &[node_id]) -> [uint] {
     let i = 0u;
-    let result = ~[];
+    let result = [];
     for r: restrict in *sc {
         for dn: node_id in roots {
-            if vec::member(dn, r.bindings) { result += ~[i]; }
+            if vec::member(dn, r.bindings) { result += [i]; }
         }
         i += 1u;
     }
@@ -530,37 +545,37 @@ type deref = @{mut: bool, kind: deref_t, outer_t: ty::t};
 fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) ->
    {ex: @ast::expr, ds: @[deref]} {
     fn maybe_auto_unbox(cx: &ctx, t: ty::t) -> {t: ty::t, ds: [deref]} {
-        let ds = ~[];
+        let ds = [];
         while true {
             alt ty::struct(cx.tcx, t) {
               ty::ty_box(mt) {
-                ds += ~[@{mut: mt.mut != ast::imm, kind: unbox, outer_t: t}];
+                ds += [@{mut: mt.mut != ast::imm, kind: unbox, outer_t: t}];
                 t = mt.ty;
               }
               ty::ty_uniq(mt) {
-                ds += ~[@{mut: false, kind: unbox, outer_t: t}];
+                ds += [@{mut: false, kind: unbox, outer_t: t}];
               }
               ty::ty_res(_, inner, tps) {
-                ds += ~[@{mut: false, kind: unbox, outer_t: t}];
+                ds += [@{mut: false, kind: unbox, outer_t: t}];
                 t = ty::substitute_type_params(cx.tcx, tps, inner);
               }
               ty::ty_tag(did, tps) {
                 let variants = ty::tag_variants(cx.tcx, did);
                 if vec::len(variants) != 1u ||
-                       vec::len(variants.(0).args) != 1u {
+                       vec::len(variants[0].args) != 1u {
                     break;
                 }
-                ds += ~[@{mut: false, kind: unbox, outer_t: t}];
+                ds += [@{mut: false, kind: unbox, outer_t: t}];
                 t =
                     ty::substitute_type_params(cx.tcx, tps,
-                                               variants.(0).args.(0));
+                                               variants[0].args[0]);
               }
               _ { break; }
             }
         }
         ret {t: t, ds: ds};
     }
-    let ds: [deref] = ~[];
+    let ds: [deref] = [];
     while true {
         alt { ex.node } {
           ast::expr_field(base, ident) {
@@ -577,7 +592,7 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) ->
               }
               ty::ty_obj(_) { }
             }
-            ds += ~[@{mut: mut, kind: field, outer_t: auto_unbox.t}];
+            ds += [@{mut: mut, kind: field, outer_t: auto_unbox.t}];
             ds += auto_unbox.ds;
             ex = base;
           }
@@ -586,9 +601,9 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) ->
             alt ty::struct(cx.tcx, auto_unbox.t) {
               ty::ty_vec(mt) {
                 ds +=
-                    ~[@{mut: mt.mut != ast::imm,
-                        kind: index,
-                        outer_t: auto_unbox.t}];
+                    [@{mut: mt.mut != ast::imm,
+                       kind: index,
+                       outer_t: auto_unbox.t}];
               }
             }
             ds += auto_unbox.ds;
@@ -605,7 +620,7 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) ->
                   ty::ty_tag(_, _) { }
                   ty::ty_ptr(mt) { mut = mt.mut != ast::imm; }
                 }
-                ds += ~[@{mut: mut, kind: unbox, outer_t: base_t}];
+                ds += [@{mut: mut, kind: unbox, outer_t: base_t}];
                 ex = base;
             } else { break; }
           }
@@ -631,9 +646,9 @@ fn inner_mut(ds: &@[deref]) -> option::t<ty::t> {
 
 fn path_def(cx: &ctx, ex: &@ast::expr) -> option::t<ast::def> {
     ret alt ex.node {
-      ast::expr_path(_) { some(cx.tcx.def_map.get(ex.id)) }
-      _ { none }
-    }
+          ast::expr_path(_) { some(cx.tcx.def_map.get(ex.id)) }
+          _ { none }
+        }
 }
 
 fn path_def_id(cx: &ctx, ex: &@ast::expr) -> option::t<ast::def_id> {
@@ -673,25 +688,23 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t,
             ret false;
           }
           ty::ty_tup(ts) {
-            for t in ts {
-                if helper(tcx, needle, t, mut) {
-                    ret true;
-                }
-            }
+            for t in ts { if helper(tcx, needle, t, mut) { ret true; } }
             ret false;
           }
 
+
           // These may contain anything.
           ty::ty_fn(_, _, _, _, _) {
             ret true;
           }
           ty::ty_obj(_) { ret true; }
 
+
           // A type param may include everything, but can only be
           // treated as opaque downstream, and is thus safe unless we
           // saw mutable fields, in which case the whole thing can be
           // overwritten.
-          ty::ty_param(_,_) {
+          ty::ty_param(_, _) {
             ret mut;
           }
           _ { ret false; }
diff --git a/src/comp/middle/ast_map.rs b/src/comp/middle/ast_map.rs
index cca7667a691..afba7e20ced 100644
--- a/src/comp/middle/ast_map.rs
+++ b/src/comp/middle/ast_map.rs
@@ -60,14 +60,14 @@ fn new_smallintmap_int_adapter<@V>() -> std::map::hashmap<int, V> {
 // interface.
 // FIXME: hashmap and smallintmap should support the same interface.
 fn new_smallintmap_adapter<@K,
-                           @V>(key_idx: fn(&K) -> uint ,
-                               idx_key: fn(&uint) -> K ) ->
+                           @V>(key_idx: fn(&K) -> uint,
+                               idx_key: fn(&uint) -> K) ->
    std::map::hashmap<K, V> {
 
     obj adapter<@K,
                 @V>(map: smallintmap::smallintmap<V>,
-                    key_idx: fn(&K) -> uint ,
-                    idx_key: fn(&uint) -> K ) {
+                    key_idx: fn(&K) -> uint,
+                    idx_key: fn(&uint) -> K) {
 
         fn size() -> uint { fail }
 
@@ -128,45 +128,44 @@ mod test {
     #[test]
     fn test_node_span_item() {
         let expected: codemap::span = mk_sp(20u, 30u);
-        let node = node_item(@{ident: "test",
-                               attrs: ~[],
-                               id: 0,
-                               node: item_mod({view_items: ~[],
-                                               items: ~[]}),
-                               span: expected});
-        assert node_span(node) == expected;
+        let node =
+            node_item(@{ident: "test",
+                        attrs: [],
+                        id: 0,
+                        node: item_mod({view_items: [], items: []}),
+                        span: expected});
+        assert (node_span(node) == expected);
     }
 
     #[test]
     fn test_node_span_obj_ctor() {
         let expected: codemap::span = mk_sp(20u, 30u);
-        let node = node_obj_ctor(@{ident: "test",
-                                   attrs: ~[],
-                                   id: 0,
-                                   node: item_mod({view_items: ~[],
-                                                   items: ~[]}),
-                                   span: expected});
-        assert node_span(node) == expected;
+        let node =
+            node_obj_ctor(@{ident: "test",
+                            attrs: [],
+                            id: 0,
+                            node: item_mod({view_items: [], items: []}),
+                            span: expected});
+        assert (node_span(node) == expected);
     }
 
     #[test]
     fn test_node_span_native_item() {
         let expected: codemap::span = mk_sp(20u, 30u);
-        let node = node_native_item(@{ident: "test",
-                                      attrs: ~[],
-                                      node: native_item_ty,
-                                      id: 0,
-                                      span: expected});
-        assert node_span(node) == expected;
+        let node =
+            node_native_item(@{ident: "test",
+                               attrs: [],
+                               node: native_item_ty,
+                               id: 0,
+                               span: expected});
+        assert (node_span(node) == expected);
     }
 
     #[test]
     fn test_node_span_expr() {
         let expected: codemap::span = mk_sp(20u, 30u);
-        let node = node_expr(@{id: 0,
-                               node: expr_break,
-                               span: expected});
-        assert node_span(node) == expected;
+        let node = node_expr(@{id: 0, node: expr_break, span: expected});
+        assert (node_span(node) == expected);
     }
 }
 
diff --git a/src/comp/middle/check_alt.rs b/src/comp/middle/check_alt.rs
index 29be298aad1..7c2f76c0590 100644
--- a/src/comp/middle/check_alt.rs
+++ b/src/comp/middle/check_alt.rs
@@ -5,7 +5,7 @@ fn check_crate(tcx: &ty::ctxt, crate: &@crate) {
     let v =
         @{visit_expr: bind check_expr(tcx, _, _, _),
           visit_local: bind check_local(tcx, _, _, _)
-          with *visit::default_visitor::<()>()};
+             with *visit::default_visitor::<()>()};
     visit::visit_crate(*crate, (), visit::mk_vt(v));
     tcx.sess.abort_if_errors();
 }
@@ -22,7 +22,7 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) {
             let reachable = true;
             let j = 0;
             while j < i {
-                for prev_pat: @pat in arms.(j).pats {
+                for prev_pat: @pat in arms[j].pats {
                     if pattern_supersedes(tcx, prev_pat, arm_pat) {
                         reachable = false;
                     }
@@ -38,11 +38,10 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) {
 }
 
 fn pattern_supersedes(tcx: &ty::ctxt, a: &@pat, b: &@pat) -> bool {
-    fn patterns_supersede(tcx: &ty::ctxt, as: &[@pat], bs: &[@pat]) ->
-       bool {
+    fn patterns_supersede(tcx: &ty::ctxt, as: &[@pat], bs: &[@pat]) -> bool {
         let i = 0;
         for a: @pat in as {
-            if !pattern_supersedes(tcx, a, bs.(i)) { ret false; }
+            if !pattern_supersedes(tcx, a, bs[i]) { ret false; }
             i += 1;
         }
         ret true;
@@ -119,19 +118,13 @@ fn is_refutable(tcx: &ty::ctxt, pat: &@pat) -> bool {
         ret false;
       }
       pat_tup(elts) {
-        for elt in elts {
-            if is_refutable(tcx, elt) { ret true; }
-        }
+        for elt in elts { if is_refutable(tcx, elt) { ret true; } }
         ret false;
       }
       pat_tag(_, args) {
         let vdef = variant_def_ids(tcx.def_map.get(pat.id));
-        if std::vec::len(ty::tag_variants(tcx, vdef.tg)) != 1u {
-            ret true;
-        }
-        for p: @pat in args {
-            if is_refutable(tcx, p) { ret true; }
-        }
+        if std::vec::len(ty::tag_variants(tcx, vdef.tg)) != 1u { ret true; }
+        for p: @pat in args { if is_refutable(tcx, p) { ret true; } }
         ret false;
       }
     }
diff --git a/src/comp/middle/freevars.rs b/src/comp/middle/freevars.rs
index 2822e404e50..8bef22f8ad8 100644
--- a/src/comp/middle/freevars.rs
+++ b/src/comp/middle/freevars.rs
@@ -38,59 +38,62 @@ type freevar_map = hashmap<ast::node_id, freevar_info>;
 // of the AST, we take a walker function that we invoke with a visitor
 // in order to start the search.
 fn collect_freevars(def_map: &resolve::def_map, sess: &session::session,
-                    walker: &fn(&visit::vt<()>) ,
+                    walker: &fn(&visit::vt<()>),
                     initial_decls: [ast::node_id]) -> freevar_info {
     let decls = new_int_hash();
     for decl: ast::node_id in initial_decls { set_add(decls, decl); }
-    let refs = @mutable ~[];
+    let refs = @mutable [];
 
-    let walk_fn = lambda(f: &ast::_fn, _tps: &[ast::ty_param], _sp: &span,
-                         _i: &ast::fn_ident, _nid: ast::node_id) {
-        for a: ast::arg in f.decl.inputs { set_add(decls, a.id); }
-    };
-    let walk_expr = lambda(expr: &@ast::expr) {
-        alt expr.node {
-          ast::expr_path(path) {
-            if !def_map.contains_key(expr.id) {
-                sess.span_fatal(expr.span,
-                                "internal error in collect_freevars");
+    let walk_fn =
+        lambda (f: &ast::_fn, _tps: &[ast::ty_param], _sp: &span,
+                _i: &ast::fn_ident, _nid: ast::node_id) {
+            for a: ast::arg in f.decl.inputs { set_add(decls, a.id); }
+        };
+    let walk_expr =
+        lambda (expr: &@ast::expr) {
+            alt expr.node {
+              ast::expr_path(path) {
+                if !def_map.contains_key(expr.id) {
+                    sess.span_fatal(expr.span,
+                                    "internal error in collect_freevars");
+                }
+                alt def_map.get(expr.id) {
+                  ast::def_arg(did) { *refs += [expr.id]; }
+                  ast::def_local(did) { *refs += [expr.id]; }
+                  ast::def_binding(did) { *refs += [expr.id]; }
+                  _ {/* no-op */ }
+                }
+              }
+              _ { }
             }
-            alt def_map.get(expr.id) {
-              ast::def_arg(did) { *refs += ~[expr.id]; }
-              ast::def_local(did) { *refs += ~[expr.id]; }
-              ast::def_binding(did) { *refs += ~[expr.id]; }
-              _ {/* no-op */ }
+        };
+    let walk_local =
+        lambda (local: &@ast::local) {
+            for each b: @ast::pat in ast::pat_bindings(local.node.pat) {
+                set_add(decls, b.id);
             }
-          }
-          _ { }
-        }
-    };
-    let walk_local = lambda(local: &@ast::local) {
-        for each b: @ast::pat in ast::pat_bindings(local.node.pat) {
-            set_add(decls, b.id);
-        }
-    };
-    let walk_pat = lambda(p: &@ast::pat) {
-        alt p.node { ast::pat_bind(_) { set_add(decls, p.id); } _ { } }
-    };
-
-    walker(visit::mk_simple_visitor
-           (@{visit_local: walk_local,
-              visit_pat: walk_pat,
-              visit_expr: walk_expr,
-              visit_fn: walk_fn
-              with *visit::default_simple_visitor()}));
+        };
+    let walk_pat =
+        lambda (p: &@ast::pat) {
+            alt p.node { ast::pat_bind(_) { set_add(decls, p.id); } _ { } }
+        };
 
+    walker(visit::mk_simple_visitor(@{visit_local: walk_local,
+                                      visit_pat: walk_pat,
+                                      visit_expr: walk_expr,
+                                      visit_fn: walk_fn
+                                         with
+                                         *visit::default_simple_visitor()}));
     // Calculate (refs - decls). This is the set of captured upvars.
     // We build a vec of the node ids of the uses and a set of the
     // node ids of the definitions.
-    let canonical_refs = ~[];
+    let canonical_refs = [];
     let defs = new_int_hash();
     for ref_id_: ast::node_id in *refs {
         let ref_id = ref_id_;
         let def_id = ast::def_id_of_def(def_map.get(ref_id)).node;
         if !decls.contains_key(def_id) && !defs.contains_key(def_id) {
-            canonical_refs += ~[ref_id];
+            canonical_refs += [ref_id];
             set_add(defs, def_id);
         }
     }
@@ -106,32 +109,34 @@ fn annotate_freevars(sess: &session::session, def_map: &resolve::def_map,
                      crate: &@ast::crate) -> freevar_map {
     let freevars = new_int_hash();
 
-    let walk_fn = lambda(f: &ast::_fn, tps: &[ast::ty_param], sp: &span,
-                         i: &ast::fn_ident, nid: ast::node_id) {
-        let start_walk = lambda(v: &visit::vt<()>) {
-            v.visit_fn(f, tps, sp, i, nid, (), v);
+    let walk_fn =
+        lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span,
+                i: &ast::fn_ident, nid: ast::node_id) {
+            let start_walk =
+                lambda (v: &visit::vt<()>) {
+                    v.visit_fn(f, tps, sp, i, nid, (), v);
+                };
+            let vars = collect_freevars(def_map, sess, start_walk, []);
+            freevars.insert(nid, vars);
+        };
+    let walk_expr =
+        lambda (expr: &@ast::expr) {
+            alt expr.node {
+              ast::expr_for_each(local, _, body) {
+                let start_walk =
+                    lambda (v: &visit::vt<()>) {
+                        v.visit_block(body, (), v);
+                    };
+                let bound = ast::pat_binding_ids(local.node.pat);
+                let vars = collect_freevars(def_map, sess, start_walk, bound);
+                freevars.insert(body.node.id, vars);
+              }
+              _ { }
+            }
         };
-        let vars = collect_freevars(def_map, sess, start_walk, ~[]);
-        freevars.insert(nid, vars);
-    };
-    let walk_expr = lambda(expr: &@ast::expr) {
-        alt expr.node {
-          ast::expr_for_each(local, _, body) {
-            let start_walk = lambda(v: &visit::vt<()>) {
-                v.visit_block(body, (), v);
-            };
-            let bound = ast::pat_binding_ids(local.node.pat);
-            let vars =
-                collect_freevars(def_map, sess, start_walk, bound);
-            freevars.insert(body.node.id, vars);
-          }
-          _ { }
-        }
-    };
 
     let visitor =
-        visit::mk_simple_visitor(@{visit_fn: walk_fn,
-                                   visit_expr: walk_expr
+        visit::mk_simple_visitor(@{visit_fn: walk_fn, visit_expr: walk_expr
                                       with *visit::default_simple_visitor()});
     visit::visit_crate(*crate, (), visitor);
 
diff --git a/src/comp/middle/gc.rs b/src/comp/middle/gc.rs
index 878762294c6..103ce9eb47d 100644
--- a/src/comp/middle/gc.rs
+++ b/src/comp/middle/gc.rs
@@ -16,15 +16,13 @@ import std::vec;
 
 import lll = lib::llvm::llvm;
 
-type ctxt = @{ mutable next_tydesc_num: uint };
+type ctxt = @{mutable next_tydesc_num: uint};
 
-fn mk_ctxt() -> ctxt {
-    ret @{ mutable next_tydesc_num: 0u };
-}
+fn mk_ctxt() -> ctxt { ret @{mutable next_tydesc_num: 0u}; }
 
 fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: str) -> ValueRef {
-    let llglobal = lll::LLVMAddGlobal(ccx.llmod, val_ty(llval),
-                                      str::buf(name));
+    let llglobal =
+        lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), str::buf(name));
     lll::LLVMSetInitializer(llglobal, llval);
     lll::LLVMSetGlobalConstant(llglobal, True);
     ret llglobal;
@@ -33,7 +31,7 @@ fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: str) -> ValueRef {
 fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt {
     let bcx = cx;
     if !type_is_gc_relevant(bcx_tcx(cx), ty) ||
-            ty::type_has_dynamic_size(bcx_tcx(cx), ty) {
+           ty::type_has_dynamic_size(bcx_tcx(cx), ty) {
         ret bcx;
     }
 
@@ -52,48 +50,45 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt {
     let llvalptr = bcx.build.PointerCast(llval, T_ptr(T_ptr(T_i8())));
 
     alt td_r.kind {
-        tk_derived. {
-            // It's a derived type descriptor. First, spill it.
-            let lltydescptr = trans::alloca(bcx, val_ty(lltydesc));
-            bcx.build.Store(lltydesc, lltydescptr);
-
-            let number = gc_cx.next_tydesc_num;
-            gc_cx.next_tydesc_num += 1u;
-
-            let lldestindex = add_global(bcx_ccx(bcx),
-                                         C_struct(~[C_int(0),
-                                                    C_uint(number)]),
-                                         "rust_gc_tydesc_dest_index");
-            let llsrcindex = add_global(bcx_ccx(bcx),
-                                        C_struct(~[C_int(1), C_uint(number)]),
-                                        "rust_gc_tydesc_src_index");
-
-            lldestindex = lll::LLVMConstPointerCast(lldestindex,
-                                                    T_ptr(T_i8()));
-            llsrcindex = lll::LLVMConstPointerCast(llsrcindex,
-                                                   T_ptr(T_i8()));
-
-            lltydescptr = bcx.build.PointerCast(lltydescptr,
-                                                T_ptr(T_ptr(T_i8())));
-
-            bcx.build.Call(gcroot, ~[ lltydescptr, lldestindex ]);
-            bcx.build.Call(gcroot, ~[ llvalptr, llsrcindex ]);
-        }
-        tk_param. {
-            bcx_tcx(cx).sess.bug("we should never be trying to root values " +
-                "of a type parameter");
-        }
-        tk_static. {
-            // Static type descriptor.
-
-            let llstaticgcmeta = add_global(bcx_ccx(bcx),
-                                            C_struct(~[C_int(2), lltydesc]),
-                                            "rust_gc_tydesc_static_gc_meta");
-            let llstaticgcmetaptr = lll::LLVMConstPointerCast(llstaticgcmeta,
-                                                              T_ptr(T_i8()));
-
-            bcx.build.Call(gcroot, ~[ llvalptr, llstaticgcmetaptr ]);
-        }
+      tk_derived. {
+        // It's a derived type descriptor. First, spill it.
+        let lltydescptr = trans::alloca(bcx, val_ty(lltydesc));
+        bcx.build.Store(lltydesc, lltydescptr);
+
+        let number = gc_cx.next_tydesc_num;
+        gc_cx.next_tydesc_num += 1u;
+
+        let lldestindex =
+            add_global(bcx_ccx(bcx), C_struct([C_int(0), C_uint(number)]),
+                       "rust_gc_tydesc_dest_index");
+        let llsrcindex =
+            add_global(bcx_ccx(bcx), C_struct([C_int(1), C_uint(number)]),
+                       "rust_gc_tydesc_src_index");
+
+        lldestindex = lll::LLVMConstPointerCast(lldestindex, T_ptr(T_i8()));
+        llsrcindex = lll::LLVMConstPointerCast(llsrcindex, T_ptr(T_i8()));
+
+        lltydescptr =
+            bcx.build.PointerCast(lltydescptr, T_ptr(T_ptr(T_i8())));
+
+        bcx.build.Call(gcroot, [lltydescptr, lldestindex]);
+        bcx.build.Call(gcroot, [llvalptr, llsrcindex]);
+      }
+      tk_param. {
+        bcx_tcx(cx).sess.bug("we should never be trying to root values " +
+                                 "of a type parameter");
+      }
+      tk_static. {
+        // Static type descriptor.
+
+        let llstaticgcmeta =
+            add_global(bcx_ccx(bcx), C_struct([C_int(2), lltydesc]),
+                       "rust_gc_tydesc_static_gc_meta");
+        let llstaticgcmetaptr =
+            lll::LLVMConstPointerCast(llstaticgcmeta, T_ptr(T_i8()));
+
+        bcx.build.Call(gcroot, [llvalptr, llstaticgcmetaptr]);
+      }
     }
 
     ret bcx;
@@ -101,45 +96,52 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt {
 
 fn type_is_gc_relevant(cx: &ty::ctxt, ty: &ty::t) -> bool {
     alt ty::struct(cx, ty) {
-        ty::ty_nil. | ty::ty_bot. | ty::ty_bool. | ty::ty_int. |
-        ty::ty_float. | ty::ty_uint. | ty::ty_machine(_) | ty::ty_char. |
-        ty::ty_istr. | ty::ty_type. | ty::ty_native(_) | ty::ty_ptr(_) |
-        ty::ty_type. | ty::ty_native(_) {
-            ret false;
-        }
-
-        ty::ty_rec(fields) {
-            for f in fields {
-                if type_is_gc_relevant(cx, f.mt.ty) { ret true; }
-            }
-            ret false;
-        }
-        ty::ty_tup(elts) {
-            for elt in elts {
-                if type_is_gc_relevant(cx, elt) { ret true; }
+      ty::ty_nil. | ty::ty_bot. | ty::ty_bool. | ty::ty_int. | ty::ty_float. |
+      ty::ty_uint. | ty::ty_machine(_) | ty::ty_char. | ty::ty_istr. |
+      ty::ty_type. | ty::ty_native(_) | ty::ty_ptr(_) | ty::ty_type. |
+      ty::ty_native(_) {
+        ret false;
+      }
+
+
+      ty::ty_rec(fields) {
+        for f in fields { if type_is_gc_relevant(cx, f.mt.ty) { ret true; } }
+        ret false;
+      }
+      ty::ty_tup(elts) {
+        for elt in elts { if type_is_gc_relevant(cx, elt) { ret true; } }
+        ret false;
+      }
+
+
+      ty::ty_tag(did, tps) {
+        let variants = ty::tag_variants(cx, did);
+        for variant in variants {
+            for aty in variant.args {
+                let arg_ty = ty::substitute_type_params(cx, tps, aty);
+                if type_is_gc_relevant(cx, arg_ty) { ret true; }
             }
-            ret false;
         }
+        ret false;
+      }
+
+
+      ty::ty_vec(tm) {
+        ret type_is_gc_relevant(cx, tm.ty);
+      }
+      ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); }
 
-        ty::ty_tag(did, tps) {
-            let variants = ty::tag_variants(cx, did);
-            for variant in variants {
-                for aty in variant.args {
-                    let arg_ty = ty::substitute_type_params(cx, tps, aty);
-                    if type_is_gc_relevant(cx, arg_ty) { ret true; }
-                }
-            }
-            ret false;
-        }
 
-        ty::ty_vec(tm) { ret type_is_gc_relevant(cx, tm.ty); }
-        ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); }
+      ty::ty_str. | ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _)
+      | ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) |
+      ty::ty_res(_, _, _) {
+        ret true;
+      }
 
-        ty::ty_str. | ty::ty_box(_) | ty::ty_uniq(_) |
-        ty::ty_fn(_,_,_,_,_) | ty::ty_native_fn(_,_,_) | ty::ty_obj(_) |
-        ty::ty_param(_,_) | ty::ty_res(_,_,_) { ret true; }
 
-        ty::ty_var(_) { fail "ty_var in type_is_gc_relevant"; }
+      ty::ty_var(_) {
+        fail "ty_var in type_is_gc_relevant";
+      }
     }
 }
 
diff --git a/src/comp/middle/kind.rs b/src/comp/middle/kind.rs
index e4333aab6f5..f5e833a86d2 100644
--- a/src/comp/middle/kind.rs
+++ b/src/comp/middle/kind.rs
@@ -101,35 +101,30 @@ fn kind_to_str(k: kind) -> str {
     }
 }
 
-fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr)
-    -> {ty: ty::t, kind: ast::kind} {
+fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr) ->
+   {ty: ty::t, kind: ast::kind} {
     let t = ty::expr_ty(tcx, e);
     let k = ty::type_kind(tcx, t);
     {ty: t, kind: k}
 }
 
-fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr,
-                  k_need: ast::kind, descr: &str) {
+fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind,
+                  descr: &str) {
     let tk = type_and_kind(tcx, e);
-    log #fmt("for %s: want %s type, got %s type %s",
-             descr,
-             kind_to_str(k_need),
-             kind_to_str(tk.kind),
-             util::ppaux::ty_to_str(tcx, tk.ty));
+    log #fmt["for %s: want %s type, got %s type %s", descr,
+             kind_to_str(k_need), kind_to_str(tk.kind),
+             util::ppaux::ty_to_str(tcx, tk.ty)];
 
-    if ! kind_lteq(k_need, tk.kind) {
+    if !kind_lteq(k_need, tk.kind) {
         let s =
-            #fmt("mismatched kinds for %s: needed %s type, got %s type %s",
-                 descr,
-                 kind_to_str(k_need),
-                 kind_to_str(tk.kind),
-                 util::ppaux::ty_to_str(tcx, tk.ty));
+            #fmt["mismatched kinds for %s: needed %s type, got %s type %s",
+                 descr, kind_to_str(k_need), kind_to_str(tk.kind),
+                 util::ppaux::ty_to_str(tcx, tk.ty)];
         tcx.sess.span_err(e.span, s);
     }
 }
 
-fn need_shared_lhs_rhs(tcx: &ty::ctxt,
-                       a: &@ast::expr, b: &@ast::expr,
+fn need_shared_lhs_rhs(tcx: &ty::ctxt, a: &@ast::expr, b: &@ast::expr,
                        op: &str) {
     need_expr_kind(tcx, a, ast::kind_shared, op + " lhs");
     need_expr_kind(tcx, b, ast::kind_shared, op + " rhs");
@@ -142,6 +137,7 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) {
       ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, "<->"); }
       ast::expr_call(callee, _) {
         let tpt = ty::expr_ty_params_and_ty(tcx, callee);
+
         // If we have typarams, we're calling an item; we need to check
         // that all the types we're supplying as typarams conform to the
         // typaram kind constraints on that item.
@@ -149,17 +145,16 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) {
             let callee_def = ast::def_id_of_def(tcx.def_map.get(callee.id));
             let item_tk = ty::lookup_item_type(tcx, callee_def);
             let i = 0;
-            assert vec::len(item_tk.kinds) == vec::len(tpt.params);
+            assert (vec::len(item_tk.kinds) == vec::len(tpt.params));
             for k_need: ast::kind in item_tk.kinds {
-                let t = tpt.params.(i);
+                let t = tpt.params[i];
                 let k = ty::type_kind(tcx, t);
-                if ! kind_lteq(k_need, k) {
-                    let s = #fmt("mismatched kinds for typaram %d: \
+                if !kind_lteq(k_need, k) {
+                    let s =
+                        #fmt["mismatched kinds for typaram %d: \
                                   needed %s type, got %s type %s",
-                                 i,
-                                 kind_to_str(k_need),
-                                 kind_to_str(k),
-                                 util::ppaux::ty_to_str(tcx, t));
+                             i, kind_to_str(k_need), kind_to_str(k),
+                             util::ppaux::ty_to_str(tcx, t)];
                     tcx.sess.span_err(e.span, s);
                 }
                 i += 1;
@@ -171,9 +166,9 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) {
 }
 
 fn check_crate(tcx: &ty::ctxt, crate: &@ast::crate) {
-    let visit = visit::mk_simple_visitor
-        (@{visit_expr: bind check_expr(tcx, _)
-           with *visit::default_simple_visitor()});
+    let visit =
+        visit::mk_simple_visitor(@{visit_expr: bind check_expr(tcx, _)
+                                      with *visit::default_simple_visitor()});
     visit::visit_crate(*crate, (), visit);
     tcx.sess.abort_if_errors();
 }
diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs
index 80bd61cd979..0785be75823 100644
--- a/src/comp/middle/resolve.rs
+++ b/src/comp/middle/resolve.rs
@@ -65,9 +65,11 @@ tag import_state {
     todo(ast::node_id, ast::ident, [ast::ident], codemap::span, scopes);
     resolving(span);
     resolved(option::t<def>,
-              /* value */
+
+             /* value */
              option::t<def>,
-              /* type */
+
+             /* type */
              option::t<def>); /* module */
 }
 
@@ -135,7 +137,7 @@ tag dir { inside; outside; }
 tag namespace { ns_value; ns_type; ns_module; }
 
 fn resolve_crate(sess: session, amap: &ast_map::map, crate: @ast::crate) ->
-    {def_map: def_map, ext_map: ext_map} {
+   {def_map: def_map, ext_map: ext_map} {
     let e =
         @{cstore: sess.get_cstore(),
           def_map: new_int_hash::<def>(),
@@ -144,7 +146,7 @@ fn resolve_crate(sess: session, amap: &ast_map::map, crate: @ast::crate) ->
           mod_map: new_int_hash::<@indexed_mod>(),
           ext_map: new_def_hash::<[ident]>(),
           ext_cache: new_ext_hash(),
-          mutable reported: ~[],
+          mutable reported: [],
           sess: sess};
     map_crate(e, crate);
     resolve_imports(*e);
@@ -169,7 +171,7 @@ fn map_crate(e: &@env, c: &@ast::crate) {
     e.mod_map.insert(-1,
                      @{m: some(c.node.module),
                        index: index_mod(c.node.module),
-                       mutable glob_imports: ~[],
+                       mutable glob_imports: [],
                        glob_imported_names: new_str_hash::<import_state>()});
     fn index_vi(e: @env, i: &@ast::view_item, sc: &scopes, _v: &vt<scopes>) {
         alt i.node {
@@ -180,8 +182,8 @@ fn map_crate(e: &@env, c: &@ast::crate) {
             for ident in idents {
                 e.imports.insert(ident.node.id,
                                  todo(ident.node.id, ident.node.name,
-                                        mod_path + ~[ident.node.name],
-                                        ident.span, sc));
+                                      mod_path + [ident.node.name],
+                                      ident.span, sc));
             }
           }
           _ { }
@@ -195,7 +197,7 @@ fn map_crate(e: &@env, c: &@ast::crate) {
             e.mod_map.insert(i.id,
                              @{m: some(md),
                                index: index_mod(md),
-                               mutable glob_imports: ~[],
+                               mutable glob_imports: [],
                                glob_imported_names: s});
           }
           ast::item_native_mod(nmd) {
@@ -203,7 +205,7 @@ fn map_crate(e: &@env, c: &@ast::crate) {
             e.mod_map.insert(i.id,
                              @{m: none::<ast::_mod>,
                                index: index_nmod(nmd),
-                               mutable glob_imports: ~[],
+                               mutable glob_imports: [],
                                glob_imported_names: s});
           }
           _ { }
@@ -237,12 +239,13 @@ fn map_crate(e: &@env, c: &@ast::crate) {
         }
         alt vi.node {
 
+
           //if it really is a glob import, that is
           ast::view_item_import_glob(path, _) {
             let imp = follow_import(*e, sc, path, vi.span);
             if option::is_some(imp) {
                 find_mod(e, sc).glob_imports +=
-                    ~[{def: option::get(imp), item: vi}];
+                    [{def: option::get(imp), item: vi}];
             }
           }
           _ { }
@@ -255,8 +258,7 @@ fn resolve_imports(e: &env) {
              {
         alt it.val {
           todo(node_id, name, path, span, scopes) {
-            resolve_import(e, local_def(node_id),
-                           name, path, span, scopes);
+            resolve_import(e, local_def(node_id), name, path, span, scopes);
           }
           resolved(_, _, _) { }
         }
@@ -318,8 +320,8 @@ fn resolve_names(e: &@env, c: &@ast::crate) {
                 e.def_map.insert(pat.id, option::get(fnd));
               }
               _ {
-                e.sess.span_err
-                    (p.span, "not a tag variant: " + ast::path_name(p));
+                e.sess.span_err(p.span,
+                                "not a tag variant: " + ast::path_name(p));
               }
             }
           }
@@ -349,7 +351,7 @@ fn visit_fn_with_scope(e: &@env, f: &ast::_fn, tp: &[ast::ty_param],
     // is this a main fn declaration?
     alt name {
       some(nm) {
-        if is_main_name(~[nm]) && !e.sess.get_opts().library {
+        if is_main_name([nm]) && !e.sess.get_opts().library {
             // This is a main function -- set it in the session
             // as the main ID
             e.sess.set_main_id(id);
@@ -361,9 +363,7 @@ fn visit_fn_with_scope(e: &@env, f: &ast::_fn, tp: &[ast::ty_param],
     // here's where we need to set up the mapping
     // for f's constrs in the table.
 
-    for c: @ast::constr in f.decl.constraints {
-        resolve_constr(e, c, sc, v);
-    }
+    for c: @ast::constr in f.decl.constraints { resolve_constr(e, c, sc, v); }
     visit::visit_fn(f, tp, sp, name, id,
                     cons(scope_fn(f.decl, f.proto, tp), @sc), v);
 }
@@ -372,24 +372,22 @@ fn visit_block_with_scope(b: &ast::blk, sc: &scopes, v: &vt<scopes>) {
     let pos = @mutable 0u, loc = @mutable 0u;
     let block_sc = cons(scope_block(b, pos, loc), @sc);
     for stmt in b.node.stmts {
-        v.visit_stmt(stmt, block_sc, v);
-        *pos += 1u;
+        v.visit_stmt(stmt, block_sc, v);;
+        *pos += 1u;;
         *loc = 0u;
     }
     visit::visit_expr_opt(b.node.expr, block_sc, v);
 }
 
 fn visit_decl_with_scope(d: &@decl, sc: &scopes, v: &vt<scopes>) {
-    let loc_pos = alt list::car(sc) {
-      scope_block(_, _, pos) { pos }
-      _ { @mutable 0u }
-    };
+    let loc_pos =
+        alt list::car(sc) {
+          scope_block(_, _, pos) { pos }
+          _ { @mutable 0u }
+        };
     alt d.node {
       decl_local(locs) {
-        for loc in locs {
-            v.visit_local(loc, sc, v);
-            *loc_pos += 1u;
-        }
+        for loc in locs { v.visit_local(loc, sc, v);; *loc_pos += 1u; }
       }
       decl_item(it) { v.visit_item(it, sc, v); }
     }
@@ -408,7 +406,7 @@ fn visit_expr_with_scope(x: &@ast::expr, sc: &scopes, v: &vt<scopes>) {
         v.visit_block(blk, new_sc, v);
       }
       ast::expr_fn(f) {
-        visit::visit_expr(x, cons(scope_fn(f.decl, f.proto, ~[]), @sc), v);
+        visit::visit_expr(x, cons(scope_fn(f.decl, f.proto, []), @sc), v);
       }
       _ { visit::visit_expr(x, sc, v); }
     }
@@ -417,12 +415,12 @@ fn visit_expr_with_scope(x: &@ast::expr, sc: &scopes, v: &vt<scopes>) {
 fn follow_import(e: &env, sc: &scopes, path: &[ident], sp: &span) ->
    option::t<def> {
     let path_len = vec::len(path);
-    let dcur = lookup_in_scope_strict(e, sc, sp, path.(0), ns_module);
+    let dcur = lookup_in_scope_strict(e, sc, sp, path[0], ns_module);
     let i = 1u;
     while true && option::is_some(dcur) {
         if i == path_len { break; }
         dcur =
-            lookup_in_mod_strict(e, sc, option::get(dcur), sp, path.(i),
+            lookup_in_mod_strict(e, sc, option::get(dcur), sp, path[i],
                                  ns_module, outside);
         i += 1u;
     }
@@ -461,23 +459,22 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
                   ids: &[ast::ident], sp: &codemap::span, sc_in: &scopes) {
     e.imports.insert(defid.node, resolving(sp));
     let n_idents = vec::len(ids);
-    let end_id = ids.(n_idents - 1u);
+    let end_id = ids[n_idents - 1u];
     // Ignore the current scope if this import would shadow itself.
     let sc =
-        if str::eq(name, ids.(0)) { std::list::cdr(sc_in) } else { sc_in };
+        if str::eq(name, ids[0]) { std::list::cdr(sc_in) } else { sc_in };
     if n_idents == 1u {
         register(e, defid, sp, end_id, sc_in,
                  lookup_in_scope(e, sc, sp, end_id, ns_value),
                  lookup_in_scope(e, sc, sp, end_id, ns_type),
                  lookup_in_scope(e, sc, sp, end_id, ns_module));
         remove_if_unresolved(e.imports, defid.node);
-    } else {
-        let  // FIXME (issue #521)
-            dcur =
-            alt lookup_in_scope(e, sc, sp, ids.(0), ns_module) {
+    } else { // FIXME (issue #521)
+        let dcur =
+            alt lookup_in_scope(e, sc, sp, ids[0], ns_module) {
               some(dcur) { dcur }
               none. {
-                unresolved_err(e, sc, sp, ids.(0), ns_name(ns_module));
+                unresolved_err(e, sc, sp, ids[0], ns_name(ns_module));
                 remove_if_unresolved(e.imports, defid.node);
                 ret ()
               }
@@ -488,20 +485,18 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
                 register(e, defid, sp, end_id, sc_in,
                          lookup_in_mod(e, dcur, sp, end_id, ns_value,
                                        outside),
-                         lookup_in_mod(e, dcur, sp, end_id, ns_type,
-                                       outside),
+                         lookup_in_mod(e, dcur, sp, end_id, ns_type, outside),
                          lookup_in_mod(e, dcur, sp, end_id, ns_module,
                                        outside));
                 remove_if_unresolved(e.imports, defid.node);
                 break;
             } else {
                 dcur =
-                    alt lookup_in_mod(e, dcur, sp, ids.(i), ns_module,
-                                      outside) {
+                    alt lookup_in_mod(e, dcur, sp, ids[i], ns_module, outside)
+                        {
                       some(dcur) { dcur }
                       none. {
-                        unresolved_err(e, sc, sp, ids.(i),
-                                       ns_name(ns_module));
+                        unresolved_err(e, sc, sp, ids[i], ns_name(ns_module));
                         remove_if_unresolved(e.imports, defid.node);
                         ret () // FIXME (issue #521)
                       }
@@ -563,7 +558,7 @@ fn unresolved_err(e: &env, sc: &scopes, sp: &span, name: &ident, kind: &str) {
     for rs: {ident: str, sc: scope} in e.reported {
         if str::eq(rs.ident, name) && err_scope == rs.sc { ret; }
     }
-    e.reported += ~[{ident: name, sc: err_scope}];
+    e.reported += [{ident: name, sc: err_scope}];
     e.sess.span_err(sp, mk_unresolved_msg(name, kind));
 }
 
@@ -572,7 +567,7 @@ fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &str) -> ! {
 }
 
 fn mk_unresolved_msg(id: &ident, kind: &str) -> str {
-    ret #fmt("unresolved %s: %s", kind, id);
+    ret #fmt["unresolved %s: %s", kind, id];
 }
 
 // Lookup helpers
@@ -587,13 +582,13 @@ fn lookup_path_strict(e: &env, sc: &scopes, sp: &span, pth: &ast::path_,
     } else { first_scope = sc; }
 
     let dcur =
-        lookup_in_scope_strict(e, first_scope, sp, pth.idents.(0), headns);
+        lookup_in_scope_strict(e, first_scope, sp, pth.idents[0], headns);
 
     let i = 1u;
     while i < n_idents && option::is_some(dcur) {
         let curns = if n_idents == i + 1u { ns } else { ns_module };
         dcur =
-            lookup_in_mod_strict(e, sc, option::get(dcur), sp, pth.idents.(i),
+            lookup_in_mod_strict(e, sc, option::get(dcur), sp, pth.idents[i],
                                  curns, outside);
         i += 1u;
     }
@@ -630,7 +625,7 @@ fn def_is_obj_field(d: &def) -> bool {
 }
 
 fn def_is_ty_arg(d: &def) -> bool {
-    ret alt d { ast::def_ty_arg(_,_) { true } _ { false } };
+    ret alt d { ast::def_ty_arg(_, _) { true } _ { false } };
 }
 
 fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident,
@@ -675,7 +670,7 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident,
             if ns == ns_value {
                 alt lookup_in_pat(name, local.node.pat) {
                   some(did) { ret some(ast::def_local(did)); }
-                  _ {}
+                  _ { }
                 }
             }
           }
@@ -685,7 +680,7 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident,
           scope_arm(a) {
             if ns == ns_value {
                 ret option::map(ast::def_binding,
-                                lookup_in_pat(name, a.pats.(0)));
+                                lookup_in_pat(name, a.pats[0]));
             }
           }
         }
@@ -736,7 +731,7 @@ fn lookup_in_ty_params(name: &ident, ty_params: &[ast::ty_param]) ->
    option::t<def> {
     let i = 0u;
     for tp: ast::ty_param in ty_params {
-        if str::eq(tp.ident, name) { ret some(ast::def_ty_arg(i,tp.kind)); }
+        if str::eq(tp.ident, name) { ret some(ast::def_ty_arg(i, tp.kind)); }
         i += 1u;
     }
     ret none::<def>;
@@ -746,9 +741,7 @@ fn lookup_in_pat(name: &ident, pat: &@ast::pat) -> option::t<def_id> {
     let found = none;
     for each bound in ast::pat_bindings(pat) {
         let p_name = alt bound.node { ast::pat_bind(n) { n } };
-        if str::eq(p_name, name) {
-            found = some(local_def(bound.id));
-        }
+        if str::eq(p_name, name) { found = some(local_def(bound.id)); }
     }
     ret found;
 }
@@ -791,7 +784,7 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint,
     let i = vec::len(b.stmts);
     while i > 0u {
         i -= 1u;
-        let st = b.stmts.(i);
+        let st = b.stmts[i];
         alt st.node {
           ast::stmt_decl(d, _) {
             alt d.node {
@@ -800,11 +793,11 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint,
                     let j = vec::len(locs);
                     while j > 0u {
                         j -= 1u;
-                        let loc = locs.(j);
+                        let loc = locs[j];
                         if ns == ns_value && (i < pos || j < loc_pos) {
                             alt lookup_in_pat(name, loc.node.pat) {
                               some(did) { ret some(ast::def_local(did)); }
-                              _ {}
+                              _ { }
                             }
                         }
                     }
@@ -817,7 +810,7 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint,
                         if str::eq(it.ident, name) {
                             ret some(ast::def_ty(local_def(it.id)));
                         }
-                    } else if (ns == ns_value) {
+                    } else if ns == ns_value {
                         for v: ast::variant in variants {
                             if str::eq(v.node.name, name) {
                                 let i = v.node.id;
@@ -904,7 +897,7 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace,
 
         let cached = e.ext_cache.find({did: defid, ident: name, ns: ns});
         if !is_none(cached) { ret cached; }
-        let path = ~[name];
+        let path = [name];
         if defid.node != -1 { path = e.ext_map.get(defid) + path; }
         let fnd = lookup_external(e, defid.crate, path, ns);
         if !is_none(fnd) {
@@ -923,8 +916,7 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace,
     }
 }
 
-fn found_view_item(e: &env, vi: @ast::view_item) ->
-   option::t<def> {
+fn found_view_item(e: &env, vi: @ast::view_item) -> option::t<def> {
     alt vi.node {
       ast::view_item_use(_, _, id) {
         let cnum = cstore::get_use_stmt_cnum(e.cstore, id);
@@ -936,8 +928,7 @@ fn found_view_item(e: &env, vi: @ast::view_item) ->
 fn lookup_import(e: &env, defid: def_id, ns: namespace) -> option::t<def> {
     alt e.imports.get(defid.node) {
       todo(node_id, name, path, span, scopes) {
-        resolve_import(e, local_def(node_id),
-                       name, path, span, scopes);
+        resolve_import(e, local_def(node_id), name, path, span, scopes);
         ret lookup_import(e, defid, ns);
       }
       resolving(sp) { e.sess.span_err(sp, "cyclic import"); ret none; }
@@ -998,15 +989,15 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident,
 
         let matches =
             vec::filter_map(bind lookup_in_mod_(e, _, sp, id, ns, dr),
-                             { info.glob_imports });
+                            { info.glob_imports });
         if vec::len(matches) == 0u {
             ret none;
-        } else if (vec::len(matches) == 1u) {
-            ret some(matches.(0).def);
+        } else if vec::len(matches) == 1u {
+            ret some(matches[0].def);
         } else {
             for match: glob_imp_def in matches {
                 let sp = match.item.span;
-                e.sess.span_note(sp, #fmt("'%s' is imported here", id));
+                e.sess.span_note(sp, #fmt["'%s' is imported here", id]);
             }
             e.sess.span_fatal(sp,
                               "'" + id + "' is glob-imported from" +
@@ -1051,7 +1042,7 @@ fn lookup_in_mie(e: &env, mie: &mod_index_entry, ns: namespace) ->
         alt item.node {
           ast::item_tag(variants, _) {
             if ns == ns_value {
-                let vid = variants.(variant_idx).node.id;
+                let vid = variants[variant_idx].node.id;
                 ret some(ast::def_variant(local_def(item.id),
                                           local_def(vid)));
             } else { ret none::<def>; }
@@ -1090,15 +1081,16 @@ fn index_mod(md: &ast::_mod) -> mod_index {
     let index = new_str_hash::<list<mod_index_entry>>();
     for it: @ast::view_item in md.view_items {
         alt it.node {
-          ast::view_item_use(ident, _, _)
-          {
+          ast::view_item_use(ident, _, _) {
             add_to_index(index, ident, mie_view_item(it));
           }
 
+
           ast::view_item_import(ident, _, id) {
             add_to_index(index, ident, mie_import_ident(id, it.span));
           }
 
+
           ast::view_item_import_from(_, idents, _) {
             for ident in idents {
                 add_to_index(index, ident.node.name,
@@ -1106,6 +1098,7 @@ fn index_mod(md: &ast::_mod) -> mod_index {
             }
           }
 
+
           //globbed imports have to be resolved lazily.
           ast::view_item_import_glob(_, _) | ast::view_item_export(_, _) {
           }
@@ -1191,20 +1184,19 @@ fn lookup_external(e: &env, cnum: int, ids: &[ident], ns: namespace) ->
 fn check_for_collisions(e: &@env, c: &ast::crate) {
     // Module indices make checking those relatively simple -- just check each
     // name for multiple entities in the same namespace.
-    for each m: @{key: ast::node_id, val: @indexed_mod}
-        in e.mod_map.items() {
-        for each name: @{key: ident, val: list<mod_index_entry>}
-            in m.val.index.items() {
+    for each m: @{key: ast::node_id, val: @indexed_mod} in e.mod_map.items() {
+        for each name: @{key: ident, val: list<mod_index_entry>} in
+                 m.val.index.items() {
             check_mod_name(*e, name.key, name.val);
         }
     }
     // Other scopes have to be checked the hard way.
-    let v = @{visit_item: bind check_item(e, _, _, _),
-              visit_block: bind check_block(e, _, _, _),
-              visit_arm: bind check_arm(e, _, _, _),
-              visit_expr: bind check_expr(e, _, _, _),
-              visit_ty: bind check_ty(e, _, _, _)
-              with *visit::default_visitor()};
+    let v =
+        @{visit_item: bind check_item(e, _, _, _),
+          visit_block: bind check_block(e, _, _, _),
+          visit_arm: bind check_arm(e, _, _, _),
+          visit_expr: bind check_expr(e, _, _, _),
+          visit_ty: bind check_ty(e, _, _, _) with *visit::default_visitor()};
     visit::visit_crate(c, (), visit::mk_vt(v));
 }
 
@@ -1252,16 +1244,16 @@ fn mie_span(mie: &mod_index_entry) -> span {
 
 fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) {
     fn typaram_names(tps: &[ast::ty_param]) -> [ident] {
-        let x: [ast::ident] = ~[];
-        for tp: ast::ty_param in tps { x += ~[tp.ident] }
+        let x: [ast::ident] = [];
+        for tp: ast::ty_param in tps { x += [tp.ident] }
         ret x;
     }
     visit::visit_item(i, x, v);
     alt i.node {
       ast::item_fn(f, ty_params) {
         check_fn(*e, i.span, f);
-        ensure_unique(*e, i.span, typaram_names(ty_params),
-                      ident_id, "type parameter");
+        ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
+                      "type parameter");
       }
       ast::item_obj(ob, ty_params, _) {
         fn field_name(field: &ast::obj_field) -> ident { ret field.ident; }
@@ -1269,12 +1261,12 @@ fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) {
         for m: @ast::method in ob.methods {
             check_fn(*e, m.span, m.node.meth);
         }
-        ensure_unique(*e, i.span, typaram_names(ty_params),
-                      ident_id, "type parameter");
+        ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
+                      "type parameter");
       }
       ast::item_tag(_, ty_params) {
-        ensure_unique(*e, i.span, typaram_names(ty_params),
-                      ident_id, "type parameter");
+        ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
+                      "type parameter");
       }
       _ { }
     }
@@ -1290,25 +1282,25 @@ fn check_pat(ch: checker, p: &@ast::pat) {
 fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) {
     visit::visit_arm(a, x, v);
     let ch0 = checker(*e, "binding");
-    check_pat(ch0, a.pats.(0));
+    check_pat(ch0, a.pats[0]);
     let seen0 = ch0.seen;
     let i = vec::len(a.pats);
     while i > 1u {
         i -= 1u;
         let ch = checker(*e, "binding");
-        check_pat(ch, a.pats.(i));
+        check_pat(ch, a.pats[i]);
 
         // Ensure the bindings introduced in this pattern are the same as in
         // the first pattern.
         if vec::len(ch.seen) != vec::len(seen0) {
-            e.sess.span_err(a.pats.(i).span,
+            e.sess.span_err(a.pats[i].span,
                             "inconsistent number of bindings");
         } else {
             for name: ident in ch.seen {
                 if is_none(vec::find(bind str::eq(name, _), seen0)) {
                     // Fight the alias checker
                     let name_ = name;
-                    e.sess.span_err(a.pats.(i).span,
+                    e.sess.span_err(a.pats[i].span,
                                     "binding " + name_ +
                                         " does not occur in first pattern");
                 }
@@ -1395,7 +1387,7 @@ fn check_ty(e: &@env, ty: &@ast::ty, x: &(), v: &vt<()>) {
 type checker = @{mutable seen: [ident], kind: str, sess: session};
 
 fn checker(e: &env, kind: str) -> checker {
-    let seen: [ident] = ~[];
+    let seen: [ident] = [];
     ret @{mutable seen: seen, kind: kind, sess: e.sess};
 }
 
@@ -1408,12 +1400,12 @@ fn check_name(ch: &checker, sp: &span, name: &ident) {
 }
 fn add_name(ch: &checker, sp: &span, name: &ident) {
     check_name(ch, sp, name);
-    ch.seen += ~[name];
+    ch.seen += [name];
 }
 
 fn ident_id(i: &ident) -> ident { ret i; }
 
-fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident ,
+fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident,
                     kind: &str) {
     let ch = checker(e, kind);
     for elt: T in elts { add_name(ch, sp, id(elt)); }
diff --git a/src/comp/middle/shape.rs b/src/comp/middle/shape.rs
index e92f7c95ff0..a3d0dbe0b6e 100644
--- a/src/comp/middle/shape.rs
+++ b/src/comp/middle/shape.rs
@@ -34,61 +34,65 @@ import std::str;
 
 import ty_ctxt = middle::ty::ctxt;
 
-type res_info = { did: ast::def_id, t: ty::t };
-
-type ctxt = {
-    mutable next_tag_id: u16,
-    pad: u16,
-    tag_id_to_index: hashmap<ast::def_id,u16>,
-    mutable tag_order: [ast::def_id],
-    resources: interner::interner<res_info>,
-    llshapetablesty: TypeRef,
-    llshapetables: ValueRef
-};
-
-const shape_u8 : u8 = 0u8;
-const shape_u16 : u8 = 1u8;
-const shape_u32 : u8 = 2u8;
-const shape_u64 : u8 = 3u8;
-const shape_i8 : u8 = 4u8;
-const shape_i16 : u8 = 5u8;
-const shape_i32 : u8 = 6u8;
-const shape_i64 : u8 = 7u8;
-const shape_f32 : u8 = 8u8;
-const shape_f64 : u8 = 9u8;
-const shape_evec : u8 = 10u8;
-const shape_ivec : u8 = 11u8;
-const shape_tag : u8 = 12u8;
-const shape_box : u8 = 13u8;
-const shape_struct : u8 = 17u8;
-const shape_fn : u8 = 18u8;
-const shape_obj : u8 = 19u8;
-const shape_res : u8 = 20u8;
-const shape_var : u8 = 21u8;
-const shape_uniq : u8 = 22u8;
+type res_info = {did: ast::def_id, t: ty::t};
+
+type ctxt =
+    {mutable next_tag_id: u16,
+     pad: u16,
+     tag_id_to_index: hashmap<ast::def_id, u16>,
+     mutable tag_order: [ast::def_id],
+     resources: interner::interner<res_info>,
+     llshapetablesty: TypeRef,
+     llshapetables: ValueRef};
+
+const shape_u8: u8 = 0u8;
+const shape_u16: u8 = 1u8;
+const shape_u32: u8 = 2u8;
+const shape_u64: u8 = 3u8;
+const shape_i8: u8 = 4u8;
+const shape_i16: u8 = 5u8;
+const shape_i32: u8 = 6u8;
+const shape_i64: u8 = 7u8;
+const shape_f32: u8 = 8u8;
+const shape_f64: u8 = 9u8;
+const shape_evec: u8 = 10u8;
+const shape_ivec: u8 = 11u8;
+const shape_tag: u8 = 12u8;
+const shape_box: u8 = 13u8;
+const shape_struct: u8 = 17u8;
+const shape_fn: u8 = 18u8;
+const shape_obj: u8 = 19u8;
+const shape_res: u8 = 20u8;
+const shape_var: u8 = 21u8;
+const shape_uniq: u8 = 22u8;
 
 // FIXME: This is a bad API in trans_common.
-fn C_u8(n : u8) -> ValueRef { ret trans_common::C_u8(n as uint); }
+fn C_u8(n: u8) -> ValueRef { ret trans_common::C_u8(n as uint); }
 
-fn hash_res_info(ri : &res_info) -> uint {
+fn hash_res_info(ri: &res_info) -> uint {
     let h = 5381u;
-    h *= 33u; h += (ri.did.crate as uint);
-    h *= 33u; h += (ri.did.node as uint);
-    h *= 33u; h += (ri.t as uint);
+    h *= 33u;
+    h += ri.did.crate as uint;
+    h *= 33u;
+    h += ri.did.node as uint;
+    h *= 33u;
+    h += ri.t as uint;
     ret h;
 }
 
-fn eq_res_info(a : &res_info, b : &res_info) -> bool {
+fn eq_res_info(a: &res_info, b: &res_info) -> bool {
     ret a.did.crate == b.did.crate && a.did.node == b.did.node && a.t == b.t;
 }
 
-fn mk_global(ccx : &@crate_ctxt, name : &str, llval : ValueRef) -> ValueRef {
-    let llglobal = lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval),
-                                                   str::buf(name));
+fn mk_global(ccx: &@crate_ctxt, name: &str, llval: ValueRef) -> ValueRef {
+    let llglobal =
+        lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval),
+                                       str::buf(name));
     lib::llvm::llvm::LLVMSetInitializer(llglobal, llval);
     lib::llvm::llvm::LLVMSetGlobalConstant(llglobal, True);
-    lib::llvm::llvm::LLVMSetLinkage(llglobal, lib::llvm::LLVMInternalLinkage
-                                    as lib::llvm::llvm::Linkage);
+    lib::llvm::llvm::LLVMSetLinkage(llglobal,
+                                    lib::llvm::LLVMInternalLinkage as
+                                        lib::llvm::llvm::Linkage);
     ret llglobal;
 }
 
@@ -99,18 +103,18 @@ fn mk_global(ccx : &@crate_ctxt, name : &str, llval : ValueRef) -> ValueRef {
 //
 // TODO: Use this in dynamic_size_of() as well.
 
-fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] {
+fn largest_variants(ccx: &@crate_ctxt, tag_id: &ast::def_id) -> [uint] {
     // Compute the minimum and maximum size and alignment for each variant.
     //
     // TODO: We could do better here; e.g. we know that any variant that
     // contains (T,T) must be as least as large as any variant that contains
     // just T.
-    let ranges = ~[];
+    let ranges = [];
     let variants = ty::tag_variants(ccx.tcx, tag_id);
-    for variant : ty::variant_info in variants {
+    for variant: ty::variant_info in variants {
         let bounded = true;
-        let { a: min_size, b: min_align } = { a: 0u, b: 0u };
-        for elem_t : ty::t in variant.args {
+        let {a: min_size, b: min_align} = {a: 0u, b: 0u};
+        for elem_t: ty::t in variant.args {
             if ty::type_contains_params(ccx.tcx, elem_t) {
                 // TODO: We could do better here; this causes us to
                 // conservatively assume that (int, T) has minimum size 0,
@@ -123,34 +127,34 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] {
             }
         }
 
-        ranges += ~[{ size:  { min: min_size,  bounded: bounded },
-                      align: { min: min_align, bounded: bounded } }];
+        ranges +=
+            [{size: {min: min_size, bounded: bounded},
+              align: {min: min_align, bounded: bounded}}];
     }
 
     // Initialize the candidate set to contain all variants.
-    let candidates = ~[mutable];
-    for variant in variants { candidates += ~[mutable true]; }
+    let candidates = [mutable];
+    for variant in variants { candidates += [mutable true]; }
 
     // Do a pairwise comparison among all variants still in the candidate set.
     // Throw out any variant that we know has size and alignment at least as
     // small as some other variant.
     let i = 0u;
     while i < vec::len(ranges) - 1u {
-        if candidates.(i) {
+        if candidates[i] {
             let j = i + 1u;
-            while (j < vec::len(ranges)) {
-                if candidates.(j) {
-                    if ranges.(i).size.bounded && ranges.(i).align.bounded &&
-                            ranges.(j).size.bounded &&
-                            ranges.(j).align.bounded {
-                        if ranges.(i).size >= ranges.(j).size &&
-                                ranges.(i).align >= ranges.(j).align {
+            while j < vec::len(ranges) {
+                if candidates[j] {
+                    if ranges[i].size.bounded && ranges[i].align.bounded &&
+                           ranges[j].size.bounded && ranges[j].align.bounded {
+                        if ranges[i].size >= ranges[j].size &&
+                               ranges[i].align >= ranges[j].align {
                             // Throw out j.
-                            candidates.(j) = false;
-                        } else if ranges.(j).size >= ranges.(i).size &&
-                                ranges.(j).align >= ranges.(j).align {
+                            candidates[j] = false;
+                        } else if ranges[j].size >= ranges[i].size &&
+                                      ranges[j].align >= ranges[j].align {
                             // Throw out i.
-                            candidates.(i) = false;
+                            candidates[i] = false;
                         }
                     }
                 }
@@ -161,10 +165,10 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] {
     }
 
     // Return the resulting set.
-    let result = ~[];
+    let result = [];
     i = 0u;
     while i < vec::len(candidates) {
-        if candidates.(i) { result += ~[i]; }
+        if candidates[i] { result += [i]; }
         i += 1u;
     }
     ret result;
@@ -175,23 +179,24 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] {
 //
 // TODO: Migrate trans over to use this.
 
-fn round_up(size : u16, align : u8) -> u16 {
-    assert align >= 1u8;
+fn round_up(size: u16, align: u8) -> u16 {
+    assert (align >= 1u8);
     let alignment = align as u16;
-    ret ((size-1u16) + alignment) & !(alignment-1u16);
+    ret size - 1u16 + alignment & !(alignment - 1u16);
 }
 
-type size_align = { size: u16, align: u8 };
+type size_align = {size: u16, align: u8};
 
-fn compute_static_tag_size(ccx : &@crate_ctxt, largest_variants : &[uint],
-                           did : &ast::def_id) -> size_align {
-    let max_size = 0u16; let max_align = 1u8;
+fn compute_static_tag_size(ccx: &@crate_ctxt, largest_variants: &[uint],
+                           did: &ast::def_id) -> size_align {
+    let max_size = 0u16;
+    let max_align = 1u8;
     let variants = ty::tag_variants(ccx.tcx, did);
-    for vid : uint in largest_variants {
+    for vid: uint in largest_variants {
         // We increment a "virtual data pointer" to compute the size.
-        let lltys = ~[];
-        for typ : ty::t in variants.(vid).args {
-            lltys += ~[trans::type_of(ccx, dummy_sp(), typ)];
+        let lltys = [];
+        for typ: ty::t in variants[vid].args {
+            lltys += [trans::type_of(ccx, dummy_sp(), typ)];
         }
 
         let llty = trans_common::T_struct(lltys);
@@ -205,24 +210,17 @@ fn compute_static_tag_size(ccx : &@crate_ctxt, largest_variants : &[uint],
     // Add space for the tag if applicable.
     // FIXME (issue #792): This is wrong. If the tag starts with an 8 byte
     // aligned quantity, we don't align it.
-    if vec::len(variants) > 1u {
-        max_size += 4u16;
-        max_align = 4u8;
-    }
+    if vec::len(variants) > 1u { max_size += 4u16; max_align = 4u8; }
 
-    ret { size: max_size, align: max_align };
+    ret {size: max_size, align: max_align};
 }
 
-tag tag_kind {
-    tk_unit;
-    tk_enum;
-    tk_complex;
-}
+tag tag_kind { tk_unit; tk_enum; tk_complex; }
 
-fn tag_kind(ccx : &@crate_ctxt, did : &ast::def_id) -> tag_kind {
+fn tag_kind(ccx: &@crate_ctxt, did: &ast::def_id) -> tag_kind {
     let variants = ty::tag_variants(ccx.tcx, did);
     if vec::len(variants) == 0u { ret tk_complex; }
-    for v : ty::variant_info in variants {
+    for v: ty::variant_info in variants {
         if vec::len(v.args) > 0u { ret tk_complex; }
     }
     if vec::len(variants) == 1u { ret tk_unit; }
@@ -231,92 +229,101 @@ fn tag_kind(ccx : &@crate_ctxt, did : &ast::def_id) -> tag_kind {
 
 
 // Returns the code corresponding to the pointer size on this architecture.
-fn s_int(_tcx : &ty_ctxt) -> u8 {
-    ret shape_i32;      // TODO: x86-64
+fn s_int(_tcx: &ty_ctxt) -> u8 {
+    ret shape_i32; // TODO: x86-64
 }
 
-fn s_uint(_tcx : &ty_ctxt) -> u8 {
-    ret shape_u32;      // TODO: x86-64
+fn s_uint(_tcx: &ty_ctxt) -> u8 {
+    ret shape_u32; // TODO: x86-64
 }
 
-fn s_float(_tcx : &ty_ctxt) -> u8 {
-    ret shape_f64;      // TODO: x86-64
+fn s_float(_tcx: &ty_ctxt) -> u8 {
+    ret shape_f64; // TODO: x86-64
 }
 
-fn mk_ctxt(llmod : ModuleRef) -> ctxt {
+fn mk_ctxt(llmod: ModuleRef) -> ctxt {
     let llshapetablesty = trans_common::T_named_struct("shapes");
     let llshapetables =
         lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty,
                                        str::buf("shapes"));
 
-    ret {
-        mutable next_tag_id: 0u16,
-        pad: 0u16,
-        tag_id_to_index: common::new_def_hash(),
-        mutable tag_order: ~[],
-        resources: interner::mk(hash_res_info, eq_res_info),
-        llshapetablesty: llshapetablesty,
-        llshapetables: llshapetables
-    };
+    ret {mutable next_tag_id: 0u16,
+         pad: 0u16,
+         tag_id_to_index: common::new_def_hash(),
+         mutable tag_order: [],
+         resources: interner::mk(hash_res_info, eq_res_info),
+         llshapetablesty: llshapetablesty,
+         llshapetables: llshapetables};
 }
 
-fn add_bool(dest : &mutable [u8], val : bool) {
-    dest += ~[if val { 1u8 } else { 0u8 }];
+fn add_bool(dest: &mutable [u8], val: bool) {
+    dest += [if val { 1u8 } else { 0u8 }];
 }
 
-fn add_u16(dest : &mutable [u8], val : u16) {
-    dest += ~[(val & 0xffu16) as u8, (val >> 8u16) as u8];
+fn add_u16(dest: &mutable [u8], val: u16) {
+    dest += [val & 0xffu16 as u8, val >> 8u16 as u8];
 }
 
-fn add_substr(dest : &mutable [u8], src : &[u8]) {
+fn add_substr(dest: &mutable [u8], src: &[u8]) {
     add_u16(dest, vec::len(src) as u16);
     dest += src;
 }
 
-fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] {
-    let s = ~[];
+fn shape_of(ccx: &@crate_ctxt, t: ty::t) -> [u8] {
+    let s = [];
 
     alt ty::struct(ccx.tcx, t) {
       ty::ty_nil. | ty::ty_bool. | ty::ty_machine(ast::ty_u8.) | ty::ty_bot. {
-        s += ~[shape_u8];
+        s += [shape_u8];
+      }
+
+
+      ty::ty_int. {
+        s += [s_int(ccx.tcx)];
       }
+      ty::ty_float. { s += [s_float(ccx.tcx)]; }
 
-      ty::ty_int. { s += ~[s_int(ccx.tcx)]; }
-      ty::ty_float. { s += ~[s_float(ccx.tcx)]; }
 
       ty::ty_uint. | ty::ty_ptr(_) | ty::ty_type. | ty::ty_native(_) {
-        s += ~[s_uint(ccx.tcx)];
+        s += [s_uint(ccx.tcx)];
       }
 
-      ty::ty_machine(ast::ty_i8.) { s += ~[shape_i8]; }
-      ty::ty_machine(ast::ty_u16.) { s += ~[shape_u16]; }
-      ty::ty_machine(ast::ty_i16.) { s += ~[shape_i16]; }
-      ty::ty_machine(ast::ty_u32.) | ty::ty_char. { s += ~[shape_u32]; }
-      ty::ty_machine(ast::ty_i32.) { s += ~[shape_i32]; }
-      ty::ty_machine(ast::ty_u64.) { s += ~[shape_u64]; }
-      ty::ty_machine(ast::ty_i64.) { s += ~[shape_i64]; }
 
-      ty::ty_str. { s += ~[shape_evec, 1u8, 1u8, 0u8, shape_u8]; }
-      ty::ty_istr. { s += ~[shape_ivec, 1u8, 1u8, 0u8, shape_u8]; }
+      ty::ty_machine(ast::ty_i8.) {
+        s += [shape_i8];
+      }
+      ty::ty_machine(ast::ty_u16.) { s += [shape_u16]; }
+      ty::ty_machine(ast::ty_i16.) { s += [shape_i16]; }
+      ty::ty_machine(ast::ty_u32.) | ty::ty_char. { s += [shape_u32]; }
+      ty::ty_machine(ast::ty_i32.) { s += [shape_i32]; }
+      ty::ty_machine(ast::ty_u64.) { s += [shape_u64]; }
+      ty::ty_machine(ast::ty_i64.) { s += [shape_i64]; }
+
+
+      ty::ty_str. {
+        s += [shape_evec, 1u8, 1u8, 0u8, shape_u8];
+      }
+      ty::ty_istr. { s += [shape_ivec, 1u8, 1u8, 0u8, shape_u8]; }
+
 
       ty::ty_tag(did, tps) {
         alt tag_kind(ccx, did) {
           tk_unit. {
             // FIXME: For now we do this.
-            s += ~[shape_u32];
+            s += [shape_u32];
           }
-          tk_enum. { s += ~[shape_u32]; }
+          tk_enum. { s += [shape_u32]; }
           tk_complex. {
-            s += ~[shape_tag];
+            s += [shape_tag];
 
-            let sub = ~[];
+            let sub = [];
 
             let id;
             alt ccx.shape_cx.tag_id_to_index.find(did) {
               none. {
                 id = ccx.shape_cx.next_tag_id;
                 ccx.shape_cx.tag_id_to_index.insert(did, id);
-                ccx.shape_cx.tag_order += ~[did];
+                ccx.shape_cx.tag_order += [did];
                 ccx.shape_cx.next_tag_id += 1u16;
               }
               some(existing_id) { id = existing_id; }
@@ -324,7 +331,7 @@ fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] {
             add_u16(sub, id as u16);
 
             add_u16(sub, vec::len(tps) as u16);
-            for tp : ty::t in tps {
+            for tp: ty::t in tps {
                 let subshape = shape_of(ccx, tp);
                 add_u16(sub, vec::len(subshape) as u16);
                 sub += subshape;
@@ -335,91 +342,97 @@ fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] {
         }
       }
 
+
       ty::ty_box(mt) {
-        s += ~[shape_box];
+        s += [shape_box];
         add_substr(s, shape_of(ccx, mt.ty));
       }
       ty::ty_uniq(subt) {
-        s += ~[shape_uniq];
+        s += [shape_uniq];
         add_substr(s, shape_of(ccx, subt));
       }
       ty::ty_vec(mt) {
-        s += ~[shape_ivec];
+        s += [shape_ivec];
         add_bool(s, ty::type_is_pod(ccx.tcx, mt.ty));
         add_size_hint(ccx, s, mt.ty);
         add_substr(s, shape_of(ccx, mt.ty));
       }
       ty::ty_rec(fields) {
-        s += ~[shape_struct];
-        let sub = ~[];
-        for f : field in fields { sub += shape_of(ccx, f.mt.ty); }
+        s += [shape_struct];
+        let sub = [];
+        for f: field in fields { sub += shape_of(ccx, f.mt.ty); }
         add_substr(s, sub);
       }
       ty::ty_tup(elts) {
-        s += ~[shape_struct];
-        let sub = ~[];
+        s += [shape_struct];
+        let sub = [];
         for elt in elts { sub += shape_of(ccx, elt); }
         add_substr(s, sub);
       }
 
-      ty::ty_fn(_,_,_,_,_) { s += ~[shape_fn]; }
-      ty::ty_native_fn(_,_,_) { s += ~[shape_u32]; }
-      ty::ty_obj(_) { s += ~[shape_obj]; }
+
+      ty::ty_fn(_, _, _, _, _) {
+        s += [shape_fn];
+      }
+      ty::ty_native_fn(_, _, _) { s += [shape_u32]; }
+      ty::ty_obj(_) { s += [shape_obj]; }
+
 
       ty::ty_res(did, raw_subt, tps) {
         let subt = ty::substitute_type_params(ccx.tcx, tps, raw_subt);
-        let ri = { did: did, t: subt };
+        let ri = {did: did, t: subt};
         let id = interner::intern(ccx.shape_cx.resources, ri);
 
-        s += ~[shape_res];
+        s += [shape_res];
         add_u16(s, id as u16);
         add_u16(s, vec::len(tps) as u16);
 
-        let sub = ~[];
-        for tp : ty::t in tps { add_substr(s, sub); }
+        let sub = [];
+        for tp: ty::t in tps { add_substr(s, sub); }
         add_substr(s, sub);
 
         add_substr(s, shape_of(ccx, subt));
 
       }
 
-      ty::ty_var(n) { fail "shape_of ty_var"; }
-      ty::ty_param(n,_) { s += ~[shape_var, n as u8]; }
+
+      ty::ty_var(n) {
+        fail "shape_of ty_var";
+      }
+      ty::ty_param(n, _) { s += [shape_var, n as u8]; }
     }
 
     ret s;
 }
 
-fn add_size_hint(ccx : &@crate_ctxt, s : &mutable [u8], typ : ty::t) {
-    if (ty::type_has_dynamic_size(ccx.tcx, typ)) {
-        s += ~[ 0u8, 0u8, 0u8 ];
-        ret;
-    }
+fn add_size_hint(ccx: &@crate_ctxt, s: &mutable [u8], typ: ty::t) {
+    if ty::type_has_dynamic_size(ccx.tcx, typ) { s += [0u8, 0u8, 0u8]; ret; }
 
     let llty = trans::type_of(ccx, dummy_sp(), typ);
     add_u16(s, trans::llsize_of_real(ccx, llty) as u16);
-    s += ~[ trans::llalign_of_real(ccx, llty) as u8 ];
+    s += [trans::llalign_of_real(ccx, llty) as u8];
 }
 
 // FIXME: We might discover other variants as we traverse these. Handle this.
-fn shape_of_variant(ccx : &@crate_ctxt, v : &ty::variant_info) -> [u8] {
-    let s = ~[];
-    for t : ty::t in v.args { s += shape_of(ccx, t); }
+fn shape_of_variant(ccx: &@crate_ctxt, v: &ty::variant_info) -> [u8] {
+    let s = [];
+    for t: ty::t in v.args { s += shape_of(ccx, t); }
     ret s;
 }
 
-fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef {
+fn gen_tag_shapes(ccx: &@crate_ctxt) -> ValueRef {
     // Loop over all the tag variants and write their shapes into a data
     // buffer. As we do this, it's possible for us to discover new tags, so we
     // must do this first.
     let i = 0u;
-    let data = ~[]; let offsets = ~[];
-    while (i < vec::len(ccx.shape_cx.tag_order)) {
-        let did = ccx.shape_cx.tag_order.(i);
+    let data = [];
+    let offsets = [];
+    while i < vec::len(ccx.shape_cx.tag_order) {
+        let did = ccx.shape_cx.tag_order[i];
         let variants = ty::tag_variants(ccx.tcx, did);
 
-        for v : ty::variant_info in variants {
-            offsets += ~[vec::len(data) as u16];
+        for v: ty::variant_info in variants {
+            offsets += [vec::len(data) as u16];
 
             let variant_shape = shape_of_variant(ccx, v);
             add_substr(data, variant_shape);
@@ -432,13 +445,14 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef {
     // info records for each tag) and the info space (which contains offsets
     // to each variant shape). As we do so, build up the header.
 
-    let header = ~[]; let info = ~[];
+    let header = [];
+    let info = [];
     let header_sz = 2u16 * ccx.shape_cx.next_tag_id;
     let data_sz = vec::len(data) as u16;
 
     let info_sz = 0u16;
-    for did_ : ast::def_id in ccx.shape_cx.tag_order {
-        let did = did_;    // Satisfy alias checker.
+    for did_: ast::def_id in ccx.shape_cx.tag_order {
+        let did = did_; // Satisfy alias checker.
         let variants = ty::tag_variants(ccx.tcx, did);
         add_u16(header, header_sz + info_sz);
         info_sz += 2u16 * ((vec::len(variants) as u16) + 2u16) + 3u16;
@@ -448,25 +462,25 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef {
     // variant. Also construct the largest-variant table for each tag, which
     // contains the variants that the size-of operation needs to look at.
 
-    let lv_table = ~[];
+    let lv_table = [];
     i = 0u;
-    for did_ : ast::def_id in ccx.shape_cx.tag_order {
-        let did = did_;    // Satisfy alias checker.
+    for did_: ast::def_id in ccx.shape_cx.tag_order {
+        let did = did_; // Satisfy alias checker.
         let variants = ty::tag_variants(ccx.tcx, did);
         add_u16(info, vec::len(variants) as u16);
 
         // Construct the largest-variants table.
-        add_u16(info, header_sz + info_sz + data_sz +
-                (vec::len(lv_table) as u16));
+        add_u16(info,
+                header_sz + info_sz + data_sz + (vec::len(lv_table) as u16));
 
         let lv = largest_variants(ccx, did);
         add_u16(lv_table, vec::len(lv) as u16);
-        for v : uint in lv { add_u16(lv_table, v as u16); }
+        for v: uint in lv { add_u16(lv_table, v as u16); }
 
         // Determine whether the tag has dynamic size.
         let dynamic = false;
-        for variant : ty::variant_info in variants {
-            for typ : ty::t in variant.args {
+        for variant: ty::variant_info in variants {
+            for typ: ty::t in variant.args {
                 if ty::type_has_dynamic_size(ccx.tcx, typ) { dynamic = true; }
             }
         }
@@ -475,24 +489,22 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef {
         // Otherwise, write a placeholder.
         let size_align;
         if dynamic {
-            size_align = { size: 0u16, align: 0u8 };
-        } else {
-            size_align = compute_static_tag_size(ccx, lv, did);
-        }
+            size_align = {size: 0u16, align: 0u8};
+        } else { size_align = compute_static_tag_size(ccx, lv, did); }
         add_u16(info, size_align.size);
-        info += ~[size_align.align];
+        info += [size_align.align];
 
         // Now write in the offset of each variant.
-        for v : ty::variant_info in variants {
-            add_u16(info, header_sz + info_sz + offsets.(i));
+        for v: ty::variant_info in variants {
+            add_u16(info, header_sz + info_sz + offsets[i]);
             i += 1u;
         }
     }
 
     assert (i == vec::len(offsets));
-    assert (header_sz == (vec::len(header) as u16));
-    assert (info_sz == (vec::len(info) as u16));
-    assert (data_sz == (vec::len(data) as u16));
+    assert (header_sz == vec::len(header) as u16);
+    assert (info_sz == vec::len(info) as u16);
+    assert (data_sz == vec::len(data) as u16);
 
     header += info;
     header += data;
@@ -501,32 +513,33 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef {
     ret mk_global(ccx, "tag_shapes", C_bytes(header));
 }
 
-fn gen_resource_shapes(ccx : &@crate_ctxt) -> ValueRef {
-    let dtors = ~[];
+fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef {
+    let dtors = [];
     let i = 0u;
     let len = interner::len(ccx.shape_cx.resources);
     while i < len {
         let ri = interner::get(ccx.shape_cx.resources, i);
-        dtors += ~[trans_common::get_res_dtor(ccx, dummy_sp(), ri.did, ri.t)];
+        dtors += [trans_common::get_res_dtor(ccx, dummy_sp(), ri.did, ri.t)];
         i += 1u;
     }
 
     ret mk_global(ccx, "resource_shapes", C_struct(dtors));
 }
 
-fn gen_shape_tables(ccx : &@crate_ctxt) {
+fn gen_shape_tables(ccx: &@crate_ctxt) {
     let lltagstable = gen_tag_shapes(ccx);
     let llresourcestable = gen_resource_shapes(ccx);
     trans_common::set_struct_body(ccx.shape_cx.llshapetablesty,
-                                  ~[val_ty(lltagstable),
-                                    val_ty(llresourcestable)]);
+                                  [val_ty(lltagstable),
+                                   val_ty(llresourcestable)]);
 
-    let lltables = C_named_struct(ccx.shape_cx.llshapetablesty,
-                                  ~[lltagstable, llresourcestable]);
+    let lltables =
+        C_named_struct(ccx.shape_cx.llshapetablesty,
+                       [lltagstable, llresourcestable]);
     lib::llvm::llvm::LLVMSetInitializer(ccx.shape_cx.llshapetables, lltables);
     lib::llvm::llvm::LLVMSetGlobalConstant(ccx.shape_cx.llshapetables, True);
     lib::llvm::llvm::LLVMSetLinkage(ccx.shape_cx.llshapetables,
                                     lib::llvm::LLVMInternalLinkage as
-                                    lib::llvm::llvm::Linkage);
+                                        lib::llvm::llvm::Linkage);
 }
 
diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs
index f587b842986..4c51c34d26a 100644
--- a/src/comp/middle/trans.rs
+++ b/src/comp/middle/trans.rs
@@ -89,15 +89,16 @@ fn type_of(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef {
 
 fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) ->
    [TypeRef] {
-    let atys: [TypeRef] = ~[];
+    let atys: [TypeRef] = [];
     for arg: ty::arg in inputs {
         let t: TypeRef = type_of_inner(cx, sp, arg.ty);
-        t = alt arg.mode {
-          ty::mo_alias(_) { T_ptr(t) }
-          ty::mo_move. { T_ptr(t) }
-          _ { t }
-        };
-        atys += ~[t];
+        t =
+            alt arg.mode {
+              ty::mo_alias(_) { T_ptr(t) }
+              ty::mo_move. { T_ptr(t) }
+              _ { t }
+            };
+        atys += [t];
     }
     ret atys;
 }
@@ -112,35 +113,30 @@ fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) ->
 fn type_of_fn_full(cx: &@crate_ctxt, sp: &span, proto: ast::proto,
                    is_method: bool, inputs: &[ty::arg], output: &ty::t,
                    ty_param_count: uint) -> TypeRef {
-    let atys: [TypeRef] = ~[];
+    let atys: [TypeRef] = [];
 
     // Arg 0: Output pointer.
-    atys += ~[T_ptr(type_of_inner(cx, sp, output))];
+    atys += [T_ptr(type_of_inner(cx, sp, output))];
 
     // Arg 1: task pointer.
-    atys += ~[T_taskptr(*cx)];
+    atys += [T_taskptr(*cx)];
 
     // Arg 2: Env (closure-bindings / self-obj)
     if is_method {
-        atys += ~[T_ptr(cx.rust_object_type)];
-    } else { atys += ~[T_opaque_closure_ptr(*cx)]; }
+        atys += [T_ptr(cx.rust_object_type)];
+    } else { atys += [T_opaque_closure_ptr(*cx)]; }
 
     // Args >3: ty params, if not acquired via capture...
     if !is_method {
         let i = 0u;
-        while i < ty_param_count {
-            atys += ~[T_ptr(cx.tydesc_type)];
-            i += 1u;
-        }
+        while i < ty_param_count { atys += [T_ptr(cx.tydesc_type)]; i += 1u; }
     }
     if proto == ast::proto_iter {
         // If it's an iter, the 'output' type of the iter is actually the
         // *input* type of the function we're given as our iter-block
         // argument.
-        atys +=
-            ~[type_of_inner(cx, sp, ty::mk_iter_body_fn(cx.tcx, output))];
+        atys += [type_of_inner(cx, sp, ty::mk_iter_body_fn(cx.tcx, output))];
     }
-
     // ... then explicit args.
     atys += type_of_explicit_args(cx, sp, inputs);
     ret T_fn(atys, llvm::LLVMVoidType());
@@ -153,26 +149,21 @@ fn type_of_fn(cx: &@crate_ctxt, sp: &span, proto: ast::proto,
 }
 
 // Given a function type and a count of ty params, construct an llvm type
-fn type_of_fn_from_ty(cx: &@crate_ctxt, sp: &span,
-                      fty: &ty::t, ty_param_count: uint) -> TypeRef {
-    ret type_of_fn(cx, sp,
-                   ty::ty_fn_proto(cx.tcx, fty),
-                   ty::ty_fn_args(cx.tcx, fty),
-                   ty::ty_fn_ret(cx.tcx, fty),
+fn type_of_fn_from_ty(cx: &@crate_ctxt, sp: &span, fty: &ty::t,
+                      ty_param_count: uint) -> TypeRef {
+    ret type_of_fn(cx, sp, ty::ty_fn_proto(cx.tcx, fty),
+                   ty::ty_fn_args(cx.tcx, fty), ty::ty_fn_ret(cx.tcx, fty),
                    ty_param_count);
 }
 
 fn type_of_native_fn(cx: &@crate_ctxt, sp: &span, abi: ast::native_abi,
                      inputs: &[ty::arg], output: &ty::t, ty_param_count: uint)
    -> TypeRef {
-    let atys: [TypeRef] = ~[];
+    let atys: [TypeRef] = [];
     if abi == ast::native_abi_rust {
-        atys += ~[T_taskptr(*cx)];
+        atys += [T_taskptr(*cx)];
         let i = 0u;
-        while i < ty_param_count {
-            atys += ~[T_ptr(cx.tydesc_type)];
-            i += 1u;
-        }
+        while i < ty_param_count { atys += [T_ptr(cx.tydesc_type)]; i += 1u; }
     }
     atys += type_of_explicit_args(cx, sp, inputs);
     ret T_fn(atys, type_of_inner(cx, sp, output));
@@ -221,9 +212,9 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef {
       }
       ty::ty_ptr(mt) { llty = T_ptr(type_of_inner(cx, sp, mt.ty)); }
       ty::ty_rec(fields) {
-        let tys: [TypeRef] = ~[];
+        let tys: [TypeRef] = [];
         for f: ty::field in fields {
-            tys += ~[type_of_inner(cx, sp, f.mt.ty)];
+            tys += [type_of_inner(cx, sp, f.mt.ty)];
         }
         llty = T_struct(tys);
       }
@@ -237,7 +228,7 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef {
       ty::ty_obj(meths) { llty = cx.rust_object_type; }
       ty::ty_res(_, sub, tps) {
         let sub1 = ty::substitute_type_params(cx.tcx, tps, sub);
-        ret T_struct(~[T_i32(), type_of_inner(cx, sp, sub1)]);
+        ret T_struct([T_i32(), type_of_inner(cx, sp, sub1)]);
       }
       ty::ty_var(_) {
         cx.tcx.sess.span_fatal(sp, "trans::type_of called on ty_var");
@@ -245,10 +236,8 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef {
       ty::ty_param(_, _) { llty = T_typaram(cx.tn); }
       ty::ty_type. { llty = T_ptr(cx.tydesc_type); }
       ty::ty_tup(elts) {
-        let tys = ~[];
-        for elt in elts {
-            tys += ~[type_of_inner(cx, sp, elt)];
-        }
+        let tys = [];
+        for elt in elts { tys += [type_of_inner(cx, sp, elt)]; }
         llty = T_struct(tys);
       }
     }
@@ -275,8 +264,8 @@ fn type_of_ty_param_kinds_and_ty(lcx: @local_ctxt, sp: &span,
                                  tpt: &ty::ty_param_kinds_and_ty) -> TypeRef {
     alt ty::struct(lcx.ccx.tcx, tpt.ty) {
       ty::ty_fn(_, _, _, _, _) {
-        let llfnty = type_of_fn_from_ty(lcx.ccx, sp, tpt.ty,
-                                        std::vec::len(tpt.kinds));
+        let llfnty =
+            type_of_fn_from_ty(lcx.ccx, sp, tpt.ty, std::vec::len(tpt.kinds));
         ret T_fn_pair(*lcx.ccx, llfnty);
       }
       _ {
@@ -309,7 +298,7 @@ fn sanitize(s: &str) -> str {
                     if c != 10u8 && c != '}' as u8 && c != ')' as u8 &&
                            c != ' ' as u8 && c != '\t' as u8 && c != ';' as u8
                        {
-                        let v = ~[c];
+                        let v = [c];
                         result += str::unsafe_from_bytes(v);
                     }
                 }
@@ -325,7 +314,7 @@ fn log_fn_time(ccx: &@crate_ctxt, name: str, start: &time::timeval,
     let elapsed =
         1000 * (end.sec - start.sec as int) +
             ((end.usec as int) - (start.usec as int)) / 1000;
-    *ccx.stats.fn_times += ~[{ident: name, time: elapsed}];
+    *ccx.stats.fn_times += [{ident: name, time: elapsed}];
 }
 
 
@@ -359,7 +348,7 @@ fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) ->
 }
 
 fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &str) -> ValueRef {
-    ret decl_cdecl_fn(llmod, s, T_fn(~[T_taskptr(cx)], T_void()));
+    ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(cx)], T_void()));
 }
 
 fn get_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef,
@@ -387,26 +376,25 @@ fn get_simple_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef,
 }
 
 fn trans_native_call(b: &builder, externs: &hashmap<str, ValueRef>,
-                     llmod: ModuleRef, name: &str,
-                     args: &[ValueRef]) -> ValueRef {
+                     llmod: ModuleRef, name: &str, args: &[ValueRef]) ->
+   ValueRef {
     let n: int = std::vec::len::<ValueRef>(args) as int;
     let llnative: ValueRef = get_simple_extern_fn(externs, llmod, name, n);
-    let call_args: [ValueRef] = ~[];
-    for a: ValueRef in args { call_args += ~[b.ZExtOrBitCast(a, T_int())]; }
+    let call_args: [ValueRef] = [];
+    for a: ValueRef in args { call_args += [b.ZExtOrBitCast(a, T_int())]; }
     ret b.Call(llnative, call_args);
 }
 
 fn trans_non_gc_free(cx: &@block_ctxt, v: ValueRef) -> result {
     cx.build.Call(bcx_ccx(cx).upcalls.free,
-                  ~[cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8())),
-                    C_int(0)]);
+                  [cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8())),
+                   C_int(0)]);
     ret rslt(cx, C_int(0));
 }
 
 fn trans_shared_free(cx: &@block_ctxt, v: ValueRef) -> result {
     cx.build.Call(bcx_ccx(cx).upcalls.shared_free,
-                  ~[cx.fcx.lltaskptr,
-                    cx.build.PointerCast(v, T_ptr(T_i8()))]);
+                  [cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8()))]);
     ret rslt(cx, C_int(0));
 }
 
@@ -470,24 +458,24 @@ fn array_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef) -> ValueRef {
     let builder = new_builder(cx.fcx.lldynamicallocas);
     let lltaskptr = bcx_fcx(bcx).lltaskptr;
     alt bcx_fcx(cx).llobstacktoken {
-        none. {
-            bcx_fcx(cx).llobstacktoken =
-                some(mk_obstack_token(bcx_ccx(cx), cx.fcx.lldynamicallocas,
-                                      lltaskptr));
-        }
-        some(_) { /* no-op */ }
+      none. {
+        bcx_fcx(cx).llobstacktoken =
+            some(mk_obstack_token(bcx_ccx(cx), cx.fcx.lldynamicallocas,
+                                  lltaskptr));
+      }
+      some(_) {/* no-op */ }
     }
 
     let dynastack_alloc = bcx_ccx(bcx).upcalls.dynastack_alloc;
     let llsz = builder.Mul(C_uint(llsize_of_real(bcx_ccx(bcx), t)), n);
-    let llresult = builder.Call(dynastack_alloc, ~[lltaskptr, llsz]);
+    let llresult = builder.Call(dynastack_alloc, [lltaskptr, llsz]);
     ret builder.PointerCast(llresult, T_ptr(t));
 }
 
 fn mk_obstack_token(ccx: &@crate_ctxt, lldynamicallocas: BasicBlockRef,
                     lltaskptr: ValueRef) -> ValueRef {
     let builder = new_builder(lldynamicallocas);
-    ret builder.Call(ccx.upcalls.dynastack_mark, ~[lltaskptr]);
+    ret builder.Call(ccx.upcalls.dynastack_mark, [lltaskptr]);
 }
 
 
@@ -502,21 +490,18 @@ fn simplify_type(ccx: &@crate_ctxt, typ: &ty::t) -> ty::t {
           ty::ty_uniq(_) { ret ty::mk_uniq(ccx.tcx, ty::mk_nil(ccx.tcx)); }
           ty::ty_fn(_, _, _, _, _) {
             ret ty::mk_tup(ccx.tcx,
-                           ~[ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)),
-                             ty::mk_imm_box(ccx.tcx,
-                                            ty::mk_nil(ccx.tcx))]);
+                           [ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)),
+                            ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx))]);
           }
           ty::ty_obj(_) {
             ret ty::mk_tup(ccx.tcx,
-                               ~[ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)),
-                                 ty::mk_imm_box(ccx.tcx,
-                                                ty::mk_nil(ccx.tcx))]);
+                           [ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)),
+                            ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx))]);
           }
           ty::ty_res(_, sub, tps) {
             let sub1 = ty::substitute_type_params(ccx.tcx, tps, sub);
             ret ty::mk_tup(ccx.tcx,
-                               ~[ty::mk_int(ccx.tcx),
-                                 simplify_type(ccx, sub1)]);
+                           [ty::mk_int(ccx.tcx), simplify_type(ccx, sub1)]);
           }
           _ { ret typ; }
         }
@@ -540,8 +525,7 @@ fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> uint {
         let max_size = 0u;
         let variants = ty::tag_variants(cx.tcx, tid);
         for variant: ty::variant_info in variants {
-            let tup_ty =
-                simplify_type(cx, ty::mk_tup(cx.tcx, variant.args));
+            let tup_ty = simplify_type(cx, ty::mk_tup(cx.tcx, variant.args));
             // Perform any type parameter substitutions.
 
             tup_ty = ty::substitute_type_params(cx.tcx, subtys, tup_ty);
@@ -586,18 +570,18 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result {
         ret rslt(bcx, off);
     }
     alt ty::struct(bcx_tcx(cx), t) {
-      ty::ty_param(p,_) {
+      ty::ty_param(p, _) {
         let szptr = field_of_tydesc(cx, t, false, abi::tydesc_field_size);
         ret rslt(szptr.bcx, szptr.bcx.build.Load(szptr.val));
       }
       ty::ty_rec(flds) {
-        let tys: [ty::t] = ~[];
-        for f: ty::field in flds { tys += ~[f.mt.ty]; }
+        let tys: [ty::t] = [];
+        for f: ty::field in flds { tys += [f.mt.ty]; }
         ret align_elements(cx, tys);
       }
       ty::ty_tup(elts) {
-        let tys = ~[];
-        for tp in elts { tys += ~[tp]; }
+        let tys = [];
+        for tp in elts { tys += [tp]; }
         ret align_elements(cx, tys);
       }
       ty::ty_tag(tid, tps) {
@@ -611,10 +595,10 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result {
             // Perform type substitution on the raw argument types.
 
             let raw_tys: [ty::t] = variant.args;
-            let tys: [ty::t] = ~[];
+            let tys: [ty::t] = [];
             for raw_ty: ty::t in raw_tys {
                 let t = ty::substitute_type_params(bcx_tcx(cx), tps, raw_ty);
-                tys += ~[t];
+                tys += [t];
             }
             let rslt = align_elements(bcx, tys);
             bcx = rslt.bcx;
@@ -644,7 +628,7 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result {
 
 fn dynamic_align_of(cx: &@block_ctxt, t: &ty::t) -> result {
     alt ty::struct(bcx_tcx(cx), t) {
-      ty::ty_param(p,_) {
+      ty::ty_param(p, _) {
         let aptr = field_of_tydesc(cx, t, false, abi::tydesc_field_align);
         ret rslt(aptr.bcx, aptr.bcx.build.Load(aptr.val));
       }
@@ -684,20 +668,18 @@ fn dynamic_align_of(cx: &@block_ctxt, t: &ty::t) -> result {
 // Simple wrapper around GEP that takes an array of ints and wraps them
 // in C_int()
 fn GEPi(cx: &@block_ctxt, base: ValueRef, ixs: &[int]) -> ValueRef {
-    let v: [ValueRef] = ~[];
-    for i: int in ixs { v += ~[C_int(i)]; }
+    let v: [ValueRef] = [];
+    for i: int in ixs { v += [C_int(i)]; }
     ret cx.build.InBoundsGEP(base, v);
 }
 
 // Increment a pointer by a given amount and then cast it to be a pointer
 // to a given type.
-fn bump_ptr(bcx: &@block_ctxt, t: &ty::t, base: ValueRef, sz: ValueRef)
-    -> ValueRef {
+fn bump_ptr(bcx: &@block_ctxt, t: &ty::t, base: ValueRef, sz: ValueRef) ->
+   ValueRef {
     let raw = bcx.build.PointerCast(base, T_ptr(T_i8()));
-    let bumped = bcx.build.GEP(raw, ~[sz]);
-    if ty::type_has_dynamic_size(bcx_tcx(bcx), t) {
-        ret bumped;
-    }
+    let bumped = bcx.build.GEP(raw, [sz]);
+    if ty::type_has_dynamic_size(bcx_tcx(bcx), t) { ret bumped; }
     let typ = T_ptr(type_of(bcx_ccx(bcx), bcx.sp, t));
     ret bcx.build.PointerCast(bumped, typ);
 }
@@ -743,15 +725,15 @@ fn GEP_tup_like(cx: &@block_ctxt, t: &ty::t, base: ValueRef, ixs: &[int]) ->
             // *single* structure, the first index (in GEP-ese) should just be
             // 0, to yield the pointee.
 
-            assert (ixs.(n) == 0);
+            assert (ixs[n] == 0);
             ret split_type(ccx, t, ixs, n + 1u);
         }
         assert (n < len);
-        let ix: int = ixs.(n);
-        let prefix: [ty::t] = ~[];
+        let ix: int = ixs[n];
+        let prefix: [ty::t] = [];
         let i: int = 0;
         while i < ix {
-            prefix += ~[ty::get_element_type(ccx.tcx, t, i as uint)];
+            prefix += [ty::get_element_type(ccx.tcx, t, i as uint)];
             i += 1;
         }
         let selected = ty::get_element_type(ccx.tcx, t, i as uint);
@@ -775,8 +757,8 @@ fn GEP_tup_like(cx: &@block_ctxt, t: &ty::t, base: ValueRef, ixs: &[int]) ->
 
     let s = split_type(bcx_ccx(cx), t, ixs, 0u);
 
-    let args = ~[];
-    for typ: ty::t in s.prefix { args += ~[typ]; }
+    let args = [];
+    for typ: ty::t in s.prefix { args += [typ]; }
     let prefix_ty = ty::mk_tup(bcx_tcx(cx), args);
 
     let bcx = cx;
@@ -799,10 +781,10 @@ fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id,
     let elem_ty = ty::mk_nil(bcx_tcx(cx)); // typestate infelicity
 
     let i = 0;
-    let true_arg_tys: [ty::t] = ~[];
+    let true_arg_tys: [ty::t] = [];
     for aty: ty::t in arg_tys {
         let arg_ty = ty::substitute_type_params(bcx_tcx(cx), ty_substs, aty);
-        true_arg_tys += ~[arg_ty];
+        true_arg_tys += [arg_ty];
         if i == ix { elem_ty = arg_ty; }
         i += 1;
     }
@@ -817,7 +799,7 @@ fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id,
     } else { llunionptr = llblobptr; }
     // Do the GEP_tup_like().
 
-    let rs = GEP_tup_like(cx, tup_ty, llunionptr, ~[0, ix]);
+    let rs = GEP_tup_like(cx, tup_ty, llunionptr, [0, ix]);
     // Cast the result to the appropriate type, if necessary.
 
     let val;
@@ -837,7 +819,7 @@ fn trans_raw_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) ->
     let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type));
     let rval =
         cx.build.Call(bcx_ccx(cx).upcalls.malloc,
-                      ~[cx.fcx.lltaskptr, llsize, tydesc]);
+                      [cx.fcx.lltaskptr, llsize, tydesc]);
     ret rslt(cx, cx.build.PointerCast(rval, llptr_ty));
 }
 
@@ -850,7 +832,7 @@ fn trans_shared_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef)
     let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type));
     let rval =
         cx.build.Call(bcx_ccx(cx).upcalls.shared_malloc,
-                      ~[cx.fcx.lltaskptr, llsize, tydesc]);
+                      [cx.fcx.lltaskptr, llsize, tydesc]);
     ret rslt(cx, cx.build.PointerCast(rval, llptr_ty));
 }
 
@@ -868,8 +850,7 @@ fn trans_malloc_boxed_raw(cx: &@block_ctxt, t: ty::t) -> result {
 
     // The mk_int here is the space being
     // reserved for the refcount.
-    let boxed_body =
-        ty::mk_tup(bcx_tcx(cx), ~[ty::mk_int(bcx_tcx(cx)), t]);
+    let boxed_body = ty::mk_tup(bcx_tcx(cx), [ty::mk_int(bcx_tcx(cx)), t]);
     let box_ptr = ty::mk_imm_box(bcx_tcx(cx), t);
     let sz = size_of(cx, boxed_body);
 
@@ -882,12 +863,12 @@ fn trans_malloc_boxed_raw(cx: &@block_ctxt, t: ty::t) -> result {
 // trans_malloc_boxed: usefully wraps trans_malloc_box_raw; allocates a box,
 // initializes the reference count to 1, and pulls out the body and rc
 fn trans_malloc_boxed(cx: &@block_ctxt, t: ty::t) ->
-    {bcx: @block_ctxt, box: ValueRef, body: ValueRef} {
+   {bcx: @block_ctxt, box: ValueRef, body: ValueRef} {
     let res = trans_malloc_boxed_raw(cx, t);
     let box = res.val;
-    let rc = GEPi(res.bcx, box, ~[0, abi::box_rc_field_refcnt]);
+    let rc = GEPi(res.bcx, box, [0, abi::box_rc_field_refcnt]);
     res.bcx.build.Store(C_int(1), rc);
-    let body = GEPi(res.bcx, box, ~[0, abi::box_rc_field_body]);
+    let body = GEPi(res.bcx, box, [0, abi::box_rc_field_body]);
     ret {bcx: res.bcx, box: res.val, body: body};
 }
 
@@ -901,7 +882,7 @@ fn field_of_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, field: int) ->
     let ti = none::<@tydesc_info>;
     let tydesc = get_tydesc(cx, t, escapes, ti).result;
     ret rslt(tydesc.bcx,
-             tydesc.bcx.build.GEP(tydesc.val, ~[C_int(0), C_int(field)]));
+             tydesc.bcx.build.GEP(tydesc.val, [C_int(0), C_int(field)]));
 }
 
 
@@ -911,20 +892,17 @@ fn field_of_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, field: int) ->
 // constructing derived tydescs.
 fn linearize_ty_params(cx: &@block_ctxt, t: &ty::t) ->
    {params: [uint], descs: [ValueRef]} {
-    let param_vals: [ValueRef] = ~[];
-    let param_defs: [uint] = ~[];
+    let param_vals: [ValueRef] = [];
+    let param_defs: [uint] = [];
     type rr =
         {cx: @block_ctxt, mutable vals: [ValueRef], mutable defs: [uint]};
 
     fn linearizer(r: @rr, t: ty::t) {
         alt ty::struct(bcx_tcx(r.cx), t) {
-          ty::ty_param(pid,_) {
+          ty::ty_param(pid, _) {
             let seen: bool = false;
             for d: uint in r.defs { if d == pid { seen = true; } }
-            if !seen {
-                r.vals += ~[r.cx.fcx.lltydescs.(pid)];
-                r.defs += ~[pid];
-            }
+            if !seen { r.vals += [r.cx.fcx.lltydescs[pid]]; r.defs += [pid]; }
           }
           _ { }
         }
@@ -937,8 +915,8 @@ fn linearize_ty_params(cx: &@block_ctxt, t: &ty::t) ->
 
 fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef,
                                     llalign: ValueRef, llroottydesc: ValueRef,
-                                    llparamtydescs: ValueRef,
-                                    n_params: uint) -> ValueRef {
+                                    llparamtydescs: ValueRef, n_params: uint)
+   -> ValueRef {
     let llmyroottydesc = alloca(cx, bcx_ccx(cx).tydesc_type);
     // By convention, desc 0 is the root descriptor.
 
@@ -946,15 +924,15 @@ fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef,
     cx.build.Store(llroottydesc, llmyroottydesc);
     // Store a pointer to the rest of the descriptors.
 
-    let llfirstparam = cx.build.GEP(llparamtydescs, ~[C_int(0), C_int(0)]);
+    let llfirstparam = cx.build.GEP(llparamtydescs, [C_int(0), C_int(0)]);
     store_inbounds(cx, llfirstparam, llmyroottydesc,
-                   ~[C_int(0), C_int(abi::tydesc_field_first_param)]);
+                   [C_int(0), C_int(abi::tydesc_field_first_param)]);
     store_inbounds(cx, C_uint(n_params), llmyroottydesc,
-                   ~[C_int(0), C_int(abi::tydesc_field_n_params)]);
+                   [C_int(0), C_int(abi::tydesc_field_n_params)]);
     store_inbounds(cx, llsz, llmyroottydesc,
-                   ~[C_int(0), C_int(abi::tydesc_field_size)]);
+                   [C_int(0), C_int(abi::tydesc_field_size)]);
     store_inbounds(cx, llalign, llmyroottydesc,
-                   ~[C_int(0), C_int(abi::tydesc_field_align)]);
+                   [C_int(0), C_int(abi::tydesc_field_align)]);
     ret llmyroottydesc;
 }
 
@@ -991,11 +969,11 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool,
             alloca(bcx,
                    T_array(T_ptr(bcx_ccx(bcx).tydesc_type), 1u + n_params));
         let i = 0;
-        let tdp = bcx.build.GEP(tydescs, ~[C_int(0), C_int(i)]);
+        let tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]);
         bcx.build.Store(root, tdp);
         i += 1;
         for td: ValueRef in tys.descs {
-            let tdp = bcx.build.GEP(tydescs, ~[C_int(0), C_int(i)]);
+            let tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]);
             bcx.build.Store(td, tdp);
             i += 1;
         }
@@ -1004,17 +982,17 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool,
                                   T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type)));
         let td_val =
             bcx.build.Call(bcx_ccx(bcx).upcalls.get_type_desc,
-                           ~[bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())),
-                             sz.val, align.val, C_int(1u + n_params as int),
-                             lltydescsptr]);
+                           [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val,
+                            align.val, C_int(1u + n_params as int),
+                            lltydescsptr]);
         v = td_val;
     } else {
         let llparamtydescs =
-            alloca(bcx, T_array(T_ptr(bcx_ccx(bcx).tydesc_type),
-                                n_params + 1u));
+            alloca(bcx,
+                   T_array(T_ptr(bcx_ccx(bcx).tydesc_type), n_params + 1u));
         let i = 0;
         for td: ValueRef in tys.descs {
-            let tdp = bcx.build.GEP(llparamtydescs, ~[C_int(0), C_int(i)]);
+            let tdp = bcx.build.GEP(llparamtydescs, [C_int(0), C_int(i)]);
             bcx.build.Store(td, tdp);
             i += 1;
         }
@@ -1026,11 +1004,11 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool,
     ret rslt(cx, v);
 }
 
-type get_tydesc_result = { kind: tydesc_kind, result: result };
+type get_tydesc_result = {kind: tydesc_kind, result: result};
 
 fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool,
-              static_ti: &mutable option::t<@tydesc_info>)
-        -> get_tydesc_result {
+              static_ti: &mutable option::t<@tydesc_info>) ->
+   get_tydesc_result {
 
     let t = ty::strip_cname(bcx_tcx(cx), orig_t);
 
@@ -1038,12 +1016,14 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool,
     alt ty::type_param(bcx_tcx(cx), t) {
       some(id) {
         if id < vec::len(cx.fcx.lltydescs) {
-            ret { kind: tk_param, result: rslt(cx, cx.fcx.lltydescs.(id)) };
-        }
-        else {
-            bcx_tcx(cx).sess.span_bug(cx.sp, "Unbound typaram in get_tydesc: "
-              + "orig_t = " + ty_to_str(bcx_tcx(cx), orig_t)
-              + " ty_param = " + std::uint::str(id));
+            ret {kind: tk_param, result: rslt(cx, cx.fcx.lltydescs[id])};
+        } else {
+            bcx_tcx(cx).sess.span_bug(cx.sp,
+                                      "Unbound typaram in get_tydesc: " +
+                                          "orig_t = " +
+                                          ty_to_str(bcx_tcx(cx), orig_t) +
+                                          " ty_param = " +
+                                          std::uint::str(id));
         }
       }
       none. {/* fall through */ }
@@ -1051,16 +1031,14 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool,
 
     // Does it contain a type param? If so, generate a derived tydesc.
     if ty::type_contains_params(bcx_tcx(cx), t) {
-        ret {
-            kind: tk_derived,
-            result: get_derived_tydesc(cx, t, escapes, static_ti)
-        };
+        ret {kind: tk_derived,
+             result: get_derived_tydesc(cx, t, escapes, static_ti)};
     }
 
     // Otherwise, generate a tydesc if necessary, and return it.
-    let info = get_static_tydesc(cx, t, ~[]);
+    let info = get_static_tydesc(cx, t, []);
     static_ti = some::<@tydesc_info>(info);
-    ret { kind: tk_static, result: rslt(cx, info.tydesc) };
+    ret {kind: tk_static, result: rslt(cx, info.tydesc)};
 }
 
 fn get_static_tydesc(cx: &@block_ctxt, orig_t: &ty::t, ty_params: &[uint]) ->
@@ -1179,18 +1157,18 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: &ty::t,
     let ty_param_count = std::vec::len::<uint>(ty_params);
     let lltyparams = llvm::LLVMGetParam(llfn, 3u);
     let copy_args_bcx = new_raw_block_ctxt(fcx, fcx.llcopyargs);
-    let lltydescs = ~[mutable];
+    let lltydescs = [mutable];
     let p = 0u;
     while p < ty_param_count {
-        let llparam = copy_args_bcx.build.GEP(lltyparams, ~[C_int(p as int)]);
+        let llparam = copy_args_bcx.build.GEP(lltyparams, [C_int(p as int)]);
         llparam = copy_args_bcx.build.Load(llparam);
-        std::vec::grow_set(lltydescs, ty_params.(p), 0 as ValueRef, llparam);
+        std::vec::grow_set(lltydescs, ty_params[p], 0 as ValueRef, llparam);
         p += 1u;
     }
 
     // TODO: Implement some kind of freeze operation in the standard library.
-    let lltydescs_frozen = ~[];
-    for lltydesc: ValueRef in lltydescs { lltydescs_frozen += ~[lltydesc]; }
+    let lltydescs_frozen = [];
+    for lltydesc: ValueRef in lltydescs { lltydescs_frozen += [lltydesc]; }
     fcx.lltydescs = lltydescs_frozen;
 
     let bcx = new_top_block_ctxt(fcx);
@@ -1250,20 +1228,20 @@ fn emit_tydescs(ccx: &@crate_ctxt) {
 
         let tydesc =
             C_named_struct(ccx.tydesc_type,
-                           ~[C_null(T_ptr(T_ptr(ccx.tydesc_type))),
-                             ti.size,               // size
-                             ti.align,              // align
-                             copy_glue,             // copy_glue
-                             drop_glue,             // drop_glue
-                             free_glue,             // free_glue
-                             C_null(glue_fn_ty),    // sever_glue
-                             C_null(glue_fn_ty),    // mark_glue
-                             C_null(glue_fn_ty),    // obj_drop_glue
-                             C_null(glue_fn_ty),    // is_stateful
-                             cmp_glue,              // cmp_glue
-                             C_shape(ccx, shape),   // shape
-                             shape_tables,          // shape_tables
-                             C_int(0)]);            // n_params
+                           [C_null(T_ptr(T_ptr(ccx.tydesc_type))),
+                            ti.size, // size
+                            ti.align, // align
+                            copy_glue, // copy_glue
+                            drop_glue, // drop_glue
+                            free_glue, // free_glue
+                            C_null(glue_fn_ty), // sever_glue
+                            C_null(glue_fn_ty), // mark_glue
+                            C_null(glue_fn_ty), // obj_drop_glue
+                            C_null(glue_fn_ty), // is_stateful
+                            cmp_glue, // cmp_glue
+                            C_shape(ccx, shape), // shape
+                            shape_tables, // shape_tables
+                            C_int(0)]); // n_params
 
         let gvar = ti.tydesc;
         llvm::LLVMSetInitializer(gvar, tydesc);
@@ -1280,7 +1258,7 @@ fn make_copy_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t) {
 
     if ty::type_is_boxed(bcx_tcx(cx), t) {
         bcx = incr_refcnt_of_boxed(cx, cx.build.Load(v)).bcx;
-    } else if (ty::type_is_structural(bcx_tcx(cx), t)) {
+    } else if ty::type_is_structural(bcx_tcx(cx), t) {
         bcx = duplicate_heap_parts_if_necessary(cx, v, t).bcx;
         bcx = iter_structural_ty(bcx, v, t, bind copy_ty(_, _, _)).bcx;
     } else { bcx = cx; }
@@ -1290,7 +1268,7 @@ fn make_copy_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t) {
 
 fn incr_refcnt_of_boxed(cx: &@block_ctxt, box_ptr: ValueRef) -> result {
     let rc_ptr =
-        cx.build.GEP(box_ptr, ~[C_int(0), C_int(abi::box_rc_field_refcnt)]);
+        cx.build.GEP(box_ptr, [C_int(0), C_int(abi::box_rc_field_refcnt)]);
     let rc = cx.build.Load(rc_ptr);
     let rc_adj_cx = new_sub_block_ctxt(cx, "rc++");
     let next_cx = new_sub_block_ctxt(cx, "next");
@@ -1312,72 +1290,62 @@ fn make_free_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) {
             let v = cx.build.Load(v0);
             if !bcx_ccx(cx).sess.get_opts().do_gc {
                 trans_non_gc_free(cx, v)
-            } else {
-                rslt(cx, C_nil())
-            }
+            } else { rslt(cx, C_nil()) }
           }
           ty::ty_box(body_mt) {
             let v = cx.build.Load(v0);
             let body =
-                cx.build.GEP(v, ~[C_int(0), C_int(abi::box_rc_field_body)]);
+                cx.build.GEP(v, [C_int(0), C_int(abi::box_rc_field_body)]);
             let body_ty = body_mt.ty;
             let body_val = load_if_immediate(cx, body, body_ty);
             let rs = drop_ty(cx, body_val, body_ty);
             if !bcx_ccx(cx).sess.get_opts().do_gc {
                 trans_non_gc_free(rs.bcx, v)
-            } else {
-                rslt(cx, C_nil())
-            }
-          }
-          ty::ty_uniq(_) {
-            fail "free uniq unimplemented";
+            } else { rslt(cx, C_nil()) }
           }
+          ty::ty_uniq(_) { fail "free uniq unimplemented"; }
           ty::ty_obj(_) {
             // Call through the obj's own fields-drop glue first.
             // Then free the body.
             let box_cell =
-                cx.build.GEP(v0, ~[C_int(0), C_int(abi::obj_field_box)]);
+                cx.build.GEP(v0, [C_int(0), C_int(abi::obj_field_box)]);
             let b = cx.build.Load(box_cell);
             let ccx = bcx_ccx(cx);
             let llbox_ty = T_opaque_obj_ptr(*ccx);
             b = cx.build.PointerCast(b, llbox_ty);
             let body =
-                cx.build.GEP(b, ~[C_int(0), C_int(abi::box_rc_field_body)]);
+                cx.build.GEP(b, [C_int(0), C_int(abi::box_rc_field_body)]);
             let tydescptr =
                 cx.build.GEP(body,
-                             ~[C_int(0), C_int(abi::obj_body_elt_tydesc)]);
+                             [C_int(0), C_int(abi::obj_body_elt_tydesc)]);
             let tydesc = cx.build.Load(tydescptr);
             let ti = none::<@tydesc_info>;
             call_tydesc_glue_full(cx, body, tydesc,
                                   abi::tydesc_field_drop_glue, ti);
-            if (!bcx_ccx(cx).sess.get_opts().do_gc) {
+            if !bcx_ccx(cx).sess.get_opts().do_gc {
                 trans_non_gc_free(cx, b)
-            } else {
-                rslt(cx, C_nil())
-            }
+            } else { rslt(cx, C_nil()) }
           }
           ty::ty_fn(_, _, _, _, _) {
             // Call through the closure's own fields-drop glue first.
             // Then free the body.
             let box_cell =
-                cx.build.GEP(v0, ~[C_int(0), C_int(abi::fn_field_box)]);
+                cx.build.GEP(v0, [C_int(0), C_int(abi::fn_field_box)]);
             let v = cx.build.Load(box_cell);
             let body =
-                cx.build.GEP(v, ~[C_int(0), C_int(abi::box_rc_field_body)]);
+                cx.build.GEP(v, [C_int(0), C_int(abi::box_rc_field_body)]);
             let bindings =
                 cx.build.GEP(body,
-                             ~[C_int(0), C_int(abi::closure_elt_bindings)]);
+                             [C_int(0), C_int(abi::closure_elt_bindings)]);
             let tydescptr =
                 cx.build.GEP(body,
-                             ~[C_int(0), C_int(abi::closure_elt_tydesc)]);
+                             [C_int(0), C_int(abi::closure_elt_tydesc)]);
             let ti = none::<@tydesc_info>;
             call_tydesc_glue_full(cx, bindings, cx.build.Load(tydescptr),
                                   abi::tydesc_field_drop_glue, ti);
-            if (!bcx_ccx(cx).sess.get_opts().do_gc) {
+            if !bcx_ccx(cx).sess.get_opts().do_gc {
                 trans_non_gc_free(cx, v)
-            } else {
-                rslt(cx, C_nil())
-            }
+            } else { rslt(cx, C_nil()) }
           }
           _ { rslt(cx, C_nil()) }
         };
@@ -1390,8 +1358,8 @@ fn maybe_free_ivec_heap_part(cx: &@block_ctxt, v0: ValueRef, unit_ty: ty::t)
     let llunitty = type_of_or_i8(cx, unit_ty);
     let stack_len =
         cx.build.Load(cx.build.InBoundsGEP(v0,
-                                           ~[C_int(0),
-                                             C_uint(abi::ivec_elt_len)]));
+                                           [C_int(0),
+                                            C_uint(abi::ivec_elt_len)]));
     let maybe_on_heap_cx = new_sub_block_ctxt(cx, "maybe_on_heap");
     let next_cx = new_sub_block_ctxt(cx, "next");
     let maybe_on_heap =
@@ -1404,7 +1372,7 @@ fn maybe_free_ivec_heap_part(cx: &@block_ctxt, v0: ValueRef, unit_ty: ty::t)
         maybe_on_heap_cx.build.PointerCast(v0, T_ptr(T_ivec_heap(llunitty)));
     let heap_ptr =
         {
-            let v = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
+            let v = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
             let m = maybe_on_heap_cx.build.InBoundsGEP(stub_ptr, v);
             maybe_on_heap_cx.build.Load(m)
         };
@@ -1431,7 +1399,7 @@ fn make_drop_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) {
           ty::ty_uniq(_) { trans_shared_free(cx, cx.build.Load(v0)) }
           ty::ty_obj(_) {
             let box_cell =
-                cx.build.GEP(v0, ~[C_int(0), C_int(abi::obj_field_box)]);
+                cx.build.GEP(v0, [C_int(0), C_int(abi::obj_field_box)]);
             decr_refcnt_maybe_free(cx, box_cell, v0, t)
           }
           ty::ty_res(did, inner, tps) {
@@ -1439,7 +1407,7 @@ fn make_drop_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) {
           }
           ty::ty_fn(_, _, _, _, _) {
             let box_cell =
-                cx.build.GEP(v0, ~[C_int(0), C_int(abi::fn_field_box)]);
+                cx.build.GEP(v0, [C_int(0), C_int(abi::fn_field_box)]);
             decr_refcnt_maybe_free(cx, box_cell, v0, t)
           }
           _ {
@@ -1457,42 +1425,42 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id,
                   inner_t: ty::t, tps: &[ty::t]) -> result {
     let ccx = bcx_ccx(cx);
     let inner_t_s = ty::substitute_type_params(ccx.tcx, tps, inner_t);
-    let tup_ty = ty::mk_tup(ccx.tcx, ~[ty::mk_int(ccx.tcx), inner_t_s]);
+    let tup_ty = ty::mk_tup(ccx.tcx, [ty::mk_int(ccx.tcx), inner_t_s]);
     let drop_cx = new_sub_block_ctxt(cx, "drop res");
     let next_cx = new_sub_block_ctxt(cx, "next");
 
-    let drop_flag = GEP_tup_like(cx, tup_ty, rs, ~[0, 0]);
+    let drop_flag = GEP_tup_like(cx, tup_ty, rs, [0, 0]);
     cx = drop_flag.bcx;
     let null_test = cx.build.IsNull(cx.build.Load(drop_flag.val));
     cx.build.CondBr(null_test, next_cx.llbb, drop_cx.llbb);
     cx = drop_cx;
 
-    let val = GEP_tup_like(cx, tup_ty, rs, ~[0, 1]);
+    let val = GEP_tup_like(cx, tup_ty, rs, [0, 1]);
     cx = val.bcx;
     // Find and call the actual destructor.
     let dtor_pair = trans_common::get_res_dtor(ccx, cx.sp, did, inner_t);
     let dtor_addr =
         cx.build.Load(cx.build.GEP(dtor_pair,
-                                   ~[C_int(0), C_int(abi::fn_field_code)]));
+                                   [C_int(0), C_int(abi::fn_field_code)]));
     let dtor_env =
         cx.build.Load(cx.build.GEP(dtor_pair,
-                                   ~[C_int(0), C_int(abi::fn_field_box)]));
-    let args = ~[cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env];
-    for tp: ty::t  in tps {
+                                   [C_int(0), C_int(abi::fn_field_box)]));
+    let args = [cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env];
+    for tp: ty::t in tps {
         let ti: option::t<@tydesc_info> = none;
         let td = get_tydesc(cx, tp, false, ti).result;
-        args += ~[td.val];
+        args += [td.val];
         cx = td.bcx;
     }
     // Kludge to work around the fact that we know the precise type of the
     // value here, but the dtor expects a type that still has opaque pointers
     // for type variables.
     let val_llty =
-        lib::llvm::fn_ty_param_tys(llvm::LLVMGetElementType
-                                   (llvm::LLVMTypeOf(dtor_addr)))
-                                    .(std::vec::len(args));
+        lib::llvm::fn_ty_param_tys(
+            llvm::LLVMGetElementType(
+                llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)];
     let val_cast = cx.build.BitCast(val.val, val_llty);
-    cx.build.FastCall(dtor_addr, args + ~[val_cast]);
+    cx.build.FastCall(dtor_addr, args + [val_cast]);
 
     cx = drop_slot(cx, val.val, inner_t_s).bcx;
     cx.build.Store(C_int(0), drop_flag.val);
@@ -1514,7 +1482,7 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef,
     cx.build.CondBr(null_test, next_cx.llbb, load_rc_cx.llbb);
     let rc_ptr =
         load_rc_cx.build.GEP(box_ptr,
-                             ~[C_int(0), C_int(abi::box_rc_field_refcnt)]);
+                             [C_int(0), C_int(abi::box_rc_field_refcnt)]);
     let rc = load_rc_cx.build.Load(rc_ptr);
     let const_test =
         load_rc_cx.build.ICmp(lib::llvm::LLVMIntEQ,
@@ -1530,9 +1498,9 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef,
     let t_else = T_nil();
     let v_else = C_nil();
     let phi =
-        next_cx.build.Phi(t_else, ~[v_else, v_else, v_else, free_res.val],
-                          ~[cx.llbb, load_rc_cx.llbb, rc_adj_cx.llbb,
-                            free_res.bcx.llbb]);
+        next_cx.build.Phi(t_else, [v_else, v_else, v_else, free_res.val],
+                          [cx.llbb, load_rc_cx.llbb, rc_adj_cx.llbb,
+                           free_res.bcx.llbb]);
     ret rslt(next_cx, phi);
 }
 
@@ -1555,15 +1523,16 @@ fn compare_scalar_types(cx: @block_ctxt, lhs: ValueRef, rhs: ValueRef,
 
     alt ty::struct(bcx_tcx(cx), t) {
       ty::ty_nil. { ret f(nil_type); }
-      ty::ty_bool. | ty::ty_uint. | ty::ty_ptr(_) |
-      ty::ty_char. { ret f(unsigned_int); }
+      ty::ty_bool. | ty::ty_uint. | ty::ty_ptr(_) | ty::ty_char. {
+        ret f(unsigned_int);
+      }
       ty::ty_int. { ret f(signed_int); }
       ty::ty_float. { ret f(floating_point); }
       ty::ty_machine(_) {
         if ty::type_is_fp(bcx_tcx(cx), t) {
             // Floating point machine types
             ret f(floating_point);
-        } else if (ty::type_is_signed(bcx_tcx(cx), t)) {
+        } else if ty::type_is_signed(bcx_tcx(cx), t) {
             // Signed, integral machine types
             ret f(signed_int);
         } else {
@@ -1634,7 +1603,7 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef,
         let r: ValueRef;
         if nt == nil_type {
             r = C_bool(op != 0u);
-        } else if (nt == floating_point) {
+        } else if nt == floating_point {
             r = cx.build.FCmp(op, lhs, rhs);
         } else { r = cx.build.ICmp(op, lhs, rhs); }
         ret r;
@@ -1656,21 +1625,21 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef,
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_lt), lt_cx.llbb);
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb);
     let last_result =
-        last_cx.build.Phi(T_i1(), ~[eq_result, lt_result, le_result],
-                          ~[eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
+        last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result],
+                          [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
     ret rslt(last_cx, last_result);
 }
 
-type val_pair_fn = fn(&@block_ctxt, ValueRef, ValueRef) -> result ;
-type val_fn = fn(&@block_ctxt, ValueRef) -> result ;
-type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result ;
+type val_pair_fn = fn(&@block_ctxt, ValueRef, ValueRef) -> result;
+type val_fn = fn(&@block_ctxt, ValueRef) -> result;
+type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result;
 
 
 // Iterates through the elements of a structural type.
 fn iter_structural_ty(cx: &@block_ctxt, v: ValueRef, t: &ty::t,
                       f: val_and_ty_fn) -> result {
-    fn adaptor_fn(f: val_and_ty_fn, cx: &@block_ctxt, av: ValueRef,
-                  t: ty::t) -> result {
+    fn adaptor_fn(f: val_and_ty_fn, cx: &@block_ctxt, av: ValueRef, t: ty::t)
+       -> result {
         ret f(cx, av, t);
     }
     ret iter_structural_ty_full(cx, v, t, bind adaptor_fn(f, _, _, _));
@@ -1689,13 +1658,13 @@ fn store_inbounds(cx: &@block_ctxt, v: ValueRef, p: ValueRef,
 // This uses store and inboundsGEP, but it only doing so superficially; it's
 // really storing an incremented pointer to another pointer.
 fn incr_ptr(cx: &@block_ctxt, p: ValueRef, incr: ValueRef, pp: ValueRef) {
-    cx.build.Store(cx.build.InBoundsGEP(p, ~[incr]), pp);
+    cx.build.Store(cx.build.InBoundsGEP(p, [incr]), pp);
 }
 
 fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
                            f: &val_and_ty_fn) -> result {
-    fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn)
-            -> result {
+    fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) ->
+       result {
         let box_ptr = cx.build.Load(box_cell);
         let tnil = ty::mk_nil(bcx_tcx(cx));
         let tbox = ty::mk_imm_box(bcx_tcx(cx), tnil);
@@ -1729,7 +1698,7 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
         // known to not use pointer casts, which tend to confuse LLVM.
 
         let a_elem_i8 = bcx.build.PointerCast(a_elem, T_ptr(T_i8()));
-        let a_end_i8 = bcx.build.GEP(a_elem_i8, ~[len]);
+        let a_end_i8 = bcx.build.GEP(a_elem_i8, [len]);
         let a_end = bcx.build.PointerCast(a_end_i8, T_ptr(llunitty));
 
         let dest_elem_ptr = alloca(bcx, T_ptr(llunitty));
@@ -1747,8 +1716,9 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
         loop_header_cx.build.CondBr(not_yet_at_end, loop_body_cx.llbb,
                                     next_cx.llbb);
 
-        rs = f(loop_body_cx,
-               load_if_immediate(loop_body_cx, dest_elem, unit_ty), unit_ty);
+        rs =
+            f(loop_body_cx,
+              load_if_immediate(loop_body_cx, dest_elem, unit_ty), unit_ty);
 
         loop_body_cx = rs.bcx;
 
@@ -1794,9 +1764,10 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
       ty::ty_rec(fields) {
         let i: int = 0;
         for fld: ty::field in fields {
-            r = GEP_tup_like(r.bcx, t, av, ~[0, i]);
+            r = GEP_tup_like(r.bcx, t, av, [0, i]);
             let llfld_a = r.val;
-            r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, fld.mt.ty),
+            r =
+                f(r.bcx, load_if_immediate(r.bcx, llfld_a, fld.mt.ty),
                   fld.mt.ty);
             i += 1;
         }
@@ -1804,7 +1775,7 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
       ty::ty_tup(args) {
         let i = 0;
         for arg in args {
-            r = GEP_tup_like(r.bcx, t, av, ~[0, i]);
+            r = GEP_tup_like(r.bcx, t, av, [0, i]);
             let llfld_a = r.val;
             r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, arg), arg);
             i += 1;
@@ -1814,8 +1785,8 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
         let tcx = bcx_tcx(cx);
         let inner1 = ty::substitute_type_params(tcx, tps, inner);
         let inner_t_s = ty::substitute_type_params(tcx, tps, inner);
-        let tup_t = ty::mk_tup(tcx, ~[ty::mk_int(tcx), inner_t_s]);
-        r = GEP_tup_like(r.bcx, tup_t, av, ~[0, 1]);
+        let tup_t = ty::mk_tup(tcx, [ty::mk_int(tcx), inner_t_s]);
+        r = GEP_tup_like(r.bcx, tup_t, av, [0, 1]);
         let llfld_a = r.val;
         r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, inner1), inner1);
       }
@@ -1825,13 +1796,13 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
 
         // Cast the tags to types we can GEP into.
         if n_variants == 1u {
-            ret iter_variant(cx, av, variants.(0), tps, tid, f);
+            ret iter_variant(cx, av, variants[0], tps, tid, f);
         }
 
         let lltagty = T_opaque_tag_ptr(bcx_ccx(cx).tn);
         let av_tag = cx.build.PointerCast(av, lltagty);
-        let lldiscrim_a_ptr = cx.build.GEP(av_tag, ~[C_int(0), C_int(0)]);
-        let llunion_a_ptr = cx.build.GEP(av_tag, ~[C_int(0), C_int(1)]);
+        let lldiscrim_a_ptr = cx.build.GEP(av_tag, [C_int(0), C_int(0)]);
+        let llunion_a_ptr = cx.build.GEP(av_tag, [C_int(0), C_int(1)]);
         let lldiscrim_a = cx.build.Load(lldiscrim_a_ptr);
 
         // NB: we must hit the discriminant first so that structural
@@ -1849,8 +1820,9 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
                                    "tag-iter-variant-" +
                                        uint::to_str(i, 10u));
             llvm::LLVMAddCase(llswitch, C_int(i as int), variant_cx.llbb);
-            variant_cx = iter_variant(variant_cx, llunion_a_ptr, variant, tps,
-                                      tid, f).bcx;
+            variant_cx =
+                iter_variant(variant_cx, llunion_a_ptr, variant, tps, tid,
+                             f).bcx;
             variant_cx.build.Br(next_cx.llbb);
             i += 1u;
         }
@@ -1858,12 +1830,12 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
       }
       ty::ty_fn(_, _, _, _, _) {
         let box_cell_a =
-            cx.build.GEP(av, ~[C_int(0), C_int(abi::fn_field_box)]);
+            cx.build.GEP(av, [C_int(0), C_int(abi::fn_field_box)]);
         ret iter_boxpp(cx, box_cell_a, f);
       }
       ty::ty_obj(_) {
         let box_cell_a =
-            cx.build.GEP(av, ~[C_int(0), C_int(abi::obj_field_box)]);
+            cx.build.GEP(av, [C_int(0), C_int(abi::obj_field_box)]);
         ret iter_boxpp(cx, box_cell_a, f);
       }
       ty::ty_vec(unit_tm) { ret iter_ivec(cx, av, unit_tm.ty, f); }
@@ -1879,12 +1851,15 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t,
 
 // Iterates through a pointer range, until the src* hits the src_lim*.
 fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef,
-                     // elt*
-                     src: ValueRef,
-                     // elt*
-                     src_lim: ValueRef,
-                     // elt*
-                     elt_sz: ValueRef, f: &val_pair_fn) -> result {
+                     src:
+                         // elt*
+                         ValueRef,
+                     src_lim:
+                         // elt*
+                         ValueRef,
+                     elt_sz:
+                         // elt*
+                         ValueRef, f: &val_pair_fn) -> result {
     let bcx = cx;
     let dst_int: ValueRef = vp2i(bcx, dst);
     let src_int: ValueRef = vp2i(bcx, src);
@@ -1894,9 +1869,9 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef,
     let next_cx = new_sub_block_ctxt(cx, "next");
     bcx.build.Br(cond_cx.llbb);
     let dst_curr: ValueRef =
-        cond_cx.build.Phi(T_int(), ~[dst_int], ~[bcx.llbb]);
+        cond_cx.build.Phi(T_int(), [dst_int], [bcx.llbb]);
     let src_curr: ValueRef =
-        cond_cx.build.Phi(T_int(), ~[src_int], ~[bcx.llbb]);
+        cond_cx.build.Phi(T_int(), [src_int], [bcx.llbb]);
     let end_test =
         cond_cx.build.ICmp(lib::llvm::LLVMIntULT, src_curr, src_lim_int);
     cond_cx.build.CondBr(end_test, body_cx.llbb, next_cx.llbb);
@@ -1907,14 +1882,13 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef,
     let dst_next = body_cx.build.Add(dst_curr, elt_sz);
     let src_next = body_cx.build.Add(src_curr, elt_sz);
     body_cx.build.Br(cond_cx.llbb);
-    cond_cx.build.AddIncomingToPhi(dst_curr, ~[dst_next], ~[body_cx.llbb]);
-    cond_cx.build.AddIncomingToPhi(src_curr, ~[src_next], ~[body_cx.llbb]);
+    cond_cx.build.AddIncomingToPhi(dst_curr, [dst_next], [body_cx.llbb]);
+    cond_cx.build.AddIncomingToPhi(src_curr, [src_next], [body_cx.llbb]);
     ret rslt(next_cx, C_nil());
 }
 
 fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef,
                        src_lim:
-
                            // elt*
                            ValueRef,
                        elt_ty: & // elt*
@@ -1945,8 +1919,8 @@ fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: &ty::t, f: &val_and_ty_fn)
         let len;
         let bcx;
         if !interior {
-            p0 = cx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_data)]);
-            let lp = cx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_fill)]);
+            p0 = cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]);
+            let lp = cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]);
             len = cx.build.Load(lp);
             bcx = cx;
         } else {
@@ -2012,65 +1986,62 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int,
             alt { ti.copy_glue } {
               some(_) { }
               none. {
-                log #fmt("+++ lazily_emit_tydesc_glue TAKE %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                log #fmt["+++ lazily_emit_tydesc_glue TAKE %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
                                          "copy");
                 ti.copy_glue = some::<ValueRef>(glue_fn);
-                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
-                                  make_copy_glue, ti.ty_params,
-                                  "take");
-                log #fmt("--- lazily_emit_tydesc_glue TAKE %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_copy_glue,
+                                  ti.ty_params, "take");
+                log #fmt["--- lazily_emit_tydesc_glue TAKE %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
               }
             }
-        } else if (field == abi::tydesc_field_drop_glue) {
+        } else if field == abi::tydesc_field_drop_glue {
             alt { ti.drop_glue } {
               some(_) { }
               none. {
-                log #fmt("+++ lazily_emit_tydesc_glue DROP %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                log #fmt["+++ lazily_emit_tydesc_glue DROP %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
                                          "drop");
                 ti.drop_glue = some::<ValueRef>(glue_fn);
-                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
-                                  make_drop_glue, ti.ty_params,
-                                  "drop");
-                log #fmt("--- lazily_emit_tydesc_glue DROP %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_drop_glue,
+                                  ti.ty_params, "drop");
+                log #fmt["--- lazily_emit_tydesc_glue DROP %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
               }
             }
-        } else if (field == abi::tydesc_field_free_glue) {
+        } else if field == abi::tydesc_field_free_glue {
             alt { ti.free_glue } {
               some(_) { }
               none. {
-                log #fmt("+++ lazily_emit_tydesc_glue FREE %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                log #fmt["+++ lazily_emit_tydesc_glue FREE %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
                                          "free");
                 ti.free_glue = some::<ValueRef>(glue_fn);
-                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
-                                  make_free_glue, ti.ty_params,
-                                  "free");
-                log #fmt("--- lazily_emit_tydesc_glue FREE %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_free_glue,
+                                  ti.ty_params, "free");
+                log #fmt["--- lazily_emit_tydesc_glue FREE %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
               }
             }
-        } else if (field == abi::tydesc_field_cmp_glue) {
+        } else if field == abi::tydesc_field_cmp_glue {
             alt { ti.cmp_glue } {
               some(_) { }
               none. {
-                log #fmt("+++ lazily_emit_tydesc_glue CMP %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                log #fmt["+++ lazily_emit_tydesc_glue CMP %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
                 ti.cmp_glue = some(bcx_ccx(cx).upcalls.cmp_type);
-                log #fmt("--- lazily_emit_tydesc_glue CMP %s",
-                         ty_to_str(bcx_tcx(cx), ti.ty));
+                log #fmt["--- lazily_emit_tydesc_glue CMP %s",
+                         ty_to_str(bcx_tcx(cx), ti.ty)];
               }
             }
         }
@@ -2088,11 +2059,11 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef,
       some(sti) {
         if field == abi::tydesc_field_copy_glue {
             static_glue_fn = sti.copy_glue;
-        } else if (field == abi::tydesc_field_drop_glue) {
+        } else if field == abi::tydesc_field_drop_glue {
             static_glue_fn = sti.drop_glue;
-        } else if (field == abi::tydesc_field_free_glue) {
+        } else if field == abi::tydesc_field_free_glue {
             static_glue_fn = sti.free_glue;
-        } else if (field == abi::tydesc_field_cmp_glue) {
+        } else if field == abi::tydesc_field_cmp_glue {
             static_glue_fn = sti.cmp_glue;
         }
       }
@@ -2101,21 +2072,21 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef,
     let llrawptr = cx.build.BitCast(v, T_ptr(T_i8()));
     let lltydescs =
         cx.build.GEP(tydesc,
-                     ~[C_int(0), C_int(abi::tydesc_field_first_param)]);
+                     [C_int(0), C_int(abi::tydesc_field_first_param)]);
     lltydescs = cx.build.Load(lltydescs);
 
     let llfn;
     alt static_glue_fn {
       none. {
-        let llfnptr = cx.build.GEP(tydesc, ~[C_int(0), C_int(field)]);
+        let llfnptr = cx.build.GEP(tydesc, [C_int(0), C_int(field)]);
         llfn = cx.build.Load(llfnptr);
       }
       some(sgf) { llfn = sgf; }
     }
 
     cx.build.Call(llfn,
-                  ~[C_null(T_ptr(T_nil())), cx.fcx.lltaskptr,
-                    C_null(T_ptr(T_nil())), lltydescs, llrawptr]);
+                  [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr,
+                   C_null(T_ptr(T_nil())), lltydescs, llrawptr]);
 }
 
 fn call_tydesc_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t, field: int) ->
@@ -2142,7 +2113,7 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t,
     let lltydesc = r.val;
     let lltydescs =
         r.bcx.build.GEP(lltydesc,
-                        ~[C_int(0), C_int(abi::tydesc_field_first_param)]);
+                        [C_int(0), C_int(abi::tydesc_field_first_param)]);
     lltydescs = r.bcx.build.Load(lltydescs);
 
     let llfn;
@@ -2150,7 +2121,7 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t,
       none. {
         let llfnptr =
             r.bcx.build.GEP(lltydesc,
-                            ~[C_int(0), C_int(abi::tydesc_field_cmp_glue)]);
+                            [C_int(0), C_int(abi::tydesc_field_cmp_glue)]);
         llfn = r.bcx.build.Load(llfnptr);
       }
       some(sti) { llfn = option::get(sti.cmp_glue); }
@@ -2158,8 +2129,8 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t,
 
     let llcmpresultptr = alloca(r.bcx, T_i1());
     let llargs: [ValueRef] =
-        ~[llcmpresultptr, r.bcx.fcx.lltaskptr, lltydesc,
-          lltydescs, llrawlhsptr, llrawrhsptr, llop];
+        [llcmpresultptr, r.bcx.fcx.lltaskptr, lltydesc, lltydescs,
+         llrawlhsptr, llrawrhsptr, llop];
     r.bcx.build.Call(llfn, llargs);
     ret rslt(r.bcx, r.bcx.build.Load(llcmpresultptr));
 }
@@ -2218,7 +2189,7 @@ fn call_memmove(cx: &@block_ctxt, dst: ValueRef, src: ValueRef,
     let volatile = C_bool(false);
     ret rslt(cx,
              cx.build.Call(memmove,
-                           ~[dst_ptr, src_ptr, size, align, volatile]));
+                           [dst_ptr, src_ptr, size, align, volatile]));
 }
 
 fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef,
@@ -2237,7 +2208,7 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef,
     let volatile = C_bool(false);
     ret rslt(cx,
              cx.build.Call(memset,
-                           ~[dst_ptr, C_u8(0u), size, align, volatile]));
+                           [dst_ptr, C_u8(0u), size, align, volatile]));
 }
 
 fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: &ty::t) ->
@@ -2248,9 +2219,7 @@ fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: &ty::t) ->
     } else if ty::type_is_structural(bcx_tcx(cx), t) {
         let llsz = llsize_of(type_of(bcx_ccx(cx), cx.sp, t));
         ret call_memmove(cx, dst, src, llsz);
-    } else {
-        ret rslt(cx, cx.build.Store(cx.build.Load(src), dst));
-    }
+    } else { ret rslt(cx, cx.build.Store(cx.build.Load(src), dst)); }
 }
 
 // Duplicates any heap-owned memory owned by a value of the given type.
@@ -2279,17 +2248,17 @@ fn copy_val(cx: &@block_ctxt, action: copy_action, dst: ValueRef,
 
     if ty::type_is_scalar(ccx.tcx, t) || ty::type_is_native(ccx.tcx, t) {
         ret rslt(cx, cx.build.Store(src, dst));
-    } else if (ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t)) {
+    } else if ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t) {
         ret rslt(cx, C_nil());
-    } else if (ty::type_is_boxed(ccx.tcx, t)) {
+    } else if ty::type_is_boxed(ccx.tcx, t) {
         let bcx;
         if action == DROP_EXISTING {
             bcx = drop_ty(cx, cx.build.Load(dst), t).bcx;
         } else { bcx = cx; }
         bcx = copy_ty(bcx, src, t).bcx;
         ret rslt(bcx, bcx.build.Store(src, dst));
-    } else if (ty::type_is_structural(ccx.tcx, t) ||
-                   ty::type_has_dynamic_size(ccx.tcx, t)) {
+    } else if ty::type_is_structural(ccx.tcx, t) ||
+                  ty::type_has_dynamic_size(ccx.tcx, t) {
         // Check for self-assignment.
         let do_copy_cx = new_sub_block_ctxt(cx, "do_copy");
         let next_cx = new_sub_block_ctxt(cx, "next");
@@ -2326,11 +2295,11 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef,
         if src.is_mem { src_val = cx.build.Load(src_val); }
         cx.build.Store(src_val, dst);
         ret rslt(cx, C_nil());
-    } else if (ty::type_is_nil(bcx_tcx(cx), t) ||
-                   ty::type_is_bot(bcx_tcx(cx), t)) {
+    } else if ty::type_is_nil(bcx_tcx(cx), t) ||
+                  ty::type_is_bot(bcx_tcx(cx), t) {
         ret rslt(cx, C_nil());
-    } else if (ty::type_is_unique(bcx_tcx(cx), t) ||
-               ty::type_is_boxed(bcx_tcx(cx), t)) {
+    } else if ty::type_is_unique(bcx_tcx(cx), t) ||
+                  ty::type_is_boxed(bcx_tcx(cx), t) {
         if src.is_mem { src_val = cx.build.Load(src_val); }
         if action == DROP_EXISTING {
             cx = drop_ty(cx, cx.build.Load(dst), t).bcx;
@@ -2341,8 +2310,8 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef,
         // If we're here, it must be a temporary.
         revoke_clean(cx, src_val);
         ret rslt(cx, C_nil());
-    } else if (ty::type_is_structural(bcx_tcx(cx), t) ||
-                   ty::type_has_dynamic_size(bcx_tcx(cx), t)) {
+    } else if ty::type_is_structural(bcx_tcx(cx), t) ||
+                  ty::type_has_dynamic_size(bcx_tcx(cx), t) {
         if action == DROP_EXISTING { cx = drop_ty(cx, dst, t).bcx; }
         cx = memmove_ty(cx, dst, src_val, t).bcx;
         if src.is_mem {
@@ -2375,51 +2344,51 @@ fn trans_lit_istr(cx: &@block_ctxt, s: str) -> result {
     if len < 3u { // 3 because of the \0
         cx.build.Store(C_uint(len + 1u),
                        cx.build.InBoundsGEP(llstackpart,
-                                            ~[C_int(0), C_int(0)]));
+                                            [C_int(0), C_int(0)]));
         cx.build.Store(C_int(4),
                        cx.build.InBoundsGEP(llstackpart,
-                                            ~[C_int(0), C_int(1)]));
+                                            [C_int(0), C_int(1)]));
         let i = 0u;
         while i < len {
-            cx.build.Store(C_u8(s.(i) as uint),
+            cx.build.Store(C_u8(s[i] as uint),
                            cx.build.InBoundsGEP(llstackpart,
-                                                ~[C_int(0), C_int(2),
-                                                  C_uint(i)]));
+                                                [C_int(0), C_int(2),
+                                                 C_uint(i)]));
             i += 1u;
         }
         cx.build.Store(C_u8(0u),
                        cx.build.InBoundsGEP(llstackpart,
-                                            ~[C_int(0), C_int(2),
-                                              C_uint(len)]));
+                                            [C_int(0), C_int(2),
+                                             C_uint(len)]));
 
         bcx = cx;
     } else {
         let r =
             trans_shared_malloc(cx, T_ptr(T_ivec_heap_part(T_i8())),
-                                llsize_of(T_struct(~[T_int(),
-                                                     T_array(T_i8(),
-                                                             len + 1u)])));
+                                llsize_of(T_struct([T_int(),
+                                                    T_array(T_i8(),
+                                                            len + 1u)])));
         bcx = r.bcx;
         let llheappart = r.val;
 
         bcx.build.Store(C_uint(len + 1u),
                         bcx.build.InBoundsGEP(llheappart,
-                                              ~[C_int(0), C_int(0)]));
+                                              [C_int(0), C_int(0)]));
         bcx.build.Store(llvm::LLVMConstString(str::buf(s), len, False),
                         bcx.build.InBoundsGEP(llheappart,
-                                              ~[C_int(0), C_int(1)]));
+                                              [C_int(0), C_int(1)]));
 
         let llspilledstackpart =
             bcx.build.PointerCast(llstackpart, T_ptr(T_ivec_heap(T_i8())));
         bcx.build.Store(C_int(0),
                         bcx.build.InBoundsGEP(llspilledstackpart,
-                                              ~[C_int(0), C_int(0)]));
+                                              [C_int(0), C_int(0)]));
         bcx.build.Store(C_uint(len + 1u),
                         bcx.build.InBoundsGEP(llspilledstackpart,
-                                              ~[C_int(0), C_int(1)]));
+                                              [C_int(0), C_int(1)]));
         bcx.build.Store(llheappart,
                         bcx.build.InBoundsGEP(llspilledstackpart,
-                                              ~[C_int(0), C_int(2)]));
+                                              [C_int(0), C_int(2)]));
     }
 
     ret rslt(bcx, llstackpart);
@@ -2520,9 +2489,8 @@ fn trans_unary(cx: &@block_ctxt, op: ast::unop, e: &@ast::expr,
     }
 }
 
-fn trans_compare(cx: &@block_ctxt, op: ast::binop,
-                 lhs: ValueRef, _lhs_t: ty::t, rhs: ValueRef,
-                 rhs_t: ty::t) -> result {
+fn trans_compare(cx: &@block_ctxt, op: ast::binop, lhs: ValueRef,
+                 _lhs_t: ty::t, rhs: ValueRef, rhs_t: ty::t) -> result {
     // Determine the operation we need.
     let llop;
     alt op {
@@ -2542,9 +2510,8 @@ fn trans_compare(cx: &@block_ctxt, op: ast::binop,
     }
 }
 
-fn trans_evec_append(cx: &@block_ctxt, t: &ty::t,
-                     lhs: ValueRef, rhs: ValueRef)
-   -> result {
+fn trans_evec_append(cx: &@block_ctxt, t: &ty::t, lhs: ValueRef,
+                     rhs: ValueRef) -> result {
     let elt_ty = ty::sequence_element_type(bcx_tcx(cx), t);
     let skip_null = C_bool(false);
     alt ty::struct(bcx_tcx(cx), t) {
@@ -2565,8 +2532,8 @@ fn trans_evec_append(cx: &@block_ctxt, t: &ty::t,
     let src = bcx.build.PointerCast(rhs, T_opaque_vec_ptr());
     ret rslt(bcx,
              bcx.build.Call(bcx_ccx(cx).upcalls.evec_append,
-                            ~[cx.fcx.lltaskptr, llvec_tydesc.val,
-                              llelt_tydesc.val, dst, src, skip_null]));
+                            [cx.fcx.lltaskptr, llvec_tydesc.val,
+                             llelt_tydesc.val, dst, src, skip_null]));
 }
 
 mod ivec {
@@ -2585,11 +2552,11 @@ mod ivec {
 
         let llunitty = type_of_or_i8(bcx, unit_ty);
         let stack_len =
-            load_inbounds(bcx, v, ~[C_int(0), C_uint(abi::ivec_elt_len)]);
+            load_inbounds(bcx, v, [C_int(0), C_uint(abi::ivec_elt_len)]);
         let stack_elem =
             bcx.build.InBoundsGEP(v,
-                                  ~[C_int(0), C_uint(abi::ivec_elt_elems),
-                                    C_int(0)]);
+                                  [C_int(0), C_uint(abi::ivec_elt_elems),
+                                   C_int(0)]);
         let on_heap =
             bcx.build.ICmp(lib::llvm::LLVMIntEQ, stack_len, C_int(0));
         let on_heap_cx = new_sub_block_ctxt(bcx, "on_heap");
@@ -2599,7 +2566,7 @@ mod ivec {
             on_heap_cx.build.PointerCast(v, T_ptr(T_ivec_heap(llunitty)));
         let heap_ptr =
             load_inbounds(on_heap_cx, heap_stub,
-                          ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]);
+                          [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]);
 
         // Check whether the heap pointer is null. If it is, the vector length
         // is truly zero.
@@ -2623,11 +2590,11 @@ mod ivec {
 
         let heap_len =
             load_inbounds(nonzero_len_cx, heap_ptr,
-                          ~[C_int(0), C_uint(abi::ivec_heap_elt_len)]);
+                          [C_int(0), C_uint(abi::ivec_heap_elt_len)]);
         let heap_elem =
             {
                 let v =
-                    ~[C_int(0), C_uint(abi::ivec_heap_elt_elems), C_int(0)];
+                    [C_int(0), C_uint(abi::ivec_heap_elt_elems), C_int(0)];
                 nonzero_len_cx.build.InBoundsGEP(heap_ptr, v)
             };
 
@@ -2636,14 +2603,14 @@ mod ivec {
         // first element.
 
         let len =
-            next_cx.build.Phi(T_int(), ~[stack_len, zero_len, heap_len],
-                              ~[bcx.llbb, zero_len_cx.llbb,
-                                nonzero_len_cx.llbb]);
+            next_cx.build.Phi(T_int(), [stack_len, zero_len, heap_len],
+                              [bcx.llbb, zero_len_cx.llbb,
+                               nonzero_len_cx.llbb]);
         let elem =
             next_cx.build.Phi(T_ptr(llunitty),
-                              ~[stack_elem, zero_elem, heap_elem],
-                              ~[bcx.llbb, zero_len_cx.llbb,
-                                nonzero_len_cx.llbb]);
+                              [stack_elem, zero_elem, heap_elem],
+                              [bcx.llbb, zero_len_cx.llbb,
+                               nonzero_len_cx.llbb]);
         ret {len: len, data: elem, bcx: next_cx};
     }
 
@@ -2652,10 +2619,10 @@ mod ivec {
     fn reserve_space(cx: &@block_ctxt, llunitty: TypeRef, v: ValueRef,
                      len_needed: ValueRef) -> result {
         let stack_len_ptr =
-            cx.build.InBoundsGEP(v, ~[C_int(0), C_uint(abi::ivec_elt_len)]);
+            cx.build.InBoundsGEP(v, [C_int(0), C_uint(abi::ivec_elt_len)]);
         let stack_len = cx.build.Load(stack_len_ptr);
         let alen =
-            load_inbounds(cx, v, ~[C_int(0), C_uint(abi::ivec_elt_alen)]);
+            load_inbounds(cx, v, [C_int(0), C_uint(abi::ivec_elt_alen)]);
         // There are four cases we have to consider:
         // (1) On heap, no resize necessary.
         // (2) On heap, need to resize.
@@ -2671,7 +2638,7 @@ mod ivec {
         let next_cx = new_sub_block_ctxt(cx, "next");
         // We're possibly on the heap, unless the vector is zero-length.
 
-        let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
+        let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
         let stub_ptr =
             maybe_on_heap_cx.build.PointerCast(v,
                                                T_ptr(T_ivec_heap(llunitty)));
@@ -2686,8 +2653,8 @@ mod ivec {
 
         let heap_len_ptr =
             on_heap_cx.build.InBoundsGEP(heap_ptr,
-                                         ~[C_int(0),
-                                           C_uint(abi::ivec_heap_elt_len)]);
+                                         [C_int(0),
+                                          C_uint(abi::ivec_heap_elt_len)]);
         let heap_len = on_heap_cx.build.Load(heap_len_ptr);
         let new_heap_len = on_heap_cx.build.Add(heap_len, len_needed);
         let heap_len_unscaled =
@@ -2703,8 +2670,8 @@ mod ivec {
         let heap_data_no_resize =
             {
                 let v =
-                    ~[C_int(0), C_uint(abi::ivec_heap_elt_elems),
-                      heap_len_unscaled];
+                    [C_int(0), C_uint(abi::ivec_heap_elt_elems),
+                     heap_len_unscaled];
                 heap_no_resize_cx.build.InBoundsGEP(heap_ptr, v)
             };
         heap_no_resize_cx.build.Store(new_heap_len, heap_len_ptr);
@@ -2717,15 +2684,15 @@ mod ivec {
                 heap_resize_cx.build.PointerCast(v, T_ptr(T_opaque_ivec()));
             let upcall = bcx_ccx(cx).upcalls.ivec_resize_shared;
             heap_resize_cx.build.Call(upcall,
-                                      ~[cx.fcx.lltaskptr, p, new_heap_len]);
+                                      [cx.fcx.lltaskptr, p, new_heap_len]);
         }
         let heap_ptr_resize = load_inbounds(heap_resize_cx, stub_ptr, stub_p);
 
         let heap_data_resize =
             {
                 let v =
-                    ~[C_int(0), C_uint(abi::ivec_heap_elt_elems),
-                      heap_len_unscaled];
+                    [C_int(0), C_uint(abi::ivec_heap_elt_elems),
+                     heap_len_unscaled];
                 heap_resize_cx.build.InBoundsGEP(heap_ptr_resize, v)
             };
         heap_resize_cx.build.Br(next_cx.llbb);
@@ -2745,9 +2712,9 @@ mod ivec {
 
         let stack_data_no_spill =
             stack_no_spill_cx.build.InBoundsGEP(v,
-                                                ~[C_int(0),
-                                                  C_uint(abi::ivec_elt_elems),
-                                                  stack_len_unscaled]);
+                                                [C_int(0),
+                                                 C_uint(abi::ivec_elt_elems),
+                                                 stack_len_unscaled]);
         stack_no_spill_cx.build.Store(new_stack_len, stack_len_ptr);
         stack_no_spill_cx.build.Br(next_cx.llbb);
         // Case (4): We're on the stack and need to spill. Like case (2), this
@@ -2758,7 +2725,7 @@ mod ivec {
                 stack_spill_cx.build.PointerCast(v, T_ptr(T_opaque_ivec()));
             let upcall = bcx_ccx(cx).upcalls.ivec_spill_shared;
             stack_spill_cx.build.Call(upcall,
-                                      ~[cx.fcx.lltaskptr, p, new_stack_len]);
+                                      [cx.fcx.lltaskptr, p, new_stack_len]);
         }
         let spill_stub =
             stack_spill_cx.build.PointerCast(v, T_ptr(T_ivec_heap(llunitty)));
@@ -2769,8 +2736,8 @@ mod ivec {
         let heap_data_spill =
             {
                 let v =
-                    ~[C_int(0), C_uint(abi::ivec_heap_elt_elems),
-                      stack_len_unscaled];
+                    [C_int(0), C_uint(abi::ivec_heap_elt_elems),
+                     stack_len_unscaled];
                 stack_spill_cx.build.InBoundsGEP(heap_ptr_spill, v)
             };
         stack_spill_cx.build.Br(next_cx.llbb);
@@ -2778,10 +2745,10 @@ mod ivec {
 
         let data_ptr =
             next_cx.build.Phi(T_ptr(llunitty),
-                              ~[heap_data_no_resize, heap_data_resize,
-                                stack_data_no_spill, heap_data_spill],
-                              ~[heap_no_resize_cx.llbb, heap_resize_cx.llbb,
-                                stack_no_spill_cx.llbb, stack_spill_cx.llbb]);
+                              [heap_data_no_resize, heap_data_resize,
+                               stack_data_no_spill, heap_data_spill],
+                              [heap_no_resize_cx.llbb, heap_resize_cx.llbb,
+                               stack_no_spill_cx.llbb, stack_spill_cx.llbb]);
         ret rslt(next_cx, data_ptr);
     }
     fn trans_append(cx: &@block_ctxt, t: &ty::t, orig_lhs: ValueRef,
@@ -2828,7 +2795,7 @@ mod ivec {
         // Work out the end pointer.
 
         let lhs_unscaled_idx = bcx.build.UDiv(rhs_len, llsize_of(llunitty));
-        let lhs_end = bcx.build.InBoundsGEP(lhs_data, ~[lhs_unscaled_idx]);
+        let lhs_end = bcx.build.InBoundsGEP(lhs_data, [lhs_unscaled_idx]);
         // Now emit the copy loop.
 
         let dest_ptr = alloca(bcx, T_ptr(llunitty));
@@ -2948,12 +2915,12 @@ mod ivec {
         bcx.build.CondBr(len_is_zero, zero_len_cx.llbb, nonzero_len_cx.llbb);
         // Case (1): Length is zero.
 
-        let stub_z = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)];
-        let stub_a = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)];
-        let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
+        let stub_z = [C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)];
+        let stub_a = [C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)];
+        let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
 
-        let vec_l = ~[C_int(0), C_uint(abi::ivec_elt_len)];
-        let vec_a = ~[C_int(0), C_uint(abi::ivec_elt_alen)];
+        let vec_l = [C_int(0), C_uint(abi::ivec_elt_len)];
+        let vec_a = [C_int(0), C_uint(abi::ivec_elt_alen)];
 
         let stub_ptr_zero =
             zero_len_cx.build.PointerCast(llvecptr,
@@ -2984,9 +2951,8 @@ mod ivec {
                              stack_cx.build.InBoundsGEP(llvecptr, vec_a));
         let dest_ptr_stack =
             stack_cx.build.InBoundsGEP(llvecptr,
-                                       ~[C_int(0),
-                                         C_uint(abi::ivec_elt_elems),
-                                         C_int(0)]);
+                                       [C_int(0), C_uint(abi::ivec_elt_elems),
+                                        C_int(0)]);
         let copy_cx = new_sub_block_ctxt(bcx, "copy");
         stack_cx.build.Br(copy_cx.llbb);
         // Case (3): Allocate on heap and copy there.
@@ -3004,35 +2970,35 @@ mod ivec {
         heap_cx.build.Store(heap_part,
                             heap_cx.build.InBoundsGEP(stub_ptr_heap, stub_p));
         {
-            let v = ~[C_int(0), C_uint(abi::ivec_heap_elt_len)];
+            let v = [C_int(0), C_uint(abi::ivec_heap_elt_len)];
             heap_cx.build.Store(lllen,
                                 heap_cx.build.InBoundsGEP(heap_part, v));
         }
         let dest_ptr_heap =
             heap_cx.build.InBoundsGEP(heap_part,
-                                      ~[C_int(0),
-                                        C_uint(abi::ivec_heap_elt_elems),
-                                        C_int(0)]);
+                                      [C_int(0),
+                                       C_uint(abi::ivec_heap_elt_elems),
+                                       C_int(0)]);
         heap_cx.build.Br(copy_cx.llbb);
         // Emit the copy loop.
 
         let first_dest_ptr =
             copy_cx.build.Phi(T_ptr(llunitty),
-                              ~[dest_ptr_stack, dest_ptr_heap],
-                              ~[stack_cx.llbb, heap_cx.llbb]);
+                              [dest_ptr_stack, dest_ptr_heap],
+                              [stack_cx.llbb, heap_cx.llbb]);
 
         let lhs_end_ptr;
         let rhs_end_ptr;
         if ty::type_has_dynamic_size(bcx_tcx(cx), unit_ty) {
-            lhs_end_ptr = copy_cx.build.InBoundsGEP(lhs_data, ~[lhs_len]);
-            rhs_end_ptr = copy_cx.build.InBoundsGEP(rhs_data, ~[rhs_len]);
+            lhs_end_ptr = copy_cx.build.InBoundsGEP(lhs_data, [lhs_len]);
+            rhs_end_ptr = copy_cx.build.InBoundsGEP(rhs_data, [rhs_len]);
         } else {
             let lhs_len_unscaled = copy_cx.build.UDiv(lhs_len, unit_sz);
             lhs_end_ptr =
-                copy_cx.build.InBoundsGEP(lhs_data, ~[lhs_len_unscaled]);
+                copy_cx.build.InBoundsGEP(lhs_data, [lhs_len_unscaled]);
             let rhs_len_unscaled = copy_cx.build.UDiv(rhs_len, unit_sz);
             rhs_end_ptr =
-                copy_cx.build.InBoundsGEP(rhs_data, ~[rhs_len_unscaled]);
+                copy_cx.build.InBoundsGEP(rhs_data, [rhs_len_unscaled]);
         }
 
         let dest_ptr_ptr = alloca(copy_cx, T_ptr(llunitty));
@@ -3123,8 +3089,7 @@ mod ivec {
 
         // Check to see if the vector is heapified.
         let stack_len_ptr =
-            cx.build.InBoundsGEP(vptr,
-                                 ~[C_int(0), C_uint(abi::ivec_elt_len)]);
+            cx.build.InBoundsGEP(vptr, [C_int(0), C_uint(abi::ivec_elt_len)]);
         let stack_len = cx.build.Load(stack_len_ptr);
         let stack_len_is_zero =
             cx.build.ICmp(lib::llvm::LLVMIntEQ, stack_len, C_int(0));
@@ -3137,8 +3102,10 @@ mod ivec {
             maybe_on_heap_cx.build.PointerCast(vptr,
                                                T_ptr(T_ivec_heap(llunitty)));
         let heap_ptr_ptr =
-            maybe_on_heap_cx.build.InBoundsGEP
-            (stub_ptr, ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]);
+            maybe_on_heap_cx.build.InBoundsGEP(
+                stub_ptr,
+                [C_int(0),
+                 C_uint(abi::ivec_heap_stub_elt_ptr)]);
         let heap_ptr = maybe_on_heap_cx.build.Load(heap_ptr_ptr);
         let heap_ptr_is_nonnull =
             maybe_on_heap_cx.build.ICmp(lib::llvm::LLVMIntNE, heap_ptr,
@@ -3149,8 +3116,10 @@ mod ivec {
 
         // Ok, the vector is on the heap. Copy the heap part.
         let alen_ptr =
-            on_heap_cx.build.InBoundsGEP
-            (stub_ptr, ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]);
+            on_heap_cx.build.InBoundsGEP(
+                stub_ptr,
+                [C_int(0),
+                 C_uint(abi::ivec_heap_stub_elt_alen)]);
         let alen = on_heap_cx.build.Load(alen_ptr);
 
         let heap_part_sz =
@@ -3171,9 +3140,8 @@ mod ivec {
     }
 }
 
-fn trans_evec_add(cx: &@block_ctxt, t: &ty::t,
-                  lhs: ValueRef, rhs: ValueRef) ->
-   result {
+fn trans_evec_add(cx: &@block_ctxt, t: &ty::t, lhs: ValueRef, rhs: ValueRef)
+   -> result {
     let r = alloc_ty(cx, t);
     let tmp = r.val;
     r = copy_val(r.bcx, INIT, tmp, lhs, t);
@@ -3190,16 +3158,14 @@ fn trans_eager_binop(cx: &@block_ctxt, op: ast::binop, lhs: ValueRef,
 
     // If either is bottom, it diverges. So no need to do the
     // operation.
-    if (ty::type_is_bot(bcx_tcx(cx), lhs_t) ||
-        ty::type_is_bot(bcx_tcx(cx), rhs_t)) {
+    if ty::type_is_bot(bcx_tcx(cx), lhs_t) ||
+           ty::type_is_bot(bcx_tcx(cx), rhs_t) {
         ret rslt(cx, cx.build.Unreachable());
     }
 
     let is_float = false;
     let intype = lhs_t;
-    if ty::type_is_bot(bcx_tcx(cx), intype) {
-        intype = rhs_t;
-    }
+    if ty::type_is_bot(bcx_tcx(cx), intype) { intype = rhs_t; }
 
     alt ty::struct(bcx_tcx(cx), intype) {
       ty::ty_float. { is_float = true; }
@@ -3257,7 +3223,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t {
         alt ty::struct(ccx.tcx, t1) {
           ty::ty_box(mt) {
             let body =
-                cx.build.GEP(v1, ~[C_int(0), C_int(abi::box_rc_field_body)]);
+                cx.build.GEP(v1, [C_int(0), C_int(abi::box_rc_field_body)]);
             t1 = mt.ty;
 
             // Since we're changing levels of box indirection, we may have
@@ -3272,17 +3238,16 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t {
           ty::ty_uniq(t) { fail "autoderef uniq unimplemented"; }
           ty::ty_res(did, inner, tps) {
             t1 = ty::substitute_type_params(ccx.tcx, tps, inner);
-            v1 = cx.build.GEP(v1, ~[C_int(0), C_int(1)]);
+            v1 = cx.build.GEP(v1, [C_int(0), C_int(1)]);
           }
           ty::ty_tag(did, tps) {
             let variants = ty::tag_variants(ccx.tcx, did);
             if std::vec::len(variants) != 1u ||
-                   std::vec::len(variants.(0).args) != 1u {
+                   std::vec::len(variants[0].args) != 1u {
                 break;
             }
             t1 =
-                ty::substitute_type_params(ccx.tcx, tps,
-                                           variants.(0).args.(0));
+                ty::substitute_type_params(ccx.tcx, tps, variants[0].args[0]);
             if !ty::type_has_dynamic_size(ccx.tcx, t1) {
                 v1 = cx.build.PointerCast(v1, T_ptr(type_of(ccx, cx.sp, t1)));
             }
@@ -3296,6 +3261,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t {
 
 fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr,
                 b: &@ast::expr) -> result {
+
     // First couple cases are lazy:
     alt op {
       ast::and. {
@@ -3314,7 +3280,7 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr,
         let rhs_bcx = trans_block_cleanups(rhs_res.bcx, rhs_cx);
         lhs_res.bcx.build.CondBr(lhs_res.val, rhs_cx.llbb, lhs_false_cx.llbb);
         ret join_results(cx, T_bool(),
-                         ~[lhs_false_res, {bcx: rhs_bcx, val: rhs_res.val}]);
+                         [lhs_false_res, {bcx: rhs_bcx, val: rhs_res.val}]);
       }
       ast::or. {
         // Lazy-eval or
@@ -3328,30 +3294,30 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr,
         let rhs_bcx = trans_block_cleanups(rhs_res.bcx, rhs_cx);
         lhs_res.bcx.build.CondBr(lhs_res.val, lhs_true_cx.llbb, rhs_cx.llbb);
         ret join_results(cx, T_bool(),
-                         ~[lhs_true_res, {bcx: rhs_bcx, val: rhs_res.val}]);
+                         [lhs_true_res, {bcx: rhs_bcx, val: rhs_res.val}]);
       }
       _ {
         // Remaining cases are eager:
         let lhs = trans_expr(cx, a);
         let rhs = trans_expr(lhs.bcx, b);
 
-        ret trans_eager_binop(rhs.bcx, op,
-                              lhs.val, ty::expr_ty(bcx_tcx(cx), a),
-                              rhs.val, ty::expr_ty(bcx_tcx(cx), b));
+        ret trans_eager_binop(rhs.bcx, op, lhs.val,
+                              ty::expr_ty(bcx_tcx(cx), a), rhs.val,
+                              ty::expr_ty(bcx_tcx(cx), b));
       }
     }
 }
 
 fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) ->
    result {
-    let live: [result] = ~[];
-    let vals: [ValueRef] = ~[];
-    let bbs: [BasicBlockRef] = ~[];
+    let live: [result] = [];
+    let vals: [ValueRef] = [];
+    let bbs: [BasicBlockRef] = [];
     for r: result in ins {
         if !is_terminated(r.bcx) {
-            live += ~[r];
-            vals += ~[r.val];
-            bbs += ~[r.bcx.llbb];
+            live += [r];
+            vals += [r.val];
+            bbs += [r.bcx.llbb];
         }
     }
     alt std::vec::len::<result>(live) {
@@ -3361,7 +3327,7 @@ fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) ->
         // is just going to propagate it outward.
 
         assert (std::vec::len::<result>(ins) >= 1u);
-        ret ins.(0);
+        ret ins[0];
       }
       _ {/* fall through */ }
     }
@@ -3384,19 +3350,16 @@ fn join_branches(parent_cx: &@block_ctxt, ins: &[result]) -> @block_ctxt {
 tag out_method { return; save_in(ValueRef); }
 
 fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk,
-            els: &option::t<@ast::expr>, output: &out_method)
-    -> result {
+            els: &option::t<@ast::expr>, output: &out_method) -> result {
     let cond_res = trans_expr(cx, cond);
 
-    if (ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), cond))) {
+    if ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), cond)) {
+
         // No need to generate code for comparison,
         // since the cond diverges.
-        if (!cx.build.is_terminated()) {
+        if !cx.build.is_terminated() {
             ret rslt(cx, cx.build.Unreachable());
-        }
-        else {
-            ret cond_res;
-        }
+        } else { ret cond_res; }
     }
 
     let then_cx = new_scope_block_ctxt(cx, "then");
@@ -3424,7 +3387,7 @@ fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk,
           _ { rslt(else_cx, C_nil()) }
         };
     cond_res.bcx.build.CondBr(cond_res.val, then_cx.llbb, else_cx.llbb);
-    ret rslt(join_branches(cx, ~[then_res, else_res]), C_nil());
+    ret rslt(join_branches(cx, [then_res, else_res]), C_nil());
 }
 
 fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
@@ -3442,8 +3405,10 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
         let local_res = alloc_local(scope_cx, local);
         let loc_r = copy_val(local_res.bcx, INIT, local_res.val, curr, t);
         add_clean(scope_cx, local_res.val, t);
-        let bcx = trans_alt::bind_irrefutable_pat
-           (loc_r.bcx, local.node.pat, local_res.val, cx.fcx.lllocals, false);
+        let bcx =
+            trans_alt::bind_irrefutable_pat(loc_r.bcx, local.node.pat,
+                                            local_res.val, cx.fcx.lllocals,
+                                            false);
         bcx = trans_block(bcx, body, return).bcx;
         if !bcx.build.is_terminated() {
             bcx.build.Br(next_cx.llbb);
@@ -3470,8 +3435,8 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
 // Otherwise, it is stack allocated and copies pointers to the upvars.
 fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
                      bound_tys: [ty::t], bound_vals: [lval_result],
-                     copying: bool)
-    -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
+                     copying: bool) ->
+   {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
     // Synthesize a closure type.
 
     // First, synthesize a tuple type containing the types of all the
@@ -3487,8 +3452,7 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
     // (We'll need room for that many tydescs in the closure.)
     let ty_param_count = std::vec::len(lltydescs);
     let tydesc_ty: ty::t = ty::mk_type(bcx_tcx(bcx));
-    let captured_tys: [ty::t] =
-        std::vec::init_elt(tydesc_ty, ty_param_count);
+    let captured_tys: [ty::t] = std::vec::init_elt(tydesc_ty, ty_param_count);
 
     // Get all the types we've got (some of which we synthesized
     // ourselves) into a vector.  The whole things ends up looking
@@ -3497,28 +3461,30 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
     // closure_tys = [tydesc_ty, [bound_ty1, bound_ty2, ...], [tydesc_ty,
     // tydesc_ty, ...]]
     let closure_tys: [ty::t] =
-        ~[tydesc_ty, bindings_ty, ty::mk_tup(bcx_tcx(bcx), captured_tys)];
+        [tydesc_ty, bindings_ty, ty::mk_tup(bcx_tcx(bcx), captured_tys)];
 
     // Finally, synthesize a type for that whole vector.
     let closure_ty: ty::t = ty::mk_tup(bcx_tcx(bcx), closure_tys);
 
     // Allocate a box that can hold something closure-sized.
-    let r = if copying {
-        trans_malloc_boxed(bcx, closure_ty)
-    } else {
-        // We need to dummy up a box on the stack
-        let ty = ty::mk_tup(bcx_tcx(bcx),
-                                ~[ty::mk_int(bcx_tcx(bcx)), closure_ty]);
-        let r = alloc_ty(bcx, ty);
-        let body = GEPi(bcx, r.val, ~[0, abi::box_rc_field_body]);
-        {bcx: r.bcx, box: r.val, body: body}
-    };
+    let r =
+        if copying {
+            trans_malloc_boxed(bcx, closure_ty)
+        } else {
+            // We need to dummy up a box on the stack
+            let ty =
+                ty::mk_tup(bcx_tcx(bcx),
+                           [ty::mk_int(bcx_tcx(bcx)), closure_ty]);
+            let r = alloc_ty(bcx, ty);
+            let body = GEPi(bcx, r.val, [0, abi::box_rc_field_body]);
+            {bcx: r.bcx, box: r.val, body: body}
+        };
     bcx = r.bcx;
     let closure = r.body;
 
     // Store bindings tydesc.
     if copying {
-        let bound_tydesc = GEPi(bcx, closure, ~[0, abi::closure_elt_tydesc]);
+        let bound_tydesc = GEPi(bcx, closure, [0, abi::closure_elt_tydesc]);
         let ti = none;
         let bindings_tydesc = get_tydesc(bcx, bindings_ty, true, ti).result;
         lazily_emit_tydesc_glue(bcx, abi::tydesc_field_drop_glue, ti);
@@ -3531,18 +3497,16 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
     let i = 0u;
     let bindings =
         GEP_tup_like(bcx, closure_ty, closure,
-                     ~[0, abi::closure_elt_bindings]);
+                     [0, abi::closure_elt_bindings]);
     bcx = bindings.bcx;
     for lv: lval_result in bound_vals {
-        let bound = GEP_tup_like(bcx, bindings_ty, bindings.val,
-                                 ~[0, i as int]);
+        let bound =
+            GEP_tup_like(bcx, bindings_ty, bindings.val, [0, i as int]);
         bcx = bound.bcx;
         if copying {
-            bcx = move_val_if_temp(bcx, INIT,
-                                   bound.val, lv, bound_tys.(i)).bcx;
-        } else {
-            bcx.build.Store(lv.res.val, bound.val);
-        }
+            bcx =
+                move_val_if_temp(bcx, INIT, bound.val, lv, bound_tys[i]).bcx;
+        } else { bcx.build.Store(lv.res.val, bound.val); }
         i += 1u;
     }
 
@@ -3550,11 +3514,11 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
     // appropriate slot in the closure.
     let ty_params_slot =
         GEP_tup_like(bcx, closure_ty, closure,
-                     ~[0, abi::closure_elt_ty_params]);
+                     [0, abi::closure_elt_ty_params]);
     bcx = ty_params_slot.bcx;
     i = 0u;
     for td: ValueRef in lltydescs {
-        let ty_param_slot = GEPi(bcx, ty_params_slot.val, ~[0, i as int]);
+        let ty_param_slot = GEPi(bcx, ty_params_slot.val, [0, i as int]);
         bcx.build.Store(td, ty_param_slot);
         i += 1u;
     }
@@ -3564,25 +3528,25 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
 
 // Given a context and a list of upvars, build a closure. This just
 // collects the upvars and packages them up for build_environment.
-fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool)
-    -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
-        let closure_vals: [lval_result] = ~[];
-        let closure_tys: [ty::t] = ~[];
-        // If we need to, package up the iterator body to call
-        if !copying && !option::is_none(cx.fcx.lliterbody) {
-            closure_vals += ~[lval_mem(cx, option::get(cx.fcx.lliterbody))];
-            closure_tys += ~[option::get(cx.fcx.iterbodyty)];
-        }
-        // Package up the upvars
-        for nid: ast::node_id in *upvars {
-            closure_vals += ~[trans_var(cx, cx.sp, nid)];
-            let ty = ty::node_id_to_monotype(bcx_tcx(cx), nid);
-            if !copying { ty = ty::mk_mut_ptr(bcx_tcx(cx), ty); }
-            closure_tys += ~[ty];
-        }
+fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool) ->
+   {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
+    let closure_vals: [lval_result] = [];
+    let closure_tys: [ty::t] = [];
+    // If we need to, package up the iterator body to call
+    if !copying && !option::is_none(cx.fcx.lliterbody) {
+        closure_vals += [lval_mem(cx, option::get(cx.fcx.lliterbody))];
+        closure_tys += [option::get(cx.fcx.iterbodyty)];
+    }
+    // Package up the upvars
+    for nid: ast::node_id in *upvars {
+        closure_vals += [trans_var(cx, cx.sp, nid)];
+        let ty = ty::node_id_to_monotype(bcx_tcx(cx), nid);
+        if !copying { ty = ty::mk_mut_ptr(bcx_tcx(cx), ty); }
+        closure_tys += [ty];
+    }
 
-        ret build_environment(cx, cx.fcx.lltydescs,
-                              closure_tys, closure_vals, copying);
+    ret build_environment(cx, cx.fcx.lltydescs, closure_tys, closure_vals,
+                          copying);
 }
 
 // Return a pointer to the stored typarams in a closure.
@@ -3593,34 +3557,36 @@ fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool)
 fn find_environment_tydescs(bcx: &@block_ctxt, envty: &ty::t,
                             closure: ValueRef) -> ValueRef {
     ret if !ty::type_has_dynamic_size(bcx_tcx(bcx), envty) {
-        // If we can find the typarams statically, do it
-        GEPi(bcx, closure,
-             ~[0, abi::box_rc_field_body, abi::closure_elt_ty_params])
-    } else {
-        // Ugh. We need to load the size of the bindings out of the
-        // closure's tydesc and use that to skip over the bindings.
-        let descsty =
-            ty::get_element_type(bcx_tcx(bcx), envty,
-                                 abi::closure_elt_ty_params as uint);
-        let llenv = GEPi(bcx, closure, ~[0, abi::box_rc_field_body]);
-        // Load the tydesc and find the size of the body
-        let lldesc =
-            bcx.build.Load(GEPi(bcx, llenv, ~[0, abi::closure_elt_tydesc]));
-        let llsz = bcx.build.Load(
-            GEPi(bcx, lldesc, ~[0, abi::tydesc_field_size]));
 
-        // Get the bindings pointer and add the size to it
-        let llbinds = GEPi(bcx, llenv, ~[0, abi::closure_elt_bindings]);
-        bump_ptr(bcx, descsty, llbinds, llsz)
-    }
+            // If we can find the typarams statically, do it
+            GEPi(bcx, closure,
+                 [0, abi::box_rc_field_body, abi::closure_elt_ty_params])
+        } else {
+            // Ugh. We need to load the size of the bindings out of the
+            // closure's tydesc and use that to skip over the bindings.
+            let descsty =
+                ty::get_element_type(bcx_tcx(bcx), envty,
+                                     abi::closure_elt_ty_params as uint);
+            let llenv = GEPi(bcx, closure, [0, abi::box_rc_field_body]);
+            // Load the tydesc and find the size of the body
+            let lldesc =
+                bcx.build.Load(GEPi(bcx, llenv,
+                                    [0, abi::closure_elt_tydesc]));
+            let llsz =
+                bcx.build.Load(GEPi(bcx, lldesc,
+                                    [0, abi::tydesc_field_size]));
+
+            // Get the bindings pointer and add the size to it
+            let llbinds = GEPi(bcx, llenv, [0, abi::closure_elt_bindings]);
+            bump_ptr(bcx, descsty, llbinds, llsz)
+        }
 }
 
 // Given an enclosing block context, a new function context, a closure type,
 // and a list of upvars, generate code to load and populate the environment
 // with the upvars and type descriptors.
-fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt,
-                    envty: &ty::t, upvars: &@[ast::node_id],
-                    copying: bool) {
+fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt, envty: &ty::t,
+                    upvars: &@[ast::node_id], copying: bool) {
     let bcx = new_raw_block_ctxt(fcx, fcx.llcopyargs);
 
     let ty = ty::mk_imm_box(bcx_tcx(bcx), envty);
@@ -3634,26 +3600,26 @@ fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt,
     let lltydescs = find_environment_tydescs(bcx, envty, llclosure);
     let i = 0u;
     while i < tydesc_count {
-        let lltydescptr = GEPi(bcx, lltydescs, ~[0, i as int]);
-        fcx.lltydescs += ~[bcx.build.Load(lltydescptr)];
+        let lltydescptr = GEPi(bcx, lltydescs, [0, i as int]);
+        fcx.lltydescs += [bcx.build.Load(lltydescptr)];
         i += 1u;
     }
 
     // Populate the upvars from the environment.
-    let path = ~[0, abi::box_rc_field_body, abi::closure_elt_bindings];
+    let path = [0, abi::box_rc_field_body, abi::closure_elt_bindings];
     i = 0u;
     // If this is an aliasing closure/for-each body, we need to load
     // the iterbody.
     if !copying && !option::is_none(enclosing_cx.fcx.lliterbody) {
-        let iterbodyptr = GEP_tup_like(bcx, ty, llclosure, path + ~[0]);
+        let iterbodyptr = GEP_tup_like(bcx, ty, llclosure, path + [0]);
         fcx.lliterbody = some(bcx.build.Load(iterbodyptr.val));
         bcx = iterbodyptr.bcx;
         i += 1u;
     }
+
     // Load the acutal upvars.
     for upvar_id: ast::node_id in *upvars {
-        let upvarptr =
-            GEP_tup_like(bcx, ty, llclosure, path + ~[i as int]);
+        let upvarptr = GEP_tup_like(bcx, ty, llclosure, path + [i as int]);
         bcx = upvarptr.bcx;
         let llupvarptr = upvarptr.val;
         if !copying { llupvarptr = bcx.build.Load(llupvarptr); }
@@ -3720,9 +3686,10 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
 
     let bcx = new_top_block_ctxt(fcx);
     // Add bindings for the loop variable alias.
-    bcx = trans_alt::bind_irrefutable_pat
-        (bcx, local.node.pat, llvm::LLVMGetParam(fcx.llfn, 3u),
-         bcx.fcx.lllocals, false);
+    bcx =
+        trans_alt::bind_irrefutable_pat(bcx, local.node.pat,
+                                        llvm::LLVMGetParam(fcx.llfn, 3u),
+                                        bcx.fcx.lllocals, false);
     let lltop = bcx.llbb;
     let r = trans_block(bcx, body, return);
     finish_fn(fcx, lltop);
@@ -3770,12 +3737,8 @@ fn trans_do_while(cx: &@block_ctxt, body: &ast::blk, cond: &@ast::expr) ->
         // This is kind of ridiculous, but no permutations
         // involving body_res or body_cx.val worked.
         let rs = trans_block(cx, body, return);
-        if ! is_terminated (next_cx) {
-            next_cx.build.Unreachable();
-        }
-        if ! is_terminated (body_cx) {
-            body_cx.build.Unreachable();
-        }
+        if !is_terminated(next_cx) { next_cx.build.Unreachable(); }
+        if !is_terminated(body_cx) { body_cx.build.Unreachable(); }
         ret rs;
     }
     let cond_res = trans_expr(body_res.bcx, cond);
@@ -3834,16 +3797,16 @@ fn lval_generic_fn(cx: &@block_ctxt, tpt: &ty::ty_param_kinds_and_ty,
     let tys = ty::node_id_to_type_params(bcx_tcx(cx), id);
     if std::vec::len::<ty::t>(tys) != 0u {
         let bcx = lv.res.bcx;
-        let tydescs: [ValueRef] = ~[];
-        let tis: [option::t<@tydesc_info>] = ~[];
+        let tydescs: [ValueRef] = [];
+        let tis: [option::t<@tydesc_info>] = [];
         for t: ty::t in tys {
             // TODO: Doesn't always escape.
 
             let ti = none::<@tydesc_info>;
             let td = get_tydesc(bcx, t, true, ti).result;
-            tis += ~[ti];
+            tis += [ti];
             bcx = td.bcx;
-            tydescs += ~[td.val];
+            tydescs += [td.val];
         }
         let gen = {item_type: tpt.ty, static_tis: tis, tydescs: tydescs};
         lv = {res: rslt(bcx, lv.res.val), generic: some(gen) with lv};
@@ -3868,8 +3831,7 @@ fn lookup_discriminant(lcx: &@local_ctxt, vid: &ast::def_id) -> ValueRef {
     }
 }
 
-fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) ->
-   lval_result {
+fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) -> lval_result {
     let ccx = bcx_ccx(cx);
     alt freevars::def_lookup(bcx_tcx(cx), cx.fcx.id, id) {
       some(ast::def_upvar(did, _)) {
@@ -3916,7 +3878,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) ->
                 let lldiscrim_gv = lookup_discriminant(bcx.fcx.lcx, vid);
                 let lldiscrim = bcx.build.Load(lldiscrim_gv);
                 let lldiscrimptr =
-                    bcx.build.GEP(lltagptr, ~[C_int(0), C_int(0)]);
+                    bcx.build.GEP(lltagptr, [C_int(0), C_int(0)]);
                 bcx.build.Store(lldiscrim, lldiscrimptr);
             }
             ret lval_val(bcx, lltagptr);
@@ -3929,7 +3891,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) ->
             ret lval_mem(cx, ccx.consts.get(did.node));
         } else {
             let tp = ty::node_id_to_monotype(ccx.tcx, id);
-            let k: [ast::kind] = ~[];
+            let k: [ast::kind] = [];
             ret lval_val(cx,
                          load_if_immediate(cx,
                                            trans_external_path(cx, did,
@@ -3958,20 +3920,20 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: &ty::t,
     alt ty::struct(bcx_tcx(cx), t) {
       ty::ty_rec(fields) {
         let ix: uint = ty::field_idx(bcx_ccx(cx).sess, sp, field, fields);
-        let v = GEP_tup_like(r.bcx, t, r.val, ~[0, ix as int]);
+        let v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]);
         ret lval_mem(v.bcx, v.val);
       }
       ty::ty_obj(methods) {
         let ix: uint = ty::method_idx(bcx_ccx(cx).sess, sp, field, methods);
         let vtbl =
-            r.bcx.build.GEP(r.val, ~[C_int(0), C_int(abi::obj_field_vtbl)]);
+            r.bcx.build.GEP(r.val, [C_int(0), C_int(abi::obj_field_vtbl)]);
         vtbl = r.bcx.build.Load(vtbl);
 
         let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u));
         vtbl = cx.build.PointerCast(vtbl, vtbl_type);
 
-        let v = r.bcx.build.GEP(vtbl, ~[C_int(0), C_int(ix as int)]);
-        let fn_ty: ty::t = ty::method_ty_to_fn_ty(bcx_tcx(cx), methods.(ix));
+        let v = r.bcx.build.GEP(vtbl, [C_int(0), C_int(ix as int)]);
+        let fn_ty: ty::t = ty::method_ty_to_fn_ty(bcx_tcx(cx), methods[ix]);
         let tcx = bcx_tcx(cx);
         let ll_fn_ty =
             type_of_fn_full(bcx_ccx(cx), sp, ty::ty_fn_proto(tcx, fn_ty),
@@ -4005,7 +3967,7 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr,
     let int_size = llsize_of_real(bcx_ccx(cx), T_int());
     if ix_size < int_size {
         ix_val = bcx.build.ZExt(ix.val, T_int());
-    } else if (ix_size > int_size) {
+    } else if ix_size > int_size {
         ix_val = bcx.build.Trunc(ix.val, T_int());
     } else { ix_val = ix.val; }
     let unit_ty = node_id_type(bcx_ccx(cx), id);
@@ -4024,7 +3986,7 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr,
     alt interior_len_and_data {
       some(lad) { lim = lad.len; }
       none. {
-        lim = bcx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_fill)]);
+        lim = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]);
         lim = bcx.build.Load(lim);
       }
     }
@@ -4041,16 +4003,15 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr,
       none. {
         body =
             next_cx.build.GEP(v,
-                              ~[C_int(0), C_int(abi::vec_elt_data),
-                                C_int(0)]);
+                              [C_int(0), C_int(abi::vec_elt_data), C_int(0)]);
       }
     }
     let elt;
     if ty::type_has_dynamic_size(bcx_tcx(cx), unit_ty) {
         body = next_cx.build.PointerCast(body, T_ptr(T_i8()));
-        elt = next_cx.build.GEP(body, ~[scaled_ix]);
+        elt = next_cx.build.GEP(body, [scaled_ix]);
     } else {
-        elt = next_cx.build.GEP(body, ~[ix_val]);
+        elt = next_cx.build.GEP(body, [ix_val]);
         // We're crossing a box boundary here, so we may need to pointer cast.
 
         let llunitty = type_of(bcx_ccx(next_cx), sp, unit_ty);
@@ -4082,12 +4043,12 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result {
             alt ty::struct(ccx.tcx, t) {
               ty::ty_box(_) {
                 sub.bcx.build.InBoundsGEP(sub.val,
-                                          ~[C_int(0),
-                                            C_int(abi::box_rc_field_body)])
+                                          [C_int(0),
+                                           C_int(abi::box_rc_field_body)])
               }
               ty::ty_uniq(_) { fail "uniq lval translation unimplemented" }
               ty::ty_res(_, _, _) {
-                sub.bcx.build.InBoundsGEP(sub.val, ~[C_int(0), C_int(1)])
+                sub.bcx.build.InBoundsGEP(sub.val, [C_int(0), C_int(1)])
               }
               ty::ty_tag(_, _) {
                 let ety = ty::expr_ty(ccx.tcx, e);
@@ -4147,9 +4108,9 @@ fn int_cast(bcx: &@block_ctxt, lldsttype: TypeRef, llsrctype: TypeRef,
     let dstsz = llvm::LLVMGetIntTypeWidth(lldsttype);
     ret if dstsz == srcsz {
             bcx.build.BitCast(llsrc, lldsttype)
-        } else if (srcsz > dstsz) {
+        } else if srcsz > dstsz {
             bcx.build.TruncOrBitCast(llsrc, lldsttype)
-        } else if (signed) {
+        } else if signed {
             bcx.build.SExtOrBitCast(llsrc, lldsttype)
         } else { bcx.build.ZExtOrBitCast(llsrc, lldsttype) };
 }
@@ -4160,7 +4121,7 @@ fn float_cast(bcx: &@block_ctxt, lldsttype: TypeRef, llsrctype: TypeRef,
     let dstsz = lib::llvm::float_width(lldsttype);
     ret if dstsz > srcsz {
             bcx.build.FPExt(llsrc, lldsttype)
-        } else if (srcsz > dstsz) {
+        } else if srcsz > dstsz {
             bcx.build.FPTrunc(llsrc, lldsttype)
         } else { llsrc };
 }
@@ -4177,9 +4138,9 @@ fn trans_cast(cx: &@block_ctxt, e: &@ast::expr, id: ast::node_id) -> result {
     fn t_kind(tcx: &ty::ctxt, t: ty::t) -> kind {
         ret if ty::type_is_fp(tcx, t) {
                 float
-            } else if (ty::type_is_native(tcx, t)) {
+            } else if ty::type_is_native(tcx, t) {
                 native_
-            } else if (ty::type_is_integral(tcx, t)) {
+            } else if ty::type_is_integral(tcx, t) {
                 integral
             } else { other };
     }
@@ -4223,7 +4184,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
                     outgoing_fty: &ty::t, args: &[option::t<@ast::expr>],
                     env_ty: &ty::t, ty_param_count: uint,
                     target_fn: &option::t<ValueRef>) ->
-    {val: ValueRef, ty: TypeRef} {
+   {val: ValueRef, ty: TypeRef} {
 
     // Here we're not necessarily constructing a thunk in the sense of
     // "function with no arguments".  The result of compiling 'bind f(foo,
@@ -4281,22 +4242,23 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
     // creating.  (In our running example, target is the function f.)  Pick
     // out the pointer to the target function from the environment. The
     // target function lives in the first binding spot.
-    let (lltarget, starting_idx) = alt target_fn {
-      some(lltarget) { (lltarget, 0) }
-      none. {
-        let lltarget =
-            GEP_tup_like(bcx, closure_ty, llclosure,
-                         ~[0, abi::box_rc_field_body,
-                           abi::closure_elt_bindings, 0]);
-        bcx = lltarget.bcx;
-        (lltarget.val, 1)
-      }
-    };
+    let (lltarget, starting_idx) =
+        alt target_fn {
+          some(lltarget) { (lltarget, 0) }
+          none. {
+            let lltarget =
+                GEP_tup_like(bcx, closure_ty, llclosure,
+                             [0, abi::box_rc_field_body,
+                              abi::closure_elt_bindings, 0]);
+            bcx = lltarget.bcx;;
+            (lltarget.val, 1)
+          }
+        };
 
     // And then, pick out the target function's own environment.  That's what
     // we'll use as the environment the thunk gets.
     let lltargetclosure =
-        bcx.build.GEP(lltarget, ~[C_int(0), C_int(abi::fn_field_box)]);
+        bcx.build.GEP(lltarget, [C_int(0), C_int(abi::fn_field_box)]);
     lltargetclosure = bcx.build.Load(lltargetclosure);
 
     // Get f's return type, which will also be the return type of the entire
@@ -4315,19 +4277,19 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
     }
 
     // Set up the three implicit arguments to the thunk.
-    let llargs: [ValueRef] = ~[llretptr, fcx.lltaskptr, lltargetclosure];
+    let llargs: [ValueRef] = [llretptr, fcx.lltaskptr, lltargetclosure];
 
     // Copy in the type parameters.
     let i: uint = 0u;
     while i < ty_param_count {
         let lltyparam_ptr =
             GEP_tup_like(copy_args_bcx, closure_ty, llclosure,
-                         ~[0, abi::box_rc_field_body,
-                           abi::closure_elt_ty_params, i as int]);
+                         [0, abi::box_rc_field_body,
+                          abi::closure_elt_ty_params, i as int]);
         copy_args_bcx = lltyparam_ptr.bcx;
         let td = copy_args_bcx.build.Load(lltyparam_ptr.val);
-        llargs += ~[td];
-        fcx.lltydescs += ~[td];
+        llargs += [td];
+        fcx.lltydescs += [td];
         i += 1u;
     }
 
@@ -4337,25 +4299,26 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
     let llout_arg_tys: [TypeRef] =
         type_of_explicit_args(cx.ccx, sp, outgoing_args);
     for arg: option::t<@ast::expr> in args {
-        let out_arg = outgoing_args.(outgoing_arg_index);
-        let llout_arg_ty = llout_arg_tys.(outgoing_arg_index);
+        let out_arg = outgoing_args[outgoing_arg_index];
+        let llout_arg_ty = llout_arg_tys[outgoing_arg_index];
         let is_val = out_arg.mode == ty::mo_val;
         alt arg {
+
           // Arg provided at binding time; thunk copies it from
           // closure.
           some(e) {
             let e_ty = ty::expr_ty(cx.ccx.tcx, e);
             let bound_arg =
                 GEP_tup_like(bcx, closure_ty, llclosure,
-                             ~[0, abi::box_rc_field_body,
-                               abi::closure_elt_bindings, b]);
+                             [0, abi::box_rc_field_body,
+                              abi::closure_elt_bindings, b]);
             bcx = bound_arg.bcx;
             let val = bound_arg.val;
             // If the type is parameterized, then we need to cast the
             // type we actually have to the parameterized out type.
             if ty::type_contains_params(cx.ccx.tcx, out_arg.ty) {
-                let ty = if is_val
-                         { T_ptr(llout_arg_ty) } else { llout_arg_ty };
+                let ty =
+                    if is_val { T_ptr(llout_arg_ty) } else { llout_arg_ty };
                 val = bcx.build.PointerCast(val, ty);
             }
             if is_val {
@@ -4367,14 +4330,16 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
                     val = bcx.build.Load(val);
                 }
             }
-            llargs += ~[val];
+            llargs += [val];
             b += 1;
           }
 
+
           // Arg will be provided when the thunk is invoked.
           none. {
             let arg: ValueRef = llvm::LLVMGetParam(llthunk, a);
             if ty::type_contains_params(cx.ccx.tcx, out_arg.ty) {
+
                 // If the argument was passed by value and isn't a
                 // pointer type, we need to spill it to an alloca in
                 // order to do a pointer cast. Argh.
@@ -4382,11 +4347,9 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
                     let argp = do_spill(bcx, arg);
                     argp = bcx.build.PointerCast(argp, T_ptr(llout_arg_ty));
                     arg = bcx.build.Load(argp);
-                } else {
-                    arg = bcx.build.PointerCast(arg, llout_arg_ty);
-                }
+                } else { arg = bcx.build.PointerCast(arg, llout_arg_ty); }
             }
-            llargs += ~[arg];
+            llargs += [arg];
             a += 1u;
           }
         }
@@ -4394,7 +4357,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t,
     }
 
     let lltargetfn =
-        bcx.build.GEP(lltarget, ~[C_int(0), C_int(abi::fn_field_code)]);
+        bcx.build.GEP(lltarget, [C_int(0), C_int(abi::fn_field_code)]);
 
     // Cast the outgoing function to the appropriate type.
     // This is necessary because the type of the function that we have
@@ -4417,11 +4380,10 @@ fn trans_bind(cx: &@block_ctxt, f: &@ast::expr,
 }
 
 fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result,
-                args: &[option::t<@ast::expr>], id: ast::node_id) ->
-   result {
-    let bound: [@ast::expr] = ~[];
+                args: &[option::t<@ast::expr>], id: ast::node_id) -> result {
+    let bound: [@ast::expr] = [];
     for argopt: option::t<@ast::expr> in args {
-        alt argopt { none. { } some(e) { bound += ~[e]; } }
+        alt argopt { none. { } some(e) { bound += [e]; } }
     }
 
     // Figure out which tydescs we need to pass, if any.
@@ -4429,7 +4391,7 @@ fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result,
     let outgoing_fty_real; // the type with typarams still in it
     let lltydescs: [ValueRef];
     alt f_res.generic {
-      none. { outgoing_fty_real = outgoing_fty; lltydescs = ~[]; }
+      none. { outgoing_fty_real = outgoing_fty; lltydescs = []; }
       some(ginfo) {
         lazily_emit_all_generic_info_tydesc_glues(cx, ginfo);
         outgoing_fty_real = ginfo.item_type;
@@ -4447,51 +4409,48 @@ fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result,
 
     // Arrange for the bound function to live in the first binding spot
     // if the function is not statically known.
-    let (bound_tys, bound_vals, target_res) = if f_res.is_mem {
-        // Cast the function we are binding to be the type that the closure
-        // will expect it to have. The type the closure knows about has the
-        // type parameters substituted with the real types.
-        let llclosurety = T_ptr(type_of(bcx_ccx(cx), cx.sp, outgoing_fty));
-        let src_loc = bcx.build.PointerCast(f_res.res.val, llclosurety);
-        let bound_f = {res: {bcx: bcx, val: src_loc} with f_res};
-        (~[outgoing_fty], ~[bound_f], none)
-    } else {
-        (~[], ~[], some(f_res.res.val))
-    };
+    let (bound_tys, bound_vals, target_res) =
+        if f_res.is_mem {
+            // Cast the function we are binding to be the type that the
+            // closure will expect it to have. The type the closure knows
+            // about has the type parameters substituted with the real types.
+            let llclosurety =
+                T_ptr(type_of(bcx_ccx(cx), cx.sp, outgoing_fty));
+            let src_loc = bcx.build.PointerCast(f_res.res.val, llclosurety);
+            let bound_f = {res: {bcx: bcx, val: src_loc} with f_res};
+            ([outgoing_fty], [bound_f], none)
+        } else { ([], [], some(f_res.res.val)) };
 
     // Translate the bound expressions.
     for e: @ast::expr in bound {
         let lv = trans_lval(bcx, e);
         bcx = lv.res.bcx;
-        bound_vals += ~[lv];
-        bound_tys += ~[ty::expr_ty(bcx_tcx(cx), e)];
+        bound_vals += [lv];
+        bound_tys += [ty::expr_ty(bcx_tcx(cx), e)];
     }
 
     // Actually construct the closure
-    let closure = build_environment(bcx, lltydescs,
-                                    bound_tys, bound_vals, true);
+    let closure =
+        build_environment(bcx, lltydescs, bound_tys, bound_vals, true);
     bcx = closure.bcx;
 
     // Make thunk
     // The type of the entire bind expression.
     let pair_ty = node_id_type(bcx_ccx(cx), id);
     let llthunk =
-        trans_bind_thunk(cx.fcx.lcx, cx.sp, pair_ty, outgoing_fty_real,
-                         args, closure.ptrty, ty_param_count,
-                         target_res);
+        trans_bind_thunk(cx.fcx.lcx, cx.sp, pair_ty, outgoing_fty_real, args,
+                         closure.ptrty, ty_param_count, target_res);
 
     // Construct the function pair
-    let pair_v = create_real_fn_pair(bcx, llthunk.ty, llthunk.val,
-                                     closure.ptr);
+    let pair_v =
+        create_real_fn_pair(bcx, llthunk.ty, llthunk.val, closure.ptr);
     add_clean_temp(cx, pair_v, pair_ty);
     ret rslt(bcx, pair_v);
 }
 
-fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg,
-                  lldestty0: TypeRef,
-                  to_zero: &mutable[{v:ValueRef, t: ty::t}],
-                  to_revoke: &mutable[ValueRef],
-                  e: &@ast::expr) -> result {
+fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, lldestty0: TypeRef,
+                  to_zero: &mutable [{v: ValueRef, t: ty::t}],
+                  to_revoke: &mutable [ValueRef], e: &@ast::expr) -> result {
     let ccx = bcx_ccx(cx);
     let e_ty = ty::expr_ty(ccx.tcx, e);
     let is_bot = ty::type_is_bot(ccx.tcx, e_ty);
@@ -4504,12 +4463,12 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg,
         // be inspected. It's important for the value
         // to have type lldestty0 (the callee's expected type).
         val = llvm::LLVMGetUndef(lldestty0);
-    } else if (arg.mode == ty::mo_val) {
+    } else if arg.mode == ty::mo_val {
         if ty::type_owns_heap_mem(ccx.tcx, e_ty) {
             let dst = alloc_ty(bcx, e_ty);
             val = dst.val;
             bcx = move_val_if_temp(dst.bcx, INIT, val, lv, e_ty).bcx;
-        } else if (lv.is_mem) {
+        } else if lv.is_mem {
             val = load_if_immediate(bcx, val, e_ty);
             bcx = copy_ty(bcx, val, e_ty).bcx;
         } else {
@@ -4529,7 +4488,7 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg,
                 bcx = copy_ty(bcx, val, e_ty).bcx;
             } else { revoke_clean(bcx, val); }
         }
-    } else if (type_is_immediate(ccx, e_ty) && !lv.is_mem) {
+    } else if type_is_immediate(ccx, e_ty) && !lv.is_mem {
         val = do_spill(bcx, val);
     }
 
@@ -4549,12 +4508,10 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg,
     // Collect arg for later if it happens to be one we've moving out.
     if arg.mode == ty::mo_move {
         if lv.is_mem {
-      // Use actual ty, not declared ty -- anything else doesn't make sense
-      // if declared ty is a ty param
-            to_zero += ~[{v: lv.res.val, t: e_ty}];
-        } else {
-            to_revoke += ~[lv.res.val];
-        }
+            // Use actual ty, not declared ty -- anything else doesn't make
+            // sense if declared ty is a ty param
+            to_zero += [{v: lv.res.val, t: e_ty}];
+        } else { to_revoke += [lv.res.val]; }
     }
     ret rslt(bcx, val);
 }
@@ -4572,14 +4529,14 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef,
    {bcx: @block_ctxt,
     args: [ValueRef],
     retslot: ValueRef,
-    to_zero: [{v:ValueRef, t: ty::t}],
-    to_revoke: [ValueRef] } {
+    to_zero: [{v: ValueRef, t: ty::t}],
+    to_revoke: [ValueRef]} {
 
     let args: [ty::arg] = ty::ty_fn_args(bcx_tcx(cx), fn_ty);
-    let llargs: [ValueRef] = ~[];
-    let lltydescs: [ValueRef] = ~[];
-    let to_zero = ~[];
-    let to_revoke = ~[];
+    let llargs: [ValueRef] = [];
+    let lltydescs: [ValueRef] = [];
+    let to_zero = [];
+    let to_revoke = [];
 
     let bcx: @block_ctxt = cx;
     // Arg 0: Output pointer.
@@ -4589,8 +4546,11 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef,
     if bcx.build.is_terminated() {
         // This means an earlier arg was divergent.
         // So this arg can't be evaluated.
-        ret {bcx: bcx, args: ~[], retslot: C_nil(),
-             to_zero: to_zero, to_revoke: to_revoke};
+        ret {bcx: bcx,
+             args: [],
+             retslot: C_nil(),
+             to_zero: to_zero,
+             to_revoke: to_revoke};
     }
     let retty = ty::ty_fn_ret(bcx_tcx(cx), fn_ty);
     let llretslot_res = alloc_ty(bcx, retty);
@@ -4605,21 +4565,21 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef,
       }
       _ { }
     }
-    if (ty::type_contains_params(bcx_tcx(cx), retty)) {
+    if ty::type_contains_params(bcx_tcx(cx), retty) {
         // It's possible that the callee has some generic-ness somewhere in
         // its return value -- say a method signature within an obj or a fn
         // type deep in a structure -- which the caller has a concrete view
         // of. If so, cast the caller's view of the restlot to the callee's
         // view, for the sake of making a type-compatible call.
         let llretty = T_ptr(type_of_inner(bcx_ccx(bcx), bcx.sp, retty));
-        llargs += ~[cx.build.PointerCast(llretslot, llretty)];
-    } else { llargs += ~[llretslot]; }
+        llargs += [cx.build.PointerCast(llretslot, llretty)];
+    } else { llargs += [llretslot]; }
 
     // Arg 1: task pointer.
-    llargs += ~[bcx.fcx.lltaskptr];
+    llargs += [bcx.fcx.lltaskptr];
 
     // Arg 2: Env (closure-bindings / self-obj)
-    llargs += ~[llenv];
+    llargs += [llenv];
 
     // Args >3: ty_params ...
     llargs += lltydescs;
@@ -4628,12 +4588,13 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef,
     alt lliterbody {
       none. { }
       some(lli) {
-        let lli = if (ty::type_contains_params(bcx_tcx(cx), retty)) {
-            let body_ty = ty::mk_iter_body_fn(bcx_tcx(cx), retty);
-            let body_llty = type_of_inner(bcx_ccx(cx), cx.sp, body_ty);
-            bcx.build.PointerCast(lli, T_ptr(body_llty))
-        } else { lli };
-        llargs += ~[cx.build.Load(lli)];
+        let lli =
+            if ty::type_contains_params(bcx_tcx(cx), retty) {
+                let body_ty = ty::mk_iter_body_fn(bcx_tcx(cx), retty);
+                let body_llty = type_of_inner(bcx_ccx(cx), cx.sp, body_ty);
+                bcx.build.PointerCast(lli, T_ptr(body_llty))
+            } else { lli };
+        llargs += [cx.build.Load(lli)];
       }
     }
 
@@ -4650,14 +4611,17 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef,
             // So this arg can't be evaluated.
             break;
         }
-        let r = trans_arg_expr(bcx, args.(i), arg_tys.(i),
-                               to_zero, to_revoke, e);
+        let r =
+            trans_arg_expr(bcx, args[i], arg_tys[i], to_zero, to_revoke, e);
         bcx = r.bcx;
-        llargs += ~[r.val];
+        llargs += [r.val];
         i += 1u;
     }
-    ret {bcx: bcx, args: llargs, retslot: llretslot,
-         to_zero: to_zero, to_revoke: to_revoke};
+    ret {bcx: bcx,
+         args: llargs,
+         retslot: llretslot,
+         to_zero: to_zero,
+         to_revoke: to_revoke};
 }
 
 fn trans_call(cx: &@block_ctxt, f: &@ast::expr,
@@ -4695,10 +4659,10 @@ fn trans_call(cx: &@block_ctxt, f: &@ast::expr,
         fn_ty = res.ty;
 
         let pair = res.val;
-        faddr = bcx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_code)]);
+        faddr = bcx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_code)]);
         faddr = bcx.build.Load(faddr);
         let llclosure =
-            bcx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_box)]);
+            bcx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_box)]);
         llenv = bcx.build.Load(llclosure);
       }
     }
@@ -4742,18 +4706,16 @@ fn trans_call(cx: &@block_ctxt, f: &@ast::expr,
         }
 
         // Forget about anything we moved out.
-        for {v,t}: {v: ValueRef, t: ty::t} in args_res.to_zero {
+        for {v: v, t: t}: {v: ValueRef, t: ty::t} in args_res.to_zero {
             zero_alloca(bcx, v, t)
         }
-        for v: ValueRef in args_res.to_revoke {
-            revoke_clean(bcx, v)
-        }
+        for v: ValueRef in args_res.to_revoke { revoke_clean(bcx, v) }
     }
     ret rslt(bcx, retval);
 }
 
-fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id)
-    -> result {
+fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id) ->
+   result {
     let bcx = cx;
     let t = node_id_type(bcx.fcx.lcx.ccx, id);
     let tup_res = alloc_ty(bcx, t);
@@ -4765,7 +4727,7 @@ fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id)
         let e_ty = ty::expr_ty(cx.fcx.lcx.ccx.tcx, e);
         let src = trans_lval(bcx, e);
         bcx = src.res.bcx;
-        let dst_res = GEP_tup_like(bcx, t, tup_val, ~[0, i]);
+        let dst_res = GEP_tup_like(bcx, t, tup_val, [0, i]);
         bcx = move_val_if_temp(dst_res.bcx, INIT, dst_res.val, src, e_ty).bcx;
         i += 1;
     }
@@ -4801,22 +4763,22 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) ->
 
         bcx.build.Store(lllen,
                         bcx.build.InBoundsGEP(llvecptr,
-                                              ~[C_int(0),
-                                                C_uint(abi::ivec_elt_len)]));
+                                              [C_int(0),
+                                               C_uint(abi::ivec_elt_len)]));
         bcx.build.Store(llalen,
                         bcx.build.InBoundsGEP(llvecptr,
-                                              ~[C_int(0),
-                                                C_uint(abi::ivec_elt_alen)]));
+                                              [C_int(0),
+                                               C_uint(abi::ivec_elt_alen)]));
         llfirsteltptr =
             bcx.build.InBoundsGEP(llvecptr,
-                                  ~[C_int(0), C_uint(abi::ivec_elt_elems),
-                                    C_int(0)]);
+                                  [C_int(0), C_uint(abi::ivec_elt_elems),
+                                   C_int(0)]);
     } else {
         // Heap case.
 
-        let stub_z = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)];
-        let stub_a = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)];
-        let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
+        let stub_z = [C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)];
+        let stub_a = [C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)];
+        let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)];
         let llstubty = T_ivec_heap(llunitty);
         let llstubptr = bcx.build.PointerCast(llvecptr, T_ptr(llstubty));
         bcx.build.Store(C_int(0), bcx.build.InBoundsGEP(llstubptr, stub_z));
@@ -4837,13 +4799,13 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) ->
             let llheapptr = rslt.val;
             bcx.build.Store(llheapptr,
                             bcx.build.InBoundsGEP(llstubptr, stub_p));
-            let heap_l = ~[C_int(0), C_uint(abi::ivec_heap_elt_len)];
+            let heap_l = [C_int(0), C_uint(abi::ivec_heap_elt_len)];
             bcx.build.Store(lllen, bcx.build.InBoundsGEP(llheapptr, heap_l));
             llfirsteltptr =
                 bcx.build.InBoundsGEP(llheapptr,
-                                      ~[C_int(0),
-                                        C_uint(abi::ivec_heap_elt_elems),
-                                        C_int(0)]);
+                                      [C_int(0),
+                                       C_uint(abi::ivec_heap_elt_elems),
+                                       C_int(0)]);
         }
     }
     // Store the individual elements.
@@ -4856,9 +4818,9 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) ->
         if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
             lleltptr =
                 bcx.build.InBoundsGEP(llfirsteltptr,
-                                      ~[bcx.build.Mul(C_uint(i), unit_sz)]);
+                                      [bcx.build.Mul(C_uint(i), unit_sz)]);
         } else {
-            lleltptr = bcx.build.InBoundsGEP(llfirsteltptr, ~[C_uint(i)]);
+            lleltptr = bcx.build.InBoundsGEP(llfirsteltptr, [C_uint(i)]);
         }
         bcx = move_val_if_temp(bcx, INIT, lleltptr, lv, unit_ty).bcx;
         i += 1u;
@@ -4884,11 +4846,11 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field],
         base_val = base_res.val;
       }
     }
-    let ty_fields: [ty::field] = ~[];
+    let ty_fields: [ty::field] = [];
     alt ty::struct(bcx_tcx(cx), t) { ty::ty_rec(flds) { ty_fields = flds; } }
     for tf: ty::field in ty_fields {
         let e_ty = tf.mt.ty;
-        let dst_res = GEP_tup_like(bcx, t, rec_val, ~[0, i]);
+        let dst_res = GEP_tup_like(bcx, t, rec_val, [0, i]);
         bcx = dst_res.bcx;
         let expr_provided = false;
         for f: ast::field in fields {
@@ -4902,7 +4864,7 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field],
             }
         }
         if !expr_provided {
-            let src_res = GEP_tup_like(bcx, t, base_val, ~[0, i]);
+            let src_res = GEP_tup_like(bcx, t, base_val, [0, i]);
             src_res =
                 rslt(src_res.bcx, load_if_immediate(bcx, src_res.val, e_ty));
             bcx =
@@ -4928,12 +4890,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
       }
       ast::expr_binary(op, x, y) { ret trans_binary(cx, op, x, y); }
       ast::expr_if(cond, thn, els) {
-        ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx,
-                            e.id, output);
+        ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, e.id,
+                            output);
       }
       ast::expr_if_check(cond, thn, els) {
-        ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx,
-                            e.id, output);
+        ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, e.id,
+                            output);
       }
       ast::expr_ternary(_, _, _) {
         ret trans_expr_out(cx, ast::ternary_to_if(e), output);
@@ -4945,8 +4907,8 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
       ast::expr_while(cond, body) { ret trans_while(cx, cond, body); }
       ast::expr_do_while(body, cond) { ret trans_do_while(cx, body, cond); }
       ast::expr_alt(expr, arms) {
-        ret with_out_method(bind trans_alt::trans_alt(cx, expr, arms, _),
-                            cx, e.id, output);
+        ret with_out_method(bind trans_alt::trans_alt(cx, expr, arms, _), cx,
+                            e.id, output);
       }
       ast::expr_fn(f) {
         let ccx = bcx_ccx(cx);
@@ -4958,12 +4920,14 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
 
         let fn_res =
             trans_closure(some(cx), some(llfnty), sub_cx, e.span, f, llfn,
-                          none, ~[], e.id);
+                          none, [], e.id);
         let fn_pair =
             alt fn_res {
               some(fn_pair) { fn_pair }
-              none. { {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false),
-                       bcx: cx} }
+              none. {
+                {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false),
+                 bcx: cx}
+              }
             };
         ret rslt(fn_pair.bcx, fn_pair.fn_pair);
       }
@@ -5040,14 +5004,14 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
                                            rhs_res.val);
                 }
                 ret trans_evec_append(rhs_res.bcx, t, lhs_res.res.val,
-                                     rhs_res.val);
+                                      rhs_res.val);
               }
               _ { }
             }
         }
         let lhs_val = load_if_immediate(rhs_res.bcx, lhs_res.res.val, t);
-        let v = trans_eager_binop(rhs_res.bcx, op, lhs_val, t,
-                                  rhs_res.val, t);
+        let v =
+            trans_eager_binop(rhs_res.bcx, op, lhs_val, t, rhs_res.val, t);
         // FIXME: calculate copy init-ness in typestate.
         // This is always a temporary, so can always be safely moved
         let move_res =
@@ -5060,9 +5024,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         ret trans_call(cx, f, none::<ValueRef>, args, e.id);
       }
       ast::expr_cast(val, _) { ret trans_cast(cx, val, e.id); }
-      ast::expr_vec(args, _) {
-        ret trans_ivec(cx, args, e.id);
-      }
+      ast::expr_vec(args, _) { ret trans_ivec(cx, args, e.id); }
       ast::expr_rec(args, base) { ret trans_rec(cx, args, base, e.id); }
       ast::expr_tup(args) { ret trans_tup(cx, args, e.id); }
       ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug("unexpanded macro"); }
@@ -5089,7 +5051,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         let els = rslt(else_cx, C_nil());
 
         cx.build.CondBr(cond, then_cx.llbb, else_cx.llbb);
-        ret rslt(join_branches(cx, ~[check_res, els]), C_nil());
+        ret rslt(join_branches(cx, [check_res, els]), C_nil());
       }
       ast::expr_break. { ret trans_break(e.span, cx); }
       ast::expr_cont. { ret trans_cont(e.span, cx); }
@@ -5116,7 +5078,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
     ret rslt(sub.res.bcx, v);
 }
 
-fn with_out_method(work: fn(&out_method) -> result , cx: @block_ctxt,
+fn with_out_method(work: fn(&out_method) -> result, cx: @block_ctxt,
                    id: ast::node_id, outer_output: &out_method) -> result {
     let ccx = bcx_ccx(cx);
     if outer_output != return {
@@ -5202,7 +5164,7 @@ fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result {
     let llval_i8 = log_bcx.build.PointerCast(llvalptr, T_ptr(T_i8()));
 
     log_bcx.build.Call(bcx_ccx(log_bcx).upcalls.log_type,
-                       ~[log_bcx.fcx.lltaskptr, r.val, llval_i8, C_int(lvl)]);
+                       [log_bcx.fcx.lltaskptr, r.val, llval_i8, C_int(lvl)]);
 
     log_bcx = trans_block_cleanups(log_bcx, log_cx);
     log_bcx.build.Br(after_cx.llbb);
@@ -5233,7 +5195,7 @@ fn trans_fail_expr(cx: &@block_ctxt, sp_opt: &option::t<span>,
         if ty::type_is_str(tcx, e_ty) {
             let elt =
                 bcx.build.GEP(expr_res.val,
-                              ~[C_int(0), C_int(abi::vec_elt_data)]);
+                              [C_int(0), C_int(abi::vec_elt_data)]);
             ret trans_fail_value(bcx, sp_opt, elt);
         } else {
             bcx_ccx(cx).sess.span_bug(expr.span,
@@ -5266,7 +5228,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>,
     }
     let V_str = cx.build.PointerCast(V_fail_str, T_ptr(T_i8()));
     V_filename = cx.build.PointerCast(V_filename, T_ptr(T_i8()));
-    let args = ~[cx.fcx.lltaskptr, V_str, V_filename, C_int(V_line)];
+    let args = [cx.fcx.lltaskptr, V_str, V_filename, C_int(V_line)];
     cx.build.Call(bcx_ccx(cx).upcalls._fail, args);
     cx.build.Unreachable();
     ret rslt(cx, C_nil());
@@ -5279,26 +5241,26 @@ fn trans_put(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
       some(lli) {
         let slot = alloca(cx, val_ty(lli));
         cx.build.Store(lli, slot);
-        llcallee = cx.build.GEP(slot, ~[C_int(0), C_int(abi::fn_field_code)]);
+        llcallee = cx.build.GEP(slot, [C_int(0), C_int(abi::fn_field_code)]);
         llcallee = cx.build.Load(llcallee);
-        llenv = cx.build.GEP(slot, ~[C_int(0), C_int(abi::fn_field_box)]);
+        llenv = cx.build.GEP(slot, [C_int(0), C_int(abi::fn_field_box)]);
         llenv = cx.build.Load(llenv);
       }
     }
     let bcx = cx;
     let dummy_retslot = alloca(bcx, T_nil());
-    let llargs: [ValueRef] = ~[dummy_retslot, cx.fcx.lltaskptr, llenv];
+    let llargs: [ValueRef] = [dummy_retslot, cx.fcx.lltaskptr, llenv];
     alt e {
       none. { }
       some(x) {
         let e_ty = ty::expr_ty(bcx_tcx(cx), x);
         let arg = {mode: ty::mo_alias(false), ty: e_ty};
-        let arg_tys = type_of_explicit_args(bcx_ccx(cx), x.span, ~[arg]);
-        let z = ~[];
-        let k = ~[];
-        let r = trans_arg_expr(bcx, arg, arg_tys.(0), z, k, x);
+        let arg_tys = type_of_explicit_args(bcx_ccx(cx), x.span, [arg]);
+        let z = [];
+        let k = [];
+        let r = trans_arg_expr(bcx, arg, arg_tys[0], z, k, x);
         bcx = r.bcx;
-        llargs += ~[r.val];
+        llargs += [r.val];
       }
     }
     bcx.build.FastCall(llcallee, llargs);
@@ -5378,14 +5340,16 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
         let t = ty::expr_ty(bcx_tcx(cx), x);
         let lv = trans_lval(cx, x);
         bcx = lv.res.bcx;
-        let is_local = alt x.node {
-          ast::expr_path(p) {
-            alt bcx_tcx(bcx).def_map.get(x.id) {
-              ast::def_local(_) { true } _ { false }
-            }
-          }
-          _ { false }
-        };
+        let is_local =
+            alt x.node {
+              ast::expr_path(p) {
+                alt bcx_tcx(bcx).def_map.get(x.id) {
+                  ast::def_local(_) { true }
+                  _ { false }
+                }
+              }
+              _ { false }
+            };
         if is_local {
             bcx = move_val(bcx, INIT, cx.fcx.llretptr, lv, t).bcx;
         } else {
@@ -5412,9 +5376,7 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
     ret rslt(new_sub_block_ctxt(bcx, "ret.unreachable"), C_nil());
 }
 
-fn build_return(bcx: &@block_ctxt) {
-    bcx.build.Br(bcx_fcx(bcx).llreturn);
-}
+fn build_return(bcx: &@block_ctxt) { bcx.build.Br(bcx_fcx(bcx).llreturn); }
 
 fn trans_be(cx: &@block_ctxt, e: &@ast::expr) -> result {
     // FIXME: This should be a typestate precondition
@@ -5450,8 +5412,9 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result {
       }
       _ { bcx = zero_alloca(bcx, llptr, ty).bcx; }
     }
-    bcx = trans_alt::bind_irrefutable_pat(bcx, local.node.pat, llptr,
-                                          bcx.fcx.lllocals, false);
+    bcx =
+        trans_alt::bind_irrefutable_pat(bcx, local.node.pat, llptr,
+                                        bcx.fcx.lllocals, false);
     ret rslt(bcx, llptr);
 }
 
@@ -5494,7 +5457,7 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result {
 // next three functions instead.
 fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind,
                   name: &str) -> @block_ctxt {
-    let cleanups: [cleanup] = ~[];
+    let cleanups: [cleanup] = [];
     let s = str::buf("");
     let held_name; //HACK for str::buf, which doesn't keep its value alive
     if cx.lcx.ccx.sess.get_opts().save_temps ||
@@ -5538,7 +5501,7 @@ fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt {
 }
 
 fn new_raw_block_ctxt(fcx: &@fn_ctxt, llbb: BasicBlockRef) -> @block_ctxt {
-    let cleanups: [cleanup] = ~[];
+    let cleanups: [cleanup] = [];
     ret @{llbb: llbb,
           build: new_builder(llbb),
           parent: parent_none,
@@ -5565,7 +5528,7 @@ fn trans_block_cleanups(cx: &@block_ctxt, cleanup_cx: &@block_ctxt) ->
     let i = std::vec::len::<cleanup>(cleanup_cx.cleanups);
     while i > 0u {
         i -= 1u;
-        let c = cleanup_cx.cleanups.(i);
+        let c = cleanup_cx.cleanups[i];
         alt c {
           clean(cfn) { bcx = cfn(bcx).bcx; }
           clean_temp(_, cfn) { bcx = cfn(bcx).bcx; }
@@ -5576,16 +5539,17 @@ fn trans_block_cleanups(cx: &@block_ctxt, cleanup_cx: &@block_ctxt) ->
 
 fn trans_fn_cleanups(fcx: &@fn_ctxt, build: &lib::llvm::builder) {
     alt fcx.llobstacktoken {
-        some(lltoken_) {
-            let lltoken = lltoken_; // satisfy alias checker
-            build.Call(fcx_ccx(fcx).upcalls.dynastack_free, ~[fcx.lltaskptr,
-                                                              lltoken]);
-        }
-        none. { /* nothing to do */ }
+      some(lltoken_) {
+        let lltoken = lltoken_; // satisfy alias checker
+        build.Call(fcx_ccx(fcx).upcalls.dynastack_free,
+                   [fcx.lltaskptr, lltoken]);
+      }
+      none. {/* nothing to do */ }
     }
 }
 
 iter block_locals(b: &ast::blk) -> @ast::local {
+
     // FIXME: putting from inside an iter block doesn't work, so we can't
     // use the index here.
     for s: @ast::stmt in b.node.stmts {
@@ -5604,7 +5568,7 @@ iter block_locals(b: &ast::blk) -> @ast::local {
 }
 
 fn llstaticallocas_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt {
-    let cleanups: [cleanup] = ~[];
+    let cleanups: [cleanup] = [];
     ret @{llbb: fcx.llstaticallocas,
           build: new_builder(fcx.llstaticallocas),
           parent: parent_none,
@@ -5615,7 +5579,7 @@ fn llstaticallocas_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt {
 }
 
 fn llderivedtydescs_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt {
-    let cleanups: [cleanup] = ~[];
+    let cleanups: [cleanup] = [];
     ret @{llbb: fcx.llderivedtydescs,
           build: new_builder(fcx.llderivedtydescs),
           parent: parent_none,
@@ -5638,9 +5602,7 @@ fn alloc_ty(cx: &@block_ctxt, t: &ty::t) -> result {
         let n = size_of(llderivedtydescs_block_ctxt(bcx.fcx), t);
         bcx.fcx.llderivedtydescs = n.bcx.llbb;
         val = array_alloca(bcx, T_i8(), n.val);
-    } else {
-        val = alloca(bcx, type_of(bcx_ccx(cx), cx.sp, t));
-    }
+    } else { val = alloca(bcx, type_of(bcx_ccx(cx), cx.sp, t)); }
     // NB: since we've pushed all size calculations in this
     // function up to the alloca block, we actually return the
     // block passed into us unmodified; it doesn't really
@@ -5648,7 +5610,7 @@ fn alloc_ty(cx: &@block_ctxt, t: &ty::t) -> result {
     // past caller conventions and may well make sense again,
     // so we leave it as-is.
 
-    if (bcx_tcx(cx).sess.get_opts().do_gc) {
+    if bcx_tcx(cx).sess.get_opts().do_gc {
         bcx = gc::add_gc_root(bcx, val, t);
     }
 
@@ -5664,7 +5626,7 @@ fn alloc_local(cx: &@block_ctxt, local: &@ast::local) -> result {
             llvm::LLVMSetValueName(r.val, str::buf(ident));
         }
       }
-      _ {}
+      _ { }
     }
     ret r;
 }
@@ -5728,11 +5690,11 @@ fn trans_block(cx: &@block_ctxt, b: &ast::blk, output: &out_method) ->
 }
 
 fn new_local_ctxt(ccx: &@crate_ctxt) -> @local_ctxt {
-    let pth: [str] = ~[];
+    let pth: [str] = [];
     ret @{path: pth,
-          module_path: ~[ccx.link_meta.name],
-          obj_typarams: ~[],
-          obj_fields: ~[],
+          module_path: [ccx.link_meta.name],
+          obj_typarams: [],
+          obj_fields: [],
           ccx: ccx};
 }
 
@@ -5792,7 +5754,7 @@ fn new_fn_ctxt_w_id(cx: @local_ctxt, sp: &span, llfndecl: ValueRef,
           llobjfields: llobjfields,
           lllocals: lllocals,
           llupvars: llupvars,
-          mutable lltydescs: ~[],
+          mutable lltydescs: [],
           derived_tydescs: derived_tydescs,
           id: id,
           sp: sp,
@@ -5831,7 +5793,7 @@ fn create_llargs_for_fn_args(cx: &@fn_ctxt, proto: ast::proto,
         for tp: ast::ty_param in ty_params {
             let llarg = llvm::LLVMGetParam(cx.llfn, arg_n);
             assert (llarg as int != 0);
-            cx.lltydescs += ~[llarg];
+            cx.lltydescs += [llarg];
             arg_n += 1u;
             i += 1u;
         }
@@ -5868,8 +5830,9 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, args: &[ast::arg]) {
             alt bcx.fcx.llargs.find(aarg.id) {
               some(x) { argval = x; }
               _ {
-                bcx_ccx(bcx).sess.span_fatal
-                    (aarg.ty.span, "unbound arg ID in copy_args_to_allocas");
+                bcx_ccx(bcx).sess.span_fatal(
+                    aarg.ty.span,
+                    "unbound arg ID in copy_args_to_allocas");
               }
             }
             let a = do_spill(bcx, argval);
@@ -5890,11 +5853,12 @@ fn add_cleanups_for_args(bcx: &@block_ctxt, args: &[ast::arg],
             alt bcx.fcx.llargs.find(aarg.id) {
               some(x) { argval = x; }
               _ {
-                bcx_ccx(bcx).sess.span_fatal
-                    (aarg.ty.span, "unbound arg ID in add_cleanups_for_args");
+                bcx_ccx(bcx).sess.span_fatal(
+                    aarg.ty.span,
+                    "unbound arg ID in add_cleanups_for_args");
               }
             }
-            add_clean(bcx, argval, arg_tys.(arg_n).ty);
+            add_clean(bcx, argval, arg_tys[arg_n].ty);
         }
         arg_n += 1u;
     }
@@ -5913,9 +5877,9 @@ fn arg_tys_of_fn(ccx: &@crate_ctxt, id: ast::node_id) -> [ty::arg] {
 
 fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) {
     let bcx = llstaticallocas_block_ctxt(fcx);
-    let field_tys: [ty::t] = ~[];
+    let field_tys: [ty::t] = [];
     for f: ast::obj_field in bcx.fcx.lcx.obj_fields {
-        field_tys += ~[node_id_type(bcx_ccx(bcx), f.id)];
+        field_tys += [node_id_type(bcx_ccx(bcx), f.id)];
     }
     // Synthesize a tuple type for the fields so that GEP_tup_like() can work
     // its magic.
@@ -5924,13 +5888,13 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) {
     let n_typarams = std::vec::len::<ast::ty_param>(bcx.fcx.lcx.obj_typarams);
     let llobj_box_ty: TypeRef = T_obj_ptr(*bcx_ccx(bcx), n_typarams);
     let box_cell =
-        bcx.build.GEP(llself.v, ~[C_int(0), C_int(abi::obj_field_box)]);
+        bcx.build.GEP(llself.v, [C_int(0), C_int(abi::obj_field_box)]);
     let box_ptr = bcx.build.Load(box_cell);
     box_ptr = bcx.build.PointerCast(box_ptr, llobj_box_ty);
     let obj_typarams =
         bcx.build.GEP(box_ptr,
-                      ~[C_int(0), C_int(abi::box_rc_field_body),
-                        C_int(abi::obj_body_elt_typarams)]);
+                      [C_int(0), C_int(abi::box_rc_field_body),
+                       C_int(abi::obj_body_elt_typarams)]);
     // The object fields immediately follow the type parameters, so we skip
     // over them to get the pointer.
 
@@ -5947,14 +5911,14 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) {
     let i: int = 0;
     for p: ast::ty_param in fcx.lcx.obj_typarams {
         let lltyparam: ValueRef =
-            bcx.build.GEP(obj_typarams, ~[C_int(0), C_int(i)]);
+            bcx.build.GEP(obj_typarams, [C_int(0), C_int(i)]);
         lltyparam = bcx.build.Load(lltyparam);
-        fcx.lltydescs += ~[lltyparam];
+        fcx.lltydescs += [lltyparam];
         i += 1;
     }
     i = 0;
     for f: ast::obj_field in fcx.lcx.obj_fields {
-        let rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, ~[0, i]);
+        let rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, [0, i]);
         bcx = llstaticallocas_block_ctxt(fcx);
         let llfield = rslt.val;
         fcx.llobjfields.insert(f.id, llfield);
@@ -5983,8 +5947,8 @@ fn finish_fn(fcx: &@fn_ctxt, lltop: BasicBlockRef) {
 fn trans_closure(bcx_maybe: &option::t<@block_ctxt>,
                  llfnty: &option::t<TypeRef>, cx: @local_ctxt, sp: &span,
                  f: &ast::_fn, llfndecl: ValueRef, ty_self: option::t<ty::t>,
-                 ty_params: &[ast::ty_param], id: ast::node_id)
-    -> option::t<{fn_pair: ValueRef, bcx: @block_ctxt}> {
+                 ty_params: &[ast::ty_param], id: ast::node_id) ->
+   option::t<{fn_pair: ValueRef, bcx: @block_ctxt}> {
     set_uwtable(llfndecl);
 
     // Set up arguments to the function.
@@ -6000,24 +5964,26 @@ fn trans_closure(bcx_maybe: &option::t<@block_ctxt>,
     copy_args_to_allocas(fcx, f.decl.inputs);
 
     // Figure out if we need to build a closure and act accordingly
-    let res = alt f.proto {
-      ast::proto_block. | ast::proto_closure. {
-        let bcx = option::get(bcx_maybe);
-        let upvars = get_freevars(cx.ccx.tcx, id);
-
-        let copying = f.proto == ast::proto_closure;
-        let env = build_closure(bcx, upvars, copying);
-        load_environment(bcx, fcx, env.ptrty, upvars, copying);
-
-        let closure = create_real_fn_pair(env.bcx, option::get(llfnty),
-                                          llfndecl, env.ptr);
-        if copying {
-            add_clean_temp(bcx, closure, node_id_type(cx.ccx, id))
-        }
-        some({fn_pair: closure, bcx: env.bcx})
-      }
-      _ { none }
-    };
+    let res =
+        alt f.proto {
+          ast::proto_block. | ast::proto_closure. {
+            let bcx = option::get(bcx_maybe);
+            let upvars = get_freevars(cx.ccx.tcx, id);
+
+            let copying = f.proto == ast::proto_closure;
+            let env = build_closure(bcx, upvars, copying);
+            load_environment(bcx, fcx, env.ptrty, upvars, copying);
+
+            let closure =
+                create_real_fn_pair(env.bcx, option::get(llfnty), llfndecl,
+                                    env.ptr);
+            if copying {
+                add_clean_temp(bcx, closure, node_id_type(cx.ccx, id))
+            }
+            some({fn_pair: closure, bcx: env.bcx})
+          }
+          _ { none }
+        };
 
     // Create the first basic block in the function and keep a handle on it to
     //  pass to finish_fn later.
@@ -6032,10 +5998,10 @@ fn trans_closure(bcx_maybe: &option::t<@block_ctxt>,
     // (trans_block, trans_expr, et cetera).
     let rslt =
         if !ty::type_is_nil(cx.ccx.tcx, block_ty) &&
-           !ty::type_is_bot(cx.ccx.tcx, block_ty) &&
-           f.proto != ast::proto_iter {
-        trans_block(bcx, f.body, save_in(fcx.llretptr))
-    } else { trans_block(bcx, f.body, return) };
+               !ty::type_is_bot(cx.ccx.tcx, block_ty) &&
+               f.proto != ast::proto_iter {
+            trans_block(bcx, f.body, save_in(fcx.llretptr))
+        } else { trans_block(bcx, f.body, return) };
     bcx = rslt.bcx;
 
     if !is_terminated(bcx) {
@@ -6087,24 +6053,23 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn,
                               dtor.decl.inputs, ty_params);
     let bcx = new_top_block_ctxt(fcx);
     let lltop = bcx.llbb;
-    let arg_t = arg_tys_of_fn(cx.ccx, ctor_id).(0).ty;
-    let tup_t = ty::mk_tup(cx.ccx.tcx, ~[ty::mk_int(cx.ccx.tcx), arg_t]);
+    let arg_t = arg_tys_of_fn(cx.ccx, ctor_id)[0].ty;
+    let tup_t = ty::mk_tup(cx.ccx.tcx, [ty::mk_int(cx.ccx.tcx), arg_t]);
     let arg;
-    alt fcx.llargs.find(dtor.decl.inputs.(0).id) {
+    alt fcx.llargs.find(dtor.decl.inputs[0].id) {
       some(x) { arg = load_if_immediate(bcx, x, arg_t); }
       _ { cx.ccx.sess.span_fatal(sp, "unbound dtor decl in trans_res_ctor"); }
     }
-
     let llretptr = fcx.llretptr;
     if ty::type_has_dynamic_size(cx.ccx.tcx, ret_t) {
-        let llret_t = T_ptr(T_struct(~[T_i32(), llvm::LLVMTypeOf(arg)]));
+        let llret_t = T_ptr(T_struct([T_i32(), llvm::LLVMTypeOf(arg)]));
         llretptr = bcx.build.BitCast(llretptr, llret_t);
     }
 
-    let dst = GEP_tup_like(bcx, tup_t, llretptr, ~[0, 1]);
+    let dst = GEP_tup_like(bcx, tup_t, llretptr, [0, 1]);
     bcx = dst.bcx;
     bcx = copy_val(bcx, INIT, dst.val, arg, arg_t).bcx;
-    let flag = GEP_tup_like(bcx, tup_t, llretptr, ~[0, 0]);
+    let flag = GEP_tup_like(bcx, tup_t, llretptr, [0, 0]);
     bcx = flag.bcx;
     bcx.build.Store(C_int(1), flag.val);
     build_return(bcx);
@@ -6121,14 +6086,14 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
     }
     // Translate variant arguments to function arguments.
 
-    let fn_args: [ast::arg] = ~[];
+    let fn_args: [ast::arg] = [];
     let i = 0u;
     for varg: ast::variant_arg in variant.node.args {
         fn_args +=
-            ~[{mode: ast::alias(false),
-               ty: varg.ty,
-               ident: "arg" + uint::to_str(i, 10u),
-               id: varg.id}];
+            [{mode: ast::alias(false),
+              ty: varg.ty,
+              ident: "arg" + uint::to_str(i, 10u),
+              id: varg.id}];
     }
     assert (cx.ccx.item_ids.contains_key(variant.node.id));
     let llfndecl: ValueRef;
@@ -6143,10 +6108,10 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
     create_llargs_for_fn_args(fcx, ast::proto_fn, none::<ty::t>,
                               ty::ret_ty_of_fn(cx.ccx.tcx, variant.node.id),
                               fn_args, ty_params);
-    let ty_param_substs: [ty::t] = ~[];
+    let ty_param_substs: [ty::t] = [];
     i = 0u;
     for tp: ast::ty_param in ty_params {
-        ty_param_substs += ~[ty::mk_param(cx.ccx.tcx, i, tp.kind)];
+        ty_param_substs += [ty::mk_param(cx.ccx.tcx, i, tp.kind)];
         i += 1u;
     }
     let arg_tys = arg_tys_of_fn(cx.ccx, variant.node.id);
@@ -6162,9 +6127,9 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
             let lltagptr =
                 bcx.build.PointerCast(fcx.llretptr,
                                       T_opaque_tag_ptr(fcx.lcx.ccx.tn));
-            let lldiscrimptr = bcx.build.GEP(lltagptr, ~[C_int(0), C_int(0)]);
+            let lldiscrimptr = bcx.build.GEP(lltagptr, [C_int(0), C_int(0)]);
             bcx.build.Store(C_int(index), lldiscrimptr);
-            bcx.build.GEP(lltagptr, ~[C_int(0), C_int(1)])
+            bcx.build.GEP(lltagptr, [C_int(0), C_int(1)])
         };
     i = 0u;
     for va: ast::variant_arg in variant.node.args {
@@ -6186,7 +6151,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
                                       trans_tag_variant");
           }
         }
-        let arg_ty = arg_tys.(i).ty;
+        let arg_ty = arg_tys[i].ty;
         let llargval;
         if ty::type_is_structural(cx.ccx.tcx, arg_ty) ||
                ty::type_has_dynamic_size(cx.ccx.tcx, arg_ty) {
@@ -6262,8 +6227,8 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) {
       }
       ast::item_mod(m) {
         let sub_cx =
-            @{path: cx.path + ~[item.ident],
-              module_path: cx.module_path + ~[item.ident] with *cx};
+            @{path: cx.path + [item.ident],
+              module_path: cx.module_path + [item.ident] with *cx};
         trans_mod(sub_cx, m);
       }
       ast::item_tag(variants, tps) {
@@ -6305,8 +6270,8 @@ fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], flav: str,
 fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str],
                          _flav: str, ty_params: &[ast::ty_param],
                          node_id: ast::node_id, node_type: ty::t) {
-    let llfty = type_of_fn_from_ty(ccx, sp, node_type,
-                                   std::vec::len(ty_params));
+    let llfty =
+        type_of_fn_from_ty(ccx, sp, node_type, std::vec::len(ty_params));
     alt ty::struct(ccx.tcx, node_type) {
       ty::ty_fn(proto, inputs, output, _, _) {
         llfty =
@@ -6315,8 +6280,7 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str],
       }
       _ { ccx.sess.bug("decl_fn_and_pair(): fn item doesn't have fn type!"); }
     }
-
-    let s: str =  mangle_internal_name_by_path(ccx, path);
+    let s: str = mangle_internal_name_by_path(ccx, path);
     let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod, s, llfty);
     // Declare the global constant pair that points to it.
 
@@ -6324,45 +6288,36 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str],
     register_fn_pair(ccx, ps, llfty, llfn, node_id);
 
     let is_main: bool = is_main_name(path) && !ccx.sess.get_opts().library;
-    if is_main {
-        create_main_wrapper(ccx, sp, llfn, node_type);
-    }
+    if is_main { create_main_wrapper(ccx, sp, llfn, node_type); }
 }
 
 // Create a _rust_main(args: [str]) function which will be called from the
 // runtime rust_start function
-fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span,
-                       main_llfn: ValueRef, main_node_type: ty::t) {
+fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
+                       main_node_type: ty::t) {
 
     if ccx.main_fn != none::<ValueRef> {
         ccx.sess.span_fatal(sp, "multiple 'main' functions");
     }
 
-    let main_takes_ivec = alt ty::struct(ccx.tcx, main_node_type) {
-      ty::ty_fn(_, args, _ ,_ ,_) {
-        std::vec::len(args) != 0u
-      }
-    };
+    let main_takes_ivec =
+        alt ty::struct(ccx.tcx, main_node_type) {
+          ty::ty_fn(_, args, _, _, _) { std::vec::len(args) != 0u }
+        };
 
     let llfn = create_main(ccx, sp, main_llfn, main_takes_ivec);
     ccx.main_fn = some(llfn);
 
-    fn create_main(ccx: &@crate_ctxt,
-                   sp: &span,
-                   main_llfn: ValueRef,
+    fn create_main(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
                    takes_ivec: bool) -> ValueRef {
-        let ivecarg_ty: ty::arg = {
-            mode: ty::mo_val,
-            ty: ty::mk_vec(ccx.tcx, {
-                ty: ty::mk_str(ccx.tcx),
-                mut: ast::imm
-            })
-        };
-        let llfty = type_of_fn(ccx, sp,
-                               ast::proto_fn,
-                               ~[ivecarg_ty],
-                               ty::mk_nil(ccx.tcx),
-                               0u);
+        let ivecarg_ty: ty::arg =
+            {mode: ty::mo_val,
+             ty:
+                 ty::mk_vec(ccx.tcx,
+                            {ty: ty::mk_str(ccx.tcx), mut: ast::imm})};
+        let llfty =
+            type_of_fn(ccx, sp, ast::proto_fn, [ivecarg_ty],
+                       ty::mk_nil(ccx.tcx), 0u);
         let llfdecl = decl_fastcall_fn(ccx.llmod, "_rust_main", llfty);
 
         let fcx = new_fn_ctxt(new_local_ctxt(ccx), sp, llfdecl);
@@ -6375,10 +6330,7 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span,
             let lltaskarg = llvm::LLVMGetParam(llfdecl, 1u);
             let llenvarg = llvm::LLVMGetParam(llfdecl, 2u);
             let llargvarg = llvm::LLVMGetParam(llfdecl, 3u);
-            let args = ~[lloutputarg,
-                         lltaskarg,
-                         llenvarg,
-                         llargvarg];
+            let args = [lloutputarg, lltaskarg, llenvarg, llargvarg];
             bcx.build.FastCall(main_llfn, args);
         } else {
             let lloutputarg = llvm::LLVMGetParam(llfdecl, 0u);
@@ -6390,12 +6342,11 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span,
             // we're responsible for freeing it
             let llivecptr = alloca(bcx, val_ty(llargvarg));
             bcx.build.Store(llargvarg, llivecptr);
-            bcx = maybe_free_ivec_heap_part(bcx, llivecptr,
-                                            ty::mk_str(ccx.tcx)).bcx;
+            bcx =
+                maybe_free_ivec_heap_part(bcx, llivecptr,
+                                          ty::mk_str(ccx.tcx)).bcx;
 
-            let args = ~[lloutputarg,
-                         lltaskarg,
-                         llenvarg];
+            let args = [lloutputarg, lltaskarg, llenvarg];
             bcx.build.FastCall(main_llfn, args);
         }
         build_return(bcx);
@@ -6414,7 +6365,7 @@ fn create_fn_pair(cx: &@crate_ctxt, ps: str, llfnty: TypeRef, llfn: ValueRef,
                   external: bool) -> ValueRef {
     let gvar =
         llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty), str::buf(ps));
-    let pair = C_struct(~[llfn, C_null(T_opaque_closure_ptr(*cx))]);
+    let pair = C_struct([llfn, C_null(T_opaque_closure_ptr(*cx))]);
     llvm::LLVMSetInitializer(gvar, pair);
     llvm::LLVMSetGlobalConstant(gvar, True);
     if !external {
@@ -6432,10 +6383,9 @@ fn create_real_fn_pair(cx: &@block_ctxt, llfnty: TypeRef, llfn: ValueRef,
     let lcx = cx.fcx.lcx;
 
     let pair = alloca(cx, T_fn_pair(*lcx.ccx, llfnty));
-    let code_cell =
-        cx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_code)]);
+    let code_cell = cx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_code)]);
     cx.build.Store(llfn, code_cell);
-    let env_cell = cx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_box)]);
+    let env_cell = cx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_box)]);
     let llenvblobptr =
         cx.build.PointerCast(llenvptr, T_opaque_closure_ptr(*lcx.ccx));
     cx.build.Store(llenvblobptr, env_cell);
@@ -6547,18 +6497,18 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
         lltaskptr = vp2i(bcx, fcx.lltaskptr);
     } else { lltaskptr = fcx.lltaskptr; }
 
-    let call_args: [ValueRef] = ~[];
-    if pass_task { call_args += ~[lltaskptr]; }
-    if uses_retptr { call_args += ~[bcx.fcx.llretptr]; }
+    let call_args: [ValueRef] = [];
+    if pass_task { call_args += [lltaskptr]; }
+    if uses_retptr { call_args += [bcx.fcx.llretptr]; }
 
     let arg_n = 3u;
     for each i: uint in uint::range(0u, num_ty_param) {
         let llarg = llvm::LLVMGetParam(fcx.llfn, arg_n);
-        fcx.lltydescs += ~[llarg];
+        fcx.lltydescs += [llarg];
         assert (llarg as int != 0);
         if cast_to_i32 {
-            call_args += ~[vp2i(bcx, llarg)];
-        } else { call_args += ~[llarg]; }
+            call_args += [vp2i(bcx, llarg)];
+        } else { call_args += [llarg]; }
         arg_n += 1u;
     }
     fn convert_arg_to_i32(cx: &@block_ctxt, v: ValueRef, t: ty::t,
@@ -6582,10 +6532,10 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
 
     fn trans_simple_native_abi(bcx: &@block_ctxt, name: str,
                                call_args: &mutable [ValueRef], fn_type: ty::t,
-                               uses_retptr: bool, cc: uint)
-       -> {val: ValueRef, rptr: ValueRef} {
-        let call_arg_tys: [TypeRef] = ~[];
-        for arg: ValueRef in call_args { call_arg_tys += ~[val_ty(arg)]; }
+                               uses_retptr: bool, cc: uint) ->
+       {val: ValueRef, rptr: ValueRef} {
+        let call_arg_tys: [TypeRef] = [];
+        for arg: ValueRef in call_args { call_arg_tys += [val_ty(arg)]; }
 
         let llnativefnty;
         if uses_retptr {
@@ -6611,18 +6561,16 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
     let args = ty::ty_fn_args(ccx.tcx, fn_type);
     // Build up the list of arguments.
 
-    let drop_args: [{val: ValueRef, ty: ty::t}] = ~[];
+    let drop_args: [{val: ValueRef, ty: ty::t}] = [];
     let i = arg_n;
     for arg: ty::arg in args {
         let llarg = llvm::LLVMGetParam(fcx.llfn, i);
         assert (llarg as int != 0);
         if cast_to_i32 {
             let llarg_i32 = convert_arg_to_i32(bcx, llarg, arg.ty, arg.mode);
-            call_args += ~[llarg_i32];
-        } else { call_args += ~[llarg]; }
-        if arg.mode == ty::mo_val {
-            drop_args += ~[{val: llarg, ty: arg.ty}];
-        }
+            call_args += [llarg_i32];
+        } else { call_args += [llarg]; }
+        if arg.mode == ty::mo_val { drop_args += [{val: llarg, ty: arg.ty}]; }
         i += 1u;
     }
     let r;
@@ -6653,8 +6601,8 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
       }
       _ {
         r =
-            trans_native_call(bcx.build, ccx.externs,
-                              ccx.llmod, name, call_args);
+            trans_native_call(bcx.build, ccx.externs, ccx.llmod, name,
+                              call_args);
         rptr = bcx.build.BitCast(fcx.llretptr, T_ptr(T_i32()));
       }
     }
@@ -6671,7 +6619,7 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
     finish_fn(fcx, lltop);
 }
 
-fn item_path(item: &@ast::item) -> [str] { ret ~[item.ident]; }
+fn item_path(item: &@ast::item) -> [str] { ret [item.ident]; }
 
 fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[str],
                        _v: &vt<[str]>) {
@@ -6692,7 +6640,7 @@ fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[str],
       ast::item_const(_, _) {
         let typ = node_id_type(ccx, i.id);
         let s =
-            mangle_exported_name(ccx, pt + ~[i.ident],
+            mangle_exported_name(ccx, pt + [i.ident],
                                  node_id_type(ccx, i.id));
         let g =
             llvm::LLVMAddGlobal(ccx.llmod, type_of(ccx, i.span, typ),
@@ -6740,8 +6688,8 @@ fn collect_items(ccx: &@crate_ctxt, crate: @ast::crate) {
           visit_item: bind collect_item_1(ccx, _, _, _) with *visitor0};
     let visitor2 =
         @{visit_item: bind collect_item_2(ccx, _, _, _) with *visitor0};
-    visit::visit_crate(*crate, ~[], visit::mk_vt(visitor1));
-    visit::visit_crate(*crate, ~[], visit::mk_vt(visitor2));
+    visit::visit_crate(*crate, [], visit::mk_vt(visitor1));
+    visit::visit_crate(*crate, [], visit::mk_vt(visitor2));
 }
 
 fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str],
@@ -6752,7 +6700,7 @@ fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str],
       ast::item_tag(variants, tps) {
         for variant: ast::variant in variants {
             if std::vec::len(variant.node.args) != 0u {
-                decl_fn_and_pair(ccx, i.span, new_pt + ~[variant.node.name],
+                decl_fn_and_pair(ccx, i.span, new_pt + [variant.node.name],
                                  "tag", tps, variant.node.id);
             }
         }
@@ -6765,7 +6713,7 @@ fn collect_tag_ctors(ccx: &@crate_ctxt, crate: @ast::crate) {
     let visitor =
         @{visit_item: bind collect_tag_ctor(ccx, _, _, _)
              with *visit::default_visitor()};
-    visit::visit_crate(*crate, ~[], visit::mk_vt(visitor));
+    visit::visit_crate(*crate, [], visit::mk_vt(visitor));
 }
 
 
@@ -6779,8 +6727,8 @@ fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[str],
         let i = 0u;
         let n_variants = std::vec::len::<ast::variant>(variants);
         while i < n_variants {
-            let variant = variants.(i);
-            let p = new_pt + ~[it.ident, variant.node.name, "discrim"];
+            let variant = variants[i];
+            let p = new_pt + [it.ident, variant.node.name, "discrim"];
             let s = mangle_exported_name(ccx, p, ty::mk_int(ccx.tcx));
             let discrim_gvar =
                 llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(s));
@@ -6801,7 +6749,7 @@ fn trans_constants(ccx: &@crate_ctxt, crate: @ast::crate) {
     let visitor =
         @{visit_item: bind trans_constant(ccx, _, _, _)
              with *visit::default_visitor()};
-    visit::visit_crate(*crate, ~[], visit::mk_vt(visitor));
+    visit::visit_crate(*crate, [], visit::mk_vt(visitor));
 }
 
 fn vp2i(cx: &@block_ctxt, v: ValueRef) -> ValueRef {
@@ -6816,20 +6764,20 @@ fn p2i(v: ValueRef) -> ValueRef { ret llvm::LLVMConstPtrToInt(v, T_int()); }
 
 fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> {
     let T_memmove32_args: [TypeRef] =
-        ~[T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()];
+        [T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()];
     let T_memmove64_args: [TypeRef] =
-        ~[T_ptr(T_i8()), T_ptr(T_i8()), T_i64(), T_i32(), T_i1()];
+        [T_ptr(T_i8()), T_ptr(T_i8()), T_i64(), T_i32(), T_i1()];
     let T_memset32_args: [TypeRef] =
-        ~[T_ptr(T_i8()), T_i8(), T_i32(), T_i32(), T_i1()];
+        [T_ptr(T_i8()), T_i8(), T_i32(), T_i32(), T_i1()];
     let T_memset64_args: [TypeRef] =
-        ~[T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()];
-    let T_trap_args: [TypeRef] = ~[];
+        [T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()];
+    let T_trap_args: [TypeRef] = [];
     let gcroot =
         decl_cdecl_fn(llmod, "llvm.gcroot",
-                      T_fn(~[T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void()));
+                      T_fn([T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void()));
     let gcread =
         decl_cdecl_fn(llmod, "llvm.gcread",
-                      T_fn(~[T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void()));
+                      T_fn([T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void()));
     let memmove32 =
         decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32",
                       T_fn(T_memmove32_args, T_void()));
@@ -6855,7 +6803,7 @@ fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> {
 }
 
 fn trap(bcx: &@block_ctxt) {
-    let v: [ValueRef] = ~[];
+    let v: [ValueRef] = [];
     alt bcx_ccx(bcx).intrinsics.find("llvm.trap") {
       some(x) { bcx.build.Call(x, v); }
       _ { bcx_ccx(bcx).sess.bug("unbound llvm.trap in trap"); }
@@ -6863,7 +6811,7 @@ fn trap(bcx: &@block_ctxt) {
 }
 
 fn decl_no_op_type_glue(llmod: ModuleRef, taskptr_type: TypeRef) -> ValueRef {
-    let ty = T_fn(~[taskptr_type, T_ptr(T_i8())], T_void());
+    let ty = T_fn([taskptr_type, T_ptr(T_i8())], T_void());
     ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty);
 }
 
@@ -6875,11 +6823,11 @@ fn make_no_op_type_glue(fun: ValueRef) {
 
 fn vec_fill(bcx: &@block_ctxt, v: ValueRef) -> ValueRef {
     ret bcx.build.Load(bcx.build.GEP(v,
-                                     ~[C_int(0), C_int(abi::vec_elt_fill)]));
+                                     [C_int(0), C_int(abi::vec_elt_fill)]));
 }
 
 fn vec_p0(bcx: &@block_ctxt, v: ValueRef) -> ValueRef {
-    let p = bcx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_data)]);
+    let p = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]);
     ret bcx.build.PointerCast(p, T_ptr(T_i8()));
 }
 
@@ -6909,19 +6857,19 @@ fn make_common_glue(sess: &session::session, output: &str) {
 }
 
 fn create_module_map(ccx: &@crate_ctxt) -> ValueRef {
-    let elttype = T_struct(~[T_int(), T_int()]);
+    let elttype = T_struct([T_int(), T_int()]);
     let maptype = T_array(elttype, ccx.module_data.size() + 1u);
     let map =
         llvm::LLVMAddGlobal(ccx.llmod, maptype, str::buf("_rust_mod_map"));
     llvm::LLVMSetLinkage(map,
                          lib::llvm::LLVMInternalLinkage as llvm::Linkage);
-    let elts: [ValueRef] = ~[];
+    let elts: [ValueRef] = [];
     for each item: @{key: str, val: ValueRef} in ccx.module_data.items() {
-        let elt = C_struct(~[p2i(C_cstr(ccx, item.key)), p2i(item.val)]);
-        elts += ~[elt];
+        let elt = C_struct([p2i(C_cstr(ccx, item.key)), p2i(item.val)]);
+        elts += [elt];
     }
-    let term = C_struct(~[C_int(0), C_int(0)]);
-    elts += ~[term];
+    let term = C_struct([C_int(0), C_int(0)]);
+    elts += [term];
     llvm::LLVMSetInitializer(map, C_array(elttype, elts));
     ret map;
 }
@@ -6929,37 +6877,36 @@ fn create_module_map(ccx: &@crate_ctxt) -> ValueRef {
 
 // FIXME use hashed metadata instead of crate names once we have that
 fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef {
-    let subcrates: [ValueRef] = ~[];
+    let subcrates: [ValueRef] = [];
     let i = 1;
     let cstore = ccx.sess.get_cstore();
     while cstore::have_crate_data(cstore, i) {
         let nm = "_rust_crate_map_" + cstore::get_crate_data(cstore, i).name;
-        let cr =
-            llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(nm));
-        subcrates += ~[p2i(cr)];
+        let cr = llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(nm));
+        subcrates += [p2i(cr)];
         i += 1;
     }
-    subcrates += ~[C_int(0)];
+    subcrates += [C_int(0)];
     let mapname;
     if ccx.sess.get_opts().library {
         mapname = ccx.link_meta.name;
     } else { mapname = "toplevel"; }
     let sym_name = "_rust_crate_map_" + mapname;
     let arrtype = T_array(T_int(), std::vec::len::<ValueRef>(subcrates));
-    let maptype = T_struct(~[T_int(), arrtype]);
+    let maptype = T_struct([T_int(), arrtype]);
     let map = llvm::LLVMAddGlobal(ccx.llmod, maptype, str::buf(sym_name));
     llvm::LLVMSetLinkage(map,
                          lib::llvm::LLVMExternalLinkage as llvm::Linkage);
     llvm::LLVMSetInitializer(map,
-                             C_struct(~[p2i(create_module_map(ccx)),
-                                        C_array(T_int(), subcrates)]));
+                             C_struct([p2i(create_module_map(ccx)),
+                                       C_array(T_int(), subcrates)]));
     ret map;
 }
 
 fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) {
     if !cx.sess.get_opts().library { ret; }
     let llmeta = C_postr(metadata::encoder::encode_metadata(cx, crate));
-    let llconst = trans_common::C_struct(~[llmeta]);
+    let llconst = trans_common::C_struct([llmeta]);
     let llglobal =
         llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst),
                             str::buf("rust_metadata"));
@@ -6976,7 +6923,7 @@ fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) {
                             str::buf("llvm.used"));
     llvm::LLVMSetLinkage(llvm_used,
                          lib::llvm::LLVMAppendingLinkage as llvm::Linkage);
-    llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, ~[llglobal]));
+    llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, [llglobal]));
 }
 
 fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
@@ -7038,7 +6985,7 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
                mutable n_glues_created: 0u,
                mutable n_null_glues: 0u,
                mutable n_real_glues: 0u,
-               fn_times: @mutable ~[]},
+               fn_times: @mutable []},
           upcalls:
               upcall::declare_upcalls(tn, tydesc_type, taskptr_type, llmod),
           rust_object_type: T_rust_object(),
@@ -7059,15 +7006,15 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
     write_metadata(cx.ccx, crate);
     if ccx.sess.get_opts().stats {
         log_err "--- trans stats ---";
-        log_err #fmt("n_static_tydescs: %u", ccx.stats.n_static_tydescs);
-        log_err #fmt("n_derived_tydescs: %u", ccx.stats.n_derived_tydescs);
-        log_err #fmt("n_glues_created: %u", ccx.stats.n_glues_created);
-        log_err #fmt("n_null_glues: %u", ccx.stats.n_null_glues);
-        log_err #fmt("n_real_glues: %u", ccx.stats.n_real_glues);
+        log_err #fmt["n_static_tydescs: %u", ccx.stats.n_static_tydescs];
+        log_err #fmt["n_derived_tydescs: %u", ccx.stats.n_derived_tydescs];
+        log_err #fmt["n_glues_created: %u", ccx.stats.n_glues_created];
+        log_err #fmt["n_null_glues: %u", ccx.stats.n_null_glues];
+        log_err #fmt["n_real_glues: %u", ccx.stats.n_real_glues];
 
 
         for timing: {ident: str, time: int} in *ccx.stats.fn_times {
-            log_err #fmt("time: %s took %d ms", timing.ident, timing.time);
+            log_err #fmt["time: %s took %d ms", timing.ident, timing.time];
         }
     }
     ret llmod;
diff --git a/src/comp/middle/trans_alt.rs b/src/comp/middle/trans_alt.rs
index ec029e6dd98..b1c94862120 100644
--- a/src/comp/middle/trans_alt.rs
+++ b/src/comp/middle/trans_alt.rs
@@ -72,24 +72,24 @@ fn matches_always(p: &@ast::pat) -> bool {
 
 fn bind_for_pat(p: &@ast::pat, br: &match_branch, val: ValueRef) {
     alt p.node {
-      ast::pat_bind(name) { br.bound += ~[{ident: name, val: val}]; }
+      ast::pat_bind(name) { br.bound += [{ident: name, val: val}]; }
       _ { }
     }
 }
 
-type enter_pat = fn(&@ast::pat) -> option::t<[@ast::pat]> ;
+type enter_pat = fn(&@ast::pat) -> option::t<[@ast::pat]>;
 
 fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match {
-    let result = ~[];
+    let result = [];
     for br: match_branch in m {
-        alt e(br.pats.(col)) {
+        alt e(br.pats[col]) {
           some(sub) {
             let pats =
                 vec::slice(br.pats, 0u, col) + sub +
                     vec::slice(br.pats, col + 1u, vec::len(br.pats));
             let new_br = @{pats: pats with *br};
-            result += ~[new_br];
-            bind_for_pat(br.pats.(col), new_br, val);
+            result += [new_br];
+            bind_for_pat(br.pats[col], new_br, val);
           }
           none. { }
         }
@@ -99,7 +99,7 @@ fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match {
 
 fn enter_default(m: &match, col: uint, val: ValueRef) -> match {
     fn e(p: &@ast::pat) -> option::t<[@ast::pat]> {
-        ret if matches_always(p) { some(~[]) } else { none };
+        ret if matches_always(p) { some([]) } else { none };
     }
     ret enter_match(m, col, val, e);
 }
@@ -116,7 +116,7 @@ fn enter_opt(ccx: &@crate_ctxt, m: &match, opt: &opt, col: uint,
                 } else { none };
           }
           ast::pat_lit(l) {
-            ret if opt_eq(lit(l), opt) { some(~[]) } else { none };
+            ret if opt_eq(lit(l), opt) { some([]) } else { none };
           }
           _ { ret some(vec::init_elt(dummy, size)); }
         }
@@ -131,13 +131,13 @@ fn enter_rec(m: &match, col: uint, fields: &[ast::ident], val: ValueRef) ->
        option::t<[@ast::pat]> {
         alt p.node {
           ast::pat_rec(fpats, _) {
-            let pats = ~[];
+            let pats = [];
             for fname: ast::ident in fields {
                 let pat = dummy;
                 for fpat: ast::field_pat in fpats {
                     if str::eq(fpat.ident, fname) { pat = fpat.pat; break; }
                 }
-                pats += ~[pat];
+                pats += [pat];
             }
             ret some(pats);
           }
@@ -149,8 +149,8 @@ fn enter_rec(m: &match, col: uint, fields: &[ast::ident], val: ValueRef) ->
 
 fn enter_tup(m: &match, col: uint, val: ValueRef, n_elts: uint) -> match {
     let dummy = @{id: 0, node: ast::pat_wild, span: dummy_sp()};
-    fn e(dummy: &@ast::pat, n_elts: uint, p: &@ast::pat)
-        -> option::t<[@ast::pat]> {
+    fn e(dummy: &@ast::pat, n_elts: uint, p: &@ast::pat) ->
+       option::t<[@ast::pat]> {
         alt p.node {
           ast::pat_tup(elts) { ret some(elts); }
           _ { ret some(vec::init_elt(dummy, n_elts)); }
@@ -163,8 +163,8 @@ fn enter_box(m: &match, col: uint, val: ValueRef) -> match {
     let dummy = @{id: 0, node: ast::pat_wild, span: dummy_sp()};
     fn e(dummy: &@ast::pat, p: &@ast::pat) -> option::t<[@ast::pat]> {
         alt p.node {
-          ast::pat_box(sub) { ret some(~[sub]); }
-          _ { ret some(~[dummy]); }
+          ast::pat_box(sub) { ret some([sub]); }
+          _ { ret some([dummy]); }
         }
     }
     ret enter_match(m, col, val, bind e(dummy, _));
@@ -173,15 +173,15 @@ fn enter_box(m: &match, col: uint, val: ValueRef) -> match {
 fn get_options(ccx: &@crate_ctxt, m: &match, col: uint) -> [opt] {
     fn add_to_set(set: &mutable [opt], val: &opt) {
         for l: opt in set { if opt_eq(l, val) { ret; } }
-        set += ~[val];
+        set += [val];
     }
 
-    let found = ~[];
+    let found = [];
     for br: match_branch in m {
-        alt br.pats.(col).node {
+        alt br.pats[col].node {
           ast::pat_lit(l) { add_to_set(found, lit(l)); }
           ast::pat_tag(_, _) {
-            add_to_set(found, variant_opt(ccx, br.pats.(col).id));
+            add_to_set(found, variant_opt(ccx, br.pats[col].id));
           }
           _ { }
         }
@@ -190,20 +190,20 @@ fn get_options(ccx: &@crate_ctxt, m: &match, col: uint) -> [opt] {
 }
 
 fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id,
-                        vdefs: &{tg: def_id, var: def_id}, val: ValueRef)
-    -> {vals: [ValueRef], bcx: @block_ctxt} {
+                        vdefs: &{tg: def_id, var: def_id}, val: ValueRef) ->
+   {vals: [ValueRef], bcx: @block_ctxt} {
     let ccx = bcx.fcx.lcx.ccx;
     let ty_param_substs = ty::node_id_to_type_params(ccx.tcx, pat_id);
     let blobptr = val;
     let variants = ty::tag_variants(ccx.tcx, vdefs.tg);
-    let args = ~[];
+    let args = [];
     let size =
         vec::len(ty::tag_variant_with_id(ccx.tcx, vdefs.tg, vdefs.var).args);
     if size > 0u && vec::len(variants) != 1u {
         let tagptr =
             bcx.build.PointerCast(val,
                                   trans_common::T_opaque_tag_ptr(ccx.tn));
-        blobptr = bcx.build.GEP(tagptr, ~[C_int(0), C_int(1)]);
+        blobptr = bcx.build.GEP(tagptr, [C_int(0), C_int(1)]);
     }
     let i = 0u;
     while i < size {
@@ -211,20 +211,20 @@ fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id,
             trans::GEP_tag(bcx, blobptr, vdefs.tg, vdefs.var, ty_param_substs,
                            i as int);
         bcx = r.bcx;
-        args += ~[r.val];
+        args += [r.val];
         i += 1u;
     }
     ret {vals: args, bcx: bcx};
 }
 
 fn collect_record_fields(m: &match, col: uint) -> [ast::ident] {
-    let fields = ~[];
+    let fields = [];
     for br: match_branch in m {
-        alt br.pats.(col).node {
+        alt br.pats[col].node {
           ast::pat_rec(fs, _) {
             for f: ast::field_pat in fs {
                 if !vec::any(bind str::eq(f.ident, _), fields) {
-                    fields += ~[f.ident];
+                    fields += [f.ident];
                 }
             }
           }
@@ -236,14 +236,14 @@ fn collect_record_fields(m: &match, col: uint) -> [ast::ident] {
 
 fn any_box_pat(m: &match, col: uint) -> bool {
     for br: match_branch in m {
-        alt br.pats.(col).node { ast::pat_box(_) { ret true; } _ { } }
+        alt br.pats[col].node { ast::pat_box(_) { ret true; } _ { } }
     }
     ret false;
 }
 
 fn any_tup_pat(m: &match, col: uint) -> bool {
     for br: match_branch in m {
-        alt br.pats.(col).node { ast::pat_tup(_) { ret true; } _ { } }
+        alt br.pats[col].node { ast::pat_tup(_) { ret true; } _ { } }
     }
     ret false;
 }
@@ -252,13 +252,13 @@ type exit_node = {bound: bind_map, from: BasicBlockRef, to: BasicBlockRef};
 type mk_fail = fn() -> BasicBlockRef;
 
 fn pick_col(m: &match) -> uint {
-    let scores = vec::init_elt_mut(0u, vec::len(m.(0).pats));
+    let scores = vec::init_elt_mut(0u, vec::len(m[0].pats));
     for br: match_branch in m {
         let i = 0u;
         for p: @ast::pat in br.pats {
             alt p.node {
-              ast::pat_lit(_) | ast::pat_tag(_, _) { scores.(i) += 1u; }
-              _ {}
+              ast::pat_lit(_) | ast::pat_tag(_, _) { scores[i] += 1u; }
+              _ { }
             }
             i += 1u;
         }
@@ -272,10 +272,7 @@ fn pick_col(m: &match) -> uint {
         if score == 0u { ret i; }
         // If no irrefutable ones are found, we pick the one with the biggest
         // branching factor.
-        if score > max_score {
-            max_score = score;
-            best_col = i;
-        }
+        if score > max_score { max_score = score; best_col = i; }
         i += 1u;
     }
     ret best_col;
@@ -284,22 +281,24 @@ fn pick_col(m: &match) -> uint {
 fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
                     f: &mk_fail, exits: &mutable [exit_node]) {
     if vec::len(m) == 0u { bcx.build.Br(f()); ret; }
-    if vec::len(m.(0).pats) == 0u {
-        exits += ~[{bound: m.(0).bound, from: bcx.llbb, to: m.(0).body}];
-        bcx.build.Br(m.(0).body);
+    if vec::len(m[0].pats) == 0u {
+        exits += [{bound: m[0].bound, from: bcx.llbb, to: m[0].body}];
+        bcx.build.Br(m[0].body);
         ret;
     }
 
     let col = pick_col(m);
-    let val = vals.(col);
-    let vals_left = vec::slice(vals, 0u, col) +
-        vec::slice(vals, col + 1u, vec::len(vals));
+    let val = vals[col];
+    let vals_left =
+        vec::slice(vals, 0u, col) +
+            vec::slice(vals, col + 1u, vec::len(vals));
     let ccx = bcx.fcx.lcx.ccx;
     let pat_id = 0;
     for br: match_branch in m {
+
         // Find a real id (we're adding placeholder wildcard patterns, but
         // each column is guaranteed to have at least one real pattern)
-        if pat_id == 0 { pat_id = br.pats.(col).id; }
+        if pat_id == 0 { pat_id = br.pats[col].id; }
     }
 
     let rec_fields = collect_record_fields(m, col);
@@ -308,12 +307,12 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
         let rec_ty = ty::node_id_to_monotype(ccx.tcx, pat_id);
         let fields =
             alt ty::struct(ccx.tcx, rec_ty) { ty::ty_rec(fields) { fields } };
-        let rec_vals = ~[];
+        let rec_vals = [];
         for field_name: ast::ident in rec_fields {
             let ix: uint =
                 ty::field_idx(ccx.sess, dummy_sp(), field_name, fields);
-            let r = trans::GEP_tup_like(bcx, rec_ty, val, ~[0, ix as int]);
-            rec_vals += ~[r.val];
+            let r = trans::GEP_tup_like(bcx, rec_ty, val, [0, ix as int]);
+            rec_vals += [r.val];
             bcx = r.bcx;
         }
         compile_submatch(bcx, enter_rec(m, col, rec_fields, val),
@@ -323,13 +322,14 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
 
     if any_tup_pat(m, col) {
         let tup_ty = ty::node_id_to_monotype(ccx.tcx, pat_id);
-        let n_tup_elts = alt ty::struct(ccx.tcx, tup_ty) {
-          ty::ty_tup(elts) { vec::len(elts) }
-        };
-        let tup_vals = ~[], i = 0u;
+        let n_tup_elts =
+            alt ty::struct(ccx.tcx, tup_ty) {
+              ty::ty_tup(elts) { vec::len(elts) }
+            };
+        let tup_vals = [], i = 0u;
         while i < n_tup_elts {
-            let r = trans::GEP_tup_like(bcx, tup_ty, val, ~[0, i as int]);
-            tup_vals += ~[r.val];
+            let r = trans::GEP_tup_like(bcx, tup_ty, val, [0, i as int]);
+            tup_vals += [r.val];
             bcx = r.bcx;
             i += 1u;
         }
@@ -343,9 +343,9 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
         let box = bcx.build.Load(val);
         let unboxed =
             bcx.build.InBoundsGEP(box,
-                                  ~[C_int(0),
-                                    C_int(back::abi::box_rc_field_body)]);
-        compile_submatch(bcx, enter_box(m, col, val), ~[unboxed] + vals_left,
+                                  [C_int(0),
+                                   C_int(back::abi::box_rc_field_body)]);
+        compile_submatch(bcx, enter_box(m, col, val), [unboxed] + vals_left,
                          f, exits);
         ret;
     }
@@ -356,14 +356,16 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
     let kind = no_branch;
     let test_val = val;
     if vec::len(opts) > 0u {
-        alt opts.(0) {
+        alt opts[0] {
           var(_, vdef) {
             if vec::len(ty::tag_variants(ccx.tcx, vdef.tg)) == 1u {
                 kind = single;
             } else {
-                let tagptr = bcx.build.PointerCast
-                    (val, trans_common::T_opaque_tag_ptr(ccx.tn));
-                let discrimptr = bcx.build.GEP(tagptr, ~[C_int(0), C_int(0)]);
+                let tagptr =
+                    bcx.build.PointerCast(
+                        val,
+                        trans_common::T_opaque_tag_ptr(ccx.tn));
+                let discrimptr = bcx.build.GEP(tagptr, [C_int(0), C_int(0)]);
                 test_val = bcx.build.Load(discrimptr);
                 kind = switch;
             }
@@ -398,15 +400,15 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
             let r = trans_opt(bcx, opt);
             bcx = r.bcx;
             let t = ty::node_id_to_type(ccx.tcx, pat_id);
-            let eq = trans::trans_compare(bcx, ast::eq, test_val, t,
-                                          r.val, t);
+            let eq =
+                trans::trans_compare(bcx, ast::eq, test_val, t, r.val, t);
             bcx = new_sub_block_ctxt(bcx, "next");
             eq.bcx.build.CondBr(eq.val, opt_cx.llbb, bcx.llbb);
           }
           _ { }
         }
         let size = 0u;
-        let unpacked = ~[];
+        let unpacked = [];
         alt opt {
           var(_, vdef) {
             let args = extract_variant_args(opt_cx, pat_id, vdef, val);
@@ -441,18 +443,18 @@ fn make_phi_bindings(bcx: &@block_ctxt, map: &[exit_node],
     let our_block = bcx.llbb as uint;
     let success = true;
     for each item: @{key: ast::ident, val: ast::node_id} in ids.items() {
-        let llbbs = ~[];
-        let vals = ~[];
+        let llbbs = [];
+        let vals = [];
         for ex: exit_node in map {
             if ex.to as uint == our_block {
                 alt assoc(item.key, ex.bound) {
-                  some(val) { llbbs += ~[ex.from]; vals += ~[val]; }
+                  some(val) { llbbs += [ex.from]; vals += [val]; }
                   none. { }
                 }
             }
         }
         if vec::len(vals) > 0u {
-            let phi = bcx.build.Phi(val_ty(vals.(0)), vals, llbbs);
+            let phi = bcx.build.Phi(val_ty(vals[0]), vals, llbbs);
             bcx.fcx.lllocals.insert(item.val, phi);
         } else { success = false; }
     }
@@ -461,25 +463,23 @@ fn make_phi_bindings(bcx: &@block_ctxt, map: &[exit_node],
 
 fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm],
              output: &trans::out_method) -> result {
-    let bodies = ~[];
-    let match: match = ~[];
+    let bodies = [];
+    let match: match = [];
     let er = trans::trans_expr(cx, expr);
-    if (ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), expr))) {
+    if ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), expr)) {
+
         // No need to generate code for alt,
         // since the disc diverges.
-        if (!cx.build.is_terminated()) {
+        if !cx.build.is_terminated() {
             ret rslt(cx, cx.build.Unreachable());
-        }
-        else {
-            ret er;
-        }
+        } else { ret er; }
     }
 
     for a: ast::arm in arms {
         let body = new_scope_block_ctxt(cx, "case_body");
-        bodies += ~[body];
+        bodies += [body];
         for p: @ast::pat in a.pats {
-            match += ~[@{pats: ~[p], body: body.llbb, mutable bound: ~[]}];
+            match += [@{pats: [p], body: body.llbb, mutable bound: []}];
         }
     }
 
@@ -489,26 +489,26 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm],
                done: @mutable option::t<BasicBlockRef>) -> BasicBlockRef {
         alt *done { some(bb) { ret bb; } _ { } }
         let fail_cx = new_sub_block_ctxt(cx, "case_fallthrough");
-        trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure");
+        trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure");;
         *done = some(fail_cx.llbb);
         ret fail_cx.llbb;
     }
 
-    let exit_map = ~[];
+    let exit_map = [];
     let t = trans::node_id_type(cx.fcx.lcx.ccx, expr.id);
     let v = trans::spill_if_immediate(er.bcx, er.val, t);
-    compile_submatch(er.bcx, match, ~[v],
-                     bind mk_fail(cx, expr.span, fail_cx), exit_map);
+    compile_submatch(er.bcx, match, [v], bind mk_fail(cx, expr.span, fail_cx),
+                     exit_map);
 
     let i = 0u;
-    let arm_results = ~[];
+    let arm_results = [];
     for a: ast::arm in arms {
-        let body_cx = bodies.(i);
-        if make_phi_bindings(body_cx, exit_map, ast::pat_id_map(a.pats.(0))) {
+        let body_cx = bodies[i];
+        if make_phi_bindings(body_cx, exit_map, ast::pat_id_map(a.pats[0])) {
             let block_res = trans::trans_block(body_cx, a.body, output);
-            arm_results += ~[block_res];
+            arm_results += [block_res];
         } else { // Unreachable
-            arm_results += ~[rslt(body_cx, C_nil())];
+            arm_results += [rslt(body_cx, C_nil())];
         }
         i += 1u;
     }
@@ -518,8 +518,7 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm],
 // Not alt-related, but similar to the pattern-munging code above
 fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
                         table: hashmap<ast::node_id, ValueRef>,
-                        make_copy: bool)
-    -> @block_ctxt {
+                        make_copy: bool) -> @block_ctxt {
     let ccx = bcx.fcx.lcx.ccx;
     alt pat.node {
       ast::pat_bind(_) {
@@ -532,9 +531,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
             bcx = trans::copy_ty(bcx, loaded, ty).bcx;
             table.insert(pat.id, alloc);
             trans_common::add_clean(bcx, alloc, ty);
-        } else {
-            table.insert(pat.id, val);
-        }
+        } else { table.insert(pat.id, val); }
       }
       ast::pat_tag(_, sub) {
         if vec::len(sub) == 0u { ret bcx; }
@@ -542,8 +539,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
         let args = extract_variant_args(bcx, pat.id, vdefs, val);
         let i = 0;
         for argval: ValueRef in args.vals {
-            bcx = bind_irrefutable_pat(bcx, sub.(i), argval, table,
-                                       make_copy);
+            bcx = bind_irrefutable_pat(bcx, sub[i], argval, table, make_copy);
             i += 1;
         }
       }
@@ -554,7 +550,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
         for f: ast::field_pat in fields {
             let ix: uint =
                 ty::field_idx(ccx.sess, pat.span, f.ident, rec_fields);
-            let r = trans::GEP_tup_like(bcx, rec_ty, val, ~[0, ix as int]);
+            let r = trans::GEP_tup_like(bcx, rec_ty, val, [0, ix as int]);
             bcx = bind_irrefutable_pat(r.bcx, f.pat, r.val, table, make_copy);
         }
       }
@@ -562,18 +558,20 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
         let tup_ty = ty::node_id_to_monotype(ccx.tcx, pat.id);
         let i = 0u;
         for elem in elems {
-            let r = trans::GEP_tup_like(bcx, tup_ty, val, ~[0, i as int]);
+            let r = trans::GEP_tup_like(bcx, tup_ty, val, [0, i as int]);
             bcx = bind_irrefutable_pat(r.bcx, elem, r.val, table, make_copy);
             i += 1u;
         }
       }
       ast::pat_box(inner) {
         let box = bcx.build.Load(val);
-        let unboxed = bcx.build.InBoundsGEP
-            (box, ~[C_int(0), C_int(back::abi::box_rc_field_body)]);
+        let unboxed =
+            bcx.build.InBoundsGEP(box,
+                                  [C_int(0),
+                                   C_int(back::abi::box_rc_field_body)]);
         bcx = bind_irrefutable_pat(bcx, inner, unboxed, table, true);
       }
-      ast::pat_wild. | ast::pat_lit(_) {}
+      ast::pat_wild. | ast::pat_lit(_) { }
     }
     ret bcx;
 }
diff --git a/src/comp/middle/trans_common.rs b/src/comp/middle/trans_common.rs
index 732c8305f84..e53f4a47b27 100644
--- a/src/comp/middle/trans_common.rs
+++ b/src/comp/middle/trans_common.rs
@@ -71,9 +71,9 @@ type derived_tydesc_info = {lltydesc: ValueRef, escapes: bool};
 type glue_fns = {no_op_type_glue: ValueRef};
 
 tag tydesc_kind {
-    tk_static;      // Static (monomorphic) type descriptor.
-    tk_param;       // Type parameter.
-    tk_derived;     // Derived from a typaram or another derived tydesc.
+    tk_static; // Static (monomorphic) type descriptor.
+    tk_param; // Type parameter.
+    tk_derived; // Derived from a typaram or another derived tydesc.
 }
 
 type tydesc_info =
@@ -111,46 +111,44 @@ type stats =
      fn_times: @mutable [{ident: str, time: int}]};
 
 // Crate context.  Every crate we compile has one of these.
-type crate_ctxt = {
-    sess: session::session,
-    llmod: ModuleRef,
-    td: target_data,
-    tn: type_names,
-    externs: hashmap<str, ValueRef>,
-    intrinsics: hashmap<str, ValueRef>,
-
+type crate_ctxt =
     // A mapping from the def_id of each item in this crate to the address
     // of the first instruction of the item's definition in the executable
     // we're generating.
-    item_ids: hashmap<ast::node_id, ValueRef>,
-    ast_map: ast_map::map,
-    item_symbols: hashmap<ast::node_id, str>,
-    mutable main_fn: option::t<ValueRef>,
-    link_meta: link::link_meta,
     // TODO: hashmap<tup(tag_id,subtys), @tag_info>
-    tag_sizes: hashmap<ty::t, uint>,
-    discrims: hashmap<ast::node_id, ValueRef>,
-    discrim_symbols: hashmap<ast::node_id, str>,
-    fn_pairs: hashmap<ast::node_id, ValueRef>,
-    consts: hashmap<ast::node_id, ValueRef>,
-    obj_methods: hashmap<ast::node_id, ()>,
-    tydescs: hashmap<ty::t, @tydesc_info>,
-    module_data: hashmap<str, ValueRef>,
-    lltypes: hashmap<ty::t, TypeRef>,
-    glues: @glue_fns,
-    names: namegen,
-    sha: std::sha1::sha1,
-    type_sha1s: hashmap<ty::t, str>,
-    type_short_names: hashmap<ty::t, str>,
-    tcx: ty::ctxt,
-    stats: stats,
-    upcalls: @upcall::upcalls,
-    rust_object_type: TypeRef,
-    tydesc_type: TypeRef,
-    task_type: TypeRef,
-    shape_cx: shape::ctxt,
-    gc_cx: gc::ctxt
-};
+    {sess: session::session,
+     llmod: ModuleRef,
+     td: target_data,
+     tn: type_names,
+     externs: hashmap<str, ValueRef>,
+     intrinsics: hashmap<str, ValueRef>,
+     item_ids: hashmap<ast::node_id, ValueRef>,
+     ast_map: ast_map::map,
+     item_symbols: hashmap<ast::node_id, str>,
+     mutable main_fn: option::t<ValueRef>,
+     link_meta: link::link_meta,
+     tag_sizes: hashmap<ty::t, uint>,
+     discrims: hashmap<ast::node_id, ValueRef>,
+     discrim_symbols: hashmap<ast::node_id, str>,
+     fn_pairs: hashmap<ast::node_id, ValueRef>,
+     consts: hashmap<ast::node_id, ValueRef>,
+     obj_methods: hashmap<ast::node_id, ()>,
+     tydescs: hashmap<ty::t, @tydesc_info>,
+     module_data: hashmap<str, ValueRef>,
+     lltypes: hashmap<ty::t, TypeRef>,
+     glues: @glue_fns,
+     names: namegen,
+     sha: std::sha1::sha1,
+     type_sha1s: hashmap<ty::t, str>,
+     type_short_names: hashmap<ty::t, str>,
+     tcx: ty::ctxt,
+     stats: stats,
+     upcalls: @upcall::upcalls,
+     rust_object_type: TypeRef,
+     tydesc_type: TypeRef,
+     task_type: TypeRef,
+     shape_cx: shape::ctxt,
+     gc_cx: gc::ctxt};
 
 type local_ctxt =
     {path: [str],
@@ -164,12 +162,11 @@ type val_self_pair = {v: ValueRef, t: ty::t};
 
 // Function context.  Every LLVM function we create will have one of
 // these.
-type fn_ctxt = {
+type fn_ctxt =
     // The ValueRef returned from a call to llvm::LLVMAddFunction; the
     // address of the first instruction in the sequence of
     // instructions for this function that will go in the .text
     // section of the executable we're generating.
-    llfn: ValueRef,
 
     // The three implicit arguments that arrive in the function we're
     // creating.  For instance, foo(int, int) is really foo(ret*,
@@ -179,16 +176,13 @@ type fn_ctxt = {
     // convenience.
 
     // Points to the current task.
-    lltaskptr: ValueRef,
 
     // Points to the current environment (bindings of variables to
     // values), if this is a regular function; points to the current
     // object, if this is a method.
-    llenv: ValueRef,
 
     // Points to where the return value of this function should end
     // up.
-    llretptr: ValueRef,
 
     // The next three elements: "hoisted basic blocks" containing
     // administrative activities that have to happen in only one place in
@@ -196,20 +190,16 @@ type fn_ctxt = {
 
     // A block for all the function's static allocas, so that LLVM
     // will coalesce them into a single alloca call.
-    mutable llstaticallocas: BasicBlockRef,
 
     // A block containing code that copies incoming arguments to space
     // already allocated by code in one of the llallocas blocks.
     // (LLVM requires that arguments be copied to local allocas before
     // allowing most any operation to be performed on them.)
-    mutable llcopyargs: BasicBlockRef,
 
     // The first block containing derived tydescs received from the
     // runtime.  See description of derived_tydescs, below.
-    mutable llderivedtydescs_first: BasicBlockRef,
 
     // The last block of the llderivedtydescs group.
-    mutable llderivedtydescs: BasicBlockRef,
 
     // A block for all of the dynamically sized allocas.  This must be
     // after llderivedtydescs, because these sometimes depend on
@@ -219,52 +209,41 @@ type fn_ctxt = {
     // for incoming function arguments?  Or is it merely the block
     // containing code that copies incoming args to space already
     // alloca'd by code in llallocas?
-    mutable lldynamicallocas: BasicBlockRef,
 
-    mutable llreturn: BasicBlockRef,
 
     // The token used to clear the dynamic allocas at the end of this frame.
-    mutable llobstacktoken: option::t<ValueRef>,
 
     // The 'self' object currently in use in this function, if there
     // is one.
-    mutable llself: option::t<val_self_pair>,
 
     // If this function is actually a iter, a block containing the
     // code called whenever the iter calls 'put'.
-    mutable lliterbody: option::t<ValueRef>,
 
     // If this function is actually a iter, the type of the function
     // that that we call when we call 'put'. Having to track this is
     // pretty irritating. We have to do it because we need the type if
     // we are going to put the iterbody into a closure (if it appears
     // in a for-each inside of an iter).
-    mutable iterbodyty: option::t<ty::t>,
 
     // The next four items: hash tables mapping from AST def_ids to
     // LLVM-stuff-in-the-frame.
 
     // Maps arguments to allocas created for them in llallocas.
-    llargs: hashmap<ast::node_id, ValueRef>,
 
     // Maps fields in objects to pointers into the interior of
     // llself's body.
-    llobjfields: hashmap<ast::node_id, ValueRef>,
 
     // Maps the def_ids for local variables to the allocas created for
     // them in llallocas.
-    lllocals: hashmap<ast::node_id, ValueRef>,
 
     // The same as above, but for variables accessed via the frame
     // pointer we pass into an iter, for access to the static
     // environment of the iter-calling frame.
-    llupvars: hashmap<ast::node_id, ValueRef>,
 
     // For convenience, a vector of the incoming tydescs for each of
     // this functions type parameters, fetched via llvm::LLVMGetParam.
     // For example, for a function foo::<A, B, C>(), lltydescs contains
     // the ValueRefs for the tydescs for A, B, and C.
-    mutable lltydescs: [ValueRef],
 
     // Derived tydescs are tydescs created at runtime, for types that
     // involve type parameters inside type constructors.  For example,
@@ -275,31 +254,48 @@ type fn_ctxt = {
     // when information about both "[T]" and "T" are available.  When
     // such a tydesc is created, we cache it in the derived_tydescs
     // table for the next time that such a tydesc is needed.
-    derived_tydescs: hashmap<ty::t, derived_tydesc_info>,
 
     // The node_id of the function, or -1 if it doesn't correspond to
     // a user-defined function.
-    id: ast::node_id,
 
     // The source span where this function comes from, for error
     // reporting.
-    sp: span,
 
     // This function's enclosing local context.
-    lcx: @local_ctxt
-};
+    {llfn: ValueRef,
+     lltaskptr: ValueRef,
+     llenv: ValueRef,
+     llretptr: ValueRef,
+     mutable llstaticallocas: BasicBlockRef,
+     mutable llcopyargs: BasicBlockRef,
+     mutable llderivedtydescs_first: BasicBlockRef,
+     mutable llderivedtydescs: BasicBlockRef,
+     mutable lldynamicallocas: BasicBlockRef,
+     mutable llreturn: BasicBlockRef,
+     mutable llobstacktoken: option::t<ValueRef>,
+     mutable llself: option::t<val_self_pair>,
+     mutable lliterbody: option::t<ValueRef>,
+     mutable iterbodyty: option::t<ty::t>,
+     llargs: hashmap<ast::node_id, ValueRef>,
+     llobjfields: hashmap<ast::node_id, ValueRef>,
+     lllocals: hashmap<ast::node_id, ValueRef>,
+     llupvars: hashmap<ast::node_id, ValueRef>,
+     mutable lltydescs: [ValueRef],
+     derived_tydescs: hashmap<ty::t, derived_tydesc_info>,
+     id: ast::node_id,
+     sp: span,
+     lcx: @local_ctxt};
 
 tag cleanup {
-    clean(fn(&@block_ctxt) -> result );
-    clean_temp(ValueRef, fn(&@block_ctxt) -> result );
+    clean(fn(&@block_ctxt) -> result);
+    clean_temp(ValueRef, fn(&@block_ctxt) -> result);
 }
 
 fn add_clean(cx: &@block_ctxt, val: ValueRef, ty: ty::t) {
-    find_scope_cx(cx).cleanups += ~[clean(bind drop_slot(_, val, ty))];
+    find_scope_cx(cx).cleanups += [clean(bind drop_slot(_, val, ty))];
 }
 fn add_clean_temp(cx: &@block_ctxt, val: ValueRef, ty: ty::t) {
-    find_scope_cx(cx).cleanups +=
-        ~[clean_temp(val, bind drop_ty(_, val, ty))];
+    find_scope_cx(cx).cleanups += [clean_temp(val, bind drop_ty(_, val, ty))];
 }
 
 // Note that this only works for temporaries. We should, at some point, move
@@ -326,22 +322,23 @@ fn revoke_clean(cx: &@block_ctxt, val: ValueRef) {
     sc_cx.cleanups =
         std::vec::slice(sc_cx.cleanups, 0u, found as uint) +
             std::vec::slice(sc_cx.cleanups, (found as uint) + 1u,
-                             std::vec::len(sc_cx.cleanups));
+                            std::vec::len(sc_cx.cleanups));
 }
 
-fn get_res_dtor(ccx : &@crate_ctxt, sp : &span, did : &ast::def_id,
-                inner_t : ty::t) -> ValueRef {
+fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id,
+                inner_t: ty::t) -> ValueRef {
     if did.crate == ast::local_crate {
         alt ccx.fn_pairs.find(did.node) {
-            some(x) { ret x; }
-            _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); }
+          some(x) { ret x; }
+          _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); }
         }
     }
 
     let params = csearch::get_type_param_count(ccx.sess.get_cstore(), did);
-    let f_t = trans::type_of_fn(ccx, sp, ast::proto_fn,
-                                ~[{ mode: ty::mo_alias(false), ty: inner_t }],
-                                ty::mk_nil(ccx.tcx), params);
+    let f_t =
+        trans::type_of_fn(ccx, sp, ast::proto_fn,
+                          [{mode: ty::mo_alias(false), ty: inner_t}],
+                          ty::mk_nil(ccx.tcx), params);
     ret trans::get_extern_const(ccx.externs, ccx.llmod,
                                 csearch::get_symbol(ccx.sess.get_cstore(),
                                                     did),
@@ -378,36 +375,35 @@ tag block_kind {
 // code.  Each basic block we generate is attached to a function, typically
 // with many basic blocks per function.  All the basic blocks attached to a
 // function are organized as a directed graph.
-type block_ctxt = {
+type block_ctxt =
     // The BasicBlockRef returned from a call to
     // llvm::LLVMAppendBasicBlock(llfn, name), which adds a basic
     // block to the function pointed to by llfn.  We insert
     // instructions into that block by way of this block context.
-    llbb: BasicBlockRef,
 
     // The llvm::builder object serving as an interface to LLVM's
     // LLVMBuild* functions.
-    build: builder,
 
     // The block pointing to this one in the function's digraph.
-    parent: block_parent,
 
     // The 'kind' of basic block this is.
-    kind: block_kind,
 
     // A list of functions that run at the end of translating this
     // block, cleaning up any variables that were introduced in the
     // block and need to go out of scope at the end of it.
-    mutable cleanups: [cleanup],
 
     // The source span where this block comes from, for error
     // reporting.
-    sp: span,
 
     // The function context for the function to which this block is
     // attached.
-    fcx: @fn_ctxt
-};
+    {llbb: BasicBlockRef,
+     build: builder,
+     parent: block_parent,
+     kind: block_kind,
+     mutable cleanups: [cleanup],
+     sp: span,
+     fcx: @fn_ctxt};
 
 // FIXME: we should be able to use option::t<@block_parent> here but
 // the infinite-tag check in rustboot gets upset.
@@ -417,7 +413,7 @@ type result = {bcx: @block_ctxt, val: ValueRef};
 type result_t = {bcx: @block_ctxt, val: ValueRef, ty: ty::t};
 
 fn extend_path(cx: @local_ctxt, name: &str) -> @local_ctxt {
-    ret @{path: cx.path + ~[name] with *cx};
+    ret @{path: cx.path + [name] with *cx};
 }
 
 fn rslt(bcx: @block_ctxt, val: ValueRef) -> result {
@@ -438,7 +434,7 @@ fn struct_elt(llstructty: TypeRef, n: uint) -> TypeRef {
     assert (n < elt_count);
     let elt_tys = std::vec::init_elt(T_nil(), elt_count);
     llvm::LLVMGetStructElementTypes(llstructty, std::vec::to_ptr(elt_tys));
-    ret llvm::LLVMGetElementType(elt_tys.(n));
+    ret llvm::LLVMGetElementType(elt_tys[n]);
 }
 
 fn find_scope_cx(cx: &@block_ctxt) -> @block_ctxt {
@@ -459,8 +455,8 @@ fn bcx_tcx(bcx: &@block_ctxt) -> ty::ctxt { ret bcx.fcx.lcx.ccx.tcx; }
 fn bcx_ccx(bcx: &@block_ctxt) -> @crate_ctxt { ret bcx.fcx.lcx.ccx; }
 fn bcx_lcx(bcx: &@block_ctxt) -> @local_ctxt { ret bcx.fcx.lcx; }
 fn bcx_fcx(bcx: &@block_ctxt) -> @fn_ctxt { ret bcx.fcx; }
-fn fcx_ccx(fcx: &@fn_ctxt)    -> @crate_ctxt { ret fcx.lcx.ccx; }
-fn fcx_tcx(fcx: &@fn_ctxt)    -> ty::ctxt { ret fcx.lcx.ccx.tcx; }
+fn fcx_ccx(fcx: &@fn_ctxt) -> @crate_ctxt { ret fcx.lcx.ccx; }
+fn fcx_tcx(fcx: &@fn_ctxt) -> ty::ctxt { ret fcx.lcx.ccx.tcx; }
 fn lcx_ccx(lcx: &@local_ctxt) -> @crate_ctxt { ret lcx.ccx; }
 fn ccx_tcx(ccx: &@crate_ctxt) -> ty::ctxt { ret ccx.tcx; }
 
@@ -527,7 +523,7 @@ fn T_fn(inputs: &[TypeRef], output: TypeRef) -> TypeRef {
 }
 
 fn T_fn_pair(cx: &crate_ctxt, tfn: TypeRef) -> TypeRef {
-    ret T_struct(~[T_ptr(tfn), T_opaque_closure_ptr(cx)]);
+    ret T_struct([T_ptr(tfn), T_opaque_closure_ptr(cx)]);
 }
 
 fn T_ptr(t: TypeRef) -> TypeRef { ret llvm::LLVMPointerType(t, 0u); }
@@ -547,7 +543,7 @@ fn set_struct_body(t: TypeRef, elts: &[TypeRef]) {
                             False);
 }
 
-fn T_empty_struct() -> TypeRef { ret T_struct(~[]); }
+fn T_empty_struct() -> TypeRef { ret T_struct([]); }
 
 // NB: This will return something different every time it's called. If
 // you need a generic object type that matches the type of your
@@ -556,25 +552,27 @@ fn T_empty_struct() -> TypeRef { ret T_struct(~[]); }
 fn T_rust_object() -> TypeRef {
     let t = T_named_struct("rust_object");
     let e = T_ptr(T_empty_struct());
-    set_struct_body(t, ~[e, e]);
+    set_struct_body(t, [e, e]);
     ret t;
 }
 
 fn T_task() -> TypeRef {
     let t = T_named_struct("task");
 
-    let  // Refcount
-         // Delegate pointer
-         // Stack segment pointer
-         // Runtime SP
-         // Rust SP
-         // GC chain
-
-         // Domain pointer
-         // Crate cache pointer
-         elems =
-        ~[T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(),
-          T_int()];
+     // Refcount
+     // Delegate pointer
+     // Stack segment pointer
+     // Runtime SP
+     // Rust SP
+     // GC chain
+
+
+     // Domain pointer
+     // Crate cache pointer
+
+    let elems =
+        [T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(),
+         T_int()];
     set_struct_body(t, elems);
     ret t;
 }
@@ -586,7 +584,7 @@ fn T_tydesc_field(cx: &crate_ctxt, field: int) -> TypeRef {
         std::vec::init_elt::<TypeRef>(T_nil(), abi::n_tydesc_fields as uint);
     llvm::LLVMGetStructElementTypes(cx.tydesc_type,
                                     std::vec::to_ptr::<TypeRef>(tydesc_elts));
-    let t = llvm::LLVMGetElementType(tydesc_elts.(field));
+    let t = llvm::LLVMGetElementType(tydesc_elts[field]);
     ret t;
 }
 
@@ -611,16 +609,16 @@ fn T_tydesc(taskptr_type: TypeRef) -> TypeRef {
     let tydescpp = T_ptr(T_ptr(tydesc));
     let pvoid = T_ptr(T_i8());
     let glue_fn_ty =
-        T_ptr(T_fn(~[T_ptr(T_nil()), taskptr_type, T_ptr(T_nil()), tydescpp,
-                     pvoid], T_void()));
+        T_ptr(T_fn([T_ptr(T_nil()), taskptr_type, T_ptr(T_nil()), tydescpp,
+                    pvoid], T_void()));
     let cmp_glue_fn_ty =
-        T_ptr(T_fn(~[T_ptr(T_i1()), taskptr_type, T_ptr(tydesc), tydescpp,
-                     pvoid, pvoid, T_i8()], T_void()));
+        T_ptr(T_fn([T_ptr(T_i1()), taskptr_type, T_ptr(tydesc), tydescpp,
+                    pvoid, pvoid, T_i8()], T_void()));
 
     let elems =
-        ~[tydescpp, T_int(), T_int(), glue_fn_ty, glue_fn_ty, glue_fn_ty,
-          glue_fn_ty, glue_fn_ty, glue_fn_ty, glue_fn_ty, cmp_glue_fn_ty,
-          T_ptr(T_i8()), T_ptr(T_i8()), T_int()];
+        [tydescpp, T_int(), T_int(), glue_fn_ty, glue_fn_ty, glue_fn_ty,
+         glue_fn_ty, glue_fn_ty, glue_fn_ty, glue_fn_ty, cmp_glue_fn_ty,
+         T_ptr(T_i8()), T_ptr(T_i8()), T_int()];
     set_struct_body(tydesc, elems);
     ret tydesc;
 }
@@ -628,13 +626,13 @@ fn T_tydesc(taskptr_type: TypeRef) -> TypeRef {
 fn T_array(t: TypeRef, n: uint) -> TypeRef { ret llvm::LLVMArrayType(t, n); }
 
 fn T_evec(t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int(), // Refcount
-                   T_int(), // Alloc
-                   T_int(), // Fill
+    ret T_struct([T_int(), // Refcount
+                  T_int(), // Alloc
+                  T_int(), // Fill
 
-                   T_int(), // Pad
-                            // Body elements
-                             T_array(t, 0u)]);
+                  T_int(), // Pad
+                           // Body elements
+                            T_array(t, 0u)]);
 }
 
 fn T_opaque_vec_ptr() -> TypeRef { ret T_ptr(T_evec(T_int())); }
@@ -644,24 +642,24 @@ fn T_opaque_vec_ptr() -> TypeRef { ret T_ptr(T_evec(T_int())); }
 //
 // TODO: Support user-defined vector sizes.
 fn T_ivec(t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int(), // Length ("fill"; if zero, heapified)
-                   T_int(), // Alloc
-                   T_array(t, abi::ivec_default_length)]); // Body elements
+    ret T_struct([T_int(), // Length ("fill"; if zero, heapified)
+                  T_int(), // Alloc
+                  T_array(t, abi::ivec_default_length)]); // Body elements
 
 }
 
 
 // Note that the size of this one is in bytes.
 fn T_opaque_ivec() -> TypeRef {
-    ret T_struct(~[T_int(), // Length ("fill"; if zero, heapified)
-                   T_int(), // Alloc
-                   T_array(T_i8(), 0u)]); // Body elements
+    ret T_struct([T_int(), // Length ("fill"; if zero, heapified)
+                  T_int(), // Alloc
+                  T_array(T_i8(), 0u)]); // Body elements
 
 }
 
 fn T_ivec_heap_part(t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int(), // Real length
-                   T_array(t, 0u)]); // Body elements
+    ret T_struct([T_int(), // Real length
+                  T_array(t, 0u)]); // Body elements
 
 }
 
@@ -669,36 +667,36 @@ fn T_ivec_heap_part(t: TypeRef) -> TypeRef {
 // Interior vector on the heap, also known as the "stub". Cast to this when
 // the allocated length (second element of T_ivec above) is zero.
 fn T_ivec_heap(t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int(), // Length (zero)
-                   T_int(), // Alloc
-                   T_ptr(T_ivec_heap_part(t))]); // Pointer
+    ret T_struct([T_int(), // Length (zero)
+                  T_int(), // Alloc
+                  T_ptr(T_ivec_heap_part(t))]); // Pointer
 
 }
 
 fn T_opaque_ivec_heap_part() -> TypeRef {
-    ret T_struct(~[T_int(), // Real length
-                   T_array(T_i8(), 0u)]); // Body elements
+    ret T_struct([T_int(), // Real length
+                  T_array(T_i8(), 0u)]); // Body elements
 
 }
 
 fn T_opaque_ivec_heap() -> TypeRef {
-    ret T_struct(~[T_int(), // Length (zero)
-                   T_int(), // Alloc
-                   T_ptr(T_opaque_ivec_heap_part())]); // Pointer
+    ret T_struct([T_int(), // Length (zero)
+                  T_int(), // Alloc
+                  T_ptr(T_opaque_ivec_heap_part())]); // Pointer
 
 }
 
 fn T_str() -> TypeRef { ret T_evec(T_i8()); }
 
-fn T_box(t: TypeRef) -> TypeRef { ret T_struct(~[T_int(), t]); }
+fn T_box(t: TypeRef) -> TypeRef { ret T_struct([T_int(), t]); }
 
 fn T_port(_t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int()]); // Refcount
+    ret T_struct([T_int()]); // Refcount
 
 }
 
 fn T_chan(_t: TypeRef) -> TypeRef {
-    ret T_struct(~[T_int()]); // Refcount
+    ret T_struct([T_int()]); // Refcount
 
 }
 
@@ -716,14 +714,13 @@ fn T_typaram(tn: &type_names) -> TypeRef {
 
 fn T_typaram_ptr(tn: &type_names) -> TypeRef { ret T_ptr(T_typaram(tn)); }
 
-fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef,
-                 n_ty_params: uint) -> TypeRef {
+fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef, n_ty_params: uint)
+   -> TypeRef {
     // NB: keep this in sync with code in trans_bind; we're making
     // an LLVM typeref structure that has the same "shape" as the ty::t
     // it constructs.
-    ret T_ptr(T_box(T_struct(~[T_ptr(cx.tydesc_type),
-                               llbindings_ty,
-                               T_captured_tydescs(cx, n_ty_params)])));
+    ret T_ptr(T_box(T_struct([T_ptr(cx.tydesc_type), llbindings_ty,
+                              T_captured_tydescs(cx, n_ty_params)])));
 }
 
 fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef {
@@ -737,7 +734,7 @@ fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef {
 fn T_tag(tn: &type_names, size: uint) -> TypeRef {
     let s = "tag_" + uint::to_str(size, 10u);
     if tn.name_has_type(s) { ret tn.get_type(s); }
-    let t = T_struct(~[T_int(), T_array(T_i8(), size)]);
+    let t = T_struct([T_int(), T_array(T_i8(), size)]);
     tn.associate(s, t);
     ret t;
 }
@@ -745,7 +742,7 @@ fn T_tag(tn: &type_names, size: uint) -> TypeRef {
 fn T_opaque_tag(tn: &type_names) -> TypeRef {
     let s = "opaque_tag";
     if tn.name_has_type(s) { ret tn.get_type(s); }
-    let t = T_struct(~[T_int(), T_i8()]);
+    let t = T_struct([T_int(), T_i8()]);
     tn.associate(s, t);
     ret t;
 }
@@ -763,8 +760,8 @@ fn T_obj_ptr(cx: &crate_ctxt, n_captured_tydescs: uint) -> TypeRef {
     // type. The dynamically-sized fields follow the captured tydescs.
 
     fn T_obj(cx: &crate_ctxt, n_captured_tydescs: uint) -> TypeRef {
-        ret T_struct(~[T_ptr(cx.tydesc_type),
-                       T_captured_tydescs(cx, n_captured_tydescs)]);
+        ret T_struct([T_ptr(cx.tydesc_type),
+                      T_captured_tydescs(cx, n_captured_tydescs)]);
     }
     ret T_ptr(T_box(T_obj(cx, n_captured_tydescs)));
 }
@@ -832,14 +829,15 @@ fn C_cstr(cx: &@crate_ctxt, s: &str) -> ValueRef {
 
 // A rust boxed-and-length-annotated string.
 fn C_str(cx: &@crate_ctxt, s: &str) -> ValueRef {
-    let len = str::byte_len(s);
-    let  // 'alloc'
-         // 'fill'
-         // 'pad'
-        box =
-        C_struct(~[C_int(abi::const_refcount as int), C_int(len + 1u as int),
-                   C_int(len + 1u as int), C_int(0),
-                   llvm::LLVMConstString(str::buf(s), len, False)]);
+    let len =
+        str::byte_len(s); // 'alloc'
+                          // 'fill'
+                          // 'pad'
+
+    let box =
+        C_struct([C_int(abi::const_refcount as int), C_int(len + 1u as int),
+                  C_int(len + 1u as int), C_int(0),
+                  llvm::LLVMConstString(str::buf(s), len, False)]);
     let g =
         llvm::LLVMAddGlobal(cx.llmod, val_ty(box),
                             str::buf(cx.names.next("str")));
@@ -856,8 +854,8 @@ fn C_postr(s: &str) -> ValueRef {
 
 fn C_zero_byte_arr(size: uint) -> ValueRef {
     let i = 0u;
-    let elts: [ValueRef] = ~[];
-    while i < size { elts += ~[C_u8(0u)]; i += 1u; }
+    let elts: [ValueRef] = [];
+    while i < size { elts += [C_u8(0u)]; i += 1u; }
     ret llvm::LLVMConstArray(T_i8(), std::vec::to_ptr(elts),
                              std::vec::len(elts));
 }
@@ -873,19 +871,19 @@ fn C_named_struct(T: TypeRef, elts: &[ValueRef]) -> ValueRef {
 }
 
 fn C_array(ty: TypeRef, elts: &[ValueRef]) -> ValueRef {
-    ret llvm::LLVMConstArray(ty, std::vec::to_ptr(elts),
-                             std::vec::len(elts));
+    ret llvm::LLVMConstArray(ty, std::vec::to_ptr(elts), std::vec::len(elts));
 }
 
-fn C_bytes(bytes : &[u8]) -> ValueRef {
+fn C_bytes(bytes: &[u8]) -> ValueRef {
     ret llvm::LLVMConstString(unsafe::reinterpret_cast(vec::to_ptr(bytes)),
                               vec::len(bytes), False);
 }
 
-fn C_shape(ccx : &@crate_ctxt, bytes : &[u8]) -> ValueRef {
+fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef {
     let llshape = C_bytes(bytes);
-    let llglobal = llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape),
-                                       str::buf(ccx.names.next("shape")));
+    let llglobal =
+        llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape),
+                            str::buf(ccx.names.next("shape")));
     llvm::LLVMSetInitializer(llglobal, llshape);
     llvm::LLVMSetGlobalConstant(llglobal, True);
     llvm::LLVMSetLinkage(llglobal,
diff --git a/src/comp/middle/trans_objects.rs b/src/comp/middle/trans_objects.rs
index 8a95fb90334..627dedf90a1 100644
--- a/src/comp/middle/trans_objects.rs
+++ b/src/comp/middle/trans_objects.rs
@@ -43,10 +43,10 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
 
     // The fields of our object will become the arguments to the function
     // we're creating.
-    let fn_args: [ast::arg] = ~[];
+    let fn_args: [ast::arg] = [];
     for f: ast::obj_field in ob.fields {
         fn_args +=
-            ~[{mode: ast::alias(false), ty: f.ty, ident: f.ident, id: f.id}];
+            [{mode: ast::alias(false), ty: f.ty, ident: f.ident, id: f.id}];
     }
     let fcx = new_fn_ctxt(cx, sp, llctor_decl);
 
@@ -77,15 +77,14 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
     // abi::obj_field_vtbl and abi::obj_field_box simply specify words 0 and 1
     // of 'pair'.
     let pair_vtbl =
-        bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_vtbl)]);
-    let pair_box =
-        bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_box)]);
+        bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
+    let pair_box = bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_box)]);
 
     // Make a vtable for this object: a static array of pointers to functions.
     // It will be located in the read-only memory of the executable we're
     // creating and will contain ValueRefs for all of this object's methods.
     // create_vtbl returns a pointer to the vtable, which we store.
-    let vtbl = create_vtbl(cx, sp, self_ty, ob, ty_params, none, ~[]);
+    let vtbl = create_vtbl(cx, sp, self_ty, ob, ty_params, none, []);
     vtbl = bcx.build.PointerCast(vtbl, T_ptr(T_empty_struct()));
 
     bcx.build.Store(vtbl, pair_vtbl);
@@ -103,18 +102,18 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
         // Store null into pair, if no args or typarams.
         bcx.build.Store(C_null(llbox_ty), pair_box);
     } else {
-        let obj_fields: [ty::t] = ~[];
-        for a: ty::arg in arg_tys { obj_fields += ~[a.ty]; }
+        let obj_fields: [ty::t] = [];
+        for a: ty::arg in arg_tys { obj_fields += [a.ty]; }
 
-        let tps: [ty::t] = ~[];
+        let tps: [ty::t] = [];
         let tydesc_ty = ty::mk_type(ccx.tcx);
-        for tp: ast::ty_param in ty_params { tps += ~[tydesc_ty]; }
+        for tp: ast::ty_param in ty_params { tps += [tydesc_ty]; }
 
         // Synthesize an object body type and hand it off to
         // trans_malloc_boxed, which allocates a box, including space for a
         // refcount.
-        let body_ty: ty::t = create_object_body_type(ccx.tcx, obj_fields, tps,
-                                                     none);
+        let body_ty: ty::t =
+            create_object_body_type(ccx.tcx, obj_fields, tps, none);
         let box = trans_malloc_boxed(bcx, body_ty);
         bcx = box.bcx;
         let body = box.body;
@@ -129,8 +128,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
         // later.
 
         let body_tydesc =
-            GEP_tup_like(bcx, body_ty, body,
-                         ~[0, abi::obj_body_elt_tydesc]);
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_tydesc]);
         bcx = body_tydesc.bcx;
         let ti = none::<@tydesc_info>;
         let body_td = get_tydesc(bcx, body_ty, true, ti).result;
@@ -148,16 +146,15 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
 
         // Copy typarams into captured typarams.
         let body_typarams =
-            GEP_tup_like(bcx, body_ty, body,
-                         ~[0, abi::obj_body_elt_typarams]);
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_typarams]);
         bcx = body_typarams.bcx;
         // TODO: can we just get typarams_ty out of body_ty instead?
         let typarams_ty: ty::t = ty::mk_tup(ccx.tcx, tps);
         let i: int = 0;
         for tp: ast::ty_param in ty_params {
-            let typaram = bcx.fcx.lltydescs.(i);
+            let typaram = bcx.fcx.lltydescs[i];
             let capture =
-                GEP_tup_like(bcx, typarams_ty, body_typarams.val, ~[0, i]);
+                GEP_tup_like(bcx, typarams_ty, body_typarams.val, [0, i]);
             bcx = capture.bcx;
             bcx = copy_val(bcx, INIT, capture.val, typaram, tydesc_ty).bcx;
             i += 1;
@@ -165,20 +162,19 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
 
         // Copy args into body fields.
         let body_fields =
-            GEP_tup_like(bcx, body_ty, body,
-                         ~[0, abi::obj_body_elt_fields]);
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_fields]);
         bcx = body_fields.bcx;
         i = 0;
         for f: ast::obj_field in ob.fields {
             alt bcx.fcx.llargs.find(f.id) {
               some(arg1) {
-                let arg = load_if_immediate(bcx, arg1, arg_tys.(i).ty);
+                let arg = load_if_immediate(bcx, arg1, arg_tys[i].ty);
                 // TODO: can we just get fields_ty out of body_ty instead?
                 let fields_ty: ty::t = ty::mk_tup(ccx.tcx, obj_fields);
                 let field =
-                    GEP_tup_like(bcx, fields_ty, body_fields.val, ~[0, i]);
+                    GEP_tup_like(bcx, fields_ty, body_fields.val, [0, i]);
                 bcx = field.bcx;
-                bcx = copy_val(bcx, INIT, field.val, arg, arg_tys.(i).ty).bcx;
+                bcx = copy_val(bcx, INIT, field.val, arg, arg_tys[i].ty).bcx;
                 i += 1;
               }
               none. {
@@ -210,16 +206,16 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
 
     // Fields.  FIXME (part of issue #538): Where do we fill in the field
     // *values* from the outer object?
-    let additional_fields: [ast::anon_obj_field] = ~[];
-    let additional_field_vals: [result] = ~[];
-    let additional_field_tys: [ty::t] = ~[];
+    let additional_fields: [ast::anon_obj_field] = [];
+    let additional_field_vals: [result] = [];
+    let additional_field_tys: [ty::t] = [];
     alt anon_obj.fields {
       none. { }
       some(fields) {
         additional_fields = fields;
         for f: ast::anon_obj_field in fields {
-            additional_field_tys += ~[node_id_type(ccx, f.id)];
-            additional_field_vals += ~[trans_expr(bcx, f.expr)];
+            additional_field_tys += [node_id_type(ccx, f.id)];
+            additional_field_vals += [trans_expr(bcx, f.expr)];
         }
       }
     }
@@ -236,7 +232,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
     let wrapper_obj: ast::_obj =
         {fields:
              std::vec::map(ast::obj_field_from_anon_obj_field,
-                            additional_fields),
+                           additional_fields),
          methods: anon_obj.methods};
 
     let inner_obj_ty: ty::t;
@@ -251,7 +247,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
         // just pass the outer object to create_vtbl().  Our vtable won't need
         // to have any forwarding slots.
         vtbl =
-            create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, ~[], none,
+            create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, [], none,
                         additional_field_tys);
       }
       some(e) {
@@ -269,7 +265,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
         // forwarding slot.  And, of course, we need to create a normal vtable
         // entry for every method being added.
         vtbl =
-            create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, ~[],
+            create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, [],
                         some(inner_obj_ty), additional_field_tys);
       }
     }
@@ -283,9 +279,8 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
 
     // Grab onto the first and second elements of the pair.
     let pair_vtbl =
-        bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_vtbl)]);
-    let pair_box =
-        bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_box)]);
+        bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
+    let pair_box = bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_box)]);
 
     vtbl = bcx.build.PointerCast(vtbl, T_ptr(T_empty_struct()));
     bcx.build.Store(vtbl, pair_vtbl);
@@ -307,9 +302,9 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
         // Synthesize a type for the object body and hand it off to
         // trans_malloc_boxed, which allocates a box, including space for a
         // refcount.
-        let body_ty: ty::t = create_object_body_type(ccx.tcx,
-                                                     additional_field_tys,
-                                                     ~[], some(inner_obj_ty));
+        let body_ty: ty::t =
+            create_object_body_type(ccx.tcx, additional_field_tys, [],
+                                    some(inner_obj_ty));
         let box = trans_malloc_boxed(bcx, body_ty);
         bcx = box.bcx;
         let body = box.body;
@@ -323,8 +318,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
         // the types of the object's fields, so that the fields can be freed
         // later.
         let body_tydesc =
-            GEP_tup_like(bcx, body_ty, body,
-                         ~[0, abi::obj_body_elt_tydesc]);
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_tydesc]);
         bcx = body_tydesc.bcx;
         let ti = none::<@tydesc_info>;
         let body_td = get_tydesc(bcx, body_ty, true, ti).result;
@@ -338,23 +332,20 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
         // function in its closure: the fields were passed to the object
         // constructor and are now available to the object's methods.
         let body_fields =
-            GEP_tup_like(bcx, body_ty, body,
-                         ~[0, abi::obj_body_elt_fields]);
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_fields]);
         bcx = body_fields.bcx;
         let i: int = 0;
         for f: ast::anon_obj_field in additional_fields {
             // FIXME (part of issue #538): make this work eventually, when we
             // have additional field exprs in the AST.
-            load_if_immediate(bcx, additional_field_vals.(i).val,
-                              additional_field_tys.(i));
-            let fields_ty: ty::t = ty::mk_tup(ccx.tcx,
-                                                  additional_field_tys);
-            let field =
-                GEP_tup_like(bcx, fields_ty, body_fields.val, ~[0, i]);
+            load_if_immediate(bcx, additional_field_vals[i].val,
+                              additional_field_tys[i]);
+            let fields_ty: ty::t = ty::mk_tup(ccx.tcx, additional_field_tys);
+            let field = GEP_tup_like(bcx, fields_ty, body_fields.val, [0, i]);
             bcx = field.bcx;
             bcx =
-                copy_val(bcx, INIT, field.val, additional_field_vals.(i).val,
-                         additional_field_tys.(i)).bcx;
+                copy_val(bcx, INIT, field.val, additional_field_vals[i].val,
+                         additional_field_tys[i]).bcx;
             i += 1;
         }
 
@@ -370,7 +361,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
 
             let body_inner_obj =
                 GEP_tup_like(bcx, body_ty, body,
-                             ~[0, abi::obj_body_elt_inner_obj]);
+                             [0, abi::obj_body_elt_inner_obj]);
             bcx = body_inner_obj.bcx;
             bcx =
                 copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val,
@@ -390,6 +381,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
 // Used only inside create_vtbl and create_backwarding_vtbl to distinguish
 // different kinds of slots we'll have to create.
 tag vtbl_mthd {
+
     // Normal methods are complete AST nodes, but for forwarding methods, the
     // only information we'll have about them is their type.
     normal_mthd(@ast::method);
@@ -421,9 +413,8 @@ fn vtbl_mthd_lteq(a: &vtbl_mthd, b: &vtbl_mthd) -> bool {
 
 // filtering_fn: Used by create_vtbl to filter a list of methods to remove the
 // ones that we don't need forwarding slots for.
-fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd,
-                addtl_meths: [@ast::method]) ->
-    option::t<vtbl_mthd> {
+fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, addtl_meths: [@ast::method])
+   -> option::t<vtbl_mthd> {
 
     // Since m is a fwding_mthd, and we're checking to see if it's in
     // addtl_meths (which only contains normal_mthds), we can't just check if
@@ -448,10 +439,10 @@ fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd,
 // object, and return a pointer to it.
 fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
                ob: &ast::_obj, ty_params: &[ast::ty_param],
-               inner_obj_ty: option::t<ty::t>,
-               additional_field_tys: &[ty::t]) -> ValueRef {
+               inner_obj_ty: option::t<ty::t>, additional_field_tys: &[ty::t])
+   -> ValueRef {
 
-    let llmethods: [ValueRef] = ~[];
+    let llmethods: [ValueRef] = [];
 
     alt inner_obj_ty {
       none. {
@@ -460,12 +451,12 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
 
         // Sort and process all the methods.
         let meths =
-            std::sort::merge_sort::<@ast::method>
-            (bind ast_mthd_lteq(_, _), ob.methods);
+            std::sort::merge_sort::<@ast::method>(bind ast_mthd_lteq(_, _),
+                                                  ob.methods);
 
         for m: @ast::method in meths {
-            llmethods += ~[process_normal_mthd(cx, m, outer_obj_ty,
-                                               ty_params)];
+            llmethods +=
+                [process_normal_mthd(cx, m, outer_obj_ty, ty_params)];
         }
       }
       some(inner_obj_ty) {
@@ -478,13 +469,13 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
         // we take the set difference of { methods on the original object }
         // and { methods being added, whether entirely new or overriding }.
 
-        let meths: [vtbl_mthd] = ~[];
+        let meths: [vtbl_mthd] = [];
 
         // Gather up methods on the inner object.
         alt ty::struct(cx.ccx.tcx, inner_obj_ty) {
           ty::ty_obj(inner_obj_methods) {
             for m: ty::method in inner_obj_methods {
-                meths += ~[fwding_mthd(@m)];
+                meths += [fwding_mthd(@m)];
             }
           }
           _ {
@@ -500,12 +491,12 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
 
         // And now add the additional ones, both overriding ones and entirely
         // new ones.  These will just be normal methods.
-        for m: @ast::method in ob.methods { meths += ~[normal_mthd(m)]; }
+        for m: @ast::method in ob.methods { meths += [normal_mthd(m)]; }
 
         // Sort all the methods and process them.
         meths =
-            std::sort::merge_sort::<vtbl_mthd>
-            (bind vtbl_mthd_lteq(_, _), meths);
+            std::sort::merge_sort::<vtbl_mthd>(bind vtbl_mthd_lteq(_, _),
+                                               meths);
 
         // To create forwarding methods, we'll need a "backwarding" vtbl.  See
         // create_backwarding_vtbl and process_bkwding_method for details.
@@ -516,13 +507,13 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
             alt m {
               normal_mthd(nm) {
                 llmethods +=
-                    ~[process_normal_mthd(cx, nm, outer_obj_ty, ty_params)];
+                    [process_normal_mthd(cx, nm, outer_obj_ty, ty_params)];
               }
               fwding_mthd(fm) {
                 llmethods +=
-                    ~[process_fwding_mthd(cx, sp, fm, ty_params, inner_obj_ty,
-                                          backwarding_vtbl,
-                                          additional_field_tys)];
+                    [process_fwding_mthd(cx, sp, fm, ty_params, inner_obj_ty,
+                                         backwarding_vtbl,
+                                         additional_field_tys)];
               }
             }
         }
@@ -542,40 +533,36 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t,
     // object, and it needs to forward them to the corresponding slots on the
     // outer object.  All we know about either one are their types.
 
-    let llmethods: [ValueRef] = ~[];
-    let meths: [ty::method]= ~[];
+    let llmethods: [ValueRef] = [];
+    let meths: [ty::method] = [];
 
     // Gather up methods on the inner object.
     alt ty::struct(cx.ccx.tcx, inner_obj_ty) {
-        ty::ty_obj(inner_obj_methods) {
-            for m: ty::method in inner_obj_methods {
-                meths += ~[m];
-            }
-        }
-        _ {
-            // Shouldn't happen.
-            cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \
+      ty::ty_obj(inner_obj_methods) {
+        for m: ty::method in inner_obj_methods { meths += [m]; }
+      }
+      _ {
+        // Shouldn't happen.
+        cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \
                             non-object");
-        }
+      }
     }
 
     // Methods should have already been sorted, so no need to do so again.
     for m: ty::method in meths {
         // We pass outer_obj_ty to process_fwding_mthd() because it's the one
         // being forwarded to.
-        llmethods += ~[process_bkwding_mthd(
-            cx, sp, @m, ~[], outer_obj_ty, ~[])];
+        llmethods += [process_bkwding_mthd(cx, sp, @m, [], outer_obj_ty, [])];
     }
-
     ret finish_vtbl(cx, llmethods, "backwarding_vtbl");
 }
 
 // finish_vtbl: Given a vector of vtable entries, create the table in
 // read-only memory and return a pointer to it.
-fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str)
-    -> ValueRef {
+fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str) ->
+   ValueRef {
     let vtbl = C_struct(llmethods);
-    let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + ~[name]);
+    let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + [name]);
     let gvar =
         llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), str::buf(vtbl_name));
     llvm::LLVMSetInitializer(gvar, vtbl);
@@ -600,17 +587,17 @@ fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str)
 // the corresponding method on inner does, calls that method on outer, and
 // returns the value returned from that call.
 fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
-                       ty_params: &[ast::ty_param], outer_obj_ty: ty::t,
-                       _additional_field_tys: &[ty::t]) -> ValueRef {
+                        ty_params: &[ast::ty_param], outer_obj_ty: ty::t,
+                        _additional_field_tys: &[ty::t]) -> ValueRef {
 
     // Create a local context that's aware of the name of the method we're
     // creating.
-    let mcx: @local_ctxt = @{path: cx.path + ~["method", m.ident] with *cx};
+    let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx};
 
     // Make up a name for the backwarding function.
     let fn_name: str = "backwarding_fn";
-    let s: str = mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path,
-                                                      fn_name);
+    let s: str =
+        mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name);
 
     // Get the backwarding function's type and declare it.
     let llbackwarding_fn_ty: TypeRef =
@@ -630,19 +617,17 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // self-stack to get to the one we really want.
 
     // Cast to self-stack's type.
-    let llenv = bcx.build.PointerCast(
-        fcx.llenv,
-        T_ptr(T_struct(~[cx.ccx.rust_object_type,
-                         T_ptr(cx.ccx.rust_object_type)])));
-
-    let llself_obj_ptr = bcx.build.GEP(llenv,
-                                       ~[C_int(0),
-                                         C_int(1)]);
+    let llenv =
+        bcx.build.PointerCast(
+            fcx.llenv,
+            T_ptr(T_struct([cx.ccx.rust_object_type,
+                            T_ptr(cx.ccx.rust_object_type)])));
+    let llself_obj_ptr = bcx.build.GEP(llenv, [C_int(0), C_int(1)]);
     llself_obj_ptr = bcx.build.Load(llself_obj_ptr);
 
     // Cast it back to pointer-to-object-type, so LLVM won't complain.
-    llself_obj_ptr = bcx.build.PointerCast(llself_obj_ptr,
-                                           T_ptr(cx.ccx.rust_object_type));
+    llself_obj_ptr =
+        bcx.build.PointerCast(llself_obj_ptr, T_ptr(cx.ccx.rust_object_type));
 
     // The 'llretptr' that will arrive in the backwarding function we're
     // creating also needs to be the correct type.  Cast it to the method's
@@ -670,13 +655,12 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u));
 
     let llouter_obj_vtbl =
-        bcx.build.GEP(llself_obj_ptr,
-                      ~[C_int(0), C_int(abi::obj_field_vtbl)]);
+        bcx.build.GEP(llself_obj_ptr, [C_int(0), C_int(abi::obj_field_vtbl)]);
     llouter_obj_vtbl = bcx.build.Load(llouter_obj_vtbl);
     llouter_obj_vtbl = bcx.build.PointerCast(llouter_obj_vtbl, vtbl_type);
 
     let llouter_mthd =
-        bcx.build.GEP(llouter_obj_vtbl, ~[C_int(0), C_int(ix as int)]);
+        bcx.build.GEP(llouter_obj_vtbl, [C_int(0), C_int(ix as int)]);
 
     // Set up the outer method to be called.
     let outer_mthd_ty = ty::method_ty_to_fn_ty(cx.ccx.tcx, *m);
@@ -692,7 +676,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // Set up the three implicit arguments to the outer method we'll need to
     // call.
     let self_arg = llself_obj_ptr;
-    let llouter_mthd_args: [ValueRef] = ~[llretptr, fcx.lltaskptr, self_arg];
+    let llouter_mthd_args: [ValueRef] = [llretptr, fcx.lltaskptr, self_arg];
 
     // Copy the explicit arguments that are being passed into the forwarding
     // function (they're in fcx.llargs) to llouter_mthd_args.
@@ -703,7 +687,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
         if arg.mode == ty::mo_val {
             passed_arg = load_if_immediate(bcx, passed_arg, arg.ty);
         }
-        llouter_mthd_args += ~[passed_arg];
+        llouter_mthd_args += [passed_arg];
         a += 1u;
     }
 
@@ -737,12 +721,12 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
 
     // Create a local context that's aware of the name of the method we're
     // creating.
-    let mcx: @local_ctxt = @{path: cx.path + ~["method", m.ident] with *cx};
+    let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx};
 
     // Make up a name for the forwarding function.
     let fn_name: str = "forwarding_fn";
-    let s: str = mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path,
-                                                      fn_name);
+    let s: str =
+        mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name);
 
     // Get the forwarding function's type and declare it.
     let llforwarding_fn_ty: TypeRef =
@@ -776,7 +760,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // First, grab the box out of the self_obj.  It contains a refcount and a
     // body.
     let llself_obj_box =
-        bcx.build.GEP(llself_obj_ptr, ~[C_int(0), C_int(abi::obj_field_box)]);
+        bcx.build.GEP(llself_obj_ptr, [C_int(0), C_int(abi::obj_field_box)]);
     llself_obj_box = bcx.build.Load(llself_obj_box);
 
     let ccx = bcx_ccx(bcx);
@@ -786,13 +770,13 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // Now, reach into the box and grab the body.
     let llself_obj_body =
         bcx.build.GEP(llself_obj_box,
-                      ~[C_int(0), C_int(abi::box_rc_field_body)]);
+                      [C_int(0), C_int(abi::box_rc_field_body)]);
 
     // Now, we need to figure out exactly what type the body is supposed to be
     // cast to.
-    let body_ty: ty::t = create_object_body_type(cx.ccx.tcx,
-                                                 additional_field_tys, ~[],
-                                                 some(inner_obj_ty));
+    let body_ty: ty::t =
+        create_object_body_type(cx.ccx.tcx, additional_field_tys, [],
+                                some(inner_obj_ty));
     // And cast to that type.
     llself_obj_body =
         bcx.build.PointerCast(llself_obj_body,
@@ -801,7 +785,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // Now, reach into the body and grab the inner_obj.
     let llinner_obj =
         GEP_tup_like(bcx, body_ty, llself_obj_body,
-                     ~[0, abi::obj_body_elt_inner_obj]);
+                     [0, abi::obj_body_elt_inner_obj]);
     bcx = llinner_obj.bcx;
 
     // And, now, somewhere in inner_obj is a vtable with an entry for the
@@ -810,12 +794,11 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // call it.
     let llinner_obj_vtbl =
         bcx.build.GEP(llinner_obj.val,
-                      ~[C_int(0), C_int(abi::obj_field_vtbl)]);
+                      [C_int(0), C_int(abi::obj_field_vtbl)]);
     llinner_obj_vtbl = bcx.build.Load(llinner_obj_vtbl);
 
     let llinner_obj_body =
-        bcx.build.GEP(llinner_obj.val,
-                      ~[C_int(0), C_int(abi::obj_field_box)]);
+        bcx.build.GEP(llinner_obj.val, [C_int(0), C_int(abi::obj_field_box)]);
     llinner_obj_body = bcx.build.Load(llinner_obj_body);
 
     // Get the index of the method we want.
@@ -836,7 +819,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     llinner_obj_vtbl = bcx.build.PointerCast(llinner_obj_vtbl, vtbl_type);
 
     let llorig_mthd =
-        bcx.build.GEP(llinner_obj_vtbl, ~[C_int(0), C_int(ix as int)]);
+        bcx.build.GEP(llinner_obj_vtbl, [C_int(0), C_int(ix as int)]);
 
     // Set up the original method to be called.
     let orig_mthd_ty = ty::method_ty_to_fn_ty(cx.ccx.tcx, *m);
@@ -850,21 +833,21 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     llorig_mthd = bcx.build.Load(llorig_mthd);
 
     // Set up the self-stack.
-    let self_stack = alloca(bcx, T_struct(~[cx.ccx.rust_object_type,
-                                            T_ptr(cx.ccx.rust_object_type)]));
-    self_stack = populate_self_stack(bcx,
-                                     self_stack,
-                                     llself_obj_ptr,
-                                     backwarding_vtbl,
-                                     llinner_obj_body);
+    let self_stack =
+        alloca(bcx,
+               T_struct([cx.ccx.rust_object_type,
+                         T_ptr(cx.ccx.rust_object_type)]));
+    self_stack =
+        populate_self_stack(bcx, self_stack, llself_obj_ptr, backwarding_vtbl,
+                            llinner_obj_body);
 
     // Cast self_stack back to pointer-to-object-type to make LLVM happy.
-    self_stack = bcx.build.PointerCast(self_stack,
-                                       T_ptr(cx.ccx.rust_object_type));
+    self_stack =
+        bcx.build.PointerCast(self_stack, T_ptr(cx.ccx.rust_object_type));
 
     // Set up the three implicit arguments to the original method we'll need
     // to call.
-    let llorig_mthd_args: [ValueRef] = ~[llretptr, fcx.lltaskptr, self_stack];
+    let llorig_mthd_args: [ValueRef] = [llretptr, fcx.lltaskptr, self_stack];
 
     // Copy the explicit arguments that are being passed into the forwarding
     // function (they're in fcx.llargs) to llorig_mthd_args.
@@ -875,7 +858,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
         if arg.mode == ty::mo_val {
             passed_arg = load_if_immediate(bcx, passed_arg, arg.ty);
         }
-        llorig_mthd_args += ~[passed_arg];
+        llorig_mthd_args += [passed_arg];
         a += 1u;
     }
 
@@ -901,12 +884,14 @@ fn create_object_body_type(tcx: &ty::ctxt, fields_ty: &[ty::t],
     let body_ty: ty::t;
     alt maybe_inner_obj_ty {
       some(inner_obj_ty) {
-        body_ty = ty::mk_tup(tcx, ~[tydesc_ty, typarams_ty_tup,
-                                    fields_ty_tup, inner_obj_ty]);
+        body_ty =
+            ty::mk_tup(tcx,
+                       [tydesc_ty, typarams_ty_tup, fields_ty_tup,
+                        inner_obj_ty]);
       }
       none {
-        body_ty = ty::mk_tup(tcx, ~[tydesc_ty, typarams_ty_tup,
-                                    fields_ty_tup]);
+        body_ty =
+            ty::mk_tup(tcx, [tydesc_ty, typarams_ty_tup, fields_ty_tup]);
       }
     }
 
@@ -927,7 +912,7 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t,
       }
     }
     let mcx: @local_ctxt =
-        @{path: cx.path + ~["method", m.node.ident] with *cx};
+        @{path: cx.path + ["method", m.node.ident] with *cx};
     let s: str = mangle_internal_name_by_path(mcx.ccx, mcx.path);
     let llfn: ValueRef = decl_internal_fastcall_fn(cx.ccx.llmod, s, llfnty);
 
@@ -949,32 +934,23 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t,
 // via the llenv argument, and we want the forwarding function to call a
 // method on a "self" that's inner-obj-shaped, but we also want to hold onto
 // the outer obj for potential use later by backwarding functions.
-fn populate_self_stack(bcx: @block_ctxt,
-                       self_stack: ValueRef, outer_obj: ValueRef,
-                       backwarding_vtbl: ValueRef, inner_obj_body: ValueRef)
-    -> ValueRef {
+fn populate_self_stack(bcx: @block_ctxt, self_stack: ValueRef,
+                       outer_obj: ValueRef, backwarding_vtbl: ValueRef,
+                       inner_obj_body: ValueRef) -> ValueRef {
 
     // Drop the outer obj into the second slot.
-    let self_pair_ptr = bcx.build.GEP(self_stack,
-                            ~[C_int(0),
-                              C_int(1)]);
+    let self_pair_ptr = bcx.build.GEP(self_stack, [C_int(0), C_int(1)]);
     bcx.build.Store(outer_obj, self_pair_ptr);
 
     // Drop in the backwarding vtbl.
-    let wrapper_pair = bcx.build.GEP(self_stack,
-                                     ~[C_int(0),
-                                       C_int(0)]);
-    let wrapper_vtbl_ptr = bcx.build.GEP(wrapper_pair,
-                                         ~[C_int(0),
-                                           C_int(0)]);
+    let wrapper_pair = bcx.build.GEP(self_stack, [C_int(0), C_int(0)]);
+    let wrapper_vtbl_ptr = bcx.build.GEP(wrapper_pair, [C_int(0), C_int(0)]);
     let backwarding_vtbl_cast =
         bcx.build.PointerCast(backwarding_vtbl, T_ptr(T_empty_struct()));
     bcx.build.Store(backwarding_vtbl_cast, wrapper_vtbl_ptr);
 
     // Drop in the inner obj body.
-    let wrapper_body_ptr = bcx.build.GEP(wrapper_pair,
-                                         ~[C_int(0),
-                                           C_int(1)]);
+    let wrapper_body_ptr = bcx.build.GEP(wrapper_pair, [C_int(0), C_int(1)]);
     bcx.build.Store(inner_obj_body, wrapper_body_ptr);
 
     ret self_stack;
diff --git a/src/comp/middle/tstate/annotate.rs b/src/comp/middle/tstate/annotate.rs
index 1d9fa056363..6aa35018f2f 100644
--- a/src/comp/middle/tstate/annotate.rs
+++ b/src/comp/middle/tstate/annotate.rs
@@ -23,21 +23,21 @@ import aux::crate_ctxt;
 import aux::add_node;
 import middle::tstate::ann::empty_ann;
 
-fn collect_ids_expr(e: &@expr, rs: @mutable [node_id]) { *rs += ~[e.id]; }
+fn collect_ids_expr(e: &@expr, rs: @mutable [node_id]) { *rs += [e.id]; }
 
-fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += ~[b.node.id]; }
+fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += [b.node.id]; }
 
 fn collect_ids_stmt(s: &@stmt, rs: @mutable [node_id]) {
     alt s.node {
       stmt_decl(_, id) {
         log "node_id " + int::str(id);
-        log_stmt(*s);
-        *rs += ~[id];
+        log_stmt(*s);;
+        *rs += [id];
       }
       stmt_expr(_, id) {
         log "node_id " + int::str(id);
-        log_stmt(*s);
-        *rs += ~[id];
+        log_stmt(*s);;
+        *rs += [id];
       }
       _ { }
     }
@@ -67,7 +67,7 @@ fn init_vecs(ccx: &crate_ctxt, node_ids: &[node_id], len: uint) {
 
 fn visit_fn(ccx: &crate_ctxt, num_constraints: uint, f: &_fn,
             tps: &[ty_param], sp: &span, i: &fn_ident, id: node_id) {
-    let node_ids: @mutable [node_id] = @mutable ~[];
+    let node_ids: @mutable [node_id] = @mutable [];
     node_ids_in_fn(f, tps, sp, i, id, node_ids);
     let node_id_vec = *node_ids;
     init_vecs(ccx, node_id_vec, num_constraints);
diff --git a/src/comp/middle/tstate/auxiliary.rs b/src/comp/middle/tstate/auxiliary.rs
index 3e5b25ec5ee..8f9a56b5e20 100644
--- a/src/comp/middle/tstate/auxiliary.rs
+++ b/src/comp/middle/tstate/auxiliary.rs
@@ -122,7 +122,7 @@ fn tos(v: &[uint]) -> str {
     for i: uint in v {
         if i == 0u {
             rslt += "0";
-        } else if (i == 1u) { rslt += "1"; } else { rslt += "?"; }
+        } else if i == 1u { rslt += "1"; } else { rslt += "?"; }
     }
     ret rslt;
 }
@@ -239,45 +239,45 @@ type norm_constraint = {bit_num: uint, c: sp_constr};
 type constr_map = @std::map::hashmap<def_id, constraint>;
 
 /* Contains stuff that has to be computed up front */
+/* For easy access, the fn_info stores two special constraints for each
+function.  i_return holds if all control paths in this function terminate
+in either a return expression, or an appropriate tail expression.
+i_diverge holds if all control paths in this function terminate in a fail
+or diverging call.
+
+It might be tempting to use a single constraint C for both properties,
+where C represents i_return and !C represents i_diverge. This is
+inadvisable, because then the sense of the bit depends on context. If we're
+inside a ! function, that reverses the sense of the bit: C would be
+i_diverge and !C would be i_return.  That's awkward, because we have to
+pass extra context around to functions that shouldn't care.
+
+Okay, suppose C represents i_return and !C represents i_diverge, regardless
+of context. Consider this code:
+
+if (foo) { ret; } else { fail; }
+
+C is true in the consequent and false in the alternative. What's T `join`
+F, then?  ? doesn't work, because this code should definitely-return if the
+context is a returning function (and be definitely-rejected if the context
+is a ! function).  F doesn't work, because then the code gets incorrectly
+rejected if the context is a returning function. T would work, but it
+doesn't make sense for T `join` F to be T (consider init constraints, for
+example).;
+
+So we need context. And so it seems clearer to just have separate
+constraints.
+*/
 type fn_info =
     {constrs: constr_map,
      num_constraints: uint,
      cf: controlflow,
-/* For easy access, the fn_info stores two special constraints for each
-   function.  i_return holds if all control paths in this function terminate
-   in either a return expression, or an appropriate tail expression.
-   i_diverge holds if all control paths in this function terminate in a fail
-   or diverging call.
-
-   It might be tempting to use a single constraint C for both properties,
-   where C represents i_return and !C represents i_diverge. This is
-   inadvisable, because then the sense of the bit depends on context. If we're
-   inside a ! function, that reverses the sense of the bit: C would be
-   i_diverge and !C would be i_return.  That's awkward, because we have to
-   pass extra context around to functions that shouldn't care.
-
-   Okay, suppose C represents i_return and !C represents i_diverge, regardless
-   of context. Consider this code:
-
-     if (foo) { ret; } else { fail; }
-
-   C is true in the consequent and false in the alternative. What's T `join`
-   F, then?  ? doesn't work, because this code should definitely-return if the
-   context is a returning function (and be definitely-rejected if the context
-   is a ! function).  F doesn't work, because then the code gets incorrectly
-   rejected if the context is a returning function. T would work, but it
-   doesn't make sense for T `join` F to be T (consider init constraints, for
-   example).;
-
-   So we need context. And so it seems clearer to just have separate
-   constraints.
-*/
      i_return: tsconstr,
      i_diverge: tsconstr,
-    /* list, accumulated during pre/postcondition
+     /* list, accumulated during pre/postcondition
      computation, of all local variables that may be
      used */
-// Doesn't seem to work without the @ -- bug
+     // Doesn't seem to work without the @ -- bug
      used_vars: @mutable [node_id]};
 
 fn tsconstr_to_def_id(t: &tsconstr) -> def_id {
@@ -285,9 +285,10 @@ fn tsconstr_to_def_id(t: &tsconstr) -> def_id {
 }
 
 fn tsconstr_to_node_id(t: &tsconstr) -> node_id {
-    alt t { ninit(id, _) { id }
-            npred(_, id, _) {
-              fail "tsconstr_to_node_id called on pred constraint" } }
+    alt t {
+      ninit(id, _) { id }
+      npred(_, id, _) { fail "tsconstr_to_node_id called on pred constraint" }
+    }
 }
 
 /* mapping from node ID to typestate annotation */
@@ -298,10 +299,7 @@ type node_ann_table = @mutable [mutable ts_ann];
 type fn_info_map = @std::map::hashmap<node_id, fn_info>;
 
 type fn_ctxt =
-    {enclosing: fn_info,
-     id: node_id,
-     name: ident,
-     ccx: crate_ctxt};
+    {enclosing: fn_info, id: node_id, name: ident, ccx: crate_ctxt};
 
 type crate_ctxt = {tcx: ty::ctxt, node_anns: node_ann_table, fm: fn_info_map};
 
@@ -315,12 +313,12 @@ fn add_node(ccx: &crate_ctxt, i: node_id, a: &ts_ann) {
     if sz <= i as uint {
         vec::grow_mut(*ccx.node_anns, (i as uint) - sz + 1u, empty_ann(0u));
     }
-    ccx.node_anns.(i) = a;
+    ccx.node_anns[i] = a;
 }
 
 fn get_ts_ann(ccx: &crate_ctxt, i: node_id) -> option::t<ts_ann> {
     if i as uint < vec::len(*ccx.node_anns) {
-        ret some::<ts_ann>(ccx.node_anns.(i));
+        ret some::<ts_ann>(ccx.node_anns[i]);
     } else { ret none::<ts_ann>; }
 }
 
@@ -507,7 +505,7 @@ fn pure_exp(ccx: &crate_ctxt, id: node_id, p: &prestate) -> bool {
 fn num_constraints(m: fn_info) -> uint { ret m.num_constraints; }
 
 fn new_crate_ctxt(cx: ty::ctxt) -> crate_ctxt {
-    let na: [mutable ts_ann] = ~[mutable];
+    let na: [mutable ts_ann] = [mutable];
     ret {tcx: cx, node_anns: @mutable na, fm: @new_int_hash::<fn_info>()};
 }
 
@@ -524,7 +522,7 @@ fn controlflow_expr(ccx: &crate_ctxt, e: @expr) -> controlflow {
 fn constraints_expr(cx: &ty::ctxt, e: @expr) -> [@ty::constr] {
     alt ty::struct(cx, ty::node_id_to_type(cx, e.id)) {
       ty::ty_fn(_, _, _, _, cs) { ret cs; }
-      _ { ret ~[]; }
+      _ { ret []; }
     }
 }
 
@@ -557,14 +555,14 @@ fn node_id_to_def_upvar(cx: &fn_ctxt, id: node_id) -> option::t<def> {
 fn norm_a_constraint(id: def_id, c: &constraint) -> [norm_constraint] {
     alt c {
       cinit(n, sp, i) {
-        ret ~[{bit_num: n, c: respan(sp, ninit(id.node, i))}];
+        ret [{bit_num: n, c: respan(sp, ninit(id.node, i))}];
       }
       cpred(p, descs) {
-        let rslt: [norm_constraint] = ~[];
+        let rslt: [norm_constraint] = [];
         for pd: pred_args in *descs {
             rslt +=
-                ~[{bit_num: pd.node.bit_num,
-                   c: respan(pd.span, npred(p, id, pd.node.args))}];
+                [{bit_num: pd.node.bit_num,
+                  c: respan(pd.span, npred(p, id, pd.node.args))}];
         }
         ret rslt;
       }
@@ -575,8 +573,8 @@ fn norm_a_constraint(id: def_id, c: &constraint) -> [norm_constraint] {
 // Tried to write this as an iterator, but I got a
 // non-exhaustive match in trans.
 fn constraints(fcx: &fn_ctxt) -> [norm_constraint] {
-    let rslt: [norm_constraint] = ~[];
-    for each p: @{key: def_id, val: constraint}  in
+    let rslt: [norm_constraint] = [];
+    for each p: @{key: def_id, val: constraint} in
              fcx.enclosing.constrs.items() {
         rslt += norm_a_constraint(p.key, p.val);
     }
@@ -614,12 +612,12 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use {
         alt tcx.def_map.find(e.id) {
           some(def_local(l_id)) {
             ret @respan(p.span,
-                        carg_ident({ident: p.node.idents.(0),
+                        carg_ident({ident: p.node.idents[0],
                                     node: l_id.node}));
           }
           some(def_arg(a_id)) {
             ret @respan(p.span,
-                        carg_ident({ident: p.node.idents.(0),
+                        carg_ident({ident: p.node.idents[0],
                                     node: a_id.node}));
           }
           _ {
@@ -638,17 +636,17 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use {
     }
 }
 
-fn exprs_to_constr_args(tcx: ty::ctxt, args: &[@expr]) ->
-   [@constr_arg_use] {
+fn exprs_to_constr_args(tcx: ty::ctxt, args: &[@expr]) -> [@constr_arg_use] {
     let f = bind expr_to_constr_arg(tcx, _);
-    let rslt: [@constr_arg_use] = ~[];
-    for e: @expr in args { rslt += ~[f(e)]; }
+    let rslt: [@constr_arg_use] = [];
+    for e: @expr in args { rslt += [f(e)]; }
     rslt
 }
 
 fn expr_to_constr(tcx: ty::ctxt, e: &@expr) -> sp_constr {
     alt e.node {
 
+
       // FIXME change the first pattern to expr_path to test a
       // typechecker bug
       expr_call(operator, args) {
@@ -681,9 +679,9 @@ fn pred_args_to_str(p: &pred_args) -> str {
 
 fn substitute_constr_args(cx: &ty::ctxt, actuals: &[@expr], c: &@ty::constr)
    -> tsconstr {
-    let rslt: [@constr_arg_use] = ~[];
+    let rslt: [@constr_arg_use] = [];
     for a: @constr_arg in c.node.args {
-        rslt += ~[substitute_arg(cx, actuals, a)];
+        rslt += [substitute_arg(cx, actuals, a)];
     }
     ret npred(c.node.path, c.node.id, rslt);
 }
@@ -694,7 +692,7 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) ->
     alt a.node {
       carg_ident(i) {
         if i < num_actuals {
-            ret expr_to_constr_arg(cx, actuals.(i));
+            ret expr_to_constr_arg(cx, actuals[i]);
         } else {
             cx.sess.span_fatal(a.span, "Constraint argument out of bounds");
         }
@@ -704,11 +702,11 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) ->
     }
 }
 
-fn pred_args_matches(pattern: &[constr_arg_general_<inst>],
-                     desc: &pred_args) -> bool {
+fn pred_args_matches(pattern: &[constr_arg_general_<inst>], desc: &pred_args)
+   -> bool {
     let i = 0u;
     for c: @constr_arg_use in desc.node.args {
-        let n = pattern.(i);
+        let n = pattern[i];
         alt c.node {
           carg_ident(p) {
             alt n {
@@ -729,8 +727,8 @@ fn pred_args_matches(pattern: &[constr_arg_general_<inst>],
     ret true;
 }
 
-fn find_instance_(pattern: &[constr_arg_general_<inst>],
-                  descs: &[pred_args]) -> option::t<uint> {
+fn find_instance_(pattern: &[constr_arg_general_<inst>], descs: &[pred_args])
+   -> option::t<uint> {
     for d: pred_args in descs {
         if pred_args_matches(pattern, d) { ret some(d.node.bit_num); }
     }
@@ -743,7 +741,7 @@ type subst = [{from: inst, to: inst}];
 fn find_instances(_fcx: &fn_ctxt, subst: &subst, c: &constraint) ->
    [{from: uint, to: uint}] {
 
-    let rslt = ~[];
+    let rslt = [];
     if vec::len(subst) == 0u { ret rslt; }
 
     alt c {
@@ -754,7 +752,7 @@ fn find_instances(_fcx: &fn_ctxt, subst: &subst, c: &constraint) ->
                 let old_bit_num = d.node.bit_num;
                 let new = replace(subst, d);
                 alt find_instance_(new, *descs) {
-                  some(d1) { rslt += ~[{from: old_bit_num, to: d1}]; }
+                  some(d1) { rslt += [{from: old_bit_num, to: d1}]; }
                   _ { }
                 }
             }
@@ -791,18 +789,18 @@ fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> str {
 }
 
 fn replace(subst: subst, d: pred_args) -> [constr_arg_general_<inst>] {
-    let rslt: [constr_arg_general_<inst>] = ~[];
+    let rslt: [constr_arg_general_<inst>] = [];
     for c: @constr_arg_use in d.node.args {
         alt c.node {
           carg_ident(p) {
             alt find_in_subst(p.node, subst) {
-              some(new) { rslt += ~[carg_ident(new)]; }
-              _ { rslt += ~[c.node]; }
+              some(new) { rslt += [carg_ident(new)]; }
+              _ { rslt += [c.node]; }
             }
           }
           _ {
             //  log_err "##";
-            rslt += ~[c.node];
+            rslt += [c.node];
           }
         }
     }
@@ -893,15 +891,15 @@ fn copy_in_poststate_two(fcx: &fn_ctxt, src_post: &poststate,
                          ty: oper_type) {
     let subst;
     alt ty {
-      oper_swap. { subst = ~[{from: dest, to: src}, {from: src, to: dest}]; }
+      oper_swap. { subst = [{from: dest, to: src}, {from: src, to: dest}]; }
       oper_assign_op. {
         ret; // Don't do any propagation
       }
-      _ { subst = ~[{from: src, to: dest}]; }
+      _ { subst = [{from: src, to: dest}]; }
     }
 
 
-    for each p: @{key: def_id, val: constraint}  in
+    for each p: @{key: def_id, val: constraint} in
              fcx.enclosing.constrs.items() {
         // replace any occurrences of the src def_id with the
         // dest def_id
@@ -1000,7 +998,7 @@ fn constraint_mentions(_fcx: &fn_ctxt, c: &norm_constraint, v: node_id) ->
    bool {
     ret alt c.c.node {
           ninit(id, _) { v == id }
-          npred(_, _, args) { args_mention(args, any_eq, ~[v]) }
+          npred(_, _, args) { args_mention(args, any_eq, [v]) }
         };
 }
 
@@ -1008,11 +1006,11 @@ fn non_init_constraint_mentions(_fcx: &fn_ctxt, c: &norm_constraint,
                                 v: &node_id) -> bool {
     ret alt c.c.node {
           ninit(_, _) { false }
-          npred(_, _, args) { args_mention(args, any_eq, ~[v]) }
+          npred(_, _, args) { args_mention(args, any_eq, [v]) }
         };
 }
 
-fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool ,
+fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool,
                    s: &[T]) -> bool {
     /*
       FIXME
@@ -1038,7 +1036,7 @@ fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool ,
     ret false;
 }
 
-fn use_var(fcx: &fn_ctxt, v: &node_id) { *fcx.enclosing.used_vars += ~[v]; }
+fn use_var(fcx: &fn_ctxt, v: &node_id) { *fcx.enclosing.used_vars += [v]; }
 
 // FIXME: This should be a function in std::vec::.
 fn vec_contains(v: &@mutable [node_id], i: &node_id) -> bool {
@@ -1057,9 +1055,9 @@ fn do_nothing<T>(_f: &_fn, _tp: &[ty_param], _sp: &span, _i: &fn_ident,
 
 
 fn args_to_constr_args(sp: &span, args: &[arg]) -> [@constr_arg_use] {
-    let actuals: [@constr_arg_use] = ~[];
+    let actuals: [@constr_arg_use] = [];
     for a: arg in args {
-        actuals += ~[@respan(sp, carg_ident({ident: a.ident, node: a.id}))];
+        actuals += [@respan(sp, carg_ident({ident: a.ident, node: a.id}))];
     }
     ret actuals;
 }
@@ -1079,56 +1077,49 @@ fn ast_constr_to_sp_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) ->
 
 type binding = {lhs: [inst], rhs: option::t<initializer>};
 
-fn local_to_bindings(loc : &@local) -> binding {
-    let lhs = ~[];
+fn local_to_bindings(loc: &@local) -> binding {
+    let lhs = [];
     for each p: @pat in pat_bindings(loc.node.pat) {
         let ident = alt p.node { pat_bind(name) { name } };
-        lhs += ~[{ident: ident, node: p.id}];
+        lhs += [{ident: ident, node: p.id}];
     }
-    {lhs: lhs,
-     rhs: loc.node.init}
+    {lhs: lhs, rhs: loc.node.init}
 }
 
-fn locals_to_bindings(locals : &[@local]) -> [binding] {
+fn locals_to_bindings(locals: &[@local]) -> [binding] {
     vec::map(local_to_bindings, locals)
 }
 
 fn callee_modes(fcx: &fn_ctxt, callee: node_id) -> [ty::mode] {
-    let ty = ty::type_autoderef(fcx.ccx.tcx,
-                                ty::node_id_to_type(fcx.ccx.tcx, callee));
+    let ty =
+        ty::type_autoderef(fcx.ccx.tcx,
+                           ty::node_id_to_type(fcx.ccx.tcx, callee));
     alt ty::struct(fcx.ccx.tcx, ty) {
-      ty::ty_fn(_, args, _, _, _)
-      | ty::ty_native_fn(_, args, _) {
-        let modes = ~[];
-        for arg: ty::arg in args {
-            modes += ~[arg.mode];
-        }
+      ty::ty_fn(_, args, _, _, _) | ty::ty_native_fn(_, args, _) {
+        let modes = [];
+        for arg: ty::arg in args { modes += [arg.mode]; }
         ret modes;
       }
       _ {
         // Shouldn't happen; callee should be ty_fn.
-        fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: "
-                             + util::ppaux::ty_to_str(fcx.ccx.tcx, ty));
+        fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: " +
+                                 util::ppaux::ty_to_str(fcx.ccx.tcx, ty));
       }
-   }
+    }
 }
 
 fn callee_arg_init_ops(fcx: &fn_ctxt, callee: node_id) -> [init_op] {
     fn mode_to_op(m: &ty::mode) -> init_op {
-        alt m {
-          ty::mo_move. { init_move }
-          _ { init_assign }
-        }
+        alt m { ty::mo_move. { init_move } _ { init_assign } }
     }
     vec::map(mode_to_op, callee_modes(fcx, callee))
 }
 
-fn anon_bindings(ops: &[init_op], es : &[@expr]) -> [binding] {
-    let bindings: [binding] = ~[];
+fn anon_bindings(ops: &[init_op], es: &[@expr]) -> [binding] {
+    let bindings: [binding] = [];
     let i = 0;
     for op: init_op in ops {
-        bindings += ~[{lhs: ~[],
-                       rhs: some({op:op, expr: es.(i)})}];
+        bindings += [{lhs: [], rhs: some({op: op, expr: es[i]})}];
         i += 1;
     }
     ret bindings;
diff --git a/src/comp/middle/tstate/bitvectors.rs b/src/comp/middle/tstate/bitvectors.rs
index 6e45902dfcf..8c37df3cec4 100644
--- a/src/comp/middle/tstate/bitvectors.rs
+++ b/src/comp/middle/tstate/bitvectors.rs
@@ -79,7 +79,7 @@ fn seq_tritv(p: &postcond, q: &postcond) {
 fn seq_postconds(fcx: &fn_ctxt, ps: &[postcond]) -> postcond {
     let sz = vec::len(ps);
     if sz >= 1u {
-        let prev = tritv_clone(ps.(0));
+        let prev = tritv_clone(ps[0]);
         for p: postcond in vec::slice(ps, 1u, sz) { seq_tritv(prev, p); }
         ret prev;
     } else { ret ann::empty_poststate(num_constraints(fcx.enclosing)); }
@@ -97,7 +97,7 @@ fn seq_preconds(fcx: &fn_ctxt, pps: &[pre_and_post]) -> precond {
                        first: &pre_and_post) -> precond {
         let sz: uint = vec::len(pps);
         if sz >= 1u {
-            let second = pps.(0);
+            let second = pps[0];
             assert (pps_len(second) == num_constraints(fcx.enclosing));
             let second_pre = clone(second.precondition);
             difference(second_pre, first.postcondition);
@@ -113,7 +113,7 @@ fn seq_preconds(fcx: &fn_ctxt, pps: &[pre_and_post]) -> precond {
 
 
     if sz >= 1u {
-        let first = pps.(0);
+        let first = pps[0];
         assert (pps_len(first) == num_vars);
         ret seq_preconds_go(fcx, vec::slice(pps, 1u, sz), first);
     } else { ret true_precond(num_vars); }
@@ -150,7 +150,7 @@ fn relax_precond_stmt(s: &@stmt, cx: &relax_ctxt,
     visit::visit_stmt(s, cx, vt);
 }
 
-type relax_ctxt = {fcx:fn_ctxt, i:node_id};
+type relax_ctxt = {fcx: fn_ctxt, i: node_id};
 
 fn relax_precond_block_inner(b: &blk, cx: &relax_ctxt,
                              vt: &visit::vt<relax_ctxt>) {
@@ -158,16 +158,16 @@ fn relax_precond_block_inner(b: &blk, cx: &relax_ctxt,
     visit::visit_block(b, cx, vt);
 }
 
-fn relax_precond_block(fcx: &fn_ctxt, i: node_id, b:&blk) {
+fn relax_precond_block(fcx: &fn_ctxt, i: node_id, b: &blk) {
     let cx = {fcx: fcx, i: i};
     let visitor = visit::default_visitor::<relax_ctxt>();
     visitor =
         @{visit_block: relax_precond_block_inner,
           visit_expr: relax_precond_expr,
           visit_stmt: relax_precond_stmt,
-          visit_item: (fn (_i: &@item, _cx: &relax_ctxt,
-                           _vt: &visit::vt<relax_ctxt>) {})
-          with *visitor};
+          visit_item:
+              fn (_i: &@item, _cx: &relax_ctxt, _vt: &visit::vt<relax_ctxt>) {
+              } with *visitor};
     let v1 = visit::mk_vt(visitor);
     v1.visit_block(b, cx, v1);
 }
@@ -217,7 +217,7 @@ fn clear_in_poststate_expr(fcx: &fn_ctxt, e: &@expr, t: &poststate) {
     }
 }
 
-fn kill_poststate_(fcx : &fn_ctxt, c : &tsconstr, post : &poststate) -> bool {
+fn kill_poststate_(fcx: &fn_ctxt, c: &tsconstr, post: &poststate) -> bool {
     log "kill_poststate_";
     ret clear_in_poststate_(bit_num(fcx, c), post);
 }
@@ -241,8 +241,8 @@ fn clear_in_prestate_ident(fcx: &fn_ctxt, id: &node_id, ident: &ident,
     ret kill_prestate(fcx, parent, ninit(id, ident));
 }
 
-fn clear_in_poststate_ident_(fcx : &fn_ctxt, id : &node_id, ident : &ident,
-                             post : &poststate) -> bool {
+fn clear_in_poststate_ident_(fcx: &fn_ctxt, id: &node_id, ident: &ident,
+                             post: &poststate) -> bool {
     ret kill_poststate_(fcx, ninit(id, ident), post);
 }
 
diff --git a/src/comp/middle/tstate/ck.rs b/src/comp/middle/tstate/ck.rs
index 4caa5ca071a..ca28e06c9f8 100644
--- a/src/comp/middle/tstate/ck.rs
+++ b/src/comp/middle/tstate/ck.rs
@@ -52,8 +52,8 @@ fn check_unused_vars(fcx: &fn_ctxt) {
     for c: norm_constraint in constraints(fcx) {
         alt c.c.node {
           ninit(id, v) {
-            if !vec_contains(fcx.enclosing.used_vars, id) &&
-               v.(0) != ('_' as u8) {
+            if !vec_contains(fcx.enclosing.used_vars, id) && v[0] != '_' as u8
+               {
                 fcx.ccx.tcx.sess.span_warn(c.c.span, "unused variable " + v);
             }
           }
@@ -143,17 +143,18 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn,
     /* Check that the return value is initialized */
     let post = aux::block_poststate(fcx.ccx, f.body);
     if f.proto == ast::proto_fn &&
-        !promises(fcx, post, fcx.enclosing.i_return) &&
-        !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) &&
-        f.decl.cf == return {
+           !promises(fcx, post, fcx.enclosing.i_return) &&
+           !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) &&
+           f.decl.cf == return {
         fcx.ccx.tcx.sess.span_err(f.body.span,
-                                   "In function " + fcx.name +
-                                       ", not all control paths \
+                                  "In function " + fcx.name +
+                                      ", not all control paths \
                                         return a value");
         fcx.ccx.tcx.sess.span_fatal(f.decl.output.span,
                                     "see declared return type of '" +
                                         ty_to_str(f.decl.output) + "'");
-    } else if (f.decl.cf == noreturn) {
+    } else if f.decl.cf == noreturn {
+
         // check that this really always fails
         // Note that it's ok for i_diverge and i_return to both be true.
         // In fact, i_diverge implies i_return. (But not vice versa!)
diff --git a/src/comp/middle/tstate/collect_locals.rs b/src/comp/middle/tstate/collect_locals.rs
index 44d48c5037c..277704998ce 100644
--- a/src/comp/middle/tstate/collect_locals.rs
+++ b/src/comp/middle/tstate/collect_locals.rs
@@ -16,16 +16,17 @@ type ctxt = {cs: @mutable [sp_constr], tcx: ty::ctxt};
 fn collect_local(loc: &@local, cx: &ctxt, v: &visit::vt<ctxt>) {
     for each p: @pat in pat_bindings(loc.node.pat) {
         let ident = alt p.node { pat_bind(id) { id } };
-        log "collect_local: pushing " + ident;
-        *cx.cs += ~[respan(loc.span, ninit(p.id, ident))];
+        log "collect_local: pushing " + ident;;
+        *cx.cs += [respan(loc.span, ninit(p.id, ident))];
     }
     visit::visit_local(loc, cx, v);
 }
 
 fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) {
     alt e.node {
-      expr_check(_, ch) { *cx.cs += ~[expr_to_constr(cx.tcx, ch)]; }
-      expr_if_check(ex, _, _) { *cx.cs += ~[expr_to_constr(cx.tcx, ex)]; }
+      expr_check(_, ch) { *cx.cs += [expr_to_constr(cx.tcx, ch)]; }
+      expr_if_check(ex, _, _) { *cx.cs += [expr_to_constr(cx.tcx, ex)]; }
+
 
       // If it's a call, generate appropriate instances of the
       // call's constraints.
@@ -34,7 +35,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) {
             let ct: sp_constr =
                 respan(c.span,
                        aux::substitute_constr_args(cx.tcx, operands, c));
-            *cx.cs += ~[ct];
+            *cx.cs += [ct];
         }
       }
       _ { }
@@ -45,7 +46,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) {
 
 fn find_locals(tcx: &ty::ctxt, f: &_fn, tps: &[ty_param], sp: &span,
                i: &fn_ident, id: node_id) -> ctxt {
-    let cx: ctxt = {cs: @mutable ~[], tcx: tcx};
+    let cx: ctxt = {cs: @mutable [], tcx: tcx};
     let visitor = visit::default_visitor::<ctxt>();
 
     visitor =
@@ -70,13 +71,13 @@ fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map)
                                  " as a variable and a pred");
               }
               cpred(_, pds) {
-                *pds += ~[respan(c.span, {args: args, bit_num: next})];
+                *pds += [respan(c.span, {args: args, bit_num: next})];
               }
             }
           }
           none. {
             let rslt: @mutable [pred_args] =
-                @mutable ~[respan(c.span, {args: args, bit_num: next})];
+                @mutable [respan(c.span, {args: args, bit_num: next})];
             tbl.insert(d_id, cpred(p, rslt));
           }
         }
@@ -111,18 +112,18 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span,
 
     /* Need to add constraints for args too, b/c they
     can be deinitialized */
-    for a:arg in f.decl.inputs {
-        next = add_constraint(cx.tcx, respan(f_sp,
-                                             ninit(a.id, a.ident)),
-                              next, res_map);
+    for a: arg in f.decl.inputs {
+        next =
+            add_constraint(cx.tcx, respan(f_sp, ninit(a.id, a.ident)), next,
+                           res_map);
     }
 
     /* add the special i_diverge and i_return constraints
     (see the type definition for auxiliary::fn_info for an explanation) */
 
     // use the name of the function for the "return" constraint
-    next = add_constraint(cx.tcx, respan(f_sp, ninit(id, name)), next,
-                          res_map);
+    next =
+        add_constraint(cx.tcx, respan(f_sp, ninit(id, name)), next, res_map);
     // and the name of the function, with a '!' appended to it, for the
     // "diverges" constraint
     let diverges_id = ccx.tcx.sess.next_node_id();
@@ -130,13 +131,14 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span,
     add_constraint(cx.tcx, respan(f_sp, ninit(diverges_id, diverges_name)),
                    next, res_map);
 
-    let v: @mutable [node_id] = @mutable ~[];
+    let v: @mutable [node_id] = @mutable [];
     let rslt =
         {constrs: res_map,
-         num_constraints:
+
          // add 2 to account for the i_return and i_diverge constraints
-             vec::len(*cx.cs) + vec::len(f.decl.constraints)
-                 + vec::len(f.decl.inputs) + 2u,
+         num_constraints:
+             vec::len(*cx.cs) + vec::len(f.decl.constraints) +
+                 vec::len(f.decl.inputs) + 2u,
          cf: f.decl.cf,
          i_return: ninit(id, name),
          i_diverge: ninit(diverges_id, diverges_name),
diff --git a/src/comp/middle/tstate/pre_post_conditions.rs b/src/comp/middle/tstate/pre_post_conditions.rs
index 9c54b8f15a3..0d04d5656e7 100644
--- a/src/comp/middle/tstate/pre_post_conditions.rs
+++ b/src/comp/middle/tstate/pre_post_conditions.rs
@@ -59,13 +59,14 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) {
     alt i.node {
       item_const(_, e) {
         // make a fake fcx
-        let v: @mutable [node_id] = @mutable ~[];
+        let v: @mutable [node_id] = @mutable [];
         let fake_fcx =
-            {enclosing:
+            {
+             // just bogus
+             enclosing:
                  {constrs: @new_def_hash::<constraint>(),
                   num_constraints: 0u,
                   cf: return,
-                  // just bogus
                   i_return: ninit(0, ""),
                   i_diverge: ninit(0, ""),
                   used_vars: v},
@@ -104,7 +105,7 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) {
 fn find_pre_post_exprs(fcx: &fn_ctxt, args: &[@expr], id: node_id) {
     if vec::len::<@expr>(args) > 0u {
         log "find_pre_post_exprs: oper =";
-        log_expr(*args.(0));
+        log_expr(*args[0]);
     }
     fn do_one(fcx: fn_ctxt, e: &@expr) { find_pre_post_expr(fcx, e); }
     for e: @expr in args { do_one(fcx, e); }
@@ -132,8 +133,7 @@ fn find_pre_post_loop(fcx: &fn_ctxt, l: &@local, index: &@expr, body: &blk,
     }
 
     let loop_precond =
-        seq_preconds(fcx,
-                     ~[expr_pp(fcx.ccx, index), block_pp(fcx.ccx, body)]);
+        seq_preconds(fcx, [expr_pp(fcx.ccx, index), block_pp(fcx.ccx, body)]);
     let loop_postcond =
         intersect_states(expr_postcond(fcx.ccx, index),
                          block_postcond(fcx.ccx, body));
@@ -159,8 +159,8 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk,
 
         let precond_res =
             seq_preconds(fcx,
-                         ~[expr_pp(fcx.ccx, antec),
-                           block_pp(fcx.ccx, conseq)]);
+                         [expr_pp(fcx.ccx, antec),
+                          block_pp(fcx.ccx, conseq)]);
         set_pre_and_post(fcx.ccx, id, precond_res,
                          expr_poststate(fcx.ccx, antec));
       }
@@ -173,12 +173,11 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk,
         find_pre_post_expr(fcx, altern);
         let precond_false_case =
             seq_preconds(fcx,
-                         ~[expr_pp(fcx.ccx, antec),
-                           expr_pp(fcx.ccx, altern)]);
+                         [expr_pp(fcx.ccx, antec), expr_pp(fcx.ccx, altern)]);
         let postcond_false_case =
             seq_postconds(fcx,
-                          ~[expr_postcond(fcx.ccx, antec),
-                            expr_postcond(fcx.ccx, altern)]);
+                          [expr_postcond(fcx.ccx, antec),
+                           expr_postcond(fcx.ccx, altern)]);
 
         /* Be sure to set the bit for the check condition here,
          so that it's *not* set in the alternative. */
@@ -191,15 +190,15 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk,
         }
         let precond_true_case =
             seq_preconds(fcx,
-                         ~[expr_pp(fcx.ccx, antec),
-                           block_pp(fcx.ccx, conseq)]);
+                         [expr_pp(fcx.ccx, antec),
+                          block_pp(fcx.ccx, conseq)]);
         let postcond_true_case =
             seq_postconds(fcx,
-                          ~[expr_postcond(fcx.ccx, antec),
-                            block_postcond(fcx.ccx, conseq)]);
+                          [expr_postcond(fcx.ccx, antec),
+                           block_postcond(fcx.ccx, conseq)]);
 
         let precond_res =
-            seq_postconds(fcx, ~[precond_true_case, precond_false_case]);
+            seq_postconds(fcx, [precond_true_case, precond_false_case]);
         let postcond_res =
             intersect_states(postcond_true_case, postcond_false_case);
         set_pre_and_post(fcx.ccx, id, precond_res, postcond_res);
@@ -220,10 +219,10 @@ fn gen_if_local(fcx: &fn_ctxt, lhs: @expr, rhs: @expr, larger_id: node_id,
             gen(fcx, larger_id,
                 ninit(d_id.node, path_to_ident(fcx.ccx.tcx, pth)));
           }
-          _ { find_pre_post_exprs(fcx, ~[lhs, rhs], larger_id); }
+          _ { find_pre_post_exprs(fcx, [lhs, rhs], larger_id); }
         }
       }
-      _ { find_pre_post_exprs(fcx, ~[lhs, rhs], larger_id); }
+      _ { find_pre_post_exprs(fcx, [lhs, rhs], larger_id); }
     }
 }
 
@@ -303,13 +302,12 @@ fn handle_var(fcx: &fn_ctxt, rslt: &pre_and_post, id: node_id, name: ident) {
     }
 }
 
-fn forget_args_moved_in(fcx: &fn_ctxt, parent: &@expr,
-                        modes: &[ty::mode],
+fn forget_args_moved_in(fcx: &fn_ctxt, parent: &@expr, modes: &[ty::mode],
                         operands: &[@expr]) {
     let i = 0u;
     for mode: ty::mode in modes {
         if mode == ty::mo_move {
-            forget_in_postcond(fcx, parent.id, operands.(i).id);
+            forget_in_postcond(fcx, parent.id, operands[i].id);
         }
         i += 1u;
     }
@@ -324,8 +322,10 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
 
     alt e.node {
       expr_call(operator, operands) {
-        let /* copy */args = operands;
-        args += ~[operator];
+        /* copy */
+
+        let args = operands;
+        args += [operator];
 
         find_pre_post_exprs(fcx, args, e.id);
         /* see if the call has any constraints on its type */
@@ -377,12 +377,10 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
       }
       expr_rec(fields, maybe_base) {
         let es = field_exprs(fields);
-        alt maybe_base { none. {/* no-op */ } some(b) { es += ~[b]; } }
+        alt maybe_base { none. {/* no-op */ } some(b) { es += [b]; } }
         find_pre_post_exprs(fcx, es, e.id);
       }
-      expr_tup(elts) {
-        find_pre_post_exprs(fcx, elts, e.id);
-      }
+      expr_tup(elts) { find_pre_post_exprs(fcx, elts, e.id); }
       expr_copy(a) {
         find_pre_post_expr(fcx, a);
         copy_pre_post(fcx.ccx, e.id, a);
@@ -394,7 +392,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         /* Different from expr_assign in that the lhs *must*
            already be initialized */
 
-        find_pre_post_exprs(fcx, ~[lhs, rhs], e.id);
+        find_pre_post_exprs(fcx, [lhs, rhs], e.id);
         forget_in_postcond_still_init(fcx, e.id, lhs.id);
       }
       expr_lit(_) { clear_pp(expr_pp(fcx.ccx, e)); }
@@ -426,12 +424,11 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
             find_pre_post_expr(fcx, l);
             find_pre_post_expr(fcx, r);
             let overall_pre =
-                seq_preconds(fcx,
-                             ~[expr_pp(fcx.ccx, l), expr_pp(fcx.ccx, r)]);
+                seq_preconds(fcx, [expr_pp(fcx.ccx, l), expr_pp(fcx.ccx, r)]);
             set_precondition(node_id_to_ts_ann(fcx.ccx, e.id), overall_pre);
             set_postcondition(node_id_to_ts_ann(fcx.ccx, e.id),
                               expr_postcond(fcx.ccx, l));
-        } else { find_pre_post_exprs(fcx, ~[l, r], e.id); }
+        } else { find_pre_post_exprs(fcx, [l, r], e.id); }
       }
       expr_unary(_, operand) {
         find_pre_post_expr(fcx, operand);
@@ -446,8 +443,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         find_pre_post_block(fcx, body);
         set_pre_and_post(fcx.ccx, e.id,
                          seq_preconds(fcx,
-                                      ~[expr_pp(fcx.ccx, test),
-                                        block_pp(fcx.ccx, body)]),
+                                      [expr_pp(fcx.ccx, test),
+                                       block_pp(fcx.ccx, body)]),
                          intersect_states(expr_postcond(fcx.ccx, test),
                                           block_postcond(fcx.ccx, body)));
       }
@@ -456,8 +453,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         find_pre_post_expr(fcx, test);
         let loop_postcond =
             seq_postconds(fcx,
-                          ~[block_postcond(fcx.ccx, body),
-                            expr_postcond(fcx.ccx, test)]);
+                          [block_postcond(fcx.ccx, body),
+                           expr_postcond(fcx.ccx, test)]);
         /* conservative approximation: if the body
            could break or cont, the test may never be executed */
 
@@ -466,8 +463,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         }
         set_pre_and_post(fcx.ccx, e.id,
                          seq_preconds(fcx,
-                                      ~[block_pp(fcx.ccx, body),
-                                        expr_pp(fcx.ccx, test)]),
+                                      [block_pp(fcx.ccx, body),
+                                       expr_pp(fcx.ccx, test)]),
                          loop_postcond);
       }
       expr_for(d, index, body) {
@@ -476,18 +473,18 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
       expr_for_each(d, index, body) {
         find_pre_post_loop(fcx, d, index, body, e.id);
       }
-      expr_index(val, sub) { find_pre_post_exprs(fcx, ~[val, sub], e.id); }
+      expr_index(val, sub) { find_pre_post_exprs(fcx, [val, sub], e.id); }
       expr_alt(ex, alts) {
         find_pre_post_expr(fcx, ex);
         fn do_an_alt(fcx: &fn_ctxt, an_alt: &arm) -> pre_and_post {
             find_pre_post_block(fcx, an_alt.body);
             ret block_pp(fcx.ccx, an_alt.body);
         }
-        let alt_pps = ~[];
-        for a: arm in alts { alt_pps += ~[do_an_alt(fcx, a)]; }
+        let alt_pps = [];
+        for a: arm in alts { alt_pps += [do_an_alt(fcx, a)]; }
         fn combine_pp(antec: pre_and_post, fcx: fn_ctxt, pp: &pre_and_post,
                       next: &pre_and_post) -> pre_and_post {
-            union(pp.precondition, seq_preconds(fcx, ~[antec, next]));
+            union(pp.precondition, seq_preconds(fcx, [antec, next]));
             intersect(pp.postcondition, next.postcondition);
             ret pp;
         }
@@ -536,22 +533,20 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
       }
 
 
+
       expr_bind(operator, maybe_args) {
-        let args = ~[];
+        let args = [];
         let cmodes = callee_modes(fcx, operator.id);
-        let modes = ~[];
+        let modes = [];
         let i = 0;
         for expr_opt: option::t<@expr> in maybe_args {
             alt expr_opt {
               none. {/* no-op */ }
-              some(expr) {
-                modes += ~[cmodes.(i)];
-                args += ~[expr];
-              }
+              some(expr) { modes += [cmodes[i]]; args += [expr]; }
             }
             i += 1;
         }
-        args += ~[operator]; /* ??? order of eval? */
+        args += [operator]; /* ??? order of eval? */
         forget_args_moved_in(fcx, e, modes, args);
         find_pre_post_exprs(fcx, args, e.id);
       }
@@ -567,7 +562,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
           none. { clear_pp(expr_pp(fcx.ccx, e)); }
         }
       }
-      expr_uniq(sub) { find_pre_post_exprs(fcx, ~[sub], e.id); }
+      expr_uniq(sub) { find_pre_post_exprs(fcx, [sub], e.id); }
     }
 }
 
@@ -603,23 +598,25 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) {
                         /* FIXME: This won't be necessary when typestate
                         works well enough for pat_bindings to return a
                         refinement-typed thing. */
-                        let ident = alt pat.node {
-                          pat_bind(n) { n }
-                          _ {
-                            fcx.ccx.tcx.sess.span_bug(pat.span,
-                                                      "Impossible LHS");
-                          }
-                        };
+                        let ident =
+                            alt pat.node {
+                              pat_bind(n) { n }
+                              _ {
+                                fcx.ccx.tcx.sess.span_bug(pat.span,
+                                                          "Impossible LHS");
+                              }
+                            };
                         alt p {
                           some(p) {
                             copy_in_postcond(fcx, id,
                                              {ident: ident, node: pat.id},
                                              {ident:
-                                              path_to_ident(fcx.ccx.tcx, p),
+                                                  path_to_ident(fcx.ccx.tcx,
+                                                                p),
                                               node: an_init.expr.id},
                                              op_to_oper_ty(an_init.op));
                           }
-                          none. {}
+                          none. { }
                         }
                         gen(fcx, id, ninit(pat.id, ident));
                     }
@@ -645,10 +642,9 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) {
                             fcx.ccx.tcx.sess.span_bug(pat.span,
                                                       "Impossible LHS");
                           }
-                        };
+                        }
                     }
-                    copy_pre_post_(fcx.ccx, id,
-                                   prev_pp.precondition,
+                    copy_pre_post_(fcx.ccx, id, prev_pp.precondition,
                                    prev_pp.postcondition);
                   }
                   none. {
@@ -694,33 +690,33 @@ fn find_pre_post_block(fcx: &fn_ctxt, b: blk) {
     let nv = num_constraints(fcx.enclosing);
     fn do_one_(fcx: fn_ctxt, s: &@stmt) {
         find_pre_post_stmt(fcx, *s);
-/*
-        log_err "pre_post for stmt:";
-        log_stmt_err(*s);
-        log_err "is:";
-        log_pp_err(stmt_pp(fcx.ccx, *s));
-*/
+        /*
+                log_err "pre_post for stmt:";
+                log_stmt_err(*s);
+                log_err "is:";
+                log_pp_err(stmt_pp(fcx.ccx, *s));
+        */
     }
     for s: @stmt in b.node.stmts { do_one_(fcx, s); }
     fn do_inner_(fcx: fn_ctxt, e: &@expr) { find_pre_post_expr(fcx, e); }
     let do_inner = bind do_inner_(fcx, _);
     option::map::<@expr, ()>(do_inner, b.node.expr);
 
-    let pps: [pre_and_post] = ~[];
-    for s: @stmt in b.node.stmts { pps += ~[stmt_pp(fcx.ccx, *s)]; }
+    let pps: [pre_and_post] = [];
+    for s: @stmt in b.node.stmts { pps += [stmt_pp(fcx.ccx, *s)]; }
     alt b.node.expr {
       none. {/* no-op */ }
-      some(e) { pps += ~[expr_pp(fcx.ccx, e)]; }
+      some(e) { pps += [expr_pp(fcx.ccx, e)]; }
     }
 
     let block_precond = seq_preconds(fcx, pps);
 
-    let postconds = ~[];
-    for pp: pre_and_post in pps { postconds += ~[get_post(pp)]; }
+    let postconds = [];
+    for pp: pre_and_post in pps { postconds += [get_post(pp)]; }
 
     /* A block may be empty, so this next line ensures that the postconds
        vector is non-empty. */
-    postconds += ~[block_precond];
+    postconds += [block_precond];
 
     let block_postcond = empty_poststate(nv);
     /* conservative approximation */
diff --git a/src/comp/middle/tstate/states.rs b/src/comp/middle/tstate/states.rs
index 7bba52ceb6d..3d8d8767ceb 100644
--- a/src/comp/middle/tstate/states.rs
+++ b/src/comp/middle/tstate/states.rs
@@ -30,9 +30,9 @@ import util::common::log_stmt_err;
 import util::common::log_expr_err;
 
 fn handle_move_or_copy(fcx: &fn_ctxt, post: &poststate, rhs_path: &path,
-      rhs_id: &node_id, instlhs: &inst, init_op: &init_op) {
+                       rhs_id: &node_id, instlhs: &inst, init_op: &init_op) {
     let rhs_d = local_node_id_to_def_id(fcx, rhs_id);
-    alt (rhs_d) {
+    alt rhs_d {
       some(rhsid) {
         // RHS is a local var
         let instrhs =
@@ -46,19 +46,19 @@ fn handle_move_or_copy(fcx: &fn_ctxt, post: &poststate, rhs_path: &path,
     }
 }
 
-fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding])
-    -> {changed: bool, post: poststate} {
+fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding]) ->
+   {changed: bool, post: poststate} {
     let changed = false;
     let post = tritv_clone(pres);
-    for b:binding in bindings {
-        alt (b.rhs) {
+    for b: binding in bindings {
+        alt b.rhs {
           some(an_init) {
             // an expression, with or without a destination
-            changed |= find_pre_post_state_expr(fcx, post, an_init.expr)
-                || changed;
+            changed |=
+                find_pre_post_state_expr(fcx, post, an_init.expr) || changed;
             post = tritv_clone(expr_poststate(fcx.ccx, an_init.expr));
             for i: inst in b.lhs {
-                alt (an_init.expr.node) {
+                alt an_init.expr.node {
                   expr_path(p) {
                     handle_move_or_copy(fcx, post, p, an_init.expr.id, i,
                                         an_init.op);
@@ -67,6 +67,7 @@ fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding])
                 }
                 set_in_poststate_ident(fcx, i.node, i.ident, post);
             }
+
             // Forget the RHS if we just moved it.
             if an_init.op == init_move {
                 forget_in_poststate(fcx, post, an_init.expr.id);
@@ -168,18 +169,17 @@ fn find_pre_post_state_call(fcx: &fn_ctxt, pres: &prestate, a: &@expr,
     // FIXME: This could be a typestate constraint
     if vec::len(bs) != vec::len(ops) {
         fcx.ccx.tcx.sess.span_bug(a.span,
-                                  #fmt("mismatched arg lengths: \
+                                  #fmt["mismatched arg lengths: \
                                         %u exprs vs. %u ops",
-                                       vec::len(bs), vec::len(ops)));
+                                       vec::len(bs), vec::len(ops)]);
     }
-    ret find_pre_post_state_exprs(fcx, expr_poststate(fcx.ccx, a), id,
-                                  ops, bs, cf)
-            || changed;
+    ret find_pre_post_state_exprs(fcx, expr_poststate(fcx.ccx, a), id, ops,
+                                  bs, cf) || changed;
 }
 
 fn find_pre_post_state_exprs(fcx: &fn_ctxt, pres: &prestate, id: node_id,
-                             ops: &[init_op], es: &[@expr],
-                             cf: controlflow) -> bool {
+                             ops: &[init_op], es: &[@expr], cf: controlflow)
+   -> bool {
     let rs = seq_states(fcx, pres, anon_bindings(ops, es));
     let changed = rs.changed | set_prestate_ann(fcx.ccx, id, pres);
     /* if this is a failing call, it sets everything as initialized */
@@ -315,8 +315,8 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
       expr_vec(elts, _) {
         ret find_pre_post_state_exprs(fcx, pres, e.id,
                                       vec::init_elt(init_assign,
-                                                     vec::len(elts)),
-                                      elts, return);
+                                                    vec::len(elts)), elts,
+                                      return);
       }
       expr_call(operator, operands) {
         ret find_pre_post_state_call(fcx, pres, operator, e.id,
@@ -325,17 +325,14 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
                                      controlflow_expr(fcx.ccx, operator));
       }
       expr_bind(operator, maybe_args) {
-        let args = ~[];
+        let args = [];
         let callee_ops = callee_arg_init_ops(fcx, operator.id);
-        let ops = ~[];
+        let ops = [];
         let i = 0;
         for a_opt: option::t<@expr> in maybe_args {
             alt a_opt {
               none. {/* no-op */ }
-              some(a) {
-                ops += ~[callee_ops.(i)];
-                args += ~[a];
-              }
+              some(a) { ops += [callee_ops[i]]; args += [a]; }
             }
             i += 1;
         }
@@ -366,9 +363,8 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
         let changed =
             find_pre_post_state_exprs(fcx, pres, e.id,
                                       vec::init_elt(init_assign,
-                                                     vec::len(fields)),
-                                      field_exprs(fields),
-                                      return);
+                                                    vec::len(fields)),
+                                      field_exprs(fields), return);
         alt maybe_base {
           none. {/* do nothing */ }
           some(base) {
@@ -383,12 +379,10 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
       expr_tup(elts) {
         ret find_pre_post_state_exprs(fcx, pres, e.id,
                                       vec::init_elt(init_assign,
-                                                     vec::len(elts)),
-                                      elts, return);
-      }
-      expr_copy(a) {
-        ret find_pre_post_state_sub(fcx, pres, a, e.id, none);
+                                                    vec::len(elts)), elts,
+                                      return);
       }
+      expr_copy(a) { ret find_pre_post_state_sub(fcx, pres, a, e.id, none); }
       expr_move(lhs, rhs) {
         ret find_pre_post_state_two(fcx, pres, lhs, rhs, e.id, oper_move);
       }
@@ -405,14 +399,14 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
         /* normally, everything is true if execution continues after
            a ret expression (since execution never continues locally
            after a ret expression */
-// FIXME should factor this out
+        // FIXME should factor this out
         let post = false_postcond(num_constrs);
         // except for the "diverges" bit...
         kill_poststate_(fcx, fcx.enclosing.i_diverge, post);
 
         set_poststate_ann(fcx.ccx, e.id, post);
 
-       alt maybe_ret_val {
+        alt maybe_ret_val {
           none. {/* do nothing */ }
           some(ret_val) {
             changed |= find_pre_post_state_expr(fcx, pres, ret_val);
@@ -565,14 +559,12 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
         woo! */
         let post = false_postcond(num_constrs);
         alt fcx.enclosing.cf {
-          noreturn. {
-            kill_poststate_(fcx, ninit(fcx.id, fcx.name), post);
-          }
-          _ {}
+          noreturn. { kill_poststate_(fcx, ninit(fcx.id, fcx.name), post); }
+          _ { }
         }
         ret set_prestate_ann(fcx.ccx, e.id, pres) |
-            set_poststate_ann(fcx.ccx, e.id, post)
-                | alt maybe_fail_val {
+                set_poststate_ann(fcx.ccx, e.id, post) |
+                alt maybe_fail_val {
                   none. { false }
                   some(fail_val) {
                     find_pre_post_state_expr(fcx, pres, fail_val)
@@ -603,74 +595,73 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
     }
 }
 
-fn find_pre_post_state_stmt(fcx: &fn_ctxt, pres: &prestate, s: @stmt)
-    -> bool {
+fn find_pre_post_state_stmt(fcx: &fn_ctxt, pres: &prestate, s: @stmt) ->
+   bool {
     let stmt_ann = stmt_to_ann(fcx.ccx, *s);
 
-/*
-    log_err ("[" + fcx.name + "]");
-    log_err "*At beginning: stmt = ";
-    log_stmt_err(*s);
-    log_err "*prestate = ";
-    log_tritv_err(fcx, stmt_ann.states.prestate);
-    log_err "*poststate =";
-    log_tritv_err(fcx, stmt_ann.states.poststate);
-    log_err "pres = ";
-    log_tritv_err(fcx, pres);
-*/
-
-    alt (s.node) {
+    /*
+        log_err ("[" + fcx.name + "]");
+        log_err "*At beginning: stmt = ";
+        log_stmt_err(*s);
+        log_err "*prestate = ";
+        log_tritv_err(fcx, stmt_ann.states.prestate);
+        log_err "*poststate =";
+        log_tritv_err(fcx, stmt_ann.states.poststate);
+        log_err "pres = ";
+        log_tritv_err(fcx, pres);
+    */
+
+    alt s.node {
       stmt_decl(adecl, id) {
-        alt (adecl.node) {
+        alt adecl.node {
           decl_local(alocals) {
             set_prestate(stmt_ann, pres);
-            let c_and_p = seq_states(fcx, pres,
-                                     locals_to_bindings(alocals));
+            let c_and_p = seq_states(fcx, pres, locals_to_bindings(alocals));
             /* important to do this in one step to ensure
             termination (don't want to set changed to true
             for intermediate changes) */
 
-            let changed = (set_poststate(stmt_ann, c_and_p.post)
-                           | c_and_p.changed);
+            let changed =
+                set_poststate(stmt_ann, c_and_p.post) | c_and_p.changed;
 
-/*
-                log_err "Summary: stmt = ";
-                log_stmt_err(*s);
-                log_err "prestate = ";
-                log_tritv_err(fcx, stmt_ann.states.prestate);
-                log_err "poststate =";
-                log_tritv_err(fcx, stmt_ann.states.poststate);
-                log_err "changed =";
-                log_err changed;
-*/
+            /*
+                            log_err "Summary: stmt = ";
+                            log_stmt_err(*s);
+                            log_err "prestate = ";
+                            log_tritv_err(fcx, stmt_ann.states.prestate);
+                            log_err "poststate =";
+                            log_tritv_err(fcx, stmt_ann.states.poststate);
+                            log_err "changed =";
+                            log_err changed;
+            */
 
             ret changed;
           }
           decl_item(an_item) {
-            ret set_prestate(stmt_ann, pres) |
-                set_poststate(stmt_ann, pres);
+            ret set_prestate(stmt_ann, pres) | set_poststate(stmt_ann, pres);
             /* the outer visitor will recurse into the item */
           }
         }
       }
       stmt_expr(ex, _) {
-        let changed = find_pre_post_state_expr(fcx, pres, ex) |
+        let changed =
+            find_pre_post_state_expr(fcx, pres, ex) |
                 set_prestate(stmt_ann, expr_prestate(fcx.ccx, ex)) |
                 set_poststate(stmt_ann, expr_poststate(fcx.ccx, ex));
 
-/*
-       log_err "Finally:";
-          log_stmt_err(*s);
-          log_err("prestate = ");
-          //              log_err(bitv::to_str(stmt_ann.states.prestate));
-          log_tritv_err(fcx, stmt_ann.states.prestate);
-          log_err("poststate =");
-          //   log_err(bitv::to_str(stmt_ann.states.poststate));
-          log_tritv_err(fcx, stmt_ann.states.poststate);
-          log_err("changed =");
-*/
+        /*
+        log_err "Finally:";
+        log_stmt_err(*s);
+        log_err("prestate = ");
+        log_err(bitv::to_str(stmt_ann.states.prestate));
+        log_tritv_err(fcx, stmt_ann.states.prestate);
+        log_err("poststate =");
+        log_err(bitv::to_str(stmt_ann.states.poststate));
+        log_tritv_err(fcx, stmt_ann.states.poststate);
+        log_err("changed =");
+        */
 
-          ret changed;
+        ret changed;
       }
       _ { ret false; }
     }
@@ -706,18 +697,18 @@ fn find_pre_post_state_block(fcx: &fn_ctxt, pres0: &prestate, b: &blk) ->
     set_poststate_ann(fcx.ccx, b.node.id, post);
 
 
-/*
-    log_err "For block:";
-    log_block_err(b);
-    log_err "poststate = ";
-    log_states_err(block_states(fcx.ccx, b));
-    log_err "pres0:";
-    log_tritv_err(fcx, pres0);
-    log_err "post:";
-    log_tritv_err(fcx, post);
-    log_err "changed = ";
-    log_err changed;
-*/
+    /*
+        log_err "For block:";
+        log_block_err(b);
+        log_err "poststate = ";
+        log_states_err(block_states(fcx.ccx, b));
+        log_err "pres0:";
+        log_tritv_err(fcx, pres0);
+        log_err "post:";
+        log_tritv_err(fcx, post);
+        log_err "changed = ";
+        log_err changed;
+    */
 
     ret changed;
 }
@@ -731,7 +722,7 @@ fn find_pre_post_state_fn(fcx: &fn_ctxt, f: &_fn) -> bool {
 
     // Arguments start out initialized
     let block_pre = block_prestate(fcx.ccx, f.body);
-    for a:arg in f.decl.inputs {
+    for a: arg in f.decl.inputs {
         set_in_prestate_constr(fcx, ninit(a.id, a.ident), block_pre);
     }
 
diff --git a/src/comp/middle/tstate/tritv.rs b/src/comp/middle/tstate/tritv.rs
index 1a280297bbe..77e3575c175 100644
--- a/src/comp/middle/tstate/tritv.rs
+++ b/src/comp/middle/tstate/tritv.rs
@@ -54,9 +54,10 @@ fn trit_minus(a: trit, b: trit) -> trit {
         alt b {
           ttrue. { dont_care }
           tfalse. { ttrue }
-           /* internally contradictory, but
-              I guess it'll get flagged? */
-           dont_care. {
+
+          /* internally contradictory, but
+             I guess it'll get flagged? */
+          dont_care. {
             ttrue
           }
         }
@@ -64,7 +65,8 @@ fn trit_minus(a: trit, b: trit) -> trit {
       tfalse. {
         alt b {
           ttrue. { tfalse }
-           /* see above comment */
+
+          /* see above comment */
           _ {
             tfalse
           }
@@ -80,7 +82,8 @@ fn trit_or(a: trit, b: trit) -> trit {
       tfalse. {
         alt b {
           ttrue. { dont_care }
-           /* FIXME: ?????? */
+
+          /* FIXME: ?????? */
           _ {
             tfalse
           }
@@ -97,15 +100,18 @@ fn trit_or(a: trit, b: trit) -> trit {
 fn trit_and(a: trit, b: trit) -> trit {
     alt a {
       dont_care. { b }
-       // also seems wrong for case b = ttrue
+
+      // also seems wrong for case b = ttrue
       ttrue. {
         alt b {
           dont_care. { ttrue }
-           // ??? Seems wrong
+
+          // ??? Seems wrong
           ttrue. {
             ttrue
           }
 
+
           // false wins, since if something is uninit
           // on one path, we care
           // (Rationale: it's always safe to assume that
@@ -117,6 +123,7 @@ fn trit_and(a: trit, b: trit) -> trit {
         }
       }
 
+
       // Rationale: if it's uninit on one path,
       // we can consider it as uninit on all paths
       tfalse. {
@@ -180,7 +187,7 @@ fn tritv_get(v: &t, i: uint) -> trit {
     let b1 = bitv::get(v.uncertain, i);
     let b2 = bitv::get(v.val, i);
     assert (!(b1 && b2));
-    if b1 { dont_care } else if (b2) { ttrue } else { tfalse }
+    if b1 { dont_care } else if b2 { ttrue } else { tfalse }
 }
 
 fn tritv_set(i: uint, v: &t, t: trit) -> bool {
@@ -241,14 +248,14 @@ fn tritv_doesntcare(v: &t) -> bool {
 
 fn to_vec(v: &t) -> [uint] {
     let i: uint = 0u;
-    let rslt: [uint] = ~[];
+    let rslt: [uint] = [];
     while i < v.nbits {
         rslt +=
-            ~[alt tritv_get(v, i) {
-                dont_care. { 2u }
-                ttrue. { 1u }
-                tfalse. { 0u }
-              }];
+            [alt tritv_get(v, i) {
+               dont_care. { 2u }
+               ttrue. { 1u }
+               tfalse. { 0u }
+             }];
         i += 1u;
     }
     ret rslt;
diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs
index b1c90844e99..c2594c98f2d 100644
--- a/src/comp/middle/ty.rs
+++ b/src/comp/middle/ty.rs
@@ -207,13 +207,12 @@ type mt = {ty: t, mut: ast::mutability};
 type creader_cache = hashmap<{cnum: int, pos: uint, len: uint}, ty::t>;
 
 type ctxt =
-
     //        constr_table fn_constrs,
+    // We need the ext_map just for printing the types of tags defined in
+    // other crates. Once we get cnames back it should go.
     @{ts: @type_store,
       sess: session::session,
       def_map: resolve::def_map,
-      // We need the ext_map just for printing the types of tags defined in
-      // other crates. Once we get cnames back it should go.
       ext_map: resolve::ext_map,
       node_types: node_type_table,
       items: ast_map::map,
@@ -460,7 +459,7 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t {
       ty_istr. {/* no-op */ }
       ty_type. {/* no-op */ }
       ty_native(_) {/* no-op */ }
-      ty_param(_,_) { has_params = true; }
+      ty_param(_, _) { has_params = true; }
       ty_var(_) { has_vars = true; }
       ty_tag(_, tys) {
         for tt: t in tys { derive_flags_t(cx, has_params, has_vars, tt); }
@@ -475,9 +474,7 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t {
         }
       }
       ty_tup(ts) {
-        for tt in ts {
-            derive_flags_t(cx, has_params, has_vars, tt);
-        }
+        for tt in ts { derive_flags_t(cx, has_params, has_vars, tt); }
       }
       ty_fn(_, args, tt, _, _) {
         derive_flags_sig(cx, has_params, has_vars, args, tt);
@@ -604,9 +601,8 @@ fn mk_type(_cx: &ctxt) -> t { ret idx_type; }
 fn mk_native(cx: &ctxt, did: &def_id) -> t { ret gen_ty(cx, ty_native(did)); }
 
 fn mk_iter_body_fn(cx: &ctxt, output: &t) -> t {
-    ret mk_fn(cx, ast::proto_block,
-              ~[{mode: ty::mo_alias(false), ty: output}],
-              ty::mk_nil(cx), ast::return, ~[]);
+    ret mk_fn(cx, ast::proto_block, [{mode: ty::mo_alias(false), ty: output}],
+              ty::mk_nil(cx), ast::return, []);
 }
 
 // Returns the one-level-deep type structure of the given type.
@@ -622,7 +618,7 @@ fn cname(cx: &ctxt, typ: &t) -> option::t<str> {
 
 
 // Type folds
-type ty_walk = fn(t) ;
+type ty_walk = fn(t);
 
 fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) {
     alt struct(cx, ty) {
@@ -647,9 +643,7 @@ fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) {
       ty_rec(fields) {
         for fl: field in fields { walk_ty(cx, walker, fl.mt.ty); }
       }
-      ty_tup(ts) {
-        for tt in ts { walk_ty(cx, walker, tt); }
-      }
+      ty_tup(ts) { for tt in ts { walk_ty(cx, walker, tt); } }
       ty_fn(proto, args, ret_ty, _, _) {
         for a: arg in args { walk_ty(cx, walker, a.ty); }
         walk_ty(cx, walker, ret_ty);
@@ -668,20 +662,18 @@ fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) {
         walk_ty(cx, walker, sub);
         for tp: t in tps { walk_ty(cx, walker, tp); }
       }
-      ty_constr(sub, _) {
-        walk_ty(cx, walker, sub);
-      }
+      ty_constr(sub, _) { walk_ty(cx, walker, sub); }
       ty_var(_) {/* no-op */ }
-      ty_param(_,_) {/* no-op */ }
+      ty_param(_, _) {/* no-op */ }
       ty_uniq(sub) { walk_ty(cx, walker, sub); }
     }
     walker(ty);
 }
 
 tag fold_mode {
-    fm_var(fn(int) -> t );
-    fm_param(fn(uint,ast::kind) -> t );
-    fm_general(fn(t) -> t );
+    fm_var(fn(int) -> t);
+    fm_param(fn(uint, ast::kind) -> t);
+    fm_general(fn(t) -> t);
 }
 
 fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
@@ -717,31 +709,29 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
         ty = mk_vec(cx, {ty: fold_ty(cx, fld, tm.ty), mut: tm.mut});
       }
       ty_tag(tid, subtys) {
-        let new_subtys: [t] = ~[];
-        for subty: t in subtys { new_subtys += ~[fold_ty(cx, fld, subty)]; }
+        let new_subtys: [t] = [];
+        for subty: t in subtys { new_subtys += [fold_ty(cx, fld, subty)]; }
         ty = copy_cname(cx, mk_tag(cx, tid, new_subtys), ty);
       }
       ty_rec(fields) {
-        let new_fields: [field] = ~[];
+        let new_fields: [field] = [];
         for fl: field in fields {
             let new_ty = fold_ty(cx, fld, fl.mt.ty);
             let new_mt = {ty: new_ty, mut: fl.mt.mut};
-            new_fields += ~[{ident: fl.ident, mt: new_mt}];
+            new_fields += [{ident: fl.ident, mt: new_mt}];
         }
         ty = copy_cname(cx, mk_rec(cx, new_fields), ty);
       }
       ty_tup(ts) {
-        let new_ts = ~[];
-        for tt in ts {
-            new_ts += ~[fold_ty(cx, fld, tt)];
-        }
+        let new_ts = [];
+        for tt in ts { new_ts += [fold_ty(cx, fld, tt)]; }
         ty = copy_cname(cx, mk_tup(cx, new_ts), ty);
       }
       ty_fn(proto, args, ret_ty, cf, constrs) {
-        let new_args: [arg] = ~[];
+        let new_args: [arg] = [];
         for a: arg in args {
             let new_ty = fold_ty(cx, fld, a.ty);
-            new_args += ~[{mode: a.mode, ty: new_ty}];
+            new_args += [{mode: a.mode, ty: new_ty}];
         }
         ty =
             copy_cname(cx,
@@ -749,10 +739,10 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
                              cf, constrs), ty);
       }
       ty_native_fn(abi, args, ret_ty) {
-        let new_args: [arg] = ~[];
+        let new_args: [arg] = [];
         for a: arg in args {
             let new_ty = fold_ty(cx, fld, a.ty);
-            new_args += ~[{mode: a.mode, ty: new_ty}];
+            new_args += [{mode: a.mode, ty: new_ty}];
         }
         ty =
             copy_cname(cx,
@@ -760,25 +750,25 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
                                     fold_ty(cx, fld, ret_ty)), ty);
       }
       ty_obj(methods) {
-        let new_methods: [method] = ~[];
+        let new_methods: [method] = [];
         for m: method in methods {
-            let new_args: [arg] = ~[];
+            let new_args: [arg] = [];
             for a: arg in m.inputs {
-                new_args += ~[{mode: a.mode, ty: fold_ty(cx, fld, a.ty)}];
+                new_args += [{mode: a.mode, ty: fold_ty(cx, fld, a.ty)}];
             }
             new_methods +=
-                ~[{proto: m.proto,
-                   ident: m.ident,
-                   inputs: new_args,
-                   output: fold_ty(cx, fld, m.output),
-                   cf: m.cf,
-                   constrs: m.constrs}];
+                [{proto: m.proto,
+                  ident: m.ident,
+                  inputs: new_args,
+                  output: fold_ty(cx, fld, m.output),
+                  cf: m.cf,
+                  constrs: m.constrs}];
         }
         ty = copy_cname(cx, mk_obj(cx, new_methods), ty);
       }
       ty_res(did, subty, tps) {
-        let new_tps = ~[];
-        for tp: t in tps { new_tps += ~[fold_ty(cx, fld, tp)]; }
+        let new_tps = [];
+        for tp: t in tps { new_tps += [fold_ty(cx, fld, tp)]; }
         ty =
             copy_cname(cx, mk_res(cx, did, fold_ty(cx, fld, subty), new_tps),
                        ty);
@@ -786,8 +776,8 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
       ty_var(id) {
         alt fld { fm_var(folder) { ty = folder(id); } _ {/* no-op */ } }
       }
-      ty_param(id,k) {
-        alt fld { fm_param(folder) { ty = folder(id,k); } _ {/* no-op */ } }
+      ty_param(id, k) {
+        alt fld { fm_param(folder) { ty = folder(id, k); } _ {/* no-op */ } }
       }
     }
 
@@ -867,7 +857,10 @@ fn type_is_str(cx: &ctxt, ty: &t) -> bool {
 fn sequence_is_interior(cx: &ctxt, ty: &t) -> bool {
     alt struct(cx, ty) {
 
-      ty::ty_str. { ret false; }
+
+      ty::ty_str. {
+        ret false;
+      }
       ty::ty_vec(_) { ret true; }
       ty::ty_istr. { ret true; }
       _ { cx.sess.bug("sequence_is_interior called on non-sequence type"); }
@@ -895,8 +888,8 @@ fn type_is_tup_like(cx: &ctxt, ty: &t) -> bool {
 
 fn get_element_type(cx: &ctxt, ty: &t, i: uint) -> t {
     alt struct(cx, ty) {
-      ty_rec(flds) { ret flds.(i).mt.ty; }
-      ty_tup(ts) { ret ts.(i); }
+      ty_rec(flds) { ret flds[i].mt.ty; }
+      ty_tup(ts) { ret ts[i]; }
       _ {
         cx.sess.bug("get_element_type called on type " + ty_to_str(cx, ty) +
                         " - expected a \
@@ -948,6 +941,7 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool {
     let result = false;
     alt struct(cx, ty) {
 
+
       // scalar types
       ty_nil. {
         /* no-op */
@@ -964,16 +958,11 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool {
       ty_native(_) {/* no-op */ }
       ty_rec(flds) {
         for f: field in flds {
-            if type_has_pointers(cx, f.mt.ty) {
-                result = true;
-                break;
-            }
+            if type_has_pointers(cx, f.mt.ty) { result = true; break; }
         }
       }
       ty_tup(elts) {
-        for m in elts {
-            if type_has_pointers(cx, m) { result = true; }
-        }
+        for m in elts { if type_has_pointers(cx, m) { result = true; } }
       }
       ty_tag(did, tps) {
         let variants = tag_variants(cx, did);
@@ -981,10 +970,7 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool {
             for aty: t in variant.args {
                 // Perform any type parameter substitutions.
                 let arg_ty = substitute_type_params(cx, tps, aty);
-                if type_has_pointers(cx, arg_ty) {
-                    result = true;
-                    break;
-                }
+                if type_has_pointers(cx, arg_ty) { result = true; break; }
             }
             if result { break; }
         }
@@ -1002,9 +988,9 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool {
 
 fn type_needs_drop(cx: &ctxt, ty: &t) -> bool {
     ret alt struct(cx, ty) {
-      ty_res(_, _, _) { true }
-      _ { type_has_pointers(cx, ty) }
-    };
+          ty_res(_, _, _) { true }
+          _ { type_has_pointers(cx, ty) }
+        };
 }
 
 fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
@@ -1020,42 +1006,52 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
 
     alt struct(cx, ty) {
 
+
       // Scalar types are unique-kind, no substructure.
-      ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float.
-      | ty_machine(_) | ty_char. | ty_native(_) {
+      ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float. |
+      ty_machine(_) | ty_char. | ty_native(_) {
         // no-op
       }
 
+
       // A handful of other built-in are unique too.
       ty_type. | ty_istr. | ty_native_fn(_, _, _) {
         // no-op
       }
 
+
       // Those things with refcounts-to-interior are just shared.
       ty_str. {
         result = kind_shared;
       }
 
+
       // FIXME: obj is broken for now, since we aren't asserting
       // anything about its fields.
-      ty_obj(_) { result = kind_shared; }
+      ty_obj(_) {
+        result = kind_shared;
+      }
+
 
       // FIXME: the environment capture mode is not fully encoded
       // here yet, leading to weirdness around closure.
       ty_fn(proto, _, _, _, _) {
-        result = alt proto {
-          ast::proto_block. { ast::kind_pinned }
-          ast::proto_closure. { ast::kind_shared }
-          _ { ast::kind_unique }
-        }
+        result =
+            alt proto {
+              ast::proto_block. { ast::kind_pinned }
+              ast::proto_closure. { ast::kind_shared }
+              _ { ast::kind_unique }
+            }
       }
 
+
       // Those with refcounts-to-inner raise pinned to shared,
       // lower unique to shared. Therefore just set result to shared.
       ty_box(mt) {
         result = ast::kind_shared;
       }
 
+
       // Pointers and unique boxes / vecs raise pinned to shared,
       // otherwise pass through their pointee kind.
       ty_ptr(tm) | ty_vec(tm) {
@@ -1064,6 +1060,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
         result = kind::lower_kind(result, k);
       }
 
+
       // Records lower to the lowest of their members.
       ty_rec(flds) {
         for f: field in flds {
@@ -1071,6 +1068,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
             if result == ast::kind_pinned { break; }
         }
       }
+
       // Tuples lower to the lowest of their members.
       ty_tup(tys) {
         for ty: t in tys {
@@ -1079,6 +1077,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
         }
       }
 
+
       // Tags lower to the lowest of their variants.
       ty_tag(did, tps) {
         let variants = tag_variants(cx, did);
@@ -1093,27 +1092,34 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind {
         }
       }
 
+
       // Resources are always pinned.
       ty_res(did, inner, tps) {
         result = ast::kind_pinned;
       }
 
-      ty_var(_) { fail; }
 
-      ty_param(_,k) {
+      ty_var(_) {
+        fail;
+      }
+
+
+      ty_param(_, k) {
         result = kind::lower_kind(result, k);
       }
 
+
       ty_constr(t, _) {
         result = type_kind(cx, t);
       }
 
-        _ {
-            cx.sess.bug("missed case: " + ty_to_str(cx, ty));
-        }
 
+      _ {
+        cx.sess.bug("missed case: " + ty_to_str(cx, ty));
+      }
     }
 
+
     cx.kind_cache.insert(ty, result);
     ret result;
 }
@@ -1140,7 +1146,7 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool {
       ty_tag(_, subtys) {
         let i = 0u;
         while i < vec::len::<t>(subtys) {
-            if type_has_dynamic_size(cx, subtys.(i)) { ret true; }
+            if type_has_dynamic_size(cx, subtys[i]) { ret true; }
             i += 1u;
         }
         ret false;
@@ -1151,15 +1157,13 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool {
       ty_rec(fields) {
         let i = 0u;
         while i < vec::len::<field>(fields) {
-            if type_has_dynamic_size(cx, fields.(i).mt.ty) { ret true; }
+            if type_has_dynamic_size(cx, fields[i].mt.ty) { ret true; }
             i += 1u;
         }
         ret false;
       }
       ty_tup(ts) {
-        for tt in ts {
-            if type_has_dynamic_size(cx, tt) { ret true; }
-        }
+        for tt in ts { if type_has_dynamic_size(cx, tt) { ret true; } }
         ret false;
       }
       ty_fn(_, _, _, _, _) { ret false; }
@@ -1170,7 +1174,7 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool {
         ret type_has_dynamic_size(cx, sub);
       }
       ty_var(_) { fail "ty_var in type_has_dynamic_size()"; }
-      ty_param(_,_) { ret true; }
+      ty_param(_, _) { ret true; }
       ty_type. { ret false; }
       ty_native(_) { ret false; }
       ty_uniq(_) { ret false; }
@@ -1242,6 +1246,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool {
       ty_istr. { result = true; }
 
 
+
       // scalar types
       ty_nil. {
         result = false;
@@ -1257,6 +1262,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool {
       ty_native(_) { result = false; }
 
 
+
       // boxed types
       ty_str. {
         result = false;
@@ -1267,6 +1273,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool {
       ty_obj(_) { result = false; }
 
 
+
       // structural types
       ty_tag(did, tps) {
         let variants = tag_variants(cx, did);
@@ -1284,20 +1291,19 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool {
         }
       }
       ty_tup(elts) {
-        for m in elts {
-            if type_owns_heap_mem(cx, m) { result = true; }
-        }
+        for m in elts { if type_owns_heap_mem(cx, m) { result = true; } }
       }
       ty_res(_, inner, tps) {
         result =
             type_owns_heap_mem(cx, substitute_type_params(cx, tps, inner));
       }
 
+
       ty_ptr(_) {
         result = false;
       }
       ty_var(_) { fail "ty_var in type_owns_heap_mem"; }
-      ty_param(_,_) { result = false; }
+      ty_param(_, _) { result = false; }
     }
 
     cx.owns_heap_mem_cache.insert(ty, result);
@@ -1305,48 +1311,53 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool {
 }
 
 // Whether a type is Plain Old Data (i.e. can be safely memmoved).
-fn type_is_pod(cx : &ctxt, ty : &t) -> bool {
+fn type_is_pod(cx: &ctxt, ty: &t) -> bool {
     let result = true;
     alt struct(cx, ty) {
-        // Scalar types
-        ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. |
-        ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) {
-            result = true;
-        }
 
-        // Boxed types
-        ty_str. | ty_istr. | ty_box(_) | ty_vec(_) |
-        ty_fn(_,_,_,_,_) | ty_native_fn(_,_,_) | ty_obj(_) { result = false; }
+      // Scalar types
+      ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. |
+      ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) {
+        result = true;
+      }
 
-        // Structural types
-        ty_tag(did, tps) {
-            let variants = tag_variants(cx, did);
-            for variant : variant_info in variants {
-                let tup_ty = mk_tup(cx, variant.args);
 
-                // Perform any type parameter substitutions.
-                tup_ty = substitute_type_params(cx, tps, tup_ty);
-                if !type_is_pod(cx, tup_ty) { result = false; }
-            }
-        }
-        ty_rec(flds) {
-            for f : field in flds {
-                if !type_is_pod(cx, f.mt.ty) { result = false; }
-            }
-        }
-        ty_tup(elts) {
-            for elt in elts {
-                if !type_is_pod(cx, elt) { result = false; }
-            }
+      // Boxed types
+      ty_str. | ty_istr. | ty_box(_) | ty_vec(_) | ty_fn(_, _, _, _, _) |
+      ty_native_fn(_, _, _) | ty_obj(_) {
+        result = false;
+      }
+
+
+      // Structural types
+      ty_tag(did, tps) {
+        let variants = tag_variants(cx, did);
+        for variant: variant_info in variants {
+            let tup_ty = mk_tup(cx, variant.args);
+
+            // Perform any type parameter substitutions.
+            tup_ty = substitute_type_params(cx, tps, tup_ty);
+            if !type_is_pod(cx, tup_ty) { result = false; }
         }
-        ty_res(_, inner, tps) {
-            result = type_is_pod(cx,
-                substitute_type_params(cx, tps, inner));
+      }
+      ty_rec(flds) {
+        for f: field in flds {
+            if !type_is_pod(cx, f.mt.ty) { result = false; }
         }
-        ty_constr(subt, _) { result = type_is_pod(cx, subt); }
+      }
+      ty_tup(elts) {
+        for elt in elts { if !type_is_pod(cx, elt) { result = false; } }
+      }
+      ty_res(_, inner, tps) {
+        result = type_is_pod(cx, substitute_type_params(cx, tps, inner));
+      }
+      ty_constr(subt, _) { result = type_is_pod(cx, subt); }
+
 
-        ty_var(_) { fail "ty_var in type_is_pod"; }
-        ty_param(_,_) { result = false; }
+      ty_var(_) {
+        fail "ty_var in type_is_pod";
+      }
+      ty_param(_, _) { result = false; }
     }
 
     ret result;
@@ -1354,7 +1365,7 @@ fn type_is_pod(cx : &ctxt, ty : &t) -> bool {
 
 fn type_param(cx: &ctxt, ty: &t) -> option::t<uint> {
     alt struct(cx, ty) {
-      ty_param(id,_) { ret some(id); }
+      ty_param(id, _) { ret some(id); }
       _ {/* fall through */ }
     }
     ret none;
@@ -1362,16 +1373,11 @@ fn type_param(cx: &ctxt, ty: &t) -> option::t<uint> {
 
 // Returns a vec of all the type variables
 // occurring in t. It may contain duplicates.
-fn vars_in_type(cx:&ctxt, ty: &t) -> [int] {
-    fn collect_var(cx:&ctxt, vars: &@mutable [int], ty: t) {
-        alt struct(cx, ty) {
-          ty_var(v) {
-            *vars += ~[v];
-          }
-          _ {}
-        }
+fn vars_in_type(cx: &ctxt, ty: &t) -> [int] {
+    fn collect_var(cx: &ctxt, vars: &@mutable [int], ty: t) {
+        alt struct(cx, ty) { ty_var(v) { *vars += [v]; } _ { } }
     }
-    let rslt: @mutable [int] = @mutable (~[]);
+    let rslt: @mutable [int] = @mutable [];
     walk_ty(cx, bind collect_var(cx, rslt, _), ty);
     // Works because of a "convenient" bug that lets us
     // return a mutable vec as if it's immutable
@@ -1388,11 +1394,10 @@ fn type_autoderef(cx: &ctxt, t: &ty::t) -> ty::t {
           }
           ty::ty_tag(did, tps) {
             let variants = tag_variants(cx, did);
-            if vec::len(variants) != 1u || vec::len(variants.(0).args) != 1u
-               {
+            if vec::len(variants) != 1u || vec::len(variants[0].args) != 1u {
                 break;
             }
-            t1 = substitute_type_params(cx, tps, variants.(0).args.(0));
+            t1 = substitute_type_params(cx, tps, variants[0].args[0]);
           }
           _ { break; }
         }
@@ -1490,6 +1495,7 @@ fn hash_type_structure(st: &sty) -> uint {
         ret h;
       }
 
+
       // ???
       ty_fn(_, args, rty, _, _) {
         ret hash_fn(27u, args, rty);
@@ -1501,7 +1507,7 @@ fn hash_type_structure(st: &sty) -> uint {
         ret h;
       }
       ty_var(v) { ret hash_uint(30u, v as uint); }
-      ty_param(pid,_) { ret hash_uint(31u, pid); }
+      ty_param(pid, _) { ret hash_uint(31u, pid); }
       ty_type. { ret 32u; }
       ty_native(did) { ret hash_def(33u, did); }
       ty_bot. { ret 34u; }
@@ -1516,11 +1522,7 @@ fn hash_type_structure(st: &sty) -> uint {
         for c: @type_constr in cs { h += h << 5u + hash_type_constr(h, c); }
         ret h;
       }
-      ty_uniq(t) {
-        let h = 37u;
-        h += h << 5u + hash_ty(t);
-        ret h;
-      }
+      ty_uniq(t) { let h = 37u; h += h << 5u + hash_ty(t); ret h; }
     }
 }
 
@@ -1542,7 +1544,7 @@ fn hash_ty(typ: &t) -> uint { ret typ; }
 // users should use `eq_ty()` instead.
 fn eq_int(x: &uint, y: &uint) -> bool { ret x == y; }
 
-fn arg_eq<T>(eq: &fn(&T, &T) -> bool , a: @sp_constr_arg<T>,
+fn arg_eq<T>(eq: &fn(&T, &T) -> bool, a: @sp_constr_arg<T>,
              b: @sp_constr_arg<T>) -> bool {
     alt a.node {
       ast::carg_base. {
@@ -1557,11 +1559,11 @@ fn arg_eq<T>(eq: &fn(&T, &T) -> bool , a: @sp_constr_arg<T>,
     }
 }
 
-fn args_eq<T>(eq: fn(&T, &T) -> bool , a: &[@sp_constr_arg<T>],
+fn args_eq<T>(eq: fn(&T, &T) -> bool, a: &[@sp_constr_arg<T>],
               b: &[@sp_constr_arg<T>]) -> bool {
     let i: uint = 0u;
     for arg: @sp_constr_arg<T> in a {
-        if !arg_eq(eq, arg, b.(i)) { ret false; }
+        if !arg_eq(eq, arg, b[i]) { ret false; }
         i += 1u;
     }
     ret true;
@@ -1576,7 +1578,7 @@ fn constr_eq(c: &@constr, d: &@constr) -> bool {
 fn constrs_eq(cs: &[@constr], ds: &[@constr]) -> bool {
     if vec::len(cs) != vec::len(ds) { ret false; }
     let i = 0u;
-    for c: @constr in cs { if !constr_eq(c, ds.(i)) { ret false; } i += 1u; }
+    for c: @constr in cs { if !constr_eq(c, ds[i]) { ret false; } i += 1u; }
     ret true;
 }
 
@@ -1630,7 +1632,7 @@ fn node_id_to_type(cx: &ctxt, id: &ast::node_id) -> t {
 
 fn node_id_to_type_params(cx: &ctxt, id: &ast::node_id) -> [t] {
     alt node_id_to_ty_param_substs_opt_and_ty(cx, id).substs {
-      none. { ret ~[]; }
+      none. { ret []; }
       some(tps) { ret tps; }
     }
 }
@@ -1663,17 +1665,17 @@ fn node_id_to_monotype(cx: &ctxt, id: ast::node_id) -> t {
 fn count_ty_params(cx: &ctxt, ty: t) -> uint {
     fn counter(cx: &ctxt, param_indices: @mutable [uint], ty: t) {
         alt struct(cx, ty) {
-          ty_param(param_idx,_) {
+          ty_param(param_idx, _) {
             let seen = false;
             for other_param_idx: uint in *param_indices {
                 if param_idx == other_param_idx { seen = true; }
             }
-            if !seen { *param_indices += ~[param_idx]; }
+            if !seen { *param_indices += [param_idx]; }
           }
           _ {/* fall through */ }
         }
     }
-    let param_indices: @mutable [uint] = @mutable ~[];
+    let param_indices: @mutable [uint] = @mutable [];
     let f = bind counter(cx, param_indices, _);
     walk_ty(cx, f, ty);
     ret vec::len::<uint>(*param_indices);
@@ -1810,31 +1812,32 @@ fn is_lval(expr: &@ast::expr) -> bool {
     }
 }
 
-fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: &t)
-    -> bool {
-    if (!type_contains_vars(tcx, rt)) {
+fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: &t) ->
+   bool {
+    if !type_contains_vars(tcx, rt) {
         // Fast path
         ret false;
     }
+
     // Occurs check!
     if vec::member(vid, vars_in_type(tcx, rt)) {
         alt sp {
-          some (s) {
+          some(s) {
             // Maybe this should be span_err -- however, there's an
             // assertion later on that the type doesn't contain
             // variables, so in this case we have to be sure to die.
-            tcx.sess.span_fatal(s,
-                                "Type inference failed because I \
-               could not find a type\n that's both of the form " +
-               ty_to_str(tcx, ty::mk_var(tcx, (vid)))
-              + " and of the form " + ty_to_str(tcx, rt)
-              + ". Such a type would have to be infinitely \
-               large.");
+            tcx.sess.span_fatal(
+                s,
+                "Type inference failed because I \
+                 could not find a type\n that's both of the form "
+                + ty_to_str(tcx, ty::mk_var(tcx, vid)) +
+                " and of the form " + ty_to_str(tcx, rt) +
+                ". Such a type would have to be infinitely \
+                 large.");
           }
           _ { ret true; }
         }
-    }
-    else { ret false; }
+    } else { ret false; }
 }
 
 // Type unification via Robinson's algorithm (Robinson 1965). Implemented as
@@ -1893,10 +1896,7 @@ mod unify {
         alt smallintmap::find(cx.vb.types, root_a) {
           none. {
             alt smallintmap::find(cx.vb.types, root_b) {
-              none. {
-                ufind::union(cx.vb.sets, set_a, set_b);
-                ret unres_ok;
-              }
+              none. { ufind::union(cx.vb.sets, set_a, set_b); ret unres_ok; }
               some(t_b) { replace_type(cx, t_b); ret unres_ok; }
             }
           }
@@ -1958,7 +1958,7 @@ mod unify {
         let i = 0u;
         let rslt;
         for c: @type_constr in expected {
-            rslt = unify_constr(base_t, c, actual.(i));
+            rslt = unify_constr(base_t, c, actual[i]);
             alt rslt { ures_ok(_) { } ures_err(_) { ret rslt; } }
             i += 1u;
         }
@@ -1975,7 +1975,7 @@ mod unify {
         let i = 0u;
         let actual;
         for a: @ty_constr_arg in expected.node.args {
-            actual = actual_constr.node.args.(i);
+            actual = actual_constr.node.args[i];
             alt a.node {
               carg_base. {
                 alt actual.node { carg_base. { } _ { ret err_res; } }
@@ -2021,22 +2021,22 @@ mod unify {
         }
         // TODO: as above, we should have an iter2 iterator.
 
-        let result_ins: [arg] = ~[];
+        let result_ins: [arg] = [];
         let i = 0u;
         while i < expected_len {
-            let expected_input = expected_inputs.(i);
-            let actual_input = actual_inputs.(i);
+            let expected_input = expected_inputs[i];
+            let actual_input = actual_inputs[i];
             // Unify the result modes.
 
             let result_mode;
             if expected_input.mode != actual_input.mode {
-                ret fn_common_res_err
-                    (ures_err(terr_mode_mismatch(expected_input.mode,
-                                                 actual_input.mode)));
+                ret fn_common_res_err(
+                    ures_err(terr_mode_mismatch(expected_input.mode,
+                                                actual_input.mode)));
             } else { result_mode = expected_input.mode; }
             let result = unify_step(cx, expected_input.ty, actual_input.ty);
             alt result {
-              ures_ok(rty) { result_ins += ~[{mode: result_mode, ty: rty}]; }
+              ures_ok(rty) { result_ins += [{mode: result_mode, ty: rty}]; }
               _ { ret fn_common_res_err(result); }
             }
             i += 1u;
@@ -2053,12 +2053,13 @@ mod unify {
                 expected: &t, actual: &t, expected_inputs: &[arg],
                 expected_output: &t, actual_inputs: &[arg], actual_output: &t,
                 expected_cf: &controlflow, actual_cf: &controlflow,
-                _expected_constrs: &[@constr], actual_constrs: &[@constr])
-       -> result {
+                _expected_constrs: &[@constr], actual_constrs: &[@constr]) ->
+       result {
         if e_proto != a_proto { ret ures_err(terr_mismatch); }
         alt expected_cf {
           ast::return. { }
-           // ok
+
+          // ok
           ast::noreturn. {
             alt actual_cf {
               ast::noreturn. {
@@ -2109,14 +2110,14 @@ mod unify {
     fn unify_obj(cx: &@ctxt, expected: &t, actual: &t,
                  expected_meths: &[method], actual_meths: &[method]) ->
        result {
-        let result_meths: [method] = ~[];
+        let result_meths: [method] = [];
         let i: uint = 0u;
         let expected_len: uint = vec::len::<method>(expected_meths);
         let actual_len: uint = vec::len::<method>(actual_meths);
         if expected_len != actual_len { ret ures_err(terr_meth_count); }
         while i < expected_len {
-            let e_meth = expected_meths.(i);
-            let a_meth = actual_meths.(i);
+            let e_meth = expected_meths[i];
+            let a_meth = actual_meths[i];
             if !str::eq(e_meth.ident, a_meth.ident) {
                 ret ures_err(terr_obj_meths(e_meth.ident, a_meth.ident));
             }
@@ -2130,8 +2131,8 @@ mod unify {
                 alt struct(cx.tcx, tfn) {
                   ty_fn(proto, ins, out, cf, constrs) {
                     result_meths +=
-                        ~[{inputs: ins, output: out, cf: cf, constrs: constrs
-                              with e_meth}];
+                        [{inputs: ins, output: out, cf: cf, constrs: constrs
+                             with e_meth}];
                   }
                 }
               }
@@ -2148,9 +2149,7 @@ mod unify {
        fixup_result {
         alt struct(tcx, typ) {
           ty_var(vid) {
-            if vid as uint >= ufind::set_count(vb.sets) {
-                ret fix_err(vid);
-            }
+            if vid as uint >= ufind::set_count(vb.sets) { ret fix_err(vid); }
             let root_id = ufind::find(vb.sets, vid as uint);
             alt smallintmap::find::<t>(vb.types, root_id) {
               none. { ret fix_err(vid); }
@@ -2172,6 +2171,7 @@ mod unify {
 
         alt struct(cx.tcx, actual) {
 
+
           // If the RHS is a variable type, then just do the
           // appropriate binding.
           ty::ty_var(actual_id) {
@@ -2219,6 +2219,7 @@ mod unify {
         alt struct(cx.tcx, expected) {
           ty::ty_nil. { ret struct_cmp(cx, expected, actual); }
 
+
           // _|_ unifies with anything
           ty::ty_bot. {
             ret ures_ok(actual);
@@ -2242,7 +2243,7 @@ mod unify {
               _ { ret ures_err(terr_mismatch); }
             }
           }
-          ty::ty_param(_,_) { ret struct_cmp(cx, expected, actual); }
+          ty::ty_param(_, _) { ret struct_cmp(cx, expected, actual); }
           ty::ty_tag(expected_id, expected_tps) {
             alt struct(cx.tcx, actual) {
               ty::ty_tag(actual_id, actual_tps) {
@@ -2251,15 +2252,15 @@ mod unify {
                     ret ures_err(terr_mismatch);
                 }
                 // TODO: factor this cruft out
-                let result_tps: [t] = ~[];
+                let result_tps: [t] = [];
                 let i = 0u;
                 let expected_len = vec::len::<t>(expected_tps);
                 while i < expected_len {
-                    let expected_tp = expected_tps.(i);
-                    let actual_tp = actual_tps.(i);
+                    let expected_tp = expected_tps[i];
+                    let actual_tp = actual_tps[i];
                     let result = unify_step(cx, expected_tp, actual_tp);
                     alt result {
-                      ures_ok(rty) { result_tps += ~[rty]; }
+                      ures_ok(rty) { result_tps += [rty]; }
                       _ { ret result; }
                     }
                     i += 1u;
@@ -2354,11 +2355,11 @@ mod unify {
                 alt result {
                   ures_ok(res_inner) {
                     let i = 0u;
-                    let res_tps = ~[];
+                    let res_tps = [];
                     for ex_tp: t in ex_tps {
-                        let result = unify_step(cx, ex_tp, act_tps.(i));
+                        let result = unify_step(cx, ex_tp, act_tps[i]);
                         alt result {
-                          ures_ok(rty) { res_tps += ~[rty]; }
+                          ures_ok(rty) { res_tps += [rty]; }
                           _ { ret result; }
                         }
                         i += 1u;
@@ -2383,11 +2384,11 @@ mod unify {
                 // TODO: implement an iterator that can iterate over
                 // two arrays simultaneously.
 
-                let result_fields: [field] = ~[];
+                let result_fields: [field] = [];
                 let i = 0u;
                 while i < expected_len {
-                    let expected_field = expected_fields.(i);
-                    let actual_field = actual_fields.(i);
+                    let expected_field = expected_fields[i];
+                    let actual_field = actual_fields[i];
                     let mut;
                     alt unify_mut(expected_field.mt.mut, actual_field.mt.mut)
                         {
@@ -2406,7 +2407,7 @@ mod unify {
                     alt result {
                       ures_ok(rty) {
                         let mt = {ty: rty, mut: mut};
-                        result_fields += ~[{mt: mt with expected_field}];
+                        result_fields += [{mt: mt with expected_field}];
                       }
                       _ { ret result; }
                     }
@@ -2422,24 +2423,21 @@ mod unify {
               ty::ty_tup(actual_elems) {
                 let expected_len = vec::len(expected_elems);
                 let actual_len = vec::len(actual_elems);
-                if (expected_len != actual_len) {
+                if expected_len != actual_len {
                     let err = terr_tuple_size(expected_len, actual_len);
                     ret ures_err(err);
                 }
                 // TODO: implement an iterator that can iterate over
                 // two arrays simultaneously.
 
-                let result_elems = ~[];
+                let result_elems = [];
                 let i = 0u;
                 while i < expected_len {
-                    let expected_elem = expected_elems.(i);
-                    let actual_elem = actual_elems.(i);
-                    let result = unify_step(cx, expected_elem,
-                                            actual_elem);
+                    let expected_elem = expected_elems[i];
+                    let actual_elem = actual_elems[i];
+                    let result = unify_step(cx, expected_elem, actual_elem);
                     alt result {
-                      ures_ok(rty) {
-                        result_elems += ~[rty];
-                      }
+                      ures_ok(rty) { result_elems += [rty]; }
                       _ { ret result; }
                     }
                     i += 1u;
@@ -2519,9 +2517,7 @@ mod unify {
             let sets = "";
             let j = 0u;
             while j < vec::len::<option::t<uint>>(vb.sets.nodes) {
-                if ufind::find(vb.sets, j) == i {
-                    sets += #fmt(" %u", j);
-                }
+                if ufind::find(vb.sets, j) == i { sets += #fmt[" %u", j]; }
                 j += 1u;
             }
             let typespec;
@@ -2529,7 +2525,7 @@ mod unify {
               none. { typespec = ""; }
               some(typ) { typespec = " =" + ty_to_str(tcx, typ); }
             }
-            log_err #fmt("set %u:%s%s", i, typespec, sets);
+            log_err #fmt["set %u:%s%s", i, typespec, sets];
             i += 1u;
         }
     }
@@ -2538,8 +2534,8 @@ mod unify {
     //    Takes an optional span - complain about occurs check violations
     //    iff the span is present (so that if we already know we're going
     //    to error anyway, we don't complain)
-    fn fixup_vars(tcx: ty_ctxt, sp: &option::t<span>,
-                  vb: @var_bindings, typ: t) -> fixup_result {
+    fn fixup_vars(tcx: ty_ctxt, sp: &option::t<span>, vb: @var_bindings,
+                  typ: t) -> fixup_result {
         fn subst_vars(tcx: ty_ctxt, sp: &option::t<span>, vb: @var_bindings,
                       unresolved: @mutable option::t<int>, vid: int) -> t {
             // Should really return a fixup_result instead of a t, but fold_ty
@@ -2553,11 +2549,13 @@ mod unify {
               none. { *unresolved = some(vid); ret ty::mk_var(tcx, vid); }
               some(rt) {
                 if occurs_check_fails(tcx, sp, vid, rt) {
-      // Return the type unchanged, so we can error out downstream
+                    // Return the type unchanged, so we can error out
+                    // downstream
                     ret rt;
                 }
                 ret fold_ty(tcx,
-                  fm_var(bind subst_vars(tcx, sp, vb, unresolved, _)), rt);
+                            fm_var(bind subst_vars(tcx, sp, vb, unresolved,
+                                                   _)), rt);
               }
             }
         }
@@ -2572,8 +2570,7 @@ mod unify {
         }
     }
     fn resolve_type_var(tcx: &ty_ctxt, sp: &option::t<span>,
-                        vb: &@var_bindings, vid: int) ->
-       fixup_result {
+                        vb: &@var_bindings, vid: int) -> fixup_result {
         if vid as uint >= ufind::set_count(vb.sets) { ret fix_err(vid); }
         let root_id = ufind::find(vb.sets, vid as uint);
         alt smallintmap::find::<t>(vb.types, root_id) {
@@ -2594,8 +2591,8 @@ fn type_err_to_str(err: &ty::type_err) -> str {
       terr_vec_mutability. { ret "vectors differ in mutability"; }
       terr_tuple_size(e_sz, a_sz) {
         ret "expected a tuple with " + uint::to_str(e_sz, 10u) +
-            " elements but found one with " + uint::to_str(a_sz, 10u)
-            + " elements";
+                " elements but found one with " + uint::to_str(a_sz, 10u) +
+                " elements";
       }
       terr_record_size(e_sz, a_sz) {
         ret "expected a record with " + uint::to_str(e_sz, 10u) +
@@ -2634,25 +2631,23 @@ fn type_err_to_str(err: &ty::type_err) -> str {
 
 // Converts type parameters in a type to type variables and returns the
 // resulting type along with a list of type variable IDs.
-fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int ,
-                       typ: t, ty_param_count: uint) -> {ids: [int], ty: t} {
-    let param_var_ids: @mutable [int] = @mutable ~[];
+fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int, typ: t,
+                       ty_param_count: uint) -> {ids: [int], ty: t} {
+    let param_var_ids: @mutable [int] = @mutable [];
     let i = 0u;
-    while i < ty_param_count { *param_var_ids += ~[next_ty_var()]; i += 1u; }
+    while i < ty_param_count { *param_var_ids += [next_ty_var()]; i += 1u; }
     fn binder(sp: span, cx: ctxt, param_var_ids: @mutable [int],
-              _next_ty_var: fn() -> int , index: uint, _kind: ast::kind)
-        -> t {
+              _next_ty_var: fn() -> int, index: uint, _kind: ast::kind) -> t {
         if index < vec::len(*param_var_ids) {
-            ret mk_var(cx, param_var_ids.(index));
+            ret mk_var(cx, param_var_ids[index]);
         } else {
             cx.sess.span_fatal(sp, "Unbound type parameter in callee's type");
         }
     }
     let new_typ =
         fold_ty(cx,
-                fm_param(bind binder(sp, cx, param_var_ids, next_ty_var,
-                                     _, _)),
-                typ);
+                fm_param(bind binder(sp, cx, param_var_ids, next_ty_var, _,
+                                     _)), typ);
     ret {ids: *param_var_ids, ty: new_typ};
 }
 
@@ -2661,10 +2656,10 @@ fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int ,
 // substitions.
 fn substitute_type_params(cx: &ctxt, substs: &[ty::t], typ: t) -> t {
     if !type_contains_params(cx, typ) { ret typ; }
-    fn substituter(_cx: ctxt, substs: @[ty::t], idx: uint,
-                   _kind: ast::kind) -> t {
+    fn substituter(_cx: ctxt, substs: @[ty::t], idx: uint, _kind: ast::kind)
+       -> t {
         // FIXME: bounds check can fail
-        ret substs.(idx);
+        ret substs[idx];
     }
     ret fold_ty(cx, fm_param(bind substituter(cx, @substs, _, _)), typ);
 }
@@ -2679,7 +2674,7 @@ fn def_has_ty_params(def: &ast::def) -> bool {
       ast::def_local(_) { ret false; }
       ast::def_variant(_, _) { ret true; }
       ast::def_ty(_) { ret false; }
-      ast::def_ty_arg(_,_) { ret false; }
+      ast::def_ty_arg(_, _) { ret false; }
       ast::def_binding(_) { ret false; }
       ast::def_use(_) { ret false; }
       ast::def_native_ty(_) { ret false; }
@@ -2702,20 +2697,20 @@ fn tag_variants(cx: &ctxt, id: &ast::def_id) -> [variant_info] {
       ast_map::node_item(item) {
         alt item.node {
           ast::item_tag(variants, _) {
-            let result: [variant_info] = ~[];
+            let result: [variant_info] = [];
             for variant: ast::variant in variants {
                 let ctor_ty = node_id_to_monotype(cx, variant.node.id);
-                let arg_tys: [t] = ~[];
+                let arg_tys: [t] = [];
                 if std::vec::len(variant.node.args) > 0u {
                     for a: arg in ty_fn_args(cx, ctor_ty) {
-                        arg_tys += ~[a.ty];
+                        arg_tys += [a.ty];
                     }
                 }
                 let did = variant.node.id;
                 result +=
-                    ~[{args: arg_tys,
-                       ctor_ty: ctor_ty,
-                       id: ast::local_def(did)}];
+                    [{args: arg_tys,
+                      ctor_ty: ctor_ty,
+                      id: ast::local_def(did)}];
             }
             ret result;
           }
@@ -2731,7 +2726,7 @@ fn tag_variant_with_id(cx: &ctxt, tag_id: &ast::def_id,
     let variants = tag_variants(cx, tag_id);
     let i = 0u;
     while i < vec::len::<variant_info>(variants) {
-        let variant = variants.(i);
+        let variant = variants[i];
         if def_eq(variant.id, variant_id) { ret variant; }
         i += 1u;
     }
@@ -2841,7 +2836,7 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool {
           ty_rec(_) { tycat_struct }
           ty_tup(_) { tycat_struct }
           ty_tag(_, _) { tycat_struct }
-          ty_bot.    { tycat_bot }
+          ty_bot. { tycat_bot }
           _ { tycat_other }
         }
     }
@@ -2852,24 +2847,20 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool {
     /*.          add,     shift,   bit
       .             sub,     rel,     logic
       .                mult,    eq,         */
-    let  /*other*/
-         /*bool*/
-         /*int*/
-         /*float*/
-         /*str*/
-         /*vec*/
-         /*bot*/
-        tbl =
-        ~[~[f, f, f, f, t, t, f, f],
-          ~[f, f, f, f, t, t, t, t],
-          ~[t, t, t, t, t, t, t, f],
-          ~[t, t, t, f, t, t, f, f],
-          ~[t, f, f, f, t, t, f, f],
-          ~[t, f, f, f, t, t, f, f],
-          ~[f, f, f, f, t, t, f, f],
-          ~[t, t, t, t, t, t, t, t]]; /*struct*/
-
-    ret tbl.(tycat(cx, ty)).(opcat(op));
+     /*other*/
+     /*bool*/
+     /*int*/
+     /*float*/
+     /*str*/
+     /*vec*/
+     /*bot*/
+    let tbl =
+        [[f, f, f, f, t, t, f, f], [f, f, f, f, t, t, t, t],
+         [t, t, t, t, t, t, t, f], [t, t, t, f, t, t, f, f],
+         [t, f, f, f, t, t, f, f], [t, f, f, f, t, t, f, f],
+         [f, f, f, f, t, t, f, f], [t, t, t, t, t, t, t, t]]; /*struct*/
+
+    ret tbl[tycat(cx, ty)][opcat(op)];
 }
 
 fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) ->
@@ -2880,10 +2871,10 @@ fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) ->
                     {path: c.node.path, args: c.node.args, id: pred_id});
       }
       _ {
-        tcx.sess.span_fatal
-            (c.span, "Predicate " + path_to_str(c.node.path) +
-             " is unbound or bound to a non-function or an \
-              impure function");
+        tcx.sess.span_fatal(c.span,
+                            "Predicate " + path_to_str(c.node.path) +
+                            " is unbound or bound to a non-function or an \
+                             impure function");
       }
     }
 }
diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs
index 7d6ba76e7eb..9e9d0682249 100644
--- a/src/comp/middle/typeck.rs
+++ b/src/comp/middle/typeck.rs
@@ -53,8 +53,10 @@ type ty_table = hashmap<ast::def_id, ty::t>;
 
 // Used for typechecking the methods of an object.
 tag obj_info {
+
     // Regular objects have a node_id at compile time.
     regular_obj([ast::obj_field], ast::node_id);
+
     // Anonymous objects only have a type at compile time.  It's optional
     // because not all anonymous objects have a inner_obj to attach to.
     anon_obj([ast::obj_field], option::t<ty::sty>);
@@ -78,14 +80,14 @@ type fn_ctxt =
 
 
 // Used for ast_ty_to_ty() below.
-type ty_getter = fn(&ast::def_id) -> ty::ty_param_kinds_and_ty ;
+type ty_getter = fn(&ast::def_id) -> ty::ty_param_kinds_and_ty;
 
 fn lookup_local(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> int {
     alt fcx.locals.find(id) {
       some(x) { x }
       _ {
-        fcx.ccx.tcx.sess.span_fatal
-            (sp, "internal error looking up a local var")
+        fcx.ccx.tcx.sess.span_fatal(sp,
+                                    "internal error looking up a local var")
       }
     }
 }
@@ -94,23 +96,23 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def {
     alt fcx.ccx.tcx.def_map.find(id) {
       some(x) { x }
       _ {
-        fcx.ccx.tcx.sess.span_fatal
-            (sp, "internal error looking up a definition")
+        fcx.ccx.tcx.sess.span_fatal(sp,
+                                    "internal error looking up a definition")
       }
     }
 }
 
 fn ident_for_local(loc: &@ast::local) -> ast::ident {
     ret alt loc.node.pat.node {
-      ast::pat_bind(name) { name }
-      _ { "local" } // FIXME DESTR
-    };
+          ast::pat_bind(name) { name }
+          _ { "local" }
+        }; // FIXME DESTR
 }
 
 // Returns the type parameter count and the type for the given definition.
 fn ty_param_kinds_and_ty_for_def(fcx: &@fn_ctxt, sp: &span, defn: &ast::def)
    -> ty_param_kinds_and_ty {
-    let no_kinds: [ast::kind] = ~[];
+    let no_kinds: [ast::kind] = [];
     alt defn {
       ast::def_arg(id) {
 
@@ -168,22 +170,25 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path,
     if ty_substs_len > 0u {
         let param_var_len = vec::len(ty_param_vars);
         if param_var_len == 0u {
-            fcx.ccx.tcx.sess.span_fatal
-                (sp, "this item does not take type parameters");
-        } else if (ty_substs_len > param_var_len) {
-            fcx.ccx.tcx.sess.span_fatal
-                (sp, "too many type parameter provided for this item");
-        } else if (ty_substs_len < param_var_len) {
-            fcx.ccx.tcx.sess.span_fatal
-                (sp, "not enough type parameters provided for this item");
-        }
-        let ty_substs: [ty::t] = ~[];
+            fcx.ccx.tcx.sess.span_fatal(
+                sp,
+                "this item does not take type parameters");
+        } else if ty_substs_len > param_var_len {
+            fcx.ccx.tcx.sess.span_fatal(
+                sp,
+                "too many type parameter provided for this item");
+        } else if ty_substs_len < param_var_len {
+            fcx.ccx.tcx.sess.span_fatal(
+                sp,
+                "not enough type parameters provided for this item");
+        }
+        let ty_substs: [ty::t] = [];
         let i = 0u;
         while i < ty_substs_len {
-            let ty_var = ty::mk_var(fcx.ccx.tcx, ty_param_vars.(i));
-            let ty_subst = ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i));
+            let ty_var = ty::mk_var(fcx.ccx.tcx, ty_param_vars[i]);
+            let ty_subst = ast_ty_to_ty_crate(fcx.ccx, pth.node.types[i]);
             let res_ty = demand::simple(fcx, pth.span, ty_var, ty_subst);
-            ty_substs += ~[res_ty];
+            ty_substs += [res_ty];
             i += 1u;
         }
         ty_substs_opt = some::<[ty::t]>(ty_substs);
@@ -194,10 +199,10 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path,
         }
     } else {
         // We will acquire the type parameters through unification.
-        let ty_substs: [ty::t] = ~[];
+        let ty_substs: [ty::t] = [];
         let i = 0u;
         while i < ty_param_count {
-            ty_substs += ~[ty::mk_var(fcx.ccx.tcx, ty_param_vars.(i))];
+            ty_substs += [ty::mk_var(fcx.ccx.tcx, ty_param_vars[i])];
             i += 1u;
         }
         ty_substs_opt = some::<[ty::t]>(ty_substs);
@@ -215,13 +220,13 @@ fn ast_mode_to_mode(mode: ast::mode) -> ty::mode {
 
 
 // Type tests
-fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) ->
-   ty::t {
+fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) -> ty::t {
     alt ty::unify::resolve_type_structure(fcx.ccx.tcx, fcx.var_bindings, tp) {
       fix_ok(typ_s) { ret typ_s; }
       fix_err(_) {
-        fcx.ccx.tcx.sess.span_fatal
-            (sp, "the type of this value must be known in this context");
+        fcx.ccx.tcx.sess.span_fatal(
+            sp,
+            "the type of this value must be known in this context");
       }
     }
 }
@@ -293,12 +298,11 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         // The typedef is type-parametric. Do the type substitution.
         //
 
-        let param_bindings: [ty::t] = ~[];
+        let param_bindings: [ty::t] = [];
         for ast_ty: @ast::ty in args {
-            param_bindings += ~[ast_ty_to_ty(tcx, getter, ast_ty)];
+            param_bindings += [ast_ty_to_ty(tcx, getter, ast_ty)];
         }
-        if vec::len(param_bindings) !=
-            vec::len(ty_param_kinds_and_ty.kinds) {
+        if vec::len(param_bindings) != vec::len(ty_param_kinds_and_ty.kinds) {
             tcx.sess.span_fatal(sp,
                                 "Wrong number of type arguments for a \
                                  polymorphic type");
@@ -335,23 +339,23 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         typ = ty::mk_tup(tcx, flds);
       }
       ast::ty_rec(fields) {
-        let flds: [field] = ~[];
+        let flds: [field] = [];
         for f: ast::ty_field in fields {
             let tm = ast_mt_to_mt(tcx, getter, f.node.mt);
-            flds += ~[{ident: f.node.ident, mt: tm}];
+            flds += [{ident: f.node.ident, mt: tm}];
         }
         typ = ty::mk_rec(tcx, flds);
       }
       ast::ty_fn(proto, inputs, output, cf, constrs) {
-        let i = ~[];
+        let i = [];
         for ta: ast::ty_arg in inputs {
-            i += ~[ast_arg_to_arg(tcx, getter, ta)];
+            i += [ast_arg_to_arg(tcx, getter, ta)];
         }
         let out_ty = ast_ty_to_ty(tcx, getter, output);
 
-        let out_constrs = ~[];
+        let out_constrs = [];
         for constr: @ast::constr in constrs {
-            out_constrs += ~[ty::ast_constr_to_constr(tcx, constr)];
+            out_constrs += [ty::ast_constr_to_constr(tcx, constr)];
         }
         typ = ty::mk_fn(tcx, proto, i, out_ty, cf, out_constrs);
       }
@@ -361,7 +365,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
             typ = instantiate(tcx, ast_ty.span, getter, id, path.node.types);
           }
           some(ast::def_native_ty(id)) { typ = getter(id).ty; }
-          some(ast::def_ty_arg(id,k)) { typ = ty::mk_param(tcx, id, k); }
+          some(ast::def_ty_arg(id, k)) { typ = ty::mk_param(tcx, id, k); }
           some(_) {
             tcx.sess.span_fatal(ast_ty.span,
                                 "found type name used as a variable");
@@ -373,17 +377,17 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         cname = some(path_to_str(path));
       }
       ast::ty_obj(meths) {
-        let tmeths: [ty::method] = ~[];
+        let tmeths: [ty::method] = [];
         for m: ast::ty_method in meths {
-            let ins = ~[];
+            let ins = [];
             for ta: ast::ty_arg in m.node.inputs {
-                ins += ~[ast_arg_to_arg(tcx, getter, ta)];
+                ins += [ast_arg_to_arg(tcx, getter, ta)];
             }
             let out = ast_ty_to_ty(tcx, getter, m.node.output);
 
-            let out_constrs = ~[];
+            let out_constrs = [];
             for constr: @ast::constr in m.node.constrs {
-                out_constrs += ~[ty::ast_constr_to_constr(tcx, constr)];
+                out_constrs += [ty::ast_constr_to_constr(tcx, constr)];
             }
             let new_m: ty::method =
                 {proto: m.node.proto,
@@ -392,20 +396,19 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
                  output: out,
                  cf: m.node.cf,
                  constrs: out_constrs};
-            tmeths += ~[new_m];
+            tmeths += [new_m];
         }
         typ = ty::mk_obj(tcx, ty::sort_methods(tmeths));
       }
       ast::ty_constr(t, cs) {
-        let out_cs = ~[];
+        let out_cs = [];
         for constr: @ast::ty_constr in cs {
-            out_cs += ~[ty::ast_constr_to_constr(tcx, constr)];
+            out_cs += [ty::ast_constr_to_constr(tcx, constr)];
         }
         typ = ty::mk_constr(tcx, ast_ty_to_ty(tcx, getter, t), out_cs);
       }
       ast::ty_infer. {
-        tcx.sess.span_bug(ast_ty.span,
-                          "found ty_infer in unexpected place");
+        tcx.sess.span_bug(ast_ty.span, "found ty_infer in unexpected place");
       }
     }
     alt cname {
@@ -429,8 +432,8 @@ fn ast_ty_to_ty_crate(ccx: @crate_ctxt, ast_ty: &@ast::ty) -> ty::t {
 }
 
 // A wrapper around ast_ty_to_ty_crate that handles ty_infer.
-fn ast_ty_to_ty_crate_infer(ccx: @crate_ctxt, ast_ty: &@ast::ty)
-    -> option::t<ty::t> {
+fn ast_ty_to_ty_crate_infer(ccx: @crate_ctxt, ast_ty: &@ast::ty) ->
+   option::t<ty::t> {
     alt ast_ty.node {
       ast::ty_infer. { none }
       _ { some(ast_ty_to_ty_crate(ccx, ast_ty)) }
@@ -467,7 +470,7 @@ mod write {
                 tpot: &ty_param_substs_opt_and_ty) {
         inner(fcx.ccx.tcx.node_types, node_id, tpot);
         if ty::type_contains_vars(fcx.ccx.tcx, tpot.ty) {
-            fcx.fixups += ~[node_id];
+            fcx.fixups += [node_id];
         }
     }
 
@@ -521,35 +524,33 @@ mod collect {
     type ctxt = {tcx: ty::ctxt};
 
     fn mk_ty_params(cx: &@ctxt, atps: &[ast::ty_param]) -> [ty::t] {
-        let tps = ~[];
+        let tps = [];
         let i = 0u;
         for atp: ast::ty_param in atps {
-            tps += ~[ty::mk_param(cx.tcx, i, atp.kind)];
+            tps += [ty::mk_param(cx.tcx, i, atp.kind)];
             i += 1u;
         }
         ret tps;
     }
 
     fn ty_param_kinds(tps: &[ast::ty_param]) -> [ast::kind] {
-        let k: [ast::kind] = ~[];
-        for p: ast::ty_param in tps {
-            k += ~[p.kind]
-        }
+        let k: [ast::kind] = [];
+        for p: ast::ty_param in tps { k += [p.kind] }
         ret k;
     }
 
-    fn ty_of_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t ,
-                     ty_of_arg: &fn(&ast::arg) -> arg , decl: &ast::fn_decl,
+    fn ty_of_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t,
+                     ty_of_arg: &fn(&ast::arg) -> arg, decl: &ast::fn_decl,
                      proto: ast::proto, ty_params: &[ast::ty_param],
                      def_id: &option::t<ast::def_id>) ->
        ty::ty_param_kinds_and_ty {
-        let input_tys = ~[];
-        for a: ast::arg in decl.inputs { input_tys += ~[ty_of_arg(a)]; }
+        let input_tys = [];
+        for a: ast::arg in decl.inputs { input_tys += [ty_of_arg(a)]; }
         let output_ty = convert(decl.output);
 
-        let out_constrs = ~[];
+        let out_constrs = [];
         for constr: @ast::constr in decl.constraints {
-            out_constrs += ~[ty::ast_constr_to_constr(cx.tcx, constr)];
+            out_constrs += [ty::ast_constr_to_constr(cx.tcx, constr)];
         }
         let t_fn =
             ty::mk_fn(cx.tcx, proto_to_ty_proto(proto), input_tys, output_ty,
@@ -558,13 +559,13 @@ mod collect {
         alt def_id { some(did) { cx.tcx.tcache.insert(did, tpt); } _ { } }
         ret tpt;
     }
-    fn ty_of_native_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t ,
-                            ty_of_arg: &fn(&ast::arg) -> arg ,
+    fn ty_of_native_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t,
+                            ty_of_arg: &fn(&ast::arg) -> arg,
                             decl: &ast::fn_decl, abi: ast::native_abi,
                             ty_params: &[ast::ty_param], def_id: &ast::def_id)
        -> ty::ty_param_kinds_and_ty {
-        let input_tys = ~[];
-        for a: ast::arg in decl.inputs { input_tys += ~[ty_of_arg(a)]; }
+        let input_tys = [];
+        for a: ast::arg in decl.inputs { input_tys += [ty_of_arg(a)]; }
         let output_ty = convert(decl.output);
 
         let t_fn = ty::mk_native_fn(cx.tcx, abi, input_tys, output_ty);
@@ -608,16 +609,16 @@ mod collect {
         let get = bind getter(cx, _);
         let convert = bind ast_ty_to_ty(cx.tcx, get, _);
 
-        let inputs = ~[];
+        let inputs = [];
         for a: ast::arg in m.node.meth.decl.inputs {
-            inputs += ~[ty_of_arg(cx, a)];
+            inputs += [ty_of_arg(cx, a)];
         }
 
         let output = convert(m.node.meth.decl.output);
 
-        let out_constrs = ~[];
+        let out_constrs = [];
         for constr: @ast::constr in m.node.meth.decl.constraints {
-            out_constrs += ~[ty::ast_constr_to_constr(cx.tcx, constr)];
+            out_constrs += [ty::ast_constr_to_constr(cx.tcx, constr)];
         }
         ret {proto: proto_to_ty_proto(m.node.meth.proto),
              ident: m.node.ident,
@@ -638,16 +639,16 @@ mod collect {
        ty::ty_param_kinds_and_ty {
         let t_obj = ty_of_obj(cx, id, ob, ty_params);
 
-        let t_inputs: [arg] = ~[];
+        let t_inputs: [arg] = [];
         for f: ast::obj_field in ob.fields {
             let g = bind getter(cx, _);
             let t_field = ast_ty_to_ty(cx.tcx, g, f.ty);
-            t_inputs += ~[{mode: ty::mo_alias(false), ty: t_field}];
+            t_inputs += [{mode: ty::mo_alias(false), ty: t_field}];
         }
 
         let t_fn =
             ty::mk_fn(cx.tcx, ast::proto_fn, t_inputs, t_obj.ty, ast::return,
-                      ~[]);
+                      []);
         let tpt = {kinds: ty_param_kinds(ty_params), ty: t_fn};
         cx.tcx.tcache.insert(local_def(ctor_id), tpt);
         ret tpt;
@@ -655,7 +656,7 @@ mod collect {
     fn ty_of_item(cx: &@ctxt, it: &@ast::item) -> ty::ty_param_kinds_and_ty {
         let get = bind getter(cx, _);
         let convert = bind ast_ty_to_ty(cx.tcx, get, _);
-        let no_kinds: [ast::kind] = ~[];
+        let no_kinds: [ast::kind] = [];
         alt it.node {
           ast::item_const(t, _) {
             let typ = convert(t);
@@ -687,7 +688,7 @@ mod collect {
             ret tpt;
           }
           ast::item_res(f, _, tps, _) {
-            let t_arg = ty_of_arg(cx, f.decl.inputs.(0));
+            let t_arg = ty_of_arg(cx, f.decl.inputs[0]);
             let t_res =
                 {kinds: ty_param_kinds(tps),
                  ty:
@@ -710,7 +711,7 @@ mod collect {
     }
     fn ty_of_native_item(cx: &@ctxt, it: &@ast::native_item,
                          abi: ast::native_abi) -> ty::ty_param_kinds_and_ty {
-        let no_kinds: [ast::kind] = ~[];
+        let no_kinds: [ast::kind] = [];
         alt it.node {
           ast::native_item_fn(_, fn_decl, params) {
             let get = bind getter(cx, _);
@@ -749,16 +750,16 @@ mod collect {
                 // should be called to resolve named types.
 
                 let f = bind getter(cx, _);
-                let args: [arg] = ~[];
+                let args: [arg] = [];
                 for va: ast::variant_arg in variant.node.args {
                     let arg_ty = ast_ty_to_ty(cx.tcx, f, va.ty);
-                    args += ~[{mode: ty::mo_alias(false), ty: arg_ty}];
+                    args += [{mode: ty::mo_alias(false), ty: arg_ty}];
                 }
                 let tag_t = ty::mk_tag(cx.tcx, tag_id, ty_param_tys);
                 // FIXME: this will be different for constrained types
                 result_ty =
                     ty::mk_fn(cx.tcx, ast::proto_fn, args, tag_t, ast::return,
-                              ~[]);
+                              []);
             }
             let tpt = {kinds: ty_param_kinds(ty_params), ty: result_ty};
             cx.tcx.tcache.insert(local_def(variant.node.id), tpt);
@@ -766,9 +767,9 @@ mod collect {
         }
     }
     fn get_obj_method_types(cx: &@ctxt, object: &ast::_obj) -> [ty::method] {
-        let meths = ~[];
+        let meths = [];
         for m: @ast::method in object.methods {
-            meths += ~[ty_of_method(cx, m)];
+            meths += [ty_of_method(cx, m)];
         }
         ret meths;
     }
@@ -793,8 +794,8 @@ mod collect {
             // we write into the table for this item.
             ty_of_item(cx, it);
 
-            let tpt = ty_of_obj_ctor(cx, it.ident, object,
-                                     ctor_id, ty_params);
+            let tpt =
+                ty_of_obj_ctor(cx, it.ident, object, ctor_id, ty_params);
             write::ty_only(cx.tcx, ctor_id, tpt.ty);
             // Write the methods into the type table.
             //
@@ -804,9 +805,9 @@ mod collect {
             let method_types = get_obj_method_types(cx, object);
             let i = 0u;
             while i < vec::len::<@ast::method>(object.methods) {
-                write::ty_only(cx.tcx, object.methods.(i).node.id,
+                write::ty_only(cx.tcx, object.methods[i].node.id,
                                ty::method_ty_to_fn_ty(cx.tcx,
-                                                      method_types.(i)));
+                                                      method_types[i]));
                 i += 1u;
             }
             // Write in the types of the object fields.
@@ -816,22 +817,22 @@ mod collect {
             let args = ty::ty_fn_args(cx.tcx, tpt.ty);
             i = 0u;
             while i < vec::len::<ty::arg>(args) {
-                let fld = object.fields.(i);
-                write::ty_only(cx.tcx, fld.id, args.(i).ty);
+                let fld = object.fields[i];
+                write::ty_only(cx.tcx, fld.id, args[i].ty);
                 i += 1u;
             }
           }
           ast::item_res(f, dtor_id, tps, ctor_id) {
-            let t_arg = ty_of_arg(cx, f.decl.inputs.(0));
+            let t_arg = ty_of_arg(cx, f.decl.inputs[0]);
             let t_res =
                 ty::mk_res(cx.tcx, local_def(it.id), t_arg.ty,
                            mk_ty_params(cx, tps));
             let t_ctor =
-                ty::mk_fn(cx.tcx, ast::proto_fn, ~[t_arg], t_res, ast::return,
-                          ~[]);
+                ty::mk_fn(cx.tcx, ast::proto_fn, [t_arg], t_res, ast::return,
+                          []);
             let t_dtor =
-                ty::mk_fn(cx.tcx, ast::proto_fn, ~[t_arg], ty::mk_nil(cx.tcx),
-                          ast::return, ~[]);
+                ty::mk_fn(cx.tcx, ast::proto_fn, [t_arg], ty::mk_nil(cx.tcx),
+                          ast::return, []);
             write::ty_only(cx.tcx, it.id, t_res);
             write::ty_only(cx.tcx, ctor_id, t_ctor);
             cx.tcx.tcache.insert(local_def(ctor_id),
@@ -869,10 +870,12 @@ mod collect {
         // contained within the native module.
         let abi = @mutable none::<ast::native_abi>;
         let cx = @{tcx: tcx};
-        let visit = visit::mk_simple_visitor
-            (@{visit_item: bind convert(cx, abi, _),
-               visit_native_item: bind convert_native(cx, abi, _)
-               with *visit::default_simple_visitor()});
+        let visit =
+            visit::mk_simple_visitor(@{visit_item: bind convert(cx, abi, _),
+                                       visit_native_item:
+                                       bind convert_native(cx, abi, _)
+                                           with
+                                           *visit::default_simple_visitor()});
         visit::visit_crate(*crate, (), visit);
     }
 }
@@ -901,7 +904,7 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t {
                     break;
                 }
               }
-              _ {}
+              _ { }
             }
             t1 = inner.ty;
           }
@@ -910,13 +913,12 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t {
           }
           ty::ty_tag(did, tps) {
             let variants = ty::tag_variants(fcx.ccx.tcx, did);
-            if vec::len(variants) != 1u || vec::len(variants.(0).args) != 1u
-               {
+            if vec::len(variants) != 1u || vec::len(variants[0].args) != 1u {
                 ret t1;
             }
             t1 =
                 ty::substitute_type_params(fcx.ccx.tcx, tps,
-                                           variants.(0).args.(0));
+                                           variants[0].args[0]);
           }
           _ { ret t1; }
         }
@@ -926,6 +928,7 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t {
 
 fn do_fn_block_coerce(fcx: &@fn_ctxt, sp: &span, actual: &ty::t,
                       expected: &ty::t) -> ty::t {
+
     // fns can be silently coerced to blocks when being used as
     // function call or bind arguments, but not the reverse.
     // If our actual type is a fn and our expected type is a block,
@@ -962,16 +965,16 @@ type ty_param_substs_and_ty = {substs: [ty::t], ty: ty::t};
 mod demand {
     fn simple(fcx: &@fn_ctxt, sp: &span, expected: &ty::t, actual: &ty::t) ->
        ty::t {
-        full(fcx, sp, expected, actual, ~[], false).ty
+        full(fcx, sp, expected, actual, [], false).ty
     }
-    fn block_coerce(fcx: &@fn_ctxt, sp: &span,
-                    expected: &ty::t, actual: &ty::t) -> ty::t {
-        full(fcx, sp, expected, actual, ~[], true).ty
+    fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: &ty::t,
+                    actual: &ty::t) -> ty::t {
+        full(fcx, sp, expected, actual, [], true).ty
     }
 
     fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: &ty::t,
                    actual: &ty::t, ty_param_substs_0: &[ty::t]) ->
-        ty_param_substs_and_ty {
+       ty_param_substs_and_ty {
         full(fcx, sp, expected, actual, ty_param_substs_0, false)
     }
 
@@ -984,33 +987,31 @@ mod demand {
             actual = do_fn_block_coerce(fcx, sp, actual, expected);
         }
 
-        let ty_param_substs: [mutable ty::t] = ~[mutable];
-        let ty_param_subst_var_ids: [int] = ~[];
+        let ty_param_substs: [mutable ty::t] = [mutable];
+        let ty_param_subst_var_ids: [int] = [];
         for ty_param_subst: ty::t in ty_param_substs_0 {
             // Generate a type variable and unify it with the type parameter
             // substitution. We will then pull out these type variables.
             let t_0 = next_ty_var(fcx);
-            ty_param_substs += ~[mutable t_0];
-            ty_param_subst_var_ids += ~[ty::ty_var_id(fcx.ccx.tcx, t_0)];
+            ty_param_substs += [mutable t_0];
+            ty_param_subst_var_ids += [ty::ty_var_id(fcx.ccx.tcx, t_0)];
             simple(fcx, sp, ty_param_subst, t_0);
         }
 
         fn mk_result(fcx: &@fn_ctxt, result_ty: &ty::t,
                      ty_param_subst_var_ids: &[int]) ->
            ty_param_substs_and_ty {
-            let result_ty_param_substs: [ty::t] = ~[];
+            let result_ty_param_substs: [ty::t] = [];
             for var_id: int in ty_param_subst_var_ids {
                 let tp_subst = ty::mk_var(fcx.ccx.tcx, var_id);
-                result_ty_param_substs += ~[tp_subst];
+                result_ty_param_substs += [tp_subst];
             }
             ret {substs: result_ty_param_substs, ty: result_ty};
         }
 
 
         alt unify::unify(fcx, expected, actual) {
-          ures_ok(t) {
-            ret mk_result(fcx, t, ty_param_subst_var_ids);
-          }
+          ures_ok(t) { ret mk_result(fcx, t, ty_param_subst_var_ids); }
           ures_err(err) {
             let e_err = resolve_type_vars_if_possible(fcx, expected);
             let a_err = resolve_type_vars_if_possible(fcx, actual);
@@ -1039,7 +1040,7 @@ fn are_compatible(fcx: &@fn_ctxt, expected: &ty::t, actual: &ty::t) -> bool {
 // Returns the types of the arguments to a tag variant.
 fn variant_arg_types(ccx: &@crate_ctxt, _sp: &span, vid: &ast::def_id,
                      tag_ty_params: &[ty::t]) -> [ty::t] {
-    let result: [ty::t] = ~[];
+    let result: [ty::t] = [];
     let tpt = ty::lookup_item_type(ccx.tcx, vid);
     alt ty::struct(ccx.tcx, tpt.ty) {
       ty::ty_fn(_, ins, _, _, _) {
@@ -1049,7 +1050,7 @@ fn variant_arg_types(ccx: &@crate_ctxt, _sp: &span, vid: &ast::def_id,
         for arg: ty::arg in ins {
             let arg_ty =
                 ty::substitute_type_params(ccx.tcx, tag_ty_params, arg.ty);
-            result += ~[arg_ty];
+            result += [arg_ty];
         }
       }
       _ {
@@ -1077,8 +1078,8 @@ mod writeback {
     fn resolve_type_vars_in_type(fcx: &@fn_ctxt, sp: &span, typ: ty::t) ->
        option::t<ty::t> {
         if !ty::type_contains_vars(fcx.ccx.tcx, typ) { ret some(typ); }
-        alt ty::unify::fixup_vars(fcx.ccx.tcx, some(sp),
-                                  fcx.var_bindings, typ) {
+        alt ty::unify::fixup_vars(fcx.ccx.tcx, some(sp), fcx.var_bindings,
+                                  typ) {
           fix_ok(new_type) { ret some(new_type); }
           fix_err(vid) {
             fcx.ccx.tcx.sess.span_err(sp,
@@ -1101,10 +1102,10 @@ mod writeback {
         alt tpot.substs {
           none::<[ty::t]>. { new_substs_opt = none::<[ty::t]>; }
           some::<[ty::t]>(substs) {
-            let new_substs: [ty::t] = ~[];
+            let new_substs: [ty::t] = [];
             for subst: ty::t in substs {
                 alt resolve_type_vars_in_type(fcx, sp, subst) {
-                  some(t) { new_substs += ~[t]; }
+                  some(t) { new_substs += [t]; }
                   none. { wbcx.success = false; ret; }
                 }
             }
@@ -1163,28 +1164,28 @@ mod writeback {
 
     fn resolve_type_vars_in_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool {
         let wbcx = {fcx: fcx, mutable success: true};
-        let visit = visit::mk_vt
-            (@{visit_item: visit_item,
-               visit_stmt: visit_stmt,
-               visit_expr: visit_expr,
-               visit_block: visit_block,
-               visit_pat: visit_pat,
-               visit_local: visit_local
-               with *visit::default_visitor()});
+        let visit =
+            visit::mk_vt(@{visit_item: visit_item,
+                           visit_stmt: visit_stmt,
+                           visit_expr: visit_expr,
+                           visit_block: visit_block,
+                           visit_pat: visit_pat,
+                           visit_local: visit_local
+                              with *visit::default_visitor()});
         visit::visit_expr(e, wbcx, visit);
         ret wbcx.success;
     }
 
     fn resolve_type_vars_in_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool {
         let wbcx = {fcx: fcx, mutable success: true};
-        let visit = visit::mk_vt
-            (@{visit_item: visit_item,
-               visit_stmt: visit_stmt,
-               visit_expr: visit_expr,
-               visit_block: visit_block,
-               visit_pat: visit_pat,
-               visit_local: visit_local
-               with *visit::default_visitor()});
+        let visit =
+            visit::mk_vt(@{visit_item: visit_item,
+                           visit_stmt: visit_stmt,
+                           visit_expr: visit_expr,
+                           visit_block: visit_block,
+                           visit_pat: visit_pat,
+                           visit_local: visit_local
+                              with *visit::default_visitor()});
         visit::visit_block(blk, wbcx, visit);
         ret wbcx.success;
     }
@@ -1202,42 +1203,40 @@ type gather_result =
 // Used only as a helper for check_fn.
 fn gather_locals(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
                  old_fcx: &option::t<@fn_ctxt>) -> gather_result {
-    let {vb, locals, local_names, nvi} = alt old_fcx {
-      none. {
-        { vb: ty::unify::mk_var_bindings(),
-          locals: new_int_hash::<int>(),
-          local_names: new_int_hash::<ast::ident>(),
-          nvi: @mutable 0 }
-      }
-      some(fcx) {
-        { vb: fcx.var_bindings,
-          locals: fcx.locals,
-          local_names: fcx.local_names,
-          nvi: fcx.next_var_id }
-      }
-    };
+    let {vb: vb, locals: locals, local_names: local_names, nvi: nvi} =
+        alt old_fcx {
+          none. {
+            {vb: ty::unify::mk_var_bindings(),
+             locals: new_int_hash::<int>(),
+             local_names: new_int_hash::<ast::ident>(),
+             nvi: @mutable 0}
+          }
+          some(fcx) {
+            {vb: fcx.var_bindings,
+             locals: fcx.locals,
+             local_names: fcx.local_names,
+             nvi: fcx.next_var_id}
+          }
+        };
     let tcx = ccx.tcx;
 
-    let next_var_id = lambda() -> int {
-        let rv = *nvi;
-        *nvi += 1;
-        ret rv;
-    };
-    let assign = lambda(nid: ast::node_id, ident: &ast::ident,
-                        ty_opt: option::t<ty::t>) {
-        let var_id = next_var_id();
-        locals.insert(nid, var_id);
-        local_names.insert(nid, ident);
-        alt ty_opt {
-          none. {/* nothing to do */ }
-          some(typ) {
-            ty::unify::unify(ty::mk_var(tcx, var_id), typ, vb, tcx);
-          }
-        }
-    };
+    let next_var_id = lambda () -> int { let rv = *nvi; *nvi += 1; ret rv; };
+    let assign =
+        lambda (nid: ast::node_id, ident: &ast::ident,
+                ty_opt: option::t<ty::t>) {
+            let var_id = next_var_id();
+            locals.insert(nid, var_id);
+            local_names.insert(nid, ident);
+            alt ty_opt {
+              none. {/* nothing to do */ }
+              some(typ) {
+                ty::unify::unify(ty::mk_var(tcx, var_id), typ, vb, tcx);
+              }
+            }
+        };
 
     // Add object fields, if any.
-    let obj_fields = ~[];
+    let obj_fields = [];
     alt get_obj_info(ccx) {
       some(oinfo) {
         alt oinfo {
@@ -1256,32 +1255,33 @@ fn gather_locals(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
     let args = ty::ty_fn_args(ccx.tcx, ty::node_id_to_type(ccx.tcx, id));
     let i = 0u;
     for arg: ty::arg in args {
-        assign(f.decl.inputs.(i).id, f.decl.inputs.(i).ident, some(arg.ty));
+        assign(f.decl.inputs[i].id, f.decl.inputs[i].ident, some(arg.ty));
         i += 1u;
     }
 
     // Add explicitly-declared locals.
-    let visit_local = lambda(local: &@ast::local, e: &(), v: &visit::vt<()>) {
-        let local_ty = ast_ty_to_ty_crate_infer(ccx, local.node.ty);
-        assign(local.node.id, ident_for_local(local), local_ty);
-        visit::visit_local(local, e, v);
-    };
+    let visit_local =
+        lambda (local: &@ast::local, e: &(), v: &visit::vt<()>) {
+            let local_ty = ast_ty_to_ty_crate_infer(ccx, local.node.ty);
+            assign(local.node.id, ident_for_local(local), local_ty);
+            visit::visit_local(local, e, v);
+        };
 
     // Add pattern bindings.
-    let visit_pat = lambda(p: &@ast::pat, e: &(), v: &visit::vt<()>) {
-        alt p.node {
-          ast::pat_bind(ident) {
-            assign(p.id, ident, none);
-          }
-          _ {/* no-op */ }
-        }
-        visit::visit_pat(p, e, v);
-    };
+    let visit_pat =
+        lambda (p: &@ast::pat, e: &(), v: &visit::vt<()>) {
+            alt p.node {
+              ast::pat_bind(ident) { assign(p.id, ident, none); }
+              _ {/* no-op */ }
+            }
+            visit::visit_pat(p, e, v);
+        };
 
     // Don't descend into fns and items
     fn visit_fn<E>(_f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span,
                    _i: &ast::fn_ident, _id: ast::node_id, _e: &E,
-                   _v: &visit::vt<E>) { }
+                   _v: &visit::vt<E>) {
+    }
     fn visit_item<E>(_i: &@ast::item, _e: &E, _v: &visit::vt<E>) { }
 
     let visit =
@@ -1371,11 +1371,11 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
                     // TODO (issue #448): Wrap a #fmt string over multiple
                     // lines...
                     let s =
-                        #fmt("this pattern has %u field%s, but the \
+                        #fmt["this pattern has %u field%s, but the \
                                        corresponding variant has %u field%s",
                              subpats_len,
                              if subpats_len == 1u { "" } else { "s" },
-                             arg_len, if arg_len == 1u { "" } else { "s" });
+                             arg_len, if arg_len == 1u { "" } else { "s" }];
                     fcx.ccx.tcx.sess.span_fatal(pat.span, s);
                 }
 
@@ -1383,18 +1383,20 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
 
                 let i = 0u;
                 for subpat: @ast::pat in subpats {
-                    check_pat(fcx, map, subpat, arg_types.(i));
+                    check_pat(fcx, map, subpat, arg_types[i]);
                     i += 1u;
                 }
-            } else if (subpats_len > 0u) {
+            } else if subpats_len > 0u {
                 // TODO: note definition of tag variant
-                fcx.ccx.tcx.sess.span_fatal
-                    (pat.span, #fmt("this pattern has %u field%s, \
-                                     but the corresponding \
-                                     variant has no fields",
-                                    subpats_len,
-                                    if subpats_len == 1u { "" }
-                                    else { "s" }));
+                fcx.ccx.tcx.sess.span_fatal(
+                    pat.span,
+                    #fmt["this pattern has %u field%s, \
+                          but the corresponding \
+                          variant has no fields",
+                         subpats_len,
+                         if subpats_len == 1u {
+                             ""
+                         } else { "s" }]);
             }
             write::ty_fixup(fcx, pat.id, path_tpot);
           }
@@ -1402,10 +1404,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
             // FIXME: Switch expected and actual in this message? I
             // can never tell.
             fcx.ccx.tcx.sess.span_fatal(pat.span,
-                                        #fmt("mismatched types: \
+                                        #fmt["mismatched types: \
                                                   expected %s, found tag",
                                              ty_to_str(fcx.ccx.tcx,
-                                                       expected)));
+                                                       expected)]);
           }
         }
         write::ty_fixup(fcx, pat.id, path_tpot);
@@ -1416,19 +1418,21 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
           ty::ty_rec(fields) { ex_fields = fields; }
           _ {
             fcx.ccx.tcx.sess.span_fatal(pat.span,
-                                        #fmt("mismatched types: expected %s, \
+                                        #fmt["mismatched types: expected %s, \
                                          found record",
                                              ty_to_str(fcx.ccx.tcx,
-                                                       expected)));
+                                                       expected)]);
           }
         }
         let f_count = vec::len(fields);
         let ex_f_count = vec::len(ex_fields);
         if ex_f_count < f_count || !etc && ex_f_count > f_count {
-            fcx.ccx.tcx.sess.span_fatal
-                (pat.span, #fmt("mismatched types: expected a record \
-                                 with %u fields, found one with %u \
-                                 fields", ex_f_count, f_count));
+            fcx.ccx.tcx.sess.span_fatal(
+                pat.span,
+                #fmt["mismatched types: expected a record \
+                      with %u fields, found one with %u \
+                      fields",
+                     ex_f_count, f_count]);
         }
         fn matches(name: &str, f: &ty::field) -> bool {
             ret str::eq(name, f.ident);
@@ -1438,9 +1442,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
               some(field) { check_pat(fcx, map, f.pat, field.mt.ty); }
               none. {
                 fcx.ccx.tcx.sess.span_fatal(pat.span,
-                                            #fmt("mismatched types: did not \
+                                            #fmt["mismatched types: did not \
                                              expect a record with a field %s",
-                                                 f.ident));
+                                                 f.ident]);
               }
             }
         }
@@ -1452,23 +1456,23 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat,
           ty::ty_tup(elts) { ex_elts = elts; }
           _ {
             fcx.ccx.tcx.sess.span_fatal(pat.span,
-                                        #fmt("mismatched types: expected %s, \
-                                         found tuple", ty_to_str(fcx.ccx.tcx,
-                                                                 expected)));
+                                        #fmt["mismatched types: expected %s, \
+                                         found tuple",
+                                             ty_to_str(fcx.ccx.tcx,
+                                                       expected)]);
           }
         }
         let e_count = vec::len(elts);
         if e_count != vec::len(ex_elts) {
-            fcx.ccx.tcx.sess.span_fatal
-                (pat.span, #fmt("mismatched types: expected a tuple \
-                                 with %u fields, found one with %u \
-                                 fields", vec::len(ex_elts), e_count));
+            fcx.ccx.tcx.sess.span_fatal(
+                pat.span,
+                #fmt["mismatched types: expected a tuple \
+                      with %u fields, found one with %u \
+                      fields",
+                     vec::len(ex_elts), e_count]);
         }
         let i = 0u;
-        for elt in elts {
-            check_pat(fcx, map, elt, ex_elts.(i));
-            i += 1u;
-        }
+        for elt in elts { check_pat(fcx, map, elt, ex_elts[i]); i += 1u; }
         write::ty_only_fixup(fcx, pat.id, expected);
       }
       ast::pat_box(inner) {
@@ -1506,31 +1510,31 @@ fn require_pure_call(ccx: @crate_ctxt, caller_purity: &ast::purity,
         alt ccx.tcx.def_map.find(callee.id) {
           some(ast::def_fn(_, ast::pure_fn.)) { ret; }
           _ {
-            ccx.tcx.sess.span_fatal
-                (sp, "Pure function calls function not known to be pure");
+            ccx.tcx.sess.span_fatal(
+                sp,
+                "Pure function calls function not known to be pure");
           }
         }
       }
     }
 }
 
-type unifier = fn(fcx: &@fn_ctxt, sp: &span,
-                  expected: &ty::t, actual: &ty::t) -> ty::t;
+type unifier = fn(&@fn_ctxt, &span, &ty::t, &ty::t) -> ty::t;
 
 fn check_expr(fcx: &@fn_ctxt, expr: &@ast::expr) -> bool {
-    fn dummy_unify(_fcx: &@fn_ctxt, _sp: &span,
-                   _expected: &ty::t, actual: &ty::t) -> ty::t {
+    fn dummy_unify(_fcx: &@fn_ctxt, _sp: &span, _expected: &ty::t,
+                   actual: &ty::t) -> ty::t {
         actual
     }
     ret check_expr_with_unifier(fcx, expr, dummy_unify, 0u);
 }
-fn check_expr_with(fcx: &@fn_ctxt, expr: &@ast::expr, expected: &ty::t)
-    -> bool {
+fn check_expr_with(fcx: &@fn_ctxt, expr: &@ast::expr, expected: &ty::t) ->
+   bool {
     ret check_expr_with_unifier(fcx, expr, demand::simple, expected);
 }
 
-fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
-                           unify: &unifier, expected: &ty::t) -> bool {
+fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
+                           expected: &ty::t) -> bool {
     //log_err "typechecking expr " + syntax::print::pprust::expr_to_str(expr);
 
     // A generic function to factor out common logic from call and bind
@@ -1558,48 +1562,54 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
           ty::ty_fn(ast::proto_iter., _, _, _, _) {
             if call_kind != kind_for_each {
                 fcx.ccx.tcx.sess.span_err(
-                    sp, "calling iter outside of for each loop");
+                    sp,
+                    "calling iter outside of for each loop");
             }
           }
           _ {
-              if call_kind == kind_for_each {
+            if call_kind == kind_for_each {
                 fcx.ccx.tcx.sess.span_err(
-                    sp, "calling non-iter as sequence of for each loop");
+                    sp,
+                    "calling non-iter as sequence of for each loop");
             }
           }
         }
 
         // Grab the argument types
-        let arg_tys = alt sty {
-          ty::ty_fn(_, arg_tys, _, _, _) |
-          ty::ty_native_fn(_, arg_tys, _) { arg_tys }
-          _ {
-            fcx.ccx.tcx.sess.span_fatal(f.span,
-                                        "mismatched types: \
+        let arg_tys =
+            alt sty {
+              ty::ty_fn(_, arg_tys, _, _, _) | ty::ty_native_fn(_, arg_tys, _)
+              {
+                arg_tys
+              }
+              _ {
+                fcx.ccx.tcx.sess.span_fatal(f.span,
+                                            "mismatched types: \
                                            expected function or native \
                                            function but found "
-                                            + ty_to_str(fcx.ccx.tcx, fty))
-          }
-        };
+                                                + ty_to_str(fcx.ccx.tcx, fty))
+              }
+            };
 
         // Check that the correct number of arguments were supplied.
         let expected_arg_count = vec::len(arg_tys);
         let supplied_arg_count = vec::len(args);
         if expected_arg_count != supplied_arg_count {
-            fcx.ccx.tcx.sess.span_err(
-                sp,
-                #fmt("this function takes %u \
+            fcx.ccx.tcx.sess.span_err(sp,
+                                      #fmt["this function takes %u \
                       parameter%s but %u parameter%s supplied",
-                     expected_arg_count,
-                     if expected_arg_count == 1u { "" } else { "s" },
-                     supplied_arg_count,
-                     if supplied_arg_count == 1u
-                     { " was" } else { "s were" }));
+                                           expected_arg_count,
+                                           if expected_arg_count == 1u {
+                                               ""
+                                           } else { "s" }, supplied_arg_count,
+                                           if supplied_arg_count == 1u {
+                                               " was"
+                                           } else { "s were" }]);
             // HACK: extend the arguments list with dummy arguments to
             // check against
             let dummy = {mode: ty::mo_val, ty: ty::mk_nil(fcx.ccx.tcx)};
             while vec::len(arg_tys) < supplied_arg_count {
-                arg_tys += ~[dummy];
+                arg_tys += [dummy];
             }
         }
 
@@ -1609,26 +1619,31 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         // functions. This is so that we have more information about the types
         // of arguments when we typecheck the functions. This isn't really the
         // right way to do this.
-        let check_args = lambda(check_blocks: bool) -> bool {
-            let i = 0u;
-            let bot = false;
-            for a_opt: option::t<@ast::expr> in args {
-                alt a_opt {
-                  some(a) {
-                    let is_block =
-                        alt a.node { ast::expr_fn(_) { true } _ { false } };
-                    if is_block == check_blocks {
-                        bot |= check_expr_with_unifier(fcx, a,
-                                                       demand::block_coerce,
-                                                       arg_tys.(i).ty);
+        let check_args =
+            lambda (check_blocks: bool) -> bool {
+                let i = 0u;
+                let bot = false;
+                for a_opt: option::t<@ast::expr> in args {
+                    alt a_opt {
+                      some(a) {
+                        let is_block =
+                            alt a.node {
+                              ast::expr_fn(_) { true }
+                              _ { false }
+                            };
+                        if is_block == check_blocks {
+                            bot |=
+                                check_expr_with_unifier(fcx, a,
+                                                        demand::block_coerce,
+                                                        arg_tys[i].ty);
+                        }
+                      }
+                      none. { }
                     }
-                  }
-                  none. {}
+                    i += 1u;
                 }
-                i += 1u;
-            }
-            ret bot;
-        };
+                ret bot;
+            };
         bot |= check_args(false);
         bot |= check_args(true);
 
@@ -1647,9 +1662,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
     // A generic function for checking call expressions
     fn check_call(fcx: &@fn_ctxt, sp: &span, f: &@ast::expr,
                   args: &[@ast::expr], call_kind: call_kind) -> bool {
-        let args_opt_0: [option::t<@ast::expr>] = ~[];
+        let args_opt_0: [option::t<@ast::expr>] = [];
         for arg: @ast::expr in args {
-            args_opt_0 += ~[some::<@ast::expr>(arg)];
+            args_opt_0 += [some::<@ast::expr>(arg)];
         }
 
         // Call the generic checker.
@@ -1687,8 +1702,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                              element_ty: ty::t, body: &ast::blk,
                              node_id: ast::node_id) -> bool {
         let locid = lookup_local(fcx, local.span, local.node.id);
-        element_ty = demand::simple(fcx, local.span, element_ty,
-                                    ty::mk_var(fcx.ccx.tcx, locid));
+        element_ty =
+            demand::simple(fcx, local.span, element_ty,
+                           ty::mk_var(fcx.ccx.tcx, locid));
         let bot = check_decl_local(fcx, local);
         check_block(fcx, body);
         // Unify type of decl with element type of the seq
@@ -1812,9 +1828,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         bot = check_expr(fcx, oper);
         let oper_t = expr_ty(tcx, oper);
         alt unop {
-          ast::box(mut) {
-            oper_t = ty::mk_box(tcx, {ty: oper_t, mut: mut});
-          }
+          ast::box(mut) { oper_t = ty::mk_box(tcx, {ty: oper_t, mut: mut}); }
           ast::deref. {
             alt structure_of(fcx, expr.span, oper_t) {
               ty::ty_box(inner) { oper_t = inner.ty; }
@@ -1822,22 +1836,22 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
               ty::ty_tag(id, tps) {
                 let variants = ty::tag_variants(tcx, id);
                 if vec::len(variants) != 1u ||
-                       vec::len(variants.(0).args) != 1u {
-                    tcx.sess.span_fatal
-                        (expr.span, "can only dereference tags " +
-                         "with a single variant which has a "
-                         + "single argument");
+                       vec::len(variants[0].args) != 1u {
+                    tcx.sess.span_fatal(
+                        expr.span,
+                        "can only dereference tags " +
+                        "with a single variant which has a "
+                        + "single argument");
                 }
                 oper_t =
-                    ty::substitute_type_params(tcx, tps,
-                                               variants.(0).args.(0));
+                    ty::substitute_type_params(tcx, tps, variants[0].args[0]);
               }
               ty::ty_ptr(inner) { oper_t = inner.ty; }
               _ {
                 tcx.sess.span_fatal(expr.span,
                                     "dereferencing non-" +
-                                    "dereferenceable type: " +
-                                    ty_to_str(tcx, oper_t));
+                                        "dereferenceable type: " +
+                                        ty_to_str(tcx, oper_t));
               }
             }
           }
@@ -1845,17 +1859,19 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             if !type_is_integral(fcx, oper.span, oper_t) &&
                    structure_of(fcx, oper.span, oper_t) != ty::ty_bool {
                 tcx.sess.span_err(expr.span,
-                                  #fmt("mismatched types: expected bool \
+                                  #fmt["mismatched types: expected bool \
                                         or integer but found %s",
-                                       ty_to_str(tcx, oper_t)));
+                                       ty_to_str(tcx, oper_t)]);
             }
           }
           ast::neg. {
             oper_t = structurally_resolved_type(fcx, oper.span, oper_t);
             if !(ty::type_is_integral(tcx, oper_t) ||
-                 ty::type_is_fp(tcx, oper_t)) {
-                tcx.sess.span_err(expr.span, "applying unary minus to \
-                   non-numeric type " + ty_to_str(tcx, oper_t));
+                     ty::type_is_fp(tcx, oper_t)) {
+                tcx.sess.span_err(expr.span,
+                                  "applying unary minus to \
+                   non-numeric type "
+                                      + ty_to_str(tcx, oper_t));
             }
           }
         }
@@ -1883,9 +1899,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         bot = true;
         alt expr_opt {
           none. {/* do nothing */ }
-          some(e) {
-            check_expr_with(fcx, e, ty::mk_str(tcx));
-          }
+          some(e) { check_expr_with(fcx, e, ty::mk_str(tcx)); }
         }
         write::bot_ty(tcx, id);
       }
@@ -1901,15 +1915,13 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                                   "ret; in function returning non-nil");
             }
           }
-          some(e) {
-            check_expr_with(fcx, e, fcx.ret_ty);
-          }
+          some(e) { check_expr_with(fcx, e, fcx.ret_ty); }
         }
         write::bot_ty(tcx, id);
       }
       ast::expr_put(expr_opt) {
         require_impure(tcx.sess, fcx.purity, expr.span);
-        if (fcx.proto != ast::proto_iter) {
+        if fcx.proto != ast::proto_iter {
             tcx.sess.span_err(expr.span, "put in non-iterator");
         }
         alt expr_opt {
@@ -1920,9 +1932,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                                   "put; in iterator yielding non-nil");
             }
           }
-          some(e) {
-            bot = check_expr_with(fcx, e, fcx.ret_ty);
-          }
+          some(e) { bot = check_expr_with(fcx, e, fcx.ret_ty); }
         }
         write::nil_ty(tcx, id);
       }
@@ -1942,8 +1952,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         write::nil_ty(tcx, id);
       }
       ast::expr_if_check(cond, thn, elsopt) {
-        bot = check_pred_expr(fcx, cond) |
-              check_then_else(fcx, thn, elsopt, id, expr.span);
+        bot =
+            check_pred_expr(fcx, cond) |
+                check_then_else(fcx, thn, elsopt, id, expr.span);
       }
       ast::expr_ternary(_, _, _) {
         bot = check_expr(fcx, ast::ternary_to_if(expr));
@@ -1954,8 +1965,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
       }
       ast::expr_copy(a) {
         bot = check_expr_with_unifier(fcx, a, unify, expected);
-        let tpot = ty::node_id_to_ty_param_substs_opt_and_ty(fcx.ccx.tcx,
-                                                             a.id);
+        let tpot =
+            ty::node_id_to_ty_param_substs_opt_and_ty(fcx.ccx.tcx, a.id);
         write::ty_fixup(fcx, id, tpot);
 
       }
@@ -1974,12 +1985,12 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
       ast::expr_assign_op(op, lhs, rhs) {
         require_impure(tcx.sess, fcx.purity, expr.span);
         bot = check_assignment(fcx, expr.span, lhs, rhs, id);
-        check_binop_type_compat(fcx, expr.span, expr_ty(tcx, lhs),
-                                op);
+        check_binop_type_compat(fcx, expr.span, expr_ty(tcx, lhs), op);
       }
       ast::expr_if(cond, thn, elsopt) {
-        bot = check_expr_with(fcx, cond, ty::mk_bool(tcx)) |
-              check_then_else(fcx, thn, elsopt, id, expr.span);
+        bot =
+            check_expr_with(fcx, cond, ty::mk_bool(tcx)) |
+                check_then_else(fcx, thn, elsopt, id, expr.span);
       }
       ast::expr_for(decl, seq, body) {
         bot = check_expr(fcx, seq);
@@ -1990,24 +2001,27 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
           ty::ty_vec(vec_elt_ty) { elt_ty = vec_elt_ty.ty; }
           ty::ty_istr. { elt_ty = ty::mk_mach(tcx, ast::ty_u8); }
           _ {
-            tcx.sess.span_fatal
-                (expr.span, "mismatched types: expected vector or string but "
-                 + "found " + ty_to_str(tcx, ety));
+            tcx.sess.span_fatal(
+                expr.span,
+                "mismatched types: expected vector or string but "
+                + "found " + ty_to_str(tcx, ety));
           }
         }
         bot |= check_for_or_for_each(fcx, decl, elt_ty, body, id);
       }
       ast::expr_for_each(decl, seq, body) {
-        alt (seq.node) {
+        alt seq.node {
           ast::expr_call(f, args) {
-            bot = check_call_full(fcx, seq.span, f, args,
-                                  kind_for_each, seq.id);
+            bot =
+                check_call_full(fcx, seq.span, f, args, kind_for_each,
+                                seq.id);
+          }
+          _ {
+            tcx.sess.span_fatal(expr.span,
+                                "sequence in for each loop not a call");
           }
-          _ { tcx.sess.span_fatal(
-              expr.span, "sequence in for each loop not a call"); }
         }
-        bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq),
-                                     body, id);
+        bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq), body, id);
       }
       ast::expr_while(cond, body) {
         bot = check_expr_with(fcx, cond, ty::mk_bool(tcx));
@@ -2025,7 +2039,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         // bindings.
         let pattern_ty = ty::expr_ty(tcx, expr);
         for arm: ast::arm in arms {
-            let id_map = ast::pat_id_map(arm.pats.(0));
+            let id_map = ast::pat_id_map(arm.pats[0]);
             for p: @ast::pat in arm.pats {
                 check_pat(fcx, id_map, p, pattern_ty);
             }
@@ -2045,14 +2059,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
       ast::expr_fn(f) {
         let cx = @{tcx: tcx};
         let convert = bind ast_ty_to_ty_crate_tyvar(fcx, _);
-        let ty_of_arg = lambda(a: &ast::arg) -> ty::arg {
-            let ty_mode = ast_mode_to_mode(a.mode);
-            let tt = ast_ty_to_ty_crate_tyvar(fcx, a.ty);
-            ret {mode: ty_mode, ty: tt};
-        };
+        let ty_of_arg =
+            lambda (a: &ast::arg) -> ty::arg {
+                let ty_mode = ast_mode_to_mode(a.mode);
+                let tt = ast_ty_to_ty_crate_tyvar(fcx, a.ty);
+                ret {mode: ty_mode, ty: tt};
+            };
         let fty =
             collect::ty_of_fn_decl(cx, convert, ty_of_arg, f.decl, f.proto,
-                                   ~[], none).ty;
+                                   [], none).ty;
         write::ty_only_fixup(fcx, id, fty);
 
         // Unify the type of the function with the expected type before we
@@ -2065,10 +2080,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
       }
       ast::expr_block(b) {
         bot = check_block(fcx, b);
-        let typ = alt b.node.expr {
-          some(expr) { expr_ty(tcx, expr) }
-          none. { ty::mk_nil(tcx) }
-        };
+        let typ =
+            alt b.node.expr {
+              some(expr) { expr_ty(tcx, expr) }
+              none. { ty::mk_nil(tcx) }
+            };
         write::ty_only_fixup(fcx, id, typ);
       }
       ast::expr_bind(f, args) {
@@ -2077,7 +2093,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
 
         // Pull the argument and return types out.
         let proto_1;
-        let arg_tys_1: [ty::arg] = ~[];
+        let arg_tys_1: [ty::arg] = [];
         let rt_1;
         let fty = expr_ty(tcx, f);
         let t_1;
@@ -2093,17 +2109,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             // to the resulting function type.
             let i = 0u;
             while i < vec::len::<option::t<@ast::expr>>(args) {
-                alt args.(i) {
+                alt args[i] {
                   some(_) {/* no-op */ }
-                  none. { arg_tys_1 += ~[arg_tys.(i)]; }
+                  none. { arg_tys_1 += [arg_tys[i]]; }
                 }
                 i += 1u;
             }
             t_1 = ty::mk_fn(tcx, proto_1, arg_tys_1, rt_1, cf, constrs);
           }
-          _ {
-            fail "LHS of bind expr didn't have a function type?!";
-          }
+          _ { fail "LHS of bind expr didn't have a function type?!"; }
         }
         write::ty_only_fixup(fcx, id, t_1);
       }
@@ -2120,6 +2134,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             alt oinfo {
               regular_obj(_, obj_id) {
                 let did = local_def(obj_id);
+
                 // Try looking up the current object in the type
                 // cache.
                 alt tcx.tcache.find(did) {
@@ -2131,7 +2146,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                   }
                   none. {
                     tcx.sess.bug("didn't find " + int::str(did.node) +
-                                 " in type cache");
+                                     " in type cache");
                   }
                 }
               }
@@ -2172,33 +2187,31 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                  type_is_scalar(fcx, expr.span, t_1)) {
             tcx.sess.span_err(expr.span,
                               "non-scalar cast: " +
-                              ty_to_str(tcx, expr_ty(tcx, e))
-                              + " as " + ty_to_str(tcx, t_1));
+                                  ty_to_str(tcx, expr_ty(tcx, e)) + " as " +
+                                  ty_to_str(tcx, t_1));
         }
         write::ty_only_fixup(fcx, id, t_1);
       }
       ast::expr_vec(args, mut) {
         let t: ty::t = next_ty_var(fcx);
-        for e: @ast::expr in args {
-            bot |= check_expr_with(fcx, e, t);
-        }
+        for e: @ast::expr in args { bot |= check_expr_with(fcx, e, t); }
         let typ = ty::mk_vec(tcx, {ty: t, mut: mut});
         write::ty_only_fixup(fcx, id, typ);
       }
       ast::expr_tup(elts) {
-        let elt_ts = ~[];
+        let elt_ts = [];
         vec::reserve(elt_ts, vec::len(elts));
         for e in elts {
             check_expr(fcx, e);
             let ety = expr_ty(fcx.ccx.tcx, e);
-            elt_ts += ~[ety];
+            elt_ts += [ety];
         }
         let typ = ty::mk_tup(fcx.ccx.tcx, elt_ts);
         write::ty_only_fixup(fcx, id, typ);
       }
       ast::expr_rec(fields, base) {
         alt base { none. {/* no-op */ } some(b_0) { check_expr(fcx, b_0); } }
-        let fields_t: [spanned<field>] = ~[];
+        let fields_t: [spanned<field>] = [];
         for f: ast::field in fields {
             bot |= check_expr(fcx, f.node.expr);
             let expr_t = expr_ty(tcx, f.node.expr);
@@ -2206,8 +2219,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             // for the most precise error message,
             // should be f.node.expr.span, not f.span
             fields_t +=
-                ~[respan(f.node.expr.span,
-                         {ident: f.node.ident, mt: expr_mt})];
+                [respan(f.node.expr.span,
+                        {ident: f.node.ident, mt: expr_mt})];
         }
         alt base {
           none. {
@@ -2218,7 +2231,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
           some(bexpr) {
             bot |= check_expr(fcx, bexpr);
             let bexpr_t = expr_ty(tcx, bexpr);
-            let base_fields: [field] = ~[];
+            let base_fields: [field] = [];
             alt structure_of(fcx, expr.span, bexpr_t) {
               ty::ty_rec(flds) { base_fields = flds; }
               _ {
@@ -2237,8 +2250,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                 }
                 if !found {
                     tcx.sess.span_fatal(f.span,
-                                        "unknown field in record update: "
-                                        + f.node.ident);
+                                        "unknown field in record update: " +
+                                            f.node.ident);
                 }
             }
           }
@@ -2250,12 +2263,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         base_t = do_autoderef(fcx, expr.span, base_t);
         alt structure_of(fcx, expr.span, base_t) {
           ty::ty_rec(fields) {
-            let ix: uint =
-                ty::field_idx(tcx.sess, expr.span, field, fields);
+            let ix: uint = ty::field_idx(tcx.sess, expr.span, field, fields);
             if ix >= vec::len::<ty::field>(fields) {
                 tcx.sess.span_fatal(expr.span, "bad index on record");
             }
-            write::ty_only_fixup(fcx, id, fields.(ix).mt.ty);
+            write::ty_only_fixup(fcx, id, fields[ix].mt.ty);
           }
           ty::ty_obj(methods) {
             let ix: uint =
@@ -2263,17 +2275,17 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             if ix >= vec::len::<ty::method>(methods) {
                 tcx.sess.span_fatal(expr.span, "bad index on obj");
             }
-            let meth = methods.(ix);
+            let meth = methods[ix];
             let t =
-                ty::mk_fn(tcx, meth.proto, meth.inputs, meth.output,
-                          meth.cf, meth.constrs);
+                ty::mk_fn(tcx, meth.proto, meth.inputs, meth.output, meth.cf,
+                          meth.constrs);
             write::ty_only_fixup(fcx, id, t);
           }
           _ {
             let t_err = resolve_type_vars_if_possible(fcx, base_t);
             let msg =
-                #fmt("attempted field access on type %s",
-                     ty_to_str(tcx, t_err));
+                #fmt["attempted field access on type %s",
+                     ty_to_str(tcx, t_err)];
             tcx.sess.span_fatal(expr.span, msg);
           }
         }
@@ -2288,7 +2300,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             tcx.sess.span_err(idx.span,
                               "mismatched types: expected \
                                integer but found "
-                              + ty_to_str(tcx, idx_t));
+                                  + ty_to_str(tcx, idx_t));
         }
         alt structure_of(fcx, expr.span, base_t) {
           ty::ty_vec(mt) { write::ty_only_fixup(fcx, id, mt.ty); }
@@ -2303,12 +2315,12 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
           _ {
             tcx.sess.span_fatal(expr.span,
                                 "vector-indexing bad type: " +
-                                ty_to_str(tcx, base_t));
+                                    ty_to_str(tcx, base_t));
           }
         }
       }
       ast::expr_anon_obj(ao) {
-        let fields: [ast::anon_obj_field] = ~[];
+        let fields: [ast::anon_obj_field] = [];
         alt ao.fields { none. { } some(v) { fields = v; } }
 
         // FIXME: These next three functions are largely ripped off from
@@ -2321,16 +2333,16 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         fn ty_of_method(ccx: @crate_ctxt, m: &@ast::method) -> ty::method {
             let convert = bind ast_ty_to_ty_crate(ccx, _);
 
-            let inputs = ~[];
+            let inputs = [];
             for aa: ast::arg in m.node.meth.decl.inputs {
-                inputs += ~[ty_of_arg(ccx, aa)];
+                inputs += [ty_of_arg(ccx, aa)];
             }
 
             let output = convert(m.node.meth.decl.output);
 
-            let out_constrs = ~[];
+            let out_constrs = [];
             for constr: @ast::constr in m.node.meth.decl.constraints {
-                out_constrs += ~[ty::ast_constr_to_constr(ccx.tcx, constr)];
+                out_constrs += [ty::ast_constr_to_constr(ccx.tcx, constr)];
             }
 
             ret {proto: m.node.meth.proto,
@@ -2341,18 +2353,18 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                  constrs: out_constrs};
         }
 
-        let method_types: [ty::method] = ~[];
+        let method_types: [ty::method] = [];
         {
             // Outer methods.
             for m: @ast::method in ao.methods {
-                method_types += ~[ty_of_method(fcx.ccx, m)];
+                method_types += [ty_of_method(fcx.ccx, m)];
             }
 
             // Inner methods.
 
             // Typecheck 'inner_obj'.  If it exists, it had better have object
             // type.
-            let inner_obj_methods: [ty::method] = ~[];
+            let inner_obj_methods: [ty::method] = [];
             let inner_obj_ty: ty::t = ty::mk_nil(tcx);
             let inner_obj_sty: option::t<ty::sty> = none;
             alt ao.inner_obj {
@@ -2371,9 +2383,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                       ty::ty_obj(ms) { inner_obj_methods = ms; }
                       _ {
                         // The user is trying to extend a non-object.
-                        tcx.sess.span_fatal
-                            (e.span, syntax::print::pprust::expr_to_str(e) +
-                             " does not have object type");
+                        tcx.sess.span_fatal(
+                            e.span,
+                            syntax::print::pprust::expr_to_str(e)
+                            +
+                            " does not have object type");
                       }
                     }
                   }
@@ -2382,16 +2396,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
             }
 
             fcx.ccx.obj_infos +=
-                ~[anon_obj(vec::map(ast::obj_field_from_anon_obj_field,
-                                     fields), inner_obj_sty)];
+                [anon_obj(vec::map(ast::obj_field_from_anon_obj_field,
+                                   fields), inner_obj_sty)];
 
             // Whenever an outer method overrides an inner, we need to remove
             // that inner from the type.  Filter inner_obj_methods to remove
             // any methods that share a name with an outer method.
-            fn filtering_fn(ccx: @crate_ctxt,
-                            m: &ty::method,
+            fn filtering_fn(ccx: @crate_ctxt, m: &ty::method,
                             outer_obj_methods: [@ast::method]) ->
-                option::t<ty::method> {
+               option::t<ty::method> {
 
                 for om: @ast::method in outer_obj_methods {
                     if str::eq(om.node.ident, m.ident) {
@@ -2401,8 +2414,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
                         if new_type != m {
                             ccx.tcx.sess.span_fatal(
                                 om.span,
-                                "Attempted to override method " +
-                                m.ident + " with one of a different type");
+                                "Attempted to override method "
+                                + m.ident +
+                                " with one of a different type");
                         }
                         ret none;
                     }
@@ -2426,9 +2440,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
         // collect::convert for regular objects.)
         let i = 0u;
         while i < vec::len::<@ast::method>(ao.methods) {
-            write::ty_only(tcx, ao.methods.(i).node.id,
-                           ty::method_ty_to_fn_ty(tcx,
-                                                  method_types.(i)));
+            write::ty_only(tcx, ao.methods[i].node.id,
+                           ty::method_ty_to_fn_ty(tcx, method_types[i]));
             i += 1u;
         }
 
@@ -2447,9 +2460,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr,
       }
       _ { tcx.sess.unimpl("expr type in typeck::check_expr"); }
     }
-    if bot {
-        write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx));
-    }
+    if bot { write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx)); }
 
     unify(fcx, expr.span, expected, expr_ty(tcx, expr));
     ret bot;
@@ -2481,7 +2492,7 @@ fn check_decl_local(fcx: &@fn_ctxt, local: &@ast::local) -> bool {
     alt fcx.locals.find(local.node.id) {
       none. {
         fcx.ccx.tcx.sess.bug("check_decl_local: local id not found " +
-                             ident_for_local(local));
+                                 ident_for_local(local));
       }
       some(i) {
         let t = ty::mk_var(fcx.ccx.tcx, i);
@@ -2523,11 +2534,13 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool {
     let warned = false;
     for s: @ast::stmt in blk.node.stmts {
         if bot && !warned &&
-           alt s.node {
-            ast::stmt_decl(@{node: ast::decl_local(_), _}, _) |
-            ast::stmt_expr(_, _) { true }
-            _ { false }
-           } {
+               alt s.node {
+                 ast::stmt_decl(@{node: ast::decl_local(_), _}, _) |
+                 ast::stmt_expr(_, _) {
+                   true
+                 }
+                 _ { false }
+               } {
             fcx.ccx.tcx.sess.span_warn(s.span, "unreachable statement");
             warned = true;
         }
@@ -2555,7 +2568,7 @@ fn check_const(ccx: &@crate_ctxt, _sp: &span, e: &@ast::expr,
     // FIXME: this is kinda a kludge; we manufacture a fake function context
     // and statement context for checking the initializer expression.
     let rty = node_id_to_type(ccx.tcx, id);
-    let fixups: [ast::node_id] = ~[];
+    let fixups: [ast::node_id] = [];
     let fcx: @fn_ctxt =
         @{ret_ty: rty,
           purity: ast::pure_fn,
@@ -2574,7 +2587,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
     let decl = f.decl;
     let body = f.body;
     let gather_result = gather_locals(ccx, f, id, old_fcx);
-    let fixups: [ast::node_id] = ~[];
+    let fixups: [ast::node_id] = [];
     let fcx: @fn_ctxt =
         @{ret_ty: ty::ty_fn_ret(ccx.tcx, ty::node_id_to_type(ccx.tcx, id)),
           purity: decl.purity,
@@ -2588,6 +2601,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
     check_block(fcx, body);
     alt decl.purity {
       ast::pure_fn. {
+
         // This just checks that the declared type is bool, and trusts
         // that that's the actual return type.
         if !ty::type_is_bool(ccx.tcx, fcx.ret_ty) {
@@ -2598,16 +2612,17 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
       _ { }
     }
 
-// For non-iterator fns, we unify the tail expr's type with the
-// function result type, if there is a tail expr.
-// We don't do this check for an iterator, as the tail expr doesn't
-// have to have the result type of the iterator.
+    // For non-iterator fns, we unify the tail expr's type with the
+    // function result type, if there is a tail expr.
+    // We don't do this check for an iterator, as the tail expr doesn't
+    // have to have the result type of the iterator.
     if option::is_some(body.node.expr) && f.proto != ast::proto_iter {
         let tail_expr = option::get(body.node.expr);
         // The use of resolve_type_vars_if_possible makes me very
         // afraid :-(
-        let tail_expr_ty = resolve_type_vars_if_possible(
-          fcx, expr_ty(ccx.tcx, tail_expr));
+        let tail_expr_ty =
+            resolve_type_vars_if_possible(fcx, expr_ty(ccx.tcx, tail_expr));
+
         // Hacky compromise: use eq and not are_compatible
         // This allows things like while loops and ifs with no
         // else to appear in tail position without a trailing
@@ -2623,7 +2638,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
     // force any remaining type vars to be resolved.
     // If we have an enclosing function scope, our type variables will be
     // resolved when the enclosing scope finishes up.
-    if (option::is_none(old_fcx)) {
+    if option::is_none(old_fcx) {
         writeback::resolve_type_vars_in_block(fcx, body);
     }
 }
@@ -2639,7 +2654,7 @@ fn check_item(ccx: @crate_ctxt, it: &@ast::item) {
       ast::item_res(f, dtor_id, _, _) { check_fn(ccx, f, dtor_id, none); }
       ast::item_obj(ob, _, _) {
         // We're entering an object, so gather up the info we need.
-        ccx.obj_infos += ~[regular_obj(ob.fields, it.id)];
+        ccx.obj_infos += [regular_obj(ob.fields, it.id)];
 
         // Typecheck the methods.
         for method: @ast::method in ob.methods { check_method(ccx, method); }
@@ -2672,17 +2687,19 @@ fn check_main_fn_ty(tcx: &ty::ctxt, main_id: &ast::node_id) {
         ok &= ty::type_is_nil(tcx, rs);
         let num_args = vec::len(args);
         ok &=
-            num_args == 0u || num_args == 1u && arg_is_argv_ty(tcx, args.(0));
+            num_args == 0u || num_args == 1u && arg_is_argv_ty(tcx, args[0]);
         if !ok {
             let span = ast_map::node_span(tcx.items.get(main_id));
-            tcx.sess.span_err(span, "wrong type in main function: found " +
-                              ty_to_str(tcx, main_t));
+            tcx.sess.span_err(span,
+                              "wrong type in main function: found " +
+                                  ty_to_str(tcx, main_t));
         }
       }
       _ {
         let span = ast_map::node_span(tcx.items.get(main_id));
-        tcx.sess.span_bug(span, "main has a non-function type: found" +
-                          ty_to_str(tcx, main_t));
+        tcx.sess.span_bug(span,
+                          "main has a non-function type: found" +
+                              ty_to_str(tcx, main_t));
       }
     }
 }
@@ -2699,12 +2716,12 @@ fn check_for_main_fn(tcx: &ty::ctxt, crate: &@ast::crate) {
 fn check_crate(tcx: &ty::ctxt, crate: &@ast::crate) {
     collect::collect_item_types(tcx, crate);
 
-    let obj_infos: [obj_info] = ~[];
+    let obj_infos: [obj_info] = [];
 
     let ccx = @{mutable obj_infos: obj_infos, tcx: tcx};
-    let visit = visit::mk_simple_visitor
-        (@{visit_item: bind check_item(ccx, _)
-           with *visit::default_simple_visitor()});
+    let visit =
+        visit::mk_simple_visitor(@{visit_item: bind check_item(ccx, _)
+                                      with *visit::default_simple_visitor()});
     visit::visit_crate(*crate, (), visit);
     check_for_main_fn(tcx, crate);
     tcx.sess.abort_if_errors();
diff --git a/src/comp/syntax/ast.rs b/src/comp/syntax/ast.rs
index 7c9bd7c6897..80d327b119b 100644
--- a/src/comp/syntax/ast.rs
+++ b/src/comp/syntax/ast.rs
@@ -49,6 +49,7 @@ tag def {
     def_arg(def_id);
     def_local(def_id);
     def_variant(def_id, /* tag */def_id);
+
     /* variant */
     def_ty(def_id);
     def_ty_arg(uint, kind);
@@ -56,6 +57,7 @@ tag def {
     def_use(def_id);
     def_native_ty(def_id);
     def_native_fn(def_id);
+
     /* A "fake" def for upvars. This never appears in the def_map, but
      * freevars::def_lookup will return it for a def that is an upvar.
      * It contains the actual def. */
@@ -77,7 +79,7 @@ fn def_id_of_def(d: def) -> def_id {
       def_local(id) { ret id; }
       def_variant(_, id) { ret id; }
       def_ty(id) { ret id; }
-      def_ty_arg(_,_) { fail; }
+      def_ty_arg(_, _) { fail; }
       def_binding(id) { ret id; }
       def_use(id) { ret id; }
       def_native_ty(id) { ret id; }
@@ -100,10 +102,7 @@ type crate_ =
 
 tag crate_directive_ {
     cdir_src_mod(ident, option::t<filename>, [attribute]);
-    cdir_dir_mod(ident,
-                 option::t<filename>,
-                 [@crate_directive],
-                 [attribute]);
+    cdir_dir_mod(ident, option::t<filename>, [@crate_directive], [attribute]);
     cdir_view_item(@view_item);
     cdir_syntax(path);
     cdir_auth(path, _auth);
@@ -155,30 +154,22 @@ iter pat_bindings(pat: &@pat) -> @pat {
     alt pat.node {
       pat_bind(_) { put pat; }
       pat_tag(_, sub) {
-        for p in sub {
-            for each b in pat_bindings(p) { put b; }
-        }
+        for p in sub { for each b in pat_bindings(p) { put b; } }
       }
       pat_rec(fields, _) {
-        for f in fields {
-            for each b in pat_bindings(f.pat) { put b; }
-        }
+        for f in fields { for each b in pat_bindings(f.pat) { put b; } }
       }
       pat_tup(elts) {
-        for elt in elts {
-            for each b in pat_bindings(elt) { put b; }
-        }
-      }
-      pat_box(sub) {
-        for each b in pat_bindings(sub) { put b; }
+        for elt in elts { for each b in pat_bindings(elt) { put b; } }
       }
-      pat_wild. | pat_lit(_) {}
+      pat_box(sub) { for each b in pat_bindings(sub) { put b; } }
+      pat_wild. | pat_lit(_) { }
     }
 }
 
 fn pat_binding_ids(pat: &@pat) -> [node_id] {
-    let found = ~[];
-    for each b in pat_bindings(pat) { found += ~[b.id]; }
+    let found = [];
+    for each b in pat_bindings(pat) { found += [b.id]; }
     ret found;
 }
 
@@ -258,6 +249,7 @@ type stmt = spanned<stmt_>;
 tag stmt_ {
     stmt_decl(@decl, node_id);
     stmt_expr(@expr, node_id);
+
     // These only exist in crate-level blocks.
     stmt_crate_directive(@crate_directive);
 }
@@ -266,10 +258,8 @@ tag init_op { init_assign; init_move; }
 
 type initializer = {op: init_op, expr: @expr};
 
-type local_ = {ty: @ty,
-               pat: @pat, // FIXME: should really be a refinement on pat
-               init: option::t<initializer>,
-               id: node_id};
+type local_ =  // FIXME: should really be a refinement on pat
+    {ty: @ty, pat: @pat, init: option::t<initializer>, id: node_id};
 
 type local = spanned<local_>;
 
@@ -312,6 +302,7 @@ tag expr_ {
     expr_alt(@expr, [arm]);
     expr_fn(_fn);
     expr_block(blk);
+
     /*
      * FIXME: many of these @exprs should be constrained with
      * is_lval once we have constrained types working.
@@ -331,10 +322,13 @@ tag expr_ {
     expr_put(option::t<@expr>);
     expr_be(@expr);
     expr_log(int, @expr);
+
     /* just an assert, no significance to typestate */
     expr_assert(@expr);
+
     /* preds that typestate is aware of */
     expr_check(check_mode, @expr);
+
     /* FIXME Would be nice if expr_check desugared
        to expr_if_check. */
     expr_if_check(@expr, blk, option::t<@expr>);
@@ -428,10 +422,11 @@ tag ty_ {
     ty_bot; /* return type of ! functions and type of
              ret/fail/break/cont. there is no syntax
              for this type. */
+
      /* bot represents the value of functions that don't return a value
         locally to their context. in contrast, things like log that do
         return, but don't return a meaningful value, have result type nil. */
-    ty_bool;
+     ty_bool;
     ty_int;
     ty_uint;
     ty_float;
@@ -453,6 +448,7 @@ tag ty_ {
     ty_type;
     ty_constr(@ty, [@ty_constr]);
     ty_mac(mac);
+
     // ty_infer means the type should be inferred instead of it having been
     // specified. This should only appear at the "top level" of a type and not
     // nested in one.
@@ -514,6 +510,7 @@ tag purity {
 tag controlflow {
     noreturn; // functions with return type _|_ that always
               // raise an error or exit (i.e. never return to the caller)
+
     return; // everything else
 }
 
@@ -531,9 +528,9 @@ type _obj = {fields: [obj_field], methods: [@method]};
 
 type anon_obj =
     // New fields and methods, if they exist.
+    // inner_obj: the original object being extended, if it exists.
     {fields: option::t<[anon_obj_field]>,
      methods: [@method],
-     // inner_obj: the original object being extended, if it exists.
      inner_obj: option::t<@expr>};
 
 type _mod = {view_items: [@view_item], items: [@item]};
@@ -601,10 +598,14 @@ tag item_ {
     item_ty(@ty, [ty_param]);
     item_tag([variant], [ty_param]);
     item_obj(_obj, [ty_param], /* constructor id */node_id);
-    item_res(_fn, /* dtor */
-             node_id, /* dtor id */
+    item_res(_fn,
+              /* dtor */
+             node_id,
+              /* dtor id */
              [ty_param],
-             node_id /* ctor id */);
+
+             /* ctor id */
+             node_id);
 }
 
 type native_item =
@@ -637,11 +638,7 @@ fn is_exported(i: ident, m: _mod) -> bool {
     for vi: @ast::view_item in m.view_items {
         alt vi.node {
           ast::view_item_export(ids, _) {
-            for id in ids {
-                if str::eq(i, id) {
-                    ret true;
-                }
-            }
+            for id in ids { if str::eq(i, id) { ret true; } }
             count += 1u;
           }
           _ {/* fall through */ }
@@ -670,7 +667,7 @@ fn eq_ty(a: &@ty, b: &@ty) -> bool { ret std::box::ptr_eq(a, b); }
 fn hash_ty(t: &@ty) -> uint { ret t.span.lo << 16u + t.span.hi; }
 
 fn block_from_expr(e: @expr) -> blk {
-    let blk_ = {stmts: ~[], expr: option::some::<@expr>(e), id: e.id};
+    let blk_ = {stmts: [], expr: option::some::<@expr>(e), id: e.id};
     ret {node: blk_, span: e.span};
 }
 
diff --git a/src/comp/syntax/codemap.rs b/src/comp/syntax/codemap.rs
index a2542e5fddf..a52a58e629e 100644
--- a/src/comp/syntax/codemap.rs
+++ b/src/comp/syntax/codemap.rs
@@ -23,36 +23,36 @@ type codemap = @{mutable files: [filemap]};
 
 type loc = {filename: filename, line: uint, col: uint};
 
-fn new_codemap() -> codemap { ret @{mutable files: ~[]}; }
+fn new_codemap() -> codemap { ret @{mutable files: []}; }
 
 fn new_filemap(filename: filename, start_pos_ch: uint, start_pos_byte: uint)
    -> filemap {
     ret @{name: filename,
           start_pos: {ch: start_pos_ch, byte: start_pos_byte},
-          mutable lines: ~[{ch: start_pos_ch, byte: start_pos_byte}]};
+          mutable lines: [{ch: start_pos_ch, byte: start_pos_byte}]};
 }
 
 fn next_line(file: filemap, chpos: uint, byte_pos: uint) {
-    file.lines += ~[{ch: chpos, byte: byte_pos}];
+    file.lines += [{ch: chpos, byte: byte_pos}];
 }
 
-type lookup_fn = fn(file_pos) -> uint ;
+type lookup_fn = fn(file_pos) -> uint;
 
 fn lookup_pos(map: codemap, pos: uint, lookup: lookup_fn) -> loc {
     let a = 0u;
     let b = vec::len(map.files);
     while b - a > 1u {
         let m = (a + b) / 2u;
-        if lookup(map.files.(m).start_pos) > pos { b = m; } else { a = m; }
+        if lookup(map.files[m].start_pos) > pos { b = m; } else { a = m; }
     }
-    let f = map.files.(a);
+    let f = map.files[a];
     a = 0u;
     b = vec::len(f.lines);
     while b - a > 1u {
         let m = (a + b) / 2u;
-        if lookup(f.lines.(m)) > pos { b = m; } else { a = m; }
+        if lookup(f.lines[m]) > pos { b = m; } else { a = m; }
     }
-    ret {filename: f.name, line: a + 1u, col: pos - lookup(f.lines.(a))};
+    ret {filename: f.name, line: a + 1u, col: pos - lookup(f.lines[a])};
 }
 
 fn lookup_char_pos(map: codemap, pos: uint) -> loc {
@@ -65,7 +65,8 @@ fn lookup_byte_pos(map: codemap, pos: uint) -> loc {
     ret lookup_pos(map, pos, lookup);
 }
 
-tag opt_span { //hack (as opposed to option::t), to make `span` compile
+tag opt_span {
+     //hack (as opposed to option::t), to make `span` compile
     os_none;
     os_some(@span);
 }
@@ -75,13 +76,14 @@ fn span_to_str(sp: &span, cm: &codemap) -> str {
     let cur = sp;
     let res = "";
     let prev_file = none;
-    while(true) {
+    while true {
         let lo = lookup_char_pos(cm, cur.lo);
         let hi = lookup_char_pos(cm, cur.hi);
-        res += #fmt("%s:%u:%u:%u:%u",
-                    if some(lo.filename) == prev_file { "-" }
-                    else                              { lo.filename },
-                    lo.line, lo.col, hi.line, hi.col);
+        res +=
+            #fmt["%s:%u:%u:%u:%u",
+                 if some(lo.filename) == prev_file {
+                     "-"
+                 } else { lo.filename }, lo.line, lo.col, hi.line, hi.col];
         alt cur.expanded_from {
           os_none. { break; }
           os_some(new_sp) {
@@ -110,11 +112,9 @@ fn emit_diagnostic(sp: &option::t<span>, msg: &str, kind: &str, color: u8,
     if term::color_supported() {
         term::fg(io::stdout().get_buf_writer(), color);
     }
-    io::stdout().write_str(#fmt("%s:", kind));
-    if term::color_supported() {
-        term::reset(io::stdout().get_buf_writer());
-    }
-    io::stdout().write_str(#fmt(" %s\n", msg));
+    io::stdout().write_str(#fmt["%s:", kind]);
+    if term::color_supported() { term::reset(io::stdout().get_buf_writer()); }
+    io::stdout().write_str(#fmt[" %s\n", msg]);
 
     maybe_highlight_lines(sp, cm, maybe_lines);
 }
@@ -143,14 +143,14 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap,
         }
         // Print the offending lines
         for line: uint in display_lines {
-            io::stdout().write_str(#fmt("%s:%u ", fm.name, line + 1u));
+            io::stdout().write_str(#fmt["%s:%u ", fm.name, line + 1u]);
             let s = get_line(fm, line as int, file);
             if !str::ends_with(s, "\n") { s += "\n"; }
             io::stdout().write_str(s);
         }
         if elided {
-            let last_line = display_lines.(vec::len(display_lines) - 1u);
-            let s = #fmt("%s:%u ", fm.name, last_line + 1u);
+            let last_line = display_lines[vec::len(display_lines) - 1u];
+            let s = #fmt["%s:%u ", fm.name, last_line + 1u];
             let indent = str::char_len(s);
             let out = "";
             while indent > 0u { out += " "; indent -= 1u; }
@@ -163,7 +163,7 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap,
         if vec::len(lines.lines) == 1u {
             let lo = lookup_char_pos(cm, option::get(sp).lo);
             let digits = 0u;
-            let num = lines.lines.(0) / 10u;
+            let num = lines.lines[0] / 10u;
 
             // how many digits must be indent past?
             while num > 0u { num /= 10u; digits += 1u; }
@@ -202,18 +202,18 @@ type file_lines = {name: str, lines: [uint]};
 fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines {
     let lo = lookup_char_pos(cm, sp.lo);
     let hi = lookup_char_pos(cm, sp.hi);
-    let lines = ~[];
+    let lines = [];
     for each i: uint in uint::range(lo.line - 1u, hi.line as uint) {
-        lines += ~[i];
+        lines += [i];
     }
     ret @{name: lo.filename, lines: lines};
 }
 
 fn get_line(fm: filemap, line: int, file: &str) -> str {
-    let begin: uint = fm.lines.(line).byte - fm.start_pos.byte;
+    let begin: uint = fm.lines[line].byte - fm.start_pos.byte;
     let end: uint;
     if line as uint < vec::len(fm.lines) - 1u {
-        end = fm.lines.(line + 1).byte - fm.start_pos.byte;
+        end = fm.lines[line + 1].byte - fm.start_pos.byte;
     } else {
         // If we're not done parsing the file, we're at the limit of what's
         // parsed. If we just slice the rest of the string, we'll print out
@@ -232,7 +232,6 @@ fn get_filemap(cm: codemap, filename: str) -> filemap {
     //      (or expected function, found _|_)
     fail; // ("asking for " + filename + " which we don't know about");
 }
-
 //
 // Local Variables:
 // mode: rust
diff --git a/src/comp/syntax/ext/base.rs b/src/comp/syntax/ext/base.rs
index 9c0ea438678..6d1bd6626c2 100644
--- a/src/comp/syntax/ext/base.rs
+++ b/src/comp/syntax/ext/base.rs
@@ -7,10 +7,10 @@ import std::map::new_str_hash;
 import codemap;
 
 type syntax_expander =
-    fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> @ast::expr ;
+    fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> @ast::expr;
 type macro_def = {ident: str, ext: syntax_extension};
 type macro_definer =
-    fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> macro_def ;
+    fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> macro_def;
 
 tag syntax_extension {
     normal(syntax_expander);
@@ -34,20 +34,22 @@ fn syntax_expander_table() -> hashmap<str, syntax_extension> {
     ret syntax_expanders;
 }
 
-obj ext_ctxt(sess: @session, crate_file_name_hack: str,
+obj ext_ctxt(sess: @session,
+             crate_file_name_hack: str,
              mutable backtrace: codemap::opt_span) {
     fn crate_file_name() -> str { ret crate_file_name_hack; }
 
     fn session() -> @session { ret sess; }
 
-    fn print_backtrace() {
-    }
+    fn print_backtrace() { }
 
     fn backtrace() -> codemap::opt_span { ret backtrace; }
 
     fn bt_push(sp: span) {
-        backtrace = codemap::os_some(@{lo: sp.lo, hi: sp.hi,
-                                       expanded_from: backtrace});
+        backtrace =
+            codemap::os_some(@{lo: sp.lo,
+                               hi: sp.hi,
+                               expanded_from: backtrace});
     }
     fn bt_pop() {
         alt backtrace {
@@ -67,21 +69,16 @@ obj ext_ctxt(sess: @session, crate_file_name_hack: str,
         self.print_backtrace();
         sess.span_err(sp, msg);
     }
-    fn span_unimpl(sp:span, msg: str) -> ! {
+    fn span_unimpl(sp: span, msg: str) -> ! {
         self.print_backtrace();
         sess.span_unimpl(sp, msg);
     }
-    fn span_bug(sp:span, msg: str) -> ! {
+    fn span_bug(sp: span, msg: str) -> ! {
         self.print_backtrace();
         sess.span_bug(sp, msg);
     }
-    fn bug(msg: str) -> ! {
-        self.print_backtrace();
-        sess.bug(msg);
-    }
-    fn next_id() -> ast::node_id {
-        ret sess.next_node_id();
-    }
+    fn bug(msg: str) -> ! { self.print_backtrace(); sess.bug(msg); }
+    fn next_id() -> ast::node_id { ret sess.next_node_id(); }
 
 }
 
@@ -93,7 +90,7 @@ fn mk_ctxt(sess: &session) -> ext_ctxt {
     // the extensions the file name of the crate being compiled so they can
     // use it to guess whether paths should be prepended with "std::". This is
     // super-ugly and needs a better solution.
-    let crate_file_name_hack = sess.get_codemap().files.(0).name;
+    let crate_file_name_hack = sess.get_codemap().files[0].name;
 
     ret ext_ctxt(@sess, crate_file_name_hack, codemap::os_none);
 }
@@ -115,7 +112,7 @@ fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr, error: str) -> ast::ident {
       ast::expr_path(p) {
         if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u {
             cx.span_fatal(expr.span, error);
-        } else { ret p.node.idents.(0); }
+        } else { ret p.node.idents[0]; }
       }
       _ { cx.span_fatal(expr.span, error); }
     }
diff --git a/src/comp/syntax/ext/concat_idents.rs b/src/comp/syntax/ext/concat_idents.rs
index 13f87e044c4..466f55e60e6 100644
--- a/src/comp/syntax/ext/concat_idents.rs
+++ b/src/comp/syntax/ext/concat_idents.rs
@@ -4,18 +4,21 @@ import syntax::ast;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
                      _body: option::t<str>) -> @ast::expr {
-    let args: [@ast::expr] = alt arg.node {
-      ast::expr_vec(elts, _) { elts }
-      _ { cx.span_fatal(sp, "#concat_idents requires a vector argument .") }
-    };
+    let args: [@ast::expr] =
+        alt arg.node {
+          ast::expr_vec(elts, _) { elts }
+          _ {
+            cx.span_fatal(sp, "#concat_idents requires a vector argument .")
+          }
+        };
     let res: ast::ident = "";
     for e: @ast::expr in args {
         res += expr_to_ident(cx, e, "expected an ident");
     }
 
     ret @{id: cx.next_id(),
-          node: ast::expr_path( {
-              node: {global: false, idents: ~[res], types: ~[]},
-              span: sp}),
+          node:
+              ast::expr_path({node: {global: false, idents: [res], types: []},
+                              span: sp}),
           span: sp};
 }
diff --git a/src/comp/syntax/ext/env.rs b/src/comp/syntax/ext/env.rs
index 50c5bda5858..52a738ab97f 100644
--- a/src/comp/syntax/ext/env.rs
+++ b/src/comp/syntax/ext/env.rs
@@ -12,17 +12,20 @@ export expand_syntax_ext;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
                      _body: option::t<str>) -> @ast::expr {
-    let args: [@ast::expr] = alt arg.node {
-      ast::expr_vec(elts, _) { elts }
-      _ { cx.span_fatal(sp, "#env requires arguments of the form `[...]`.") }
-    };
+    let args: [@ast::expr] =
+        alt arg.node {
+          ast::expr_vec(elts, _) { elts }
+          _ {
+            cx.span_fatal(sp, "#env requires arguments of the form `[...]`.")
+          }
+        };
     if vec::len::<@ast::expr>(args) != 1u {
         cx.span_fatal(sp, "malformed #env call");
     }
     // FIXME: if this was more thorough it would manufacture an
     // option::t<str> rather than just an maybe-empty string.
 
-    let var = expr_to_str(cx, args.(0), "#env requires a string");
+    let var = expr_to_str(cx, args[0], "#env requires a string");
     alt generic_os::getenv(var) {
       option::none. { ret make_new_str(cx, sp, ""); }
       option::some(s) { ret make_new_str(cx, sp, s); }
diff --git a/src/comp/syntax/ext/expand.rs b/src/comp/syntax/ext/expand.rs
index 044bee4ba2b..149216aa6cd 100644
--- a/src/comp/syntax/ext/expand.rs
+++ b/src/comp/syntax/ext/expand.rs
@@ -15,14 +15,14 @@ import syntax::ext::base::*;
 
 
 fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt,
-               e: &expr_, fld: ast_fold,
-               orig: &fn(&expr_, ast_fold) -> expr_ ) -> expr_ {
+               e: &expr_, fld: ast_fold, orig: &fn(&expr_, ast_fold) -> expr_)
+   -> expr_ {
     ret alt e {
           expr_mac(mac) {
             alt mac.node {
               mac_invoc(pth, args, body) {
                 assert (vec::len(pth.node.idents) > 0u);
-                let extname = pth.node.idents.(0);
+                let extname = pth.node.idents[0];
                 alt exts.find(extname) {
                   none. {
                     cx.span_fatal(pth.span,
@@ -41,7 +41,7 @@ fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt,
                   some(macro_defining(ext)) {
                     let named_extension = ext(cx, pth.span, args, body);
                     exts.insert(named_extension.ident, named_extension.ext);
-                    ast::expr_rec(~[], none)
+                    ast::expr_rec([], none)
                   }
                 }
               }
@@ -65,7 +65,6 @@ fn expand_crate(sess: &session::session, c: &@crate) -> @crate {
     ret res;
 
 }
-
 // Local Variables:
 // mode: rust
 // fill-column: 78;
diff --git a/src/comp/syntax/ext/fmt.rs b/src/comp/syntax/ext/fmt.rs
index 738b65c7d91..9b8a1b61684 100644
--- a/src/comp/syntax/ext/fmt.rs
+++ b/src/comp/syntax/ext/fmt.rs
@@ -17,17 +17,20 @@ export expand_syntax_ext;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: span, arg: @ast::expr,
                      _body: option::t<str>) -> @ast::expr {
-    let args: [@ast::expr] = alt arg.node {
-      ast::expr_vec(elts, _) { elts }
-      _ { cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.") }
-    };
+    let args: [@ast::expr] =
+        alt arg.node {
+          ast::expr_vec(elts, _) { elts }
+          _ {
+            cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.")
+          }
+        };
     if vec::len::<@ast::expr>(args) == 0u {
         cx.span_fatal(sp, "#fmt requires a format string");
     }
     let fmt =
-        expr_to_str(cx, args.(0),
+        expr_to_str(cx, args[0],
                     "first argument to #fmt must be a " + "string literal.");
-    let fmtspan = args.(0).span;
+    let fmtspan = args[0].span;
     log "Format string:";
     log fmt;
     fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: str) -> ! {
@@ -66,7 +69,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     }
     fn make_path_expr(cx: &ext_ctxt, sp: span, idents: &[ast::ident]) ->
        @ast::expr {
-        let path = {global: false, idents: idents, types: ~[]};
+        let path = {global: false, idents: idents, types: []};
         let sp_path = {node: path, span: sp};
         let pathexpr = ast::expr_path(sp_path);
         ret @{id: cx.next_id(), node: pathexpr, span: sp};
@@ -85,13 +88,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     fn make_rec_expr(cx: &ext_ctxt, sp: span,
                      fields: &[{ident: ast::ident, ex: @ast::expr}]) ->
        @ast::expr {
-        let astfields: [ast::field] = ~[];
+        let astfields: [ast::field] = [];
         for field: {ident: ast::ident, ex: @ast::expr} in fields {
             let ident = field.ident;
             let val = field.ex;
             let astfield =
                 {node: {mut: ast::imm, ident: ident, expr: val}, span: sp};
-            astfields += ~[astfield];
+            astfields += [astfield];
         }
         let recexpr = ast::expr_rec(astfields, option::none::<@ast::expr>);
         ret @{id: cx.next_id(), node: recexpr, span: sp};
@@ -101,8 +104,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             ret str::find(cx.crate_file_name(), "std.rc") >= 0;
         }
         if compiling_std(cx) {
-            ret ~["extfmt", "rt", ident];
-        } else { ret ~["std", "extfmt", "rt", ident]; }
+            ret ["extfmt", "rt", ident];
+        } else { ret ["std", "extfmt", "rt", ident]; }
     }
     fn make_rt_path_expr(cx: &ext_ctxt, sp: span, ident: str) -> @ast::expr {
         let path = make_path_vec(cx, ident);
@@ -112,9 +115,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     // which tells the RT::conv* functions how to perform the conversion
 
     fn make_rt_conv_expr(cx: &ext_ctxt, sp: span, cnv: &conv) -> @ast::expr {
-        fn make_flags(cx: &ext_ctxt, sp: span, flags: &[flag]) ->
-           @ast::expr {
-            let flagexprs: [@ast::expr] = ~[];
+        fn make_flags(cx: &ext_ctxt, sp: span, flags: &[flag]) -> @ast::expr {
+            let flagexprs: [@ast::expr] = [];
             for f: flag in flags {
                 let fstr;
                 alt f {
@@ -124,14 +126,14 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
                   flag_sign_always. { fstr = "flag_sign_always"; }
                   flag_alternate. { fstr = "flag_alternate"; }
                 }
-                flagexprs += ~[make_rt_path_expr(cx, sp, fstr)];
+                flagexprs += [make_rt_path_expr(cx, sp, fstr)];
             }
             // FIXME: 0-length vectors can't have their type inferred
             // through the rec that these flags are a member of, so
             // this is a hack placeholder flag
 
             if vec::len::<@ast::expr>(flagexprs) == 0u {
-                flagexprs += ~[make_rt_path_expr(cx, sp, "flag_none")];
+                flagexprs += [make_rt_path_expr(cx, sp, "flag_none")];
             }
             ret make_vec_expr(cx, sp, flagexprs);
         }
@@ -143,7 +145,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
               count_is(c) {
                 let count_lit = make_new_int(cx, sp, c);
                 let count_is_path = make_path_vec(cx, "count_is");
-                let count_is_args = ~[count_lit];
+                let count_is_args = [count_lit];
                 ret make_call(cx, sp, count_is_path, count_is_args);
               }
               _ { cx.span_unimpl(sp, "unimplemented #fmt conversion"); }
@@ -168,10 +170,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
                          width_expr: @ast::expr, precision_expr: @ast::expr,
                          ty_expr: @ast::expr) -> @ast::expr {
             ret make_rec_expr(cx, sp,
-                              ~[{ident: "flags", ex: flags_expr},
-                                {ident: "width", ex: width_expr},
-                                {ident: "precision", ex: precision_expr},
-                                {ident: "ty", ex: ty_expr}]);
+                              [{ident: "flags", ex: flags_expr},
+                               {ident: "width", ex: width_expr},
+                               {ident: "precision", ex: precision_expr},
+                               {ident: "ty", ex: ty_expr}]);
         }
         let rt_conv_flags = make_flags(cx, sp, cnv.flags);
         let rt_conv_width = make_count(cx, sp, cnv.width);
@@ -185,7 +187,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
         let fname = "conv_" + conv_type;
         let path = make_path_vec(cx, fname);
         let cnv_expr = make_rt_conv_expr(cx, sp, cnv);
-        let args = ~[cnv_expr, arg];
+        let args = [cnv_expr, arg];
         ret make_call(cx, arg.span, path, args);
     }
     fn make_new_conv(cx: &ext_ctxt, sp: span, cnv: conv, arg: @ast::expr) ->
@@ -304,7 +306,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
           ty_octal. { log "type: octal"; }
         }
     }
-    let fmt_sp = args.(0).span;
+    let fmt_sp = args[0].span;
     let n = 0u;
     let tmp_expr = make_new_str(cx, sp, "");
     let nargs = vec::len::<@ast::expr>(args);
@@ -323,7 +325,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             }
             log "Building conversion:";
             log_conv(conv);
-            let arg_expr = args.(n);
+            let arg_expr = args[n];
             let c_expr = make_new_conv(cx, fmt_sp, conv, arg_expr);
             tmp_expr = make_add_expr(cx, fmt_sp, tmp_expr, c_expr);
           }
@@ -332,9 +334,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     let expected_nargs = n + 1u; // n conversions + the fmt string
 
     if expected_nargs < nargs {
-        cx.span_fatal
-            (sp, #fmt("too many arguments to #fmt. found %u, expected %u",
-                      nargs, expected_nargs));
+        cx.span_fatal(
+            sp,
+            #fmt["too many arguments to #fmt. found %u, expected %u",
+                 nargs, expected_nargs]);
     }
     ret tmp_expr;
 }
diff --git a/src/comp/syntax/ext/ident_to_str.rs b/src/comp/syntax/ext/ident_to_str.rs
index ce24e2605e4..4eb381762fe 100644
--- a/src/comp/syntax/ext/ident_to_str.rs
+++ b/src/comp/syntax/ext/ident_to_str.rs
@@ -5,16 +5,19 @@ import syntax::ast;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
                      _body: option::t<str>) -> @ast::expr {
-    let args: [@ast::expr] = alt arg.node {
-      ast::expr_vec(elts, _) { elts }
-      _ { cx.span_fatal(sp, "#ident_to_str requires a vector argument .") }
-    };
+    let args: [@ast::expr] =
+        alt arg.node {
+          ast::expr_vec(elts, _) { elts }
+          _ {
+            cx.span_fatal(sp, "#ident_to_str requires a vector argument .")
+          }
+        };
     if vec::len::<@ast::expr>(args) != 1u {
         cx.span_fatal(sp, "malformed #ident_to_str call");
     }
 
     ret make_new_lit(cx, sp,
-                     ast::lit_str(expr_to_ident(cx, args.(0u),
+                     ast::lit_str(expr_to_ident(cx, args[0u],
                                                 "expected an ident"),
                                   ast::sk_rc));
 
diff --git a/src/comp/syntax/ext/log_syntax.rs b/src/comp/syntax/ext/log_syntax.rs
index f0834f4f079..a03ff11a66d 100644
--- a/src/comp/syntax/ext/log_syntax.rs
+++ b/src/comp/syntax/ext/log_syntax.rs
@@ -9,5 +9,5 @@ fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
     std::io::stdout().write_line(print::pprust::expr_to_str(arg));
 
     //trivial expression
-    ret @{id: cx.next_id(), node: ast::expr_rec(~[], option::none), span: sp};
+    ret @{id: cx.next_id(), node: ast::expr_rec([], option::none), span: sp};
 }
diff --git a/src/comp/syntax/ext/simplext.rs b/src/comp/syntax/ext/simplext.rs
index 9b8a5e28e09..e5dd343203a 100644
--- a/src/comp/syntax/ext/simplext.rs
+++ b/src/comp/syntax/ext/simplext.rs
@@ -34,7 +34,7 @@ export add_new_extension;
 
 fn path_to_ident(pth: &path) -> option::t<ident> {
     if vec::len(pth.node.idents) == 1u && vec::len(pth.node.types) == 0u {
-        ret some(pth.node.idents.(0u));
+        ret some(pth.node.idents[0u]);
     }
     ret none;
 }
@@ -89,10 +89,10 @@ fn match_error(cx: &ext_ctxt, m: &matchable, expected: &str) -> ! {
 // we'll want to return something indicating amount of progress and location
 // of failure instead of `none`.
 type match_result = option::t<arb_depth<matchable>>;
-type selector = fn(&matchable) -> match_result ;
+type selector = fn(&matchable) -> match_result;
 
-fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr])
-    -> {pre: [@expr], rep: option::t<@expr>, post: [@expr]} {
+fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) ->
+   {pre: [@expr], rep: option::t<@expr>, post: [@expr]} {
     let idx: uint = 0u;
     let res = none;
     for elt: @expr in elts {
@@ -103,10 +103,10 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr])
                 if res != none {
                     cx.span_fatal(m.span, "only one ellipsis allowed");
                 }
-                res = some({pre: vec::slice(elts, 0u, idx - 1u),
-                            rep: some(elts.(idx - 1u)),
-                            post: vec::slice(elts, idx + 1u,
-                                              vec::len(elts))});
+                res =
+                    some({pre: vec::slice(elts, 0u, idx - 1u),
+                          rep: some(elts[idx - 1u]),
+                          post: vec::slice(elts, idx + 1u, vec::len(elts))});
               }
               _ { }
             }
@@ -116,16 +116,16 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr])
         idx += 1u;
     }
     ret alt res {
-      some(val) { val }
-      none. { {pre: elts, rep: none, post: ~[]} }
-    }
+          some(val) { val }
+          none. { {pre: elts, rep: none, post: []} }
+        }
 }
 
 fn option_flatten_map<T, U>(f: &fn(&T) -> option::t<U>, v: &[T]) ->
    option::t<[U]> {
-    let res = ~[];
+    let res = [];
     for elem: T in v {
-        alt f(elem) { none. { ret none; } some(fv) { res += ~[fv]; } }
+        alt f(elem) { none. { ret none; } some(fv) { res += [fv]; } }
     }
     ret some(res);
 }
@@ -168,7 +168,7 @@ fn acumm_bindings(_cx: &ext_ctxt, _b_dest: &bindings, _b_src: &bindings) { }
 fn pattern_to_selectors(cx: &ext_ctxt, e: @expr) -> binders {
     let res: binders =
         {real_binders: new_str_hash::<selector>(),
-         mutable literal_ast_matchers: ~[]};
+         mutable literal_ast_matchers: []};
     //this oughta return binders instead, but macro args are a sequence of
     //expressions, rather than a single expression
     fn trivial_selector(m: &matchable) -> match_result { ret some(leaf(m)); }
@@ -203,7 +203,7 @@ fn use_selectors_to_bind(b: &binders, e: @expr) -> option::t<bindings> {
 /* use the bindings on the body to generate the expanded code */
 
 fn transcribe(cx: &ext_ctxt, b: &bindings, body: @expr) -> @expr {
-    let idx_path: @mutable [uint] = @mutable ~[];
+    let idx_path: @mutable [uint] = @mutable [];
     fn new_id(_old: node_id, cx: &ext_ctxt) -> node_id { ret cx.next_id(); }
     fn new_span(cx: &ext_ctxt, sp: &span) -> span {
         /* this discards information in the case of macro-defining macros */
@@ -236,7 +236,7 @@ fn follow(m: &arb_depth<matchable>, idx_path: @mutable [uint]) ->
     for idx: uint in *idx_path {
         alt res {
           leaf(_) { ret res;/* end of the line */ }
-          seq(new_ms, _) { res = new_ms.(idx); }
+          seq(new_ms, _) { res = new_ms[idx]; }
         }
     }
     ret res;
@@ -282,13 +282,12 @@ iter free_vars(b: &bindings, e: @expr) -> ident {
 
 /* handle sequences (anywhere in the AST) of exprs, either real or ...ed */
 fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
-                    recur: fn(&@expr) -> @expr , exprs: [@expr])
-    -> [@expr] {
+                    recur: fn(&@expr) -> @expr, exprs: [@expr]) -> [@expr] {
     alt elts_to_ell(cx, exprs) {
       {pre: pre, rep: repeat_me_maybe, post: post} {
         let res = vec::map(recur, pre);
         alt repeat_me_maybe {
-          none. {}
+          none. { }
           some(repeat_me) {
             let repeat: option::t<{rep_count: uint, name: ident}> = none;
             /* we need to walk over all the free vars in lockstep, except for
@@ -305,9 +304,10 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                       some({rep_count: old_len, name: old_name}) {
                         let len = vec::len(*ms);
                         if old_len != len {
-                            let msg = #fmt("'%s' occurs %u times, but ", fv,
-                                           len) + #fmt("'%s' occurs %u times",
-                                                       old_name, old_len);
+                            let msg =
+                                #fmt["'%s' occurs %u times, but ", fv, len] +
+                                    #fmt["'%s' occurs %u times", old_name,
+                                         old_len];
                             cx.span_fatal(repeat_me.span, msg);
                         }
                       }
@@ -319,14 +319,14 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
               none. {
                 cx.span_fatal(repeat_me.span,
                               "'...' surrounds an expression without any" +
-                              " repeating syntax variables");
+                                  " repeating syntax variables");
               }
               some({rep_count: rc, _}) {
                 /* Whew, we now know how how many times to repeat */
                 let idx: uint = 0u;
                 while idx < rc {
-                    *idx_path += ~[idx];
-                    res += ~[recur(repeat_me)]; // whew!
+                    *idx_path += [idx];
+                    res += [recur(repeat_me)]; // whew!
                     vec::pop(*idx_path);
                     idx += 1u;
                 }
@@ -357,9 +357,9 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                    p: &path_, _fld: ast_fold) -> path_ {
     // Don't substitute into qualified names.
     if vec::len(p.types) > 0u || vec::len(p.idents) != 1u { ret p; }
-    ret alt follow_for_trans(cx, b.find(p.idents.(0)), idx_path) {
+    ret alt follow_for_trans(cx, b.find(p.idents[0]), idx_path) {
           some(match_ident(id)) {
-            {global: false, idents: ~[id.node], types: ~[]}
+            {global: false, idents: [id.node], types: []}
           }
           some(match_path(a_pth)) { a_pth.node }
           some(m) { match_error(cx, m, "a path") }
@@ -370,21 +370,20 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
 
 fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                    e: &ast::expr_, fld: ast_fold,
-                   orig: fn(&ast::expr_, ast_fold) -> ast::expr_ ) ->
+                   orig: fn(&ast::expr_, ast_fold) -> ast::expr_) ->
    ast::expr_ {
     ret alt e {
           expr_path(p) {
             // Don't substitute into qualified names.
-            if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u
-               {
+            if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u {
                 e
             }
-            alt follow_for_trans(cx, b.find(p.node.idents.(0)), idx_path) {
+            alt follow_for_trans(cx, b.find(p.node.idents[0]), idx_path) {
               some(match_ident(id)) {
                 expr_path(respan(id.span,
                                  {global: false,
-                                  idents: ~[id.node],
-                                  types: ~[]}))
+                                  idents: [id.node],
+                                  types: []}))
               }
               some(match_path(a_pth)) { expr_path(a_pth) }
               some(match_expr(a_exp)) { a_exp.node }
@@ -398,7 +397,7 @@ fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
 
 fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                    t: &ast::ty_, fld: ast_fold,
-                   orig: fn(&ast::ty_, ast_fold) -> ast::ty_ ) -> ast::ty_ {
+                   orig: fn(&ast::ty_, ast_fold) -> ast::ty_) -> ast::ty_ {
     ret alt t {
           ast::ty_path(pth, _) {
             alt path_to_ident(pth) {
@@ -422,12 +421,13 @@ fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
 
 fn transcribe_block(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                     blk: &blk_, fld: ast_fold,
-                    orig: fn(&blk_, ast_fold) -> blk_ ) -> blk_ {
+                    orig: fn(&blk_, ast_fold) -> blk_) -> blk_ {
     ret alt block_to_ident(blk) {
           some(id) {
             alt follow_for_trans(cx, b.find(id), idx_path) {
               some(match_block(new_blk)) { new_blk.node }
 
+
               // possibly allow promotion of ident/path/expr to blocks?
               some(m) {
                 match_error(cx, m, "a block")
@@ -452,20 +452,20 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
           expr_vec(p_elts, _) {
             alt elts_to_ell(cx, p_elts) {
               {pre: pre, rep: some(repeat_me), post: post} {
-                p_t_s_r_length(cx, vec::len(pre) + vec::len(post),
-                               true, s, b);
-                if(vec::len(pre) > 0u) {
+                p_t_s_r_length(cx, vec::len(pre) + vec::len(post), true, s,
+                               b);
+                if vec::len(pre) > 0u {
                     p_t_s_r_actual_vector(cx, pre, true, s, b);
                 }
                 p_t_s_r_ellipses(cx, repeat_me, vec::len(pre), s, b);
 
-                if(vec::len(post) > 0u) {
+                if vec::len(post) > 0u {
                     cx.span_unimpl(e.span,
                                    "matching after `...` not yet supported");
                 }
               }
               {pre: pre, rep: none., post: post} {
-                if post != ~[] {
+                if post != [] {
                     cx.bug("elts_to_ell provided an invalid result");
                 }
                 p_t_s_r_length(cx, vec::len(pre), false, s, b);
@@ -474,6 +474,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
             }
           }
 
+
           /* TODO: handle embedded types and blocks, at least */
           expr_mac(mac) {
             p_t_s_r_mac(cx, mac, s, b);
@@ -488,7 +489,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
                       _ { cx.bug("broken traversal in p_t_s_r") }
                     }
             }
-            b.literal_ast_matchers += ~[bind select(cx, _, e)];
+            b.literal_ast_matchers += [bind select(cx, _, e)];
           }
         }
       }
@@ -545,7 +546,7 @@ fn block_to_ident(blk: &blk_) -> option::t<ident> {
 
 fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) {
     fn select_pt_1(cx: &ext_ctxt, m: &matchable,
-                   fn_m: fn(&ast::mac) -> match_result ) -> match_result {
+                   fn_m: fn(&ast::mac) -> match_result) -> match_result {
         ret alt m {
               match_expr(e) {
                 alt e.node { expr_mac(mac) { fn_m(mac) } _ { none } }
@@ -603,17 +604,18 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) {
 fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint,
                     s: &selector, b: &binders) {
     fn select(cx: &ext_ctxt, repeat_me: @expr, offset: uint, m: &matchable) ->
-        match_result {
+       match_result {
         ret alt m {
               match_expr(e) {
                 alt e.node {
                   expr_vec(arg_elts, _) {
-                    let elts = ~[];
+                    let elts = [];
                     let idx = offset;
                     while idx < vec::len(arg_elts) {
-                        elts += ~[leaf(match_expr(arg_elts.(idx)))];
+                        elts += [leaf(match_expr(arg_elts[idx]))];
                         idx += 1u;
                     }
+
                     // using repeat_me.span is a little wacky, but the
                     // error we want to report is one in the macro def
                     some(seq(@elts, repeat_me.span))
@@ -631,14 +633,14 @@ fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint,
 
 fn p_t_s_r_length(cx: &ext_ctxt, len: uint, at_least: bool, s: selector,
                   b: &binders) {
-    fn len_select(_cx: &ext_ctxt, m: &matchable, at_least: bool, len: uint)
-        -> match_result {
+    fn len_select(_cx: &ext_ctxt, m: &matchable, at_least: bool, len: uint) ->
+       match_result {
         ret alt m {
               match_expr(e) {
                 alt e.node {
                   expr_vec(arg_elts, _) {
                     let actual_len = vec::len(arg_elts);
-                    if (at_least && actual_len >= len) || actual_len == len {
+                    if at_least && actual_len >= len || actual_len == len {
                         some(leaf(match_exact))
                     } else { none }
                   }
@@ -649,7 +651,7 @@ fn p_t_s_r_length(cx: &ext_ctxt, len: uint, at_least: bool, s: selector,
             }
     }
     b.literal_ast_matchers +=
-        ~[compose_sels(s, bind len_select(cx, _, at_least, len))];
+        [compose_sels(s, bind len_select(cx, _, at_least, len))];
 }
 
 fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
@@ -661,7 +663,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
                   match_expr(e) {
                     alt e.node {
                       expr_vec(arg_elts, _) {
-                        some(leaf(match_expr(arg_elts.(idx))))
+                        some(leaf(match_expr(arg_elts[idx])))
                       }
                       _ { none }
                     }
@@ -669,7 +671,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
                   _ { cx.bug("broken traversal in p_t_s_r") }
                 }
         }
-        p_t_s_rec(cx, match_expr(elts.(idx)),
+        p_t_s_rec(cx, match_expr(elts[idx]),
                   compose_sels(s, bind select(cx, _, idx)), b);
         idx += 1u;
     }
@@ -677,15 +679,17 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
 
 fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                      _body: option::t<str>) -> base::macro_def {
-    let args: [@ast::expr] = alt arg.node {
-      ast::expr_vec(elts, _) { elts }
-      _ {
-        cx.span_fatal(sp, "#macro requires arguments of the form `[...]`.")
-      }
-    };
+    let args: [@ast::expr] =
+        alt arg.node {
+          ast::expr_vec(elts, _) { elts }
+          _ {
+            cx.span_fatal(sp,
+                          "#macro requires arguments of the form `[...]`.")
+          }
+        };
 
     let macro_name: option::t<str> = none;
-    let clauses: [@clause] = ~[];
+    let clauses: [@clause] = [];
     for arg: @expr in args {
         alt arg.node {
           expr_vec(elts, mut) {
@@ -696,7 +700,7 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
             }
 
 
-            alt elts.(0u).node {
+            alt elts[0u].node {
               expr_mac(mac) {
                 alt mac.node {
                   mac_invoc(pth, invoc_arg, body) {
@@ -706,8 +710,9 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                           none. { macro_name = some(id); }
                           some(other_id) {
                             if id != other_id {
-                                cx.span_fatal(pth.span, "macro name must be "
-                                              + "consistent");
+                                cx.span_fatal(pth.span,
+                                              "macro name must be " +
+                                                  "consistent");
                             }
                           }
                         }
@@ -718,15 +723,15 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                       }
                     }
                     clauses +=
-                        ~[@{params: pattern_to_selectors(cx, invoc_arg),
-                            body: elts.(1u)}];
+                        [@{params: pattern_to_selectors(cx, invoc_arg),
+                           body: elts[1u]}];
                     // FIXME: check duplicates (or just simplify
                     // the macro arg situation)
                   }
                 }
               }
               _ {
-                cx.span_fatal(elts.(0u).span,
+                cx.span_fatal(elts[0u].span,
                               "extension clause must" +
                                   " start with a macro invocation.");
               }
@@ -756,9 +761,7 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                          _body: option::t<str>, clauses: [@clause]) -> @expr {
         for c: @clause in clauses {
             alt use_selectors_to_bind(c.params, arg) {
-              some(bindings) {
-                ret transcribe(cx, bindings, c.body)
-              }
+              some(bindings) { ret transcribe(cx, bindings, c.body) }
               none. { cont; }
             }
         }
diff --git a/src/comp/syntax/fold.rs b/src/comp/syntax/fold.rs
index 5593ddb21c6..b781a2481c2 100644
--- a/src/comp/syntax/fold.rs
+++ b/src/comp/syntax/fold.rs
@@ -20,57 +20,57 @@ type ast_fold = @mutable a_f;
 
 type ast_fold_precursor =
     //unlike the others, item_ is non-trivial
-    {fold_crate: fn(&crate_, ast_fold) -> crate_ ,
+    {fold_crate: fn(&crate_, ast_fold) -> crate_,
      fold_crate_directive:
-         fn(&crate_directive_, ast_fold) -> crate_directive_ ,
-     fold_view_item: fn(&view_item_, ast_fold) -> view_item_ ,
-     fold_native_item: fn(&@native_item, ast_fold) -> @native_item ,
-     fold_item: fn(&@item, ast_fold) -> @item ,
-     fold_item_underscore: fn(&item_, ast_fold) -> item_ ,
-     fold_method: fn(&method_, ast_fold) -> method_ ,
-     fold_block: fn(&blk_, ast_fold) -> blk_ ,
-     fold_stmt: fn(&stmt_, ast_fold) -> stmt_ ,
-     fold_arm: fn(&arm, ast_fold) -> arm ,
-     fold_pat: fn(&pat_, ast_fold) -> pat_ ,
-     fold_decl: fn(&decl_, ast_fold) -> decl_ ,
-     fold_expr: fn(&expr_, ast_fold) -> expr_ ,
-     fold_ty: fn(&ty_, ast_fold) -> ty_ ,
-     fold_constr: fn(&ast::constr_, ast_fold) -> constr_ ,
-     fold_fn: fn(&_fn, ast_fold) -> _fn ,
-     fold_mod: fn(&_mod, ast_fold) -> _mod ,
-     fold_native_mod: fn(&native_mod, ast_fold) -> native_mod ,
-     fold_variant: fn(&variant_, ast_fold) -> variant_ ,
-     fold_ident: fn(&ident, ast_fold) -> ident ,
-     fold_path: fn(&path_, ast_fold) -> path_ ,
-     fold_local: fn(&local_, ast_fold) -> local_ ,
-     map_exprs: fn(fn(&@expr) -> @expr , [@expr]) -> [@expr],
+         fn(&crate_directive_, ast_fold) -> crate_directive_,
+     fold_view_item: fn(&view_item_, ast_fold) -> view_item_,
+     fold_native_item: fn(&@native_item, ast_fold) -> @native_item,
+     fold_item: fn(&@item, ast_fold) -> @item,
+     fold_item_underscore: fn(&item_, ast_fold) -> item_,
+     fold_method: fn(&method_, ast_fold) -> method_,
+     fold_block: fn(&blk_, ast_fold) -> blk_,
+     fold_stmt: fn(&stmt_, ast_fold) -> stmt_,
+     fold_arm: fn(&arm, ast_fold) -> arm,
+     fold_pat: fn(&pat_, ast_fold) -> pat_,
+     fold_decl: fn(&decl_, ast_fold) -> decl_,
+     fold_expr: fn(&expr_, ast_fold) -> expr_,
+     fold_ty: fn(&ty_, ast_fold) -> ty_,
+     fold_constr: fn(&ast::constr_, ast_fold) -> constr_,
+     fold_fn: fn(&_fn, ast_fold) -> _fn,
+     fold_mod: fn(&_mod, ast_fold) -> _mod,
+     fold_native_mod: fn(&native_mod, ast_fold) -> native_mod,
+     fold_variant: fn(&variant_, ast_fold) -> variant_,
+     fold_ident: fn(&ident, ast_fold) -> ident,
+     fold_path: fn(&path_, ast_fold) -> path_,
+     fold_local: fn(&local_, ast_fold) -> local_,
+     map_exprs: fn(fn(&@expr) -> @expr, [@expr]) -> [@expr],
      new_id: fn(node_id) -> node_id,
      new_span: fn(&span) -> span};
 
 type a_f =
-    {fold_crate: fn(&crate) -> crate ,
-     fold_crate_directive: fn(&@crate_directive) -> @crate_directive ,
-     fold_view_item: fn(&@view_item) -> @view_item ,
-     fold_native_item: fn(&@native_item) -> @native_item ,
-     fold_item: fn(&@item) -> @item ,
-     fold_item_underscore: fn(&item_) -> item_ ,
-     fold_method: fn(&@method) -> @method ,
-     fold_block: fn(&blk) -> blk ,
-     fold_stmt: fn(&@stmt) -> @stmt ,
-     fold_arm: fn(&arm) -> arm ,
-     fold_pat: fn(&@pat) -> @pat ,
-     fold_decl: fn(&@decl) -> @decl ,
-     fold_expr: fn(&@expr) -> @expr ,
-     fold_ty: fn(&@ty) -> @ty ,
-     fold_constr: fn(&@constr) -> @constr ,
-     fold_fn: fn(&_fn) -> _fn ,
-     fold_mod: fn(&_mod) -> _mod ,
-     fold_native_mod: fn(&native_mod) -> native_mod ,
-     fold_variant: fn(&variant) -> variant ,
-     fold_ident: fn(&ident) -> ident ,
-     fold_path: fn(&path) -> path ,
-     fold_local: fn(&@local) -> @local ,
-     map_exprs: fn(fn(&@expr) -> @expr , [@expr]) -> [@expr],
+    {fold_crate: fn(&crate) -> crate,
+     fold_crate_directive: fn(&@crate_directive) -> @crate_directive,
+     fold_view_item: fn(&@view_item) -> @view_item,
+     fold_native_item: fn(&@native_item) -> @native_item,
+     fold_item: fn(&@item) -> @item,
+     fold_item_underscore: fn(&item_) -> item_,
+     fold_method: fn(&@method) -> @method,
+     fold_block: fn(&blk) -> blk,
+     fold_stmt: fn(&@stmt) -> @stmt,
+     fold_arm: fn(&arm) -> arm,
+     fold_pat: fn(&@pat) -> @pat,
+     fold_decl: fn(&@decl) -> @decl,
+     fold_expr: fn(&@expr) -> @expr,
+     fold_ty: fn(&@ty) -> @ty,
+     fold_constr: fn(&@constr) -> @constr,
+     fold_fn: fn(&_fn) -> _fn,
+     fold_mod: fn(&_mod) -> _mod,
+     fold_native_mod: fn(&native_mod) -> native_mod,
+     fold_variant: fn(&variant) -> variant,
+     fold_ident: fn(&ident) -> ident,
+     fold_path: fn(&path) -> path,
+     fold_local: fn(&@local) -> @local,
+     map_exprs: fn(fn(&@expr) -> @expr, [@expr]) -> [@expr],
      new_id: fn(node_id) -> node_id,
      new_span: fn(&span) -> span};
 
@@ -120,7 +120,7 @@ fn fold_meta_item_(mi: &@meta_item, fld: ast_fold) -> @meta_item {
           span: mi.span};
 }
 //used in noop_fold_item and noop_fold_crate
-fn fold_attribute_(at: &attribute, fmi: fn(&@meta_item) -> @meta_item ) ->
+fn fold_attribute_(at: &attribute, fmi: fn(&@meta_item) -> @meta_item) ->
    attribute {
     ret {node: {style: at.node.style, value: *fmi(@at.node.value)},
          span: at.span};
@@ -135,14 +135,14 @@ fn fold_arg_(a: &arg, fld: ast_fold) -> arg {
 //used in noop_fold_expr, and possibly elsewhere in the future
 fn fold_mac_(m: &mac, fld: ast_fold) -> mac {
     ret {node:
-         alt m.node {
-           mac_invoc(pth, arg, body) {
-             mac_invoc(fld.fold_path(pth), fld.fold_expr(arg), body)
-           }
-           mac_embed_type(ty) { mac_embed_type(fld.fold_ty(ty)) }
-           mac_embed_block(blk) { mac_embed_block(fld.fold_block(blk)) }
-           mac_ellipsis. { mac_ellipsis }
-         },
+             alt m.node {
+               mac_invoc(pth, arg, body) {
+                 mac_invoc(fld.fold_path(pth), fld.fold_expr(arg), body)
+               }
+               mac_embed_type(ty) { mac_embed_type(fld.fold_ty(ty)) }
+               mac_embed_block(blk) { mac_embed_block(fld.fold_block(blk)) }
+               mac_ellipsis. { mac_ellipsis }
+             },
          span: m.span};
 }
 
@@ -200,7 +200,7 @@ fn noop_fold_native_item(ni: &@native_item, fld: ast_fold) -> @native_item {
                                   cf: fdec.cf,
                                   constraints:
                                       vec::map(fld.fold_constr,
-                                                fdec.constraints)}, typms)
+                                               fdec.constraints)}, typms)
                 }
               },
           id: ni.id,
@@ -238,8 +238,8 @@ fn noop_fold_item_underscore(i: &item_, fld: ast_fold) -> item_ {
           }
           item_obj(o, typms, d) {
             item_obj({fields: vec::map(fold_obj_field, o.fields),
-                      methods: vec::map(fld.fold_method, o.methods)},
-                     typms, d)
+                      methods: vec::map(fld.fold_method, o.methods)}, typms,
+                     d)
           }
           item_res(dtor, did, typms, cid) {
             item_res(fld.fold_fn(dtor), did, typms, cid)
@@ -269,8 +269,7 @@ fn noop_fold_stmt(s: &stmt_, fld: ast_fold) -> stmt_ {
 }
 
 fn noop_fold_arm(a: &arm, fld: ast_fold) -> arm {
-    ret {pats: vec::map(fld.fold_pat, a.pats),
-         body: fld.fold_block(a.body)};
+    ret {pats: vec::map(fld.fold_pat, a.pats), body: fld.fold_block(a.body)};
 }
 
 fn noop_fold_pat(p: &pat_, fld: ast_fold) -> pat_ {
@@ -282,15 +281,13 @@ fn noop_fold_pat(p: &pat_, fld: ast_fold) -> pat_ {
             pat_tag(fld.fold_path(pth), vec::map(fld.fold_pat, pats))
           }
           pat_rec(fields, etc) {
-            let fs = ~[];
+            let fs = [];
             for f: ast::field_pat in fields {
-                fs += ~[{ident: f.ident, pat: fld.fold_pat(f.pat)}];
+                fs += [{ident: f.ident, pat: fld.fold_pat(f.pat)}];
             }
             pat_rec(fs, etc)
           }
-          pat_tup(elts) {
-            pat_tup(vec::map(fld.fold_pat, elts))
-          }
+          pat_tup(elts) { pat_tup(vec::map(fld.fold_pat, elts)) }
           pat_box(inner) { pat_box(fld.fold_pat(inner)) }
         };
 }
@@ -346,9 +343,7 @@ fn noop_fold_expr(e: &expr_, fld: ast_fold) -> expr_ {
             expr_rec(vec::map(fold_field, fields),
                      option::map(fld.fold_expr, maybe_expr))
           }
-          expr_tup(elts) {
-            expr_tup(vec::map(fld.fold_expr, elts))
-          }
+          expr_tup(elts) { expr_tup(vec::map(fld.fold_expr, elts)) }
           expr_call(f, args) {
             expr_call(fld.fold_expr(f), fld.map_exprs(fld.fold_expr, args))
           }
@@ -393,9 +388,7 @@ fn noop_fold_expr(e: &expr_, fld: ast_fold) -> expr_ {
           expr_move(el, er) {
             expr_move(fld.fold_expr(el), fld.fold_expr(er))
           }
-          expr_copy(e) {
-            expr_copy(fld.fold_expr(e))
-          }
+          expr_copy(e) { expr_copy(fld.fold_expr(e)) }
           expr_assign(el, er) {
             expr_assign(fld.fold_expr(el), fld.fold_expr(er))
           }
@@ -487,19 +480,20 @@ fn noop_fold_path(p: &path_, fld: ast_fold) -> path_ {
 fn noop_fold_local(l: &local_, fld: ast_fold) -> local_ {
     ret {ty: fld.fold_ty(l.ty),
          pat: fld.fold_pat(l.pat),
-         init: alt l.init {
-           option::none::<initializer>. { l.init }
-           option::some::<initializer>(init) {
-             option::some::<initializer>({op: init.op,
-                                        expr: fld.fold_expr(init.expr)})
-           }
-         },
+         init:
+             alt l.init {
+               option::none::<initializer>. { l.init }
+               option::some::<initializer>(init) {
+                 option::some::<initializer>({op: init.op,
+                                              expr: fld.fold_expr(init.expr)})
+               }
+             },
          id: l.id};
 }
 
 /* temporarily eta-expand because of a compiler bug with using `fn<T>` as a
    value */
-fn noop_map_exprs(f: fn(&@expr) -> @expr , es: [@expr]) -> [@expr] {
+fn noop_map_exprs(f: fn(&@expr) -> @expr, es: [@expr]) -> [@expr] {
     ret vec::map(f, es);
 }
 
@@ -634,14 +628,16 @@ fn make_fold(afp: &ast_fold_precursor) -> ast_fold {
     }
     fn f_pat(afp: &ast_fold_precursor, f: ast_fold, x: &@pat) -> @pat {
         ret @{id: afp.new_id(x.id),
-              node: afp.fold_pat(x.node, f), span: afp.new_span(x.span)};
+              node: afp.fold_pat(x.node, f),
+              span: afp.new_span(x.span)};
     }
     fn f_decl(afp: &ast_fold_precursor, f: ast_fold, x: &@decl) -> @decl {
         ret @{node: afp.fold_decl(x.node, f), span: afp.new_span(x.span)};
     }
     fn f_expr(afp: &ast_fold_precursor, f: ast_fold, x: &@expr) -> @expr {
         ret @{id: afp.new_id(x.id),
-              node: afp.fold_expr(x.node, f), span: afp.new_span(x.span)};
+              node: afp.fold_expr(x.node, f),
+              span: afp.new_span(x.span)};
     }
     fn f_ty(afp: &ast_fold_precursor, f: ast_fold, x: &@ty) -> @ty {
         ret @{node: afp.fold_ty(x.node, f), span: afp.new_span(x.span)};
diff --git a/src/comp/syntax/parse/eval.rs b/src/comp/syntax/parse/eval.rs
index fb52960517d..af1ba91b37b 100644
--- a/src/comp/syntax/parse/eval.rs
+++ b/src/comp/syntax/parse/eval.rs
@@ -26,8 +26,7 @@ type ctx =
       cfg: ast::crate_cfg};
 
 fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive],
-                         prefix: str,
-                         view_items: &mutable [@ast::view_item],
+                         prefix: str, view_items: &mutable [@ast::view_item],
                          items: &mutable [@ast::item]) {
     for sub_cdir: @ast::crate_directive in cdirs {
         eval_crate_directive(cx, sub_cdir, prefix, view_items, items);
@@ -36,8 +35,8 @@ fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive],
 
 fn eval_crate_directives_to_mod(cx: ctx, cdirs: &[@ast::crate_directive],
                                 prefix: str) -> ast::_mod {
-    let view_items: [@ast::view_item] = ~[];
-    let items: [@ast::item] = ~[];
+    let view_items: [@ast::view_item] = [];
+    let items: [@ast::item] = [];
     eval_crate_directives(cx, cdirs, prefix, view_items, items);
     ret {view_items: view_items, items: items};
 }
@@ -53,7 +52,7 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str,
             if std::fs::path_is_absolute(file_path) {
                 file_path
             } else { prefix + std::fs::path_sep() + file_path };
-        if cx.mode == mode_depend { cx.deps += ~[full_path]; ret; }
+        if cx.mode == mode_depend { cx.deps += [full_path]; ret; }
         let p0 =
             new_parser_from_file(cx.sess, cx.cfg, full_path, cx.chpos,
                                  cx.byte_pos, SOURCE_FILE);
@@ -68,7 +67,7 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str,
         // Thread defids, chpos and byte_pos through the parsers
         cx.chpos = p0.get_chpos();
         cx.byte_pos = p0.get_byte_pos();
-        items += ~[i];
+        items += [i];
       }
       ast::cdir_dir_mod(id, dir_opt, cdirs, attrs) {
         let path = id;
@@ -85,9 +84,9 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str,
               node: ast::item_mod(m0),
               span: cdir.span};
         cx.sess.next_id += 1;
-        items += ~[i];
+        items += [i];
       }
-      ast::cdir_view_item(vi) { view_items += ~[vi]; }
+      ast::cdir_view_item(vi) { view_items += [vi]; }
       ast::cdir_syntax(pth) { }
       ast::cdir_auth(pth, eff) { }
     }
diff --git a/src/comp/syntax/parse/lexer.rs b/src/comp/syntax/parse/lexer.rs
index 9e78c8e7e82..6e4cc10abb7 100644
--- a/src/comp/syntax/parse/lexer.rs
+++ b/src/comp/syntax/parse/lexer.rs
@@ -14,18 +14,18 @@ import codemap;
 
 type reader =
     obj {
-        fn is_eof() -> bool ;
-        fn curr() -> char ;
-        fn next() -> char ;
-        fn init() ;
-        fn bump() ;
-        fn get_str_from(uint) -> str ;
-        fn get_interner() -> @interner::interner<str> ;
-        fn get_chpos() -> uint ;
-        fn get_byte_pos() -> uint ;
-        fn get_col() -> uint ;
-        fn get_filemap() -> codemap::filemap ;
-        fn err(str) ;
+        fn is_eof() -> bool;
+        fn curr() -> char;
+        fn next() -> char;
+        fn init();
+        fn bump();
+        fn get_str_from(uint) -> str;
+        fn get_interner() -> @interner::interner<str>;
+        fn get_chpos() -> uint;
+        fn get_byte_pos() -> uint;
+        fn get_col() -> uint;
+        fn get_filemap() -> codemap::filemap;
+        fn err(str);
     };
 
 fn new_reader(cm: &codemap::codemap, src: str, filemap: codemap::filemap,
@@ -81,7 +81,7 @@ fn new_reader(cm: &codemap::codemap, src: str, filemap: codemap::filemap,
             codemap::emit_error(some(ast::mk_sp(chpos, chpos)), m, cm);
         }
     }
-    let strs: [str] = ~[];
+    let strs: [str] = [];
     let rd =
         reader(cm, src, str::byte_len(src), 0u, 0u, -1 as char,
                filemap.start_pos.ch, strs, filemap, itr);
@@ -166,10 +166,7 @@ fn consume_block_comment(rdr: &reader) {
 
 fn digits_to_string(s: str) -> int {
     let accum_int: int = 0;
-    for c: u8 in s {
-        accum_int *= 10;
-        accum_int += dec_digit_val(c as char);
-    }
+    for c: u8 in s { accum_int *= 10; accum_int += dec_digit_val(c as char); }
     ret accum_int;
 }
 
@@ -177,11 +174,11 @@ fn scan_exponent(rdr: &reader) -> option::t<str> {
     let c = rdr.curr();
     let rslt = "";
     if c == 'e' || c == 'E' {
-        rslt += str::unsafe_from_bytes(~[c as u8]);
+        rslt += str::unsafe_from_bytes([c as u8]);
         rdr.bump();
         c = rdr.curr();
         if c == '-' || c == '+' {
-            rslt += str::unsafe_from_bytes(~[c as u8]);
+            rslt += str::unsafe_from_bytes([c as u8]);
             rdr.bump();
         }
         let exponent = scan_dec_digits(rdr);
@@ -195,7 +192,7 @@ fn scan_dec_digits(rdr: &reader) -> str {
     let c = rdr.curr();
     let rslt: str = "";
     while is_dec_digit(c) || c == '_' {
-        if c != '_' { rslt += str::unsafe_from_bytes(~[c as u8]); }
+        if c != '_' { rslt += str::unsafe_from_bytes([c as u8]); }
         rdr.bump();
         c = rdr.curr();
     }
@@ -216,7 +213,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token {
             rdr.bump();
             c = rdr.curr();
         }
-    } else if (c == '0' && n == 'b') {
+    } else if c == '0' && n == 'b' {
         rdr.bump();
         rdr.bump();
         c = rdr.curr();
@@ -290,7 +287,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token {
                 ret token::LIT_MACH_FLOAT(ast::ty_f32,
                                           intern(*rdr.get_interner(),
                                                  float_str));
-            } else if (c == '6' && n == '4') {
+            } else if c == '6' && n == '4' {
                 rdr.bump();
                 rdr.bump();
                 ret token::LIT_MACH_FLOAT(ast::ty_f64,
@@ -302,14 +299,14 @@ fn scan_number(c: char, rdr: &reader) -> token::token {
             }
         } else {
             ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(),
-                                                       float_str));
+                                                         float_str));
         }
     }
     let maybe_exponent = scan_exponent(rdr);
     alt maybe_exponent {
       some(s) {
         ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(),
-                                                   dec_str + s));
+                                                     dec_str + s));
       }
       none. { ret token::LIT_INT(accum_int); }
     }
@@ -321,7 +318,7 @@ fn scan_numeric_escape(rdr: &reader, n_hex_digits: uint) -> char {
         let n = rdr.curr();
         rdr.bump();
         if !is_hex_digit(n) {
-            rdr.err(#fmt("illegal numeric character escape: %d", n as int));
+            rdr.err(#fmt["illegal numeric character escape: %d", n as int]);
             fail;
         }
         accum_int *= 16;
@@ -351,7 +348,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
         if str::eq(accum_str, "_") { ret token::UNDERSCORE; }
         let is_mod_name = c == ':' && rdr.next() == ':';
         ret token::IDENT(interner::intern::<str>(*rdr.get_interner(),
-                                               accum_str), is_mod_name);
+                                                 accum_str), is_mod_name);
     }
     if is_dec_digit(c) { ret scan_number(c, rdr); }
     fn binop(rdr: &reader, op: token::binop) -> token::token {
@@ -363,6 +360,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
     }
     alt c {
 
+
       // One-byte tokens.
       '?' {
         rdr.bump();
@@ -401,6 +399,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
         } else { ret token::COLON; }
       }
 
+
       // Multi-byte tokens.
       '=' {
         rdr.bump();
@@ -461,7 +460,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
               'u' { c2 = scan_numeric_escape(rdr, 4u); }
               'U' { c2 = scan_numeric_escape(rdr, 8u); }
               c2 {
-                rdr.err(#fmt("unknown character escape: %d", c2 as int));
+                rdr.err(#fmt["unknown character escape: %d", c2 as int]);
                 fail;
               }
             }
@@ -500,7 +499,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
                     str::push_char(accum_str, scan_numeric_escape(rdr, 8u));
                   }
                   c2 {
-                    rdr.err(#fmt("unknown string escape: %d", c2 as int));
+                    rdr.err(#fmt["unknown string escape: %d", c2 as int]);
                     fail;
                   }
                 }
@@ -510,7 +509,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
         }
         rdr.bump();
         ret token::LIT_STR(interner::intern::<str>(*rdr.get_interner(),
-                                                 accum_str));
+                                                   accum_str));
       }
       '-' {
         if rdr.next() == '>' {
@@ -537,7 +536,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
       '/' { ret binop(rdr, token::SLASH); }
       '^' { ret binop(rdr, token::CARET); }
       '%' { ret binop(rdr, token::PERCENT); }
-      c { rdr.err(#fmt("unkown start of token: %d", c as int)); fail; }
+      c { rdr.err(#fmt["unkown start of token: %d", c as int]); fail; }
     }
 }
 
@@ -562,7 +561,7 @@ fn read_to_eol(rdr: &reader) -> str {
 
 fn read_one_line_comment(rdr: &reader) -> str {
     let val = read_to_eol(rdr);
-    assert (val.(0) == '/' as u8 && val.(1) == '/' as u8);
+    assert (val[0] == '/' as u8 && val[1] == '/' as u8);
     ret val;
 }
 
@@ -578,8 +577,8 @@ fn consume_non_eol_whitespace(rdr: &reader) {
 
 fn push_blank_line_comment(rdr: &reader, comments: &mutable [cmnt]) {
     log ">>> blank-line comment";
-    let v: [str] = ~[];
-    comments += ~[{style: blank_line, lines: v, pos: rdr.get_chpos()}];
+    let v: [str] = [];
+    comments += [{style: blank_line, lines: v, pos: rdr.get_chpos()}];
 }
 
 fn consume_whitespace_counting_blank_lines(rdr: &reader,
@@ -595,11 +594,11 @@ fn consume_whitespace_counting_blank_lines(rdr: &reader,
 fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt {
     log ">>> line comments";
     let p = rdr.get_chpos();
-    let lines: [str] = ~[];
+    let lines: [str] = [];
     while rdr.curr() == '/' && rdr.next() == '/' {
         let line = read_one_line_comment(rdr);
         log line;
-        lines += ~[line];
+        lines += [line];
         consume_non_eol_whitespace(rdr);
     }
     log "<<< line comments";
@@ -610,10 +609,7 @@ fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt {
 
 fn all_whitespace(s: &str, begin: uint, end: uint) -> bool {
     let i: uint = begin;
-    while i != end {
-        if !is_whitespace(s.(i) as char) { ret false; }
-        i += 1u;
-    }
+    while i != end { if !is_whitespace(s[i] as char) { ret false; } i += 1u; }
     ret true;
 }
 
@@ -626,20 +622,20 @@ fn trim_whitespace_prefix_and_push_line(lines: &mutable [str], s: &str,
         } else { s1 = ""; }
     } else { s1 = s; }
     log "pushing line: " + s1;
-    lines += ~[s1];
+    lines += [s1];
 }
 
 fn read_block_comment(rdr: &reader, code_to_the_left: bool) -> cmnt {
     log ">>> block comment";
     let p = rdr.get_chpos();
-    let lines: [str] = ~[];
+    let lines: [str] = [];
     let col: uint = rdr.get_col();
     rdr.bump();
     rdr.bump();
     let curr_line = "/*";
     let level: int = 1;
     while level > 0 {
-        log #fmt("=== block comment level %d", level);
+        log #fmt["=== block comment level %d", level];
         if rdr.is_eof() { rdr.err("unterminated block comment"); fail; }
         if rdr.curr() == '\n' {
             trim_whitespace_prefix_and_push_line(lines, curr_line, col);
@@ -683,9 +679,9 @@ fn consume_comment(rdr: &reader, code_to_the_left: bool,
                    comments: &mutable [cmnt]) {
     log ">>> consume comment";
     if rdr.curr() == '/' && rdr.next() == '/' {
-        comments += ~[read_line_comments(rdr, code_to_the_left)];
-    } else if (rdr.curr() == '/' && rdr.next() == '*') {
-        comments += ~[read_block_comment(rdr, code_to_the_left)];
+        comments += [read_line_comments(rdr, code_to_the_left)];
+    } else if rdr.curr() == '/' && rdr.next() == '*' {
+        comments += [read_block_comment(rdr, code_to_the_left)];
     } else { fail; }
     log "<<< consume comment";
 }
@@ -712,8 +708,8 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: str,
     let src = str::unsafe_from_bytes(srdr.read_whole_stream());
     let itr = @interner::mk::<str>(str::hash, str::eq);
     let rdr = new_reader(cm, src, codemap::new_filemap(path, 0u, 0u), itr);
-    let comments: [cmnt] = ~[];
-    let literals: [lit] = ~[];
+    let comments: [cmnt] = [];
+    let literals: [lit] = [];
     let first_read: bool = true;
     while !rdr.is_eof() {
         while true {
@@ -731,7 +727,7 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: str,
         }
         let tok = next_token(rdr);
         if is_lit(tok.tok) {
-            literals += ~[{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}];
+            literals += [{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}];
         }
         log "tok: " + token::to_str(rdr, tok.tok);
         first_read = false;
diff --git a/src/comp/syntax/parse/parser.rs b/src/comp/syntax/parse/parser.rs
index 2d11ae974d3..8113f9fd94d 100644
--- a/src/comp/syntax/parse/parser.rs
+++ b/src/comp/syntax/parse/parser.rs
@@ -33,39 +33,38 @@ fn next_node_id(sess: &parse_sess) -> node_id {
 
 type parser =
     obj {
-        fn peek() -> token::token ;
-        fn bump() ;
-        fn swap(token::token, uint, uint) ;
-        fn look_ahead(uint) -> token::token ;
-        fn fatal(str) -> !  ;
-        fn warn(str) ;
-        fn restrict(restriction) ;
-        fn get_restriction() -> restriction ;
-        fn get_file_type() -> file_type ;
-        fn get_cfg() -> ast::crate_cfg ;
-        fn get_span() -> span ;
-        fn get_lo_pos() -> uint ;
-        fn get_hi_pos() -> uint ;
-        fn get_last_lo_pos() -> uint ;
-        fn get_last_hi_pos() -> uint ;
-        fn get_prec_table() -> @[op_spec] ;
-        fn get_str(token::str_num) -> str ;
-        fn get_reader() -> lexer::reader ;
-        fn get_filemap() -> codemap::filemap ;
-        fn get_bad_expr_words() -> hashmap<str, ()> ;
-        fn get_chpos() -> uint ;
-        fn get_byte_pos() -> uint ;
-        fn get_id() -> node_id ;
-        fn get_sess() -> parse_sess ;
+        fn peek() -> token::token;
+        fn bump();
+        fn swap(token::token, uint, uint);
+        fn look_ahead(uint) -> token::token;
+        fn fatal(str) -> ! ;
+        fn warn(str);
+        fn restrict(restriction);
+        fn get_restriction() -> restriction;
+        fn get_file_type() -> file_type;
+        fn get_cfg() -> ast::crate_cfg;
+        fn get_span() -> span;
+        fn get_lo_pos() -> uint;
+        fn get_hi_pos() -> uint;
+        fn get_last_lo_pos() -> uint;
+        fn get_last_hi_pos() -> uint;
+        fn get_prec_table() -> @[op_spec];
+        fn get_str(token::str_num) -> str;
+        fn get_reader() -> lexer::reader;
+        fn get_filemap() -> codemap::filemap;
+        fn get_bad_expr_words() -> hashmap<str, ()>;
+        fn get_chpos() -> uint;
+        fn get_byte_pos() -> uint;
+        fn get_id() -> node_id;
+        fn get_sess() -> parse_sess;
     };
 
-fn new_parser_from_file(sess: parse_sess, cfg:
-                        ast::crate_cfg, path: str,
-                        chpos: uint, byte_pos: uint,
-                        ftype: file_type) -> parser {
+fn new_parser_from_file(sess: parse_sess, cfg: ast::crate_cfg, path: str,
+                        chpos: uint, byte_pos: uint, ftype: file_type) ->
+   parser {
     let src = io::read_whole_file_str(path);
     let filemap = codemap::new_filemap(path, chpos, byte_pos);
-    sess.cm.files += ~[filemap];
+    sess.cm.files += [filemap];
     let itr = @interner::mk(str::hash, str::eq);
     let rdr = lexer::new_reader(sess.cm, src, filemap, itr);
 
@@ -106,9 +105,9 @@ fn new_parser(sess: parse_sess, cfg: ast::crate_cfg, rdr: lexer::reader,
             while vec::len(buffer) < distance {
                 let next = lexer::next_token(rdr);
                 let sp = ast::mk_sp(next.chpos, rdr.get_chpos());
-                buffer = ~[{tok: next.tok, span: sp}] + buffer;
+                buffer = [{tok: next.tok, span: sp}] + buffer;
             }
-            ret buffer.(distance - 1u).tok;
+            ret buffer[distance - 1u].tok;
         }
         fn fatal(m: str) -> ! {
             codemap::emit_error(some(self.get_span()), m, sess.cm);
@@ -141,7 +140,7 @@ fn new_parser(sess: parse_sess, cfg: ast::crate_cfg, rdr: lexer::reader,
 
     let tok0 = lexer::next_token(rdr);
     let span0 = ast::mk_sp(tok0.chpos, rdr.get_chpos());
-    ret stdio_parser(sess, cfg, ftype, tok0.tok, span0, span0, ~[],
+    ret stdio_parser(sess, cfg, ftype, tok0.tok, span0, span0, [],
                      UNRESTRICTED, rdr, prec_table(), bad_expr_word_table());
 }
 
@@ -213,8 +212,7 @@ fn expect_gt(p: &parser) {
     } else if p.peek() == token::BINOP(token::LSR) {
         p.swap(token::GT, p.get_lo_pos() + 1u, p.get_hi_pos());
     } else if p.peek() == token::BINOP(token::ASR) {
-        p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u,
-               p.get_hi_pos());
+        p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u, p.get_hi_pos());
     } else {
         let s: str = "expecting ";
         s += token::to_str(p.get_reader(), token::GT);
@@ -304,7 +302,7 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ {
                   parse_fn_input_ty, p);
     // FIXME: there's no syntax for this right now anyway
     //  auto constrs = parse_constrs(~[], p);
-    let constrs: [@ast::constr] = ~[];
+    let constrs: [@ast::constr] = [];
     let output: @ast::ty;
     let cf = ast::return;
     if p.peek() == token::RARROW {
@@ -324,11 +322,11 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ {
 fn parse_proto(p: &parser) -> ast::proto {
     if eat_word(p, "iter") {
         ret ast::proto_iter;
-    } else if (eat_word(p, "fn")) {
+    } else if eat_word(p, "fn") {
         ret ast::proto_fn;
-    } else if (eat_word(p, "block")) {
+    } else if eat_word(p, "block") {
         ret ast::proto_block;
-    } else if (eat_word(p, "pred")) {
+    } else if eat_word(p, "pred") {
         ret ast::proto_fn;
     } else { unexpected(p, p.peek()); }
 }
@@ -431,10 +429,10 @@ fn parse_constr_in_type(p: &parser) -> @ast::ty_constr {
 
 fn parse_constrs<T>(pser: fn(&parser) -> @ast::constr_general<T>, p: &parser)
    -> [@ast::constr_general<T>] {
-    let constrs: [@ast::constr_general<T>] = ~[];
+    let constrs: [@ast::constr_general<T>] = [];
     while true {
         let constr = pser(p);
-        constrs += ~[constr];
+        constrs += [constr];
         if p.peek() == token::COMMA { p.bump(); } else { break; }
     }
     constrs
@@ -445,7 +443,7 @@ fn parse_type_constraints(p: &parser) -> [@ast::ty_constr] {
 }
 
 fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool)
-        -> @ast::ty {
+   -> @ast::ty {
     let lo = p.get_lo_pos();
 
     if colons_before_params && p.peek() == token::MOD_SEP {
@@ -453,9 +451,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool)
         expect(p, token::LT);
     } else if !colons_before_params && p.peek() == token::LT {
         p.bump();
-    } else {
-        ret @spanned(lo, p.get_lo_pos(), orig_t);
-    }
+    } else { ret @spanned(lo, p.get_lo_pos(), orig_t); }
 
     // If we're here, we have explicit type parameter instantiation.
     let seq = parse_seq_to_gt(some(token::COMMA), bind parse_ty(_, false), p);
@@ -469,9 +465,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool)
                                            idents: pth.node.idents,
                                            types: seq}), ann));
       }
-      _ {
-        p.fatal("type parameter instantiation only allowed for paths");
-      }
+      _ { p.fatal("type parameter instantiation only allowed for paths"); }
     }
 }
 
@@ -490,73 +484,71 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty {
 
     if eat_word(p, "bool") {
         t = ast::ty_bool;
-    } else if (eat_word(p, "int")) {
+    } else if eat_word(p, "int") {
         t = ast::ty_int;
-    } else if (eat_word(p, "uint")) {
+    } else if eat_word(p, "uint") {
         t = ast::ty_uint;
-    } else if (eat_word(p, "float")) {
+    } else if eat_word(p, "float") {
         t = ast::ty_float;
-    } else if (eat_word(p, "str")) {
+    } else if eat_word(p, "str") {
         t = ast::ty_str;
-    } else if (eat_word(p, "istr")) {
+    } else if eat_word(p, "istr") {
         t = ast::ty_istr;
-    } else if (eat_word(p, "char")) {
+    } else if eat_word(p, "char") {
         t = ast::ty_char;
-/*
-    } else if (eat_word(p, "task")) {
-        t = ast::ty_task;
-*/
-    } else if (eat_word(p, "i8")) {
+        /*
+            } else if (eat_word(p, "task")) {
+                t = ast::ty_task;
+        */
+    } else if eat_word(p, "i8") {
         t = ast::ty_machine(ast::ty_i8);
-    } else if (eat_word(p, "i16")) {
+    } else if eat_word(p, "i16") {
         t = ast::ty_machine(ast::ty_i16);
-    } else if (eat_word(p, "i32")) {
+    } else if eat_word(p, "i32") {
         t = ast::ty_machine(ast::ty_i32);
-    } else if (eat_word(p, "i64")) {
+    } else if eat_word(p, "i64") {
         t = ast::ty_machine(ast::ty_i64);
-    } else if (eat_word(p, "u8")) {
+    } else if eat_word(p, "u8") {
         t = ast::ty_machine(ast::ty_u8);
-    } else if (eat_word(p, "u16")) {
+    } else if eat_word(p, "u16") {
         t = ast::ty_machine(ast::ty_u16);
-    } else if (eat_word(p, "u32")) {
+    } else if eat_word(p, "u32") {
         t = ast::ty_machine(ast::ty_u32);
-    } else if (eat_word(p, "u64")) {
+    } else if eat_word(p, "u64") {
         t = ast::ty_machine(ast::ty_u64);
-    } else if (eat_word(p, "f32")) {
+    } else if eat_word(p, "f32") {
         t = ast::ty_machine(ast::ty_f32);
-    } else if (eat_word(p, "f64")) {
+    } else if eat_word(p, "f64") {
         t = ast::ty_machine(ast::ty_f64);
-    } else if (p.peek() == token::LPAREN) {
+    } else if p.peek() == token::LPAREN {
         p.bump();
         if p.peek() == token::RPAREN {
             hi = p.get_hi_pos();
             p.bump();
             t = ast::ty_nil;
         } else {
-            let ts = ~[parse_ty(p, false)];
+            let ts = [parse_ty(p, false)];
             while p.peek() == token::COMMA {
                 p.bump();
-                ts += ~[parse_ty(p, false)];
+                ts += [parse_ty(p, false)];
             }
             if vec::len(ts) == 1u {
-                t = ts.(0).node;
-            } else {
-                t = ast::ty_tup(ts);
-            }
+                t = ts[0].node;
+            } else { t = ast::ty_tup(ts); }
             hi = p.get_hi_pos();
             expect(p, token::RPAREN);
         }
-    } else if (p.peek() == token::AT) {
+    } else if p.peek() == token::AT {
         p.bump();
         let mt = parse_mt(p);
         hi = mt.ty.span.hi;
         t = ast::ty_box(mt);
-    } else if (p.peek() == token::BINOP(token::STAR)) {
+    } else if p.peek() == token::BINOP(token::STAR) {
         p.bump();
         let mt = parse_mt(p);
         hi = mt.ty.span.hi;
         t = ast::ty_ptr(mt);
-    } else if (p.peek() == token::LBRACE) {
+    } else if p.peek() == token::LBRACE {
         let elems =
             parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA),
                       parse_ty_field, p);
@@ -568,28 +560,28 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty {
                 ast::ty_constr(@spanned(lo, hi, t),
                                parse_type_constraints(p));
         }
-    } else if (p.peek() == token::LBRACKET) {
+    } else if p.peek() == token::LBRACKET {
         expect(p, token::LBRACKET);
         t = ast::ty_vec(parse_mt(p));
         hi = p.get_hi_pos();
         expect(p, token::RBRACKET);
-    } else if (eat_word(p, "fn")) {
+    } else if eat_word(p, "fn") {
         t = parse_ty_fn(ast::proto_fn, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if (eat_word(p, "block")) {
+    } else if eat_word(p, "block") {
         t = parse_ty_fn(ast::proto_block, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if (eat_word(p, "iter")) {
+    } else if eat_word(p, "iter") {
         t = parse_ty_fn(ast::proto_iter, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if (eat_word(p, "obj")) {
+    } else if eat_word(p, "obj") {
         t = parse_ty_obj(p, hi);
-    } else if (eat_word(p, "mutable")) {
+    } else if eat_word(p, "mutable") {
         p.warn("ignoring deprecated 'mutable' type constructor");
         let typ = parse_ty(p, false);
         t = typ.node;
         hi = typ.span.hi;
-    } else if (p.peek() == token::MOD_SEP || is_ident(p.peek())) {
+    } else if p.peek() == token::MOD_SEP || is_ident(p.peek()) {
         let path = parse_path(p);
         t = ast::ty_path(path, p.get_id());
         hi = path.span.hi;
@@ -602,9 +594,7 @@ fn parse_arg_mode(p: &parser) -> ast::mode {
         ast::alias(eat_word(p, "mutable"))
     } else if eat(p, token::BINOP(token::MINUS)) {
         ast::move
-    } else {
-        ast::val
-    }
+    } else { ast::val }
 }
 
 fn parse_arg(p: &parser) -> ast::arg {
@@ -625,15 +615,14 @@ fn parse_fn_block_arg(p: &parser) -> ast::arg {
 fn parse_seq_to_before_gt<T>(sep: option::t<token::token>,
                              f: fn(&parser) -> T, p: &parser) -> [T] {
     let first = true;
-    let v = ~[];
-    while p.peek() != token::GT &&
-          p.peek() != token::BINOP(token::LSR) &&
-          p.peek() != token::BINOP(token::ASR) {
+    let v = [];
+    while p.peek() != token::GT && p.peek() != token::BINOP(token::LSR) &&
+              p.peek() != token::BINOP(token::ASR) {
         alt sep {
           some(t) { if first { first = false; } else { expect(p, t); } }
           _ { }
         }
-        v += ~[f(p)];
+        v += [f(p)];
     }
 
     ret v;
@@ -658,30 +647,30 @@ fn parse_seq_lt_gt<T>(sep: option::t<token::token>, f: fn(&parser) -> T,
 }
 
 fn parse_seq_to_end<T>(ket: token::token, sep: option::t<token::token>,
-                       f: fn(&parser) -> T , p: &parser) -> [T] {
+                       f: fn(&parser) -> T, p: &parser) -> [T] {
     let val = parse_seq_to_before_end(ket, sep, f, p);
     p.bump();
     ret val;
 }
 
 fn parse_seq_to_before_end<T>(ket: token::token, sep: option::t<token::token>,
-                              f: fn(&parser) -> T , p: &parser) -> [T] {
+                              f: fn(&parser) -> T, p: &parser) -> [T] {
     let first: bool = true;
-    let v: [T] = ~[];
+    let v: [T] = [];
     while p.peek() != ket {
         alt sep {
           some(t) { if first { first = false; } else { expect(p, t); } }
           _ { }
         }
-        v += ~[f(p)];
+        v += [f(p)];
     }
     ret v;
 }
 
 
 fn parse_seq<T>(bra: token::token, ket: token::token,
-                sep: option::t<token::token>, f: fn(&parser) -> T ,
-                p: &parser) -> spanned<[T]> {
+                sep: option::t<token::token>, f: fn(&parser) -> T, p: &parser)
+   -> spanned<[T]> {
     let lo = p.get_lo_pos();
     expect(p, bra);
     let result = parse_seq_to_before_end::<T>(ket, sep, f, p);
@@ -696,7 +685,7 @@ fn parse_lit(p: &parser) -> ast::lit {
     let lit: ast::lit_ = ast::lit_nil;
     if eat_word(p, "true") {
         lit = ast::lit_bool(true);
-    } else if (eat_word(p, "false")) {
+    } else if eat_word(p, "false") {
         lit = ast::lit_bool(false);
     } else {
         alt p.peek() {
@@ -749,24 +738,22 @@ fn parse_path(p: &parser) -> ast::path {
         p.bump();
     } else { global = false; }
 
-    let ids: [ast::ident] = ~[];
+    let ids: [ast::ident] = [];
     while true {
         alt p.peek() {
           token::IDENT(i, _) {
             hi = p.get_hi_pos();
-            ids += ~[p.get_str(i)];
+            ids += [p.get_str(i)];
             hi = p.get_hi_pos();
             p.bump();
             if p.peek() == token::MOD_SEP && p.look_ahead(1u) != token::LT {
                 p.bump();
-            } else {
-                break;
-            }
+            } else { break; }
           }
           _ { break; }
         }
     }
-    ret spanned(lo, hi, {global: global, idents: ids, types: ~[]});
+    ret spanned(lo, hi, {global: global, idents: ids, types: []});
 }
 
 fn parse_path_and_ty_param_substs(p: &parser) -> ast::path {
@@ -775,8 +762,8 @@ fn parse_path_and_ty_param_substs(p: &parser) -> ast::path {
     if p.peek() == token::MOD_SEP {
         p.bump();
 
-        let seq = parse_seq_lt_gt(some(token::COMMA), bind parse_ty(_, false),
-                                  p);
+        let seq =
+            parse_seq_lt_gt(some(token::COMMA), bind parse_ty(_, false), p);
         let hi = seq.span.hi;
         path =
             spanned(lo, hi,
@@ -827,28 +814,23 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
             let lit = @spanned(lo, hi, ast::lit_nil);
             ret mk_expr(p, lo, hi, ast::expr_lit(lit));
         }
-        let es = ~[parse_expr(p)];
-        while p.peek() == token::COMMA {
-            p.bump();
-            es += ~[parse_expr(p)];
-        }
+        let es = [parse_expr(p)];
+        while p.peek() == token::COMMA { p.bump(); es += [parse_expr(p)]; }
         hi = p.get_hi_pos();
         expect(p, token::RPAREN);
         if vec::len(es) == 1u {
-            ret mk_expr(p, lo, hi, es.(0).node);
-        } else {
-            ret mk_expr(p, lo, hi, ast::expr_tup(es));
-        }
-    } else if (p.peek() == token::LBRACE) {
+            ret mk_expr(p, lo, hi, es[0].node);
+        } else { ret mk_expr(p, lo, hi, ast::expr_tup(es)); }
+    } else if p.peek() == token::LBRACE {
         p.bump();
         if is_word(p, "mutable") ||
                is_plain_ident(p) && p.look_ahead(1u) == token::COLON {
-            let fields = ~[parse_field(p, token::COLON)];
+            let fields = [parse_field(p, token::COLON)];
             let base = none;
             while p.peek() != token::RBRACE {
                 if eat_word(p, "with") { base = some(parse_expr(p)); break; }
                 expect(p, token::COMMA);
-                fields += ~[parse_field(p, token::COLON)];
+                fields += [parse_field(p, token::COLON)];
             }
             hi = p.get_hi_pos();
             expect(p, token::RBRACE);
@@ -859,48 +841,48 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
             let blk = parse_block_tail(p, lo);
             ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk));
         }
-    } else if (eat_word(p, "if")) {
+    } else if eat_word(p, "if") {
         ret parse_if_expr(p);
-    } else if (eat_word(p, "for")) {
+    } else if eat_word(p, "for") {
         ret parse_for_expr(p);
-    } else if (eat_word(p, "while")) {
+    } else if eat_word(p, "while") {
         ret parse_while_expr(p);
-    } else if (eat_word(p, "do")) {
+    } else if eat_word(p, "do") {
         ret parse_do_while_expr(p);
-    } else if (eat_word(p, "alt")) {
+    } else if eat_word(p, "alt") {
         ret parse_alt_expr(p);
-/*
-    } else if (eat_word(p, "spawn")) {
-        ret parse_spawn_expr(p);
-*/
-    } else if (eat_word(p, "fn")) {
+        /*
+            } else if (eat_word(p, "spawn")) {
+                ret parse_spawn_expr(p);
+        */
+    } else if eat_word(p, "fn") {
         ret parse_fn_expr(p, ast::proto_fn);
-    } else if (eat_word(p, "block")) {
+    } else if eat_word(p, "block") {
         ret parse_fn_expr(p, ast::proto_block);
-    } else if (eat_word(p, "lambda")) {
+    } else if eat_word(p, "lambda") {
         ret parse_fn_expr(p, ast::proto_closure);
-    } else if (p.peek() == token::LBRACKET) {
+    } else if p.peek() == token::LBRACKET {
         p.bump();
         let mut = parse_mutability(p);
         let es =
             parse_seq_to_end(token::RBRACKET, some(token::COMMA), parse_expr,
                              p);
         ex = ast::expr_vec(es, mut);
-    } else if (p.peek() == token::POUND_LT) {
+    } else if p.peek() == token::POUND_LT {
         p.bump();
         let ty = parse_ty(p, false);
         expect(p, token::GT);
 
         /* hack: early return to take advantage of specialized function */
         ret mk_mac_expr(p, lo, p.get_hi_pos(), ast::mac_embed_type(ty))
-    } else if (p.peek() == token::POUND_LBRACE) {
+    } else if p.peek() == token::POUND_LBRACE {
         p.bump();
         let blk = ast::mac_embed_block(parse_block_tail(p, lo));
         ret mk_mac_expr(p, lo, p.get_hi_pos(), blk);
-    } else if (p.peek() == token::ELLIPSIS) {
+    } else if p.peek() == token::ELLIPSIS {
         p.bump();
         ret mk_mac_expr(p, lo, p.get_hi_pos(), ast::mac_ellipsis)
-    } else if (p.peek() == token::TILDE) {
+    } else if p.peek() == token::TILDE {
         p.bump();
         alt p.peek() {
           token::LBRACKET. { // unique array (temporary)
@@ -920,7 +902,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
           }
           _ { ex = ast::expr_uniq(parse_expr(p)); }
         }
-    } else if (eat_word(p, "obj")) {
+    } else if eat_word(p, "obj") {
         // Anonymous object
 
         // Only make people type () if they're actually adding new fields
@@ -931,13 +913,13 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
                 some(parse_seq_to_end(token::RPAREN, some(token::COMMA),
                                       parse_anon_obj_field, p));
         }
-        let meths: [@ast::method] = ~[];
+        let meths: [@ast::method] = [];
         let inner_obj: option::t<@ast::expr> = none;
         expect(p, token::LBRACE);
         while p.peek() != token::RBRACE {
             if eat_word(p, "with") {
                 inner_obj = some(parse_expr(p));
-            } else { meths += ~[parse_method(p)]; }
+            } else { meths += [parse_method(p)]; }
         }
         hi = p.get_hi_pos();
         expect(p, token::RBRACE);
@@ -949,7 +931,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         // "spanned".
         let ob = {fields: fields, methods: meths, inner_obj: inner_obj};
         ex = ast::expr_anon_obj(ob);
-    } else if (eat_word(p, "bind")) {
+    } else if eat_word(p, "bind") {
         let e = parse_expr_res(p, RESTRICT_NO_CALL_EXPRS);
         fn parse_expr_opt(p: &parser) -> option::t<@ast::expr> {
             alt p.peek() {
@@ -962,29 +944,29 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
                       parse_expr_opt, p);
         hi = es.span.hi;
         ex = ast::expr_bind(e, es.node);
-    } else if (p.peek() == token::POUND) {
+    } else if p.peek() == token::POUND {
         let ex_ext = parse_syntax_ext(p);
         hi = ex_ext.span.hi;
         ex = ex_ext.node;
-    } else if (eat_word(p, "fail")) {
+    } else if eat_word(p, "fail") {
         if can_begin_expr(p.peek()) {
             let e = parse_expr(p);
             hi = e.span.hi;
             ex = ast::expr_fail(some(e));
         } else { ex = ast::expr_fail(none); }
-    } else if (eat_word(p, "log")) {
+    } else if eat_word(p, "log") {
         let e = parse_expr(p);
         ex = ast::expr_log(1, e);
         hi = e.span.hi;
-    } else if (eat_word(p, "log_err")) {
+    } else if eat_word(p, "log_err") {
         let e = parse_expr(p);
         ex = ast::expr_log(0, e);
         hi = e.span.hi;
-    } else if (eat_word(p, "assert")) {
+    } else if eat_word(p, "assert") {
         let e = parse_expr(p);
         ex = ast::expr_assert(e);
         hi = e.span.hi;
-    } else if (eat_word(p, "check")) {
+    } else if eat_word(p, "check") {
         /* Should be a predicate (pure boolean function) applied to
            arguments that are all either slot variables or literals.
            but the typechecker enforces that. */
@@ -992,7 +974,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let e = parse_expr(p);
         hi = e.span.hi;
         ex = ast::expr_check(ast::checked, e);
-    } else if (eat_word(p, "claim")) {
+    } else if eat_word(p, "claim") {
         /* Same rules as check, except that if check-claims
          is enabled (a command-line flag), then the parser turns
         claims into check */
@@ -1000,19 +982,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let e = parse_expr(p);
         hi = e.span.hi;
         ex = ast::expr_check(ast::unchecked, e);
-    } else if (eat_word(p, "ret")) {
+    } else if eat_word(p, "ret") {
         if can_begin_expr(p.peek()) {
             let e = parse_expr(p);
             hi = e.span.hi;
             ex = ast::expr_ret(some(e));
         } else { ex = ast::expr_ret(none); }
-    } else if (eat_word(p, "break")) {
+    } else if eat_word(p, "break") {
         ex = ast::expr_break;
         hi = p.get_hi_pos();
-    } else if (eat_word(p, "cont")) {
+    } else if eat_word(p, "cont") {
         ex = ast::expr_cont;
         hi = p.get_hi_pos();
-    } else if (eat_word(p, "put")) {
+    } else if eat_word(p, "put") {
         alt p.peek() {
           token::SEMI. { ex = ast::expr_put(none); }
           _ {
@@ -1021,18 +1003,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
             ex = ast::expr_put(some(e));
           }
         }
-    } else if (eat_word(p, "be")) {
+    } else if eat_word(p, "be") {
         let e = parse_expr(p);
+
         // FIXME: Is this the right place for this check?
         if /*check*/ast::is_call_expr(e) {
             hi = e.span.hi;
             ex = ast::expr_be(e);
         } else { p.fatal("Non-call expression in tail call"); }
-    } else if (eat_word(p, "copy")) {
+    } else if eat_word(p, "copy") {
         let e = parse_expr(p);
         ex = ast::expr_copy(e);
         hi = e.span.hi;
-    } else if (eat_word(p, "self")) {
+    } else if eat_word(p, "self") {
         expect(p, token::DOT);
         // The rest is a call expression.
         let f: @ast::expr = parse_self_method(p);
@@ -1041,9 +1024,9 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
                       parse_expr, p);
         hi = es.span.hi;
         ex = ast::expr_call(f, es.node);
-    } else if (p.peek() == token::MOD_SEP ||
-                   is_ident(p.peek()) && !is_word(p, "true") &&
-                       !is_word(p, "false")) {
+    } else if p.peek() == token::MOD_SEP ||
+                  is_ident(p.peek()) && !is_word(p, "true") &&
+                      !is_word(p, "false") {
         check_bad_word(p);
         let pth = parse_path_and_ty_param_substs(p);
         hi = pth.span.hi;
@@ -1068,16 +1051,16 @@ fn parse_syntax_ext_naked(p: &parser, lo: uint) -> @ast::expr {
         p.fatal("expected a syntax expander name");
     }
     //temporary for a backwards-compatible cycle:
-    let es = if p.peek() == token::LPAREN {
-        parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA),
-                  parse_expr, p)
-    } else {
-        parse_seq(token::LBRACKET, token::RBRACKET, some(token::COMMA),
-                  parse_expr, p)
-    };
+    let es =
+        if p.peek() == token::LPAREN {
+            parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA),
+                      parse_expr, p)
+        } else {
+            parse_seq(token::LBRACKET, token::RBRACKET, some(token::COMMA),
+                      parse_expr, p)
+        };
     let hi = es.span.hi;
-    let e = mk_expr(p, es.span.lo, hi,
-                    ast::expr_vec(es.node, ast::imm));
+    let e = mk_expr(p, es.span.lo, hi, ast::expr_vec(es.node, ast::imm));
     ret mk_mac_expr(p, lo, hi, ast::mac_invoc(pth, e, none));
 }
 
@@ -1204,26 +1187,26 @@ type op_spec = {tok: token::token, op: ast::binop, prec: int};
 
 // FIXME make this a const, don't store it in parser state
 fn prec_table() -> @[op_spec] {
-    ret @~[{tok: token::BINOP(token::STAR), op: ast::mul, prec: 11},
-           {tok: token::BINOP(token::SLASH), op: ast::div, prec: 11},
-           {tok: token::BINOP(token::PERCENT), op: ast::rem, prec: 11},
-           {tok: token::BINOP(token::PLUS), op: ast::add, prec: 10},
-           {tok: token::BINOP(token::MINUS), op: ast::sub, prec: 10},
-           {tok: token::BINOP(token::LSL), op: ast::lsl, prec: 9},
-           {tok: token::BINOP(token::LSR), op: ast::lsr, prec: 9},
-           {tok: token::BINOP(token::ASR), op: ast::asr, prec: 9},
-           {tok: token::BINOP(token::AND), op: ast::bitand, prec: 8},
-           {tok: token::BINOP(token::CARET), op: ast::bitxor, prec: 6},
-           {tok: token::BINOP(token::OR), op: ast::bitor, prec: 6},
-           // 'as' sits between here with 5
-           {tok: token::LT, op: ast::lt, prec: 4},
-           {tok: token::LE, op: ast::le, prec: 4},
-           {tok: token::GE, op: ast::ge, prec: 4},
-           {tok: token::GT, op: ast::gt, prec: 4},
-           {tok: token::EQEQ, op: ast::eq, prec: 3},
-           {tok: token::NE, op: ast::ne, prec: 3},
-           {tok: token::ANDAND, op: ast::and, prec: 2},
-           {tok: token::OROR, op: ast::or, prec: 1}];
+    ret @[{tok: token::BINOP(token::STAR), op: ast::mul, prec: 11},
+          {tok: token::BINOP(token::SLASH), op: ast::div, prec: 11},
+          {tok: token::BINOP(token::PERCENT), op: ast::rem, prec: 11},
+          {tok: token::BINOP(token::PLUS), op: ast::add, prec: 10},
+          {tok: token::BINOP(token::MINUS), op: ast::sub, prec: 10},
+          {tok: token::BINOP(token::LSL), op: ast::lsl, prec: 9},
+          {tok: token::BINOP(token::LSR), op: ast::lsr, prec: 9},
+          {tok: token::BINOP(token::ASR), op: ast::asr, prec: 9},
+          {tok: token::BINOP(token::AND), op: ast::bitand, prec: 8},
+          {tok: token::BINOP(token::CARET), op: ast::bitxor, prec: 6},
+          {tok: token::BINOP(token::OR), op: ast::bitor, prec: 6},
+          // 'as' sits between here with 5
+          {tok: token::LT, op: ast::lt, prec: 4},
+          {tok: token::LE, op: ast::le, prec: 4},
+          {tok: token::GE, op: ast::ge, prec: 4},
+          {tok: token::GT, op: ast::gt, prec: 4},
+          {tok: token::EQEQ, op: ast::eq, prec: 3},
+          {tok: token::NE, op: ast::ne, prec: 3},
+          {tok: token::ANDAND, op: ast::and, prec: 2},
+          {tok: token::OROR, op: ast::or, prec: 1}];
 }
 
 fn parse_binops(p: &parser) -> @ast::expr {
@@ -1388,11 +1371,11 @@ fn parse_alt_expr(p: &parser) -> @ast::expr {
     let lo = p.get_last_lo_pos();
     let discriminant = parse_expr(p);
     expect(p, token::LBRACE);
-    let arms: [ast::arm] = ~[];
+    let arms: [ast::arm] = [];
     while p.peek() != token::RBRACE {
         let pats = parse_pats(p);
         let blk = parse_block(p);
-        arms += ~[{pats: pats, body: blk}];
+        arms += [{pats: pats, body: blk}];
     }
     let hi = p.get_hi_pos();
     p.bump();
@@ -1422,6 +1405,7 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> {
         ret some({op: ast::init_move, expr: parse_expr(p)});
       }
 
+
       // Now that the the channel is the first argument to receive,
       // combining it with an initializer doesn't really make sense.
       // case (token::RECV) {
@@ -1436,9 +1420,9 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> {
 }
 
 fn parse_pats(p: &parser) -> [@ast::pat] {
-    let pats = ~[];
+    let pats = [];
     while true {
-        pats += ~[parse_pat(p)];
+        pats += [parse_pat(p)];
         if p.peek() == token::BINOP(token::OR) { p.bump(); } else { break; }
     }
     ret pats;
@@ -1458,7 +1442,7 @@ fn parse_pat(p: &parser) -> @ast::pat {
       }
       token::LBRACE. {
         p.bump();
-        let fields = ~[];
+        let fields = [];
         let etc = false;
         let first = true;
         while p.peek() != token::RBRACE {
@@ -1488,7 +1472,7 @@ fn parse_pat(p: &parser) -> @ast::pat {
                       node: ast::pat_bind(fieldname),
                       span: ast::mk_sp(lo, hi)};
             }
-            fields += ~[{ident: fieldname, pat: subpat}];
+            fields += [{ident: fieldname, pat: subpat}];
         }
         hi = p.get_hi_pos();
         p.bump();
@@ -1499,13 +1483,13 @@ fn parse_pat(p: &parser) -> @ast::pat {
         if p.peek() == token::RPAREN {
             hi = p.get_hi_pos();
             p.bump();
-            pat = ast::pat_lit(@{node: ast::lit_nil,
-                                 span: ast::mk_sp(lo,hi)});
+            pat =
+                ast::pat_lit(@{node: ast::lit_nil, span: ast::mk_sp(lo, hi)});
         } else {
-            let fields = ~[parse_pat(p)];
+            let fields = [parse_pat(p)];
             while p.peek() == token::COMMA {
                 p.bump();
-                fields += ~[parse_pat(p)];
+                fields += [parse_pat(p)];
             }
             if vec::len(fields) == 1u { expect(p, token::COMMA); }
             hi = p.get_hi_pos();
@@ -1518,13 +1502,13 @@ fn parse_pat(p: &parser) -> @ast::pat {
             let lit = parse_lit(p);
             hi = lit.span.hi;
             pat = ast::pat_lit(@lit);
-        } else if (is_plain_ident(p) &&
-                       alt p.look_ahead(1u) {
-                         token::DOT. | token::LPAREN. | token::LBRACKET. {
-                           false
-                         }
-                         _ { true }
-                       }) {
+        } else if is_plain_ident(p) &&
+                      alt p.look_ahead(1u) {
+                        token::DOT. | token::LPAREN. | token::LBRACKET. {
+                          false
+                        }
+                        _ { true }
+                      } {
             hi = p.get_hi_pos();
             pat = ast::pat_bind(parse_value_ident(p));
         } else {
@@ -1539,7 +1523,7 @@ fn parse_pat(p: &parser) -> @ast::pat {
                 args = a.node;
                 hi = a.span.hi;
               }
-              token::DOT. { args = ~[]; p.bump(); }
+              token::DOT. { args = []; p.bump(); }
               _ { expect(p, token::LPAREN); fail; }
             }
             pat = ast::pat_tag(tag_path, args);
@@ -1556,18 +1540,15 @@ fn parse_local(p: &parser, allow_init: bool) -> @ast::local {
     if eat(p, token::COLON) { ty = parse_ty(p, false); }
     let init = if allow_init { parse_initializer(p) } else { none };
     ret @spanned(lo, p.get_last_hi_pos(),
-                 {ty: ty,
-                  pat: pat,
-                  init: init,
-                  id: p.get_id()});
+                 {ty: ty, pat: pat, init: init, id: p.get_id()});
 }
 
 fn parse_let(p: &parser) -> @ast::decl {
     let lo = p.get_lo_pos();
-    let locals = ~[parse_local(p, true)];
+    let locals = [parse_local(p, true)];
     while p.peek() == token::COMMA {
         p.bump();
-        locals += ~[parse_local(p, true)];
+        locals += [parse_local(p, true)];
     }
     ret @spanned(lo, p.get_last_hi_pos(), ast::decl_local(locals));
 }
@@ -1579,7 +1560,7 @@ fn parse_stmt(p: &parser) -> @ast::stmt {
 }
 
 fn parse_crate_stmt(p: &parser) -> @ast::stmt {
-    let cdir = parse_crate_directive(p, ~[]);
+    let cdir = parse_crate_directive(p, []);
     ret @spanned(cdir.span.lo, cdir.span.hi,
                  ast::stmt_crate_directive(@cdir));
 }
@@ -1593,7 +1574,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt {
 
         let item_attrs;
         alt parse_outer_attrs_or_ext(p) {
-          none. { item_attrs = ~[]; }
+          none. { item_attrs = []; }
           some(left(attrs)) { item_attrs = attrs; }
           some(right(ext)) {
             ret @spanned(lo, ext.span.hi, ast::stmt_expr(ext, p.get_id()));
@@ -1682,6 +1663,7 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool {
             }
       }
 
+
       // We should not be calling this on a cdir.
       ast::stmt_crate_directive(cdir) {
         fail;
@@ -1697,7 +1679,7 @@ fn parse_block(p: &parser) -> ast::blk {
 
 // some blocks start with "#{"...
 fn parse_block_tail(p: &parser, lo: uint) -> ast::blk {
-    let stmts: [@ast::stmt] = ~[];
+    let stmts: [@ast::stmt] = [];
     let expr: option::t<@ast::expr> = none;
     while p.peek() != token::RBRACE {
         alt p.peek() {
@@ -1709,7 +1691,7 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk {
             alt stmt_to_expr(stmt) {
               some(e) {
                 alt p.peek() {
-                  token::SEMI. { p.bump(); stmts += ~[stmt]; }
+                  token::SEMI. { p.bump(); stmts += [stmt]; }
                   token::RBRACE. { expr = some(e); }
                   t {
                     if stmt_ends_with_semi(*stmt) {
@@ -1717,13 +1699,13 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk {
                                     "expression but found " +
                                     token::to_str(p.get_reader(), t));
                     }
-                    stmts += ~[stmt];
+                    stmts += [stmt];
                   }
                 }
               }
               none. {
                 // Not an expression statement.
-                stmts += ~[stmt];
+                stmts += [stmt];
 
 
                 if p.get_file_type() == SOURCE_FILE &&
@@ -1742,16 +1724,17 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk {
 }
 
 fn parse_ty_param(p: &parser) -> ast::ty_param {
-    let k = alt p.peek() {
-      token::TILDE. { p.bump(); ast::kind_unique }
-      token::AT. { p.bump(); ast::kind_shared }
-      _ { ast::kind_pinned }
-    };
+    let k =
+        alt p.peek() {
+          token::TILDE. { p.bump(); ast::kind_unique }
+          token::AT. { p.bump(); ast::kind_shared }
+          _ { ast::kind_pinned }
+        };
     ret {ident: parse_ident(p), kind: k};
 }
 
 fn parse_ty_params(p: &parser) -> [ast::ty_param] {
-    let ty_params: [ast::ty_param] = ~[];
+    let ty_params: [ast::ty_param] = [];
     if p.peek() == token::LT {
         p.bump();
         ty_params = parse_seq_to_gt(some(token::COMMA), parse_ty_param, p);
@@ -1764,8 +1747,8 @@ fn parse_ty_params(p: &parser) -> [ast::ty_param] {
     ret ty_params;
 }
 
-fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness)
-        -> ast::fn_decl {
+fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness) ->
+   ast::fn_decl {
     let inputs: ast::spanned<[ast::arg]> =
         parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), parse_arg,
                   p);
@@ -1773,7 +1756,7 @@ fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness)
     // Use the args list to translate each bound variable
     // mentioned in a constraint to an arg index.
     // Seems weird to do this in the parser, but I'm not sure how else to.
-    let constrs = ~[];
+    let constrs = [];
     if p.peek() == token::COLON {
         p.bump();
         constrs = parse_constrs(bind parse_ty_constr(inputs.node, _), p);
@@ -1813,7 +1796,7 @@ fn parse_fn_block_decl(p: &parser) -> ast::fn_decl {
          purity: ast::impure_fn,
          il: ast::il_normal,
          cf: ast::return,
-         constraints: ~[]};
+         constraints: []};
 }
 
 fn parse_fn(p: &parser, proto: ast::proto, purity: ast::purity,
@@ -1839,8 +1822,8 @@ fn mk_item(p: &parser, lo: uint, hi: uint, ident: &ast::ident,
 }
 
 fn parse_item_fn_or_iter(p: &parser, purity: ast::purity, proto: ast::proto,
-                         attrs: &[ast::attribute], il: ast::inlineness)
-        -> @ast::item {
+                         attrs: &[ast::attribute], il: ast::inlineness) ->
+   @ast::item {
     let lo = p.get_last_lo_pos();
     let t = parse_fn_header(p);
     let f = parse_fn(p, proto, purity, il);
@@ -1875,19 +1858,16 @@ fn parse_method(p: &parser) -> @ast::method {
     ret @spanned(lo, f.body.span.hi, meth);
 }
 
-fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) ->
-   @ast::item {
+fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     let lo = p.get_last_lo_pos();
     let ident = parse_value_ident(p);
     let ty_params = parse_ty_params(p);
     let fields: ast::spanned<[ast::obj_field]> =
         parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA),
                   parse_obj_field, p);
-    let meths: [@ast::method] = ~[];
+    let meths: [@ast::method] = [];
     expect(p, token::LBRACE);
-    while p.peek() != token::RBRACE {
-        meths += ~[parse_method(p)];
-    }
+    while p.peek() != token::RBRACE { meths += [parse_method(p)]; }
     let hi = p.get_hi_pos();
     expect(p, token::RBRACE);
     let ob: ast::_obj = {fields: fields.node, methods: meths};
@@ -1895,8 +1875,7 @@ fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) ->
                 attrs);
 }
 
-fn parse_item_res(p: &parser, attrs: &[ast::attribute]) ->
-   @ast::item {
+fn parse_item_res(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     let lo = p.get_last_lo_pos();
     let ident = parse_value_ident(p);
     let ty_params = parse_ty_params(p);
@@ -1908,15 +1887,15 @@ fn parse_item_res(p: &parser, attrs: &[ast::attribute]) ->
     let dtor = parse_block(p);
     let decl =
         {inputs:
-             ~[{mode: ast::alias(false),
-                ty: t,
-                ident: arg_ident,
-                id: p.get_id()}],
+             [{mode: ast::alias(false),
+               ty: t,
+               ident: arg_ident,
+               id: p.get_id()}],
          output: @spanned(lo, lo, ast::ty_nil),
          purity: ast::impure_fn,
          il: ast::il_normal,
          cf: ast::return,
-         constraints: ~[]};
+         constraints: []};
     let f = {decl: decl, proto: ast::proto_fn, body: dtor};
     ret mk_item(p, lo, dtor.span.hi, ident,
                 ast::item_res(f, p.get_id(), ty_params, p.get_id()), attrs);
@@ -1926,14 +1905,14 @@ fn parse_mod_items(p: &parser, term: token::token,
                    first_item_attrs: &[ast::attribute]) -> ast::_mod {
     // Shouldn't be any view items since we've already parsed an item attr
     let view_items =
-        if vec::len(first_item_attrs) == 0u { parse_view(p) } else { ~[] };
-    let items: [@ast::item] = ~[];
+        if vec::len(first_item_attrs) == 0u { parse_view(p) } else { [] };
+    let items: [@ast::item] = [];
     let initial_attrs = first_item_attrs;
     while p.peek() != term {
         let attrs = initial_attrs + parse_outer_attributes(p);
-        initial_attrs = ~[];
+        initial_attrs = [];
         alt parse_item(p, attrs) {
-          some(i) { items += ~[i]; }
+          some(i) { items += [i]; }
           _ {
             p.fatal("expected item but found " +
                         token::to_str(p.get_reader(), p.peek()));
@@ -1999,25 +1978,25 @@ fn parse_native_item(p: &parser, attrs: &[ast::attribute]) ->
    @ast::native_item {
     if eat_word(p, "type") {
         ret parse_item_native_type(p, attrs);
-    } else if (eat_word(p, "fn")) {
+    } else if eat_word(p, "fn") {
         ret parse_item_native_fn(p, attrs);
     } else { unexpected(p, p.peek()); }
 }
 
 fn parse_native_mod_items(p: &parser, native_name: &str, abi: ast::native_abi,
-                          first_item_attrs: &[ast::attribute])
-    -> ast::native_mod {
+                          first_item_attrs: &[ast::attribute]) ->
+   ast::native_mod {
     // Shouldn't be any view items since we've already parsed an item attr
     let view_items =
         if vec::len(first_item_attrs) == 0u {
             parse_native_view(p)
-        } else { ~[] };
-    let items: [@ast::native_item] = ~[];
+        } else { [] };
+    let items: [@ast::native_item] = [];
     let initial_attrs = first_item_attrs;
     while p.peek() != token::RBRACE {
         let attrs = initial_attrs + parse_outer_attributes(p);
-        initial_attrs = ~[];
-        items += ~[parse_native_item(p, attrs)];
+        initial_attrs = [];
+        items += [parse_native_item(p, attrs)];
     }
     ret {native_name: native_name,
          abi: abi,
@@ -2031,13 +2010,13 @@ fn parse_item_native_mod(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     if !is_word(p, "mod") {
         let t = parse_str(p);
         if str::eq(t, "cdecl") {
-        } else if (str::eq(t, "rust")) {
+        } else if str::eq(t, "rust") {
             abi = ast::native_abi_rust;
-        } else if (str::eq(t, "llvm")) {
+        } else if str::eq(t, "llvm") {
             abi = ast::native_abi_llvm;
-        } else if (str::eq(t, "rust-intrinsic")) {
+        } else if str::eq(t, "rust-intrinsic") {
             abi = ast::native_abi_rust_intrinsic;
-        } else if (str::eq(t, "x86stdcall")) {
+        } else if str::eq(t, "x86stdcall") {
             abi = ast::native_abi_x86stdcall;
         } else { p.fatal("unsupported abi: " + t); }
     }
@@ -2079,7 +2058,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     let lo = p.get_last_lo_pos();
     let id = parse_ident(p);
     let ty_params = parse_ty_params(p);
-    let variants: [ast::variant] = ~[];
+    let variants: [ast::variant] = [];
     // Newtype syntax
     if p.peek() == token::EQ {
         if p.get_bad_expr_words().contains_key(id) {
@@ -2091,10 +2070,10 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
         let variant =
             spanned(ty.span.lo, ty.span.hi,
                     {name: id,
-                     args: ~[{ty: ty, id: p.get_id()}],
+                     args: [{ty: ty, id: p.get_id()}],
                      id: p.get_id()});
         ret mk_item(p, lo, ty.span.hi, id,
-                    ast::item_tag(~[variant], ty_params), attrs);
+                    ast::item_tag([variant], ty_params), attrs);
     }
     expect(p, token::LBRACE);
     while p.peek() != token::RBRACE {
@@ -2104,7 +2083,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
             check_bad_word(p);
             let vlo = p.get_lo_pos();
             p.bump();
-            let args: [ast::variant_arg] = ~[];
+            let args: [ast::variant_arg] = [];
             let vhi = p.get_hi_pos();
             alt p.peek() {
               token::LPAREN. {
@@ -2112,7 +2091,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
                     parse_seq(token::LPAREN, token::RPAREN,
                               some(token::COMMA), bind parse_ty(_, false), p);
                 for ty: @ast::ty in arg_tys.node {
-                    args += ~[{ty: ty, id: p.get_id()}];
+                    args += [{ty: ty, id: p.get_id()}];
                 }
                 vhi = arg_tys.span.hi;
               }
@@ -2121,7 +2100,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
             expect(p, token::SEMI);
             p.get_id();
             let vr = {name: p.get_str(name), args: args, id: p.get_id()};
-            variants += ~[spanned(vlo, vhi, vr)];
+            variants += [spanned(vlo, vhi, vr)];
           }
           token::RBRACE. {/* empty */ }
           _ {
@@ -2144,33 +2123,33 @@ fn parse_auth(p: &parser) -> ast::_auth {
 fn parse_item(p: &parser, attrs: &[ast::attribute]) -> option::t<@ast::item> {
     if eat_word(p, "const") {
         ret some(parse_item_const(p, attrs));
-    } else if (eat_word(p, "inline")) {
+    } else if eat_word(p, "inline") {
         expect_word(p, "fn");
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn,
                                        attrs, ast::il_inline));
-    } else if (is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN) {
+    } else if is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN {
         p.bump();
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn,
                                        attrs, ast::il_normal));
-    } else if (eat_word(p, "pred")) {
-        ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn,
-                                       attrs, ast::il_normal));
-    } else if (eat_word(p, "iter")) {
+    } else if eat_word(p, "pred") {
+        ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn, attrs,
+                                       ast::il_normal));
+    } else if eat_word(p, "iter") {
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_iter,
                                        attrs, ast::il_normal));
-    } else if (eat_word(p, "mod")) {
+    } else if eat_word(p, "mod") {
         ret some(parse_item_mod(p, attrs));
-    } else if (eat_word(p, "native")) {
+    } else if eat_word(p, "native") {
         ret some(parse_item_native_mod(p, attrs));
     }
     if eat_word(p, "type") {
         ret some(parse_item_type(p, attrs));
-    } else if (eat_word(p, "tag")) {
+    } else if eat_word(p, "tag") {
         ret some(parse_item_tag(p, attrs));
-    } else if (is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN) {
+    } else if is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN {
         p.bump();
         ret some(parse_item_obj(p, attrs));
-    } else if (eat_word(p, "resource")) {
+    } else if eat_word(p, "resource") {
         ret some(parse_item_res(p, attrs));
     } else { ret none; }
 }
@@ -2185,8 +2164,8 @@ fn parse_outer_attrs_or_ext(p: &parser) -> attr_or_ext {
         p.bump();
         if p.peek() == token::LBRACKET {
             let first_attr = parse_attribute_naked(p, ast::attr_outer, lo);
-            ret some(left(~[first_attr] + parse_outer_attributes(p)));
-        } else if (!(p.peek() == token::LT || p.peek() == token::LBRACKET)) {
+            ret some(left([first_attr] + parse_outer_attributes(p)));
+        } else if !(p.peek() == token::LT || p.peek() == token::LBRACKET) {
             ret some(right(parse_syntax_ext_naked(p, lo)));
         } else { ret none; }
     } else { ret none; }
@@ -2194,9 +2173,9 @@ fn parse_outer_attrs_or_ext(p: &parser) -> attr_or_ext {
 
 // Parse attributes that appear before an item
 fn parse_outer_attributes(p: &parser) -> [ast::attribute] {
-    let attrs: [ast::attribute] = ~[];
+    let attrs: [ast::attribute] = [];
     while p.peek() == token::POUND {
-        attrs += ~[parse_attribute(p, ast::attr_outer)];
+        attrs += [parse_attribute(p, ast::attr_outer)];
     }
     ret attrs;
 }
@@ -2224,19 +2203,19 @@ fn parse_attribute_naked(p: &parser, style: ast::attr_style, lo: uint) ->
 // until we see the semi).
 fn parse_inner_attrs_and_next(p: &parser) ->
    {inner: [ast::attribute], next: [ast::attribute]} {
-    let inner_attrs: [ast::attribute] = ~[];
-    let next_outer_attrs: [ast::attribute] = ~[];
+    let inner_attrs: [ast::attribute] = [];
+    let next_outer_attrs: [ast::attribute] = [];
     while p.peek() == token::POUND {
         let attr = parse_attribute(p, ast::attr_inner);
         if p.peek() == token::SEMI {
             p.bump();
-            inner_attrs += ~[attr];
+            inner_attrs += [attr];
         } else {
             // It's not really an inner attribute
             let outer_attr =
                 spanned(attr.span.lo, attr.span.hi,
                         {style: ast::attr_outer, value: attr.node.value});
-            next_outer_attrs += ~[outer_attr];
+            next_outer_attrs += [outer_attr];
             break;
         }
     }
@@ -2271,7 +2250,7 @@ fn parse_meta_seq(p: &parser) -> [@ast::meta_item] {
 }
 
 fn parse_optional_meta(p: &parser) -> [@ast::meta_item] {
-    alt p.peek() { token::LPAREN. { ret parse_meta_seq(p); } _ { ret ~[]; } }
+    alt p.peek() { token::LPAREN. { ret parse_meta_seq(p); } _ { ret []; } }
 }
 
 fn parse_use(p: &parser) -> ast::view_item_ {
@@ -2283,16 +2262,14 @@ fn parse_use(p: &parser) -> ast::view_item_ {
 fn parse_rest_import_name(p: &parser, first: ast::ident,
                           def_ident: option::t<ast::ident>) ->
    ast::view_item_ {
-    let identifiers: [ast::ident] = ~[first];
+    let identifiers: [ast::ident] = [first];
     let glob: bool = false;
     let from_idents = option::none::<[ast::import_ident]>;
     while true {
         alt p.peek() {
           token::SEMI. { break; }
           token::MOD_SEP. {
-            if glob {
-                p.fatal("cannot path into a glob");
-            }
+            if glob { p.fatal("cannot path into a glob"); }
             if option::is_some(from_idents) {
                 p.fatal("cannot path into import list");
             }
@@ -2301,7 +2278,8 @@ fn parse_rest_import_name(p: &parser, first: ast::ident,
           _ { p.fatal("expecting '::' or ';'"); }
         }
         alt p.peek() {
-          token::IDENT(_, _) { identifiers += ~[parse_ident(p)]; }
+          token::IDENT(_, _) { identifiers += [parse_ident(p)]; }
+
 
           //the lexer can't tell the different kinds of stars apart ) :
           token::BINOP(token::STAR.) {
@@ -2309,33 +2287,32 @@ fn parse_rest_import_name(p: &parser, first: ast::ident,
             p.bump();
           }
 
+
           token::LBRACE. {
             fn parse_import_ident(p: &parser) -> ast::import_ident {
                 let lo = p.get_lo_pos();
                 let ident = parse_ident(p);
                 let hi = p.get_hi_pos();
-                ret spanned(lo, hi, {name: ident,
-                                     id: p.get_id()});
+                ret spanned(lo, hi, {name: ident, id: p.get_id()});
             }
-            let from_idents_ = parse_seq(token::LBRACE,
-                                         token::RBRACE,
-                                         some(token::COMMA),
-                                         parse_import_ident,
-                                         p).node;
+            let from_idents_ =
+                parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA),
+                          parse_import_ident, p).node;
             if vec::is_empty(from_idents_) {
                 p.fatal("at least one import is required");
             }
             from_idents = some(from_idents_);
           }
 
-          _ { p.fatal("expecting an identifier, or '*'"); }
+
+          _ {
+            p.fatal("expecting an identifier, or '*'");
+          }
         }
     }
     alt def_ident {
       some(i) {
-        if glob {
-            p.fatal("globbed imports can't be renamed");
-        }
+        if glob { p.fatal("globbed imports can't be renamed"); }
         if option::is_some(from_idents) {
             p.fatal("can't rename import list");
         }
@@ -2350,7 +2327,7 @@ fn parse_rest_import_name(p: &parser, first: ast::ident,
                                            p.get_id());
         } else {
             let len = vec::len(identifiers);
-            ret ast::view_item_import(identifiers.(len - 1u), identifiers,
+            ret ast::view_item_import(identifiers[len - 1u], identifiers,
                                       p.get_id());
         }
       }
@@ -2385,8 +2362,9 @@ fn parse_import(p: &parser) -> ast::view_item_ {
 }
 
 fn parse_export(p: &parser) -> ast::view_item_ {
-    let ids = parse_seq_to_before_end(
-        token::SEMI, option::some(token::COMMA), parse_ident, p);
+    let ids =
+        parse_seq_to_before_end(token::SEMI, option::some(token::COMMA),
+                                parse_ident, p);
     ret ast::view_item_export(ids, p.get_id());
 }
 
@@ -2395,9 +2373,9 @@ fn parse_view_item(p: &parser) -> @ast::view_item {
     let the_item =
         if eat_word(p, "use") {
             parse_use(p)
-        } else if (eat_word(p, "import")) {
+        } else if eat_word(p, "import") {
             parse_import(p)
-        } else if (eat_word(p, "export")) { parse_export(p) } else { fail };
+        } else if eat_word(p, "export") { parse_export(p) } else { fail };
     let hi = p.get_lo_pos();
     expect(p, token::SEMI);
     ret @spanned(lo, hi, the_item);
@@ -2415,14 +2393,14 @@ fn is_view_item(p: &parser) -> bool {
 }
 
 fn parse_view(p: &parser) -> [@ast::view_item] {
-    let items: [@ast::view_item] = ~[];
-    while is_view_item(p) { items += ~[parse_view_item(p)]; }
+    let items: [@ast::view_item] = [];
+    while is_view_item(p) { items += [parse_view_item(p)]; }
     ret items;
 }
 
 fn parse_native_view(p: &parser) -> [@ast::view_item] {
-    let items: [@ast::view_item] = ~[];
-    while is_view_item(p) { items += ~[parse_view_item(p)]; }
+    let items: [@ast::view_item] = [];
+    while is_view_item(p) { items += [parse_view_item(p)]; }
     ret items;
 }
 
@@ -2436,7 +2414,7 @@ fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg,
                                sess: &parse_sess) -> @ast::crate {
     let ftype = SOURCE_FILE;
     let filemap = codemap::new_filemap(name, 0u, 0u);
-    sess.cm.files += ~[filemap];
+    sess.cm.files += [filemap];
     let itr = @interner::mk(str::hash, str::eq);
     let rdr = lexer::new_reader(sess.cm, source, filemap, itr);
     let p = new_parser(sess, cfg, rdr, ftype);
@@ -2444,14 +2422,13 @@ fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg,
 }
 
 // Parses a source module as a crate
-fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) ->
-   @ast::crate {
+fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) -> @ast::crate {
     let lo = p.get_lo_pos();
     let crate_attrs = parse_inner_attrs_and_next(p);
     let first_item_outer_attrs = crate_attrs.next;
     let m = parse_mod_items(p, token::EOF, first_item_outer_attrs);
     ret @spanned(lo, p.get_lo_pos(),
-                 {directives: ~[],
+                 {directives: [],
                   module: m,
                   attrs: crate_attrs.inner,
                   config: p.get_cfg()});
@@ -2488,6 +2465,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
             };
         alt p.peek() {
 
+
           // mod x = "foo.rs";
           token::SEMI. {
             let hi = p.get_hi_pos();
@@ -2495,6 +2473,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
             ret spanned(lo, hi, ast::cdir_src_mod(id, file_opt, outer_attrs));
           }
 
+
           // mod x = "foo_dir" { ...directives... }
           token::LBRACE. {
             p.bump();
@@ -2510,14 +2489,14 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
           }
           t { unexpected(p, t); }
         }
-    } else if (eat_word(p, "auth")) {
+    } else if eat_word(p, "auth") {
         let n = parse_path(p);
         expect(p, token::EQ);
         let a = parse_auth(p);
         let hi = p.get_hi_pos();
         expect(p, token::SEMI);
         ret spanned(lo, hi, ast::cdir_auth(n, a));
-    } else if (is_view_item(p)) {
+    } else if is_view_item(p) {
         let vi = parse_view_item(p);
         ret spanned(lo, vi.span.hi, ast::cdir_view_item(vi));
     } else { ret p.fatal("expected crate directive"); }
@@ -2534,10 +2513,10 @@ fn parse_crate_directives(p: &parser, term: token::token,
         expect_word(p, "mod");
     }
 
-    let cdirs: [@ast::crate_directive] = ~[];
+    let cdirs: [@ast::crate_directive] = [];
     while p.peek() != term {
         let cdir = @parse_crate_directive(p, first_outer_attr);
-        cdirs += ~[cdir];
+        cdirs += [cdir];
     }
     ret cdirs;
 }
@@ -2551,7 +2530,7 @@ fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg,
     let crate_attrs = leading_attrs.inner;
     let first_cdir_attr = leading_attrs.next;
     let cdirs = parse_crate_directives(p, token::EOF, first_cdir_attr);
-    let deps: [str] = ~[];
+    let deps: [str] = [];
     let cx =
         @{p: p,
           mode: eval::mode_parse,
@@ -2570,15 +2549,14 @@ fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg,
                   config: p.get_cfg()});
 }
 
-fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg,
-                         sess: &parse_sess) -> @ast::crate {
+fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess)
+   -> @ast::crate {
     if str::ends_with(input, ".rc") {
         parse_crate_from_crate_file(input, cfg, sess)
     } else if str::ends_with(input, ".rs") {
         parse_crate_from_source_file(input, cfg, sess)
     } else {
-        codemap::emit_error(none,
-                            "unknown input file type: " + input,
+        codemap::emit_error(none, "unknown input file type: " + input,
                             sess.cm);
         fail
     }
diff --git a/src/comp/syntax/parse/token.rs b/src/comp/syntax/parse/token.rs
index 574684dc234..c974dc915c4 100644
--- a/src/comp/syntax/parse/token.rs
+++ b/src/comp/syntax/parse/token.rs
@@ -116,6 +116,7 @@ fn to_str(r: lexer::reader, t: token) -> str {
       BINOP(op) { ret binop_to_str(op); }
       BINOPEQ(op) { ret binop_to_str(op) + "="; }
 
+
       /* Structural symbols */
       AT. {
         ret "@";
@@ -140,6 +141,7 @@ fn to_str(r: lexer::reader, t: token) -> str {
       POUND_LBRACE. { ret "#{"; }
       POUND_LT. { ret "#<"; }
 
+
       /* Literals */
       LIT_INT(i) {
         ret int::to_str(i, 10u);
@@ -165,6 +167,7 @@ fn to_str(r: lexer::reader, t: token) -> str {
       }
       LIT_BOOL(b) { if b { ret "true"; } else { ret "false"; } }
 
+
       /* Name components */
       IDENT(s, _) {
         ret interner::get::<str>(*r.get_interner(), s);
diff --git a/src/comp/syntax/print/pp.rs b/src/comp/syntax/print/pp.rs
index bd67c552cbb..adeccd4150c 100644
--- a/src/comp/syntax/print/pp.rs
+++ b/src/comp/syntax/print/pp.rs
@@ -66,7 +66,7 @@ tag token { STRING(str, int); BREAK(break_t); BEGIN(begin_t); END; EOF; }
 
 fn tok_str(t: token) -> str {
     alt t {
-      STRING(s, len) { ret #fmt("STR(%s,%d)", s, len); }
+      STRING(s, len) { ret #fmt["STR(%s,%d)", s, len]; }
       BREAK(_) { ret "BREAK"; }
       BEGIN(_) { ret "BEGIN"; }
       END. { ret "END"; }
@@ -84,7 +84,7 @@ fn buf_str(toks: &[mutable token], szs: &[mutable int], left: uint,
     while i != right && L != 0u {
         L -= 1u;
         if i != left { s += ", "; }
-        s += #fmt("%d=%s", szs.(i), tok_str(toks.(i)));
+        s += #fmt["%d=%s", szs[i], tok_str(toks[i])];
         i += 1u;
         i %= n;
     }
@@ -103,11 +103,11 @@ fn mk_printer(out: io::writer, linewidth: uint) -> printer {
     // fall behind.
 
     let n: uint = 3u * linewidth;
-    log #fmt("mk_printer %u", linewidth);
+    log #fmt["mk_printer %u", linewidth];
     let token: [mutable token] = vec::init_elt_mut(EOF, n);
     let size: [mutable int] = vec::init_elt_mut(0, n);
     let scan_stack: [mutable uint] = vec::init_elt_mut(0u, n);
-    let print_stack: [print_stack_elt] = ~[];
+    let print_stack: [print_stack_elt] = [];
     ret printer(out, n, linewidth as int, // margin
                 linewidth as int, // space
                 0u, // left
@@ -237,18 +237,18 @@ obj printer(out: io::writer,
             // buffered indentation to avoid writing trailing whitespace
             mutable pending_indentation: int) {
 
-    fn last_token() -> token { ret token.(right); }
+    fn last_token() -> token { ret token[right]; }
 
     // be very careful with this!
-    fn replace_last_token(t: token) { token.(right) = t; }
+    fn replace_last_token(t: token) { token[right] = t; }
 
     fn pretty_print(t: token) {
-        log #fmt("pp [%u,%u]", left, right);
+        log #fmt["pp [%u,%u]", left, right];
         alt t {
           EOF. {
             if !scan_stack_empty {
                 self.check_stack(0);
-                self.advance_left(token.(left), size.(left));
+                self.advance_left(token[left], size[left]);
             }
             self.indent(0);
           }
@@ -259,20 +259,20 @@ obj printer(out: io::writer,
                 left = 0u;
                 right = 0u;
             } else { self.advance_right(); }
-            log #fmt("pp BEGIN/buffer [%u,%u]", left, right);
-            token.(right) = t;
-            size.(right) = -right_total;
+            log #fmt["pp BEGIN/buffer [%u,%u]", left, right];
+            token[right] = t;
+            size[right] = -right_total;
             self.scan_push(right);
           }
           END. {
             if scan_stack_empty {
-                log #fmt("pp END/print [%u,%u]", left, right);
+                log #fmt["pp END/print [%u,%u]", left, right];
                 self.print(t, 0);
             } else {
-                log #fmt("pp END/buffer [%u,%u]", left, right);
+                log #fmt["pp END/buffer [%u,%u]", left, right];
                 self.advance_right();
-                token.(right) = t;
-                size.(right) = -1;
+                token[right] = t;
+                size[right] = -1;
                 self.scan_push(right);
             }
           }
@@ -283,22 +283,22 @@ obj printer(out: io::writer,
                 left = 0u;
                 right = 0u;
             } else { self.advance_right(); }
-            log #fmt("pp BREAK/buffer [%u,%u]", left, right);
+            log #fmt["pp BREAK/buffer [%u,%u]", left, right];
             self.check_stack(0);
             self.scan_push(right);
-            token.(right) = t;
-            size.(right) = -right_total;
+            token[right] = t;
+            size[right] = -right_total;
             right_total += b.blank_space;
           }
           STRING(s, len) {
             if scan_stack_empty {
-                log #fmt("pp STRING/print [%u,%u]", left, right);
+                log #fmt["pp STRING/print [%u,%u]", left, right];
                 self.print(t, len);
             } else {
-                log #fmt("pp STRING/buffer [%u,%u]", left, right);
+                log #fmt["pp STRING/buffer [%u,%u]", left, right];
                 self.advance_right();
-                token.(right) = t;
-                size.(right) = len;
+                token[right] = t;
+                size[right] = len;
                 right_total += len;
                 self.check_stream();
             }
@@ -306,43 +306,40 @@ obj printer(out: io::writer,
         }
     }
     fn check_stream() {
-        log #fmt("check_stream [%u, %u] with left_total=%d, right_total=%d",
-                 left, right, left_total, right_total);
+        log #fmt["check_stream [%u, %u] with left_total=%d, right_total=%d",
+                 left, right, left_total, right_total];
         if right_total - left_total > space {
-            log #fmt("scan window is %d, longer than space on line (%d)",
-                     right_total - left_total, space);
+            log #fmt["scan window is %d, longer than space on line (%d)",
+                     right_total - left_total, space];
             if !scan_stack_empty {
-                if left == scan_stack.(bottom) {
-                    log #fmt("setting %u to infinity and popping", left);
-                    size.(self.scan_pop_bottom()) = size_infinity;
+                if left == scan_stack[bottom] {
+                    log #fmt["setting %u to infinity and popping", left];
+                    size[self.scan_pop_bottom()] = size_infinity;
                 }
             }
-            self.advance_left(token.(left), size.(left));
+            self.advance_left(token[left], size[left]);
             if left != right { self.check_stream(); }
         }
     }
     fn scan_push(x: uint) {
-        log #fmt("scan_push %u", x);
+        log #fmt["scan_push %u", x];
         if scan_stack_empty {
             scan_stack_empty = false;
         } else { top += 1u; top %= buf_len; assert (top != bottom); }
-        scan_stack.(top) = x;
+        scan_stack[top] = x;
     }
     fn scan_pop() -> uint {
         assert (!scan_stack_empty);
-        let x = scan_stack.(top);
+        let x = scan_stack[top];
         if top == bottom {
             scan_stack_empty = true;
         } else { top += buf_len - 1u; top %= buf_len; }
         ret x;
     }
-    fn scan_top() -> uint {
-        assert (!scan_stack_empty);
-        ret scan_stack.(top);
-    }
+    fn scan_top() -> uint { assert (!scan_stack_empty); ret scan_stack[top]; }
     fn scan_pop_bottom() -> uint {
         assert (!scan_stack_empty);
-        let x = scan_stack.(bottom);
+        let x = scan_stack[bottom];
         if top == bottom {
             scan_stack_empty = true;
         } else { bottom += 1u; bottom %= buf_len; }
@@ -354,7 +351,7 @@ obj printer(out: io::writer,
         assert (right != left);
     }
     fn advance_left(x: token, L: int) {
-        log #fmt("advnce_left [%u,%u], sizeof(%u)=%d", left, right, left, L);
+        log #fmt["advnce_left [%u,%u], sizeof(%u)=%d", left, right, left, L];
         if L >= 0 {
             self.print(x, L);
             alt x {
@@ -365,47 +362,47 @@ obj printer(out: io::writer,
             if left != right {
                 left += 1u;
                 left %= buf_len;
-                self.advance_left(token.(left), size.(left));
+                self.advance_left(token[left], size[left]);
             }
         }
     }
     fn check_stack(k: int) {
         if !scan_stack_empty {
             let x = self.scan_top();
-            alt token.(x) {
+            alt token[x] {
               BEGIN(b) {
                 if k > 0 {
-                    size.(self.scan_pop()) = size.(x) + right_total;
+                    size[self.scan_pop()] = size[x] + right_total;
                     self.check_stack(k - 1);
                 }
               }
               END. {
                 // paper says + not =, but that makes no sense.
 
-                size.(self.scan_pop()) = 1;
+                size[self.scan_pop()] = 1;
                 self.check_stack(k + 1);
               }
               _ {
-                size.(self.scan_pop()) = size.(x) + right_total;
+                size[self.scan_pop()] = size[x] + right_total;
                 if k > 0 { self.check_stack(k); }
               }
             }
         }
     }
     fn print_newline(amount: int) {
-        log #fmt("NEWLINE %d", amount);
+        log #fmt["NEWLINE %d", amount];
         out.write_str("\n");
         pending_indentation = 0;
         self.indent(amount);
     }
     fn indent(amount: int) {
-        log #fmt("INDENT %d", amount);
+        log #fmt["INDENT %d", amount];
         pending_indentation += amount;
     }
     fn top() -> print_stack_elt {
         let n = vec::len(print_stack);
         let top: print_stack_elt = {offset: 0, pbreak: broken(inconsistent)};
-        if n != 0u { top = print_stack.(n - 1u); }
+        if n != 0u { top = print_stack[n - 1u]; }
         ret top;
     }
     fn write_str(s: str) {
@@ -416,18 +413,18 @@ obj printer(out: io::writer,
         out.write_str(s);
     }
     fn print(x: token, L: int) {
-        log #fmt("print %s %d (remaining line space=%d)", tok_str(x), L,
-                 space);
+        log #fmt["print %s %d (remaining line space=%d)", tok_str(x), L,
+                 space];
         log buf_str(token, size, left, right, 6u);
         alt x {
           BEGIN(b) {
             if L > space {
                 let col = margin - space + b.offset;
-                log #fmt("print BEGIN -> push broken block at col %d", col);
-                print_stack += ~[{offset: col, pbreak: broken(b.breaks)}];
+                log #fmt["print BEGIN -> push broken block at col %d", col];
+                print_stack += [{offset: col, pbreak: broken(b.breaks)}];
             } else {
                 log "print BEGIN -> push fitting block";
-                print_stack += ~[{offset: 0, pbreak: fits}];
+                print_stack += [{offset: 0, pbreak: fits}];
             }
           }
           END. {
diff --git a/src/comp/syntax/print/pprust.rs b/src/comp/syntax/print/pprust.rs
index 0e23928699e..c0e38a3b40e 100644
--- a/src/comp/syntax/print/pprust.rs
+++ b/src/comp/syntax/print/pprust.rs
@@ -32,7 +32,7 @@ tag ann_node {
     node_expr(ps, @ast::expr);
     node_pat(ps, @ast::pat);
 }
-type pp_ann = {pre: fn(&ann_node) , post: fn(&ann_node) };
+type pp_ann = {pre: fn(&ann_node), post: fn(&ann_node)};
 
 fn no_ann() -> pp_ann {
     fn ignore(_node: &ann_node) { }
@@ -49,12 +49,12 @@ type ps =
       mutable boxes: [pp::breaks],
       ann: pp_ann};
 
-fn ibox(s: &ps, u: uint) { s.boxes += ~[pp::inconsistent]; pp::ibox(s.s, u); }
+fn ibox(s: &ps, u: uint) { s.boxes += [pp::inconsistent]; pp::ibox(s.s, u); }
 
 fn end(s: &ps) { vec::pop(s.boxes); pp::end(s.s); }
 
 fn rust_printer(writer: io::writer) -> ps {
-    let boxes: [pp::breaks] = ~[];
+    let boxes: [pp::breaks] = [];
     ret @{s: pp::mk_printer(writer, default_columns),
           cm: none::<codemap>,
           comments: none::<[lexer::cmnt]>,
@@ -75,7 +75,7 @@ const default_columns: uint = 78u;
 // copy forward.
 fn print_crate(cm: &codemap, crate: @ast::crate, filename: str,
                in: io::reader, out: io::writer, ann: &pp_ann) {
-    let boxes: [pp::breaks] = ~[];
+    let boxes: [pp::breaks] = [];
     let r = lexer::gather_comments_and_literals(cm, filename, in);
     let s =
         @{s: pp::mk_printer(out, default_columns),
@@ -135,12 +135,9 @@ fn attribute_to_str(attr: &ast::attribute) -> str {
     be to_str(attr, print_attribute);
 }
 
-fn cbox(s: &ps, u: uint) { s.boxes += ~[pp::consistent]; pp::cbox(s.s, u); }
+fn cbox(s: &ps, u: uint) { s.boxes += [pp::consistent]; pp::cbox(s.s, u); }
 
-fn box(s: &ps, u: uint, b: pp::breaks) {
-    s.boxes += ~[b];
-    pp::box(s.s, u, b);
-}
+fn box(s: &ps, u: uint, b: pp::breaks) { s.boxes += [b]; pp::box(s.s, u, b); }
 
 fn nbsp(s: &ps) { word(s.s, " "); }
 
@@ -175,22 +172,16 @@ fn bclose_(s: &ps, span: codemap::span, indented: uint) {
 fn bclose(s: &ps, span: codemap::span) { bclose_(s, span, indent_unit); }
 
 fn is_begin(s: &ps) -> bool {
-    alt s.s.last_token() {
-      pp::BEGIN(_) { true }
-      _ { false }
-    }
+    alt s.s.last_token() { pp::BEGIN(_) { true } _ { false } }
 }
 
 fn is_end(s: &ps) -> bool {
-    alt s.s.last_token() {
-      pp::END. { true }
-      _ { false }
-    }
+    alt s.s.last_token() { pp::END. { true } _ { false } }
 }
 
 fn is_bol(s: &ps) -> bool {
     ret s.s.last_token() == pp::EOF ||
-        s.s.last_token() == pp::hardbreak_tok();
+            s.s.last_token() == pp::hardbreak_tok();
 }
 
 fn hardbreak_if_not_bol(s: &ps) { if !is_bol(s) { hardbreak(s.s); } }
@@ -218,7 +209,7 @@ fn synth_comment(s: &ps, text: str) {
     word(s.s, "*/");
 }
 
-fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ) {
+fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN)) {
     box(s, 0u, b);
     let first = true;
     for elt: IN in elts {
@@ -229,8 +220,8 @@ fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ) {
 }
 
 
-fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ,
-                     get_span: fn(&IN) -> codemap::span ) {
+fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN),
+                     get_span: fn(&IN) -> codemap::span) {
     box(s, 0u, b);
     let len = vec::len::<IN>(elts);
     let i = 0u;
@@ -241,7 +232,7 @@ fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ,
         if i < len {
             word(s.s, ",");
             maybe_print_trailing_comment(s, get_span(elt),
-                                         some(get_span(elts.(i)).hi));
+                                         some(get_span(elts[i]).hi));
             space_if_not_bol(s);
         }
     }
@@ -290,7 +281,7 @@ fn print_type(s: &ps, ty: &@ast::ty) {
         alt mt.mut {
           ast::mut. { word_space(s, "mutable"); }
           ast::maybe_mut. { word_space(s, "mutable?"); }
-          ast::imm. {}
+          ast::imm. { }
         }
         print_type(s, mt.ty);
         word(s.s, "]");
@@ -322,9 +313,9 @@ fn print_type(s: &ps, ty: &@ast::ty) {
         word(s.s, "}");
       }
       ast::ty_tup(elts) {
-          popen(s);
-          commasep(s, inconsistent, elts, print_type);
-          pclose(s);
+        popen(s);
+        commasep(s, inconsistent, elts, print_type);
+        pclose(s);
       }
       ast::ty_fn(proto, inputs, output, cf, constrs) {
         print_ty_fn(s, proto, none::<str>, inputs, output, cf, constrs);
@@ -371,6 +362,7 @@ fn print_native_item(s: &ps, item: &@ast::native_item) {
       }
 
 
+
       ast::native_item_fn(lname, decl, typarams) {
         print_fn(s, decl, ast::proto_fn, item.ident, typarams,
                  decl.constraints);
@@ -457,8 +449,8 @@ fn print_item(s: &ps, item: &@ast::item) {
       ast::item_tag(variants, params) {
         let newtype =
             vec::len(variants) == 1u &&
-                str::eq(item.ident, variants.(0).node.name) &&
-                vec::len(variants.(0).node.args) == 1u;
+                str::eq(item.ident, variants[0].node.name) &&
+                vec::len(variants[0].node.args) == 1u;
         if newtype {
             ibox(s, indent_unit);
             word_space(s, "tag");
@@ -468,7 +460,7 @@ fn print_item(s: &ps, item: &@ast::item) {
         space(s.s);
         if newtype {
             word_space(s, "=");
-            print_type(s, variants.(0).node.args.(0).ty);
+            print_type(s, variants[0].node.args[0].ty);
             word(s.s, ";");
             end(s);
         } else {
@@ -509,11 +501,11 @@ fn print_item(s: &ps, item: &@ast::item) {
         space(s.s);
         bopen(s);
         for meth: @ast::method in _obj.methods {
-            let typarams: [ast::ty_param] = ~[];
+            let typarams: [ast::ty_param] = [];
             hardbreak_if_not_bol(s);
             maybe_print_comment(s, meth.span.lo);
             print_fn(s, meth.node.meth.decl, meth.node.meth.proto,
-                     meth.node.ident, typarams, ~[]);
+                     meth.node.ident, typarams, []);
             word(s.s, " ");
             print_block(s, meth.node.meth.body);
         }
@@ -524,8 +516,8 @@ fn print_item(s: &ps, item: &@ast::item) {
         word(s.s, item.ident);
         print_type_params(s, tps);
         popen(s);
-        word_space(s, dt.decl.inputs.(0).ident + ":");
-        print_type(s, dt.decl.inputs.(0).ty);
+        word_space(s, dt.decl.inputs[0].ident + ":");
+        print_type(s, dt.decl.inputs[0].ty);
         pclose(s);
         space(s.s);
         print_block(s, dt.body);
@@ -620,85 +612,77 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type,
     // extra semi to make sure the output retains the same meaning.
     fn maybe_protect_block(s: &ps, last: &option::t<@ast::stmt>,
                            next: &expr_or_stmt) {
-        let last_expr_is_block = alt last {
-          option::some(@{node: ast::stmt_expr(e, _), _}) {
-            alt e.node {
-              ast::expr_if(_ ,_ ,_)
-              | ast::expr_alt(_, _)
-              | ast::expr_block(_) { true }
+        let last_expr_is_block =
+            alt last {
+              option::some(@{node: ast::stmt_expr(e, _), _}) {
+                alt e.node {
+                  ast::expr_if(_, _, _) | ast::expr_alt(_, _) |
+                  ast::expr_block(_) {
+                    true
+                  }
+                  _ { false }
+                }
+                true
+              }
               _ { false }
-            }
-            true
-          }
-          _ { false }
-        };
+            };
 
         if !last_expr_is_block { ret; }
 
-        let next_expr_is_ambig = alt next {
-          expr_(e) { expr_is_ambig(e) }
-          stmt_(@{node: ast::stmt_expr(e, _), _}) {
-            expr_is_ambig(e)
-          }
-          _ { false }
-        };
+        let next_expr_is_ambig =
+            alt next {
+              expr_(e) { expr_is_ambig(e) }
+              stmt_(@{node: ast::stmt_expr(e, _), _}) { expr_is_ambig(e) }
+              _ { false }
+            };
 
-        if last_expr_is_block && next_expr_is_ambig {
-            word(s.s, ";");
-        }
+        if last_expr_is_block && next_expr_is_ambig { word(s.s, ";"); }
 
         fn expr_is_ambig(ex: @ast::expr) -> bool {
-          // We're going to walk the expression to the 'left' looking for
-          // various properties that might indicate ambiguity
-
-          type env = @mutable bool;
-          let visitor = visit::mk_vt(@{
-              visit_expr: visit_expr
-                  with *visit::default_visitor()
-          });
-          let env = @mutable false;
-          visit_expr(ex, env, visitor);
-          ret *env;
-
-          fn visit_expr(ex: &@ast::expr, e: &env, v: &visit::vt<env>) {
-              assert *e == false;
-
-              if expr_is_ambig(ex) {
-                  *e = true;
-                  ret;
-              }
-
-              alt ex.node {
-                ast::expr_assign(x, _) { v.visit_expr(x, e, v); }
-                ast::expr_assign_op(_, x, _) { visit_expr(x, e, v); }
-                ast::expr_move(x, _) { v.visit_expr(x, e, v); }
-                ast::expr_field(x, _) { v.visit_expr(x, e, v); }
-                ast::expr_index(x, _) { v.visit_expr(x, e, v); }
-                ast::expr_binary(op, x, _) {
-                  if need_parens(x, operator_prec(op)) {
-                      *e = true;
-                      ret;
+            // We're going to walk the expression to the 'left' looking for
+            // various properties that might indicate ambiguity
+
+            type env = @mutable bool;
+            let visitor =
+                visit::mk_vt(@{visit_expr: visit_expr
+                                  with *visit::default_visitor()});
+            let env = @mutable false;
+            visit_expr(ex, env, visitor);
+            ret *env;
+
+            fn visit_expr(ex: &@ast::expr, e: &env, v: &visit::vt<env>) {
+                assert (*e == false);
+
+                if expr_is_ambig(ex) { *e = true; ret; }
+
+                alt ex.node {
+                  ast::expr_assign(x, _) { v.visit_expr(x, e, v); }
+                  ast::expr_assign_op(_, x, _) { visit_expr(x, e, v); }
+                  ast::expr_move(x, _) { v.visit_expr(x, e, v); }
+                  ast::expr_field(x, _) { v.visit_expr(x, e, v); }
+                  ast::expr_index(x, _) { v.visit_expr(x, e, v); }
+                  ast::expr_binary(op, x, _) {
+                    if need_parens(x, operator_prec(op)) { *e = true; ret; }
+                    v.visit_expr(x, e, v);
                   }
-                  v.visit_expr(x, e, v);
-                }
-                ast::expr_cast(x, _) {
-                  if need_parens(x, parse::parser::as_prec) {
-                      *e = true;
-                      ret;
+                  ast::expr_cast(x, _) {
+                    if need_parens(x, parse::parser::as_prec) {
+                        *e = true;
+                        ret;
+                    }
                   }
+                  ast::expr_ternary(x, _, _) { v.visit_expr(x, e, v); }
+                  _ { }
                 }
-                ast::expr_ternary(x, _, _) { v.visit_expr(x, e, v); }
-                _ { }
-              }
-          }
+            }
 
-          fn expr_is_ambig(ex: @ast::expr) -> bool {
-              alt ex.node {
-                ast::expr_unary(_, _) { true }
-                ast::expr_tup(_) { true }
-                _ { false }
-              }
-          }
+            fn expr_is_ambig(ex: @ast::expr) -> bool {
+                alt ex.node {
+                  ast::expr_unary(_, _) { true }
+                  ast::expr_tup(_) { true }
+                  _ { false }
+                }
+            }
         }
     }
 }
@@ -706,10 +690,8 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type,
 // ret and fail, without arguments cannot appear is the discriminant of if,
 // alt, do, & while unambiguously without being parenthesized
 fn print_maybe_parens_discrim(s: &ps, e: &@ast::expr) {
-    let disambig = alt e.node {
-      ast::expr_ret(option::none.) { true }
-      _ { false }
-    };
+    let disambig =
+        alt e.node { ast::expr_ret(option::none.) { true } _ { false } };
     if disambig { popen(s) }
     print_expr(s, e);
     if disambig { pclose(s) }
@@ -727,6 +709,7 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
           some(_else) {
             alt _else.node {
 
+
               // "another else-if"
               ast::expr_if(i, t, e) {
                 cbox(s, indent_unit - 1u);
@@ -738,6 +721,7 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
                 do_else(s, e);
               }
 
+
               // "final else"
               ast::expr_block(b) {
                 cbox(s, indent_unit - 1u);
@@ -758,10 +742,7 @@ fn print_mac(s: &ps, m: &ast::mac) {
       ast::mac_invoc(path, arg, body) {
         word(s.s, "#");
         print_path(s, path, false);
-        alt (arg.node) {
-          ast::expr_vec(_,_) {}
-          _ { word(s.s, " "); }
-        }
+        alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, " "); } }
         print_expr(s, arg);
         // FIXME: extension 'body'
       }
@@ -930,6 +911,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
         bclose_(s, expr.span, alt_indent_unit);
       }
       ast::expr_fn(f) {
+
         // If the return type is the magic ty_infer, then we need to
         // pretty print as a lambda-block
         if f.decl.output.node == ast::ty_infer {
@@ -939,11 +921,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
             ibox(s, 0u);
             word(s.s, "{");
             print_fn_block_args(s, f.decl);
-            print_possibly_embedded_block(s, f.body,
-                                          block_block_fn, indent_unit);
+            print_possibly_embedded_block(s, f.body, block_block_fn,
+                                          indent_unit);
         } else {
             head(s, proto_to_str(f.proto));
-            print_fn_args_and_ret(s, f.decl, ~[]);
+            print_fn_args_and_ret(s, f.decl, []);
             space(s.s);
             print_block(s, f.body);
         }
@@ -955,10 +937,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
         ibox(s, 0u);
         print_block(s, blk);
       }
-      ast::expr_copy(e) {
-        word_space(s, "copy");
-        print_expr(s, e);
-      }
+      ast::expr_copy(e) { word_space(s, "copy"); print_expr(s, e); }
       ast::expr_move(lhs, rhs) {
         print_expr(s, lhs);
         space(s.s);
@@ -1070,11 +1049,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
 
         // Methods
         for meth: @ast::method in anon_obj.methods {
-            let typarams: [ast::ty_param] = ~[];
+            let typarams: [ast::ty_param] = [];
             hardbreak_if_not_bol(s);
             maybe_print_comment(s, meth.span.lo);
             print_fn(s, meth.node.meth.decl, meth.node.meth.proto,
-                     meth.node.ident, typarams, ~[]);
+                     meth.node.ident, typarams, []);
             word(s.s, " ");
             print_block(s, meth.node.meth.body);
         }
@@ -1082,18 +1061,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
         // With object
         alt anon_obj.inner_obj {
           none. { }
-          some(e) {
-            space(s.s);
-            word_space(s, "with");
-            print_expr(s, e);
-          }
+          some(e) { space(s.s); word_space(s, "with"); print_expr(s, e); }
         }
         bclose(s, expr.span);
       }
-      ast::expr_uniq(expr) {
-        word(s.s, "~");
-        print_expr(s, expr);
-      }
+      ast::expr_uniq(expr) { word(s.s, "~"); print_expr(s, expr); }
     }
     s.ann.post(ann_node);
     end(s);
@@ -1224,7 +1196,7 @@ fn print_fn(s: &ps, decl: ast::fn_decl, proto: ast::proto, name: str,
 }
 
 fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl,
-                        constrs: [@ast::constr]) {
+                         constrs: [@ast::constr]) {
     popen(s);
     fn print_arg(s: &ps, x: &ast::arg) {
         ibox(s, indent_unit);
@@ -1270,7 +1242,7 @@ fn print_kind(s: &ps, kind: ast::kind) {
     alt kind {
       ast::kind_unique. { word(s.s, "~"); }
       ast::kind_shared. { word(s.s, "@"); }
-      _ { /* fallthrough */ }
+      _ {/* fallthrough */ }
     }
 }
 
@@ -1320,7 +1292,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) {
       }
       ast::view_item_import(id, ids, _) {
         head(s, "import");
-        if !str::eq(id, ids.(vec::len(ids) - 1u)) {
+        if !str::eq(id, ids[vec::len(ids) - 1u]) {
             word_space(s, id);
             word_space(s, "=");
         }
@@ -1332,13 +1304,10 @@ fn print_view_item(s: &ps, item: &@ast::view_item) {
       }
       ast::view_item_import_from(mod_path, idents, _) {
         head(s, "import");
-        for elt: str in mod_path {
-            word(s.s, elt);
-            word(s.s, "::");
-        }
+        for elt: str in mod_path { word(s.s, elt); word(s.s, "::"); }
         word(s.s, "{");
         commasep(s, inconsistent, idents,
-                 fn(s: &ps, w: &ast::import_ident) {
+                 fn (s: &ps, w: &ast::import_ident) {
                      word(s.s, w.node.name)
                  });
         word(s.s, "}");
@@ -1354,8 +1323,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) {
       }
       ast::view_item_export(ids, _) {
         head(s, "export");
-        commasep(s, inconsistent, ids,
-                 fn(s: &ps, w: &str) { word(s.s, w) });
+        commasep(s, inconsistent, ids, fn (s: &ps, w: &str) { word(s.s, w) });
       }
     }
     word(s.s, ";");
@@ -1377,16 +1345,15 @@ fn operator_prec(op: ast::binop) -> int {
 
 fn need_parens(expr: &@ast::expr, outer_prec: int) -> bool {
     alt expr.node {
-      ast::expr_binary(op, _, _) {
-        operator_prec(op) < outer_prec
-      }
+      ast::expr_binary(op, _, _) { operator_prec(op) < outer_prec }
       ast::expr_cast(_, _) { parse::parser::as_prec < outer_prec }
-      ast::expr_ternary(_, _, _) {
-        parse::parser::ternary_prec < outer_prec
-      }
+      ast::expr_ternary(_, _, _) { parse::parser::ternary_prec < outer_prec }
+
 
       // This may be too conservative in some cases
-      ast::expr_assign(_, _) { true }
+      ast::expr_assign(_, _) {
+        true
+      }
       ast::expr_move(_, _) { true }
       ast::expr_swap(_, _) { true }
       ast::expr_assign_op(_, _, _) { true }
@@ -1485,7 +1452,7 @@ fn print_remaining_comments(s: &ps) {
 fn in_cbox(s: &ps) -> bool {
     let len = vec::len(s.boxes);
     if len == 0u { ret false; }
-    ret s.boxes.(len - 1u) == pp::consistent;
+    ret s.boxes[len - 1u] == pp::consistent;
 }
 
 fn print_literal(s: &ps, lit: &@ast::lit) {
@@ -1502,8 +1469,9 @@ fn print_literal(s: &ps, lit: &@ast::lit) {
         print_string(s, st);
       }
       ast::lit_char(ch) {
-        word(s.s, "'" + escape_str(
-            str::unsafe_from_bytes(~[ch as u8]), '\'') + "'");
+        word(s.s,
+             "'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') +
+                 "'");
       }
       ast::lit_int(val) { word(s.s, int::str(val)); }
       ast::lit_uint(val) { word(s.s, uint::str(val) + "u"); }
@@ -1530,7 +1498,7 @@ fn next_lit(s: &ps) -> option::t<lexer::lit> {
     alt s.literals {
       some(lits) {
         if s.cur_lit < vec::len(lits) {
-            ret some(lits.(s.cur_lit));
+            ret some(lits[s.cur_lit]);
         } else { ret none::<lexer::lit>; }
       }
       _ { ret none::<lexer::lit>; }
@@ -1556,7 +1524,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
       lexer::mixed. {
         assert (vec::len(cmnt.lines) == 1u);
         zerobreak(s.s);
-        word(s.s, cmnt.lines.(0));
+        word(s.s, cmnt.lines[0]);
         zerobreak(s.s);
       }
       lexer::isolated. {
@@ -1571,7 +1539,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
       lexer::trailing. {
         word(s.s, " ");
         if vec::len(cmnt.lines) == 1u {
-            word(s.s, cmnt.lines.(0));
+            word(s.s, cmnt.lines[0]);
             hardbreak(s.s);
         } else {
             ibox(s, 0u);
@@ -1584,10 +1552,11 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
       }
       lexer::blank_line. {
         // We need to do at least one, possibly two hardbreaks.
-        let is_semi = alt s.s.last_token() {
-          pp::STRING(s, _) { s == ";" }
-          _ { false }
-        };
+        let is_semi =
+            alt s.s.last_token() {
+              pp::STRING(s, _) { s == ";" }
+              _ { false }
+            };
         if is_semi || is_begin(s) || is_end(s) { hardbreak(s.s) }
         hardbreak(s.s);
       }
@@ -1605,7 +1574,7 @@ fn escape_str(st: str, to_escape: char) -> str {
     let len = str::byte_len(st);
     let i = 0u;
     while i < len {
-        alt st.(i) as char {
+        alt st[i] as char {
           '\n' { out += "\\n"; }
           '\t' { out += "\\t"; }
           '\r' { out += "\\r"; }
@@ -1622,7 +1591,7 @@ fn escape_str(st: str, to_escape: char) -> str {
     ret out;
 }
 
-fn to_str<T>(t: &T, f: fn(&ps, &T) ) -> str {
+fn to_str<T>(t: &T, f: fn(&ps, &T)) -> str {
     let writer = io::string_writer();
     let s = rust_printer(writer.get_writer());
     f(s, t);
@@ -1634,7 +1603,7 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> {
     alt s.comments {
       some(cmnts) {
         if s.cur_cmnt < vec::len(cmnts) {
-            ret some(cmnts.(s.cur_cmnt));
+            ret some(cmnts[s.cur_cmnt]);
         } else { ret none::<lexer::cmnt>; }
       }
       _ { ret none::<lexer::cmnt>; }
@@ -1643,8 +1612,8 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> {
 
 // Removing the aliases from the type of f in the next two functions
 // triggers memory corruption, but I haven't isolated the bug yet. FIXME
-fn constr_args_to_str<T>(f: &fn(&T) -> str ,
-                         args: &[@ast::sp_constr_arg<T>]) -> str {
+fn constr_args_to_str<T>(f: &fn(&T) -> str, args: &[@ast::sp_constr_arg<T>])
+   -> str {
     let comma = false;
     let s = "(";
     for a: @ast::sp_constr_arg<T> in args {
@@ -1655,8 +1624,8 @@ fn constr_args_to_str<T>(f: &fn(&T) -> str ,
     ret s;
 }
 
-fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>)
-   -> str {
+fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>) ->
+   str {
     alt c {
       ast::carg_base. { ret "*"; }
       ast::carg_ident(i) { ret f(i); }
@@ -1686,7 +1655,7 @@ fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> str {
 }
 
 fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> str {
-    decl.inputs.(idx).ident
+    decl.inputs[idx].ident
 }
 
 fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str {
@@ -1696,8 +1665,7 @@ fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str {
 }
 
 // FIXME: fix repeated code
-fn ast_fn_constrs_str(decl: &ast::fn_decl,
-                      constrs: &[@ast::constr]) -> str {
+fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> str {
     let s = "";
     let colon = true;
     for c: @ast::constr in constrs {
@@ -1717,9 +1685,7 @@ fn proto_to_str(p: &ast::proto) -> str {
 }
 
 fn ty_constr_to_str(c: &@ast::ty_constr) -> str {
-    fn ty_constr_path_to_str(p: &ast::path) -> str {
-        "*." + path_to_str(p)
-    }
+    fn ty_constr_path_to_str(p: &ast::path) -> str { "*." + path_to_str(p) }
 
     ret path_to_str(c.node.path) +
             constr_args_to_str::<ast::path>(ty_constr_path_to_str,
diff --git a/src/comp/syntax/util/interner.rs b/src/comp/syntax/util/interner.rs
index 0b80bdd5bfd..31656886a45 100644
--- a/src/comp/syntax/util/interner.rs
+++ b/src/comp/syntax/util/interner.rs
@@ -18,7 +18,7 @@ type interner<T> =
 
 fn mk<@T>(hasher: hashfn<T>, eqer: eqfn<T>) -> interner<T> {
     let m = map::mk_hashmap::<T, uint>(hasher, eqer);
-    ret {map: m, mutable vect: ~[], hasher: hasher, eqer: eqer};
+    ret {map: m, mutable vect: [], hasher: hasher, eqer: eqer};
 }
 
 fn intern<@T>(itr: &interner<T>, val: &T) -> uint {
@@ -27,13 +27,13 @@ fn intern<@T>(itr: &interner<T>, val: &T) -> uint {
       none. {
         let new_idx = vec::len::<T>(itr.vect);
         itr.map.insert(val, new_idx);
-        itr.vect += ~[val];
+        itr.vect += [val];
         ret new_idx;
       }
     }
 }
 
-fn get<T>(itr: &interner<T>, idx: uint) -> T { ret itr.vect.(idx); }
+fn get<T>(itr: &interner<T>, idx: uint) -> T { ret itr.vect[idx]; }
 
-fn len<T>(itr : &interner<T>) -> uint { ret vec::len(itr.vect); }
+fn len<T>(itr: &interner<T>) -> uint { ret vec::len(itr.vect); }
 
diff --git a/src/comp/syntax/visit.rs b/src/comp/syntax/visit.rs
index bd1064af843..350dfc3dd44 100644
--- a/src/comp/syntax/visit.rs
+++ b/src/comp/syntax/visit.rs
@@ -32,8 +32,7 @@ type visitor<E> =
       visit_expr: fn(&@expr, &E, &vt<E>),
       visit_ty: fn(&@ty, &E, &vt<E>),
       visit_constr: fn(&path, &span, node_id, &E, &vt<E>),
-      visit_fn:
-          fn(&_fn, &[ty_param], &span, &fn_ident, node_id, &E, &vt<E>) };
+      visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id, &E, &vt<E>)};
 
 fn default_visitor<E>() -> visitor<E> {
     ret @{visit_mod: bind visit_mod::<E>(_, _, _, _),
@@ -104,8 +103,8 @@ fn visit_item<E>(i: &@item, e: &E, v: &vt<E>) {
       item_obj(ob, _, _) {
         for f: obj_field in ob.fields { v.visit_ty(f.ty, e, v); }
         for m: @method in ob.methods {
-            v.visit_fn(m.node.meth, ~[], m.span, some(m.node.ident),
-                       m.node.id, e, v);
+            v.visit_fn(m.node.meth, [], m.span, some(m.node.ident), m.node.id,
+                       e, v);
         }
       }
     }
@@ -132,9 +131,7 @@ fn visit_ty<E>(t: &@ty, e: &E, v: &vt<E>) {
       ty_rec(flds) {
         for f: ty_field in flds { v.visit_ty(f.node.mt.ty, e, v); }
       }
-      ty_tup(ts) {
-        for tt in ts { v.visit_ty(tt, e, v); }
-      }
+      ty_tup(ts) { for tt in ts { v.visit_ty(tt, e, v); } }
       ty_fn(_, args, out, _, constrs) {
         for a: ty_arg in args { v.visit_ty(a.node.ty, e, v); }
         for c: @constr in constrs {
@@ -174,9 +171,7 @@ fn visit_pat<E>(p: &@pat, e: &E, v: &vt<E>) {
       pat_rec(fields, _) {
         for f: field_pat in fields { v.visit_pat(f.pat, e, v); }
       }
-      pat_tup(elts) {
-        for elt in elts { v.visit_pat(elt, e, v); }
-      }
+      pat_tup(elts) { for elt in elts { v.visit_pat(elt, e, v); } }
       pat_box(inner) { v.visit_pat(inner, e, v); }
       _ { }
     }
@@ -249,9 +244,7 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) {
         for f: field in flds { v.visit_expr(f.node.expr, e, v); }
         visit_expr_opt(base, e, v);
       }
-      expr_tup(elts) {
-        for el in elts { v.visit_expr(el, e, v); }
-      }
+      expr_tup(elts) { for el in elts { v.visit_expr(el, e, v); } }
       expr_call(callee, args) {
         v.visit_expr(callee, e, v);
         visit_exprs(args, e, v);
@@ -291,7 +284,7 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) {
         v.visit_expr(x, e, v);
         for a: arm in arms { v.visit_arm(a, e, v); }
       }
-      expr_fn(f) { v.visit_fn(f, ~[], ex.span, none, ex.id, e, v); }
+      expr_fn(f) { v.visit_fn(f, [], ex.span, none, ex.id, e, v); }
       expr_block(b) { v.visit_block(b, e, v); }
       expr_assign(a, b) { v.visit_expr(b, e, v); v.visit_expr(a, e, v); }
       expr_copy(a) { v.visit_expr(a, e, v); }
@@ -328,8 +321,8 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) {
           some(ex) { v.visit_expr(ex, e, v); }
         }
         for m: @method in anon_obj.methods {
-            v.visit_fn(m.node.meth, ~[], m.span, some(m.node.ident),
-                       m.node.id, e, v);
+            v.visit_fn(m.node.meth, [], m.span, some(m.node.ident), m.node.id,
+                       e, v);
         }
       }
       expr_mac(mac) { visit_mac(mac, e, v); }
@@ -348,20 +341,20 @@ fn visit_arm<E>(a: &arm, e: &E, v: &vt<E>) {
 type simple_visitor =
     // takes the components so that one function can be
     // generic over constr and ty_constr
-    @{visit_mod: fn(&_mod, &span) ,
-      visit_view_item: fn(&@view_item) ,
-      visit_native_item: fn(&@native_item) ,
-      visit_item: fn(&@item) ,
-      visit_local: fn(&@local) ,
-      visit_block: fn(&ast::blk) ,
-      visit_stmt: fn(&@stmt) ,
-      visit_arm: fn(&arm) ,
-      visit_pat: fn(&@pat) ,
-      visit_decl: fn(&@decl) ,
-      visit_expr: fn(&@expr) ,
-      visit_ty: fn(&@ty) ,
-      visit_constr: fn(&path, &span, node_id) ,
-      visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id) };
+    @{visit_mod: fn(&_mod, &span),
+      visit_view_item: fn(&@view_item),
+      visit_native_item: fn(&@native_item),
+      visit_item: fn(&@item),
+      visit_local: fn(&@local),
+      visit_block: fn(&ast::blk),
+      visit_stmt: fn(&@stmt),
+      visit_arm: fn(&arm),
+      visit_pat: fn(&@pat),
+      visit_decl: fn(&@decl),
+      visit_expr: fn(&@expr),
+      visit_ty: fn(&@ty),
+      visit_constr: fn(&path, &span, node_id),
+      visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id)};
 
 fn default_simple_visitor() -> simple_visitor {
     ret @{visit_mod: fn (_m: &_mod, _sp: &span) { },
@@ -384,61 +377,61 @@ fn default_simple_visitor() -> simple_visitor {
 }
 
 fn mk_simple_visitor(v: &simple_visitor) -> vt<()> {
-    fn v_mod(f: fn(&_mod, &span) , m: &_mod, sp: &span, e: &(), v: &vt<()>) {
+    fn v_mod(f: fn(&_mod, &span), m: &_mod, sp: &span, e: &(), v: &vt<()>) {
         f(m, sp);
         visit_mod(m, sp, e, v);
     }
-    fn v_view_item(f: fn(&@view_item) , vi: &@view_item, e: &(), v: &vt<()>) {
+    fn v_view_item(f: fn(&@view_item), vi: &@view_item, e: &(), v: &vt<()>) {
         f(vi);
         visit_view_item(vi, e, v);
     }
-    fn v_native_item(f: fn(&@native_item) , ni: &@native_item, e: &(),
+    fn v_native_item(f: fn(&@native_item), ni: &@native_item, e: &(),
                      v: &vt<()>) {
         f(ni);
         visit_native_item(ni, e, v);
     }
-    fn v_item(f: fn(&@item) , i: &@item, e: &(), v: &vt<()>) {
+    fn v_item(f: fn(&@item), i: &@item, e: &(), v: &vt<()>) {
         f(i);
         visit_item(i, e, v);
     }
-    fn v_local(f: fn(&@local) , l: &@local, e: &(), v: &vt<()>) {
+    fn v_local(f: fn(&@local), l: &@local, e: &(), v: &vt<()>) {
         f(l);
         visit_local(l, e, v);
     }
-    fn v_block(f: fn(&ast::blk) , bl: &ast::blk, e: &(), v: &vt<()>) {
+    fn v_block(f: fn(&ast::blk), bl: &ast::blk, e: &(), v: &vt<()>) {
         f(bl);
         visit_block(bl, e, v);
     }
-    fn v_stmt(f: fn(&@stmt) , st: &@stmt, e: &(), v: &vt<()>) {
+    fn v_stmt(f: fn(&@stmt), st: &@stmt, e: &(), v: &vt<()>) {
         f(st);
         visit_stmt(st, e, v);
     }
-    fn v_arm(f: fn(&arm) , a: &arm, e: &(), v: &vt<()>) {
+    fn v_arm(f: fn(&arm), a: &arm, e: &(), v: &vt<()>) {
         f(a);
         visit_arm(a, e, v);
     }
-    fn v_pat(f: fn(&@pat) , p: &@pat, e: &(), v: &vt<()>) {
+    fn v_pat(f: fn(&@pat), p: &@pat, e: &(), v: &vt<()>) {
         f(p);
         visit_pat(p, e, v);
     }
-    fn v_decl(f: fn(&@decl) , d: &@decl, e: &(), v: &vt<()>) {
+    fn v_decl(f: fn(&@decl), d: &@decl, e: &(), v: &vt<()>) {
         f(d);
         visit_decl(d, e, v);
     }
-    fn v_expr(f: fn(&@expr) , ex: &@expr, e: &(), v: &vt<()>) {
+    fn v_expr(f: fn(&@expr), ex: &@expr, e: &(), v: &vt<()>) {
         f(ex);
         visit_expr(ex, e, v);
     }
-    fn v_ty(f: fn(&@ty) , ty: &@ty, e: &(), v: &vt<()>) {
+    fn v_ty(f: fn(&@ty), ty: &@ty, e: &(), v: &vt<()>) {
         f(ty);
         visit_ty(ty, e, v);
     }
-    fn v_constr(f: fn(&path, &span, node_id) , pt: &path, sp: &span,
+    fn v_constr(f: fn(&path, &span, node_id), pt: &path, sp: &span,
                 id: node_id, e: &(), v: &vt<()>) {
         f(pt, sp, id);
         visit_constr(pt, sp, id, e, v);
     }
-    fn v_fn(f: fn(&_fn, &[ty_param], &span, &fn_ident, node_id) , ff: &_fn,
+    fn v_fn(f: fn(&_fn, &[ty_param], &span, &fn_ident, node_id), ff: &_fn,
             tps: &[ty_param], sp: &span, ident: &fn_ident, id: node_id,
             e: &(), v: &vt<()>) {
         f(ff, tps, sp, ident, id);
diff --git a/src/comp/util/common.rs b/src/comp/util/common.rs
index 984e047834b..ddd12d77229 100644
--- a/src/comp/util/common.rs
+++ b/src/comp/util/common.rs
@@ -50,8 +50,8 @@ fn new_def_hash<@V>() -> std::map::hashmap<ast::def_id, V> {
 fn field_expr(f: &ast::field) -> @ast::expr { ret f.node.expr; }
 
 fn field_exprs(fields: &[ast::field]) -> [@ast::expr] {
-    let es = ~[];
-    for f: ast::field in fields { es += ~[f.node.expr]; }
+    let es = [];
+    for f: ast::field in fields { es += [f.node.expr]; }
     ret es;
 }
 
@@ -160,8 +160,7 @@ fn is_main_name(path: &[str]) -> bool {
 // FIXME mode this to std::float when editing the stdlib no longer
 // requires a snapshot
 fn float_to_str(num: float, digits: uint) -> str {
-    let accum = if num < 0.0 { num = -num; "-" }
-                else { "" };
+    let accum = if num < 0.0 { num = -num; "-" } else { "" };
     let trunc = num as uint;
     let frac = num - (trunc as float);
     accum += uint::str(trunc);
diff --git a/src/comp/util/ppaux.rs b/src/comp/util/ppaux.rs
index a1c0c145681..5a71005acc2 100644
--- a/src/comp/util/ppaux.rs
+++ b/src/comp/util/ppaux.rs
@@ -38,7 +38,7 @@ fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> str {
 }
 
 fn get_id_ident(cx: &ctxt, id: ast::def_id) -> str {
-    if (id.crate != ast::local_crate) {
+    if id.crate != ast::local_crate {
         str::connect(cx.ext_map.get(id), "::")
     } else {
         alt cx.items.find(id.node) {
@@ -60,8 +60,8 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> str {
         let s = proto_to_str(proto);
         alt ident { some(i) { s += " "; s += i; } _ { } }
         s += "(";
-        let strs = ~[];
-        for a: arg in inputs { strs += ~[fn_input_to_str(cx, a)]; }
+        let strs = [];
+        for a: arg in inputs { strs += [fn_input_to_str(cx, a)]; }
         s += str::connect(strs, ", ");
         s += ")";
         if struct(cx, output) != ty_nil {
@@ -91,60 +91,59 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> str {
     }
     alt cname(cx, typ) { some(cs) { ret cs; } _ { } }
     ret alt struct(cx, typ) {
-      ty_native(_) { "native" }
-      ty_nil. { "()" }
-      ty_bot. { "_|_" }
-      ty_bool. { "bool" }
-      ty_int. { "int" }
-      ty_float. { "float" }
-      ty_uint. { "uint" }
-      ty_machine(tm) { ty_mach_to_str(tm) }
-      ty_char. { "char" }
-      ty_str. { "str" }
-      ty_istr. { "istr" }
-      ty_box(tm) { "@" + mt_to_str(cx, tm) }
-      ty_uniq(t) { "~" + ty_to_str(cx, t) }
-      ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" }
-      ty_type. { "type" }
-      ty_rec(elems) {
-        let strs: [str] = ~[];
-        for fld: field in elems { strs += ~[field_to_str(cx, fld)]; }
-        "{" + str::connect(strs, ",") + "}"
-      }
-      ty_tup(elems) {
-        let strs = ~[];
-        for elem in elems { strs += ~[ty_to_str(cx, elem)]; }
-        "(" + str::connect(strs, ",") + ")"
-      }
-      ty_tag(id, tps) {
-        let s = get_id_ident(cx, id);
-        if vec::len::<t>(tps) > 0u {
-            let strs: [str] = ~[];
-            for typ: t in tps { strs += ~[ty_to_str(cx, typ)]; }
-            s += "[" + str::connect(strs, ",") + "]";
+          ty_native(_) { "native" }
+          ty_nil. { "()" }
+          ty_bot. { "_|_" }
+          ty_bool. { "bool" }
+          ty_int. { "int" }
+          ty_float. { "float" }
+          ty_uint. { "uint" }
+          ty_machine(tm) { ty_mach_to_str(tm) }
+          ty_char. { "char" }
+          ty_str. { "str" }
+          ty_istr. { "istr" }
+          ty_box(tm) { "@" + mt_to_str(cx, tm) }
+          ty_uniq(t) { "~" + ty_to_str(cx, t) }
+          ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" }
+          ty_type. { "type" }
+          ty_rec(elems) {
+            let strs: [str] = [];
+            for fld: field in elems { strs += [field_to_str(cx, fld)]; }
+            "{" + str::connect(strs, ",") + "}"
+          }
+          ty_tup(elems) {
+            let strs = [];
+            for elem in elems { strs += [ty_to_str(cx, elem)]; }
+            "(" + str::connect(strs, ",") + ")"
+          }
+          ty_tag(id, tps) {
+            let s = get_id_ident(cx, id);
+            if vec::len::<t>(tps) > 0u {
+                let strs: [str] = [];
+                for typ: t in tps { strs += [ty_to_str(cx, typ)]; }
+                s += "[" + str::connect(strs, ",") + "]";
+            }
+            s
+          }
+          ty_fn(proto, inputs, output, cf, constrs) {
+            fn_to_str(cx, proto, none, inputs, output, cf, constrs)
+          }
+          ty_native_fn(_, inputs, output) {
+            fn_to_str(cx, ast::proto_fn, none, inputs, output, ast::return,
+                      [])
+          }
+          ty_obj(meths) {
+            let strs = [];
+            for m: method in meths { strs += [method_to_str(cx, m)]; }
+            "obj {\n\t" + str::connect(strs, "\n\t") + "\n}"
+          }
+          ty_res(id, _, _) { get_id_ident(cx, id) }
+          ty_var(v) { "<T" + int::str(v) + ">" }
+          ty_param(id, _) {
+            "'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)])
+          }
+          _ { ty_to_short_str(cx, typ) }
         }
-        s
-      }
-      ty_fn(proto, inputs, output, cf, constrs) {
-        fn_to_str(cx, proto, none, inputs, output, cf, constrs)
-      }
-      ty_native_fn(_, inputs, output) {
-        fn_to_str(cx, ast::proto_fn, none, inputs, output, ast::return, ~[])
-      }
-      ty_obj(meths) {
-        let strs = ~[];
-        for m: method in meths { strs += ~[method_to_str(cx, m)]; }
-        "obj {\n\t" + str::connect(strs, "\n\t") + "\n}"
-      }
-      ty_res(id, _, _) {
-        get_id_ident(cx, id)
-      }
-      ty_var(v) { "<T" + int::str(v) + ">" }
-      ty_param(id,_) {
-        "'" + str::unsafe_from_bytes(~[('a' as u8) + (id as u8)])
-      }
-      _ { ty_to_short_str(cx, typ) }
-    }
 }
 
 fn ty_to_short_str(cx: &ctxt, typ: t) -> str {
diff --git a/src/fuzzer/ast_match.rs b/src/fuzzer/ast_match.rs
index ebd3bf339bb..de8696baf3f 100644
--- a/src/fuzzer/ast_match.rs
+++ b/src/fuzzer/ast_match.rs
@@ -1,13 +1,13 @@
 use std;
 import std::vec;
 
-fn vec_equal<T>(v: &[T], u: &[T], element_equality_test: fn(&T, &T) -> bool )
+fn vec_equal<T>(v: &[T], u: &[T], element_equality_test: fn(&T, &T) -> bool)
    -> bool {
     let Lv = vec::len(v);
     if Lv != vec::len(u) { ret false; }
     let i = 0u;
     while i < Lv {
-        if !element_equality_test(v.(i), u.(i)) { ret false; }
+        if !element_equality_test(v[i], u[i]) { ret false; }
         i += 1u;
     }
     ret true;
@@ -18,10 +18,10 @@ fn builtin_equal<T>(a: &T, b: &T) -> bool { ret a == b; }
 fn main() {
     assert (builtin_equal(5, 5));
     assert (!builtin_equal(5, 4));
-    assert (!vec_equal(~[5, 5], ~[5], builtin_equal));
-    assert (!vec_equal(~[5, 5], ~[5, 4], builtin_equal));
-    assert (!vec_equal(~[5, 5], ~[4, 5], builtin_equal));
-    assert (vec_equal(~[5, 5], ~[5, 5], builtin_equal));
+    assert (!vec_equal([5, 5], [5], builtin_equal));
+    assert (!vec_equal([5, 5], [5, 4], builtin_equal));
+    assert (!vec_equal([5, 5], [4, 5], builtin_equal));
+    assert (vec_equal([5, 5], [5, 5], builtin_equal));
 
     log_err "Pass";
 }
diff --git a/src/fuzzer/fuzzer.rs b/src/fuzzer/fuzzer.rs
index a9f4c96cdb2..d9c3f979e39 100644
--- a/src/fuzzer/fuzzer.rs
+++ b/src/fuzzer/fuzzer.rs
@@ -21,11 +21,9 @@ import rustc::syntax::parse::parser;
 import rustc::syntax::print::pprust;
 
 fn write_file(filename: &str, content: &str) {
-    io::file_writer(filename,
-                        ~[io::create,
-                          io::truncate]).write_str(content);
+    io::file_writer(filename, [io::create, io::truncate]).write_str(content);
     // Work around https://github.com/graydon/rust/issues/726
-    std::run::run_program("chmod", ~["644", filename]);
+    std::run::run_program("chmod", ["644", filename]);
 }
 
 fn file_contains(filename: &str, needle: &str) -> bool {
@@ -41,9 +39,8 @@ fn find_rust_files(files: &mutable [str], path: str) {
     if str::ends_with(path, ".rs") {
         if file_contains(path, "xfail-stage1") {
             //log_err "Skipping " + path + " because it is marked as xfail-stage1";
-        } else { files += ~[path]; }
-    } else if (fs::file_is_dir(path) && str::find(path, "compile-fail") == -1)
-     {
+        } else { files += [path]; }
+    } else if fs::file_is_dir(path) && str::find(path, "compile-fail") == -1 {
         for p in fs::list_dir(path) { find_rust_files(files, p); }
     }
 }
@@ -51,6 +48,7 @@ fn find_rust_files(files: &mutable [str], path: str) {
 fn safe_to_steal(e: ast::expr_) -> bool {
     alt e {
 
+
       // pretty-printer precedence issues -- https://github.com/graydon/rust/issues/670
       ast::expr_unary(_, _) {
         false
@@ -73,13 +71,23 @@ fn safe_to_steal(e: ast::expr_) -> bool {
       ast::expr_binary(_, _, _) { false }
       ast::expr_assign(_, _) { false }
       ast::expr_assign_op(_, _, _) { false }
-      ast::expr_fail(option::none.) { false /* https://github.com/graydon/rust/issues/764 */ }
+      ast::expr_fail(option::none.) {
+        false
+        /* https://github.com/graydon/rust/issues/764 */
+
+      }
       ast::expr_ret(option::none.) { false }
       ast::expr_put(option::none.) { false }
 
-      ast::expr_ret(_) { false /* lots of code generation issues, such as https://github.com/graydon/rust/issues/770 */ }
+
+      ast::expr_ret(_) {
+        false
+        /* lots of code generation issues, such as https://github.com/graydon/rust/issues/770 */
+
+      }
       ast::expr_fail(_) { false }
 
+
       _ {
         true
       }
@@ -87,17 +95,17 @@ fn safe_to_steal(e: ast::expr_) -> bool {
 }
 
 fn steal_exprs(crate: &ast::crate) -> [ast::expr] {
-    let exprs: @mutable [ast::expr] = @mutable ~[];
+    let exprs: @mutable [ast::expr] = @mutable [];
     // "Stash" is not type-parameterized because of the need for safe_to_steal
     fn stash_expr(es: @mutable [ast::expr], e: &@ast::expr) {
         if safe_to_steal(e.node) {
-            *es += ~[*e];
+            *es += [*e];
         } else {/* now my indices are wrong :( */ }
     }
-    let v = visit::mk_simple_visitor
-        (@{visit_expr: bind stash_expr(exprs, _)
-           with *visit::default_simple_visitor()});
-    visit::visit_crate(crate, (), v);
+    let v =
+        visit::mk_simple_visitor(@{visit_expr: bind stash_expr(exprs, _)
+                                      with *visit::default_simple_visitor()});
+    visit::visit_crate(crate, (), v);;
     *exprs
 }
 
@@ -128,6 +136,7 @@ fn replace_expr_in_crate(crate: &ast::crate, i: uint, newexpr: ast::expr_) ->
     let af = fold::make_fold(afp);
     let crate2: @ast::crate = @af.fold_crate(crate);
     fold::dummy_out(af); // work around a leak (https://github.com/graydon/rust/issues/651)
+    ;
     *crate2
 }
 
@@ -138,26 +147,28 @@ iter under(n: uint) -> uint {
 
 fn devnull() -> io::writer { std::io::string_writer().get_writer() }
 
-fn as_str(f: fn(io::writer) ) -> str {
+fn as_str(f: fn(io::writer)) -> str {
     let w = std::io::string_writer();
     f(w.get_writer());
     ret w.get_str();
 }
 
-fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, filename: &str) {
+fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap,
+                         filename: &str) {
     let exprs = steal_exprs(crate);
     let exprsL = vec::len(exprs);
-    if (exprsL < 100u) {
+    if exprsL < 100u {
         for each i: uint in under(uint::min(exprsL, 20u)) {
-            log_err "Replacing... " + pprust::expr_to_str(@exprs.(i));
+            log_err "Replacing... " + pprust::expr_to_str(@exprs[i]);
             for each j: uint in under(uint::min(exprsL, 5u)) {
-                log_err "With... " + pprust::expr_to_str(@exprs.(j));
-                let crate2 = @replace_expr_in_crate(crate, i, exprs.(j).node);
+                log_err "With... " + pprust::expr_to_str(@exprs[j]);
+                let crate2 = @replace_expr_in_crate(crate, i, exprs[j].node);
                 // It would be best to test the *crate* for stability, but testing the
                 // string for stability is easier and ok for now.
-                let str3 = as_str(bind pprust::print_crate(codemap, crate2, filename,
-                                  io::string_reader(""), _,
-                                  pprust::no_ann()));
+                let str3 =
+                    as_str(bind pprust::print_crate(codemap, crate2, filename,
+                                                    io::string_reader(""), _,
+                                                    pprust::no_ann()));
                 // 1u would be sane here, but the pretty-printer currently has lots of whitespace and paren issues,
                 // and https://github.com/graydon/rust/issues/766 is hilarious.
                 check_roundtrip_convergence(str3, 7u);
@@ -174,37 +185,52 @@ fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, filenam
 fn check_whole_compiler(code: &str) {
     let filename = "test.rs";
     write_file(filename, code);
-    let p = std::run::program_output("/Users/jruderman/code/rust/build/stage1/rustc", ~["-c", filename]);
+    let p =
+        std::run::program_output("/Users/jruderman/code/rust/build/stage1/rustc",
+                                 ["-c", filename]);
+
     //log_err #fmt("Status: %d", p.status);
     //log_err "Output: " + p.out;
     if p.err != "" {
         if contains(p.err, "argument of incompatible type") {
             log_err "https://github.com/graydon/rust/issues/769";
-        } else if contains(p.err, "Cannot create binary operator with two operands of differing type") {
+        } else if contains(p.err,
+                           "Cannot create binary operator with two operands of differing type")
+         {
             log_err "https://github.com/graydon/rust/issues/770";
         } else if contains(p.err, "May only branch on boolean predicates!") {
             log_err "https://github.com/graydon/rust/issues/770 or https://github.com/graydon/rust/issues/776";
-        } else if contains(p.err, "Invalid constantexpr cast!") && contains(code, "!") {
+        } else if contains(p.err, "Invalid constantexpr cast!") &&
+                      contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/777";
-        } else if contains(p.err, "Both operands to ICmp instruction are not of the same type!") && contains(code, "!") {
+        } else if contains(p.err,
+                           "Both operands to ICmp instruction are not of the same type!")
+                      && contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/777 #issuecomment-1678487";
-        } else if contains(p.err, "Ptr must be a pointer to Val type!") && contains(code, "!") {
+        } else if contains(p.err, "Ptr must be a pointer to Val type!") &&
+                      contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/779";
-        } else if contains(p.err, "Calling a function with bad signature!") && (contains(code, "iter") || contains(code, "range")) {
+        } else if contains(p.err, "Calling a function with bad signature!") &&
+                      (contains(code, "iter") || contains(code, "range")) {
             log_err "https://github.com/graydon/rust/issues/771 - calling an iter fails";
-        } else if contains(p.err, "Calling a function with a bad signature!") && contains(code, "empty") {
+        } else if contains(p.err, "Calling a function with a bad signature!")
+                      && contains(code, "empty") {
             log_err "https://github.com/graydon/rust/issues/775 - possibly a modification of run-pass/import-glob-crate.rs";
-        } else if contains(p.err, "Invalid type for pointer element!") && contains(code, "put") {
+        } else if contains(p.err, "Invalid type for pointer element!") &&
+                      contains(code, "put") {
             log_err "https://github.com/graydon/rust/issues/773 - put put ()";
-        } else if contains(p.err, "pointer being freed was not allocated") && contains(p.out, "Out of stack space, sorry") {
+        } else if contains(p.err, "pointer being freed was not allocated") &&
+                      contains(p.out, "Out of stack space, sorry") {
             log_err "https://github.com/graydon/rust/issues/768 + https://github.com/graydon/rust/issues/778"
         } else {
             log_err "Stderr: " + p.err;
             fail "Unfamiliar error message";
         }
-    } else if contains(p.out, "non-exhaustive match failure") && contains(p.out, "alias.rs") {
+    } else if contains(p.out, "non-exhaustive match failure") &&
+                  contains(p.out, "alias.rs") {
         log_err "https://github.com/graydon/rust/issues/772";
-    } else if contains(p.out, "non-exhaustive match failure") && contains(p.out, "trans.rs") && contains(code, "put") {
+    } else if contains(p.out, "non-exhaustive match failure") &&
+                  contains(p.out, "trans.rs") && contains(code, "put") {
         log_err "https://github.com/graydon/rust/issues/774";
     } else if contains(p.out, "Out of stack space, sorry") {
         log_err "Possibly a variant of https://github.com/graydon/rust/issues/768";
@@ -214,74 +240,64 @@ fn check_whole_compiler(code: &str) {
         }
     } else if p.status == 11 {
         log_err "What is this I don't even";
-    } else if p.status != 0 {
-        fail "Unfamiliar status code";
-    }
+    } else if p.status != 0 { fail "Unfamiliar status code"; }
 }
 
 fn parse_and_print(code: &str) -> str {
     let filename = "tmp.rs";
     let sess = @{cm: codemap::new_codemap(), mutable next_id: 0};
     //write_file(filename, code);
-    let crate =
-        parser::parse_crate_from_source_str(filename, code, ~[], sess);
+    let crate = parser::parse_crate_from_source_str(filename, code, [], sess);
     ret as_str(bind pprust::print_crate(sess.cm, crate, filename,
                                         io::string_reader(code), _,
                                         pprust::no_ann()));
 }
 
 fn content_is_dangerous_to_modify(code: &str) -> bool {
-    let dangerous_patterns = [
-         "obj", // not safe to steal; https://github.com/graydon/rust/issues/761
+    let dangerous_patterns =
+        ["obj", // not safe to steal; https://github.com/graydon/rust/issues/761
          "#macro", // not safe to steal things inside of it, because they have a special syntax
          "#", // strange representation of the arguments to #fmt, for example
          " be ", // don't want to replace its child with a non-call: "Non-call expression in tail call"
-         "@" // hangs when compiling: https://github.com/graydon/rust/issues/768
-    ];
+         "@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768
 
     for p: str in dangerous_patterns { if contains(code, p) { ret true; } }
     ret false;
 }
 
-fn content_is_confusing(code: &str) -> bool {
-    let  // https://github.com/graydon/rust/issues/671
-         // https://github.com/graydon/rust/issues/669
-         // https://github.com/graydon/rust/issues/669
-         // https://github.com/graydon/rust/issues/669
-         // crazy rules enforced by parser rather than typechecker?
-         // more precedence issues
-         // more precedence issues?
-        confusing_patterns =
+fn content_is_confusing(code: &str) ->
+   bool { // https://github.com/graydon/rust/issues/671
+          // https://github.com/graydon/rust/issues/669
+          // https://github.com/graydon/rust/issues/669
+          // https://github.com/graydon/rust/issues/669
+          // crazy rules enforced by parser rather than typechecker?
+          // more precedence issues
+          // more precedence issues?
+
+    let confusing_patterns =
         ["#macro", "][]", "][mutable]", "][mutable ]", "self", "spawn",
-         "bind",
-         "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759
+         "bind", "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759
          " : ", // https://github.com/graydon/rust/issues/760
-         "if ret",
-         "alt ret",
-         "if fail",
-         "alt fail"
-         ];
+         "if ret", "alt ret", "if fail", "alt fail"];
 
     for p: str in confusing_patterns { if contains(code, p) { ret true; } }
     ret false;
 }
 
 fn file_is_confusing(filename: &str) -> bool {
-    let
 
-         // https://github.com/graydon/rust/issues/674
+    // https://github.com/graydon/rust/issues/674
 
-         // something to do with () as a lone pattern
+    // something to do with () as a lone pattern
 
-         // an issue where -2147483648 gains an
-         // extra negative sign each time through,
-         // which i can't reproduce using "rustc
-         // --pretty normal"???
-         confusing_files =
+    // an issue where -2147483648 gains an
+    // extra negative sign each time through,
+    // which i can't reproduce using "rustc
+    // --pretty normal"???
+    let confusing_files =
         ["block-expr-precedence.rs", "nil-pattern.rs",
          "syntax-extension-fmt.rs",
-         "newtype.rs" // modifying it hits something like https://github.com/graydon/rust/issues/670
-         ];
+         "newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670
 
     for f in confusing_files { if contains(filename, f) { ret true; } }
 
@@ -303,23 +319,25 @@ fn check_roundtrip_convergence(code: &str, maxIters: uint) {
     }
 
     if old == new {
-        log_err #fmt("Converged after %u iterations", i);
+        log_err #fmt["Converged after %u iterations", i];
     } else {
-        log_err #fmt("Did not converge after %u iterations!", i);
+        log_err #fmt["Did not converge after %u iterations!", i];
         write_file("round-trip-a.rs", old);
         write_file("round-trip-b.rs", new);
-        std::run::run_program("diff", ~["-w", "-u", "round-trip-a.rs", "round-trip-b.rs"]);
+        std::run::run_program("diff",
+                              ["-w", "-u", "round-trip-a.rs",
+                               "round-trip-b.rs"]);
         fail "Mismatch";
     }
 }
 
 fn check_convergence(files: &[str]) {
-    log_err #fmt("pp convergence tests: %u files", vec::len(files));
+    log_err #fmt["pp convergence tests: %u files", vec::len(files)];
     for file in files {
         if !file_is_confusing(file) {
             let s = io::read_whole_file_str(file);
             if !content_is_confusing(s) {
-                log_err #fmt("pp converge: %s", file);
+                log_err #fmt["pp converge: %s", file];
                 // Change from 7u to 2u when https://github.com/graydon/rust/issues/759 is fixed
                 check_roundtrip_convergence(s, 7u);
             }
@@ -331,13 +349,16 @@ fn check_variants(files: &[str]) {
     for file in files {
         if !file_is_confusing(file) {
             let s = io::read_whole_file_str(file);
-            if content_is_dangerous_to_modify(s) || content_is_confusing(s) { cont; }
+            if content_is_dangerous_to_modify(s) || content_is_confusing(s) {
+                cont;
+            }
             log_err "check_variants: " + file;
             let sess = @{cm: codemap::new_codemap(), mutable next_id: 0};
-            let crate = parser::parse_crate_from_source_str(file, s, ~[], sess);
+            let crate =
+                parser::parse_crate_from_source_str(file, s, [], sess);
             log_err as_str(bind pprust::print_crate(sess.cm, crate, file,
-                                        io::string_reader(s), _,
-                                        pprust::no_ann()));
+                                                    io::string_reader(s), _,
+                                                    pprust::no_ann()));
             check_variants_of_ast(*crate, sess.cm, file);
         }
     }
@@ -345,11 +366,11 @@ fn check_variants(files: &[str]) {
 
 fn main(args: [str]) {
     if vec::len(args) != 2u {
-        log_err #fmt("usage: %s <testdir>", args.(0));
+        log_err #fmt["usage: %s <testdir>", args[0]];
         ret;
     }
-    let files = ~[];
-    let root = args.(1);
+    let files = [];
+    let root = args[1];
 
     find_rust_files(files, root);
     check_convergence(files);
diff --git a/src/fuzzer/ivec_fuzz.rs b/src/fuzzer/ivec_fuzz.rs
index 2d6c51c4225..3dd24875c52 100644
--- a/src/fuzzer/ivec_fuzz.rs
+++ b/src/fuzzer/ivec_fuzz.rs
@@ -32,19 +32,19 @@ fn vec_omit<T>(v: &[T], i: uint) -> [T] {
     slice(v, 0u, i) + slice(v, i + 1u, len(v))
 }
 fn vec_dup<T>(v: &[T], i: uint) -> [T] {
-    slice(v, 0u, i) + ~[v.(i)] + slice(v, i, len(v))
+    slice(v, 0u, i) + [v[i]] + slice(v, i, len(v))
 }
 fn vec_swadj<T>(v: &[T], i: uint) -> [T] {
-    slice(v, 0u, i) + ~[v.(i + 1u), v.(i)] + slice(v, i + 2u, len(v))
+    slice(v, 0u, i) + [v[i + 1u], v[i]] + slice(v, i + 2u, len(v))
 }
 fn vec_prefix<T>(v: &[T], i: uint) -> [T] { slice(v, 0u, i) }
 fn vec_suffix<T>(v: &[T], i: uint) -> [T] { slice(v, i, len(v)) }
 
 fn vec_poke<T>(v: &[T], i: uint, x: &T) -> [T] {
-    slice(v, 0u, i) + ~[x] + slice(v, i + 1u, len(v))
+    slice(v, 0u, i) + [x] + slice(v, i + 1u, len(v))
 }
 fn vec_insert<T>(v: &[T], i: uint, x: &T) -> [T] {
-    slice(v, 0u, i) + ~[x] + slice(v, i, len(v))
+    slice(v, 0u, i) + [x] + slice(v, i, len(v))
 }
 
 // Iterates over 0...length, skipping the specified number on each side.
@@ -55,28 +55,28 @@ iter ix(skip_low: uint, skip_high: uint, length: uint) -> uint {
 
 // Returns a bunch of modified versions of v, some of which introduce new elements (borrowed from xs).
 fn vec_edits<T>(v: &[T], xs: &[T]) -> [[T]] {
-    let edits: [[T]] = ~[];
+    let edits: [[T]] = [];
     let Lv: uint = len(v);
 
     if Lv != 1u {
         edits +=
-            ~[~[]]; // When Lv == 1u, this is redundant with omit
-                    //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; }
+            [[]]; // When Lv == 1u, this is redundant with omit
+                  //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; }
 
-    }
 
-    for each i: uint in ix(0u, 1u, Lv) { edits += ~[vec_omit(v, i)]; }
-    for each i: uint in ix(0u, 1u, Lv) { edits += ~[vec_dup(v, i)]; }
-    for each i: uint in ix(0u, 2u, Lv) { edits += ~[vec_swadj(v, i)]; }
-    for each i: uint in ix(1u, 2u, Lv) { edits += ~[vec_prefix(v, i)]; }
-    for each i: uint in ix(2u, 1u, Lv) { edits += ~[vec_suffix(v, i)]; }
+    }
+    for each i: uint in ix(0u, 1u, Lv) { edits += [vec_omit(v, i)]; }
+    for each i: uint in ix(0u, 1u, Lv) { edits += [vec_dup(v, i)]; }
+    for each i: uint in ix(0u, 2u, Lv) { edits += [vec_swadj(v, i)]; }
+    for each i: uint in ix(1u, 2u, Lv) { edits += [vec_prefix(v, i)]; }
+    for each i: uint in ix(2u, 1u, Lv) { edits += [vec_suffix(v, i)]; }
 
     for each j: uint in ix(0u, 1u, len(xs)) {
         for each i: uint in ix(0u, 1u, Lv) {
-            edits += ~[vec_poke(v, i, xs.(j))];
+            edits += [vec_poke(v, i, xs[j])];
         }
         for each i: uint in ix(0u, 0u, Lv) {
-            edits += ~[vec_insert(v, i, xs.(j))];
+            edits += [vec_insert(v, i, xs[j])];
         }
     }
 
@@ -89,7 +89,7 @@ fn vec_to_str(v: &[int]) -> str {
     let i = 0u;
     let s = "[";
     while i < len(v) {
-        s += int::str(v.(i));
+        s += int::str(v[i]);
         if i + 1u < len(v) { s += ", " }
         i += 1u;
     }
@@ -99,16 +99,16 @@ fn vec_to_str(v: &[int]) -> str {
 fn show_edits(a: &[int], xs: &[int]) {
     log_err "=== Edits of " + vec_to_str(a) + " ===";
     let b = vec_edits(a, xs);
-    for each i: uint in ix(0u, 1u, len(b)) { log_err vec_to_str(b.(i)); }
+    for each i: uint in ix(0u, 1u, len(b)) { log_err vec_to_str(b[i]); }
 }
 
 fn demo_edits() {
-    let xs = ~[7, 8];
-    show_edits(~[], xs);
-    show_edits(~[1], xs);
-    show_edits(~[1, 2], xs);
-    show_edits(~[1, 2, 3], xs);
-    show_edits(~[1, 2, 3, 4], xs);
+    let xs = [7, 8];
+    show_edits([], xs);
+    show_edits([1], xs);
+    show_edits([1, 2], xs);
+    show_edits([1, 2, 3], xs);
+    show_edits([1, 2, 3, 4], xs);
 }
 
 fn main() { demo_edits(); }
diff --git a/src/lib/aio.rs b/src/lib/aio.rs
index fc10e40a327..c2e9c13dc89 100644
--- a/src/lib/aio.rs
+++ b/src/lib/aio.rs
@@ -28,26 +28,17 @@ native "rust" mod rustrt {
 // currently in the sendable kind, so we'll unsafely cast between ints.
 type server = rustrt::server;
 type client = rustrt::socket;
-tag pending_connection {
-    remote(net::ip_addr,int);
-    incoming(server);
-}
+tag pending_connection { remote(net::ip_addr, int); incoming(server); }
 
-tag socket_event {
-    connected(client);
-    closed;
-    received([u8]);
-}
+tag socket_event { connected(client); closed; received([u8]); }
 
-tag server_event {
-    pending(_chan<_chan<socket_event>>);
-}
+tag server_event { pending(_chan<_chan<socket_event>>); }
 
 tag request {
     quit;
-    connect(pending_connection,_chan<socket_event>);
-    serve(net::ip_addr,int,_chan<server_event>,_chan<server>);
-    write(client,[u8],_chan<bool>);
+    connect(pending_connection, _chan<socket_event>);
+    serve(net::ip_addr, int, _chan<server_event>, _chan<server>);
+    write(client, [u8], _chan<bool>);
     close_server(server, _chan<bool>);
     close_client(client);
 }
@@ -74,12 +65,12 @@ fn new_client(client: client, evt: _chan<socket_event>) {
 
     send(evt, connected(client));
 
-    while (true) {
+    while true {
         log "waiting for bytes";
         let data: [u8] = reader.recv();
         log "got some bytes";
         log vec::len::<u8>(data);
-        if (vec::len::<u8>(data) == 0u) {
+        if vec::len::<u8>(data) == 0u {
             log "got empty buffer, bailing";
             break;
         }
@@ -104,19 +95,17 @@ fn accept_task(client: client, events: _chan<server_event>) {
 fn server_task(ip: net::ip_addr, portnum: int, events: _chan<server_event>,
                server: _chan<server>) {
     let accepter: _port<client> = mk_port();
-    send(server, rustrt::aio_serve(ip_to_sbuf(ip), portnum,
-                                   accepter.mk_chan()));
+    send(server,
+         rustrt::aio_serve(ip_to_sbuf(ip), portnum, accepter.mk_chan()));
 
     let client: client;
-    while (true) {
+    while true {
         log "preparing to accept a client";
         client = accepter.recv();
-        if (rustrt::aio_is_null_client(client)) {
-          log "client was actually null, returning";
-          ret;
-        } else {
-          task::_spawn(bind accept_task(client, events));
-        }
+        if rustrt::aio_is_null_client(client) {
+            log "client was actually null, returning";
+            ret;
+        } else { task::_spawn(bind accept_task(client, events)); }
     }
 }
 
@@ -128,7 +117,7 @@ fn request_task(c: _chan<ctx>) {
     log "uv run task spawned";
     // Spin for requests
     let req: request;
-    while (true) {
+    while true {
         req = p.recv();
         alt req {
           quit. {
@@ -137,20 +126,19 @@ fn request_task(c: _chan<ctx>) {
             rustrt::aio_stop();
             ret;
           }
-          connect(remote(ip,portnum),client) {
+          connect(remote(ip, portnum), client) {
             task::_spawn(bind connect_task(ip, portnum, client));
           }
-          serve(ip,portnum,events,server) {
+          serve(ip, portnum, events, server) {
             task::_spawn(bind server_task(ip, portnum, events, server));
           }
-          write(socket,v,status) {
-            rustrt::aio_writedata(socket,
-                                  vec::to_ptr::<u8>(v), vec::len::<u8>(v),
-                                  status);
+          write(socket, v, status) {
+            rustrt::aio_writedata(socket, vec::to_ptr::<u8>(v),
+                                  vec::len::<u8>(v), status);
           }
-          close_server(server,status) {
+          close_server(server, status) {
             log "closing server";
-            rustrt::aio_close_server(server,status);
+            rustrt::aio_close_server(server, status);
           }
           close_client(client) {
             log "closing client";
diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs
index c42ef07bfb2..019aa32f36a 100644
--- a/src/lib/bitv.rs
+++ b/src/lib/bitv.rs
@@ -35,16 +35,16 @@ fn create(nbits: uint, init: bool) -> t {
     ret @{storage: storage, nbits: nbits};
 }
 
-fn process(op: &block(uint, uint) -> uint , v0: &t, v1: &t) -> bool {
+fn process(op: &block(uint, uint) -> uint, v0: &t, v1: &t) -> bool {
     let len = vec::len(v1.storage);
     assert (vec::len(v0.storage) == len);
     assert (v0.nbits == v1.nbits);
     let changed = false;
     for each i: uint in uint::range(0u, len) {
-        let w0 = v0.storage.(i);
-        let w1 = v1.storage.(i);
+        let w0 = v0.storage[i];
+        let w1 = v1.storage[i];
         let w = op(w0, w1);
-        if w0 != w { changed = true; v0.storage.(i) = w; }
+        if w0 != w { changed = true; v0.storage[i] = w; }
     }
     ret changed;
 }
@@ -70,7 +70,7 @@ fn assign(v0: &t, v1: t) -> bool {
 fn clone(v: t) -> t {
     let storage = vec::init_elt_mut::<uint>(0u, v.nbits / uint_bits() + 1u);
     let len = vec::len(v.storage);
-    for each i: uint in uint::range(0u, len) { storage.(i) = v.storage.(i); }
+    for each i: uint in uint::range(0u, len) { storage[i] = v.storage[i]; }
     ret @{storage: storage, nbits: v.nbits};
 }
 
@@ -79,7 +79,7 @@ fn get(v: &t, i: uint) -> bool {
     let bits = uint_bits();
     let w = i / bits;
     let b = i % bits;
-    let x = 1u & v.storage.(w) >> b;
+    let x = 1u & v.storage[w] >> b;
     ret x == 1u;
 }
 
@@ -90,7 +90,7 @@ fn equal(v0: &t, v1: &t) -> bool {
     let len = vec::len(v1.storage);
     let i = 0u;
     while i < len {
-        if v0.storage.(i) != v1.storage.(i) { ret false; }
+        if v0.storage[i] != v1.storage[i] { ret false; }
         i = i + 1u;
     }
     ret true;
@@ -98,7 +98,7 @@ fn equal(v0: &t, v1: &t) -> bool {
 
 fn clear(v: &t) {
     for each i: uint in uint::range(0u, vec::len(v.storage)) {
-        v.storage.(i) = 0u;
+        v.storage[i] = 0u;
     }
 }
 
@@ -108,7 +108,7 @@ fn set_all(v: &t) {
 
 fn invert(v: &t) {
     for each i: uint in uint::range(0u, vec::len(v.storage)) {
-        v.storage.(i) = !v.storage.(i);
+        v.storage[i] = !v.storage[i];
     }
 }
 
@@ -127,8 +127,7 @@ fn set(v: &t, i: uint, x: bool) {
     let w = i / bits;
     let b = i % bits;
     let flag = 1u << b;
-    v.storage.(w) =
-        if x { v.storage.(w) | flag } else { v.storage.(w) & !flag };
+    v.storage[w] = if x { v.storage[w] | flag } else { v.storage[w] & !flag };
 }
 
 
@@ -154,9 +153,7 @@ fn to_vec(v: &t) -> [uint] {
 
 fn to_str(v: &t) -> str {
     let rs = "";
-    for i: uint in to_vec(v) {
-        if i == 1u { rs += "1"; } else { rs += "0"; }
-    }
+    for i: uint in to_vec(v) { if i == 1u { rs += "1"; } else { rs += "0"; } }
     ret rs;
 }
 
@@ -166,7 +163,7 @@ fn eq_vec(v0: &t, v1: &[uint]) -> bool {
     let i = 0u;
     while i < len {
         let w0 = get(v0, i);
-        let w1 = v1.(i);
+        let w1 = v1[i];
         if !w0 && w1 != 0u || w0 && w1 == 0u { ret false; }
         i = i + 1u;
     }
diff --git a/src/lib/char.rs b/src/lib/char.rs
index 65e6de5373d..634c9b9647c 100644
--- a/src/lib/char.rs
+++ b/src/lib/char.rs
@@ -26,31 +26,55 @@ pred is_whitespace(c: char) -> bool {
     const ch_next_line: char = '\u0085';
     const ch_no_break_space: char = '\u00a0';
 
-    if c == ch_space { true }
-    else if c == ch_ogham_space_mark { true }
-    else if c == ch_mongolian_vowel_sep { true }
-    else if c == ch_en_quad { true }
-    else if c == ch_em_quad { true }
-    else if c == ch_en_space { true }
-    else if c == ch_em_space { true }
-    else if c == ch_three_per_em_space { true }
-    else if c == ch_four_per_em_space { true }
-    else if c == ch_six_per_em_space { true }
-    else if c == ch_figure_space { true }
-    else if c == ch_punctuation_space { true }
-    else if c == ch_thin_space { true }
-    else if c == ch_hair_space { true }
-    else if c == ch_narrow_no_break_space { true }
-    else if c == ch_medium_mathematical_space { true }
-    else if c == ch_ideographic_space { true }
-    else if c == ch_line_tabulation { true }
-    else if c == ch_paragraph_separator { true }
-    else if c == ch_character_tabulation { true }
-    else if c == ch_line_feed { true }
-    else if c == ch_line_tabulation { true }
-    else if c == ch_form_feed { true }
-    else if c == ch_carriage_return { true }
-    else if c == ch_next_line { true }
-    else if c == ch_no_break_space { true }
-    else { false }
-}
\ No newline at end of file
+    if c == ch_space {
+        true
+    } else if c == ch_ogham_space_mark {
+        true
+    } else if c == ch_mongolian_vowel_sep {
+        true
+    } else if c == ch_en_quad {
+        true
+    } else if c == ch_em_quad {
+        true
+    } else if c == ch_en_space {
+        true
+    } else if c == ch_em_space {
+        true
+    } else if c == ch_three_per_em_space {
+        true
+    } else if c == ch_four_per_em_space {
+        true
+    } else if c == ch_six_per_em_space {
+        true
+    } else if c == ch_figure_space {
+        true
+    } else if c == ch_punctuation_space {
+        true
+    } else if c == ch_thin_space {
+        true
+    } else if c == ch_hair_space {
+        true
+    } else if c == ch_narrow_no_break_space {
+        true
+    } else if c == ch_medium_mathematical_space {
+        true
+    } else if c == ch_ideographic_space {
+        true
+    } else if c == ch_line_tabulation {
+        true
+    } else if c == ch_paragraph_separator {
+        true
+    } else if c == ch_character_tabulation {
+        true
+    } else if c == ch_line_feed {
+        true
+    } else if c == ch_line_tabulation {
+        true
+    } else if c == ch_form_feed {
+        true
+    } else if c == ch_carriage_return {
+        true
+    } else if c == ch_next_line {
+        true
+    } else if c == ch_no_break_space { true } else { false }
+}
diff --git a/src/lib/comm.rs b/src/lib/comm.rs
index 615686a49e0..ebe9c75bc39 100644
--- a/src/lib/comm.rs
+++ b/src/lib/comm.rs
@@ -17,22 +17,21 @@ native "rust" mod rustrt {
     type void;
     type rust_port;
 
-    fn chan_id_send<~T>(target_task : task_id, target_port : port_id,
-                        data : -T);
+    fn chan_id_send<~T>(target_task: task_id, target_port: port_id, data: -T);
 
-    fn new_port(unit_sz : uint) -> *rust_port;
-    fn del_port(po : *rust_port);
-    fn drop_port(po : *rust_port);
-    fn get_port_id(po : *rust_port) -> port_id;
+    fn new_port(unit_sz: uint) -> *rust_port;
+    fn del_port(po: *rust_port);
+    fn drop_port(po: *rust_port);
+    fn get_port_id(po: *rust_port) -> port_id;
 }
 
 native "rust-intrinsic" mod rusti {
-    fn recv<~T>(port : *rustrt::rust_port) -> T;
+    fn recv<~T>(port: *rustrt::rust_port) -> T;
 }
 
 type port_id = int;
 
-type chan_handle<~T> = { task : task_id, port : port_id};
+type chan_handle<~T> = {task: task_id, port: port_id};
 
 tag chan<~T> { chan_t(chan_handle<T>); }
 type _chan<~T> = chan<T>;
@@ -44,22 +43,16 @@ resource port_ptr(po: *rustrt::rust_port) {
 
 tag port<~T> { port_t(@port_ptr); }
 
-obj port_obj<~T>(raw_port : port<T>) {
-    fn mk_chan() -> chan<T> {
-        chan(raw_port)
-    }
+obj port_obj<~T>(raw_port: port<T>) {
+    fn mk_chan() -> chan<T> { chan(raw_port) }
 
-    fn recv() -> T {
-        recv(raw_port)
-    }
+    fn recv() -> T { recv(raw_port) }
 }
 type _port<~T> = port_obj<T>;
 
-fn mk_port<~T>() -> _port<T> {
-    ret port_obj::<T>(port::<T>());
-}
+fn mk_port<~T>() -> _port<T> { ret port_obj::<T>(port::<T>()); }
 
-fn send<~T>(ch : &chan<T>, data : -T) {
+fn send<~T>(ch: &chan<T>, data: -T) {
     rustrt::chan_id_send(ch.task, ch.port, data);
 }
 
@@ -67,13 +60,8 @@ fn port<~T>() -> port<T> {
     port_t(@port_ptr(rustrt::new_port(sys::size_of::<T>())))
 }
 
-fn recv<~T>(p : &port<T>) -> T {
-    ret rusti::recv(***p)
-}
+fn recv<~T>(p: &port<T>) -> T { ret rusti::recv(***p) }
 
-fn chan<~T>(p : &port<T>) -> chan<T> {
-    chan_t({
-        task: task::get_task_id(),
-        port: rustrt::get_port_id(***p)
-    })
+fn chan<~T>(p: &port<T>) -> chan<T> {
+    chan_t({task: task::get_task_id(), port: rustrt::get_port_id(***p)})
 }
diff --git a/src/lib/deque.rs b/src/lib/deque.rs
index 19d74f14789..5b2d8db418b 100644
--- a/src/lib/deque.rs
+++ b/src/lib/deque.rs
@@ -6,14 +6,14 @@
  */
 type t<T> =
     obj {
-        fn size() -> uint ;
-        fn add_front(&T) ;
-        fn add_back(&T) ;
-        fn pop_front() -> T ;
-        fn pop_back() -> T ;
-        fn peek_front() -> T ;
-        fn peek_back() -> T ;
-        fn get(int) -> T ;
+        fn size() -> uint;
+        fn add_front(&T);
+        fn add_back(&T);
+        fn pop_front() -> T;
+        fn pop_back() -> T;
+        fn peek_front() -> T;
+        fn peek_back() -> T;
+        fn get(int) -> T;
     };
 
 fn create<@T>() -> t<T> {
@@ -26,24 +26,25 @@ fn create<@T>() -> t<T> {
       */
 
 
+
     fn grow<@T>(nelts: uint, lo: uint, elts: &[mutable cell<T>]) ->
        [mutable cell<T>] {
         assert (nelts == vec::len(elts));
-        let rv = ~[mutable];
+        let rv = [mutable];
 
         let i = 0u;
         let nalloc = uint::next_power_of_two(nelts + 1u);
         while i < nalloc {
             if i < nelts {
-                rv += ~[mutable elts.((lo + i) % nelts)];
-            } else { rv += ~[mutable option::none]; }
+                rv += [mutable elts[(lo + i) % nelts]];
+            } else { rv += [mutable option::none]; }
             i += 1u;
         }
 
         ret rv;
     }
     fn get<@T>(elts: &[mutable cell<T>], i: uint) -> T {
-        ret alt elts.(i) { option::some(t) { t } _ { fail } };
+        ret alt elts[i] { option::some(t) { t } _ { fail } };
     }
     obj deque<@T>(mutable nelts: uint,
                   mutable lo: uint,
@@ -60,7 +61,7 @@ fn create<@T>() -> t<T> {
                 lo = vec::len::<cell<T>>(elts) - 1u;
                 hi = nelts;
             }
-            elts.(lo) = option::some::<T>(t);
+            elts[lo] = option::some::<T>(t);
             nelts += 1u;
         }
         fn add_back(t: &T) {
@@ -69,7 +70,7 @@ fn create<@T>() -> t<T> {
                 lo = 0u;
                 hi = nelts;
             }
-            elts.(hi) = option::some::<T>(t);
+            elts[hi] = option::some::<T>(t);
             hi = (hi + 1u) % vec::len::<cell<T>>(elts);
             nelts += 1u;
         }
@@ -80,7 +81,7 @@ fn create<@T>() -> t<T> {
          */
         fn pop_front() -> T {
             let t: T = get::<T>(elts, lo);
-            elts.(lo) = option::none::<T>;
+            elts[lo] = option::none::<T>;
             lo = (lo + 1u) % vec::len::<cell<T>>(elts);
             nelts -= 1u;
             ret t;
@@ -90,7 +91,7 @@ fn create<@T>() -> t<T> {
                 hi = vec::len::<cell<T>>(elts) - 1u;
             } else { hi -= 1u; }
             let t: T = get::<T>(elts, hi);
-            elts.(hi) = option::none::<T>;
+            elts[hi] = option::none::<T>;
             nelts -= 1u;
             ret t;
         }
diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs
index 31814b8d098..09d0bee1a60 100644
--- a/src/lib/ebml.rs
+++ b/src/lib/ebml.rs
@@ -18,23 +18,23 @@ type ebml_state = {ebml_tag: ebml_tag, tag_pos: uint, data_pos: uint};
 type doc = {data: @[u8], start: uint, end: uint};
 
 fn vint_at(data: &[u8], start: uint) -> {val: uint, next: uint} {
-    let a = data.(start);
+    let a = data[start];
     if a & 0x80u8 != 0u8 { ret {val: a & 0x7fu8 as uint, next: start + 1u}; }
     if a & 0x40u8 != 0u8 {
-        ret {val: (a & 0x3fu8 as uint) << 8u | (data.(start + 1u) as uint),
+        ret {val: (a & 0x3fu8 as uint) << 8u | (data[start + 1u] as uint),
              next: start + 2u};
-    } else if (a & 0x20u8 != 0u8) {
+    } else if a & 0x20u8 != 0u8 {
         ret {val:
                  (a & 0x1fu8 as uint) << 16u |
-                     (data.(start + 1u) as uint) << 8u |
-                     (data.(start + 2u) as uint),
+                     (data[start + 1u] as uint) << 8u |
+                     (data[start + 2u] as uint),
              next: start + 3u};
-    } else if (a & 0x10u8 != 0u8) {
+    } else if a & 0x10u8 != 0u8 {
         ret {val:
                  (a & 0x0fu8 as uint) << 24u |
-                     (data.(start + 1u) as uint) << 16u |
-                     (data.(start + 2u) as uint) << 8u |
-                     (data.(start + 3u) as uint),
+                     (data[start + 1u] as uint) << 16u |
+                     (data[start + 2u] as uint) << 8u |
+                     (data[start + 3u] as uint),
              next: start + 4u};
     } else { log_err "vint too big"; fail; }
 }
@@ -105,7 +105,7 @@ fn be_uint_from_bytes(data: &@[u8], start: uint, size: uint) -> uint {
     let pos = start;
     while sz > 0u {
         sz -= 1u;
-        val += (data.(pos) as uint) << sz * 8u;
+        val += (data[pos] as uint) << sz * 8u;
         pos += 1u;
     }
     ret val;
@@ -122,17 +122,17 @@ type writer = {writer: io::buf_writer, mutable size_positions: [uint]};
 fn write_sized_vint(w: &io::buf_writer, n: uint, size: uint) {
     let buf: [u8];
     alt size {
-      1u { buf = ~[0x80u8 | (n as u8)]; }
-      2u { buf = ~[0x40u8 | (n >> 8u as u8), n & 0xffu as u8]; }
+      1u { buf = [0x80u8 | (n as u8)]; }
+      2u { buf = [0x40u8 | (n >> 8u as u8), n & 0xffu as u8]; }
       3u {
         buf =
-            ~[0x20u8 | (n >> 16u as u8), n >> 8u & 0xffu as u8,
-              n & 0xffu as u8];
+            [0x20u8 | (n >> 16u as u8), n >> 8u & 0xffu as u8,
+             n & 0xffu as u8];
       }
       4u {
         buf =
-            ~[0x10u8 | (n >> 24u as u8), n >> 16u & 0xffu as u8,
-              n >> 8u & 0xffu as u8, n & 0xffu as u8];
+            [0x10u8 | (n >> 24u as u8), n >> 16u & 0xffu as u8,
+             n >> 8u & 0xffu as u8, n & 0xffu as u8];
       }
       _ { log_err "vint to write too big"; fail; }
     }
@@ -149,7 +149,7 @@ fn write_vint(w: &io::buf_writer, n: uint) {
 }
 
 fn create_writer(w: &io::buf_writer) -> writer {
-    let size_positions: [uint] = ~[];
+    let size_positions: [uint] = [];
     ret {writer: w, mutable size_positions: size_positions};
 }
 
@@ -161,8 +161,8 @@ fn start_tag(w: &writer, tag_id: uint) {
     write_vint(w.writer, tag_id);
     // Write a placeholder four-byte size.
 
-    w.size_positions += ~[w.writer.tell()];
-    let zeroes: [u8] = ~[0u8, 0u8, 0u8, 0u8];
+    w.size_positions += [w.writer.tell()];
+    let zeroes: [u8] = [0u8, 0u8, 0u8, 0u8];
     w.writer.write(zeroes);
 }
 
diff --git a/src/lib/either.rs b/src/lib/either.rs
index 95f1d9aca21..6f2a27a958d 100644
--- a/src/lib/either.rs
+++ b/src/lib/either.rs
@@ -5,32 +5,33 @@ import option::none;
 
 tag t<T, U> { left(T); right(U); }
 
-fn either<T, U, V>(f_left: &block(&T) -> V, f_right: &block(&U) -> V,
-                   value: &t<T, U>) -> V {
+fn either<T, U,
+          V>(f_left: &block(&T) -> V, f_right: &block(&U) -> V,
+             value: &t<T, U>) -> V {
     alt value { left(l) { f_left(l) } right(r) { f_right(r) } }
 }
 
 fn lefts<T, U>(eithers: &[t<T, U>]) -> [T] {
-    let result: [T] = ~[];
+    let result: [T] = [];
     for elt: t<T, U> in eithers {
-        alt elt { left(l) { result += ~[l] } _ {/* fallthrough */ } }
+        alt elt { left(l) { result += [l] } _ {/* fallthrough */ } }
     }
     ret result;
 }
 
 fn rights<T, U>(eithers: &[t<T, U>]) -> [U] {
-    let result: [U] = ~[];
+    let result: [U] = [];
     for elt: t<T, U> in eithers {
-        alt elt { right(r) { result += ~[r] } _ {/* fallthrough */ } }
+        alt elt { right(r) { result += [r] } _ {/* fallthrough */ } }
     }
     ret result;
 }
 
 fn partition<T, U>(eithers: &[t<T, U>]) -> {lefts: [T], rights: [U]} {
-    let lefts: [T] = ~[];
-    let rights: [U] = ~[];
+    let lefts: [T] = [];
+    let rights: [U] = [];
     for elt: t<T, U> in eithers {
-        alt elt { left(l) { lefts += ~[l] } right(r) { rights += ~[r] } }
+        alt elt { left(l) { lefts += [l] } right(r) { rights += [r] } }
     }
     ret {lefts: lefts, rights: rights};
 }
diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs
index d7460a6b24e..7f7605a1d85 100644
--- a/src/lib/extfmt.rs
+++ b/src/lib/extfmt.rs
@@ -69,16 +69,16 @@ mod ct {
 
     // A fragment of the output sequence
     tag piece { piece_string(str); piece_conv(conv); }
-    type error_fn = fn(str) -> !  ;
+    type error_fn = fn(str) -> ! ;
 
     fn parse_fmt_string(s: str, error: error_fn) -> [piece] {
-        let pieces: [piece] = ~[];
+        let pieces: [piece] = [];
         let lim = str::byte_len(s);
         let buf = "";
         fn flush_buf(buf: str, pieces: &mutable [piece]) -> str {
             if str::byte_len(buf) > 0u {
                 let piece = piece_string(buf);
-                pieces += ~[piece];
+                pieces += [piece];
             }
             ret "";
         }
@@ -96,7 +96,7 @@ mod ct {
                 } else {
                     buf = flush_buf(buf, pieces);
                     let rs = parse_conversion(s, i, lim, error);
-                    pieces += ~[rs.piece];
+                    pieces += [rs.piece];
                     i = rs.next;
                 }
             } else { buf += curr; i += 1u; }
@@ -107,7 +107,7 @@ mod ct {
     fn peek_num(s: str, i: uint, lim: uint) ->
        option::t<{num: uint, next: uint}> {
         if i >= lim { ret none; }
-        let c = s.(i);
+        let c = s[i];
         if !('0' as u8 <= c && c <= '9' as u8) { ret option::none; }
         let n = c - ('0' as u8) as uint;
         ret alt peek_num(s, i + 1u, lim) {
@@ -143,7 +143,7 @@ mod ct {
               some(t) {
                 let n = t.num;
                 let j = t.next;
-                if j < lim && s.(j) == '$' as u8 {
+                if j < lim && s[j] == '$' as u8 {
                     {param: some(n as int), next: j + 1u}
                 } else { {param: none, next: i} }
               }
@@ -151,7 +151,7 @@ mod ct {
     }
     fn parse_flags(s: str, i: uint, lim: uint) ->
        {flags: [flag], next: uint} {
-        let noflags: [flag] = ~[];
+        let noflags: [flag] = [];
         if i >= lim { ret {flags: noflags, next: i}; }
 
         // FIXME: This recursion generates illegal instructions if the return
@@ -161,27 +161,27 @@ mod ct {
             let next = parse_flags(s, i + 1u, lim);
             let rest = next.flags;
             let j = next.next;
-            let curr: [flag] = ~[f];
+            let curr: [flag] = [f];
             ret @{flags: curr + rest, next: j};
         }
         let more = bind more_(_, s, i, lim);
-        let f = s.(i);
+        let f = s[i];
         ret if f == '-' as u8 {
                 *more(flag_left_justify)
-            } else if (f == '0' as u8) {
+            } else if f == '0' as u8 {
                 *more(flag_left_zero_pad)
-            } else if (f == ' ' as u8) {
+            } else if f == ' ' as u8 {
                 *more(flag_space_for_sign)
-            } else if (f == '+' as u8) {
+            } else if f == '+' as u8 {
                 *more(flag_sign_always)
-            } else if (f == '#' as u8) {
+            } else if f == '#' as u8 {
                 *more(flag_alternate)
             } else { {flags: noflags, next: i} };
     }
     fn parse_count(s: str, i: uint, lim: uint) -> {count: count, next: uint} {
         ret if i >= lim {
                 {count: count_implied, next: i}
-            } else if (s.(i) == '*' as u8) {
+            } else if s[i] == '*' as u8 {
                 let param = parse_parameter(s, i + 1u, lim);
                 let j = param.next;
                 alt param.param {
@@ -202,7 +202,7 @@ mod ct {
        {count: count, next: uint} {
         ret if i >= lim {
                 {count: count_implied, next: i}
-            } else if (s.(i) == '.' as u8) {
+            } else if s[i] == '.' as u8 {
                 let count = parse_count(s, i + 1u, lim);
 
 
@@ -223,21 +223,21 @@ mod ct {
         let t =
             if str::eq(tstr, "b") {
                 ty_bool
-            } else if (str::eq(tstr, "s")) {
+            } else if str::eq(tstr, "s") {
                 ty_str
-            } else if (str::eq(tstr, "c")) {
+            } else if str::eq(tstr, "c") {
                 ty_char
-            } else if (str::eq(tstr, "d") || str::eq(tstr, "i")) {
+            } else if str::eq(tstr, "d") || str::eq(tstr, "i") {
                 ty_int(signed)
-            } else if (str::eq(tstr, "u")) {
+            } else if str::eq(tstr, "u") {
                 ty_int(unsigned)
-            } else if (str::eq(tstr, "x")) {
+            } else if str::eq(tstr, "x") {
                 ty_hex(case_lower)
-            } else if (str::eq(tstr, "X")) {
+            } else if str::eq(tstr, "X") {
                 ty_hex(case_upper)
-            } else if (str::eq(tstr, "t")) {
+            } else if str::eq(tstr, "t") {
                 ty_bits
-            } else if (str::eq(tstr, "o")) {
+            } else if str::eq(tstr, "o") {
                 ty_octal
             } else { error("unknown type in conversion: " + tstr) };
         ret {ty: t, next: i + 1u};
@@ -277,7 +277,7 @@ mod rt {
         if 0 <= i {
             if have_flag(cv.flags, flag_sign_always) {
                 s = "+" + s;
-            } else if (have_flag(cv.flags, flag_space_for_sign)) {
+            } else if have_flag(cv.flags, flag_space_for_sign) {
                 s = " " + s;
             }
         }
@@ -404,9 +404,9 @@ mod rt {
         // instead.
 
         if signed && zero_padding && str::byte_len(s) > 0u {
-            let head = s.(0);
+            let head = s[0];
             if head == '+' as u8 || head == '-' as u8 || head == ' ' as u8 {
-                let headstr = str::unsafe_from_bytes(~[head]);
+                let headstr = str::unsafe_from_bytes([head]);
                 let bytelen = str::byte_len(s);
                 let numpart = str::substr(s, 1u, bytelen - 1u);
                 ret headstr + padstr + numpart;
diff --git a/src/lib/fs.rs b/src/lib/fs.rs
index e3eb47802b6..c49d77815a3 100644
--- a/src/lib/fs.rs
+++ b/src/lib/fs.rs
@@ -35,7 +35,7 @@ fn basename(p: path) -> path {
 // FIXME: Need some typestate to avoid bounds check when len(pre) == 0
 fn connect(pre: path, post: path) -> path {
     let len = str::byte_len(pre);
-    ret if pre.(len - 1u) == os_fs::path_sep as u8 {
+    ret if pre[len - 1u] == os_fs::path_sep as u8 {
 
             // Trailing '/'?
             pre + post
@@ -46,11 +46,11 @@ fn file_is_dir(p: path) -> bool { ret rustrt::rust_file_is_dir(p) != 0; }
 
 fn list_dir(p: path) -> [str] {
     let pl = str::byte_len(p);
-    if pl == 0u || p.(pl - 1u) as char != os_fs::path_sep { p += path_sep(); }
-    let full_paths: [str] = ~[];
+    if pl == 0u || p[pl - 1u] as char != os_fs::path_sep { p += path_sep(); }
+    let full_paths: [str] = [];
     for filename: str in os_fs::list_dir(p) {
         if !str::eq(filename, ".") {
-            if !str::eq(filename, "..") { full_paths += ~[p + filename]; }
+            if !str::eq(filename, "..") { full_paths += [p + filename]; }
         }
     }
     ret full_paths;
diff --git a/src/lib/generic_os.rs b/src/lib/generic_os.rs
index acb9a772048..80bc7747b47 100644
--- a/src/lib/generic_os.rs
+++ b/src/lib/generic_os.rs
@@ -28,7 +28,7 @@ fn getenv(n: str) -> option::t<str> {
         let res = os::kernel32::GetEnvironmentVariableA(nbuf, vbuf, nsize);
         if res == 0u {
             ret option::none;
-        } else if (res < nsize) {
+        } else if res < nsize {
             ret option::some(str::str_from_cstr(vbuf));
         } else { nsize = res; }
     }
diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs
index 22628f8aa6e..95747e3c453 100644
--- a/src/lib/getopts.rs
+++ b/src/lib/getopts.rs
@@ -68,7 +68,7 @@ tag optval { val(str); given; }
 type match = {opts: [opt], vals: [mutable [optval]], free: [str]};
 
 fn is_arg(arg: str) -> bool {
-    ret str::byte_len(arg) > 1u && arg.(0) == '-' as u8;
+    ret str::byte_len(arg) > 1u && arg[0] == '-' as u8;
 }
 
 fn name_str(nm: name) -> str {
@@ -78,7 +78,7 @@ fn name_str(nm: name) -> str {
 fn find_opt(opts: &[opt], nm: name) -> option::t<uint> {
     let i = 0u;
     let l = vec::len::<opt>(opts);
-    while i < l { if opts.(i).name == nm { ret some::<uint>(i); } i += 1u; }
+    while i < l { if opts[i].name == nm { ret some::<uint>(i); } i += 1u; }
     ret none::<uint>;
 }
 
@@ -108,30 +108,30 @@ tag result { success(match); failure(fail_); }
 
 fn getopts(args: &[str], opts: &[opt]) -> result {
     let n_opts = vec::len::<opt>(opts);
-    fn f(_x: uint) -> [optval] { ret ~[]; }
+    fn f(_x: uint) -> [optval] { ret []; }
     let vals = vec::init_fn_mut::<[optval]>(f, n_opts);
-    let free: [str] = ~[];
+    let free: [str] = [];
     let l = vec::len::<str>(args);
     let i = 0u;
     while i < l {
-        let cur = args.(i);
+        let cur = args[i];
         let curlen = str::byte_len(cur);
         if !is_arg(cur) {
-            free += ~[cur];
-        } else if (str::eq(cur, "--")) {
+            free += [cur];
+        } else if str::eq(cur, "--") {
             let j = i + 1u;
-            while j < l { free += ~[args.(j)]; j += 1u; }
+            while j < l { free += [args[j]]; j += 1u; }
             break;
         } else {
             let names;
             let i_arg = option::none::<str>;
-            if cur.(1) == '-' as u8 {
+            if cur[1] == '-' as u8 {
                 let tail = str::slice(cur, 2u, curlen);
                 let eq = str::index(tail, '=' as u8);
                 if eq == -1 {
-                    names = ~[long(tail)];
+                    names = [long(tail)];
                 } else {
-                    names = ~[long(str::slice(tail, 0u, eq as uint))];
+                    names = [long(str::slice(tail, 0u, eq as uint))];
                     i_arg =
                         option::some::<str>(str::slice(tail,
                                                        (eq as uint) + 1u,
@@ -139,10 +139,10 @@ fn getopts(args: &[str], opts: &[opt]) -> result {
                 }
             } else {
                 let j = 1u;
-                names = ~[];
+                names = [];
                 while j < curlen {
                     let range = str::char_range_at(cur, j);
-                    names += ~[short(range.ch)];
+                    names += [short(range.ch)];
                     j = range.next;
                 }
             }
@@ -154,27 +154,27 @@ fn getopts(args: &[str], opts: &[opt]) -> result {
                   some(id) { optid = id; }
                   none. { ret failure(unrecognized_option(name_str(nm))); }
                 }
-                alt opts.(optid).hasarg {
+                alt opts[optid].hasarg {
                   no. {
                     if !option::is_none::<str>(i_arg) {
                         ret failure(unexpected_argument(name_str(nm)));
                     }
-                    vals.(optid) += ~[given];
+                    vals[optid] += [given];
                   }
                   maybe. {
                     if !option::is_none::<str>(i_arg) {
-                        vals.(optid) += ~[val(option::get(i_arg))];
-                    } else if (name_pos < vec::len::<name>(names) ||
-                                   i + 1u == l || is_arg(args.(i + 1u))) {
-                        vals.(optid) += ~[given];
-                    } else { i += 1u; vals.(optid) += ~[val(args.(i))]; }
+                        vals[optid] += [val(option::get(i_arg))];
+                    } else if name_pos < vec::len::<name>(names) ||
+                                  i + 1u == l || is_arg(args[i + 1u]) {
+                        vals[optid] += [given];
+                    } else { i += 1u; vals[optid] += [val(args[i])]; }
                   }
                   yes. {
                     if !option::is_none::<str>(i_arg) {
-                        vals.(optid) += ~[val(option::get::<str>(i_arg))];
-                    } else if (i + 1u == l) {
+                        vals[optid] += [val(option::get::<str>(i_arg))];
+                    } else if i + 1u == l {
                         ret failure(argument_missing(name_str(nm)));
-                    } else { i += 1u; vals.(optid) += ~[val(args.(i))]; }
+                    } else { i += 1u; vals[optid] += [val(args[i])]; }
                   }
                 }
             }
@@ -183,16 +183,16 @@ fn getopts(args: &[str], opts: &[opt]) -> result {
     }
     i = 0u;
     while i < n_opts {
-        let n = vec::len::<optval>(vals.(i));
-        let occ = opts.(i).occur;
+        let n = vec::len::<optval>(vals[i]);
+        let occ = opts[i].occur;
         if occ == req {
             if n == 0u {
-                ret failure(option_missing(name_str(opts.(i).name)));
+                ret failure(option_missing(name_str(opts[i].name)));
             }
         }
         if occ != multi {
             if n > 1u {
-                ret failure(option_duplicated(name_str(opts.(i).name)));
+                ret failure(option_duplicated(name_str(opts[i].name)));
             }
         }
         i += 1u;
@@ -202,12 +202,12 @@ fn getopts(args: &[str], opts: &[opt]) -> result {
 
 fn opt_vals(m: &match, nm: str) -> [optval] {
     ret alt find_opt(m.opts, mkname(nm)) {
-          some(id) { m.vals.(id) }
+          some(id) { m.vals[id] }
           none. { log_err "No option '" + nm + "' defined."; fail }
         };
 }
 
-fn opt_val(m: &match, nm: str) -> optval { ret opt_vals(m, nm).(0); }
+fn opt_val(m: &match, nm: str) -> optval { ret opt_vals(m, nm)[0]; }
 
 fn opt_present(m: &match, nm: str) -> bool {
     ret vec::len::<optval>(opt_vals(m, nm)) > 0u;
@@ -218,9 +218,9 @@ fn opt_str(m: &match, nm: str) -> str {
 }
 
 fn opt_strs(m: &match, nm: str) -> [str] {
-    let acc: [str] = ~[];
+    let acc: [str] = [];
     for v: optval in opt_vals(m, nm) {
-        alt v { val(s) { acc += ~[s]; } _ { } }
+        alt v { val(s) { acc += [s]; } _ { } }
     }
     ret acc;
 }
@@ -228,7 +228,7 @@ fn opt_strs(m: &match, nm: str) -> [str] {
 fn opt_maybe_str(m: &match, nm: str) -> option::t<str> {
     let vals = opt_vals(m, nm);
     if vec::len::<optval>(vals) == 0u { ret none::<str>; }
-    ret alt vals.(0) { val(s) { some::<str>(s) } _ { none::<str> } };
+    ret alt vals[0] { val(s) { some::<str>(s) } _ { none::<str> } };
 }
 
 
@@ -238,7 +238,7 @@ fn opt_maybe_str(m: &match, nm: str) -> option::t<str> {
 fn opt_default(m: &match, nm: str, def: str) -> option::t<str> {
     let vals = opt_vals(m, nm);
     if vec::len::<optval>(vals) == 0u { ret none::<str>; }
-    ret alt vals.(0) { val(s) { some::<str>(s) } _ { some::<str>(def) } }
+    ret alt vals[0] { val(s) { some::<str>(s) } _ { some::<str>(def) } }
 }
 // Local Variables:
 // mode: rust;
diff --git a/src/lib/int.rs b/src/lib/int.rs
index 52a1cb1cd66..fd4cd09f279 100644
--- a/src/lib/int.rs
+++ b/src/lib/int.rs
@@ -52,7 +52,7 @@ fn str(i: int) -> str { ret to_str(i, 10u); }
 fn pow(base: int, exponent: uint) -> int {
     ret if exponent == 0u {
             1
-        } else if (base == 0) {
+        } else if base == 0 {
             0
         } else {
             let accum = base;
diff --git a/src/lib/io.rs b/src/lib/io.rs
index 10a59334f62..454cfd1041f 100644
--- a/src/lib/io.rs
+++ b/src/lib/io.rs
@@ -15,53 +15,49 @@ tag seek_style { seek_set; seek_end; seek_cur; }
 
 // The raw underlying reader class. All readers must implement this.
 type buf_reader =
-
     // FIXME: Seekable really should be orthogonal. We will need
     // inheritance.
     obj {
-        fn read(uint) -> [u8] ;
-        fn read_byte() -> int ;
-        fn unread_byte(int) ;
-        fn eof() -> bool ;
-        fn seek(int, seek_style) ;
-        fn tell() -> uint ;
+        fn read(uint) -> [u8];
+        fn read_byte() -> int;
+        fn unread_byte(int);
+        fn eof() -> bool;
+        fn seek(int, seek_style);
+        fn tell() -> uint;
     };
 
 
 // Convenience methods for reading.
 type reader =
-
     // FIXME: This should inherit from buf_reader.
-     // FIXME: eventually u64
+    // FIXME: eventually u64
 
     obj {
-        fn get_buf_reader() -> buf_reader ;
-        fn read_byte() -> int ;
-        fn unread_byte(int) ;
-        fn read_bytes(uint) -> [u8] ;
-        fn read_char() -> char ;
-        fn eof() -> bool ;
-        fn read_line() -> str ;
-        fn read_c_str() -> str ;
-        fn read_le_uint(uint) -> uint ;
-        fn read_le_int(uint) -> int ;
-        fn read_be_uint(uint) -> uint ;
-        fn read_whole_stream() -> [u8] ;
-        fn seek(int, seek_style) ;
-        fn tell() -> uint ;
+        fn get_buf_reader() -> buf_reader;
+        fn read_byte() -> int;
+        fn unread_byte(int);
+        fn read_bytes(uint) -> [u8];
+        fn read_char() -> char;
+        fn eof() -> bool;
+        fn read_line() -> str;
+        fn read_c_str() -> str;
+        fn read_le_uint(uint) -> uint;
+        fn read_le_int(uint) -> int;
+        fn read_be_uint(uint) -> uint;
+        fn read_whole_stream() -> [u8];
+        fn seek(int, seek_style);
+        fn tell() -> uint;
     };
 
 fn convert_whence(whence: seek_style) -> int {
     ret alt whence { seek_set. { 0 } seek_cur. { 1 } seek_end. { 2 } };
 }
 
-resource FILE_res(f: os::libc::FILE) {
-    os::libc::fclose(f);
-}
+resource FILE_res(f: os::libc::FILE) { os::libc::fclose(f); }
 
 obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) {
     fn read(len: uint) -> [u8] {
-        let buf = ~[];
+        let buf = [];
         vec::reserve::<u8>(buf, len);
         let read = os::libc::fread(vec::to_ptr::<u8>(buf), 1u, len, f);
         vec::unsafe::set_len::<u8>(buf, read);
@@ -73,9 +69,7 @@ obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) {
     fn seek(offset: int, whence: seek_style) {
         assert (os::libc::fseek(f, offset, convert_whence(whence)) == 0);
     }
-    fn tell() -> uint {
-        ret os::libc::ftell(f) as uint;
-    }
+    fn tell() -> uint { ret os::libc::ftell(f) as uint; }
 }
 
 
@@ -111,7 +105,7 @@ obj new_reader(rdr: buf_reader) {
     }
     fn eof() -> bool { ret rdr.eof(); }
     fn read_line() -> str {
-        let buf: [u8] = ~[];
+        let buf: [u8] = [];
         // No break yet in rustc
 
         let go_on = true;
@@ -119,16 +113,16 @@ obj new_reader(rdr: buf_reader) {
             let ch = rdr.read_byte();
             if ch == -1 || ch == 10 {
                 go_on = false;
-            } else { buf += ~[ch as u8]; }
+            } else { buf += [ch as u8]; }
         }
         ret str::unsafe_from_bytes(buf);
     }
     fn read_c_str() -> str {
-        let buf: [u8] = ~[];
+        let buf: [u8] = [];
         let go_on = true;
         while go_on {
             let ch = rdr.read_byte();
-            if ch < 1 { go_on = false; } else { buf += ~[ch as u8]; }
+            if ch < 1 { go_on = false; } else { buf += [ch as u8]; }
         }
         ret str::unsafe_from_bytes(buf);
     }
@@ -166,7 +160,7 @@ obj new_reader(rdr: buf_reader) {
         ret val;
     }
     fn read_whole_stream() -> [u8] {
-        let buf: [u8] = ~[];
+        let buf: [u8] = [];
         while !rdr.eof() { buf += rdr.read(2048u); }
         ret buf;
     }
@@ -205,7 +199,7 @@ obj byte_buf_reader(bbuf: byte_buf) {
     }
     fn read_byte() -> int {
         if bbuf.pos == vec::len::<u8>(bbuf.buf) { ret -1; }
-        let b = bbuf.buf.(bbuf.pos);
+        let b = bbuf.buf[bbuf.pos];
         bbuf.pos += 1u;
         ret b as int;
     }
@@ -232,15 +226,14 @@ fn string_reader(s: &str) -> reader {
 tag fileflag { append; create; truncate; none; }
 
 type buf_writer =
-
     // FIXME: Seekable really should be orthogonal. We will need
     // inheritance.
-     // FIXME: eventually u64
+    // FIXME: eventually u64
 
     obj {
-        fn write(&[u8]) ;
-        fn seek(int, seek_style) ;
-        fn tell() -> uint ;
+        fn write(&[u8]);
+        fn seek(int, seek_style);
+        fn tell() -> uint;
     };
 
 obj FILE_writer(f: os::libc::FILE, res: option::t<@FILE_res>) {
@@ -253,14 +246,10 @@ obj FILE_writer(f: os::libc::FILE, res: option::t<@FILE_res>) {
     fn seek(offset: int, whence: seek_style) {
         assert (os::libc::fseek(f, offset, convert_whence(whence)) == 0);
     }
-    fn tell() -> uint {
-        ret os::libc::ftell(f) as uint;
-    }
+    fn tell() -> uint { ret os::libc::ftell(f) as uint; }
 }
 
-resource fd_res(fd: int) {
-    os::libc::close(fd);
-}
+resource fd_res(fd: int) { os::libc::close(fd); }
 
 obj fd_buf_writer(fd: int, res: option::t<@fd_res>) {
     fn write(v: &[u8]) {
@@ -312,32 +301,31 @@ fn file_buf_writer(path: str, flags: &[fileflag]) -> buf_writer {
 }
 
 type writer =
-
     // write_str will continue to do utf-8 output only. an alternative
     // function will be provided for general encoded string output
     obj {
-        fn get_buf_writer() -> buf_writer ;
-        fn write_str(str) ;
-        fn write_line(str) ;
-        fn write_char(char) ;
-        fn write_int(int) ;
-        fn write_uint(uint) ;
-        fn write_bytes(&[u8]) ;
-        fn write_le_uint(uint, uint) ;
-        fn write_le_int(int, uint) ;
-        fn write_be_uint(uint, uint) ;
+        fn get_buf_writer() -> buf_writer;
+        fn write_str(str);
+        fn write_line(str);
+        fn write_char(char);
+        fn write_int(int);
+        fn write_uint(uint);
+        fn write_bytes(&[u8]);
+        fn write_le_uint(uint, uint);
+        fn write_le_int(int, uint);
+        fn write_be_uint(uint, uint);
     };
 
 fn uint_to_le_bytes(n: uint, size: uint) -> [u8] {
-    let bytes: [u8] = ~[];
-    while size > 0u { bytes += ~[n & 255u as u8]; n >>= 8u; size -= 1u; }
+    let bytes: [u8] = [];
+    while size > 0u { bytes += [n & 255u as u8]; n >>= 8u; size -= 1u; }
     ret bytes;
 }
 
 fn uint_to_be_bytes(n: uint, size: uint) -> [u8] {
-    let bytes: [u8] = ~[];
+    let bytes: [u8] = [];
     let i = size - 1u as int;
-    while i >= 0 { bytes += ~[n >> (i * 8 as uint) & 255u as u8]; i -= 1; }
+    while i >= 0 { bytes += [n >> (i * 8 as uint) & 255u as u8]; i -= 1; }
     ret bytes;
 }
 
@@ -354,9 +342,7 @@ obj new_writer(out: buf_writer) {
         out.write(str::bytes(str::from_char(ch)));
     }
     fn write_int(n: int) { out.write(str::bytes(int::to_str(n, 10u))); }
-    fn write_uint(n: uint) {
-        out.write(str::bytes(uint::to_str(n, 10u)));
-    }
+    fn write_uint(n: uint) { out.write(str::bytes(uint::to_str(n, 10u))); }
     fn write_bytes(bytes: &[u8]) { out.write(bytes); }
     fn write_le_uint(n: uint, size: uint) {
         out.write(uint_to_le_bytes(n, size));
@@ -391,8 +377,8 @@ fn stdout() -> writer { ret new_writer(fd_buf_writer(1, option::none)); }
 
 type str_writer =
     obj {
-        fn get_writer() -> writer ;
-        fn get_str() -> str ;
+        fn get_writer() -> writer;
+        fn get_str() -> str;
     };
 
 type mutable_byte_buf = @{mutable buf: [mutable u8], mutable pos: uint};
@@ -402,7 +388,7 @@ obj byte_buf_writer(buf: mutable_byte_buf) {
         // Fast path.
 
         if buf.pos == vec::len(buf.buf) {
-            for b: u8 in v { buf.buf += ~[mutable b]; }
+            for b: u8 in v { buf.buf += [mutable b]; }
             buf.pos += vec::len::<u8>(v);
             ret;
         }
@@ -411,10 +397,10 @@ obj byte_buf_writer(buf: mutable_byte_buf) {
         let vlen = vec::len::<u8>(v);
         let vpos = 0u;
         while vpos < vlen {
-            let b = v.(vpos);
+            let b = v[vpos];
             if buf.pos == vec::len(buf.buf) {
-                buf.buf += ~[mutable b];
-            } else { buf.buf.(buf.pos) = b; }
+                buf.buf += [mutable b];
+            } else { buf.buf[buf.pos] = b; }
             buf.pos += 1u;
             vpos += 1u;
         }
@@ -430,7 +416,7 @@ obj byte_buf_writer(buf: mutable_byte_buf) {
 fn string_writer() -> str_writer {
     // FIXME: yikes, this is bad. Needs fixing of mutable syntax.
 
-    let b: [mutable u8] = ~[mutable 0u8];
+    let b: [mutable u8] = [mutable 0u8];
     vec::pop(b);
     let buf: mutable_byte_buf = @{mutable buf: b, mutable pos: 0u};
     obj str_writer_wrap(wr: writer, buf: mutable_byte_buf) {
@@ -451,7 +437,7 @@ fn seek_in_buf(offset: int, pos: uint, len: uint, whence: seek_style) ->
       seek_cur. { bpos += offset; }
       seek_end. { bpos = blen + offset; }
     }
-    if bpos < 0 { bpos = 0; } else if (bpos > blen) { bpos = blen; }
+    if bpos < 0 { bpos = 0; } else if bpos > blen { bpos = blen; }
     ret bpos as uint;
 }
 
@@ -460,6 +446,7 @@ fn read_whole_file_str(file: &str) -> str {
 }
 
 fn read_whole_file(file: &str) -> [u8] {
+
     // FIXME: There's a lot of copying here
     file_reader(file).read_whole_stream()
 }
diff --git a/src/lib/list.rs b/src/lib/list.rs
index ee25f7cd3bb..4f3cc5b2238 100644
--- a/src/lib/list.rs
+++ b/src/lib/list.rs
@@ -13,7 +13,7 @@ fn from_vec<@T>(v: &[T]) -> list<T> {
     ret l;
 }
 
-fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U ) -> U {
+fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U) -> U {
     let accum: U = u;
     let ls = ls_;
     while true {
@@ -25,8 +25,8 @@ fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U ) -> U {
     ret accum;
 }
 
-fn find<@T, @U>(ls_: &list<T>, f: &block(&T) -> option::t<U>)
-    -> option::t<U> {
+fn find<@T, @U>(ls_: &list<T>, f: &block(&T) -> option::t<U>) ->
+   option::t<U> {
     let ls = ls_;
     while true {
         alt ls {
@@ -56,26 +56,17 @@ fn length<@T>(ls: &list<T>) -> uint {
 }
 
 fn cdr<@T>(ls: &list<T>) -> list<T> {
-    alt ls {
-      cons(_, tl) { ret *tl; }
-      nil. { fail "list empty" }
-    }
+    alt ls { cons(_, tl) { ret *tl; } nil. { fail "list empty" } }
 }
 
 fn car<@T>(ls: &list<T>) -> T {
-    alt ls {
-      cons(hd, _) { ret hd; }
-      nil. { fail "list empty" }
-    }
+    alt ls { cons(hd, _) { ret hd; } nil. { fail "list empty" } }
 }
 
 fn append<@T>(l: &list<T>, m: &list<T>) -> list<T> {
     alt l {
       nil. { ret m; }
-      cons(x, xs) {
-        let rest = append(*xs, m);
-        ret cons(x, @rest);
-      }
+      cons(x, xs) { let rest = append(*xs, m); ret cons(x, @rest); }
     }
 }
 
diff --git a/src/lib/map.rs b/src/lib/map.rs
index 4590fd8c63d..d54eae03d10 100644
--- a/src/lib/map.rs
+++ b/src/lib/map.rs
@@ -1,21 +1,21 @@
 /**
  * Hashmap implementation.
  */
-type hashfn<K> = fn(&K) -> uint ;
+type hashfn<K> = fn(&K) -> uint;
 
-type eqfn<K> = fn(&K, &K) -> bool ;
+type eqfn<K> = fn(&K, &K) -> bool;
 
 type hashmap<K, V> =
     obj {
-        fn size() -> uint ;
-        fn insert(&K, &V) -> bool ;
-        fn contains_key(&K) -> bool ;
-        fn get(&K) -> V ;
-        fn find(&K) -> option::t<V> ;
-        fn remove(&K) -> option::t<V> ;
-        fn rehash() ;
-        iter items() -> @{key: K, val: V} ;
-        iter keys() -> K ;
+        fn size() -> uint;
+        fn insert(&K, &V) -> bool;
+        fn contains_key(&K) -> bool;
+        fn get(&K) -> V;
+        fn find(&K) -> option::t<V>;
+        fn remove(&K) -> option::t<V>;
+        fn rehash();
+        iter items() -> @{key: K, val: V};
+        iter keys() -> K;
     };
 type hashset<K> = hashmap<K, ()>;
 
@@ -26,7 +26,7 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
 
     let load_factor: util::rational = {num: 3, den: 4};
     tag bucket<@K, @V> { nil; deleted; some(K, V); }
-    fn make_buckets<@K, @V>(nbkts: uint) -> [mutable (bucket<K, V>)] {
+    fn make_buckets<@K, @V>(nbkts: uint) -> [mutable bucket<K, V>] {
         ret vec::init_elt_mut::<bucket<K, V>>(nil::<K, V>, nbkts);
     }
     // Derive two hash functions from the one given by taking the upper
@@ -53,37 +53,36 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
      * will fail.
      */
 
-    fn insert_common<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
-                             bkts: &[mutable bucket<K, V>], nbkts: uint,
-                             key: &K, val: &V) -> bool {
+    fn insert_common<@K,
+                     @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
+                         bkts: &[mutable bucket<K, V>], nbkts: uint, key: &K,
+                         val: &V) -> bool {
         let i: uint = 0u;
         let h: uint = hasher(key);
         while i < nbkts {
             let j: uint = hash(h, nbkts, i);
-            alt bkts.(j) {
+            alt bkts[j] {
               some(k, _) {
                 // Copy key to please alias analysis.
 
                 let k_ = k;
-                if eqer(key, k_) {
-                    bkts.(j) = some(k_, val);
-                    ret false;
-                }
+                if eqer(key, k_) { bkts[j] = some(k_, val); ret false; }
                 i += 1u;
               }
-              _ { bkts.(j) = some(key, val); ret true; }
+              _ { bkts[j] = some(key, val); ret true; }
             }
         }
         fail; // full table
     }
-    fn find_common<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
-                           bkts: &[mutable bucket<K, V>], nbkts: uint,
-                           key: &K) -> option::t<V> {
+    fn find_common<@K,
+                   @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
+                       bkts: &[mutable bucket<K, V>], nbkts: uint, key: &K) ->
+       option::t<V> {
         let i: uint = 0u;
         let h: uint = hasher(key);
         while i < nbkts {
             let j: uint = hash(h, nbkts, i);
-            alt bkts.(j) {
+            alt bkts[j] {
               some(k, v) {
                 // Copy to please alias analysis.
                 let k_ = k;
@@ -97,9 +96,10 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
         }
         ret option::none;
     }
-    fn rehash<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
-                      oldbkts: &[mutable bucket<K, V>], _noldbkts: uint,
-                      newbkts: &[mutable bucket<K, V>], nnewbkts: uint) {
+    fn rehash<@K,
+              @V>(hasher: &hashfn<K>, eqer: &eqfn<K>,
+                  oldbkts: &[mutable bucket<K, V>], _noldbkts: uint,
+                  newbkts: &[mutable bucket<K, V>], nnewbkts: uint) {
         for b: bucket<K, V> in oldbkts {
             alt b {
               some(k_, v_) {
@@ -111,12 +111,13 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
             }
         }
     }
-    obj hashmap<@K, @V>(hasher: hashfn<K>,
-                        eqer: eqfn<K>,
-                        mutable bkts: [mutable bucket<K, V>],
-                        mutable nbkts: uint,
-                        mutable nelts: uint,
-                        lf: util::rational) {
+    obj hashmap<@K,
+                @V>(hasher: hashfn<K>,
+                    eqer: eqfn<K>,
+                    mutable bkts: [mutable bucket<K, V>],
+                    mutable nbkts: uint,
+                    mutable nelts: uint,
+                    lf: util::rational) {
         fn size() -> uint { ret nelts; }
         fn insert(key: &K, val: &V) -> bool {
             let load: util::rational =
@@ -154,12 +155,12 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
             let h: uint = hasher(key);
             while i < nbkts {
                 let j: uint = hash(h, nbkts, i);
-                alt bkts.(j) {
+                alt bkts[j] {
                   some(k, v) {
                     let k_ = k;
                     let vo = option::some(v);
                     if eqer(key, k_) {
-                        bkts.(j) = deleted;
+                        bkts[j] = deleted;
                         nelts -= 1u;
                         ret vo;
                     }
diff --git a/src/lib/net.rs b/src/lib/net.rs
index 8b8b8113d8d..83923d6b987 100644
--- a/src/lib/net.rs
+++ b/src/lib/net.rs
@@ -2,29 +2,20 @@ import str;
 import vec;
 import uint;
 
-tag ip_addr {
-    ipv4(u8, u8, u8, u8);
-}
+tag ip_addr { ipv4(u8, u8, u8, u8); }
 
-fn format_addr(ip : ip_addr) -> str {
-    alt(ip) {
+fn format_addr(ip: ip_addr) -> str {
+    alt ip {
       ipv4(a, b, c, d) {
-        #fmt("%u.%u.%u.%u",
-             a as uint,
-             b as uint,
-             c as uint,
-             d as uint)
+        #fmt["%u.%u.%u.%u", a as uint, b as uint, c as uint, d as uint]
       }
       _ { fail "Unsupported address type"; }
     }
 }
 
-fn parse_addr(ip : str) -> ip_addr {
-    let parts = vec::map(uint::from_str, str::split(ip, ".".(0)));
+fn parse_addr(ip: str) -> ip_addr {
+    let parts = vec::map(uint::from_str, str::split(ip, "."[0]));
     if vec::len(parts) != 4u { fail "Too many dots in IP address"; }
     for i in parts { if i > 255u { fail "Invalid IP Address part."; } }
-    ipv4(parts.(0) as u8,
-         parts.(1) as u8,
-         parts.(2) as u8,
-         parts.(3) as u8)
+    ipv4(parts[0] as u8, parts[1] as u8, parts[2] as u8, parts[3] as u8)
 }
diff --git a/src/lib/option.rs b/src/lib/option.rs
index e8656b0b77d..ea14ef2b867 100644
--- a/src/lib/option.rs
+++ b/src/lib/option.rs
@@ -3,10 +3,7 @@
 tag t<@T> { none; some(T); }
 
 fn get<@T>(opt: &t<T>) -> T {
-    alt opt {
-      some(x) { x }
-      none. { fail "option none" }
-    }
+    alt opt { some(x) { x } none. { fail "option none" } }
 }
 
 fn map<@T, @U>(f: &block(&T) -> U, opt: &t<T>) -> t<U> {
diff --git a/src/lib/rand.rs b/src/lib/rand.rs
index 7b47311b04b..fee8bbe06ba 100644
--- a/src/lib/rand.rs
+++ b/src/lib/rand.rs
@@ -11,17 +11,16 @@ native "rust" mod rustrt {
     fn rand_free(c: rctx);
 }
 
-type rng = obj { fn next() -> u32; };
+type rng =
+    obj {
+        fn next() -> u32;
+    };
 
-resource rand_res(c: rustrt::rctx) {
-    rustrt::rand_free(c);
-}
+resource rand_res(c: rustrt::rctx) { rustrt::rand_free(c); }
 
 fn mk_rng() -> rng {
     obj rt_rng(c: @rand_res) {
-        fn next() -> u32 {
-            ret rustrt::rand_next(**c);
-        }
+        fn next() -> u32 { ret rustrt::rand_next(**c); }
     }
     ret rt_rng(@rand_res(rustrt::rand_new()));
 }
diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs
index 5c5f110816b..fb593bca58a 100644
--- a/src/lib/run_program.rs
+++ b/src/lib/run_program.rs
@@ -13,9 +13,9 @@ native "rust" mod rustrt {
 }
 
 fn arg_vec(prog: str, args: &[str]) -> [sbuf] {
-    let argptrs = ~[str::buf(prog)];
-    for arg: str in args { argptrs += ~[str::buf(arg)]; }
-    argptrs += ~[0 as sbuf];
+    let argptrs = [str::buf(prog)];
+    for arg: str in args { argptrs += [str::buf(arg)]; }
+    argptrs += [0 as sbuf];
     ret argptrs;
 }
 
@@ -24,8 +24,8 @@ fn spawn_process(prog: str, args: &[str], in_fd: int, out_fd: int,
     // Note: we have to hold on to this vector reference while we hold a
     // pointer to its buffer
     let argv = arg_vec(prog, args);
-    let pid = rustrt::rust_run_program(
-        vec::to_ptr(argv), in_fd, out_fd, err_fd);
+    let pid =
+        rustrt::rust_run_program(vec::to_ptr(argv), in_fd, out_fd, err_fd);
     ret pid;
 }
 
@@ -44,16 +44,15 @@ type program =
         fn destroy();
     };
 
-resource program_res(p: program) {
-    p.destroy();
-}
+resource program_res(p: program) { p.destroy(); }
 
 fn start_program(prog: str, args: &[str]) -> @program_res {
     let pipe_input = os::pipe();
     let pipe_output = os::pipe();
     let pipe_err = os::pipe();
-    let pid = spawn_process(prog, args, pipe_input.in, pipe_output.out,
-                            pipe_err.out);
+    let pid =
+        spawn_process(prog, args, pipe_input.in, pipe_output.out,
+                      pipe_err.out);
 
     if pid == -1 { fail; }
     os::libc::close(pipe_input.in);
@@ -66,16 +65,13 @@ fn start_program(prog: str, args: &[str]) -> @program_res {
                     mutable finished: bool) {
         fn get_id() -> int { ret pid; }
         fn input() -> io::writer {
-            ret io::new_writer(
-                io::fd_buf_writer(in_fd, option::none));
+            ret io::new_writer(io::fd_buf_writer(in_fd, option::none));
         }
         fn output() -> io::reader {
-            ret io::new_reader(
-                io::FILE_buf_reader(out_file, option::none));
+            ret io::new_reader(io::FILE_buf_reader(out_file, option::none));
         }
         fn err() -> io::reader {
-            ret io::new_reader(
-                io::FILE_buf_reader(err_file, option::none));
+            ret io::new_reader(io::FILE_buf_reader(err_file, option::none));
         }
         fn close_input() {
             let invalid_fd = -1;
@@ -96,11 +92,9 @@ fn start_program(prog: str, args: &[str]) -> @program_res {
             os::libc::fclose(err_file);
         }
     }
-    ret @program_res(new_program(pid,
-                                 pipe_input.out,
+    ret @program_res(new_program(pid, pipe_input.out,
                                  os::fd_FILE(pipe_output.in),
-                                 os::fd_FILE(pipe_err.in),
-                                 false));
+                                 os::fd_FILE(pipe_err.in), false));
 }
 
 fn read_all(rd: &io::reader) -> str {
@@ -112,8 +106,8 @@ fn read_all(rd: &io::reader) -> str {
     ret buf;
 }
 
-fn program_output(prog: str, args: [str])
-    -> {status: int, out: str, err: str} {
+fn program_output(prog: str, args: [str]) ->
+   {status: int, out: str, err: str} {
     let pr = start_program(prog, args);
     pr.close_input();
     ret {status: pr.finish(),
diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs
index 99c0f1276d1..db6fad15784 100644
--- a/src/lib/sha1.rs
+++ b/src/lib/sha1.rs
@@ -9,7 +9,6 @@ export sha1;
 export mk_sha1;
 
 type sha1 =
-
     // Provide message input as bytes
 
 
@@ -25,11 +24,11 @@ type sha1 =
     // Reset the sha1 state for reuse. This is called
     // automatically during construction
     obj {
-        fn input(&[u8]) ;
-        fn input_str(&str) ;
-        fn result() -> [u8] ;
-        fn result_str() -> str ;
-        fn reset() ;
+        fn input(&[u8]);
+        fn input_str(&str);
+        fn result() -> [u8];
+        fn result_str() -> str;
+        fn reset();
     };
 
 
@@ -65,7 +64,7 @@ fn mk_sha1() -> sha1 {
 
         assert (!st.computed);
         for element: u8 in msg {
-            st.msg_block.(st.msg_block_idx) = element;
+            st.msg_block[st.msg_block_idx] = element;
             st.msg_block_idx += 1u;
             st.len_low += 8u32;
             if st.len_low == 0u32 {
@@ -92,30 +91,29 @@ fn mk_sha1() -> sha1 {
         t = 0;
         while t < 16 {
             let tmp;
-            tmp = (st.msg_block.(t * 4) as u32) << 24u32;
-            tmp = tmp | (st.msg_block.(t * 4 + 1) as u32) << 16u32;
-            tmp = tmp | (st.msg_block.(t * 4 + 2) as u32) << 8u32;
-            tmp = tmp | (st.msg_block.(t * 4 + 3) as u32);
-            w.(t) = tmp;
+            tmp = (st.msg_block[t * 4] as u32) << 24u32;
+            tmp = tmp | (st.msg_block[t * 4 + 1] as u32) << 16u32;
+            tmp = tmp | (st.msg_block[t * 4 + 2] as u32) << 8u32;
+            tmp = tmp | (st.msg_block[t * 4 + 3] as u32);
+            w[t] = tmp;
             t += 1;
         }
         // Initialize the rest of vector w
 
         while t < 80 {
-            let val = w.(t - 3) ^ w.(t - 8) ^ w.(t - 14) ^ w.(t - 16);
-            w.(t) = circular_shift(1u32, val);
+            let val = w[t - 3] ^ w[t - 8] ^ w[t - 14] ^ w[t - 16];
+            w[t] = circular_shift(1u32, val);
             t += 1;
         }
-        let a = st.h.(0);
-        let b = st.h.(1);
-        let c = st.h.(2);
-        let d = st.h.(3);
-        let e = st.h.(4);
+        let a = st.h[0];
+        let b = st.h[1];
+        let c = st.h[2];
+        let d = st.h[3];
+        let e = st.h[4];
         let temp: u32;
         t = 0;
         while t < 20 {
-            temp =
-                circular_shift(5u32, a) + (b & c | !b & d) + e + w.(t) + k0;
+            temp = circular_shift(5u32, a) + (b & c | !b & d) + e + w[t] + k0;
             e = d;
             d = c;
             c = circular_shift(30u32, b);
@@ -124,7 +122,7 @@ fn mk_sha1() -> sha1 {
             t += 1;
         }
         while t < 40 {
-            temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w.(t) + k1;
+            temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w[t] + k1;
             e = d;
             d = c;
             c = circular_shift(30u32, b);
@@ -134,8 +132,8 @@ fn mk_sha1() -> sha1 {
         }
         while t < 60 {
             temp =
-                circular_shift(5u32, a) + (b & c | b & d | c & d) + e + w.(t)
-                    + k2;
+                circular_shift(5u32, a) + (b & c | b & d | c & d) + e + w[t] +
+                    k2;
             e = d;
             d = c;
             c = circular_shift(30u32, b);
@@ -144,7 +142,7 @@ fn mk_sha1() -> sha1 {
             t += 1;
         }
         while t < 80 {
-            temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w.(t) + k3;
+            temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w[t] + k3;
             e = d;
             d = c;
             c = circular_shift(30u32, b);
@@ -152,11 +150,11 @@ fn mk_sha1() -> sha1 {
             a = temp;
             t += 1;
         }
-        st.h.(0) = st.h.(0) + a;
-        st.h.(1) = st.h.(1) + b;
-        st.h.(2) = st.h.(2) + c;
-        st.h.(3) = st.h.(3) + d;
-        st.h.(4) = st.h.(4) + e;
+        st.h[0] = st.h[0] + a;
+        st.h[1] = st.h[1] + b;
+        st.h[2] = st.h[2] + c;
+        st.h[3] = st.h[3] + d;
+        st.h[4] = st.h[4] + e;
         st.msg_block_idx = 0u;
     }
     fn circular_shift(bits: u32, word: u32) -> u32 {
@@ -164,13 +162,13 @@ fn mk_sha1() -> sha1 {
     }
     fn mk_result(st: &sha1state) -> [u8] {
         if !st.computed { pad_msg(st); st.computed = true; }
-        let rs: [u8] = ~[];
+        let rs: [u8] = [];
         for hpart: u32 in st.h {
             let a = hpart >> 24u32 & 0xFFu32 as u8;
             let b = hpart >> 16u32 & 0xFFu32 as u8;
             let c = hpart >> 8u32 & 0xFFu32 as u8;
             let d = hpart & 0xFFu32 as u8;
-            rs += ~[a, b, c, d];
+            rs += [a, b, c, d];
         }
         ret rs;
     }
@@ -195,31 +193,31 @@ fn mk_sha1() -> sha1 {
          */
 
         if st.msg_block_idx > 55u {
-            st.msg_block.(st.msg_block_idx) = 0x80u8;
+            st.msg_block[st.msg_block_idx] = 0x80u8;
             st.msg_block_idx += 1u;
             while st.msg_block_idx < msg_block_len {
-                st.msg_block.(st.msg_block_idx) = 0u8;
+                st.msg_block[st.msg_block_idx] = 0u8;
                 st.msg_block_idx += 1u;
             }
             process_msg_block(st);
         } else {
-            st.msg_block.(st.msg_block_idx) = 0x80u8;
+            st.msg_block[st.msg_block_idx] = 0x80u8;
             st.msg_block_idx += 1u;
         }
         while st.msg_block_idx < 56u {
-            st.msg_block.(st.msg_block_idx) = 0u8;
+            st.msg_block[st.msg_block_idx] = 0u8;
             st.msg_block_idx += 1u;
         }
         // Store the message length as the last 8 octets
 
-        st.msg_block.(56) = st.len_high >> 24u32 & 0xFFu32 as u8;
-        st.msg_block.(57) = st.len_high >> 16u32 & 0xFFu32 as u8;
-        st.msg_block.(58) = st.len_high >> 8u32 & 0xFFu32 as u8;
-        st.msg_block.(59) = st.len_high & 0xFFu32 as u8;
-        st.msg_block.(60) = st.len_low >> 24u32 & 0xFFu32 as u8;
-        st.msg_block.(61) = st.len_low >> 16u32 & 0xFFu32 as u8;
-        st.msg_block.(62) = st.len_low >> 8u32 & 0xFFu32 as u8;
-        st.msg_block.(63) = st.len_low & 0xFFu32 as u8;
+        st.msg_block[56] = st.len_high >> 24u32 & 0xFFu32 as u8;
+        st.msg_block[57] = st.len_high >> 16u32 & 0xFFu32 as u8;
+        st.msg_block[58] = st.len_high >> 8u32 & 0xFFu32 as u8;
+        st.msg_block[59] = st.len_high & 0xFFu32 as u8;
+        st.msg_block[60] = st.len_low >> 24u32 & 0xFFu32 as u8;
+        st.msg_block[61] = st.len_low >> 16u32 & 0xFFu32 as u8;
+        st.msg_block[62] = st.len_low >> 8u32 & 0xFFu32 as u8;
+        st.msg_block[63] = st.len_low & 0xFFu32 as u8;
         process_msg_block(st);
     }
     obj sha1(st: sha1state) {
@@ -230,11 +228,11 @@ fn mk_sha1() -> sha1 {
             st.len_low = 0u32;
             st.len_high = 0u32;
             st.msg_block_idx = 0u;
-            st.h.(0) = 0x67452301u32;
-            st.h.(1) = 0xEFCDAB89u32;
-            st.h.(2) = 0x98BADCFEu32;
-            st.h.(3) = 0x10325476u32;
-            st.h.(4) = 0xC3D2E1F0u32;
+            st.h[0] = 0x67452301u32;
+            st.h[1] = 0xEFCDAB89u32;
+            st.h[2] = 0x98BADCFEu32;
+            st.h[3] = 0x10325476u32;
+            st.h[4] = 0xC3D2E1F0u32;
             st.computed = false;
         }
         fn input(msg: &[u8]) { add_input(st, msg); }
diff --git a/src/lib/sio.rs b/src/lib/sio.rs
index bd75efa76a5..b506f92a97b 100644
--- a/src/lib/sio.rs
+++ b/src/lib/sio.rs
@@ -7,25 +7,17 @@ import str;
 import net;
 
 type ctx = aio::ctx;
-type client = { ctx: ctx, client: aio::client,
-               evt: _port<aio::socket_event> };
-type server = { ctx: ctx, server: aio::server,
-               evt: _port<aio::server_event> };
+type client = {ctx: ctx, client: aio::client, evt: _port<aio::socket_event>};
+type server = {ctx: ctx, server: aio::server, evt: _port<aio::server_event>};
 
-fn new() -> ctx {
-    ret aio::new();
-}
+fn new() -> ctx { ret aio::new(); }
 
-fn destroy(ctx: ctx) {
-    send(ctx, aio::quit);
-}
+fn destroy(ctx: ctx) { send(ctx, aio::quit); }
 
 fn make_socket(ctx: ctx, p: _port<aio::socket_event>) -> client {
     let evt: aio::socket_event = p.recv();
     alt evt {
-      aio::connected(client) {
-        ret { ctx: ctx, client: client, evt: p };
-      }
+      aio::connected(client) { ret {ctx: ctx, client: client, evt: p}; }
       _ { fail "Could not connect to client"; }
     }
 }
@@ -38,22 +30,17 @@ fn connect_to(ctx: ctx, ip: net::ip_addr, portnum: int) -> client {
 
 fn read(c: client) -> [u8] {
     alt c.evt.recv() {
-        aio::closed. {
-            ret ~[];
-        }
-        aio::received(buf) {
-            ret buf;
-        }
+      aio::closed. { ret []; }
+      aio::received(buf) { ret buf; }
     }
 }
 
 fn create_server(ctx: ctx, ip: net::ip_addr, portnum: int) -> server {
     let evt: _port<aio::server_event> = mk_port();
     let p: _port<aio::server> = mk_port();
-    send(ctx, aio::serve(ip, portnum,
-                         evt.mk_chan(), p.mk_chan()));
+    send(ctx, aio::serve(ip, portnum, evt.mk_chan(), p.mk_chan()));
     let srv: aio::server = p.recv();
-    ret { ctx: ctx, server: srv, evt: evt };
+    ret {ctx: ctx, server: srv, evt: evt};
 }
 
 fn accept_from(server: server) -> client {
@@ -85,15 +72,8 @@ fn close_server(server: server) {
 fn close_client(client: client) {
     send(client.ctx, aio::close_client(client.client));
     let evt: aio::socket_event;
-    do {
-        evt = client.evt.recv();
-        alt evt {
-          aio::closed. {
-            ret;
-          }
-          _ {}
-        }
-    } while (true);
+    do  { evt = client.evt.recv(); alt evt { aio::closed. { ret; } _ { } } }
+        while true
 }
 
 // Local Variables:
diff --git a/src/lib/smallintmap.rs b/src/lib/smallintmap.rs
index 6eca2eccc23..d5dcd6bcc78 100644
--- a/src/lib/smallintmap.rs
+++ b/src/lib/smallintmap.rs
@@ -10,7 +10,7 @@ import option::some;
 type smallintmap<T> = @{mutable v: [mutable option::t<T>]};
 
 fn mk<@T>() -> smallintmap<T> {
-    let v: [mutable option::t<T>] = ~[mutable];
+    let v: [mutable option::t<T>] = [mutable];
     ret @{mutable v: v};
 }
 
@@ -19,7 +19,7 @@ fn insert<@T>(m: &smallintmap<T>, key: uint, val: &T) {
 }
 
 fn find<@T>(m: &smallintmap<T>, key: uint) -> option::t<T> {
-    if key < vec::len::<option::t<T>>(m.v) { ret m.v.(key); }
+    if key < vec::len::<option::t<T>>(m.v) { ret m.v[key]; }
     ret none::<T>;
 }
 
diff --git a/src/lib/sort.rs b/src/lib/sort.rs
index 137cf0495ca..2a43bde42be 100644
--- a/src/lib/sort.rs
+++ b/src/lib/sort.rs
@@ -6,20 +6,20 @@ export merge_sort;
 export quick_sort;
 export quick_sort3;
 
-type lteq<T> = block(&T, &T) -> bool ;
+type lteq<T> = block(&T, &T) -> bool;
 
 fn merge_sort<@T>(le: &lteq<T>, v: &[T]) -> [T] {
     fn merge<@T>(le: &lteq<T>, a: &[T], b: &[T]) -> [T] {
-        let rs: [T] = ~[];
+        let rs: [T] = [];
         let a_len: uint = len::<T>(a);
         let a_ix: uint = 0u;
         let b_len: uint = len::<T>(b);
         let b_ix: uint = 0u;
         while a_ix < a_len && b_ix < b_len {
-            if le(a.(a_ix), b.(b_ix)) {
-                rs += ~[a.(a_ix)];
+            if le(a[a_ix], b[b_ix]) {
+                rs += [a[a_ix]];
                 a_ix += 1u;
-            } else { rs += ~[b.(b_ix)]; b_ix += 1u; }
+            } else { rs += [b[b_ix]]; b_ix += 1u; }
         }
         rs += slice::<T>(a, a_ix, a_len);
         rs += slice::<T>(b, b_ix, b_len);
@@ -34,19 +34,19 @@ fn merge_sort<@T>(le: &lteq<T>, v: &[T]) -> [T] {
 }
 
 fn swap<@T>(arr: &[mutable T], x: uint, y: uint) {
-    let a = arr.(x);
-    arr.(x) = arr.(y);
-    arr.(y) = a;
+    let a = arr[x];
+    arr[x] = arr[y];
+    arr[y] = a;
 }
 
 fn part<@T>(compare_func: &lteq<T>, arr: &[mutable T], left: uint,
             right: uint, pivot: uint) -> uint {
-    let pivot_value = arr.(pivot);
+    let pivot_value = arr[pivot];
     swap::<T>(arr, pivot, right);
     let storage_index: uint = left;
     let i: uint = left;
     while i < right {
-        if compare_func({ arr.(i) }, pivot_value) {
+        if compare_func({ arr[i] }, pivot_value) {
             swap::<T>(arr, i, storage_index);
             storage_index += 1u;
         }
@@ -82,26 +82,26 @@ fn quick_sort<@T>(compare_func: &lteq<T>, arr: &[mutable T]) {
 fn qsort3<@T>(compare_func_lt: &lteq<T>, compare_func_eq: &lteq<T>,
               arr: &[mutable T], left: int, right: int) {
     if right <= left { ret; }
-    let v: T = arr.(right);
+    let v: T = arr[right];
     let i: int = left - 1;
     let j: int = right;
     let p: int = i;
     let q: int = j;
     while true {
         i += 1;
-        while compare_func_lt({ arr.(i) }, v) { i += 1; }
+        while compare_func_lt({ arr[i] }, v) { i += 1; }
         j -= 1;
-        while compare_func_lt(v, { arr.(j) }) {
+        while compare_func_lt(v, { arr[j] }) {
             if j == left { break; }
             j -= 1;
         }
         if i >= j { break; }
         swap::<T>(arr, i as uint, j as uint);
-        if compare_func_eq({ arr.(i) }, v) {
+        if compare_func_eq({ arr[i] }, v) {
             p += 1;
             swap::<T>(arr, p as uint, i as uint);
         }
-        if compare_func_eq(v, { arr.(j) }) {
+        if compare_func_eq(v, { arr[j] }) {
             q -= 1;
             swap::<T>(arr, j as uint, q as uint);
         }
@@ -131,7 +131,7 @@ fn quick_sort3<@T>(compare_func_lt: &lteq<T>, compare_func_eq: &lteq<T>,
                    arr: &[mutable T]) {
     if len::<T>(arr) == 0u { ret; }
     qsort3::<T>(compare_func_lt, compare_func_eq, arr, 0,
-              (len::<T>(arr) as int) - 1);
+                (len::<T>(arr) as int) - 1);
 }
 
 // Local Variables:
diff --git a/src/lib/str.rs b/src/lib/str.rs
index df9f6817343..98e59f70b4f 100644
--- a/src/lib/str.rs
+++ b/src/lib/str.rs
@@ -73,8 +73,8 @@ fn eq(a: &str, b: &str) -> bool {
     if byte_len(b) != i { ret false; }
     while i > 0u {
         i -= 1u;
-        let cha = a.(i);
-        let chb = b.(i);
+        let cha = a[i];
+        let chb = b[i];
         if cha != chb { ret false; }
     }
     ret true;
@@ -87,9 +87,9 @@ fn lteq(a: &str, b: &str) -> bool {
     if j < n { n = j; }
     let x: uint = 0u;
     while x < n {
-        let cha = a.(x);
-        let chb = b.(x);
-        if cha < chb { ret true; } else if (cha > chb) { ret false; }
+        let cha = a[x];
+        let chb = b[x];
+        if cha < chb { ret true; } else if cha > chb { ret false; }
         x += 1u;
     }
     ret i <= j;
@@ -134,12 +134,12 @@ fn is_utf8(v: &[u8]) -> bool {
     let i = 0u;
     let total = vec::len::<u8>(v);
     while i < total {
-        let chsize = utf8_char_width(v.(i));
+        let chsize = utf8_char_width(v[i]);
         if chsize == 0u { ret false; }
         if i + chsize > total { ret false; }
         i += 1u;
         while chsize > 1u {
-            if v.(i) & 192u8 != tag_cont_u8 { ret false; }
+            if v[i] & 192u8 != tag_cont_u8 { ret false; }
             i += 1u;
             chsize -= 1u;
         }
@@ -149,7 +149,7 @@ fn is_utf8(v: &[u8]) -> bool {
 
 fn is_ascii(s: str) -> bool {
     let i: uint = byte_len(s);
-    while i > 0u { i -= 1u; if s.(i) & 128u8 != 0u8 { ret false; } }
+    while i > 0u { i -= 1u; if s[i] & 128u8 != 0u8 { ret false; } }
     ret true;
 }
 
@@ -165,9 +165,7 @@ fn is_whitespace(s: str) -> bool {
     let i = 0u;
     let len = char_len(s);
     while i < len {
-        if !char::is_whitespace(char_at(s, i)) {
-            ret false;
-        }
+        if !char::is_whitespace(char_at(s, i)) { ret false; }
         i += 1u
     }
     ret true;
@@ -192,7 +190,7 @@ fn unsafe_from_bytes(v: &[mutable? u8]) -> str {
     ret rustrt::str_from_ivec(v);
 }
 
-fn unsafe_from_byte(u: u8) -> str { ret rustrt::str_from_ivec(~[u]); }
+fn unsafe_from_byte(u: u8) -> str { ret rustrt::str_from_ivec([u]); }
 
 fn str_from_cstr(cstr: sbuf) -> str { ret rustrt::str_from_cstr(cstr); }
 
@@ -204,19 +202,19 @@ fn push_utf8_bytes(s: &mutable str, ch: char) {
     let code = ch as uint;
     if code < max_one_b {
         s = rustrt::str_push_byte(s, code);
-    } else if (code < max_two_b) {
+    } else if code < max_two_b {
         s = rustrt::str_push_byte(s, code >> 6u & 31u | tag_two_b);
         s = rustrt::str_push_byte(s, code & 63u | tag_cont);
-    } else if (code < max_three_b) {
+    } else if code < max_three_b {
         s = rustrt::str_push_byte(s, code >> 12u & 15u | tag_three_b);
         s = rustrt::str_push_byte(s, code >> 6u & 63u | tag_cont);
         s = rustrt::str_push_byte(s, code & 63u | tag_cont);
-    } else if (code < max_four_b) {
+    } else if code < max_four_b {
         s = rustrt::str_push_byte(s, code >> 18u & 7u | tag_four_b);
         s = rustrt::str_push_byte(s, code >> 12u & 63u | tag_cont);
         s = rustrt::str_push_byte(s, code >> 6u & 63u | tag_cont);
         s = rustrt::str_push_byte(s, code & 63u | tag_cont);
-    } else if (code < max_five_b) {
+    } else if code < max_five_b {
         s = rustrt::str_push_byte(s, code >> 24u & 3u | tag_five_b);
         s = rustrt::str_push_byte(s, code >> 18u & 63u | tag_cont);
         s = rustrt::str_push_byte(s, code >> 12u & 63u | tag_cont);
@@ -259,7 +257,7 @@ fn utf8_char_width(b: u8) -> uint {
 }
 
 fn char_range_at(s: str, i: uint) -> {ch: char, next: uint} {
-    let b0 = s.(i);
+    let b0 = s[i];
     let w = utf8_char_width(b0);
     assert (w != 0u);
     if w == 1u { ret {ch: b0 as char, next: i + 1u}; }
@@ -267,7 +265,7 @@ fn char_range_at(s: str, i: uint) -> {ch: char, next: uint} {
     let end = i + w;
     i += 1u;
     while i < end {
-        let byte = s.(i);
+        let byte = s[i];
         assert (byte & 192u8 == tag_cont_u8);
         val <<= 6u;
         val += byte & 63u8 as uint;
@@ -288,7 +286,7 @@ fn char_len(s: str) -> uint {
     let len = 0u;
     let total = byte_len(s);
     while i < total {
-        let chsize = utf8_char_width(s.(i));
+        let chsize = utf8_char_width(s[i]);
         assert (chsize > 0u);
         len += 1u;
         i += chsize;
@@ -298,12 +296,12 @@ fn char_len(s: str) -> uint {
 }
 
 fn to_chars(s: str) -> [char] {
-    let buf: [char] = ~[];
+    let buf: [char] = [];
     let i = 0u;
     let len = byte_len(s);
     while i < len {
         let cur = char_range_at(s, i);
-        buf += ~[cur.ch];
+        buf += [cur.ch];
         i = cur.next;
     }
     ret buf;
@@ -313,7 +311,7 @@ fn push_char(s: &mutable str, ch: char) { s += from_char(ch); }
 
 fn pop_char(s: &mutable str) -> char {
     let end = byte_len(s);
-    while end > 0u && s.(end - 1u) & 192u8 == tag_cont_u8 { end -= 1u; }
+    while end > 0u && s[end - 1u] & 192u8 == tag_cont_u8 { end -= 1u; }
     assert (end > 0u);
     let ch = char_at(s, end - 1u);
     s = substr(s, 0u, end - 1u);
@@ -343,7 +341,7 @@ fn index(s: str, c: u8) -> int {
 
 fn rindex(s: str, c: u8) -> int {
     let n: int = str::byte_len(s) as int;
-    while n >= 0 { if s.(n) == c { ret n; } n -= 1; }
+    while n >= 0 { if s[n] == c { ret n; } n -= 1; }
     ret n;
 }
 
@@ -353,7 +351,7 @@ fn find(haystack: str, needle: str) -> int {
     if needle_len == 0 { ret 0; }
     fn match_at(haystack: &str, needle: &str, i: int) -> bool {
         let j: int = i;
-        for c: u8 in needle { if haystack.(j) != c { ret false; } j += 1; }
+        for c: u8 in needle { if haystack[j] != c { ret false; } j += 1; }
         ret true;
     }
     let i: int = 0;
@@ -377,7 +375,7 @@ fn ends_with(haystack: str, needle: str) -> bool {
     let needle_len: uint = byte_len(needle);
     ret if needle_len == 0u {
             true
-        } else if (needle_len > haystack_len) {
+        } else if needle_len > haystack_len {
             false
         } else {
             eq(substr(haystack, haystack_len - needle_len, needle_len),
@@ -397,18 +395,19 @@ fn slice(s: str, begin: uint, end: uint) -> str {
     ret rustrt::str_slice(s, begin, end);
 }
 
-fn safe_slice(s: str, begin: uint, end: uint): le(begin, end) -> str {
+fn safe_slice(s: str, begin: uint, end: uint) : le(begin, end) -> str {
     assert (end <=
                 str::byte_len(s)); // would need some magic to
                                    // make this a precondition
 
+
     ret rustrt::str_slice(s, begin, end);
 }
 
 fn shift_byte(s: &mutable str) -> u8 {
     let len = byte_len(s);
     assert (len > 0u);
-    let b = s.(0);
+    let b = s[0];
     s = substr(s, 1u, len - 1u);
     ret b;
 }
@@ -416,7 +415,7 @@ fn shift_byte(s: &mutable str) -> u8 {
 fn pop_byte(s: &mutable str) -> u8 {
     let len = byte_len(s);
     assert (len > 0u);
-    let b = s.(len - 1u);
+    let b = s[len - 1u];
     s = substr(s, 0u, len - 1u);
     ret b;
 }
@@ -433,17 +432,17 @@ fn unshift_byte(s: &mutable str, b: u8) {
 }
 
 fn split(s: str, sep: u8) -> [str] {
-    let v: [str] = ~[];
+    let v: [str] = [];
     let accum: str = "";
     let ends_with_sep: bool = false;
     for c: u8 in s {
         if c == sep {
-            v += ~[accum];
+            v += [accum];
             accum = "";
             ends_with_sep = true;
         } else { accum += unsafe_from_byte(c); ends_with_sep = false; }
     }
-    if str::byte_len(accum) != 0u || ends_with_sep { v += ~[accum]; }
+    if str::byte_len(accum) != 0u || ends_with_sep { v += [accum]; }
     ret v;
 }
 
@@ -486,10 +485,10 @@ fn replace(s: str, from: str, to: str) : is_not_empty(from) -> str {
     check (is_not_empty(from));
     if byte_len(s) == 0u {
         ret "";
-    } else if (starts_with(s, from)) {
+    } else if starts_with(s, from) {
         ret to + replace(slice(s, byte_len(from), byte_len(s)), from, to);
     } else {
-        ret unsafe_from_byte(s.(0)) +
+        ret unsafe_from_byte(s[0]) +
                 replace(slice(s, 1u, byte_len(s)), from, to);
     }
 }
@@ -503,9 +502,7 @@ fn trim_left(s: &str) -> str {
     fn count_whities(s: &[char]) -> uint {
         let i = 0u;
         while i < vec::len(s) {
-            if !char::is_whitespace(s.(i)) {
-                break;
-            }
+            if !char::is_whitespace(s[i]) { break; }
             i += 1u;
         }
         ret i;
@@ -519,9 +516,7 @@ fn trim_right(s: &str) -> str {
     fn count_whities(s: &[char]) -> uint {
         let i = vec::len(s);
         while 0u < i {
-            if !char::is_whitespace(s.(i - 1u)) {
-                break;
-            }
+            if !char::is_whitespace(s[i - 1u]) { break; }
             i -= 1u;
         }
         ret i;
@@ -531,9 +526,7 @@ fn trim_right(s: &str) -> str {
     ret from_chars(vec::slice(chars, 0u, whities));
 }
 
-fn trim(s: &str) -> str {
-    trim_left(trim_right(s))
-}
+fn trim(s: &str) -> str { trim_left(trim_right(s)) }
 
 // Local Variables:
 // mode: rust;
diff --git a/src/lib/task.rs b/src/lib/task.rs
index 9ed8e8ecdf0..fd971b27477 100644
--- a/src/lib/task.rs
+++ b/src/lib/task.rs
@@ -19,43 +19,35 @@ native "rust" mod rustrt {
     fn set_min_stack(stack_size: uint);
 
     fn new_task() -> task_id;
-    fn drop_task(task : *rust_task);
-    fn get_task_pointer(id : task_id) -> *rust_task;
-    fn start_task(id : task_id);
+    fn drop_task(task: *rust_task);
+    fn get_task_pointer(id: task_id) -> *rust_task;
+    fn start_task(id: task_id);
     fn get_task_trampoline() -> u32;
 
-    fn migrate_alloc(alloc : *u8, target : task_id);
+    fn migrate_alloc(alloc: *u8, target: task_id);
 
-    fn leak<@T>(thing : -T);
+    fn leak<@T>(thing: -T);
 }
 
-type rust_task = {
-    id : task,
-    mutable notify_enabled : u8,
-    mutable notify_chan : comm::chan_handle<task_notification>,
-    ctx : task_context,
-    stack_ptr : *u8
-};
-
-type task_context = {
-    regs : x86_registers,
-    next : *u8
-};
-
-resource rust_task_ptr(task : *rust_task) {
-    rustrt::drop_task(task);
-}
+type rust_task =
+    {id: task,
+     mutable notify_enabled: u8,
+     mutable notify_chan: comm::chan_handle<task_notification>,
+     ctx: task_context,
+     stack_ptr: *u8};
+
+type task_context = {regs: x86_registers, next: *u8};
+
+resource rust_task_ptr(task: *rust_task) { rustrt::drop_task(task); }
 
-fn get_task_ptr(id : task) -> rust_task_ptr {
+fn get_task_ptr(id: task) -> rust_task_ptr {
     ret rust_task_ptr(rustrt::get_task_pointer(id));
 }
 
 type task = int;
 type task_id = task;
 
-fn get_task_id() -> task_id {
-    rustrt::get_task_id()
-}
+fn get_task_id() -> task_id { rustrt::get_task_id() }
 
 /**
  * Hints the scheduler to yield this task for a specified ammount of time.
@@ -68,22 +60,20 @@ fn yield() { ret rustrt::task_yield(); }
 
 tag task_result { tr_success; tr_failure; }
 
-tag task_notification {
-    exit(task, task_result);
-}
+tag task_notification { exit(task, task_result); }
 
-fn join(task_port : (task_id, comm::port<task_notification>))
-    -> task_result {
+fn join(task_port: (task_id, comm::port<task_notification>)) -> task_result {
     let (id, port) = task_port;
     alt comm::recv::<task_notification>(port) {
       exit(_id, res) {
-        if _id == id { ret res }
-        else { fail #fmt("join received id %d, expected %d", _id, id) }
+        if _id == id {
+            ret res
+        } else { fail #fmt["join received id %d, expected %d", _id, id] }
       }
     }
 }
 
-fn join_id(t : task_id) -> task_result {
+fn join_id(t: task_id) -> task_result {
     alt rustrt::task_join(t) { 0 { tr_success } _ { tr_failure } }
 }
 
@@ -93,33 +83,25 @@ fn pin() { rustrt::pin_task(); }
 
 fn unpin() { rustrt::unpin_task(); }
 
-fn set_min_stack(stack_size : uint) {
-    rustrt::set_min_stack(stack_size);
-}
+fn set_min_stack(stack_size: uint) { rustrt::set_min_stack(stack_size); }
 
-fn _spawn(thunk : -fn() -> ()) -> task {
-    spawn(thunk)
-}
+fn _spawn(thunk: -fn()) -> task { spawn(thunk) }
 
-fn spawn(thunk : -fn() -> ()) -> task {
-    spawn_inner(thunk, none)
-}
+fn spawn(thunk: -fn()) -> task { spawn_inner(thunk, none) }
 
-fn spawn_notify(thunk : -fn() -> (), notify : comm::chan<task_notification>)
-    -> task {
+fn spawn_notify(thunk: -fn(), notify: comm::chan<task_notification>) -> task {
     spawn_inner(thunk, some(notify))
 }
 
-fn spawn_joinable(thunk : -fn()) -> (task_id, comm::port<task_notification>) {
+fn spawn_joinable(thunk: -fn()) -> (task_id, comm::port<task_notification>) {
     let p = comm::port::<task_notification>();
     let id = spawn_notify(thunk, comm::chan::<task_notification>(p));
     ret (id, p);
 }
 
 // FIXME: make this a fn~ once those are supported.
-fn spawn_inner(thunk : -fn() -> (),
-               notify : option<comm::chan<task_notification>>)
-    -> task_id {
+fn spawn_inner(thunk: -fn(), notify: option<comm::chan<task_notification>>) ->
+   task_id {
     let id = rustrt::new_task();
 
     // the order of arguments are outptr, taskptr, envptr.
@@ -129,21 +111,21 @@ fn spawn_inner(thunk : -fn() -> (),
     // set up the task pointer
     let task_ptr = get_task_ptr(id);
     let regs = ptr::addr_of((**task_ptr).ctx.regs);
-    (*regs).edx = cast(*task_ptr);
+    (*regs).edx = cast(*task_ptr);;
     (*regs).esp = cast((**task_ptr).stack_ptr);
 
-    assert ptr::null() != (**task_ptr).stack_ptr;
+    assert (ptr::null() != (**task_ptr).stack_ptr);
 
-    let raw_thunk : { code: u32, env: u32 } = cast(thunk);
+    let raw_thunk: {code: u32, env: u32} = cast(thunk);
     (*regs).eip = raw_thunk.code;
 
     // set up notifications if they are enabled.
     alt notify {
       some(c) {
-        (**task_ptr).notify_enabled = 1u8;
+        (**task_ptr).notify_enabled = 1u8;;
         (**task_ptr).notify_chan = *c;
       }
-      none {}
+      none { }
     };
 
     // okay, now we align the stack and add the environment pointer and a fake
@@ -153,15 +135,15 @@ fn spawn_inner(thunk : -fn() -> (),
     // -4 for the return address.
     (*regs).esp = align_down((*regs).esp - 12u32) - 4u32;
 
-    let ra : *mutable u32 = cast((*regs).esp);
-    let env : *mutable u32 = cast((*regs).esp+4u32);
-    let tptr : *mutable u32 = cast((*regs).esp+12u32);
+    let ra: *mutable u32 = cast((*regs).esp);
+    let env: *mutable u32 = cast((*regs).esp + 4u32);
+    let tptr: *mutable u32 = cast((*regs).esp + 12u32);
 
     // put the return pointer in ecx.
-    (*regs).ecx = (*regs).esp + 8u32;
+    (*regs).ecx = (*regs).esp + 8u32;;
 
-    *tptr = cast(*task_ptr);
-    *env = raw_thunk.env;
+    *tptr = cast(*task_ptr);;
+    *env = raw_thunk.env;;
     *ra = rustrt::get_task_trampoline();
 
     rustrt::migrate_alloc(cast(raw_thunk.env), id);
@@ -173,31 +155,31 @@ fn spawn_inner(thunk : -fn() -> (),
 }
 
 // Who says we can't write an operating system in Rust?
-type x86_registers = {
+type x86_registers =
     // This needs to match the structure in context.h
-    mutable eax : u32,
-    mutable ebx : u32,
-    mutable ecx : u32,
-    mutable edx : u32,
-    mutable ebp : u32,
-    mutable esi : u32,
-    mutable edi : u32,
-    mutable esp : u32,
-
-    mutable cs : u16,
-    mutable ds : u16,
-    mutable ss : u16,
-    mutable es : u16,
-    mutable fs : u16,
-    mutable gs : u16,
-
-    mutable eflags : u32,
-    mutable eip : u32
-};
-
-fn align_down(x : u32) -> u32 {
+
+
+    {mutable eax: u32,
+     mutable ebx: u32,
+     mutable ecx: u32,
+     mutable edx: u32,
+     mutable ebp: u32,
+     mutable esi: u32,
+     mutable edi: u32,
+     mutable esp: u32,
+     mutable cs: u16,
+     mutable ds: u16,
+     mutable ss: u16,
+     mutable es: u16,
+     mutable fs: u16,
+     mutable gs: u16,
+     mutable eflags: u32,
+     mutable eip: u32};
+
+fn align_down(x: u32) -> u32 {
+
     // Aligns x down to 16 bytes
-    x & !(15u32)
+    x & !15u32
 }
 
 // Local Variables:
diff --git a/src/lib/term.rs b/src/lib/term.rs
index 8891a9ddadd..cfec5ff6b8f 100644
--- a/src/lib/term.rs
+++ b/src/lib/term.rs
@@ -40,15 +40,15 @@ const color_bright_cyan: u8 = 14u8;
 
 const color_bright_white: u8 = 15u8;
 
-fn esc(writer: io::buf_writer) { writer.write(~[0x1bu8, '[' as u8]); }
+fn esc(writer: io::buf_writer) { writer.write([0x1bu8, '[' as u8]); }
 
 fn reset(writer: io::buf_writer) {
     esc(writer);
-    writer.write(~['0' as u8, 'm' as u8]);
+    writer.write(['0' as u8, 'm' as u8]);
 }
 
 fn color_supported() -> bool {
-    let supported_terms = ~["xterm-color", "xterm", "screen-bce"];
+    let supported_terms = ["xterm-color", "xterm", "screen-bce"];
     ret alt generic_os::getenv("TERM") {
           option::some(env) {
             for term: str in supported_terms {
@@ -63,8 +63,8 @@ fn color_supported() -> bool {
 fn set_color(writer: io::buf_writer, first_char: u8, color: u8) {
     assert (color < 16u8);
     esc(writer);
-    if color >= 8u8 { writer.write(~['1' as u8, ';' as u8]); color -= 8u8; }
-    writer.write(~[first_char, ('0' as u8) + color, 'm' as u8]);
+    if color >= 8u8 { writer.write(['1' as u8, ';' as u8]); color -= 8u8; }
+    writer.write([first_char, ('0' as u8) + color, 'm' as u8]);
 }
 
 fn fg(writer: io::buf_writer, color: u8) {
diff --git a/src/lib/test.rs b/src/lib/test.rs
index b725507502b..72e5eb75597 100644
--- a/src/lib/test.rs
+++ b/src/lib/test.rs
@@ -41,7 +41,7 @@ type test_name = str;
 // the test succeeds; if the function fails then the test fails. We
 // may need to come up with a more clever definition of test in order
 // to support isolation of tests into tasks.
-type test_fn = fn() ;
+type test_fn = fn();
 
 // The definition of a single test. A test runner will run a list of
 // these.
@@ -69,7 +69,7 @@ fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res {
     // FIXME (#649): Shouldn't have to check here
     check (vec::is_not_empty(args));
     let args_ = vec::tail(args);
-    let opts = ~[getopts::optflag("ignored")];
+    let opts = [getopts::optflag("ignored")];
     let match =
         alt getopts::getopts(args_, opts) {
           getopts::success(m) { m }
@@ -78,7 +78,7 @@ fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res {
 
     let filter =
         if vec::len(match.free) > 0u {
-            option::some(match.free.(0))
+            option::some(match.free[0])
         } else { option::none };
 
     let run_ignored = getopts::opt_present(match, "ignored");
@@ -106,25 +106,22 @@ fn run_tests_console(opts: &test_opts, tests: &[test_desc]) -> bool {
 fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
                       to_task: &test_to_task) -> bool {
 
-    type test_state = @{
-        out: io::writer,
-        use_color: bool,
-        mutable total: uint,
-        mutable passed: uint,
-        mutable failed: uint,
-        mutable ignored: uint,
-        mutable failures: [test_desc]
-    };
+    type test_state =
+        @{out: io::writer,
+          use_color: bool,
+          mutable total: uint,
+          mutable passed: uint,
+          mutable failed: uint,
+          mutable ignored: uint,
+          mutable failures: [test_desc]};
 
     fn callback(event: testevent, st: test_state) {
         alt event {
           te_filtered(filtered_tests) {
             st.total = vec::len(filtered_tests);
-            st.out.write_line(#fmt("\nrunning %u tests", st.total));
-          }
-          te_wait(test) {
-            st.out.write_str(#fmt("test %s ... ", test.name));
+            st.out.write_line(#fmt["\nrunning %u tests", st.total]);
           }
+          te_wait(test) { st.out.write_str(#fmt["test %s ... ", test.name]); }
           te_result(test, result) {
             alt result {
               tr_ok. {
@@ -136,7 +133,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
                 st.failed += 1u;
                 write_failed(st.out, st.use_color);
                 st.out.write_line("");
-                st.failures += ~[test];
+                st.failures += [test];
               }
               tr_ignored. {
                 st.ignored += 1u;
@@ -148,37 +145,35 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
         }
     }
 
-    let st = @{
-        out: io::stdout(),
-        use_color: use_color(),
-        mutable total: 0u,
-        mutable passed: 0u,
-        mutable failed: 0u,
-        mutable ignored: 0u,
-        mutable failures: ~[]
-    };
+    let st =
+        @{out: io::stdout(),
+          use_color: use_color(),
+          mutable total: 0u,
+          mutable passed: 0u,
+          mutable failed: 0u,
+          mutable ignored: 0u,
+          mutable failures: []};
 
-    run_tests(opts, tests, to_task,
-              bind callback(_, st));
+    run_tests(opts, tests, to_task, bind callback(_, st));
 
-    assert st.passed + st.failed + st.ignored == st.total;
+    assert (st.passed + st.failed + st.ignored == st.total);
     let success = st.failed == 0u;
 
     if !success {
         st.out.write_line("\nfailures:");
         for test: test_desc in st.failures {
             let testname = test.name; // Satisfy alias analysis
-            st.out.write_line(#fmt("    %s", testname));
+            st.out.write_line(#fmt["    %s", testname]);
         }
     }
 
-    st.out.write_str(#fmt("\nresult: "));
+    st.out.write_str(#fmt["\nresult: "]);
     if success {
         // There's no parallelism at this point so it's safe to use color
         write_ok(st.out, true);
     } else { write_failed(st.out, true); }
-    st.out.write_str(#fmt(". %u passed; %u failed; %u ignored\n\n",
-                       st.passed, st.failed, st.ignored));
+    st.out.write_str(#fmt[". %u passed; %u failed; %u ignored\n\n", st.passed,
+                          st.failed, st.ignored]);
 
     ret success;
 
@@ -206,9 +201,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
     }
 }
 
-fn use_color() -> bool {
-    ret get_concurrency() == 1u;
-}
+fn use_color() -> bool { ret get_concurrency() == 1u; }
 
 tag testevent {
     te_filtered([test_desc]);
@@ -216,8 +209,8 @@ tag testevent {
     te_result(test_desc, test_result);
 }
 
-fn run_tests(opts: &test_opts, tests: &[test_desc],
-             to_task: &test_to_task, callback: fn(testevent)) {
+fn run_tests(opts: &test_opts, tests: &[test_desc], to_task: &test_to_task,
+             callback: fn(testevent)) {
 
     let filtered_tests = filter_tests(opts, tests);
 
@@ -227,19 +220,19 @@ fn run_tests(opts: &test_opts, tests: &[test_desc],
     // provide a great user experience because you might sit waiting for the
     // result of a particular test for an unusually long amount of time.
     let concurrency = get_concurrency();
-    log #fmt("using %u test tasks", concurrency);
+    log #fmt["using %u test tasks", concurrency];
     let total = vec::len(filtered_tests);
     let run_idx = 0u;
     let wait_idx = 0u;
-    let futures = ~[];
+    let futures = [];
 
     while wait_idx < total {
         while vec::len(futures) < concurrency && run_idx < total {
-            futures += ~[run_test(filtered_tests.(run_idx), to_task)];
+            futures += [run_test(filtered_tests[run_idx], to_task)];
             run_idx += 1u;
         }
 
-        let future = futures.(0);
+        let future = futures[0];
         callback(te_wait(future.test));
         let result = future.wait();
         callback(te_result(future.test, result));
@@ -306,33 +299,26 @@ fn filter_tests(opts: &test_opts, tests: &[test_desc]) -> [test_desc] {
     ret filtered;
 }
 
-type test_future =
-    {test: test_desc, wait: fn() -> test_result };
+type test_future = {test: test_desc, wait: fn() -> test_result};
 
 fn run_test(test: &test_desc, to_task: &test_to_task) -> test_future {
     if !test.ignore {
         let test_task = to_task(test.fn);
         ret {test: test,
              wait:
-             bind fn (test_task: joinable)-> test_result {
-                 alt task::join(test_task) {
-                   task::tr_success. { tr_ok }
-                   task::tr_failure. { tr_failed }
-                 }
-             }(test_task)};
-    } else {
-        ret {test: test,
-             wait: fn () -> test_result { tr_ignored }};
-    }
+                 bind fn (test_task: joinable) -> test_result {
+                          alt task::join(test_task) {
+                            task::tr_success. { tr_ok }
+                            task::tr_failure. { tr_failed }
+                          }
+                      }(test_task)};
+    } else { ret {test: test, wait: fn () -> test_result { tr_ignored }}; }
 }
 
 // We need to run our tests in another task in order to trap test failures.
 // This function only works with functions that don't contain closures.
 fn default_test_to_task(f: &fn()) -> joinable {
-    fn run_task(f: fn()) {
-        configure_test_task();
-        f();
-    }
+    fn run_task(f: fn()) { configure_test_task(); f(); }
     ret task::spawn_joinable(bind run_task(f));
 }
 
diff --git a/src/lib/time.rs b/src/lib/time.rs
index cf8ddfc6323..c92bdb61f30 100644
--- a/src/lib/time.rs
+++ b/src/lib/time.rs
@@ -18,4 +18,4 @@ fn precise_time_ns() -> u64 { let ns = 0u64; rustrt::nano_time(ns); ret ns; }
 
 fn precise_time_s() -> float {
     ret (precise_time_ns() as float) / 1000000000.;
-}
\ No newline at end of file
+}
diff --git a/src/lib/u64.rs b/src/lib/u64.rs
index 12197adaedf..8082f7aef0d 100644
--- a/src/lib/u64.rs
+++ b/src/lib/u64.rs
@@ -33,4 +33,4 @@ fn to_str(n: u64, radix: uint) -> str {
     ret s;
 }
 
-fn str(n: u64) -> str { ret to_str(n, 10u); }
\ No newline at end of file
+fn str(n: u64) -> str { ret to_str(n, 10u); }
diff --git a/src/lib/ufind.rs b/src/lib/ufind.rs
index 12e85a98b7c..f225a2a7ca3 100644
--- a/src/lib/ufind.rs
+++ b/src/lib/ufind.rs
@@ -10,11 +10,11 @@ type node = option::t<uint>;
 
 type ufind = {mutable nodes: [mutable node]};
 
-fn make() -> ufind { ret {mutable nodes: ~[mutable]}; }
+fn make() -> ufind { ret {mutable nodes: [mutable]}; }
 
 fn make_set(ufnd: &ufind) -> uint {
     let idx = vec::len(ufnd.nodes);
-    ufnd.nodes += ~[mutable none::<uint>];
+    ufnd.nodes += [mutable none::<uint>];
     ret idx;
 }
 
@@ -26,7 +26,7 @@ fn grow(ufnd: &ufind, n: uint) {
 }
 
 fn find(ufnd: &ufind, n: uint) -> uint {
-    alt ufnd.nodes.(n) {
+    alt ufnd.nodes[n] {
       none. { ret n; }
       some(m) { let m_ = m; be find(ufnd, m_); }
     }
@@ -36,10 +36,8 @@ fn union(ufnd: &ufind, m: uint, n: uint) {
     let m_root = find(ufnd, m);
     let n_root = find(ufnd, n);
     if m_root < n_root {
-        ufnd.nodes.(n_root) = some::<uint>(m_root);
-    } else if (m_root > n_root) {
-        ufnd.nodes.(m_root) = some::<uint>(n_root);
-    }
+        ufnd.nodes[n_root] = some::<uint>(m_root);
+    } else if m_root > n_root { ufnd.nodes[m_root] = some::<uint>(n_root); }
 }
 
 fn set_count(ufnd: &ufind) -> uint { ret vec::len::<node>(ufnd.nodes); }
diff --git a/src/lib/uint.rs b/src/lib/uint.rs
index 8be0df57fd7..94517b29f27 100644
--- a/src/lib/uint.rs
+++ b/src/lib/uint.rs
@@ -51,7 +51,7 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint {
     let power = 1u;
     let n = 0u;
     while true {
-        n += (buf.(i) - ('0' as u8) as uint) * power;
+        n += (buf[i] - ('0' as u8) as uint) * power;
         power *= radix;
         if i == 0u { ret n; }
         i -= 1u;
@@ -59,9 +59,7 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint {
     fail;
 }
 
-fn from_str(s : &str) -> uint {
-    parse_buf(str::bytes(s), 10u)
-}
+fn from_str(s: &str) -> uint { parse_buf(str::bytes(s), 10u) }
 
 fn to_str(num: uint, radix: uint) -> str {
     let n = num;
@@ -95,7 +93,7 @@ fn to_str(num: uint, radix: uint) -> str {
     }
     let s1: str = "";
     let len: uint = str::byte_len(s);
-    while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s.(len)); }
+    while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s[len]); }
     ret s1;
 }
 fn str(i: uint) -> str { ret to_str(i, 10u); }
diff --git a/src/lib/vec.rs b/src/lib/vec.rs
index a2222dfbf21..dde4fc7505b 100644
--- a/src/lib/vec.rs
+++ b/src/lib/vec.rs
@@ -28,51 +28,51 @@ fn to_ptr<T>(v: &[T]) -> *T { ret rustrt::ivec_to_ptr(v); }
 
 fn len<T>(v: &[mutable? T]) -> uint { ret rusti::ivec_len(v); }
 
-type init_op<T> = fn(uint) -> T ;
+type init_op<T> = fn(uint) -> T;
 
 fn init_fn<@T>(op: &init_op<T>, n_elts: uint) -> [T] {
-    let v = ~[];
+    let v = [];
     reserve(v, n_elts);
     let i: uint = 0u;
-    while i < n_elts { v += ~[op(i)]; i += 1u; }
+    while i < n_elts { v += [op(i)]; i += 1u; }
     ret v;
 }
 
 // TODO: Remove me once we have slots.
 fn init_fn_mut<@T>(op: &init_op<T>, n_elts: uint) -> [mutable T] {
-    let v = ~[mutable];
+    let v = [mutable];
     reserve(v, n_elts);
     let i: uint = 0u;
-    while i < n_elts { v += ~[mutable op(i)]; i += 1u; }
+    while i < n_elts { v += [mutable op(i)]; i += 1u; }
     ret v;
 }
 
 fn init_elt<@T>(t: &T, n_elts: uint) -> [T] {
-    let v = ~[];
+    let v = [];
     reserve(v, n_elts);
     let i: uint = 0u;
-    while i < n_elts { v += ~[t]; i += 1u; }
+    while i < n_elts { v += [t]; i += 1u; }
     ret v;
 }
 
 // TODO: Remove me once we have slots.
 fn init_elt_mut<@T>(t: &T, n_elts: uint) -> [mutable T] {
-    let v = ~[mutable];
+    let v = [mutable];
     reserve(v, n_elts);
     let i: uint = 0u;
-    while i < n_elts { v += ~[mutable t]; i += 1u; }
+    while i < n_elts { v += [mutable t]; i += 1u; }
     ret v;
 }
 
 fn to_mut<@T>(v: &[T]) -> [mutable T] {
-    let vres = ~[mutable];
-    for t: T in v { vres += ~[mutable t]; }
+    let vres = [mutable];
+    for t: T in v { vres += [mutable t]; }
     ret vres;
 }
 
 fn from_mut<@T>(v: &[mutable T]) -> [T] {
-    let vres = ~[];
-    for t: T in v { vres += ~[t]; }
+    let vres = [];
+    for t: T in v { vres += [t]; }
     ret vres;
 }
 
@@ -88,7 +88,7 @@ pred is_not_empty<T>(v: &[mutable? T]) -> bool { ret !is_empty(v); }
 // Accessors
 
 /// Returns the first element of a vector
-fn head<@T>(v: &[mutable? T]) : is_not_empty(v) -> T { ret v.(0); }
+fn head<@T>(v: &[mutable? T]) : is_not_empty(v) -> T { ret v[0]; }
 
 /// Returns all but the first element of a vector
 fn tail<@T>(v: &[mutable? T]) : is_not_empty(v) -> [mutable? T] {
@@ -98,17 +98,17 @@ fn tail<@T>(v: &[mutable? T]) : is_not_empty(v) -> [mutable? T] {
 /// Returns the last element of `v`.
 fn last<@T>(v: &[mutable? T]) -> option::t<T> {
     if len(v) == 0u { ret none; }
-    ret some(v.(len(v) - 1u));
+    ret some(v[len(v) - 1u]);
 }
 
 /// Returns a copy of the elements from [`start`..`end`) from `v`.
 fn slice<@T>(v: &[mutable? T], start: uint, end: uint) -> [T] {
     assert (start <= end);
     assert (end <= len(v));
-    let result = ~[];
+    let result = [];
     reserve(result, end - start);
     let i = start;
-    while i < end { result += ~[v.(i)]; i += 1u; }
+    while i < end { result += [v[i]]; i += 1u; }
     ret result;
 }
 
@@ -116,10 +116,10 @@ fn slice<@T>(v: &[mutable? T], start: uint, end: uint) -> [T] {
 fn slice_mut<@T>(v: &[mutable? T], start: uint, end: uint) -> [mutable T] {
     assert (start <= end);
     assert (end <= len(v));
-    let result = ~[mutable];
+    let result = [mutable];
     reserve(result, end - start);
     let i = start;
-    while i < end { result += ~[mutable v.(i)]; i += 1u; }
+    while i < end { result += [mutable v[i]]; i += 1u; }
     ret result;
 }
 
@@ -129,7 +129,7 @@ fn slice_mut<@T>(v: &[mutable? T], start: uint, end: uint) -> [mutable T] {
 fn shift<@T>(v: &mutable [mutable? T]) -> T {
     let ln = len::<T>(v);
     assert (ln > 0u);
-    let e = v.(0);
+    let e = v[0];
     v = slice::<T>(v, 1u, ln);
     ret e;
 }
@@ -139,7 +139,7 @@ fn pop<@T>(v: &mutable [mutable? T]) -> T {
     let ln = len(v);
     assert (ln > 0u);
     ln -= 1u;
-    let e = v.(ln);
+    let e = v[ln];
     v = slice(v, 0u, ln);
     ret e;
 }
@@ -153,22 +153,22 @@ fn pop<@T>(v: &mutable [mutable? T]) -> T {
 fn grow<@T>(v: &mutable [T], n: uint, initval: &T) {
     reserve(v, next_power_of_two(len(v) + n));
     let i: uint = 0u;
-    while i < n { v += ~[initval]; i += 1u; }
+    while i < n { v += [initval]; i += 1u; }
 }
 
 // TODO: Remove me once we have slots.
 fn grow_mut<@T>(v: &mutable [mutable T], n: uint, initval: &T) {
     reserve(v, next_power_of_two(len(v) + n));
     let i: uint = 0u;
-    while i < n { v += ~[mutable initval]; i += 1u; }
+    while i < n { v += [mutable initval]; i += 1u; }
 }
 
 /// Calls `f` `n` times and appends the results of these calls to the given
 /// vector.
-fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T ) {
+fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T) {
     reserve(v, next_power_of_two(len(v) + n));
     let i: uint = 0u;
-    while i < n { v += ~[init_fn(i)]; i += 1u; }
+    while i < n { v += [init_fn(i)]; i += 1u; }
 }
 
 /// Sets the element at position `index` to `val`. If `index` is past the end
@@ -176,49 +176,48 @@ fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T ) {
 /// intervening space.
 fn grow_set<@T>(v: &mutable [mutable T], index: uint, initval: &T, val: &T) {
     if index >= len(v) { grow_mut(v, index - len(v) + 1u, initval); }
-    v.(index) = val;
+    v[index] = val;
 }
 
 
 // Functional utilities
 
-fn map<@T, @U>(f: &block(&T) -> U , v: &[mutable? T]) -> [U] {
-    let result = ~[];
+fn map<@T, @U>(f: &block(&T) -> U, v: &[mutable? T]) -> [U] {
+    let result = [];
     reserve(result, len(v));
     for elem: T in v {
         let elem2 = elem; // satisfies alias checker
-        result += ~[f(elem2)];
+        result += [f(elem2)];
     }
     ret result;
 }
 
-fn map2<@T, @U, @V>(f: &block(&T, &U) -> V, v0: &[T], v1: &[U])
-    -> [V] {
+fn map2<@T, @U, @V>(f: &block(&T, &U) -> V, v0: &[T], v1: &[U]) -> [V] {
     let v0_len = len::<T>(v0);
     if v0_len != len::<U>(v1) { fail; }
-    let u: [V] = ~[];
+    let u: [V] = [];
     let i = 0u;
-    while i < v0_len { u += ~[f({ v0.(i) }, { v1.(i) })]; i += 1u; }
+    while i < v0_len { u += [f({ v0[i] }, { v1[i] })]; i += 1u; }
     ret u;
 }
 
-fn filter_map<@T, @U>(f: &block(&T) -> option::t<U>,
-                      v: &[mutable? T]) -> [U] {
-    let result = ~[];
+fn filter_map<@T, @U>(f: &block(&T) -> option::t<U>, v: &[mutable? T]) ->
+   [U] {
+    let result = [];
     for elem: T in v {
         let elem2 = elem; // satisfies alias checker
         alt f(elem2) {
           none. {/* no-op */ }
-          some(result_elem) { result += ~[result_elem]; }
+          some(result_elem) { result += [result_elem]; }
         }
     }
     ret result;
 }
 
-fn foldl<@T, @U>(p: &block(&U, &T) -> U , z: &U, v: &[mutable? T]) -> U {
+fn foldl<@T, @U>(p: &block(&U, &T) -> U, z: &U, v: &[mutable? T]) -> U {
     let sz = len(v);
     if sz == 0u { ret z; }
-    let first = v.(0);
+    let first = v[0];
     let rest = slice(v, 1u, sz);
     ret p(foldl(p, z, rest), first);
 }
@@ -251,42 +250,36 @@ fn find<@T>(f: &block(&T) -> bool, v: &[T]) -> option::t<T> {
 
 fn position<@T>(x: &T, v: &[T]) -> option::t<uint> {
     let i: uint = 0u;
-    while i < len(v) { if x == v.(i) { ret some::<uint>(i); } i += 1u; }
+    while i < len(v) { if x == v[i] { ret some::<uint>(i); } i += 1u; }
     ret none;
 }
 
 fn position_pred<T>(f: fn(&T) -> bool, v: &[T]) -> option::t<uint> {
     let i: uint = 0u;
-    while i < len(v) { if f(v.(i)) { ret some::<uint>(i); } i += 1u; }
+    while i < len(v) { if f(v[i]) { ret some::<uint>(i); } i += 1u; }
     ret none;
 }
 
 fn unzip<@T, @U>(v: &[(T, U)]) -> ([T], [U]) {
-    let as = ~[], bs = ~[];
-    for (a, b) in v {
-        as += ~[a];
-        bs += ~[b];
-    }
+    let as = [], bs = [];
+    for (a, b) in v { as += [a]; bs += [b]; }
     ret (as, bs);
 }
 
 // FIXME make the lengths being equal a constraint
 fn zip<@T, @U>(v: &[T], u: &[U]) -> [(T, U)] {
-    let zipped = ~[];
+    let zipped = [];
     let sz = len(v), i = 0u;
     assert (sz == len(u));
-    while i < sz {
-        zipped += ~[(v.(i), u.(i))];
-        i += 1u;
-    }
+    while i < sz { zipped += [(v[i], u[i])]; i += 1u; }
     ret zipped;
 }
 
 // Swaps two elements in a vector
 fn swap<@T>(v: &[mutable T], a: uint, b: uint) {
-    let t: T = v.(a);
-    v.(a) = v.(b);
-    v.(b) = t;
+    let t: T = v[a];
+    v[a] = v[b];
+    v[b] = t;
 }
 
 // In place vector reversal
@@ -299,11 +292,11 @@ fn reverse<@T>(v: &[mutable T]) {
 
 // Functional vector reversal. Returns a reversed copy of v.
 fn reversed<@T>(v: &[T]) -> [T] {
-    let rs: [T] = ~[];
+    let rs: [T] = [];
     let i = len::<T>(v);
     if i == 0u { ret rs; } else { i -= 1u; }
-    while i != 0u { rs += ~[v.(i)]; i -= 1u; }
-    rs += ~[v.(0)];
+    while i != 0u { rs += [v[i]]; i -= 1u; }
+    rs += [v[0]];
     ret rs;
 }
 
@@ -328,7 +321,7 @@ mod unsafe {
     }
 
     fn from_buf<T>(ptr: *T, bytes: uint) -> [T] {
-        let v = ~[];
+        let v = [];
         copy_from_buf(v, ptr, bytes);
         ret v;
     }
diff --git a/src/lib/win32_fs.rs b/src/lib/win32_fs.rs
index 6a8fe063251..5890e1f4443 100644
--- a/src/lib/win32_fs.rs
+++ b/src/lib/win32_fs.rs
@@ -5,9 +5,7 @@ native "rust" mod rustrt {
     fn rust_file_is_dir(path: str) -> int;
 }
 
-fn list_dir(path: str) -> [str] {
-    ret *rustrt::rust_list_files(path + "*");
-}
+fn list_dir(path: str) -> [str] { ret *rustrt::rust_list_files(path + "*"); }
 
 fn path_is_absolute(p: str) -> bool {
     ret str::char_at(p, 0u) == '/' ||
diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs
index cfd03dfce85..57944b5ff53 100644
--- a/src/lib/win32_os.rs
+++ b/src/lib/win32_os.rs
@@ -30,7 +30,7 @@ mod libc_constants {
     fn O_TRUNC() -> int { ret 512; }
     fn O_TEXT() -> int { ret 16384; }
     fn O_BINARY() -> int { ret 32768; }
-    fn O_NOINHERIT() -> int { ret 0x0080; }
+    fn O_NOINHERIT() -> int { ret 128; }
     fn S_IRUSR() -> uint {
         ret 256u; // really _S_IREAD  in win32
 
@@ -59,12 +59,13 @@ fn pipe() -> {in: int, out: int} {
     // which means to pass it to a subprocess they need to be duplicated
     // first, as in rust_run_program.
     let fds = {mutable in: 0, mutable out: 0};
-    let res = os::libc::_pipe(ptr::addr_of(fds.in), 1024u,
-                            libc_constants::O_BINARY()
-                            | libc_constants::O_NOINHERIT());
-    assert res == 0;
-    assert fds.in != -1 && fds.in != 0;
-    assert fds.out != -1 && fds.in != 0;
+    let res =
+        os::libc::_pipe(ptr::addr_of(fds.in), 1024u,
+                        libc_constants::O_BINARY() |
+                            libc_constants::O_NOINHERIT());
+    assert (res == 0);
+    assert (fds.in != -1 && fds.in != 0);
+    assert (fds.out != -1 && fds.in != 0);
     ret {in: fds.in, out: fds.out};
 }
 
diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs
index cf1989ce294..aa79590a246 100644
--- a/src/test/bench/99bob-iter.rs
+++ b/src/test/bench/99bob-iter.rs
@@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str {
       _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
-        if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); }
+        if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
         i += 1u;
     }
     ret b;
diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs
index 4bbea0c34bd..fdfce9dfae5 100644
--- a/src/test/bench/99bob-pattern.rs
+++ b/src/test/bench/99bob-pattern.rs
@@ -56,4 +56,4 @@ fn main() {
     let b: bottle = multiple(99);
     let running: bool = true;
     while running { show(b); log ""; running = more(b); b = next(b); }
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs
index 205ab67ff9a..2db6321d257 100644
--- a/src/test/bench/99bob-simple.rs
+++ b/src/test/bench/99bob-simple.rs
@@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str {
       _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
-        if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); }
+        if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
         i += 1u;
     }
     ret b;
@@ -45,4 +45,4 @@ fn main() {
     while n > 0 { log sub(b1(), n); log sub(b2(), n - 1); log ""; n -= 1; }
     log b7();
     log sub(b8(), 99);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs
index c68d77fe324..af5e22f48ea 100644
--- a/src/test/bench/99bob-tail.rs
+++ b/src/test/bench/99bob-tail.rs
@@ -36,4 +36,4 @@ fn main() {
         log "";
     }
     multiple(99);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-ackermann.rs b/src/test/bench/shootout-ackermann.rs
index 91e524d0d31..46b8cc443bf 100644
--- a/src/test/bench/shootout-ackermann.rs
+++ b/src/test/bench/shootout-ackermann.rs
@@ -22,4 +22,4 @@ fn main() {
 
     // assert (ack(4,1) == 65533);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-binarytrees.rs b/src/test/bench/shootout-binarytrees.rs
index 0fd77456e2a..d6a44e6eb82 100644
--- a/src/test/bench/shootout-binarytrees.rs
+++ b/src/test/bench/shootout-binarytrees.rs
@@ -28,8 +28,8 @@ fn main() {
     } else { max_depth = n; }
     let stretch_depth = max_depth + 1;
     let stretch_tree = bottom_up_tree(0, stretch_depth);
-    log #fmt("stretch tree of depth %d\t check: %d", stretch_depth,
-             item_check(stretch_tree));
+    log #fmt["stretch tree of depth %d\t check: %d", stretch_depth,
+             item_check(stretch_tree)];
     let long_lived_tree = bottom_up_tree(0, max_depth);
     let depth = min_depth;
     while depth <= max_depth {
@@ -43,10 +43,10 @@ fn main() {
             chk += item_check(temp_tree);
             i += 1;
         }
-        log #fmt("%d\t trees of depth %d\t check: %d", iterations * 2, depth,
-                 chk);
+        log #fmt["%d\t trees of depth %d\t check: %d", iterations * 2, depth,
+                 chk];
         depth += 2;
     }
-    log #fmt("long lived trees of depth %d\t check: %d", max_depth,
-             item_check(long_lived_tree));
-}
\ No newline at end of file
+    log #fmt["long lived trees of depth %d\t check: %d", max_depth,
+             item_check(long_lived_tree)];
+}
diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs
index d4bdbc93b35..8e7b2cbe269 100644
--- a/src/test/bench/shootout-fannkuchredux.rs
+++ b/src/test/bench/shootout-fannkuchredux.rs
@@ -20,21 +20,21 @@ fn fannkuch(n: int) -> int {
     r = n;
     while r > 0 {
         i = 0;
-        while r != 1 { count.(r - 1) = r; r -= 1; }
-        while i < n { perm.(i) = perm1.(i); i += 1; }
+        while r != 1 { count[r - 1] = r; r -= 1; }
+        while i < n { perm[i] = perm1[i]; i += 1; }
         // Count flips and update max and checksum
 
         f = 0;
-        k = perm.(0);
+        k = perm[0];
         while k != 0 {
             i = 0;
             while 2 * i < k {
-                let t = perm.(i);
-                perm.(i) = perm.(k - i);
-                perm.(k - i) = t;
+                let t = perm[i];
+                perm[i] = perm[k - i];
+                perm[k - i] = t;
                 i += 1;
             }
-            k = perm.(0);
+            k = perm[0];
             f += 1;
         }
         if f > flips { flips = f; }
@@ -44,12 +44,12 @@ fn fannkuch(n: int) -> int {
         let go = true;
         while go {
             if r == n { log checksum; ret flips; }
-            let p0 = perm1.(0);
+            let p0 = perm1[0];
             i = 0;
-            while i < r { let j = i + 1; perm1.(i) = perm1.(j); i = j; }
-            perm1.(r) = p0;
-            count.(r) -= 1;
-            if count.(r) > 0 { go = false; } else { r += 1; }
+            while i < r { let j = i + 1; perm1[i] = perm1[j]; i = j; }
+            perm1[r] = p0;
+            count[r] -= 1;
+            if count[r] > 0 { go = false; } else { r += 1; }
         }
         nperm += 1;
     }
@@ -58,5 +58,5 @@ fn fannkuch(n: int) -> int {
 
 fn main(args: [str]) {
     let n = 7;
-    log #fmt("Pfannkuchen(%d) = %d", n, fannkuch(n));
+    log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)];
 }
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index 25a3756346a..80e0108867d 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -25,20 +25,20 @@ type aminoacids = {ch: char, prob: u32};
 
 fn make_cumulative(aa: &[aminoacids]) -> [aminoacids] {
     let cp: u32 = 0u32;
-    let ans: [aminoacids] = ~[];
-    for a: aminoacids in aa { cp += a.prob; ans += ~[{ch: a.ch, prob: cp}]; }
+    let ans: [aminoacids] = [];
+    for a: aminoacids in aa { cp += a.prob; ans += [{ch: a.ch, prob: cp}]; }
     ret ans;
 }
 
 fn select_random(r: u32, genelist: &[aminoacids]) -> char {
-    if r < genelist.(0).prob { ret genelist.(0).ch; }
+    if r < genelist[0].prob { ret genelist[0].ch; }
     fn bisect(v: &[aminoacids], lo: uint, hi: uint, target: u32) -> char {
         if hi > lo + 1u {
             let mid: uint = lo + (hi - lo) / 2u;
-            if target < v.(mid).prob {
+            if target < v[mid].prob {
                 be bisect(v, lo, mid, target);
             } else { be bisect(v, mid, hi, target); }
-        } else { ret v.(hi).ch; }
+        } else { ret v[hi].ch; }
     }
     ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r);
 }
@@ -59,7 +59,7 @@ fn make_repeat_fasta(id: str, desc: str, s: str, n: int) {
     let op: str = "";
     let sl: uint = str::byte_len(s);
     for each i: uint in uint::range(0u, n as uint) {
-        str::push_byte(op, s.(i % sl));
+        str::push_byte(op, s[i % sl]);
         if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
@@ -69,16 +69,14 @@ fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; }
 
 fn main(args: [str]) {
     let iub: [aminoacids] =
-        make_cumulative(
-            ~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
-              acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
-              acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
-              acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
-              acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
+        make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
+                         acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
+                         acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
+                         acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
+                         acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
     let homosapiens: [aminoacids] =
-        make_cumulative(
-            ~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
-              acid('t', 30u32)]);
+        make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
+                         acid('t', 30u32)]);
     let alu: str =
         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
             "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
diff --git a/src/test/bench/shootout-fibo.rs b/src/test/bench/shootout-fibo.rs
index f0a2009b213..a4b5f2588d4 100644
--- a/src/test/bench/shootout-fibo.rs
+++ b/src/test/bench/shootout-fibo.rs
@@ -16,4 +16,4 @@ fn main() {
     assert (fib(15) == 610);
     log fib(8);
     log fib(15);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs
index 7657d058d02..5e888041981 100644
--- a/src/test/bench/shootout-nbody.rs
+++ b/src/test/bench/shootout-nbody.rs
@@ -12,7 +12,7 @@ fn main() {
     // during 'make check' under valgrind
     // 5000000
     // 50000000
-    let inputs: [int] = ~[50000, 500000];
+    let inputs: [int] = [50000, 500000];
 
     let bodies: [Body::props] = NBodySystem::MakeNBodySystem();
 
@@ -34,7 +34,7 @@ mod NBodySystem {
     fn MakeNBodySystem() -> [Body::props] {
         // these each return a Body::props
         let bodies: [Body::props] =
-            ~[Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(),
+            [Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(),
              Body::neptune()];
 
         let px: float = 0.0;
@@ -43,15 +43,15 @@ mod NBodySystem {
 
         let i: int = 0;
         while i < 5 {
-            px += bodies.(i).vx * bodies.(i).mass;
-            py += bodies.(i).vy * bodies.(i).mass;
-            pz += bodies.(i).vz * bodies.(i).mass;
+            px += bodies[i].vx * bodies[i].mass;
+            py += bodies[i].vy * bodies[i].mass;
+            pz += bodies[i].vz * bodies[i].mass;
 
             i += 1;
         }
 
         // side-effecting
-        Body::offsetMomentum(bodies.(0), px, py, pz);
+        Body::offsetMomentum(bodies[0], px, py, pz);
 
         ret bodies;
     }
@@ -61,13 +61,13 @@ mod NBodySystem {
         let i: int = 0;
         while i < 5 {
             let j: int = i + 1;
-            while j < 5 { advance_one(bodies.(i), bodies.(j), dt); j += 1; }
+            while j < 5 { advance_one(bodies[i], bodies[j], dt); j += 1; }
 
             i += 1;
         }
 
         i = 0;
-        while i < 5 { move(bodies.(i), dt); i += 1; }
+        while i < 5 { move(bodies[i], dt); i += 1; }
     }
 
     fn advance_one(bi: &Body::props, bj: &Body::props, dt: float) {
@@ -105,19 +105,18 @@ mod NBodySystem {
         let i: int = 0;
         while i < 5 {
             e +=
-                0.5 * bodies.(i).mass *
-                    (bodies.(i).vx * bodies.(i).vx +
-                         bodies.(i).vy * bodies.(i).vy +
-                         bodies.(i).vz * bodies.(i).vz);
+                0.5 * bodies[i].mass *
+                    (bodies[i].vx * bodies[i].vx + bodies[i].vy * bodies[i].vy
+                         + bodies[i].vz * bodies[i].vz);
 
             let j: int = i + 1;
             while j < 5 {
-                dx = bodies.(i).x - bodies.(j).x;
-                dy = bodies.(i).y - bodies.(j).y;
-                dz = bodies.(i).z - bodies.(j).z;
+                dx = bodies[i].x - bodies[j].x;
+                dy = bodies[i].y - bodies[j].y;
+                dz = bodies[i].z - bodies[j].z;
 
                 distance = llvm::sqrt(dx * dx + dy * dy + dz * dz);
-                e -= bodies.(i).mass * bodies.(j).mass / distance;
+                e -= bodies[i].mass * bodies[j].mass / distance;
 
                 j += 1;
             }
@@ -133,7 +132,7 @@ mod Body {
 
     const PI: float = 3.141592653589793;
     const SOLAR_MASS: float = 39.478417604357432;
-     // was 4 * PI * PI originally
+    // was 4 * PI * PI originally
     const DAYS_PER_YEAR: float = 365.24;
 
     type props =
diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs
index 67cbf77968e..60b54cbe33d 100644
--- a/src/test/bench/shootout-pfib.rs
+++ b/src/test/bench/shootout-pfib.rs
@@ -30,7 +30,7 @@ fn fib(n: int) -> int {
     fn pfib(c: _chan<int>, n: int) {
         if n == 0 {
             send(c, 0);
-        } else if (n <= 2) {
+        } else if n <= 2 {
             send(c, 1);
         } else {
             let p = mk_port::<int>();
@@ -50,7 +50,7 @@ fn fib(n: int) -> int {
 type config = {stress: bool};
 
 fn parse_opts(argv: [str]) -> config {
-    let opts = ~[getopts::optflag("stress")];
+    let opts = [getopts::optflag("stress")];
 
     let opt_args = vec::slice(argv, 1u, vec::len(argv));
 
@@ -67,7 +67,7 @@ fn stress_task(id: int) {
         let n = 15;
         assert (fib(n) == fib(n));
         i += 1;
-        log_err #fmt("%d: Completed %d iterations", id, i);
+        log_err #fmt["%d: Completed %d iterations", id, i];
     }
 }
 
@@ -91,7 +91,7 @@ fn main(argv: [str]) {
         if opts.stress {
             stress(2);
         } else {
-            let max = uint::parse_buf(str::bytes(argv.(1)), 10u) as int;
+            let max = uint::parse_buf(str::bytes(argv[1]), 10u) as int;
 
             let num_trials = 10;
 
@@ -106,8 +106,8 @@ fn main(argv: [str]) {
 
                     let elapsed = stop - start;
 
-                    out.write_line(#fmt("%d\t%d\t%s", n, fibn,
-                                        u64::str(elapsed)));
+                    out.write_line(#fmt["%d\t%d\t%s", n, fibn,
+                                        u64::str(elapsed)]);
                 }
             }
         }
diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs
index 48e1b4d8087..150853e2328 100644
--- a/src/test/bench/task-perf-spawnalot.rs
+++ b/src/test/bench/task-perf-spawnalot.rs
@@ -6,25 +6,17 @@ import std::str;
 
 fn f(n: uint) {
     let i = 0u;
-    while i < n {
-        let thunk = g;
-        task::join_id(task::spawn(thunk));
-        i += 1u;
-    }
+    while i < n { let thunk = g; task::join_id(task::spawn(thunk)); i += 1u; }
 }
 
-fn g() {}
+fn g() { }
 
 fn main(args: [str]) {
 
-    let n = if vec::len(args) < 2u {
-        10u
-    } else {
-        uint::parse_buf(str::bytes(args.(1)), 10u)
-    };
+    let n =
+        if vec::len(args) < 2u {
+            10u
+        } else { uint::parse_buf(str::bytes(args[1]), 10u) };
     let i = 0u;
-    while i < n {
-        task::spawn(bind f(n));
-        i += 1u;
-    }
+    while i < n { task::spawn(bind f(n)); i += 1u; }
 }
diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs
index 54bfae13c23..7d0effb4a7f 100644
--- a/src/test/bench/task-perf-word-count.rs
+++ b/src/test/bench/task-perf-word-count.rs
@@ -42,14 +42,7 @@ fn reduce(word: str, get: map_reduce::getter) {
     let count = 0;
 
 
-    while true {
-        alt get() {
-          some(_) {
-            count += 1;
-          }
-          none. { break }
-        }
-    }
+    while true { alt get() { some(_) { count += 1; } none. { break } } }
 }
 
 mod map_reduce {
@@ -59,13 +52,13 @@ mod map_reduce {
     export reducer;
     export map_reduce;
 
-    type putter = fn(str, int) ;
+    type putter = fn(str, int);
 
-    type mapper = fn(str, putter) ;
+    type mapper = fn(str, putter);
 
-    type getter = fn() -> option<int> ;
+    type getter = fn() -> option<int>;
 
-    type reducer = fn(str, getter) ;
+    type reducer = fn(str, getter);
 
     tag ctrl_proto {
         find_reducer([u8], _chan<_chan<reduce_proto>>);
@@ -75,9 +68,9 @@ mod map_reduce {
     tag reduce_proto { emit_val(int); done; ref; release; }
 
     fn start_mappers(ctrl: _chan<ctrl_proto>, inputs: &[str]) -> [task_id] {
-        let tasks = ~[];
+        let tasks = [];
         for i: str in inputs {
-            tasks += ~[task::spawn(bind map_task(ctrl, i))];
+            tasks += [task::spawn(bind map_task(ctrl, i))];
         }
         ret tasks;
     }
@@ -108,7 +101,7 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        for each kv: @{key: str, val: _chan<reduce_proto>}  in
+        for each kv: @{key: str, val: _chan<reduce_proto>} in
                  intermediates.items() {
             send(kv.val, release);
         }
@@ -178,8 +171,7 @@ mod map_reduce {
                   none. {
                     // log_err "creating new reducer for " + k;
                     let p = mk_port();
-                    tasks +=
-                        ~[task::spawn(bind reduce_task(k, p.mk_chan()))];
+                    tasks += [task::spawn(bind reduce_task(k, p.mk_chan()))];
                     c = p.recv();
                     reducers.insert(k, c);
                   }
@@ -202,7 +194,7 @@ fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(#fmt("Usage: %s <filename> ...", argv.(0)));
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
diff --git a/src/test/compile-fail/alias-mismatch.rs b/src/test/compile-fail/alias-mismatch.rs
index c25c7229e22..068e8c65ff5 100644
--- a/src/test/compile-fail/alias-mismatch.rs
+++ b/src/test/compile-fail/alias-mismatch.rs
@@ -5,5 +5,5 @@ import std::vec::map;
 fn main() {
     fn f(i: uint) -> bool { true }
 
-    let a = map(f, ~[5u]);
-}
\ No newline at end of file
+    let a = map(f, [5u]);
+}
diff --git a/src/test/compile-fail/aliasness-mismatch.rs b/src/test/compile-fail/aliasness-mismatch.rs
index a376508e8b4..8be70d8e29f 100644
--- a/src/test/compile-fail/aliasness-mismatch.rs
+++ b/src/test/compile-fail/aliasness-mismatch.rs
@@ -3,6 +3,6 @@
 
 fn f(x: &int) { log_err x; }
 fn h(x: int) { log_err x; }
-fn main() { let g: fn(int)  = f; g(10); g = h; g(10); }
+fn main() { let g: fn(int) = f; g(10); g = h; g(10); }
 
 
diff --git a/src/test/compile-fail/alt-join.rs b/src/test/compile-fail/alt-join.rs
index 613e1e12382..246d186b06c 100644
--- a/src/test/compile-fail/alt-join.rs
+++ b/src/test/compile-fail/alt-join.rs
@@ -5,11 +5,8 @@
 fn my_fail() -> ! { fail; }
 
 fn main() {
-    alt (true) {
-      false { my_fail(); }
-      true {}
-    }
+    alt true { false { my_fail(); } true { } }
 
     log x;
-    let x:int;
-}
\ No newline at end of file
+    let x: int;
+}
diff --git a/src/test/compile-fail/and-init.rs b/src/test/compile-fail/and-init.rs
index 26296dc6faa..75e63ab2cc6 100644
--- a/src/test/compile-fail/and-init.rs
+++ b/src/test/compile-fail/and-init.rs
@@ -5,4 +5,4 @@ fn main() {
 
     log false && { i = 5; true };
     log i;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/arg-count-mismatch.rs b/src/test/compile-fail/arg-count-mismatch.rs
index 89be0585c34..62aad13d150 100644
--- a/src/test/compile-fail/arg-count-mismatch.rs
+++ b/src/test/compile-fail/arg-count-mismatch.rs
@@ -2,4 +2,4 @@
 
 fn f(x: int) { }
 
-fn main() { let i: (); i = f(); }
\ No newline at end of file
+fn main() { let i: (); i = f(); }
diff --git a/src/test/compile-fail/arg-type-mismatch.rs b/src/test/compile-fail/arg-type-mismatch.rs
index 3fe2e95c294..8934a12b27a 100644
--- a/src/test/compile-fail/arg-type-mismatch.rs
+++ b/src/test/compile-fail/arg-type-mismatch.rs
@@ -3,4 +3,4 @@
 
 fn f(x: int) { }
 
-fn main() { let i: (); i = f(()); }
\ No newline at end of file
+fn main() { let i: (); i = f(()); }
diff --git a/src/test/compile-fail/assign-alias.rs b/src/test/compile-fail/assign-alias.rs
index 66041f08a7a..b291b6d47b6 100644
--- a/src/test/compile-fail/assign-alias.rs
+++ b/src/test/compile-fail/assign-alias.rs
@@ -2,4 +2,4 @@
 
 fn f(i: &int) { i += 2; }
 
-fn main() { f(1); }
\ No newline at end of file
+fn main() { f(1); }
diff --git a/src/test/compile-fail/auto-deref-bind.rs b/src/test/compile-fail/auto-deref-bind.rs
index 9d9b0613bd7..b218ddd122a 100644
--- a/src/test/compile-fail/auto-deref-bind.rs
+++ b/src/test/compile-fail/auto-deref-bind.rs
@@ -1,4 +1,4 @@
 // error-pattern: mismatched types
 
 fn add1(i: int) -> int { ret i + 1; }
-fn main() { let f = @add1; let g = bind f(5); }
\ No newline at end of file
+fn main() { let f = @add1; let g = bind f(5); }
diff --git a/src/test/compile-fail/bad-bang-ann-2.rs b/src/test/compile-fail/bad-bang-ann-2.rs
index 15ba26b0dc0..011358ac10c 100644
--- a/src/test/compile-fail/bad-bang-ann-2.rs
+++ b/src/test/compile-fail/bad-bang-ann-2.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { log 3; }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-bang-ann-3.rs b/src/test/compile-fail/bad-bang-ann-3.rs
index 7077a2e7986..2ba862ff57f 100644
--- a/src/test/compile-fail/bad-bang-ann-3.rs
+++ b/src/test/compile-fail/bad-bang-ann-3.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { ret 7u; }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-bang-ann.rs b/src/test/compile-fail/bad-bang-ann.rs
index 20aed480bfc..e67013998a1 100644
--- a/src/test/compile-fail/bad-bang-ann.rs
+++ b/src/test/compile-fail/bad-bang-ann.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { if i < 0u { } else { fail; } }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-env-capture.rs b/src/test/compile-fail/bad-env-capture.rs
index 2848d185739..8e8441e55ac 100644
--- a/src/test/compile-fail/bad-env-capture.rs
+++ b/src/test/compile-fail/bad-env-capture.rs
@@ -3,4 +3,4 @@ fn foo() {
     let x: int;
     fn bar() { log x; }
 }
-fn main() { foo(); }
\ No newline at end of file
+fn main() { foo(); }
diff --git a/src/test/compile-fail/bad-env-capture2.rs b/src/test/compile-fail/bad-env-capture2.rs
index 47e9a4e0ed9..40a0a39e7c6 100644
--- a/src/test/compile-fail/bad-env-capture2.rs
+++ b/src/test/compile-fail/bad-env-capture2.rs
@@ -2,4 +2,4 @@
 fn foo(x: int) {
     fn bar() { log x; }
 }
-fn main() { foo(2); }
\ No newline at end of file
+fn main() { foo(2); }
diff --git a/src/test/compile-fail/bad-env-capture3.rs b/src/test/compile-fail/bad-env-capture3.rs
index 43d9a15665c..1ff3602ee88 100644
--- a/src/test/compile-fail/bad-env-capture3.rs
+++ b/src/test/compile-fail/bad-env-capture3.rs
@@ -5,4 +5,4 @@ obj foo(x: int) {
     }
 }
 
-fn main() { foo(2); }
\ No newline at end of file
+fn main() { foo(2); }
diff --git a/src/test/compile-fail/bad-main.rs b/src/test/compile-fail/bad-main.rs
index 40879fae555..725f88129b9 100644
--- a/src/test/compile-fail/bad-main.rs
+++ b/src/test/compile-fail/bad-main.rs
@@ -1,3 +1,3 @@
 // error-pattern:wrong type in main function
 
-fn main(x: int) { }
\ No newline at end of file
+fn main(x: int) { }
diff --git a/src/test/compile-fail/bad-module.rs b/src/test/compile-fail/bad-module.rs
index bfb796916a3..c5b67b9401b 100644
--- a/src/test/compile-fail/bad-module.rs
+++ b/src/test/compile-fail/bad-module.rs
@@ -1,4 +1,4 @@
 // error-pattern: unresolved import: vec
 import vec;
 
-fn main() { let foo = vec::len([]); }
\ No newline at end of file
+fn main() { let foo = vec::len([]); }
diff --git a/src/test/compile-fail/bad-record-pat-2.rs b/src/test/compile-fail/bad-record-pat-2.rs
index 125b608e4ed..54ae70a8661 100644
--- a/src/test/compile-fail/bad-record-pat-2.rs
+++ b/src/test/compile-fail/bad-record-pat-2.rs
@@ -1,3 +1,3 @@
 // error-pattern:did not expect a record with a field q
 
-fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } }
\ No newline at end of file
+fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } }
diff --git a/src/test/compile-fail/bad-record-pat.rs b/src/test/compile-fail/bad-record-pat.rs
index e8bb2426cd9..1b12d274ce8 100644
--- a/src/test/compile-fail/bad-record-pat.rs
+++ b/src/test/compile-fail/bad-record-pat.rs
@@ -1,3 +1,3 @@
 // error-pattern:expected a record with 2 fields, found one with 1
 
-fn main() { alt {x: 1, y: 2} { {x: x} { } } }
\ No newline at end of file
+fn main() { alt {x: 1, y: 2} { {x: x} { } } }
diff --git a/src/test/compile-fail/bang-tailexpr.rs b/src/test/compile-fail/bang-tailexpr.rs
index 87afc1bd401..d13fca4486c 100644
--- a/src/test/compile-fail/bang-tailexpr.rs
+++ b/src/test/compile-fail/bang-tailexpr.rs
@@ -1,3 +1,3 @@
 // error-pattern: some control paths may return
 fn f() -> ! { 3 }
-fn main(){}
+fn main() { }
diff --git a/src/test/compile-fail/binop-add-tup-assign.rs b/src/test/compile-fail/binop-add-tup-assign.rs
index 6470ae353a8..86515aeea6a 100644
--- a/src/test/compile-fail/binop-add-tup-assign.rs
+++ b/src/test/compile-fail/binop-add-tup-assign.rs
@@ -1,3 +1,3 @@
 // error-pattern:+ cannot be applied to type `{x: bool}`
 
-fn main() { let x = {x: true}; x += {x: false}; }
\ No newline at end of file
+fn main() { let x = {x: true}; x += {x: false}; }
diff --git a/src/test/compile-fail/binop-add-tup.rs b/src/test/compile-fail/binop-add-tup.rs
index 96dc63fef01..fadb35503e2 100644
--- a/src/test/compile-fail/binop-add-tup.rs
+++ b/src/test/compile-fail/binop-add-tup.rs
@@ -1,3 +1,3 @@
 // error-pattern:+ cannot be applied to type `{x: bool}`
 
-fn main() { let x = {x: true} + {x: false}; }
\ No newline at end of file
+fn main() { let x = {x: true} + {x: false}; }
diff --git a/src/test/compile-fail/binop-bitxor-str.rs b/src/test/compile-fail/binop-bitxor-str.rs
index 0f1e2202419..65e0996fa62 100644
--- a/src/test/compile-fail/binop-bitxor-str.rs
+++ b/src/test/compile-fail/binop-bitxor-str.rs
@@ -1,3 +1,3 @@
 // error-pattern:^ cannot be applied to type `str`
 
-fn main() { let x = "a" ^ "b"; }
\ No newline at end of file
+fn main() { let x = "a" ^ "b"; }
diff --git a/src/test/compile-fail/binop-logic-float.rs b/src/test/compile-fail/binop-logic-float.rs
index 900c290b07e..7b7b165d49b 100644
--- a/src/test/compile-fail/binop-logic-float.rs
+++ b/src/test/compile-fail/binop-logic-float.rs
@@ -1,3 +1,3 @@
 // error-pattern:|| cannot be applied to type `f32`
 
-fn main() { let x = 1.0_f32 || 2.0_f32; }
\ No newline at end of file
+fn main() { let x = 1.0_f32 || 2.0_f32; }
diff --git a/src/test/compile-fail/binop-logic-int.rs b/src/test/compile-fail/binop-logic-int.rs
index ffe05f1649c..ef8643bd7b4 100644
--- a/src/test/compile-fail/binop-logic-int.rs
+++ b/src/test/compile-fail/binop-logic-int.rs
@@ -1,3 +1,3 @@
 // error-pattern:&& cannot be applied to type `int`
 
-fn main() { let x = 1 && 2; }
\ No newline at end of file
+fn main() { let x = 1 && 2; }
diff --git a/src/test/compile-fail/binop-mul-bool.rs b/src/test/compile-fail/binop-mul-bool.rs
index 78e7cbe23b5..7c912f58d1e 100644
--- a/src/test/compile-fail/binop-mul-bool.rs
+++ b/src/test/compile-fail/binop-mul-bool.rs
@@ -1,3 +1,3 @@
 // error-pattern:* cannot be applied to type `bool`
 
-fn main() { let x = true * false; }
\ No newline at end of file
+fn main() { let x = true * false; }
diff --git a/src/test/compile-fail/binop-sub-obj.rs b/src/test/compile-fail/binop-sub-obj.rs
index f5010dbbe05..630cd288a49 100644
--- a/src/test/compile-fail/binop-sub-obj.rs
+++ b/src/test/compile-fail/binop-sub-obj.rs
@@ -1,3 +1,3 @@
 // error-pattern:- cannot be applied to type `obj
 
-fn main() { let x = obj () {  } - obj () {  }; }
\ No newline at end of file
+fn main() { let x = obj () { } - obj () { }; }
diff --git a/src/test/compile-fail/binop-typeck.rs b/src/test/compile-fail/binop-typeck.rs
index caa844516fb..9cb6dea5360 100644
--- a/src/test/compile-fail/binop-typeck.rs
+++ b/src/test/compile-fail/binop-typeck.rs
@@ -1,4 +1,4 @@
 // error-pattern:mismatched types
 // issue #500
 
-fn main() { let x = true; let y = 1; let z = x + y; }
\ No newline at end of file
+fn main() { let x = true; let y = 1; let z = x + y; }
diff --git a/src/test/compile-fail/block-coerce-no.rs b/src/test/compile-fail/block-coerce-no.rs
index 42b1504562a..bb3e53028c2 100644
--- a/src/test/compile-fail/block-coerce-no.rs
+++ b/src/test/compile-fail/block-coerce-no.rs
@@ -3,11 +3,11 @@
 // Make sure that fn-to-block coercion isn't incorrectly lifted over
 // other tycons.
 
-fn coerce(b: &block() ) -> fn()  {
-    fn lol(f: &fn(&block() ) -> fn()  , g: &block() ) -> fn()  { ret f(g); }
-    fn fn_id(f: &fn() ) -> fn()  { ret f }
+fn coerce(b: &block()) -> fn() {
+    fn lol(f: &fn(&block()) -> fn(), g: &block()) -> fn() { ret f(g); }
+    fn fn_id(f: &fn()) -> fn() { ret f }
     ret lol(fn_id, b);
 }
 
 
-fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); }
\ No newline at end of file
+fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); }
diff --git a/src/test/compile-fail/block-copy.rs b/src/test/compile-fail/block-copy.rs
index f0e510e87a7..6a6c708cf88 100644
--- a/src/test/compile-fail/block-copy.rs
+++ b/src/test/compile-fail/block-copy.rs
@@ -1,4 +1,4 @@
 // error-pattern: non-copyable
 
-fn lol(f: &block() ) -> block()  { ret f; }
-fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); }
\ No newline at end of file
+fn lol(f: &block()) -> block() { ret f; }
+fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); }
diff --git a/src/test/compile-fail/block-uninit.rs b/src/test/compile-fail/block-uninit.rs
index 4fa112762e8..9028d5fa435 100644
--- a/src/test/compile-fail/block-uninit.rs
+++ b/src/test/compile-fail/block-uninit.rs
@@ -1,4 +1,4 @@
 // error-pattern: Unsatisfied precondition constraint
 
-fn force(f: &block() ) { f(); }
-fn main() { let x: int; force(block () { log_err x; }); }
\ No newline at end of file
+fn force(f: &block()) { f(); }
+fn main() { let x: int; force(block () { log_err x; }); }
diff --git a/src/test/compile-fail/break-outside-loop.rs b/src/test/compile-fail/break-outside-loop.rs
index adf6413ed62..3783dc83dd0 100644
--- a/src/test/compile-fail/break-outside-loop.rs
+++ b/src/test/compile-fail/break-outside-loop.rs
@@ -4,4 +4,4 @@ fn main() {
 
     let rs: {t: str} = {t: pth};
 
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/break-uninit.rs b/src/test/compile-fail/break-uninit.rs
index d1c7a90f7f2..9a82a95ade2 100644
--- a/src/test/compile-fail/break-uninit.rs
+++ b/src/test/compile-fail/break-uninit.rs
@@ -11,4 +11,4 @@ fn foo() -> int {
     ret 17;
 }
 
-fn main() { log foo(); }
\ No newline at end of file
+fn main() { log foo(); }
diff --git a/src/test/compile-fail/break-uninit2.rs b/src/test/compile-fail/break-uninit2.rs
index 9fb89c5c648..d1fda52fae6 100644
--- a/src/test/compile-fail/break-uninit2.rs
+++ b/src/test/compile-fail/break-uninit2.rs
@@ -11,4 +11,4 @@ fn foo() -> int {
     ret 17;
 }
 
-fn main() { log foo(); }
\ No newline at end of file
+fn main() { log foo(); }
diff --git a/src/test/compile-fail/capture1.rs b/src/test/compile-fail/capture1.rs
index 1e8e48aea02..877884bf7f9 100644
--- a/src/test/compile-fail/capture1.rs
+++ b/src/test/compile-fail/capture1.rs
@@ -5,4 +5,4 @@
 fn main() {
     let bar: int = 5;
     fn foo() -> int { ret bar; }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/constructor-as-cast.rs b/src/test/compile-fail/constructor-as-cast.rs
index 2bee78316f2..85d8c7850cf 100644
--- a/src/test/compile-fail/constructor-as-cast.rs
+++ b/src/test/compile-fail/constructor-as-cast.rs
@@ -1,10 +1,10 @@
 // error-pattern: unresolved name: base
 type base =
     obj {
-        fn foo() ;
+        fn foo();
     };
 obj derived() {
     fn foo() { }
     fn bar() { }
 }
-fn main() { let d: derived = derived(); let b: base = base(d); }
\ No newline at end of file
+fn main() { let d: derived = derived(); let b: base = base(d); }
diff --git a/src/test/compile-fail/copy-a-resource.rs b/src/test/compile-fail/copy-a-resource.rs
index aabacdde27f..9e5e6f81666 100644
--- a/src/test/compile-fail/copy-a-resource.rs
+++ b/src/test/compile-fail/copy-a-resource.rs
@@ -2,4 +2,4 @@
 
 resource foo(i: int) { }
 
-fn main() { let x <- foo(10); let y = x; }
\ No newline at end of file
+fn main() { let x <- foo(10); let y = x; }
diff --git a/src/test/compile-fail/cross-crate-glob-collision.rs b/src/test/compile-fail/cross-crate-glob-collision.rs
index 3771851cfae..490f8ae9b21 100644
--- a/src/test/compile-fail/cross-crate-glob-collision.rs
+++ b/src/test/compile-fail/cross-crate-glob-collision.rs
@@ -10,4 +10,4 @@ mod alternate_supplier {
     fn member() { }
 }
 
-fn main() { member() }
\ No newline at end of file
+fn main() { member() }
diff --git a/src/test/compile-fail/direct-obj-fn-call.rs b/src/test/compile-fail/direct-obj-fn-call.rs
index 557b6af1696..01ec855bf7c 100644
--- a/src/test/compile-fail/direct-obj-fn-call.rs
+++ b/src/test/compile-fail/direct-obj-fn-call.rs
@@ -4,4 +4,4 @@ obj x() {
     fn hello() { log "hello"; }
 }
 
-fn main() { x.hello(); }
\ No newline at end of file
+fn main() { x.hello(); }
diff --git a/src/test/compile-fail/do-while-constraints.rs b/src/test/compile-fail/do-while-constraints.rs
index cfea71fc7ef..f7d03b89354 100644
--- a/src/test/compile-fail/do-while-constraints.rs
+++ b/src/test/compile-fail/do-while-constraints.rs
@@ -7,4 +7,4 @@ fn main() {
         log y;
         do  { do  { do  { x <- y; } while true } while true } while true
     } while true
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/do-while-pred-constraints.rs b/src/test/compile-fail/do-while-pred-constraints.rs
index 31d3e82796e..90fcd26ea9f 100644
--- a/src/test/compile-fail/do-while-pred-constraints.rs
+++ b/src/test/compile-fail/do-while-pred-constraints.rs
@@ -1,24 +1,14 @@
 // error-pattern: Unsatisfied precondition constraint (for example, even(y
 
-fn print_even(y: int) : even(y) {
-  log y;
-}
+fn print_even(y: int) : even(y) { log y; }
 
-pred even(y: int) -> bool {
-  true
-}
+pred even(y: int) -> bool { true }
 
 fn main() {
-  let y: int = 42;
-  check even(y);
-  do {
-    print_even(y);
-    do {
-      do {
-    do {
-      y += 1;
-    } while (true);
-      } while (true);
-    } while (true);
-  } while (true);
+    let y: int = 42;
+    check (even(y));
+    do  {
+        print_even(y);
+        do  { do  { do  { y += 1; } while true } while true } while true
+    } while true
 }
diff --git a/src/test/compile-fail/dup-link-name.rs b/src/test/compile-fail/dup-link-name.rs
index 346588392ee..c7f0a12d061 100644
--- a/src/test/compile-fail/dup-link-name.rs
+++ b/src/test/compile-fail/dup-link-name.rs
@@ -2,4 +2,4 @@
 
 #[link(name = "test", name)];
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/export-fully-qualified.rs b/src/test/compile-fail/export-fully-qualified.rs
index 7413777ee2b..30075a1cadb 100644
--- a/src/test/compile-fail/export-fully-qualified.rs
+++ b/src/test/compile-fail/export-fully-qualified.rs
@@ -13,4 +13,4 @@ mod foo {
     fn baz() { }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/export-import.rs b/src/test/compile-fail/export-import.rs
index 2608f523220..f5ed4c4f3a7 100644
--- a/src/test/compile-fail/export-import.rs
+++ b/src/test/compile-fail/export-import.rs
@@ -11,4 +11,4 @@ mod m {
 }
 
 
-fn main() { unexported(); }
\ No newline at end of file
+fn main() { unexported(); }
diff --git a/src/test/compile-fail/export-no-tag-variants.rs b/src/test/compile-fail/export-no-tag-variants.rs
index a824212ab08..2d10cb49270 100644
--- a/src/test/compile-fail/export-no-tag-variants.rs
+++ b/src/test/compile-fail/export-no-tag-variants.rs
@@ -9,4 +9,4 @@ mod foo {
     tag t { t1; }
 }
 
-fn main() { let x = foo::t1; }
\ No newline at end of file
+fn main() { let x = foo::t1; }
diff --git a/src/test/compile-fail/export-tag-variant.rs b/src/test/compile-fail/export-tag-variant.rs
index a31ae5615fb..33496480c02 100644
--- a/src/test/compile-fail/export-tag-variant.rs
+++ b/src/test/compile-fail/export-tag-variant.rs
@@ -8,4 +8,4 @@ mod foo {
     tag y { y1; }
 }
 
-fn main() { let z = foo::y1; }
\ No newline at end of file
+fn main() { let z = foo::y1; }
diff --git a/src/test/compile-fail/export.rs b/src/test/compile-fail/export.rs
index 57967838640..55d33160d34 100644
--- a/src/test/compile-fail/export.rs
+++ b/src/test/compile-fail/export.rs
@@ -5,4 +5,4 @@ mod foo {
     fn z(y: int) { log y; }
 }
 
-fn main() { foo::z(10); }
\ No newline at end of file
+fn main() { foo::z(10); }
diff --git a/src/test/compile-fail/export2.rs b/src/test/compile-fail/export2.rs
index 47b80014a1c..28919efdd49 100644
--- a/src/test/compile-fail/export2.rs
+++ b/src/test/compile-fail/export2.rs
@@ -14,4 +14,4 @@ mod bar {
     fn y() { }
 }
 
-fn main() { foo::x(); }
\ No newline at end of file
+fn main() { foo::x(); }
diff --git a/src/test/compile-fail/ext-nonexistent.rs b/src/test/compile-fail/ext-nonexistent.rs
index f4cb0021be3..ec63c1f07d0 100644
--- a/src/test/compile-fail/ext-nonexistent.rs
+++ b/src/test/compile-fail/ext-nonexistent.rs
@@ -1,2 +1,2 @@
 // error-pattern:macro undefined
-fn main() { #iamnotanextensionthatexists(""); }
\ No newline at end of file
+fn main() { #iamnotanextensionthatexists[""]; }
diff --git a/src/test/compile-fail/extend-non-object.rs b/src/test/compile-fail/extend-non-object.rs
index 4a957f5fc73..0857ac990c0 100644
--- a/src/test/compile-fail/extend-non-object.rs
+++ b/src/test/compile-fail/extend-non-object.rs
@@ -10,4 +10,4 @@ fn main() {
             with
             x
         };
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/extenv-no-args.rs b/src/test/compile-fail/extenv-no-args.rs
index 5b0be3c9871..ec73f0a7a45 100644
--- a/src/test/compile-fail/extenv-no-args.rs
+++ b/src/test/compile-fail/extenv-no-args.rs
@@ -1,5 +1,3 @@
 // error-pattern:malformed #env call
 
-fn main() {
-    #env();
-}
+fn main() { #env[]; }
diff --git a/src/test/compile-fail/extenv-not-string-literal.rs b/src/test/compile-fail/extenv-not-string-literal.rs
index 8ab4953c8fa..57d50b2e54d 100644
--- a/src/test/compile-fail/extenv-not-string-literal.rs
+++ b/src/test/compile-fail/extenv-not-string-literal.rs
@@ -1,3 +1,3 @@
 // error-pattern:requires a string
 
-fn main() { #env(10); }
\ No newline at end of file
+fn main() { #env[10]; }
diff --git a/src/test/compile-fail/extenv-too-many-args.rs b/src/test/compile-fail/extenv-too-many-args.rs
index 65200e5c116..945546fd6cb 100644
--- a/src/test/compile-fail/extenv-too-many-args.rs
+++ b/src/test/compile-fail/extenv-too-many-args.rs
@@ -1,3 +1,3 @@
 // error-pattern:malformed #env call
 
-fn main() { #env("one", "two"); }
\ No newline at end of file
+fn main() { #env["one", "two"]; }
diff --git a/src/test/compile-fail/extfmt-missing-type.rs b/src/test/compile-fail/extfmt-missing-type.rs
index 23deb75e9e7..9e1cbc557d4 100644
--- a/src/test/compile-fail/extfmt-missing-type.rs
+++ b/src/test/compile-fail/extfmt-missing-type.rs
@@ -1,3 +1,3 @@
 // error-pattern:missing type
 
-fn main() { #fmt("%+"); }
\ No newline at end of file
+fn main() { #fmt["%+"]; }
diff --git a/src/test/compile-fail/extfmt-no-args.rs b/src/test/compile-fail/extfmt-no-args.rs
index 8bc3f23f2f0..7c13ef99dc5 100644
--- a/src/test/compile-fail/extfmt-no-args.rs
+++ b/src/test/compile-fail/extfmt-no-args.rs
@@ -1,5 +1,3 @@
 // error-pattern:format string
 
-fn main() {
-    #fmt();
-}
\ No newline at end of file
+fn main() { #fmt[]; }
diff --git a/src/test/compile-fail/extfmt-non-literal.rs b/src/test/compile-fail/extfmt-non-literal.rs
index 7b1b4db7378..445455f33d8 100644
--- a/src/test/compile-fail/extfmt-non-literal.rs
+++ b/src/test/compile-fail/extfmt-non-literal.rs
@@ -4,5 +4,5 @@ fn main() {
     // #fmt's first argument must be a literal.  Hopefully this
     // restriction can be eased eventually to just require a
     // compile-time constant.
-    let x = #fmt("a" + "b");
-}
\ No newline at end of file
+    let x = #fmt["a" + "b"];
+}
diff --git a/src/test/compile-fail/extfmt-non-literal2.rs b/src/test/compile-fail/extfmt-non-literal2.rs
index 5bb730c8aa6..8a2d7c4bbed 100644
--- a/src/test/compile-fail/extfmt-non-literal2.rs
+++ b/src/test/compile-fail/extfmt-non-literal2.rs
@@ -4,5 +4,5 @@ fn main() {
     // #fmt's first argument must be a literal.  Hopefully this
     // restriction can be eased eventually to just require a
     // compile-time constant.
-    let x = #fmt(20);
-}
\ No newline at end of file
+    let x = #fmt[20];
+}
diff --git a/src/test/compile-fail/extfmt-not-enough-args.rs b/src/test/compile-fail/extfmt-not-enough-args.rs
index 9e3012bbc49..849a836060d 100644
--- a/src/test/compile-fail/extfmt-not-enough-args.rs
+++ b/src/test/compile-fail/extfmt-not-enough-args.rs
@@ -2,4 +2,4 @@
 
 use std;
 
-fn main() { let s = #fmt("%s%s%s", "test", "test"); }
\ No newline at end of file
+fn main() { let s = #fmt["%s%s%s", "test", "test"]; }
diff --git a/src/test/compile-fail/extfmt-too-many-args.rs b/src/test/compile-fail/extfmt-too-many-args.rs
index 617a1091173..4c91da227e1 100644
--- a/src/test/compile-fail/extfmt-too-many-args.rs
+++ b/src/test/compile-fail/extfmt-too-many-args.rs
@@ -2,4 +2,4 @@
 
 use std;
 
-fn main() { let s = #fmt("%s", "test", "test"); }
\ No newline at end of file
+fn main() { let s = #fmt["%s", "test", "test"]; }
diff --git a/src/test/compile-fail/extfmt-unknown-type.rs b/src/test/compile-fail/extfmt-unknown-type.rs
index 8c272a182a5..3a35a1d727b 100644
--- a/src/test/compile-fail/extfmt-unknown-type.rs
+++ b/src/test/compile-fail/extfmt-unknown-type.rs
@@ -1,3 +1,3 @@
 // error-pattern:unknown type
 
-fn main() { #fmt("%w"); }
\ No newline at end of file
+fn main() { #fmt["%w"]; }
diff --git a/src/test/compile-fail/extfmt-unsigned-plus.rs b/src/test/compile-fail/extfmt-unsigned-plus.rs
index 7715305e829..4ac41efb312 100644
--- a/src/test/compile-fail/extfmt-unsigned-plus.rs
+++ b/src/test/compile-fail/extfmt-unsigned-plus.rs
@@ -2,5 +2,5 @@
 
 fn main() {
     // Can't use a sign on unsigned conversions
-    #fmt("%+u", 10u);
-}
\ No newline at end of file
+    #fmt["%+u", 10u];
+}
diff --git a/src/test/compile-fail/extfmt-unsigned-space.rs b/src/test/compile-fail/extfmt-unsigned-space.rs
index 0a99a4b6c5e..6393548eb3d 100644
--- a/src/test/compile-fail/extfmt-unsigned-space.rs
+++ b/src/test/compile-fail/extfmt-unsigned-space.rs
@@ -2,5 +2,5 @@
 
 fn main() {
     // Can't use a space on unsigned conversions
-    #fmt("% u", 10u);
-}
\ No newline at end of file
+    #fmt["% u", 10u];
+}
diff --git a/src/test/compile-fail/extfmt-unterminated-conv.rs b/src/test/compile-fail/extfmt-unterminated-conv.rs
index 44a321f578d..3b7d0ce1767 100644
--- a/src/test/compile-fail/extfmt-unterminated-conv.rs
+++ b/src/test/compile-fail/extfmt-unterminated-conv.rs
@@ -1,3 +1,3 @@
 // error-pattern:unterminated conversion
 
-fn main() { #fmt("%"); }
\ No newline at end of file
+fn main() { #fmt["%"]; }
diff --git a/src/test/compile-fail/fail-expr.rs b/src/test/compile-fail/fail-expr.rs
index 13d91ce5cb2..72ae83062eb 100644
--- a/src/test/compile-fail/fail-expr.rs
+++ b/src/test/compile-fail/fail-expr.rs
@@ -1,3 +1,3 @@
 // error-pattern:mismatched types
 
-fn main() { fail 5; }
\ No newline at end of file
+fn main() { fail 5; }
diff --git a/src/test/compile-fail/fail-type-err.rs b/src/test/compile-fail/fail-type-err.rs
index e65ad1af413..8ea86d80a7b 100644
--- a/src/test/compile-fail/fail-type-err.rs
+++ b/src/test/compile-fail/fail-type-err.rs
@@ -1,2 +1,2 @@
 // error-pattern:expected str but found [int]
-fn main() { fail ~[0]; }
\ No newline at end of file
+fn main() { fail [0]; }
diff --git a/src/test/compile-fail/fn-bad-block-type.rs b/src/test/compile-fail/fn-bad-block-type.rs
index ba82efcf750..2349bfe90dc 100644
--- a/src/test/compile-fail/fn-bad-block-type.rs
+++ b/src/test/compile-fail/fn-bad-block-type.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { true }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/fn-compare-mismatch.rs b/src/test/compile-fail/fn-compare-mismatch.rs
index a2bb326c548..87287edca71 100644
--- a/src/test/compile-fail/fn-compare-mismatch.rs
+++ b/src/test/compile-fail/fn-compare-mismatch.rs
@@ -4,4 +4,4 @@ fn main() {
     fn f() { }
     fn g(i: int) { }
     let x = f == g;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-constraint.rs b/src/test/compile-fail/fn-constraint.rs
index 0be8d79a399..9ace741d836 100644
--- a/src/test/compile-fail/fn-constraint.rs
+++ b/src/test/compile-fail/fn-constraint.rs
@@ -6,4 +6,4 @@ fn main() {
     let a: uint = 4u;
     let b: uint = 1u;
     log_err safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-expr-type-state.rs b/src/test/compile-fail/fn-expr-type-state.rs
index 02650b45d88..935542e85e7 100644
--- a/src/test/compile-fail/fn-expr-type-state.rs
+++ b/src/test/compile-fail/fn-expr-type-state.rs
@@ -4,4 +4,4 @@ fn main() {
     // Typestate should work even in a lambda. we should reject this program.
     let f = fn () -> int { let i: int; ret i; };
     log_err f();
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-expr-typestate-2.rs b/src/test/compile-fail/fn-expr-typestate-2.rs
index 299b11cb743..d4f49f96466 100644
--- a/src/test/compile-fail/fn-expr-typestate-2.rs
+++ b/src/test/compile-fail/fn-expr-typestate-2.rs
@@ -1,3 +1,3 @@
 // error-pattern:Unsatisfied precondition
 
-fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; }
\ No newline at end of file
+fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; }
diff --git a/src/test/compile-fail/for-each-over-bs.rs b/src/test/compile-fail/for-each-over-bs.rs
index d34c91cd271..0d184978769 100644
--- a/src/test/compile-fail/for-each-over-bs.rs
+++ b/src/test/compile-fail/for-each-over-bs.rs
@@ -1,2 +1,2 @@
 // error-pattern:sequence in for each loop not a call
-fn main() { for each p in 1 {} }
+fn main() { for each p in 1 { } }
diff --git a/src/test/compile-fail/forgot-ret.rs b/src/test/compile-fail/forgot-ret.rs
index 1cdc55ffd87..5d91e3212df 100644
--- a/src/test/compile-fail/forgot-ret.rs
+++ b/src/test/compile-fail/forgot-ret.rs
@@ -5,4 +5,4 @@ fn god_exists(a: int) -> bool { be god_exists(a); }
 
 fn f(a: int) -> int { if god_exists(a) { ret 5; } }
 
-fn main() { f(12); }
\ No newline at end of file
+fn main() { f(12); }
diff --git a/src/test/compile-fail/fru-extra-field.rs b/src/test/compile-fail/fru-extra-field.rs
index 6957da34956..7d070c47f46 100644
--- a/src/test/compile-fail/fru-extra-field.rs
+++ b/src/test/compile-fail/fru-extra-field.rs
@@ -8,4 +8,4 @@ fn main() {
     let origin: point = {x: 0, y: 0};
 
     let origin3d: point = {z: 0 with origin};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fru-typestate.rs b/src/test/compile-fail/fru-typestate.rs
index ce5102cbf65..447f6f44dc5 100644
--- a/src/test/compile-fail/fru-typestate.rs
+++ b/src/test/compile-fail/fru-typestate.rs
@@ -9,4 +9,4 @@ fn main() {
 
     let right: point = {x: 10 with origin};
     origin = {x: 0, y: 0};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/if-branch-types.rs b/src/test/compile-fail/if-branch-types.rs
index 345d2509970..bfb7a277492 100644
--- a/src/test/compile-fail/if-branch-types.rs
+++ b/src/test/compile-fail/if-branch-types.rs
@@ -1,3 +1,3 @@
 // error-pattern:mismatched types
 
-fn main() { let x = if true { 10 } else { 10u }; }
\ No newline at end of file
+fn main() { let x = if true { 10 } else { 10u }; }
diff --git a/src/test/compile-fail/if-check-precond-fail.rs b/src/test/compile-fail/if-check-precond-fail.rs
index af7658b4f94..9ce0d6f8ef5 100644
--- a/src/test/compile-fail/if-check-precond-fail.rs
+++ b/src/test/compile-fail/if-check-precond-fail.rs
@@ -2,11 +2,11 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn print_even(x: uint) : even(x) { log x; }
 
 fn foo(x: uint) { if check even(x) { fail; } else { print_even(x); } }
 
-fn main() { foo(3u); }
\ No newline at end of file
+fn main() { foo(3u); }
diff --git a/src/test/compile-fail/if-typeck.rs b/src/test/compile-fail/if-typeck.rs
index c88a1c8c9e6..d8c262bd6b3 100644
--- a/src/test/compile-fail/if-typeck.rs
+++ b/src/test/compile-fail/if-typeck.rs
@@ -7,4 +7,4 @@ fn main() {
 
     // f is not a bool
     if f { }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-from-dup.rs b/src/test/compile-fail/import-from-dup.rs
index 729622c8b5a..73e14bfc753 100644
--- a/src/test/compile-fail/import-from-dup.rs
+++ b/src/test/compile-fail/import-from-dup.rs
@@ -4,11 +4,11 @@ import m1::{f};
 import m2::{f};
 
 mod m1 {
-    fn f() {}
+    fn f() { }
 }
 
 mod m2 {
-    fn f() {}
+    fn f() { }
 }
 
-fn main() {}
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/import-from-missing.rs b/src/test/compile-fail/import-from-missing.rs
index 1e0b3869053..bcd9ee7da43 100644
--- a/src/test/compile-fail/import-from-missing.rs
+++ b/src/test/compile-fail/import-from-missing.rs
@@ -2,10 +2,7 @@
 import spam::{ham, eggs};
 
 mod spam {
-    fn ham() {}
+    fn ham() { }
 }
 
-fn main() {
-    ham();
-    eggs();
-}
\ No newline at end of file
+fn main() { ham(); eggs(); }
diff --git a/src/test/compile-fail/import-glob-0.rs b/src/test/compile-fail/import-glob-0.rs
index 8d74000ef0b..d0cbcf57ad3 100644
--- a/src/test/compile-fail/import-glob-0.rs
+++ b/src/test/compile-fail/import-glob-0.rs
@@ -19,4 +19,4 @@ fn main() {
     f2();
     f999(); // 'export' currently doesn't work?
     f4();
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-glob-circular.rs b/src/test/compile-fail/import-glob-circular.rs
index 1a937d617c6..c9595777c27 100644
--- a/src/test/compile-fail/import-glob-circular.rs
+++ b/src/test/compile-fail/import-glob-circular.rs
@@ -22,4 +22,4 @@ mod test {
     import circ1::*;
 
     fn test() { f1066(); }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-glob-export.rs b/src/test/compile-fail/import-glob-export.rs
index 57f154e104f..3965ad5fc4d 100644
--- a/src/test/compile-fail/import-glob-export.rs
+++ b/src/test/compile-fail/import-glob-export.rs
@@ -9,4 +9,4 @@ mod m1 {
     fn f2() { }
 }
 
-fn main() { f2(); }
\ No newline at end of file
+fn main() { f2(); }
diff --git a/src/test/compile-fail/import-glob-multiple.rs b/src/test/compile-fail/import-glob-multiple.rs
index 1abe786ab6b..55a8878381d 100644
--- a/src/test/compile-fail/import-glob-multiple.rs
+++ b/src/test/compile-fail/import-glob-multiple.rs
@@ -17,4 +17,4 @@ mod mod2 {
 
 
 
-fn main() { common2(); }
\ No newline at end of file
+fn main() { common2(); }
diff --git a/src/test/compile-fail/import-loop-2.rs b/src/test/compile-fail/import-loop-2.rs
index a21950898fa..4040f8333f9 100644
--- a/src/test/compile-fail/import-loop-2.rs
+++ b/src/test/compile-fail/import-loop-2.rs
@@ -10,4 +10,4 @@ mod b {
     export x;
 
     fn main() { let y = x; }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-loop.rs b/src/test/compile-fail/import-loop.rs
index 6e790829ec8..6aa88db603d 100644
--- a/src/test/compile-fail/import-loop.rs
+++ b/src/test/compile-fail/import-loop.rs
@@ -7,4 +7,4 @@ mod y {
     export x;
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/import5.rs b/src/test/compile-fail/import5.rs
index 4910bb5065e..71f17b0c34a 100644
--- a/src/test/compile-fail/import5.rs
+++ b/src/test/compile-fail/import5.rs
@@ -12,4 +12,4 @@ mod m3 {
     import m2::foo;
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/impure-pred.rs b/src/test/compile-fail/impure-pred.rs
index cf775f8d6f1..05433ba17ed 100644
--- a/src/test/compile-fail/impure-pred.rs
+++ b/src/test/compile-fail/impure-pred.rs
@@ -9,4 +9,4 @@ fn main() {
     let x = 0;
 
     check (f(x));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/infinite-vec-type-recursion.rs b/src/test/compile-fail/infinite-vec-type-recursion.rs
index c41c9fb3881..709c5b628ee 100644
--- a/src/test/compile-fail/infinite-vec-type-recursion.rs
+++ b/src/test/compile-fail/infinite-vec-type-recursion.rs
@@ -3,4 +3,4 @@
 
 type x = [x];
 
-fn main() { let b: x = ~[]; }
+fn main() { let b: x = []; }
diff --git a/src/test/compile-fail/lambda-mutate-nested.rs b/src/test/compile-fail/lambda-mutate-nested.rs
index 6da8e3b252e..409b0e59950 100644
--- a/src/test/compile-fail/lambda-mutate-nested.rs
+++ b/src/test/compile-fail/lambda-mutate-nested.rs
@@ -3,10 +3,7 @@
 // mutate upvars from a lambda.
 fn main() {
     let i = 0;
-    let ctr = lambda() -> int {
-        block() { i = i + 1; }();
-        ret i;
-    };
+    let ctr = lambda () -> int { block () { i = i + 1; }(); ret i; };
     log_err ctr();
     log_err ctr();
     log_err ctr();
diff --git a/src/test/compile-fail/lambda-mutate.rs b/src/test/compile-fail/lambda-mutate.rs
index 24f4c75a853..cb891aad374 100644
--- a/src/test/compile-fail/lambda-mutate.rs
+++ b/src/test/compile-fail/lambda-mutate.rs
@@ -2,10 +2,7 @@
 // Make sure we can't write to upvars from lambdas
 fn main() {
     let i = 0;
-    let ctr = lambda() -> int {
-        i = i + 1;
-        ret i;
-    };
+    let ctr = lambda () -> int { i = i + 1; ret i; };
     log_err ctr();
     log_err ctr();
     log_err ctr();
diff --git a/src/test/compile-fail/let-destruct-refutable.rs b/src/test/compile-fail/let-destruct-refutable.rs
index 0217fb9cb40..d1796da9037 100644
--- a/src/test/compile-fail/let-destruct-refutable.rs
+++ b/src/test/compile-fail/let-destruct-refutable.rs
@@ -1,11 +1,8 @@
 // error-pattern:refutable pattern
 
-tag xx {
-    xx(int);
-    yy;
-}
+tag xx { xx(int); yy; }
 
 fn main() {
-    let @{x:xx(x), y} = @{x: xx(10), y: 20};
-    assert x + y == 30;
+    let @{x: xx(x), y: y} = @{x: xx(10), y: 20};
+    assert (x + y == 30);
 }
diff --git a/src/test/compile-fail/macro-2.rs b/src/test/compile-fail/macro-2.rs
index a11dd1f95f9..a802301756c 100644
--- a/src/test/compile-fail/macro-2.rs
+++ b/src/test/compile-fail/macro-2.rs
@@ -1,6 +1,10 @@
 //error-pattern:is an expr, expected an identifier
 fn main() {
-  #macro([#mylambda(x, body), {fn f(x: int) -> int {ret body}; f}]);
+    #macro[[#mylambda[x, body],
+            {
+                fn f(x: int) -> int { ret body }
+                f
+            }]];
 
-  assert(#mylambda(y*1, y*2)(8) == 16);
-}
\ No newline at end of file
+    assert (#mylambda[y * 1, y * 2](8) == 16);
+}
diff --git a/src/test/compile-fail/macro.rs b/src/test/compile-fail/macro.rs
index a3f2df4f187..5943e575a48 100644
--- a/src/test/compile-fail/macro.rs
+++ b/src/test/compile-fail/macro.rs
@@ -1,7 +1,8 @@
 //error-pattern:no clauses match
 
 fn main() {
-  #macro([#trivial(), 1*2*4*2*1]);
+    #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]];
 
-  assert(#trivial(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16) == 16);
+    assert (#trivial[1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16] ==
+                16);
 }
diff --git a/src/test/compile-fail/main-wrong-type-2.rs b/src/test/compile-fail/main-wrong-type-2.rs
index 3e1e1fa1eef..e3d5ca40d08 100644
--- a/src/test/compile-fail/main-wrong-type-2.rs
+++ b/src/test/compile-fail/main-wrong-type-2.rs
@@ -1,2 +1,2 @@
 // error-pattern:wrong type in main function: found fn() -> char
-fn main() -> char { }
\ No newline at end of file
+fn main() -> char { }
diff --git a/src/test/compile-fail/main-wrong-type.rs b/src/test/compile-fail/main-wrong-type.rs
index 33d5c305204..2be4af77008 100644
--- a/src/test/compile-fail/main-wrong-type.rs
+++ b/src/test/compile-fail/main-wrong-type.rs
@@ -1,2 +1,2 @@
 // error-pattern:wrong type in main function: found fn(
-fn main(foo: {x: int, y: int}) { }
\ No newline at end of file
+fn main(foo: {x: int, y: int}) { }
diff --git a/src/test/compile-fail/minus-string.rs b/src/test/compile-fail/minus-string.rs
index def6124960e..e30a2dbe7df 100644
--- a/src/test/compile-fail/minus-string.rs
+++ b/src/test/compile-fail/minus-string.rs
@@ -1,5 +1,3 @@
 // error-pattern:applying unary minus to non-numeric type str
 
-fn main() {
-    -"foo";
-}
\ No newline at end of file
+fn main() { -"foo"; }
diff --git a/src/test/compile-fail/missing-main.rs b/src/test/compile-fail/missing-main.rs
index 1c59427fa9c..e531cbdc6cc 100644
--- a/src/test/compile-fail/missing-main.rs
+++ b/src/test/compile-fail/missing-main.rs
@@ -1,2 +1,2 @@
 // error-pattern:main function not found
-fn mian() { }
\ No newline at end of file
+fn mian() { }
diff --git a/src/test/compile-fail/missing-return2.rs b/src/test/compile-fail/missing-return2.rs
index af1612b1323..0fc48fd950a 100644
--- a/src/test/compile-fail/missing-return2.rs
+++ b/src/test/compile-fail/missing-return2.rs
@@ -7,4 +7,4 @@ fn f() -> int {
     alt true { true { } }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/move-arg.rs b/src/test/compile-fail/move-arg.rs
index cd348231d91..9b60e5dae9a 100644
--- a/src/test/compile-fail/move-arg.rs
+++ b/src/test/compile-fail/move-arg.rs
@@ -1,10 +1,4 @@
 // error-pattern: Unsatisfied precondition constraint
-fn test(foo: -int) {
-    assert (foo == 10);
-}
+fn test(foo: -int) { assert (foo == 10); }
 
-fn main() {
-    let x = 10;
-    test(x);
-    log x;
-}
\ No newline at end of file
+fn main() { let x = 10; test(x); log x; }
diff --git a/src/test/compile-fail/native-type-mismatch.rs b/src/test/compile-fail/native-type-mismatch.rs
index daa2c9fa96b..ddb6375e36d 100644
--- a/src/test/compile-fail/native-type-mismatch.rs
+++ b/src/test/compile-fail/native-type-mismatch.rs
@@ -4,4 +4,4 @@ use std;
 fn main() {
     let f: std::os::libc::FILE = std::io::rustrt::rust_get_stdin();
     std::os::libc::fopen(f, f);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/nested-ty-params.rs b/src/test/compile-fail/nested-ty-params.rs
index 413ea883618..7a249c657fd 100644
--- a/src/test/compile-fail/nested-ty-params.rs
+++ b/src/test/compile-fail/nested-ty-params.rs
@@ -1,6 +1,6 @@
 // error-pattern:Attempt to use a type argument out of scope
 fn hd<U>(v: &[U]) -> U {
-    fn hd1(w: &[U]) -> U { ret w.(0); }
+    fn hd1(w: &[U]) -> U { ret w[0]; }
 
     ret hd1(v);
 }
diff --git a/src/test/compile-fail/no-constraint-prop.rs b/src/test/compile-fail/no-constraint-prop.rs
index 2f98c4917b0..65e21baf78b 100644
--- a/src/test/compile-fail/no-constraint-prop.rs
+++ b/src/test/compile-fail/no-constraint-prop.rs
@@ -17,4 +17,4 @@ fn main() {
     // prestate.
     let d <- a;
     log safe_slice("kitties", b, d);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/no-self-dispatch.rs b/src/test/compile-fail/no-self-dispatch.rs
index b23092b6409..876c668e8c6 100644
--- a/src/test/compile-fail/no-self-dispatch.rs
+++ b/src/test/compile-fail/no-self-dispatch.rs
@@ -3,4 +3,4 @@ obj oT() {
     fn get() -> int { ret 3; }
     fn foo() { let c = get(); }
 }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/not-a-pred-2.rs b/src/test/compile-fail/not-a-pred-2.rs
index 63aad9b37df..852db46e9df 100644
--- a/src/test/compile-fail/not-a-pred-2.rs
+++ b/src/test/compile-fail/not-a-pred-2.rs
@@ -7,4 +7,5 @@ fn main() {
                2); // should fail to typecheck, as (a == b)
                    // is not a manifest call
 
-}
\ No newline at end of file
+
+}
diff --git a/src/test/compile-fail/not-a-pred-3.rs b/src/test/compile-fail/not-a-pred-3.rs
index 5ec15e9c653..3ca98a5c1ce 100644
--- a/src/test/compile-fail/not-a-pred-3.rs
+++ b/src/test/compile-fail/not-a-pred-3.rs
@@ -10,4 +10,4 @@ fn main() {
     let z = f();
     // should fail to typecheck, as z.g isn't an explicit name
     check (z.g(42));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/not-a-pred-check.rs b/src/test/compile-fail/not-a-pred-check.rs
index 20a0b5a7070..8ba91d0e26e 100644
--- a/src/test/compile-fail/not-a-pred-check.rs
+++ b/src/test/compile-fail/not-a-pred-check.rs
@@ -7,4 +7,4 @@ fn main() {
     let x = 0;
 
     check (f(x));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/not-a-pred.rs b/src/test/compile-fail/not-a-pred.rs
index 3e76ef9601c..80e227ffb16 100644
--- a/src/test/compile-fail/not-a-pred.rs
+++ b/src/test/compile-fail/not-a-pred.rs
@@ -1,8 +1,8 @@
 // -*- rust -*-
 // error-pattern: Non-predicate in constraint: lt
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 obj lt(a: int, b: int) { }
 
-fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); }
\ No newline at end of file
+fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); }
diff --git a/src/test/compile-fail/not-pred-args.rs b/src/test/compile-fail/not-pred-args.rs
index e73cd18dac7..6ba399ba00c 100644
--- a/src/test/compile-fail/not-pred-args.rs
+++ b/src/test/compile-fail/not-pred-args.rs
@@ -8,4 +8,4 @@ fn main() {
     // should fail to typecheck, as pred args must be slot variables
     // or literals
     check (f(42 * 17));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/occurs-check-2.rs b/src/test/compile-fail/occurs-check-2.rs
index 20a4cf314c4..6c600158d21 100644
--- a/src/test/compile-fail/occurs-check-2.rs
+++ b/src/test/compile-fail/occurs-check-2.rs
@@ -1,6 +1,2 @@
 // error-pattern: Type inference failed because I could not find
-fn main() {
-    let f;
-    f = @f;
-    f();
-}
\ No newline at end of file
+fn main() { let f; f = @f; f(); }
diff --git a/src/test/compile-fail/occurs-check.rs b/src/test/compile-fail/occurs-check.rs
index 16b2f94045e..aba5b5c5928 100644
--- a/src/test/compile-fail/occurs-check.rs
+++ b/src/test/compile-fail/occurs-check.rs
@@ -1,5 +1,2 @@
 // error-pattern: Type inference failed because I could not find
-fn main() {
-    let f;
-    f = @f;
-}
+fn main() { let f; f = @f; }
diff --git a/src/test/compile-fail/or-init.rs b/src/test/compile-fail/or-init.rs
index 8c952b0d93f..8103864c154 100644
--- a/src/test/compile-fail/or-init.rs
+++ b/src/test/compile-fail/or-init.rs
@@ -5,4 +5,4 @@ fn main() {
 
     log false || { i = 5; true };
     log i;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/or-patter-mismatch.rs b/src/test/compile-fail/or-patter-mismatch.rs
index d7525d7b627..dc71c2c1e42 100644
--- a/src/test/compile-fail/or-patter-mismatch.rs
+++ b/src/test/compile-fail/or-patter-mismatch.rs
@@ -2,4 +2,4 @@
 
 tag blah { a(int, int, uint); b(int, int); }
 
-fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } }
\ No newline at end of file
+fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } }
diff --git a/src/test/compile-fail/output-type-mismatch.rs b/src/test/compile-fail/output-type-mismatch.rs
index 38ee7b5a6be..c4ec5bef8c6 100644
--- a/src/test/compile-fail/output-type-mismatch.rs
+++ b/src/test/compile-fail/output-type-mismatch.rs
@@ -2,4 +2,4 @@
 
 fn f() { }
 
-fn main() { let i: int; i = f(); }
\ No newline at end of file
+fn main() { let i: int; i = f(); }
diff --git a/src/test/compile-fail/pred-assign.rs b/src/test/compile-fail/pred-assign.rs
index 0e5ddf23a47..10c6f1443ec 100644
--- a/src/test/compile-fail/pred-assign.rs
+++ b/src/test/compile-fail/pred-assign.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -13,4 +13,4 @@ fn main() {
     check (lt(a, b));
     a = 24;
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/pred-not-bool.rs b/src/test/compile-fail/pred-not-bool.rs
index 024ff5216f9..50344120a98 100644
--- a/src/test/compile-fail/pred-not-bool.rs
+++ b/src/test/compile-fail/pred-not-bool.rs
@@ -7,4 +7,4 @@
 
 pred bad(a: int) -> int { ret 37; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/pred-on-wrong-slots.rs b/src/test/compile-fail/pred-on-wrong-slots.rs
index de0faef653b..9e6c86c0737 100644
--- a/src/test/compile-fail/pred-on-wrong-slots.rs
+++ b/src/test/compile-fail/pred-on-wrong-slots.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: lt(a, c)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -14,4 +14,4 @@ fn main() {
     check (lt(b, c));
     f(a, b);
     f(a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/pred-swap.rs b/src/test/compile-fail/pred-swap.rs
index 9e96b74ad69..8fe7b19acf5 100644
--- a/src/test/compile-fail/pred-swap.rs
+++ b/src/test/compile-fail/pred-swap.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -13,4 +13,4 @@ fn main() {
     check (lt(a, b));
     b <-> a;
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/rec-extend.rs b/src/test/compile-fail/rec-extend.rs
index 773f06fb205..35f884fbff9 100644
--- a/src/test/compile-fail/rec-extend.rs
+++ b/src/test/compile-fail/rec-extend.rs
@@ -5,4 +5,4 @@ fn main() {
     let a = {foo: 0};
 
     let b = {foo: true with a};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/rec-missing-fields.rs b/src/test/compile-fail/rec-missing-fields.rs
index 50bf16c9a20..50bcf32dd7f 100644
--- a/src/test/compile-fail/rec-missing-fields.rs
+++ b/src/test/compile-fail/rec-missing-fields.rs
@@ -6,4 +6,4 @@
 
 type point = {x: int, y: int};
 
-fn main() { let p: point = {x: 10}; log p.y; }
\ No newline at end of file
+fn main() { let p: point = {x: 10}; log p.y; }
diff --git a/src/test/compile-fail/ret-non-nil.rs b/src/test/compile-fail/ret-non-nil.rs
index 7c483ed4194..71db7e4192f 100644
--- a/src/test/compile-fail/ret-non-nil.rs
+++ b/src/test/compile-fail/ret-non-nil.rs
@@ -4,4 +4,4 @@ fn f() { ret; }
 
 fn g() -> int { ret; }
 
-fn main() { f(); g(); }
\ No newline at end of file
+fn main() { f(); g(); }
diff --git a/src/test/compile-fail/return-uninit.rs b/src/test/compile-fail/return-uninit.rs
index 34b7a6b5af0..1978ec5f420 100644
--- a/src/test/compile-fail/return-uninit.rs
+++ b/src/test/compile-fail/return-uninit.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { let x: int; ret x; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/compile-fail/self-call-non-obj.rs b/src/test/compile-fail/self-call-non-obj.rs
index 6fd8bee270b..6261fda60ac 100644
--- a/src/test/compile-fail/self-call-non-obj.rs
+++ b/src/test/compile-fail/self-call-non-obj.rs
@@ -7,4 +7,4 @@ fn main() {
 
     self.foo();
 
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/slot-as-pred.rs b/src/test/compile-fail/slot-as-pred.rs
index 0220a16f087..820ebd655f5 100644
--- a/src/test/compile-fail/slot-as-pred.rs
+++ b/src/test/compile-fail/slot-as-pred.rs
@@ -1,7 +1,7 @@
 // -*- rust -*-
 // error-pattern: unresolved name: lt
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 fn main() {
     let lt: int;
@@ -9,4 +9,4 @@ fn main() {
     let b: int = 23;
     check (lt(a, b));
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/spawn-non-nil-fn.rs b/src/test/compile-fail/spawn-non-nil-fn.rs
index dfc5471f4de..4d3d13373dc 100644
--- a/src/test/compile-fail/spawn-non-nil-fn.rs
+++ b/src/test/compile-fail/spawn-non-nil-fn.rs
@@ -5,4 +5,4 @@ import std::task;
 
 fn f(x: int) -> int { ret x; }
 
-fn main() { task::_spawn(bind f(10)); }
\ No newline at end of file
+fn main() { task::_spawn(bind f(10)); }
diff --git a/src/test/compile-fail/swap-no-lval.rs b/src/test/compile-fail/swap-no-lval.rs
index a45f524fe09..2bb54464157 100644
--- a/src/test/compile-fail/swap-no-lval.rs
+++ b/src/test/compile-fail/swap-no-lval.rs
@@ -1,3 +1,3 @@
 // error-pattern: assignment to non-lvalue
 
-fn main() { 5 <-> 3; }
\ No newline at end of file
+fn main() { 5 <-> 3; }
diff --git a/src/test/compile-fail/swap-uninit.rs b/src/test/compile-fail/swap-uninit.rs
index e06d539702b..27fdc611379 100644
--- a/src/test/compile-fail/swap-uninit.rs
+++ b/src/test/compile-fail/swap-uninit.rs
@@ -1,3 +1,3 @@
 // error-pattern:Unsatisfied precondition
 
-fn main() { let x = 3; let y; x <-> y; }
\ No newline at end of file
+fn main() { let x = 3; let y; x <-> y; }
diff --git a/src/test/compile-fail/tail-typeck.rs b/src/test/compile-fail/tail-typeck.rs
index 7dd315b929b..c121458f233 100644
--- a/src/test/compile-fail/tail-typeck.rs
+++ b/src/test/compile-fail/tail-typeck.rs
@@ -4,4 +4,4 @@ fn f() -> int { be g(); }
 
 fn g() -> uint { ret 0u; }
 
-fn main() { let y = f(); }
\ No newline at end of file
+fn main() { let y = f(); }
diff --git a/src/test/compile-fail/type-arg-out-of-scope.rs b/src/test/compile-fail/type-arg-out-of-scope.rs
index a3ae6619b3e..19be0933c48 100644
--- a/src/test/compile-fail/type-arg-out-of-scope.rs
+++ b/src/test/compile-fail/type-arg-out-of-scope.rs
@@ -1,5 +1,5 @@
 // error-pattern:Attempt to use a type argument out of scope
 fn foo<T>(x: &T) {
-    fn bar(f: fn(&T) -> T ) { }
+    fn bar(f: fn(&T) -> T) { }
 }
 fn main() { foo(1); }
diff --git a/src/test/compile-fail/type-mismatch-multiple.rs b/src/test/compile-fail/type-mismatch-multiple.rs
index 9a7a4b588a7..363af271986 100644
--- a/src/test/compile-fail/type-mismatch-multiple.rs
+++ b/src/test/compile-fail/type-mismatch-multiple.rs
@@ -2,4 +2,4 @@
 // error-pattern:mismatched types: expected bool
 // error-pattern:mismatched types: expected int
 
-fn main() { let a: bool = 1; let b: int = true; }
\ No newline at end of file
+fn main() { let a: bool = 1; let b: int = true; }
diff --git a/src/test/compile-fail/type-mismatch.rs b/src/test/compile-fail/type-mismatch.rs
index a0e257dcd8f..d2ddf61b0bc 100644
--- a/src/test/compile-fail/type-mismatch.rs
+++ b/src/test/compile-fail/type-mismatch.rs
@@ -1,4 +1,4 @@
 // error-pattern:expected bool but found int
 // issue #516
 
-fn main() { let x = true; let y = 1; let z = x + y; }
\ No newline at end of file
+fn main() { let x = true; let y = 1; let z = x + y; }
diff --git a/src/test/compile-fail/type-recursive.rs b/src/test/compile-fail/type-recursive.rs
index d7ba8faa288..c38c6f5d244 100644
--- a/src/test/compile-fail/type-recursive.rs
+++ b/src/test/compile-fail/type-recursive.rs
@@ -1,4 +1,4 @@
 // error-pattern:illegal recursive type
 type t1 = {foo: int, foolish: t1};
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/type-shadow.rs b/src/test/compile-fail/type-shadow.rs
index 52022cf67fc..9f26de765be 100644
--- a/src/test/compile-fail/type-shadow.rs
+++ b/src/test/compile-fail/type-shadow.rs
@@ -9,4 +9,4 @@ fn main() {
         type X = str;
         let y: Y = "hello";
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unreachable-arm.rs b/src/test/compile-fail/unreachable-arm.rs
index eaf5d75702f..ee637fed666 100644
--- a/src/test/compile-fail/unreachable-arm.rs
+++ b/src/test/compile-fail/unreachable-arm.rs
@@ -2,4 +2,4 @@
 
 tag foo { a(@foo, int); b(uint); }
 
-fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } }
\ No newline at end of file
+fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } }
diff --git a/src/test/compile-fail/unsafe-alias-2.rs b/src/test/compile-fail/unsafe-alias-2.rs
index 3917dd3f883..ad7296ef1b4 100644
--- a/src/test/compile-fail/unsafe-alias-2.rs
+++ b/src/test/compile-fail/unsafe-alias-2.rs
@@ -5,4 +5,4 @@ fn whoknows(x: @mutable int) { *x = 10; }
 fn main() {
     let box = @mutable 1;
     alt *box { x { whoknows(box); log_err x; } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unsafe-alias.rs b/src/test/compile-fail/unsafe-alias.rs
index 46fb135b951..80eaa661d1d 100644
--- a/src/test/compile-fail/unsafe-alias.rs
+++ b/src/test/compile-fail/unsafe-alias.rs
@@ -1,7 +1,7 @@
 // error-pattern:may alias with argument
 
-fn foo(x: &int, f: fn() ) { log x; }
+fn foo(x: &int, f: fn()) { log x; }
 
 fn whoknows(x: @mutable int) { *x = 10; }
 
-fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); }
\ No newline at end of file
+fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); }
diff --git a/src/test/compile-fail/unsafe-alt.rs b/src/test/compile-fail/unsafe-alt.rs
index 2e0605fa055..fb42b188a7c 100644
--- a/src/test/compile-fail/unsafe-alt.rs
+++ b/src/test/compile-fail/unsafe-alt.rs
@@ -5,4 +5,4 @@ tag foo { left(int); right(bool); }
 fn main() {
     let x = left(10);
     alt x { left(i) { x = right(false); log i; } _ { } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unsafe-for.rs b/src/test/compile-fail/unsafe-for.rs
index 43e8b9cb7c2..22d5396c1cb 100644
--- a/src/test/compile-fail/unsafe-for.rs
+++ b/src/test/compile-fail/unsafe-for.rs
@@ -1,6 +1,6 @@
 // error-pattern:invalidate alias x
 
 fn main() {
-    let v: [mutable int] = ~[mutable 1, 2, 3];
-    for x: int in v { v.(0) = 10; log x; }
+    let v: [mutable int] = [mutable 1, 2, 3];
+    for x: int in v { v[0] = 10; log x; }
 }
diff --git a/src/test/compile-fail/unsafe-mutable-alias.rs b/src/test/compile-fail/unsafe-mutable-alias.rs
index f438d021a25..2f2a395778e 100644
--- a/src/test/compile-fail/unsafe-mutable-alias.rs
+++ b/src/test/compile-fail/unsafe-mutable-alias.rs
@@ -2,4 +2,4 @@
 
 fn f(a: &int, b: &mutable int) -> int { b += 1; ret a + b; }
 
-fn main() { let i = 4; log f(i, i); }
\ No newline at end of file
+fn main() { let i = 4; log f(i, i); }
diff --git a/src/test/compile-fail/use-after-move.rs b/src/test/compile-fail/use-after-move.rs
index ff20307fece..3fb1827441e 100644
--- a/src/test/compile-fail/use-after-move.rs
+++ b/src/test/compile-fail/use-after-move.rs
@@ -1,2 +1,2 @@
 // error-pattern: Unsatisfied precondition constraint (for example, init(x
-fn main() { let x = @5; let y <- x; log *x; }
\ No newline at end of file
+fn main() { let x = @5; let y <- x; log *x; }
diff --git a/src/test/compile-fail/use-after-send.rs b/src/test/compile-fail/use-after-send.rs
index 212fa50a506..965c262237d 100644
--- a/src/test/compile-fail/use-after-send.rs
+++ b/src/test/compile-fail/use-after-send.rs
@@ -1,9 +1,5 @@
 // error-pattern: Unsatisfied precondition constraint
-fn send<~T>(ch : _chan<T>, data : -T) {
-    log ch;
-    log data;
-    fail;
-}
+fn send<~T>(ch: _chan<T>, data: -T) { log ch; log data; fail; }
 type _chan<T> = int;
 
 // Tests that "log message;" is flagged as using
@@ -13,6 +9,4 @@ fn test00_start(ch: _chan<int>, message: int, count: int) {
     log message;
 }
 
-fn main() {
-    fail;
-}
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/compile-fail/use-meta-dup.rs b/src/test/compile-fail/use-meta-dup.rs
index 5e44999b595..04d67263c36 100644
--- a/src/test/compile-fail/use-meta-dup.rs
+++ b/src/test/compile-fail/use-meta-dup.rs
@@ -2,4 +2,4 @@
 
 use std(name = "std", name = "nonstd");
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/use-meta-mismatch.rs b/src/test/compile-fail/use-meta-mismatch.rs
index a2adca83cd4..fef50525a1e 100644
--- a/src/test/compile-fail/use-meta-mismatch.rs
+++ b/src/test/compile-fail/use-meta-mismatch.rs
@@ -2,4 +2,4 @@
 
 use std(complex(meta(item)));
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/use-uninit-2.rs b/src/test/compile-fail/use-uninit-2.rs
index d46c340a9df..4d35567ea4f 100644
--- a/src/test/compile-fail/use-uninit-2.rs
+++ b/src/test/compile-fail/use-uninit-2.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); }
diff --git a/src/test/compile-fail/use-uninit-3.rs b/src/test/compile-fail/use-uninit-3.rs
index cf680f0c184..5b7c619f36f 100644
--- a/src/test/compile-fail/use-uninit-3.rs
+++ b/src/test/compile-fail/use-uninit-3.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); }
diff --git a/src/test/compile-fail/use-uninit.rs b/src/test/compile-fail/use-uninit.rs
index b787947fe7b..75e60bdbce3 100644
--- a/src/test/compile-fail/use-uninit.rs
+++ b/src/test/compile-fail/use-uninit.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; foo(x); }
\ No newline at end of file
+fn main() { let x: int; foo(x); }
diff --git a/src/test/compile-fail/vec-field.rs b/src/test/compile-fail/vec-field.rs
index 10a222f5cd0..1ec888670c4 100644
--- a/src/test/compile-fail/vec-field.rs
+++ b/src/test/compile-fail/vec-field.rs
@@ -2,7 +2,7 @@
 // issue #367
 
 fn f() {
-    let v = ~[1];
+    let v = [1];
     log v.some_field_name; //type error
 }
 
diff --git a/src/test/compile-fail/vector-no-ann.rs b/src/test/compile-fail/vector-no-ann.rs
index 087fa20d076..80463e3ead3 100644
--- a/src/test/compile-fail/vector-no-ann.rs
+++ b/src/test/compile-fail/vector-no-ann.rs
@@ -1,2 +1,2 @@
 // error-pattern:cannot determine a type
-fn main() { let foo = []; }
\ No newline at end of file
+fn main() { let foo = []; }
diff --git a/src/test/compile-fail/while-bypass.rs b/src/test/compile-fail/while-bypass.rs
index 7fa5ccb37a5..e70090dd59e 100644
--- a/src/test/compile-fail/while-bypass.rs
+++ b/src/test/compile-fail/while-bypass.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { let x: int; while true { x = 10; } ret x; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/compile-fail/while-expr.rs b/src/test/compile-fail/while-expr.rs
index 8da769a29fd..5ff3adf34c3 100644
--- a/src/test/compile-fail/while-expr.rs
+++ b/src/test/compile-fail/while-expr.rs
@@ -1,3 +1,3 @@
 // error-pattern: precondition constraint
 
-fn main() { let x: bool; while x { } }
\ No newline at end of file
+fn main() { let x: bool; while x { } }
diff --git a/src/test/compile-fail/while-loop-constraints.rs b/src/test/compile-fail/while-loop-constraints.rs
index 9d936f62fdb..557ff099cbf 100644
--- a/src/test/compile-fail/while-loop-constraints.rs
+++ b/src/test/compile-fail/while-loop-constraints.rs
@@ -4,4 +4,4 @@ fn main() {
     let y: int = 42;
     let x: int;
     while true { log y; while true { while true { while true { x <- y; } } } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/while-loop-pred-constraints.rs b/src/test/compile-fail/while-loop-pred-constraints.rs
index 43e662d643c..5920d25230f 100644
--- a/src/test/compile-fail/while-loop-pred-constraints.rs
+++ b/src/test/compile-fail/while-loop-pred-constraints.rs
@@ -13,4 +13,4 @@ fn main() {
         print_even(y);
         while true { while true { while true { y += x; } } }
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/writing-through-read-alias.rs b/src/test/compile-fail/writing-through-read-alias.rs
index bc3f9037da9..2cfcb31ccbc 100644
--- a/src/test/compile-fail/writing-through-read-alias.rs
+++ b/src/test/compile-fail/writing-through-read-alias.rs
@@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int};
 
 fn f(p: &point) { p.x = 13; }
 
-fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
\ No newline at end of file
+fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
diff --git a/src/test/compile-fail/writing-through-uninit-vec.rs b/src/test/compile-fail/writing-through-uninit-vec.rs
index 7397773d940..0462824c276 100644
--- a/src/test/compile-fail/writing-through-uninit-vec.rs
+++ b/src/test/compile-fail/writing-through-uninit-vec.rs
@@ -1,5 +1,5 @@
 // error-pattern: Unsatisfied precondition constraint
 
-fn test() { let w: [int]; w.(5) = 0; }
+fn test() { let w: [int]; w[5] = 0; }
 
 fn main() { test(); }
diff --git a/src/test/compile-fail/writing-to-immutable-obj.rs b/src/test/compile-fail/writing-to-immutable-obj.rs
index 484afd91a3e..cc35f545120 100644
--- a/src/test/compile-fail/writing-to-immutable-obj.rs
+++ b/src/test/compile-fail/writing-to-immutable-obj.rs
@@ -2,4 +2,4 @@
 obj objy(x: int) {
     fn foo() { x = 5; }
 }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/writing-to-immutable-rec.rs b/src/test/compile-fail/writing-to-immutable-rec.rs
index c40c6934f5c..ad0ceed8ee3 100644
--- a/src/test/compile-fail/writing-to-immutable-rec.rs
+++ b/src/test/compile-fail/writing-to-immutable-rec.rs
@@ -1,2 +1,2 @@
 // error-pattern: assignment to immutable field
-fn main() { let r: {x: int} = {x: 1}; r.x = 6; }
\ No newline at end of file
+fn main() { let r: {x: int} = {x: 1}; r.x = 6; }
diff --git a/src/test/compile-fail/writing-to-immutable-vec.rs b/src/test/compile-fail/writing-to-immutable-vec.rs
index d800288dd92..6f0f7c53504 100644
--- a/src/test/compile-fail/writing-to-immutable-vec.rs
+++ b/src/test/compile-fail/writing-to-immutable-vec.rs
@@ -1,2 +1,2 @@
 // error-pattern:assignment to immutable vec content
-fn main() { let v: [int] = ~[1, 2, 3]; v.(1) = 4; }
+fn main() { let v: [int] = [1, 2, 3]; v[1] = 4; }
diff --git a/src/test/compile-fail/wrong-ret-type.rs b/src/test/compile-fail/wrong-ret-type.rs
index b4435086cdd..82293a8f706 100644
--- a/src/test/compile-fail/wrong-ret-type.rs
+++ b/src/test/compile-fail/wrong-ret-type.rs
@@ -1,3 +1,3 @@
 // error-pattern: mismatched types
 fn mk_int() -> uint { let i: int = 3; ret i; }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compiletest/common.rs b/src/test/compiletest/common.rs
index 85b7be9b00f..ab0415fd7c1 100644
--- a/src/test/compiletest/common.rs
+++ b/src/test/compiletest/common.rs
@@ -1,38 +1,32 @@
 import std::option;
 
-tag mode {
-    mode_compile_fail;
-    mode_run_fail;
-    mode_run_pass;
-    mode_pretty;
-}
+tag mode { mode_compile_fail; mode_run_fail; mode_run_pass; mode_pretty; }
 
-type config = {
+type config =
     // The library paths required for running the compiler
-    compile_lib_path: str,
     // The library paths required for running compiled programs
-    run_lib_path: str,
     // The rustc executable
-    rustc_path: str,
     // The directory containing the tests to run
-    src_base: str,
     // The directory where programs should be built
-    build_base: str,
     // The name of the stage being built (stage1, etc)
-    stage_id: str,
     // The test mode, compile-fail, run-fail, run-pass
-    mode: mode,
     // Run ignored tests
-    run_ignored: bool,
     // Only run tests that match this filter
-    filter: option::t<str>,
     // A command line to prefix program execution with,
     // for running under valgrind
-    runtool: option::t<str>,
     // Flags to pass to the compiler
-    rustcflags: option::t<str>,
     // Explain what's going on
-    verbose: bool
-};
+    {compile_lib_path: str,
+     run_lib_path: str,
+     rustc_path: str,
+     src_base: str,
+     build_base: str,
+     stage_id: str,
+     mode: mode,
+     run_ignored: bool,
+     filter: option::t<str>,
+     runtool: option::t<str>,
+     rustcflags: option::t<str>,
+     verbose: bool};
 
 type cx = {config: config, procsrv: procsrv::handle};
diff --git a/src/test/compiletest/compiletest.rs b/src/test/compiletest/compiletest.rs
index 9bbc30de519..d045875e295 100644
--- a/src/test/compiletest/compiletest.rs
+++ b/src/test/compiletest/compiletest.rs
@@ -31,12 +31,12 @@ fn main(args: [str]) {
 
 fn parse_config(args: &[str]) -> config {
     let opts =
-        ~[getopts::reqopt("compile-lib-path"),
-          getopts::reqopt("run-lib-path"), getopts::reqopt("rustc-path"),
-          getopts::reqopt("src-base"), getopts::reqopt("build-base"),
-          getopts::reqopt("stage-id"), getopts::reqopt("mode"),
-          getopts::optflag("ignored"), getopts::optopt("runtool"),
-          getopts::optopt("rustcflags"), getopts::optflag("verbose")];
+        [getopts::reqopt("compile-lib-path"), getopts::reqopt("run-lib-path"),
+         getopts::reqopt("rustc-path"), getopts::reqopt("src-base"),
+         getopts::reqopt("build-base"), getopts::reqopt("stage-id"),
+         getopts::reqopt("mode"), getopts::optflag("ignored"),
+         getopts::optopt("runtool"), getopts::optopt("rustcflags"),
+         getopts::optflag("verbose")];
 
     check (vec::is_not_empty(args));
     let args_ = vec::tail(args);
@@ -56,7 +56,7 @@ fn parse_config(args: &[str]) -> config {
          run_ignored: getopts::opt_present(match, "ignored"),
          filter:
              if vec::len(match.free) > 0u {
-                 option::some(match.free.(0))
+                 option::some(match.free[0])
              } else { option::none },
          runtool: getopts::opt_maybe_str(match, "runtool"),
          rustcflags: getopts::opt_maybe_str(match, "rustcflags"),
@@ -65,20 +65,20 @@ fn parse_config(args: &[str]) -> config {
 
 fn log_config(config: &config) {
     let c = config;
-    logv(c, #fmt("configuration:"));
-    logv(c, #fmt("compile_lib_path: %s", config.compile_lib_path));
-    logv(c, #fmt("run_lib_path: %s", config.run_lib_path));
-    logv(c, #fmt("rustc_path: %s", config.rustc_path));
-    logv(c, #fmt("src_base: %s", config.src_base));
-    logv(c, #fmt("build_base: %s", config.build_base));
-    logv(c, #fmt("stage_id: %s", config.stage_id));
-    logv(c, #fmt("mode: %s", mode_str(config.mode)));
-    logv(c, #fmt("run_ignored: %b", config.run_ignored));
-    logv(c, #fmt("filter: %s", opt_str(config.filter)));
-    logv(c, #fmt("runtool: %s", opt_str(config.runtool)));
-    logv(c, #fmt("rustcflags: %s", opt_str(config.rustcflags)));
-    logv(c, #fmt("verbose: %b", config.verbose));
-    logv(c, #fmt("\n"));
+    logv(c, #fmt["configuration:"]);
+    logv(c, #fmt["compile_lib_path: %s", config.compile_lib_path]);
+    logv(c, #fmt["run_lib_path: %s", config.run_lib_path]);
+    logv(c, #fmt["rustc_path: %s", config.rustc_path]);
+    logv(c, #fmt["src_base: %s", config.src_base]);
+    logv(c, #fmt["build_base: %s", config.build_base]);
+    logv(c, #fmt["stage_id: %s", config.stage_id]);
+    logv(c, #fmt["mode: %s", mode_str(config.mode)]);
+    logv(c, #fmt["run_ignored: %b", config.run_ignored]);
+    logv(c, #fmt["filter: %s", opt_str(config.filter)]);
+    logv(c, #fmt["runtool: %s", opt_str(config.runtool)]);
+    logv(c, #fmt["rustcflags: %s", opt_str(config.rustcflags)]);
+    logv(c, #fmt["verbose: %b", config.verbose]);
+    logv(c, #fmt["\n"]);
 }
 
 fn opt_str(maybestr: option::t<str>) -> str {
@@ -121,16 +121,16 @@ fn test_opts(config: &config) -> test::test_opts {
 }
 
 type tests_and_conv_fn =
-    {tests: [test::test_desc], to_task: fn(&fn() ) -> test::joinable };
+    {tests: [test::test_desc], to_task: fn(&fn()) -> test::joinable};
 
 fn make_tests(cx: &cx) -> tests_and_conv_fn {
-    log #fmt("making tests from %s", cx.config.src_base);
+    log #fmt["making tests from %s", cx.config.src_base];
     let configport = mk_port::<[u8]>();
-    let tests = ~[];
+    let tests = [];
     for file: str in fs::list_dir(cx.config.src_base) {
-        log #fmt("inspecting file %s", file);
+        log #fmt["inspecting file %s", file];
         if is_test(cx.config, file) {
-            tests += ~[make_test(cx, file, configport)];
+            tests += [make_test(cx, file, configport)];
         }
     }
     ret {tests: tests, to_task: bind closure_to_task(cx, configport, _)};
@@ -138,11 +138,9 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn {
 
 fn is_test(config: &config, testfile: &str) -> bool {
     // Pretty-printer does not work with .rc files yet
-    let valid_extensions = alt config.mode {
-      mode_pretty. { ~[".rs"] }
-      _ { ~[".rc", ".rs"] }
-    };
-    let invalid_prefixes = ~[".", "#", "~"];
+    let valid_extensions =
+        alt config.mode { mode_pretty. { [".rs"] } _ { [".rc", ".rs"] } };
+    let invalid_prefixes = [".", "#", "~"];
     let name = fs::basename(testfile);
 
     let valid = false;
@@ -166,7 +164,7 @@ fn make_test(cx: &cx, testfile: &str, configport: &_port<[u8]>) ->
 }
 
 fn make_test_name(config: &config, testfile: &str) -> str {
-    #fmt("[%s] %s", mode_str(config.mode), testfile)
+    #fmt["[%s] %s", mode_str(config.mode), testfile]
 }
 
 /*
@@ -188,8 +186,8 @@ up. Then we'll spawn that data into another task and return the task.
 Really convoluted. Need to think up of a better definition for tests.
 */
 
-fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) -> test::test_fn
-{
+fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) ->
+   test::test_fn {
     bind send_config(testfile, configchan)
 }
 
@@ -207,25 +205,19 @@ break up the config record and pass everything individually to the spawned
 function.
 */
 
-fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn() )
-    -> test::joinable
-{
+fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn()) ->
+   test::joinable {
     testfn();
     let testfile = configport.recv();
-    let testthunk = bind run_test_task(cx.config.compile_lib_path,
-                                       cx.config.run_lib_path,
-                                       cx.config.rustc_path,
-                                       cx.config.src_base,
-                                       cx.config.build_base,
-                                       cx.config.stage_id,
-                                       mode_str(cx.config.mode),
-                                       cx.config.run_ignored,
-                                       opt_str(cx.config.filter),
-                                       opt_str(cx.config.runtool),
-                                       opt_str(cx.config.rustcflags),
-                                       cx.config.verbose,
-                                       cx.procsrv.chan,
-                                       testfile);
+    let testthunk =
+        bind run_test_task(cx.config.compile_lib_path, cx.config.run_lib_path,
+                           cx.config.rustc_path, cx.config.src_base,
+                           cx.config.build_base, cx.config.stage_id,
+                           mode_str(cx.config.mode), cx.config.run_ignored,
+                           opt_str(cx.config.filter),
+                           opt_str(cx.config.runtool),
+                           opt_str(cx.config.rustcflags), cx.config.verbose,
+                           cx.procsrv.chan, testfile);
     ret task::spawn_joinable(testthunk);
 }
 
diff --git a/src/test/compiletest/procsrv.rs b/src/test/compiletest/procsrv.rs
index d434562cf3c..6e464038b18 100644
--- a/src/test/compiletest/procsrv.rs
+++ b/src/test/compiletest/procsrv.rs
@@ -30,24 +30,20 @@ type reqchan = chan<request>;
 
 type handle = {task: option::t<task_id>, chan: reqchan};
 
-tag request {
-    exec([u8], [u8], [[u8]], chan<response>);
-    stop;
-}
+tag request { exec([u8], [u8], [[u8]], chan<response>); stop; }
 
 type response = {pid: int, infd: int, outfd: int, errfd: int};
 
 fn mk() -> handle {
     let setupport = port();
-    let task = task::spawn(bind fn(setupchan: chan<chan<request>>) {
-        let reqport = port();
-        let reqchan = chan(reqport);
-        send(setupchan, reqchan);
-        worker(reqport);
-    } (chan(setupport)));
-    ret {task: option::some(task),
-         chan: recv(setupport)
-        };
+    let task =
+        task::spawn(bind fn (setupchan: chan<chan<request>>) {
+                             let reqport = port();
+                             let reqchan = chan(reqport);
+                             send(setupchan, reqchan);
+                             worker(reqport);
+                         }(chan(setupport)));
+    ret {task: option::some(task), chan: recv(setupport)};
 }
 
 fn from_chan(ch: &reqchan) -> handle { {task: option::none, chan: ch} }
@@ -57,15 +53,13 @@ fn close(handle: &handle) {
     task::join_id(option::get(handle.task));
 }
 
-fn run(handle: &handle, lib_path: &str,
-       prog: &str, args: &[str], input: &option::t<str>) ->
-{status: int, out: str, err: str} {
+fn run(handle: &handle, lib_path: &str, prog: &str, args: &[str],
+       input: &option::t<str>) -> {status: int, out: str, err: str} {
     let p = port();
     let ch = chan(p);
-    send(handle.chan, exec(str::bytes(lib_path),
-                           str::bytes(prog),
-                           clone_vecstr(args),
-                           ch));
+    send(handle.chan,
+         exec(str::bytes(lib_path), str::bytes(prog), clone_vecstr(args),
+              ch));
     let resp = recv(p);
 
     writeclose(resp.infd, input);
@@ -77,8 +71,7 @@ fn run(handle: &handle, lib_path: &str,
 
 fn writeclose(fd: int, s: &option::t<str>) {
     if option::is_some(s) {
-        let writer = io::new_writer(
-            io::fd_buf_writer(fd, option::none));
+        let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(option::get(s));
     }
 
@@ -88,8 +81,7 @@ fn writeclose(fd: int, s: &option::t<str>) {
 fn readclose(fd: int) -> str {
     // Copied from run::program_output
     let file = os::fd_FILE(fd);
-    let reader = io::new_reader(
-        io::FILE_buf_reader(file, option::none));
+    let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
     let buf = "";
     while !reader.eof() {
         let bytes = reader.read_bytes(4096u);
@@ -112,35 +104,32 @@ fn worker(p: port<request>) {
         // the receiver's poniters outlive the sender's. Here we clone
         // everything and let the originals go out of scope before sending
         // a response.
-        execparms = {
-            // FIXME (785): The 'discriminant' of an alt expression has
-            // the same scope as the alt expression itself, so we have to
-            // put the entire alt in another block to make sure the exec
-            // message goes out of scope. Seems like the scoping rules for
-            // the alt discriminant are wrong.
-            alt recv(p) {
-              exec(lib_path, prog, args, respchan) {
-                {
-                    lib_path: str::unsafe_from_bytes(lib_path),
-                    prog: str::unsafe_from_bytes(prog),
-                    args: clone_vecu8str(args),
-                    respchan: respchan
+        execparms =
+            {
+
+                // FIXME (785): The 'discriminant' of an alt expression has
+                // the same scope as the alt expression itself, so we have to
+                // put the entire alt in another block to make sure the exec
+                // message goes out of scope. Seems like the scoping rules for
+                // the alt discriminant are wrong.
+                alt recv(p) {
+                  exec(lib_path, prog, args, respchan) {
+                    {lib_path: str::unsafe_from_bytes(lib_path),
+                     prog: str::unsafe_from_bytes(prog),
+                     args: clone_vecu8str(args),
+                     respchan: respchan}
+                  }
+                  stop. { ret }
                 }
-              }
-              stop. { ret }
-            }
-        };
+            };
 
         // This is copied from run::start_program
         let pipe_in = os::pipe();
         let pipe_out = os::pipe();
         let pipe_err = os::pipe();
         let spawnproc =
-            bind run::spawn_process(execparms.prog,
-                                    execparms.args,
-                                    pipe_in.in,
-                                    pipe_out.out,
-                                    pipe_err.out);
+            bind run::spawn_process(execparms.prog, execparms.args,
+                                    pipe_in.in, pipe_out.out, pipe_err.out);
         let pid = with_lib_path(execparms.lib_path, spawnproc);
 
         os::libc::close(pipe_in.in);
@@ -161,7 +150,7 @@ fn worker(p: port<request>) {
     }
 }
 
-fn with_lib_path<T>(path: &str, f: fn() -> T ) -> T {
+fn with_lib_path<T>(path: &str, f: fn() -> T) -> T {
     let maybe_oldpath = getenv(util::lib_path_env_var());
     append_lib_path(path);
     let res = f();
@@ -179,17 +168,15 @@ fn append_lib_path(path: &str) { export_lib_path(util::make_new_path(path)); }
 fn export_lib_path(path: &str) { setenv(util::lib_path_env_var(), path); }
 
 fn clone_vecstr(v: &[str]) -> [[u8]] {
-    let r = ~[];
-    for t: str in vec::slice(v, 0u, vec::len(v)) {
-        r += ~[str::bytes(t)];
-    }
+    let r = [];
+    for t: str in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; }
     ret r;
 }
 
 fn clone_vecu8str(v: &[[u8]]) -> [str] {
-    let r = ~[];
+    let r = [];
     for t in vec::slice(v, 0u, vec::len(v)) {
-        r += ~[str::unsafe_from_bytes(t)];
+        r += [str::unsafe_from_bytes(t)];
     }
     ret r;
 }
diff --git a/src/test/compiletest/runtest.rs b/src/test/compiletest/runtest.rs
index c56ec6970ef..c3572e20cba 100644
--- a/src/test/compiletest/runtest.rs
+++ b/src/test/compiletest/runtest.rs
@@ -20,11 +20,11 @@ export run;
 
 fn run(cx: &cx, _testfile: -[u8]) {
     let testfile = str::unsafe_from_bytes(_testfile);
-    if (cx.config.verbose) {
+    if cx.config.verbose {
         // We're going to be dumping a lot of info. Start on a new line.
         io::stdout().write_str("\n\n");
     }
-    log #fmt("running %s", testfile);
+    log #fmt["running %s", testfile];
     let props = load_props(testfile);
     alt cx.config.mode {
       mode_compile_fail. { run_cfail_test(cx, props, testfile); }
@@ -38,8 +38,7 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres("compile-fail test compiled successfully!",
-                      procres);
+        fatal_procres("compile-fail test compiled successfully!", procres);
     }
 
     check_error_patterns(props, testfile, procres);
@@ -48,14 +47,12 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 {
-        fatal_procres("compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres("run-fail test didn't produce an error!",
-                      procres);
+        fatal_procres("run-fail test didn't produce an error!", procres);
     }
 
     // This is the value valgrind returns on failure
@@ -73,8 +70,7 @@ fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 {
-        fatal_procres("compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
@@ -85,46 +81,41 @@ fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
     if option::is_some(props.pp_exact) {
         logv(cx.config, "testing for exact pretty-printing");
-    } else {
-        logv(cx.config, "testing for converging pretty-printing");
-    }
+    } else { logv(cx.config, "testing for converging pretty-printing"); }
 
-    let rounds = alt props.pp_exact {
-      option::some(_) { 1 }
-      option::none. { 2 }
-    };
+    let rounds =
+        alt props.pp_exact { option::some(_) { 1 } option::none. { 2 } };
 
-    let srcs = ~[io::read_whole_file_str(testfile)];
+    let srcs = [io::read_whole_file_str(testfile)];
 
     let round = 0;
     while round < rounds {
-        logv(cx.config, #fmt("pretty-printing round %d", round));
-        let procres = print_source(cx, testfile, srcs.(round));
+        logv(cx.config, #fmt["pretty-printing round %d", round]);
+        let procres = print_source(cx, testfile, srcs[round]);
 
         if procres.status != 0 {
-            fatal_procres(#fmt("pretty-printing failed in round %d", round),
+            fatal_procres(#fmt["pretty-printing failed in round %d", round],
                           procres);
         }
 
-        srcs += ~[procres.stdout];
+        srcs += [procres.stdout];
         round += 1;
     }
 
-    let expected = alt props.pp_exact {
-      option::some(file) {
-        let filepath = fs::connect(fs::dirname(testfile), file);
-        io::read_whole_file_str(filepath)
-      }
-      option::none. {
-        srcs.(vec::len(srcs) - 2u)
-      }
-    };
-    let actual = srcs.(vec::len(srcs) - 1u);
+    let expected =
+        alt props.pp_exact {
+          option::some(file) {
+            let filepath = fs::connect(fs::dirname(testfile), file);
+            io::read_whole_file_str(filepath)
+          }
+          option::none. { srcs[vec::len(srcs) - 2u] }
+        };
+    let actual = srcs[vec::len(srcs) - 1u];
 
     if option::is_some(props.pp_exact) {
         // Now we have to care about line endings
         let cr = "\r";
-        check str::is_not_empty(cr);
+        check (str::is_not_empty(cr));
         actual = str::replace(actual, cr, "");
         expected = str::replace(expected, cr, "");
     }
@@ -135,8 +126,7 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = typecheck_source(cx, testfile, actual);
 
     if procres.status != 0 {
-        fatal_procres("pretty-printed source does not typecheck",
-                      procres);
+        fatal_procres("pretty-printed source does not typecheck", procres);
     }
 
     ret;
@@ -148,14 +138,15 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
 
     fn make_pp_args(config: &config, testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = ~["-", "--pretty", "normal"];
+        let args = ["-", "--pretty", "normal"];
         ret {prog: prog, args: args};
     }
 
     fn compare_source(expected: &str, actual: &str) {
         if expected != actual {
             error("pretty-printed source does match expected source");
-            let msg = #fmt("\n\
+            let msg =
+                #fmt["\n\
 expected:\n\
 ------------------------------------------\n\
 %s\n\
@@ -165,7 +156,7 @@ actual:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-                          expected, actual);
+                     expected, actual];
             io::stdout().write_str(msg);
             fail;
         }
@@ -178,7 +169,7 @@ actual:\n\
 
     fn make_typecheck_args(config: &config, testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = ~["-", "--no-trans", "--lib"];
+        let args = ["-", "--no-trans", "--lib"];
         ret {prog: prog, args: args};
     }
 }
@@ -190,28 +181,28 @@ fn check_error_patterns(props: &test_props, testfile: &str,
     }
 
     let next_err_idx = 0u;
-    let next_err_pat = props.error_patterns.(next_err_idx);
+    let next_err_pat = props.error_patterns[next_err_idx];
     for line: str in str::split(procres.stdout, '\n' as u8) {
         if str::find(line, next_err_pat) > 0 {
-            log #fmt("found error pattern %s", next_err_pat);
+            log #fmt["found error pattern %s", next_err_pat];
             next_err_idx += 1u;
             if next_err_idx == vec::len(props.error_patterns) {
                 log "found all error patterns";
                 ret;
             }
-            next_err_pat = props.error_patterns.(next_err_idx);
+            next_err_pat = props.error_patterns[next_err_idx];
         }
     }
 
     let missing_patterns =
         vec::slice(props.error_patterns, next_err_idx,
-                    vec::len(props.error_patterns));
+                   vec::len(props.error_patterns));
     if vec::len(missing_patterns) == 1u {
-        fatal_procres(#fmt("error pattern '%s' not found!",
-                           missing_patterns.(0)), procres);
+        fatal_procres(#fmt["error pattern '%s' not found!",
+                           missing_patterns[0]], procres);
     } else {
         for pattern: str in missing_patterns {
-            error(#fmt("error pattern '%s' not found!", pattern));
+            error(#fmt["error pattern '%s' not found!", pattern]);
         }
         fatal_procres("multiple error patterns not found", procres);
     }
@@ -226,27 +217,24 @@ fn compile_test(cx: &cx, props: &test_props, testfile: &str) -> procres {
                     cx.config.compile_lib_path, option::none)
 }
 
-fn exec_compiled_test(cx: &cx, props: &test_props,
-                      testfile: &str) -> procres {
+fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &str) ->
+   procres {
     compose_and_run(cx, testfile, bind make_run_args(_, props, _),
                     cx.config.run_lib_path, option::none)
 }
 
 fn compose_and_run(cx: &cx, testfile: &str,
-                   make_args: fn(&config, &str) -> procargs ,
-                   lib_path: &str,
+                   make_args: fn(&config, &str) -> procargs, lib_path: &str,
                    input: option::t<str>) -> procres {
     let procargs = make_args(cx.config, testfile);
-    ret program_output(cx, testfile, lib_path,
-                       procargs.prog, procargs.args,
+    ret program_output(cx, testfile, lib_path, procargs.prog, procargs.args,
                        input);
 }
 
-fn make_compile_args(config: &config,
-                     props: &test_props, testfile: &str) ->
-    procargs {
+fn make_compile_args(config: &config, props: &test_props, testfile: &str) ->
+   procargs {
     let prog = config.rustc_path;
-    let args = ~[testfile, "-o", make_exe_name(config, testfile)];
+    let args = [testfile, "-o", make_exe_name(config, testfile)];
     args += split_maybe_args(config.rustcflags);
     args += split_maybe_args(props.compile_flags);
     ret {prog: prog, args: args};
@@ -256,35 +244,29 @@ fn make_exe_name(config: &config, testfile: &str) -> str {
     output_base_name(config, testfile) + os::exec_suffix()
 }
 
-fn make_run_args(config: &config,
-                 props: &test_props, testfile: &str) -> procargs {
-    let toolargs = if !props.no_valgrind {
-        // If we've got another tool to run under (valgrind),
-        // then split apart its command
-        split_maybe_args(config.runtool)
-    } else {
-        ~[]
-    };
+fn make_run_args(config: &config, props: &test_props, testfile: &str) ->
+   procargs {
+    let toolargs =
+        if !props.no_valgrind {
 
-    let args = toolargs + ~[make_exe_name(config, testfile)];
-    ret {prog: args.(0), args: vec::slice(args, 1u, vec::len(args))};
+            // If we've got another tool to run under (valgrind),
+            // then split apart its command
+            split_maybe_args(config.runtool)
+        } else { [] };
+
+    let args = toolargs + [make_exe_name(config, testfile)];
+    ret {prog: args[0], args: vec::slice(args, 1u, vec::len(args))};
 }
 
 fn split_maybe_args(argstr: &option::t<str>) -> [str] {
     fn rm_whitespace(v: &[str]) -> [str] {
         fn flt(s: &str) -> option::t<str> {
-            if !is_whitespace(s) {
-                option::some(s)
-            } else {
-                option::none
-            }
+            if !is_whitespace(s) { option::some(s) } else { option::none }
         }
 
         // FIXME: This should be in std
         fn is_whitespace(s: str) -> bool {
-            for c: u8 in s {
-                if c != (' ' as u8) { ret false; }
-            }
+            for c: u8 in s { if c != ' ' as u8 { ret false; } }
             ret true;
         }
         vec::filter_map(flt, v)
@@ -292,38 +274,38 @@ fn split_maybe_args(argstr: &option::t<str>) -> [str] {
 
     alt argstr {
       option::some(s) { rm_whitespace(str::split(s, ' ' as u8)) }
-      option::none. { ~[] }
+      option::none. { [] }
     }
 }
 
 fn program_output(cx: &cx, testfile: &str, lib_path: &str, prog: &str,
                   args: &[str], input: option::t<str>) -> procres {
     let cmdline =
-    {
-        let cmdline = make_cmdline(lib_path, prog, args);
-        logv(cx.config, #fmt("executing %s", cmdline));
-        cmdline
-    };
-    let res = procsrv::run(cx.procsrv, lib_path,
-                           prog, args, input);
+        {
+            let cmdline = make_cmdline(lib_path, prog, args);
+            logv(cx.config, #fmt["executing %s", cmdline]);
+            cmdline
+        };
+    let res = procsrv::run(cx.procsrv, lib_path, prog, args, input);
     dump_output(cx.config, testfile, res.out, res.err);
-    ret {status: res.status, stdout: res.out,
-         stderr: res.err, cmdline: cmdline};
+    ret {status: res.status,
+         stdout: res.out,
+         stderr: res.err,
+         cmdline: cmdline};
 }
 
 fn make_cmdline(libpath: &str, prog: &str, args: &[str]) -> str {
-    #fmt("%s %s %s", lib_path_cmd_prefix(libpath), prog,
-         str::connect(args, " "))
+    #fmt["%s %s %s", lib_path_cmd_prefix(libpath), prog,
+         str::connect(args, " ")]
 }
 
 // Build the LD_LIBRARY_PATH variable as it would be seen on the command line
 // for diagnostic purposes
 fn lib_path_cmd_prefix(path: &str) -> str {
-    #fmt("%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path))
+    #fmt["%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)]
 }
 
-fn dump_output(config: &config, testfile: &str,
-               out: &str, err: &str) {
+fn dump_output(config: &config, testfile: &str, out: &str, err: &str) {
     dump_output_file(config, testfile, out, "out");
     dump_output_file(config, testfile, err, "err");
     maybe_dump_to_stdout(config, out, err);
@@ -331,22 +313,20 @@ fn dump_output(config: &config, testfile: &str,
 
 #[cfg(target_os = "win32")]
 #[cfg(target_os = "linux")]
-fn dump_output_file(config: &config, testfile: &str,
-                    out: &str, extension: &str) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
     let outfile = make_out_name(config, testfile, extension);
-    let writer = io::file_writer(outfile,
-                                     ~[io::create, io::truncate]);
+    let writer = io::file_writer(outfile, [io::create, io::truncate]);
     writer.write_str(out);
 }
 
 // FIXME (726): Can't use file_writer on mac
 #[cfg(target_os = "macos")]
-fn dump_output_file(config: &config, testfile: &str,
-                    out: &str, extension: &str) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
 }
 
-fn make_out_name(config: &config, testfile: &str,
-                 extension: &str) -> str {
+fn make_out_name(config: &config, testfile: &str, extension: &str) -> str {
     output_base_name(config, testfile) + "." + extension
 }
 
@@ -358,16 +338,13 @@ fn output_base_name(config: &config, testfile: &str) -> str {
             parts = vec::slice(parts, 0u, vec::len(parts) - 1u);
             str::connect(parts, ".")
         };
-    #fmt("%s%s.%s", base, filename, config.stage_id)
+    #fmt["%s%s.%s", base, filename, config.stage_id]
 }
 
-fn maybe_dump_to_stdout(config: &config,
-                        out: &str, err: &str) {
+fn maybe_dump_to_stdout(config: &config, out: &str, err: &str) {
     if config.verbose {
-        let sep1 = #fmt("------%s------------------------------",
-                        "stdout");
-        let sep2 = #fmt("------%s------------------------------",
-                        "stderr");
+        let sep1 = #fmt["------%s------------------------------", "stdout"];
+        let sep2 = #fmt["------%s------------------------------", "stderr"];
         let sep3 = "------------------------------------------";
         io::stdout().write_line(sep1);
         io::stdout().write_line(out);
@@ -377,13 +354,13 @@ fn maybe_dump_to_stdout(config: &config,
     }
 }
 
-fn error(err: &str) { io::stdout().write_line(#fmt("\nerror: %s", err)); }
+fn error(err: &str) { io::stdout().write_line(#fmt["\nerror: %s", err]); }
 
 fn fatal(err: &str) -> ! { error(err); fail; }
 
 fn fatal_procres(err: &str, procres: procres) -> ! {
     let msg =
-        #fmt("\n\
+        #fmt["\n\
 error: %s\n\
 command: %s\n\
 stdout:\n\
@@ -395,7 +372,7 @@ stderr:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-             err, procres.cmdline, procres.stdout, procres.stderr);
+             err, procres.cmdline, procres.stdout, procres.stderr];
     io::stdout().write_str(msg);
     fail;
 }
diff --git a/src/test/compiletest/util.rs b/src/test/compiletest/util.rs
index 5f971777c75..3dcd8699927 100644
--- a/src/test/compiletest/util.rs
+++ b/src/test/compiletest/util.rs
@@ -9,7 +9,7 @@ fn make_new_path(path: &str) -> str {
     // Windows just uses PATH as the library search path, so we have to
     // maintain the current value while adding our own
     alt getenv(lib_path_env_var()) {
-      option::some(curr) { #fmt("%s:%s", path, curr) }
+      option::some(curr) { #fmt["%s:%s", path, curr] }
       option::none. { path }
     }
 }
diff --git a/src/test/pretty/block-disambig.rs b/src/test/pretty/block-disambig.rs
index f035b9393c2..252eb0270da 100644
--- a/src/test/pretty/block-disambig.rs
+++ b/src/test/pretty/block-disambig.rs
@@ -1,40 +1,20 @@
 // Tests that the pretty printer correctly disambiguates various scenarios
 // involving block statements by ending them with a semi-colon
-fn test1() {
-    let val = @0;
-    {};
-    *val;
-}
+fn test1() { let val = @0; { }; *val; }
 
-fn test2() -> int {
-    let val = @0;
-    {};
-    *val
-}
+fn test2() -> int { let val = @0; { }; *val }
 
 fn test3() {
     let regs = @{mutable eax: 0};
-    alt true {
-      true { }
-    };
+    alt true { true { } };
     (*regs).eax = 1;
 }
 
-fn test4() -> bool {
-    let regs = @true;
-    if true { };
-    *regs || false
-}
+fn test4() -> bool { let regs = @true; if true { }; *regs || false }
 
-fn test5() -> (int, int) {
-    {};
-    (0, 1)
-}
+fn test5() -> (int, int) { { }; (0, 1) }
 
-fn test6() -> bool {
-    {};
-    (true || false) && true
-}
+fn test6() -> bool { { }; (true || false) && true }
 
 fn test7() -> uint {
     let regs = @0;
@@ -42,24 +22,12 @@ fn test7() -> uint {
     (*regs < 2) as uint
 }
 
-fn test8() -> int {
-    let val = @0;
-    alt true { true { } };
-    *val < 1 ? 0 : 1
-}
+fn test8() -> int { let val = @0; alt true { true { } }; *val < 1 ? 0 : 1 }
 
-fn test9() {
-    let regs = @mutable 0;
-    alt true {
-      true { }
-    };
-    *regs += 1;
-}
+fn test9() { let regs = @mutable 0; alt true { true { } }; *regs += 1; }
 
 fn test10() -> int {
     let regs = @mutable [0];
-    alt true {
-      true { }
-    };
-    (*regs).(0)
+    alt true { true { } };
+    (*regs)[0]
 }
diff --git a/src/test/pretty/empty-lines.rs b/src/test/pretty/empty-lines.rs
index 87de5ff64c2..e598e96db24 100644
--- a/src/test/pretty/empty-lines.rs
+++ b/src/test/pretty/empty-lines.rs
@@ -4,4 +4,4 @@
 fn a() -> uint {
 
     1u
-}
\ No newline at end of file
+}
diff --git a/src/test/pretty/example2.rs b/src/test/pretty/example2.rs
index ea9ff94112a..852b9f316ce 100644
--- a/src/test/pretty/example2.rs
+++ b/src/test/pretty/example2.rs
@@ -1,7 +1,3 @@
 // pp-exact:example2.pp
 
-fn
-main
-()
-{
-}
+fn main() { }
diff --git a/src/test/pretty/unary-op-disambig.rs b/src/test/pretty/unary-op-disambig.rs
index 79cc24a2f20..0f67570e722 100644
--- a/src/test/pretty/unary-op-disambig.rs
+++ b/src/test/pretty/unary-op-disambig.rs
@@ -2,34 +2,16 @@
 
 fn f() { }
 
-fn block_semi() -> int {
-    { f() };
-    -1
-}
-
-fn block_nosemi() -> int {
-    { 0 } - 1
-}
-
-fn if_semi() -> int {
-    if true { f() } else { f() };
-    -1
-}
-
-fn if_nosemi() -> int {
-    if true { 0 } else { 0 } - 1
-}
-
-fn alt_semi() -> int {
-    alt true { true { f() } };
-    -1
-}
-
-fn alt_no_semi() -> int {
-    alt true { true { 0 } } - 1
-}
-
-fn stmt() {
-    { f() };
-    -1;
-}
\ No newline at end of file
+fn block_semi() -> int { { f() }; -1 }
+
+fn block_nosemi() -> int { { 0 } - 1 }
+
+fn if_semi() -> int { if true { f() } else { f() }; -1 }
+
+fn if_nosemi() -> int { if true { 0 } else { 0 } - 1 }
+
+fn alt_semi() -> int { alt true { true { f() } }; -1 }
+
+fn alt_no_semi() -> int { alt true { true { 0 } } - 1 }
+
+fn stmt() { { f() }; -1; }
diff --git a/src/test/pretty/vec-comments.rs b/src/test/pretty/vec-comments.rs
index 48de34972b7..2cd5fffdf75 100644
--- a/src/test/pretty/vec-comments.rs
+++ b/src/test/pretty/vec-comments.rs
@@ -2,30 +2,28 @@
 // Testing that comments are correctly interleaved
 // pp-exact:vec-comments.pp
 fn main() {
-    let v1 = ~[
-        // Comment
-        0,
-        // Comment
-        1,
-        // Comment
-        2
-    ];
-    let v2 = ~[
-        0, // Comment
-        1, // Comment
-        2  // Comment
-    ];
-    let v3 = ~[
-        /* Comment */
-        0,
-        /* Comment */
-        1,
-        /* Comment */
-        2
-    ];
-    let v4 = ~[
-        0, /* Comment */
-        1, /* Comment */
-        2  /* Comment */
-    ];
+    let v1 =
+        [
+         // Comment
+         0,
+         // Comment
+         1,
+         // Comment
+         2];
+    let v2 =
+        [0, // Comment
+         1, // Comment
+         2]; // Comment
+    let v3 =
+        [
+         /* Comment */
+         0,
+         /* Comment */
+         1,
+         /* Comment */
+         2];
+    let v4 =
+        [0, /* Comment */
+         1, /* Comment */
+         2]; /* Comment */
 }
diff --git a/src/test/pretty/vec-type.rs b/src/test/pretty/vec-type.rs
index 010ad755f51..60265eebcf7 100644
--- a/src/test/pretty/vec-type.rs
+++ b/src/test/pretty/vec-type.rs
@@ -2,4 +2,4 @@
 
 fn f1(x: [int]) { }
 
-fn g1() { f1(~[1, 2, 3]); }
+fn g1() { f1([1, 2, 3]); }
diff --git a/src/test/run-fail/alt-bot-fail.rs b/src/test/run-fail/alt-bot-fail.rs
index 7a414b3ca6a..355892d5a13 100644
--- a/src/test/run-fail/alt-bot-fail.rs
+++ b/src/test/run-fail/alt-bot-fail.rs
@@ -7,9 +7,7 @@ import std::option::*;
 fn foo(s: str) { }
 
 fn main() {
-    let i = alt some::<int>(3) {
-        none::<int>. { fail }
-        some::<int>(_) { fail }
-    };
+    let i =
+        alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { fail } };
     foo(i);
 }
diff --git a/src/test/run-fail/alt-disc-bot.rs b/src/test/run-fail/alt-disc-bot.rs
index 8b4d30ef6ac..2ac519e6419 100644
--- a/src/test/run-fail/alt-disc-bot.rs
+++ b/src/test/run-fail/alt-disc-bot.rs
@@ -1,4 +1,4 @@
 // error-pattern:quux
 fn f() -> ! { fail "quux" }
-fn g() -> int { alt f() { true { 1 } false { 0 } }; }
+fn g() -> int { alt f() { true { 1 } false { 0 } } }
 fn main() { g(); }
diff --git a/src/test/run-fail/args-fail.rs b/src/test/run-fail/args-fail.rs
index 9dc6ecc7413..afdaa553ba6 100644
--- a/src/test/run-fail/args-fail.rs
+++ b/src/test/run-fail/args-fail.rs
@@ -1,4 +1,4 @@
 // error-pattern:meep
 fn f(a: int, b: int, c: @int) { fail "moop"; }
 
-fn main() { f(1, fail "meep", @42); }
\ No newline at end of file
+fn main() { f(1, fail "meep", @42); }
diff --git a/src/test/run-fail/bug-811.rs b/src/test/run-fail/bug-811.rs
index 176b95343eb..aa4d829a100 100644
--- a/src/test/run-fail/bug-811.rs
+++ b/src/test/run-fail/bug-811.rs
@@ -1,16 +1,11 @@
 // error-pattern:quux
-fn test00_start(ch: chan_t<int>, message: int) {
-    send(ch, message);
-}
+fn test00_start(ch: chan_t<int>, message: int) { send(ch, message); }
 
 type task_id = int;
 type port_id = int;
 
-type chan_t<~T> = {
-    task : task_id,
-    port : port_id
-};
+type chan_t<~T> = {task: task_id, port: port_id};
 
-fn send<~T>(ch : chan_t<T>, data : -T) { fail; }
+fn send<~T>(ch: chan_t<T>, data: -T) { fail; }
 
 fn main() { fail "quux"; }
diff --git a/src/test/run-fail/do-while-body-fails.rs b/src/test/run-fail/do-while-body-fails.rs
index 1a6cac5fabc..3ab257de397 100644
--- a/src/test/run-fail/do-while-body-fails.rs
+++ b/src/test/run-fail/do-while-body-fails.rs
@@ -1,4 +1,2 @@
 // error-pattern:quux
-fn main() {
-    let x: int = do { fail "quux" } while (true);
-}
+fn main() { let x: int = do  { fail "quux" } while true; }
diff --git a/src/test/run-fail/explicit-fail-msg.rs b/src/test/run-fail/explicit-fail-msg.rs
index f238d226b34..b45e443759c 100644
--- a/src/test/run-fail/explicit-fail-msg.rs
+++ b/src/test/run-fail/explicit-fail-msg.rs
@@ -1,3 +1,3 @@
 // error-pattern:wooooo
 // no-valgrind
-fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; }
\ No newline at end of file
+fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; }
diff --git a/src/test/run-fail/explicit-fail.rs b/src/test/run-fail/explicit-fail.rs
index a74cf4b36e3..396f12d5caf 100644
--- a/src/test/run-fail/explicit-fail.rs
+++ b/src/test/run-fail/explicit-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit
-fn main() { fail; }
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/run-fail/expr-alt-fail-fn.rs b/src/test/run-fail/expr-alt-fail-fn.rs
index e9754643ccd..bf6898ed297 100644
--- a/src/test/run-fail/expr-alt-fail-fn.rs
+++ b/src/test/run-fail/expr-alt-fail-fn.rs
@@ -6,4 +6,4 @@ fn f() -> ! { fail }
 
 fn g() -> int { let x = alt true { true { f() } false { 10 } }; ret x; }
 
-fn main() { g(); }
\ No newline at end of file
+fn main() { g(); }
diff --git a/src/test/run-fail/expr-alt-fail.rs b/src/test/run-fail/expr-alt-fail.rs
index 50154890bc3..230497135cd 100644
--- a/src/test/run-fail/expr-alt-fail.rs
+++ b/src/test/run-fail/expr-alt-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit failure
-fn main() { let x = alt true { false { 0 } true { fail } }; }
\ No newline at end of file
+fn main() { let x = alt true { false { 0 } true { fail } }; }
diff --git a/src/test/run-fail/expr-fn-fail.rs b/src/test/run-fail/expr-fn-fail.rs
index fc716fc1c60..24d0fa4c4aa 100644
--- a/src/test/run-fail/expr-fn-fail.rs
+++ b/src/test/run-fail/expr-fn-fail.rs
@@ -4,4 +4,4 @@
 // error-pattern:explicit failure
 fn f() -> ! { fail }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-fail/expr-if-fail-fn.rs b/src/test/run-fail/expr-if-fail-fn.rs
index 6b7b6d64b45..406302532fa 100644
--- a/src/test/run-fail/expr-if-fail-fn.rs
+++ b/src/test/run-fail/expr-if-fail-fn.rs
@@ -6,4 +6,4 @@ fn f() -> ! { fail }
 
 fn g() -> int { let x = if true { f() } else { 10 }; ret x; }
 
-fn main() { g(); }
\ No newline at end of file
+fn main() { g(); }
diff --git a/src/test/run-fail/expr-if-fail.rs b/src/test/run-fail/expr-if-fail.rs
index a738bfc7f1e..24cd815c244 100644
--- a/src/test/run-fail/expr-if-fail.rs
+++ b/src/test/run-fail/expr-if-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit failure
-fn main() { let x = if false { 0 } else if (true) { fail } else { 10 }; }
\ No newline at end of file
+fn main() { let x = if false { 0 } else if true { fail } else { 10 }; }
diff --git a/src/test/run-fail/fail-arg.rs b/src/test/run-fail/fail-arg.rs
index ef43fea8694..e657bf7d9a6 100644
--- a/src/test/run-fail/fail-arg.rs
+++ b/src/test/run-fail/fail-arg.rs
@@ -1,4 +1,4 @@
 // error-pattern:woe
 fn f(a: int) { log a; }
 
-fn main() { f(fail "woe"); }
\ No newline at end of file
+fn main() { f(fail "woe"); }
diff --git a/src/test/run-fail/fail-main.rs b/src/test/run-fail/fail-main.rs
index 0ac56613439..a8e51009352 100644
--- a/src/test/run-fail/fail-main.rs
+++ b/src/test/run-fail/fail-main.rs
@@ -1,4 +1,4 @@
 // error-pattern:moop
 use std;
 import std::uint;
-fn main() { fail "moop"; }
\ No newline at end of file
+fn main() { fail "moop"; }
diff --git a/src/test/run-fail/fail.rs b/src/test/run-fail/fail.rs
index a0520c288a4..75e6f7e886e 100644
--- a/src/test/run-fail/fail.rs
+++ b/src/test/run-fail/fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:1 == 2
-fn main() { assert (1 == 2); }
\ No newline at end of file
+fn main() { assert (1 == 2); }
diff --git a/src/test/run-fail/fmt-fail.rs b/src/test/run-fail/fmt-fail.rs
index d4eb12292a6..2d3e35b41af 100644
--- a/src/test/run-fail/fmt-fail.rs
+++ b/src/test/run-fail/fmt-fail.rs
@@ -3,4 +3,4 @@
 use std;
 import std::str;
 
-fn main() { let str_var: str = "meh"; fail #fmt("%s", str_var); }
\ No newline at end of file
+fn main() { let str_var: str = "meh"; fail #fmt["%s", str_var]; }
diff --git a/src/test/run-fail/fn-constraint-claim.rs b/src/test/run-fail/fn-constraint-claim.rs
index ca243210647..a5309b61627 100644
--- a/src/test/run-fail/fn-constraint-claim.rs
+++ b/src/test/run-fail/fn-constraint-claim.rs
@@ -5,9 +5,4 @@ import std::uint::*;
 
 fn nop(a: uint, b: uint) : le(a, b) { fail "quux"; }
 
-fn main() {
-    let a: uint = 5u;
-    let b: uint = 4u;
-    claim (le(a, b));
-    nop(a, b);
-}
+fn main() { let a: uint = 5u; let b: uint = 4u; claim (le(a, b)); nop(a, b); }
diff --git a/src/test/run-fail/fn-constraint.rs b/src/test/run-fail/fn-constraint.rs
index 65bcc413498..3499d44ceff 100644
--- a/src/test/run-fail/fn-constraint.rs
+++ b/src/test/run-fail/fn-constraint.rs
@@ -8,4 +8,4 @@ fn main() {
     let b: uint = 1u;
     check (le(a, b));
     log_err safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-fail/if-check-fail.rs b/src/test/run-fail/if-check-fail.rs
index 677240d0763..885c92deab8 100644
--- a/src/test/run-fail/if-check-fail.rs
+++ b/src/test/run-fail/if-check-fail.rs
@@ -2,9 +2,9 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn foo(x: uint) { if check even(x) { log x; } else { fail "Number is odd"; } }
 
-fn main() { foo(3u); }
\ No newline at end of file
+fn main() { foo(3u); }
diff --git a/src/test/run-fail/non-exhaustive-match.rs b/src/test/run-fail/non-exhaustive-match.rs
index e62d0692d4f..4afd83c1b97 100644
--- a/src/test/run-fail/non-exhaustive-match.rs
+++ b/src/test/run-fail/non-exhaustive-match.rs
@@ -6,4 +6,4 @@
 // error-pattern:non-exhaustive match failure
 tag t { a; b; }
 
-fn main() { let x = a; alt x { b. { } } }
\ No newline at end of file
+fn main() { let x = a; alt x { b. { } } }
diff --git a/src/test/run-fail/pred.rs b/src/test/run-fail/pred.rs
index 14e46976113..a2f9420825c 100644
--- a/src/test/run-fail/pred.rs
+++ b/src/test/run-fail/pred.rs
@@ -4,4 +4,4 @@ fn f(a: int, b: int) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
-fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); }
\ No newline at end of file
+fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); }
diff --git a/src/test/run-fail/rhs-type.rs b/src/test/run-fail/rhs-type.rs
index 0277d83d393..461b2c65b44 100644
--- a/src/test/run-fail/rhs-type.rs
+++ b/src/test/run-fail/rhs-type.rs
@@ -1,4 +1,4 @@
 // Tests that trans treats the rhs of pth's decl
 // as a _|_-typed thing, not a str-typed thing
 // error-pattern:bye
-fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; }
\ No newline at end of file
+fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; }
diff --git a/src/test/run-fail/str-overrun.rs b/src/test/run-fail/str-overrun.rs
index 1ac862f2405..3d12bce20c9 100644
--- a/src/test/run-fail/str-overrun.rs
+++ b/src/test/run-fail/str-overrun.rs
@@ -7,12 +7,12 @@
 fn main() {
     let s: str = "hello";
     let x: int = 0;
-    assert (s.(x) == 0x68 as u8);
+    assert (s[x] == 0x68 as u8);
     // NB: at the moment a string always has a trailing NULL,
     // so the largest index value on the string above is 5, not
     // 4. Possibly change this.
 
     // Bounds-check failure.
 
-    assert (s.(x + 6) == 0x0 as u8);
-}
\ No newline at end of file
+    assert (s[x + 6] == 0x0 as u8);
+}
diff --git a/src/test/run-fail/vec-overrun.rs b/src/test/run-fail/vec-overrun.rs
index 28349f27a50..54329ca63b5 100644
--- a/src/test/run-fail/vec-overrun.rs
+++ b/src/test/run-fail/vec-overrun.rs
@@ -3,10 +3,10 @@
 // error-pattern:bounds check
 // no-valgrind
 fn main() {
-    let v: [int] = ~[10];
+    let v: [int] = [10];
     let x: int = 0;
-    assert (v.(x) == 10);
+    assert (v[x] == 10);
     // Bounds-check failure.
 
-    assert (v.(x + 2) == 20);
+    assert (v[x + 2] == 20);
 }
diff --git a/src/test/run-fail/vec-underrun.rs b/src/test/run-fail/vec-underrun.rs
index 41eb94ca739..87c8295840e 100644
--- a/src/test/run-fail/vec-underrun.rs
+++ b/src/test/run-fail/vec-underrun.rs
@@ -3,10 +3,10 @@
 // error-pattern:bounds check
 // no-valgrind
 fn main() {
-    let v: [int] = ~[10, 20];
+    let v: [int] = [10, 20];
     let x: int = 0;
-    assert (v.(x) == 10);
+    assert (v[x] == 10);
     // Bounds-check failure.
 
-    assert (v.(x - 1) == 20);
+    assert (v[x - 1] == 20);
 }
diff --git a/src/test/run-pass/alloca-from-derived-tydesc.rs b/src/test/run-pass/alloca-from-derived-tydesc.rs
index 00371d3567d..6077bbf6723 100644
--- a/src/test/run-pass/alloca-from-derived-tydesc.rs
+++ b/src/test/run-pass/alloca-from-derived-tydesc.rs
@@ -2,6 +2,6 @@ tag option<T> { some(T); none; }
 
 type r<T> = {mutable v: [option<T>]};
 
-fn f<T>() -> [T] { ret ~[]; }
+fn f<T>() -> [T] { ret []; }
 
-fn main() { let r: r<int> = {mutable v: ~[]}; r.v = f(); }
+fn main() { let r: r<int> = {mutable v: []}; r.v = f(); }
diff --git a/src/test/run-pass/alt-bot.rs b/src/test/run-pass/alt-bot.rs
index a5369804d00..6949d727f59 100644
--- a/src/test/run-pass/alt-bot.rs
+++ b/src/test/run-pass/alt-bot.rs
@@ -2,9 +2,7 @@ use std;
 import std::option::*;
 
 fn main() {
-    let i: int = alt some::<int>(3) {
-        none::<int>. { fail }
-        some::<int>(_) { 5 }
-    };
+    let i: int =
+        alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { 5 } };
     log i;
 }
diff --git a/src/test/run-pass/alt-join.rs b/src/test/run-pass/alt-join.rs
index 423d08fc66a..4d1be53cdf3 100644
--- a/src/test/run-pass/alt-join.rs
+++ b/src/test/run-pass/alt-join.rs
@@ -7,12 +7,12 @@ import std::option::some;
 
 fn foo<T>(y: &option::t<T>) {
     let x: int;
-    let rs: [int] = ~[];
+    let rs: [int] = [];
     /* tests that x doesn't get put in the precondition for the
        entire if expression */
 
     if true {
-    } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += ~[x]; }
+    } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += [x]; }
     ret;
 }
 
diff --git a/src/test/run-pass/alt-path.rs b/src/test/run-pass/alt-path.rs
index 9f37cd2585c..84d79220f90 100644
--- a/src/test/run-pass/alt-path.rs
+++ b/src/test/run-pass/alt-path.rs
@@ -6,4 +6,4 @@ mod m1 {
 
 fn bar(x: m1::foo) { alt x { m1::foo1. { } } }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/alt-pattern-drop.rs b/src/test/run-pass/alt-pattern-drop.rs
index af0c615f53f..d3fb0715b4d 100644
--- a/src/test/run-pass/alt-pattern-drop.rs
+++ b/src/test/run-pass/alt-pattern-drop.rs
@@ -32,4 +32,4 @@ fn main() {
 
     log str::refcount(s);
     assert (str::refcount(s) == const_refcount);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/alt-pattern-lit.rs b/src/test/run-pass/alt-pattern-lit.rs
index 3dc7bae1ea9..1f544495d88 100644
--- a/src/test/run-pass/alt-pattern-lit.rs
+++ b/src/test/run-pass/alt-pattern-lit.rs
@@ -4,4 +4,4 @@ fn altlit(f: int) -> int {
     alt f { 10 { log "case 10"; ret 20; } 11 { log "case 11"; ret 22; } }
 }
 
-fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); }
\ No newline at end of file
+fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); }
diff --git a/src/test/run-pass/alt-pattern-simple.rs b/src/test/run-pass/alt-pattern-simple.rs
index 1d02eb64a82..e29cd72ac77 100644
--- a/src/test/run-pass/alt-pattern-simple.rs
+++ b/src/test/run-pass/alt-pattern-simple.rs
@@ -2,4 +2,4 @@
 
 fn altsimple(f: int) { alt f { x { } } }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/alt-str.rs b/src/test/run-pass/alt-str.rs
index 8fd15eb76af..fbdf7fdbfe3 100644
--- a/src/test/run-pass/alt-str.rs
+++ b/src/test/run-pass/alt-str.rs
@@ -12,4 +12,4 @@ fn main() {
       tag1("test") { }
       _ { fail; }
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/alt-tag.rs b/src/test/run-pass/alt-tag.rs
index 3bdc4b3a528..6a3606d6dc3 100644
--- a/src/test/run-pass/alt-tag.rs
+++ b/src/test/run-pass/alt-tag.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (process(gray) == 127);
     assert (process(clear) == 0);
     assert (process(red) == 255);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-backwarding-2.rs b/src/test/run-pass/anon-obj-backwarding-2.rs
index 3a806a6e399..039d25be381 100644
--- a/src/test/run-pass/anon-obj-backwarding-2.rs
+++ b/src/test/run-pass/anon-obj-backwarding-2.rs
@@ -9,15 +9,17 @@ fn main() {
 
     let my_a = a();
 
-    let my_b = obj () {
-        fn baz() -> int { ret self.foo(); }
-        with my_a
-    };
+    let my_b =
+        obj () {
+            fn baz() -> int { ret self.foo(); }
+            with
+            my_a
+        };
 
-    assert my_a.foo() == 2;
-    assert my_a.bar() == 2;
-    assert my_b.foo() == 2;
-    assert my_b.baz() == 2;
-    assert my_b.bar() == 2;
+    assert (my_a.foo() == 2);
+    assert (my_a.bar() == 2);
+    assert (my_b.foo() == 2);
+    assert (my_b.baz() == 2);
+    assert (my_b.bar() == 2);
 
 }
diff --git a/src/test/run-pass/anon-obj-cats.rs b/src/test/run-pass/anon-obj-cats.rs
index ca093f0cb9b..c1024afc6ec 100644
--- a/src/test/run-pass/anon-obj-cats.rs
+++ b/src/test/run-pass/anon-obj-cats.rs
@@ -3,42 +3,34 @@ fn main() {
     // The Internet made me do it.
 
     obj cat() {
-        fn ack() -> str {
-            ret "ack";
-        }
-        fn meow() -> str {
-            ret "meow";
-        }
-        fn zzz() -> str {
-            ret self.meow();
-        }
+        fn ack() -> str { ret "ack"; }
+        fn meow() -> str { ret "meow"; }
+        fn zzz() -> str { ret self.meow(); }
     }
 
     let shortcat = cat();
 
-    let longcat = obj() {
-        fn lol() -> str {
-            ret "lol";
-        }
-        fn nyan() -> str {
-            ret "nyan";
-        }
-        with shortcat
-    };
-
-    let longercat = obj() {
-        fn meow() -> str {
-            ret "zzz";
-        }
-        with shortcat
-    };
-
-    let evenlongercat = obj() {
-        fn meow() -> str {
-            ret "zzzzzz";
-        }
-        with longercat
-    };
+    let longcat =
+        obj () {
+            fn lol() -> str { ret "lol"; }
+            fn nyan() -> str { ret "nyan"; }
+            with
+            shortcat
+        };
+
+    let longercat =
+        obj () {
+            fn meow() -> str { ret "zzz"; }
+            with
+            shortcat
+        };
+
+    let evenlongercat =
+        obj () {
+            fn meow() -> str { ret "zzzzzz"; }
+            with
+            longercat
+        };
 
     // Tests self-call.
     assert (shortcat.zzz() == "meow");
diff --git a/src/test/run-pass/anon-obj-degenerate.rs b/src/test/run-pass/anon-obj-degenerate.rs
index d4870fc3d78..c9c47e29008 100644
--- a/src/test/run-pass/anon-obj-degenerate.rs
+++ b/src/test/run-pass/anon-obj-degenerate.rs
@@ -17,4 +17,4 @@ fn main() {
     assert (my_d.foo() == 2);
     assert (my_d.bar() == 2);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
index 423196dac82..3e782ce56de 100644
--- a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
+++ b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
@@ -3,36 +3,41 @@ use std;
 fn main() {
 
     // Anonymous object that doesn't extend an existing one.
-    let my_obj = obj() {
-        fn foo() -> int { ret 2; }
-        fn bar() -> int { ret 3; }
-        fn baz() -> str { "hello!" }
-    };
+    let my_obj =
+        obj () {
+            fn foo() -> int { ret 2; }
+            fn bar() -> int { ret 3; }
+            fn baz() -> str { "hello!" }
+        };
 
-    assert my_obj.foo() == 2;
-    assert my_obj.bar() == 3;
-    assert my_obj.baz() == "hello!";
+    assert (my_obj.foo() == 2);
+    assert (my_obj.bar() == 3);
+    assert (my_obj.baz() == "hello!");
 
     // Make sure the result is extendable.
-    let my_ext_obj = obj() {
-        fn foo() -> int { ret 3; }
-        fn quux() -> str { ret self.baz(); }
-        with my_obj
-    };
+    let my_ext_obj =
+        obj () {
+            fn foo() -> int { ret 3; }
+            fn quux() -> str { ret self.baz(); }
+            with
+            my_obj
+        };
 
-    assert my_ext_obj.foo() == 3;
-    assert my_ext_obj.bar() == 3;
-    assert my_ext_obj.baz() == "hello!";
-    assert my_ext_obj.quux() == "hello!";
+    assert (my_ext_obj.foo() == 3);
+    assert (my_ext_obj.bar() == 3);
+    assert (my_ext_obj.baz() == "hello!");
+    assert (my_ext_obj.quux() == "hello!");
 
     // And again.
-    let my_ext_ext_obj = obj() {
-        fn baz() -> str { "world!" }
-        with my_ext_obj
-    };
+    let my_ext_ext_obj =
+        obj () {
+            fn baz() -> str { "world!" }
+            with
+            my_ext_obj
+        };
 
-    assert my_ext_ext_obj.foo() == 3;
-    assert my_ext_ext_obj.bar() == 3;
-    assert my_ext_ext_obj.baz() == "world!";
-    assert my_ext_ext_obj.quux() == "world!";
+    assert (my_ext_ext_obj.foo() == 3);
+    assert (my_ext_ext_obj.bar() == 3);
+    assert (my_ext_ext_obj.baz() == "world!");
+    assert (my_ext_ext_obj.quux() == "world!");
 }
diff --git a/src/test/run-pass/anon-obj-overriding-reduced.rs b/src/test/run-pass/anon-obj-overriding-reduced.rs
index df1b700de56..3eb7c72d864 100644
--- a/src/test/run-pass/anon-obj-overriding-reduced.rs
+++ b/src/test/run-pass/anon-obj-overriding-reduced.rs
@@ -15,4 +15,4 @@ fn main() {
         };
 
     assert (my_b.foo() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-overriding.rs b/src/test/run-pass/anon-obj-overriding.rs
index 19860158ce4..e9551900b26 100644
--- a/src/test/run-pass/anon-obj-overriding.rs
+++ b/src/test/run-pass/anon-obj-overriding.rs
@@ -36,4 +36,4 @@ fn main() {
 
     assert (my_c.baz(1, 2) == 6);
     assert (my_d.baz(1, 2) == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-with-self-call-2.rs b/src/test/run-pass/anon-obj-with-self-call-2.rs
index 69153ac567b..807f1275d8a 100644
--- a/src/test/run-pass/anon-obj-with-self-call-2.rs
+++ b/src/test/run-pass/anon-obj-with-self-call-2.rs
@@ -13,4 +13,4 @@ fn main() {
         };
 
     assert (my_b.baz() == 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-with-self-call.rs b/src/test/run-pass/anon-obj-with-self-call.rs
index 2944bc0b595..76faa9decc4 100644
--- a/src/test/run-pass/anon-obj-with-self-call.rs
+++ b/src/test/run-pass/anon-obj-with-self-call.rs
@@ -28,4 +28,4 @@ fn main() {
 
     assert (my_c.baz() == 3);
     assert (my_c.bar() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs
index b0feeff2232..0bb536086ba 100644
--- a/src/test/run-pass/argv.rs
+++ b/src/test/run-pass/argv.rs
@@ -1,5 +1,5 @@
 fn main(args: [str]) {
-    let vs: [str] = ~["hi", "there", "this", "is", "a", "vec"];
-    let vvs: [[str]] = ~[args, vs];
+    let vs: [str] = ["hi", "there", "this", "is", "a", "vec"];
+    let vvs: [[str]] = [args, vs];
     for vs: [str] in vvs { for s: str in vs { log s; } }
 }
diff --git a/src/test/run-pass/arith-0.rs b/src/test/run-pass/arith-0.rs
index 6ad797982e6..7c77d25e4c0 100644
--- a/src/test/run-pass/arith-0.rs
+++ b/src/test/run-pass/arith-0.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); }
\ No newline at end of file
+fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); }
diff --git a/src/test/run-pass/arith-1.rs b/src/test/run-pass/arith-1.rs
index 0f907de0a6f..b9d61493ecf 100644
--- a/src/test/run-pass/arith-1.rs
+++ b/src/test/run-pass/arith-1.rs
@@ -20,4 +20,4 @@ fn main() {
     assert (i32_b & i32_b << 1 == 0);
     log i32_b | i32_b << 1;
     assert (i32_b | i32_b << 1 == 0x30303030);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/arith-2.rs b/src/test/run-pass/arith-2.rs
index bb0f67499a2..b55c66f8462 100644
--- a/src/test/run-pass/arith-2.rs
+++ b/src/test/run-pass/arith-2.rs
@@ -4,4 +4,4 @@ fn main() {
     let i32_c: int = 0x10101010;
     assert (i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3) ==
                 i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/arith-unsigned.rs b/src/test/run-pass/arith-unsigned.rs
index 75f7549b994..24433d49ebc 100644
--- a/src/test/run-pass/arith-unsigned.rs
+++ b/src/test/run-pass/arith-unsigned.rs
@@ -23,4 +23,4 @@ fn main() {
     assert (4000000005u32 % 10u32 == 5u32);
     // 64-bit numbers have some flakiness yet. Not tested
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/artificial-block.rs b/src/test/run-pass/artificial-block.rs
index 3944a0e9da5..87c7cc149f6 100644
--- a/src/test/run-pass/artificial-block.rs
+++ b/src/test/run-pass/artificial-block.rs
@@ -1,3 +1,3 @@
 fn f() -> int { { ret 3; } }
 
-fn main() { assert (f() == 3); }
\ No newline at end of file
+fn main() { assert (f() == 3); }
diff --git a/src/test/run-pass/assign-assign.rs b/src/test/run-pass/assign-assign.rs
index cdf5a6f18bd..fffb35e81fb 100644
--- a/src/test/run-pass/assign-assign.rs
+++ b/src/test/run-pass/assign-assign.rs
@@ -19,4 +19,4 @@ fn test_assign_op() {
     assert (x == 33);
 }
 
-fn main() { test_assign(); test_assign_op(); }
\ No newline at end of file
+fn main() { test_assign(); test_assign_op(); }
diff --git a/src/test/run-pass/auto-deref-fn.rs b/src/test/run-pass/auto-deref-fn.rs
index 717d79ad18e..caff3f29fbc 100644
--- a/src/test/run-pass/auto-deref-fn.rs
+++ b/src/test/run-pass/auto-deref-fn.rs
@@ -7,4 +7,4 @@ fn main() {
     assert (g(8) == 9);
     assert (h(0x1badd00d) == 0x1badd00e);
     assert ((@add1)(42) == 43);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/auto-loop.rs b/src/test/run-pass/auto-loop.rs
index b4ea2f5dedc..6e83d2ca0aa 100644
--- a/src/test/run-pass/auto-loop.rs
+++ b/src/test/run-pass/auto-loop.rs
@@ -1,5 +1,5 @@
 fn main() {
     let sum = 0;
-    for x in ~[1, 2, 3, 4, 5] { sum += x; }
+    for x in [1, 2, 3, 4, 5] { sum += x; }
     assert (sum == 15);
 }
diff --git a/src/test/run-pass/autobind.rs b/src/test/run-pass/autobind.rs
index f8a0f8e3ee7..536db525d5c 100644
--- a/src/test/run-pass/autobind.rs
+++ b/src/test/run-pass/autobind.rs
@@ -1,9 +1,9 @@
-fn f<T>(x: &[T]) -> T { ret x.(0); }
+fn f<T>(x: &[T]) -> T { ret x[0]; }
 
-fn g(act: fn(&[int]) -> int ) -> int { ret act(~[1, 2, 3]); }
+fn g(act: fn(&[int]) -> int) -> int { ret act([1, 2, 3]); }
 
 fn main() {
     assert (g(f) == 1);
-    let f1: fn(&[str]) -> str  = f;
-    assert (f1(~["x", "y", "z"]) == "x");
+    let f1: fn(&[str]) -> str = f;
+    assert (f1(["x", "y", "z"]) == "x");
 }
diff --git a/src/test/run-pass/autoderef-objfn.rs b/src/test/run-pass/autoderef-objfn.rs
index cf7bb394b4c..430293989a0 100644
--- a/src/test/run-pass/autoderef-objfn.rs
+++ b/src/test/run-pass/autoderef-objfn.rs
@@ -8,4 +8,4 @@ obj clam() {
 
 fn foo(c: @clam) { c.chowder(); }
 
-fn main() { let c: clam = clam(); foo(@c); }
\ No newline at end of file
+fn main() { let c: clam = clam(); foo(@c); }
diff --git a/src/test/run-pass/bind-interior.rs b/src/test/run-pass/bind-interior.rs
index ab3ce3b5e9f..639077a72c0 100644
--- a/src/test/run-pass/bind-interior.rs
+++ b/src/test/run-pass/bind-interior.rs
@@ -5,7 +5,7 @@
 fn f(n: int) -> int { ret n; }
 
 fn main() {
-    let g: fn() -> int  = bind f(10);
+    let g: fn() -> int = bind f(10);
     let i: int = g();
     assert (i == 10);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-obj-ctor.rs b/src/test/run-pass/bind-obj-ctor.rs
index 6be4df99abc..a76b17cc10a 100644
--- a/src/test/run-pass/bind-obj-ctor.rs
+++ b/src/test/run-pass/bind-obj-ctor.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (obj0.sum() == 3);
     assert (obj1.sum() == 3);
     assert (obj2.sum() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-parameterized-args-2.rs b/src/test/run-pass/bind-parameterized-args-2.rs
index 3646b8ba691..68d47073413 100644
--- a/src/test/run-pass/bind-parameterized-args-2.rs
+++ b/src/test/run-pass/bind-parameterized-args-2.rs
@@ -3,5 +3,5 @@ fn main() {
 
     let y = bind echo(42, _);
 
-    y(fn(i: &str){});
+    y(fn (i: &str) { });
 }
diff --git a/src/test/run-pass/bind-parameterized-args.rs b/src/test/run-pass/bind-parameterized-args.rs
index 53b8f85ea49..1f3e8efbf37 100644
--- a/src/test/run-pass/bind-parameterized-args.rs
+++ b/src/test/run-pass/bind-parameterized-args.rs
@@ -1,7 +1,7 @@
 fn main() {
     fn echo<T>(c: int, x: &[T]) { }
 
-    let y: fn(&[int])  = bind echo(42, _);
+    let y: fn(&[int]) = bind echo(42, _);
 
-    y(~[1]);
+    y([1]);
 }
diff --git a/src/test/run-pass/bind-thunk.rs b/src/test/run-pass/bind-thunk.rs
index e70fa6fdd6c..a85c7fc9679 100644
--- a/src/test/run-pass/bind-thunk.rs
+++ b/src/test/run-pass/bind-thunk.rs
@@ -5,7 +5,7 @@
 fn f() -> int { ret 42; }
 
 fn main() {
-    let g: fn() -> int  = bind f();
+    let g: fn() -> int = bind f();
     let i: int = g();
     assert (i == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-trivial.rs b/src/test/run-pass/bind-trivial.rs
index 35ed5d7477f..20b217c1046 100644
--- a/src/test/run-pass/bind-trivial.rs
+++ b/src/test/run-pass/bind-trivial.rs
@@ -5,7 +5,7 @@
 fn f(n: int) -> int { ret n; }
 
 fn main() {
-    let g: fn(int) -> int  = bind f(_);
+    let g: fn(int) -> int = bind f(_);
     let i: int = g(42);
     assert (i == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/binops.rs b/src/test/run-pass/binops.rs
index dfb02f70e7e..f676e6a3b11 100644
--- a/src/test/run-pass/binops.rs
+++ b/src/test/run-pass/binops.rs
@@ -64,8 +64,8 @@ fn test_port() {
     let p1 = comm::mk_port::<int>();
     let p2 = comm::mk_port::<int>();
 
-    assert p1 == p1;
-    assert p1 != p2;
+    assert (p1 == p1);
+    assert (p1 != p2);
 }
 
 fn test_chan() {
@@ -73,9 +73,9 @@ fn test_chan() {
     let ch1 = p.mk_chan();
     let ch2 = p.mk_chan();
 
-    assert ch1 == ch1;
+    assert (ch1 == ch1);
     // Chans are equal because they are just task:port addresses.
-    assert ch1 == ch2;
+    assert (ch1 == ch2);
 }
 
 fn test_ptr() {
@@ -89,8 +89,8 @@ fn test_task() {
     let t1 = task::spawn(f1);
     let t2 = task::spawn(f2);
 
-    assert t1 == t1;
-    assert t1 != t2;
+    assert (t1 == t1);
+    assert (t1 != t2);
 }
 
 fn test_fn() {
@@ -128,8 +128,8 @@ fn test_native_fn() {
 }
 
 fn test_obj() {
-    let o1 = obj () {  };
-    let o2 = obj () {  };
+    let o1 = obj () { };
+    let o2 = obj () { };
 
     assert (o1 == o1);
 
diff --git a/src/test/run-pass/bitwise.rs b/src/test/run-pass/bitwise.rs
index 0d41cb0c303..afe16cf113f 100644
--- a/src/test/run-pass/bitwise.rs
+++ b/src/test/run-pass/bitwise.rs
@@ -19,4 +19,4 @@ fn main() {
     assert (-16 >>> 2 == -4);
     assert (0b1010_1010 | 0b0101_0101 == 0xff);
     assert (-1000 >> 3 == 536870787);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/block-fn-coerce.rs b/src/test/run-pass/block-fn-coerce.rs
index c9dd29f7d00..163d99ee5d6 100644
--- a/src/test/run-pass/block-fn-coerce.rs
+++ b/src/test/run-pass/block-fn-coerce.rs
@@ -1,7 +1,7 @@
-fn force(f: &block() -> int ) -> int { ret f(); }
+fn force(f: &block() -> int) -> int { ret f(); }
 fn main() {
     let f = fn () -> int { ret 7 };
     assert (force(f) == 7);
     let g = bind force(f);
     assert (g() == 7);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/block-iter-1.rs b/src/test/run-pass/block-iter-1.rs
index 47c728af36d..006d4f18fe4 100644
--- a/src/test/run-pass/block-iter-1.rs
+++ b/src/test/run-pass/block-iter-1.rs
@@ -1,14 +1,10 @@
-fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } }
+fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } }
 
 fn main() {
-    let v = ~[1, 2, 3, 4, 5, 6, 7];
+    let v = [1, 2, 3, 4, 5, 6, 7];
     let odds = 0;
     iter_vec(v,
-             {|&i|
-                 log_err i;
-                 if i % 2 == 1 { odds += 1; }
-                 log_err odds;
-             });
+             {|&i| log_err i; if i % 2 == 1 { odds += 1; } log_err odds; });
     log_err odds;
     assert (odds == 4);
 }
diff --git a/src/test/run-pass/block-iter-2.rs b/src/test/run-pass/block-iter-2.rs
index a6d9455e3f1..d49cffbcc72 100644
--- a/src/test/run-pass/block-iter-2.rs
+++ b/src/test/run-pass/block-iter-2.rs
@@ -1,12 +1,9 @@
-fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } }
+fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } }
 
 fn main() {
-    let v = ~[1, 2, 3, 4, 5];
+    let v = [1, 2, 3, 4, 5];
     let sum = 0;
-    iter_vec(v,
-             {|&i|
-                 iter_vec(v, {|&j| log_err i * j; sum += i * j; });
-             });
+    iter_vec(v, {|&i| iter_vec(v, {|&j| log_err i * j; sum += i * j; }); });
     log_err sum;
     assert (sum == 225);
 }
diff --git a/src/test/run-pass/block-vec-map2.rs b/src/test/run-pass/block-vec-map2.rs
index 5153a81d1c7..35b979b3694 100644
--- a/src/test/run-pass/block-vec-map2.rs
+++ b/src/test/run-pass/block-vec-map2.rs
@@ -2,9 +2,9 @@ use std;
 import std::vec;
 
 fn main() {
-    let v = std::vec::map2({|&i, &b| if b { -i } else { i }},
-                           ~[1, 2, 3, 4, 5],
-                           ~[true, false, false, true, true]);
+    let v =
+        std::vec::map2({|&i, &b| if b { -i } else { i } }, [1, 2, 3, 4, 5],
+                       [true, false, false, true, true]);
     log_err v;
-    assert v == ~[-1, 2, 3, -4, -5];
+    assert (v == [-1, 2, 3, -4, -5]);
 }
diff --git a/src/test/run-pass/bool-not.rs b/src/test/run-pass/bool-not.rs
index 9d609d44efd..5e38e974c1a 100644
--- a/src/test/run-pass/bool-not.rs
+++ b/src/test/run-pass/bool-not.rs
@@ -5,4 +5,4 @@
 fn main() {
     if !false { assert (true); } else { assert (false); }
     if !true { assert (false); } else { assert (true); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box-compare.rs b/src/test/run-pass/box-compare.rs
index e3a93520d4a..51eeb6e8eb7 100644
--- a/src/test/run-pass/box-compare.rs
+++ b/src/test/run-pass/box-compare.rs
@@ -4,4 +4,4 @@ fn main() {
     assert (@1 < @3);
     assert (@@"hello " > @@"hello");
     assert (@@@"hello" != @@@"there");
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box-in-tup.rs b/src/test/run-pass/box-in-tup.rs
index aa2d6a596e1..0f75897a337 100644
--- a/src/test/run-pass/box-in-tup.rs
+++ b/src/test/run-pass/box-in-tup.rs
@@ -1,4 +1 @@
-fn main() {
-    let i: (@int, int) = (@10, 10);
-    let (a, _) = i;
-}
\ No newline at end of file
+fn main() { let i: (@int, int) = (@10, 10); let (a, _) = i; }
diff --git a/src/test/run-pass/box-pattern.rs b/src/test/run-pass/box-pattern.rs
index 6c20cdd805d..973d7e303b9 100644
--- a/src/test/run-pass/box-pattern.rs
+++ b/src/test/run-pass/box-pattern.rs
@@ -6,4 +6,4 @@ fn main() {
               u(@{a: a, b: b}) { a + (b as int) }
               _ { 66 }
             } == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box.rs b/src/test/run-pass/box.rs
index c9ef392e347..c3dee8ed5ea 100644
--- a/src/test/run-pass/box.rs
+++ b/src/test/run-pass/box.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: @int = @10; assert (*x == 10); }
\ No newline at end of file
+fn main() { let x: @int = @10; assert (*x == 10); }
diff --git a/src/test/run-pass/break-value.rs b/src/test/run-pass/break-value.rs
index 9db96e85782..764d03bdf22 100644
--- a/src/test/run-pass/break-value.rs
+++ b/src/test/run-pass/break-value.rs
@@ -1,3 +1,3 @@
 fn int_id(x: int) -> int { ret x; }
 
-fn main() { while true { int_id(break); } }
\ No newline at end of file
+fn main() { while true { int_id(break); } }
diff --git a/src/test/run-pass/break.rs b/src/test/run-pass/break.rs
index d53445ef586..962c360ca7b 100644
--- a/src/test/run-pass/break.rs
+++ b/src/test/run-pass/break.rs
@@ -6,15 +6,12 @@ fn main() {
     assert (i == 10);
     do  { i += 1; if i == 20 { break; } } while i < 30
     assert (i == 20);
-    for x: int in ~[1, 2, 3, 4, 5, 6] {
-        if x == 3 { break; }
-        assert (x <= 3);
-    }
+    for x: int in [1, 2, 3, 4, 5, 6] { if x == 3 { break; } assert (x <= 3); }
     i = 0;
     while i < 10 { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); }
     i = 0;
     do  { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); } while i < 10
-    for x: int in ~[1, 2, 3, 4, 5, 6] {
+    for x: int in [1, 2, 3, 4, 5, 6] {
         if x % 2 == 0 { cont; }
         assert (x % 2 != 0);
     }
diff --git a/src/test/run-pass/call-autoderef-tag.rs b/src/test/run-pass/call-autoderef-tag.rs
index 6cc87ae7b95..f978092ca95 100644
--- a/src/test/run-pass/call-autoderef-tag.rs
+++ b/src/test/run-pass/call-autoderef-tag.rs
@@ -1,5 +1,5 @@
-tag int_fn { f(fn(int) -> int ); }
-tag int_box_fn { fb(@fn(int) -> int ); }
+tag int_fn { f(fn(int) -> int); }
+tag int_box_fn { fb(@fn(int) -> int); }
 fn add1(i: int) -> int { ret i + 1; }
 fn main() {
     let g = f(add1);
@@ -7,4 +7,4 @@ fn main() {
     assert (f(add1)(5) == 6);
     assert ((@f(add1))(5) == 6);
     assert (fb(@add1)(7) == 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/cast.rs b/src/test/run-pass/cast.rs
index 38a4ca72a1a..6d1560305d6 100644
--- a/src/test/run-pass/cast.rs
+++ b/src/test/run-pass/cast.rs
@@ -13,4 +13,4 @@ fn main() {
     assert (0x51 as char == 'Q');
     assert (true == 1 as bool);
     assert (0 as u32 == false as u32);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/chan-leak.rs b/src/test/run-pass/chan-leak.rs
index 39e445b47ec..e08bfbd28ed 100644
--- a/src/test/run-pass/chan-leak.rs
+++ b/src/test/run-pass/chan-leak.rs
@@ -7,10 +7,7 @@ import std::comm::send;
 import std::comm;
 import std::comm::mk_port;
 
-tag request {
-  quit;
-  close(_chan<bool>);
-}
+tag request { quit; close(_chan<bool>); }
 
 type ctx = _chan<request>;
 
diff --git a/src/test/run-pass/char.rs b/src/test/run-pass/char.rs
index 8383a3d36fc..2783c05200f 100644
--- a/src/test/run-pass/char.rs
+++ b/src/test/run-pass/char.rs
@@ -10,4 +10,4 @@ fn main() {
     assert (d == c);
     assert (d == 'x');
     assert ('x' == d);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/child-outlives-parent.rs b/src/test/run-pass/child-outlives-parent.rs
index d6b48ccb131..2da34466cdb 100644
--- a/src/test/run-pass/child-outlives-parent.rs
+++ b/src/test/run-pass/child-outlives-parent.rs
@@ -5,4 +5,4 @@ import std::task;
 
 fn child2(s: str) { }
 
-fn main() { let x = task::_spawn(bind child2("hi")); }
\ No newline at end of file
+fn main() { let x = task::_spawn(bind child2("hi")); }
diff --git a/src/test/run-pass/claim-nonterm.rs b/src/test/run-pass/claim-nonterm.rs
index 6b555f1bc59..770beeb9fbf 100644
--- a/src/test/run-pass/claim-nonterm.rs
+++ b/src/test/run-pass/claim-nonterm.rs
@@ -5,4 +5,4 @@ import std::uint::*;
 
 pred fails(a: uint) -> bool { fail; }
 
-fn main() { let b: uint = 4u; claim (fails(b)); }
\ No newline at end of file
+fn main() { let b: uint = 4u; claim (fails(b)); }
diff --git a/src/test/run-pass/command-line-args.rs b/src/test/run-pass/command-line-args.rs
index 429bea89771..efd5d2bb04c 100644
--- a/src/test/run-pass/command-line-args.rs
+++ b/src/test/run-pass/command-line-args.rs
@@ -1,3 +1,3 @@
 
 
-fn main(args: [str]) { log args.(0); }
+fn main(args: [str]) { log args[0]; }
diff --git a/src/test/run-pass/complex.rs b/src/test/run-pass/complex.rs
index cc5d8d3acb7..1b14e7ab7f5 100644
--- a/src/test/run-pass/complex.rs
+++ b/src/test/run-pass/complex.rs
@@ -25,4 +25,4 @@ fn foo(x: int) -> int {
     ret 0;
 }
 
-fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; }
\ No newline at end of file
+fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; }
diff --git a/src/test/run-pass/const.rs b/src/test/run-pass/const.rs
index d181c49484b..b96ae6f7360 100644
--- a/src/test/run-pass/const.rs
+++ b/src/test/run-pass/const.rs
@@ -2,4 +2,4 @@
 
 const i: int = 10;
 
-fn main() { log i; }
\ No newline at end of file
+fn main() { log i; }
diff --git a/src/test/run-pass/constrained-type.rs b/src/test/run-pass/constrained-type.rs
index 96ab84cb53d..d05e4311dbf 100644
--- a/src/test/run-pass/constrained-type.rs
+++ b/src/test/run-pass/constrained-type.rs
@@ -6,6 +6,6 @@ type bubu = {x: int, y: int};
 
 pred less_than(x: int, y: int) -> bool { ret x < y; }
 
-type ordered_range = {low: int, high: int} : less_than(*.low, *.high);
+type ordered_range = {low: int, high: int}  : less_than(*.low, *.high);
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/constraint-prop-expr-move.rs b/src/test/run-pass/constraint-prop-expr-move.rs
index c9104f3e789..56ebc914b93 100644
--- a/src/test/run-pass/constraint-prop-expr-move.rs
+++ b/src/test/run-pass/constraint-prop-expr-move.rs
@@ -9,4 +9,4 @@ fn main() {
     check (le(a, b));
     c <- a;
     log safe_slice("kitties", c, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop-move.rs b/src/test/run-pass/constraint-prop-move.rs
index 9418d3dff7f..97285adae0c 100644
--- a/src/test/run-pass/constraint-prop-move.rs
+++ b/src/test/run-pass/constraint-prop-move.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(a, b));
     let c <- a;
     log safe_slice("kitties", c, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop-swap.rs b/src/test/run-pass/constraint-prop-swap.rs
index 3212ad54e2a..7b96a89bb16 100644
--- a/src/test/run-pass/constraint-prop-swap.rs
+++ b/src/test/run-pass/constraint-prop-swap.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(b, a));
     b <-> a;
     log safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop.rs b/src/test/run-pass/constraint-prop.rs
index 720f2ff5631..71f151f5260 100644
--- a/src/test/run-pass/constraint-prop.rs
+++ b/src/test/run-pass/constraint-prop.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(a, b));
     let c = b;
     log safe_slice("kitties", a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/crate-attributes-src/foo.rs b/src/test/run-pass/crate-attributes-src/foo.rs
index 7decb512ec4..5ab36dfe00d 100644
--- a/src/test/run-pass/crate-attributes-src/foo.rs
+++ b/src/test/run-pass/crate-attributes-src/foo.rs
@@ -5,4 +5,4 @@
 // Attributes of the following function
 #[attr1 = "val"]
 #[attr2 = "val"]
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/dead-code-one-arm-if.rs b/src/test/run-pass/dead-code-one-arm-if.rs
index 456d8bff367..5aedb18282b 100644
--- a/src/test/run-pass/dead-code-one-arm-if.rs
+++ b/src/test/run-pass/dead-code-one-arm-if.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { if 1 == 1 { ret; } log "Paul is dead"; }
\ No newline at end of file
+fn main() { if 1 == 1 { ret; } log "Paul is dead"; }
diff --git a/src/test/run-pass/deep.rs b/src/test/run-pass/deep.rs
index c229ff93598..461d3c9ddfd 100644
--- a/src/test/run-pass/deep.rs
+++ b/src/test/run-pass/deep.rs
@@ -6,4 +6,4 @@ fn f(x: int) -> int {
     if x == 1 { ret 1; } else { let y: int = 1 + f(x - 1); ret y; }
 }
 
-fn main() { assert (f(5000) == 5000); }
\ No newline at end of file
+fn main() { assert (f(5000) == 5000); }
diff --git a/src/test/run-pass/deref-lval.rs b/src/test/run-pass/deref-lval.rs
index ba5149a7fd8..33d7f48dfe0 100644
--- a/src/test/run-pass/deref-lval.rs
+++ b/src/test/run-pass/deref-lval.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x = @mutable 5; *x = 1000; log *x; }
\ No newline at end of file
+fn main() { let x = @mutable 5; *x = 1000; log *x; }
diff --git a/src/test/run-pass/deref.rs b/src/test/run-pass/deref.rs
index 71dcfeb81f6..0d7276af659 100644
--- a/src/test/run-pass/deref.rs
+++ b/src/test/run-pass/deref.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: @int = @10; let y: int = *x; }
\ No newline at end of file
+fn main() { let x: @int = @10; let y: int = *x; }
diff --git a/src/test/run-pass/div-mod.rs b/src/test/run-pass/div-mod.rs
index 38a5bab5ca7..0e663ef4e09 100644
--- a/src/test/run-pass/div-mod.rs
+++ b/src/test/run-pass/div-mod.rs
@@ -15,4 +15,4 @@ fn main() {
     assert (x % 3 == 0);
     assert (x % y == 0);
     assert (15 % y == 0);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/double-unbox.rs b/src/test/run-pass/double-unbox.rs
index 32ecfa628e6..aacfbb91509 100644
--- a/src/test/run-pass/double-unbox.rs
+++ b/src/test/run-pass/double-unbox.rs
@@ -3,4 +3,4 @@ type quux = {bar: int};
 fn g(i: &int) { }
 fn f(foo: @@quux) { g(foo.bar); }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/drop-bind-thunk-args.rs b/src/test/run-pass/drop-bind-thunk-args.rs
index d5eddb77321..2a2d2c5e630 100644
--- a/src/test/run-pass/drop-bind-thunk-args.rs
+++ b/src/test/run-pass/drop-bind-thunk-args.rs
@@ -2,4 +2,4 @@
 
 fn f(x: @int) { }
 
-fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); }
\ No newline at end of file
+fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); }
diff --git a/src/test/run-pass/drop-on-empty-block-exit.rs b/src/test/run-pass/drop-on-empty-block-exit.rs
index 2a4f093f1de..97a161f19e7 100644
--- a/src/test/run-pass/drop-on-empty-block-exit.rs
+++ b/src/test/run-pass/drop-on-empty-block-exit.rs
@@ -2,4 +2,4 @@
 
 tag t { foo(@int); }
 
-fn main() { let tt = foo(@10); alt tt { foo(z) { } } }
\ No newline at end of file
+fn main() { let tt = foo(@10); alt tt { foo(z) { } } }
diff --git a/src/test/run-pass/drop-on-ret.rs b/src/test/run-pass/drop-on-ret.rs
index f1da1a37176..821601baae8 100644
--- a/src/test/run-pass/drop-on-ret.rs
+++ b/src/test/run-pass/drop-on-ret.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f() -> int { if true { let s: str = "should not leak"; ret 1; } ret 0; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/early-ret-binop-add.rs b/src/test/run-pass/early-ret-binop-add.rs
index dc847b30fc2..f7719afc591 100644
--- a/src/test/run-pass/early-ret-binop-add.rs
+++ b/src/test/run-pass/early-ret-binop-add.rs
@@ -1,4 +1,2 @@
-fn wsucc(n: int) -> int {
-    { ret n + 1 } + 0;
-}
-fn main() {}
+fn wsucc(n: int) -> int { { ret n + 1 } + 0; }
+fn main() { }
diff --git a/src/test/run-pass/early-ret-binop.rs b/src/test/run-pass/early-ret-binop.rs
index 682bf502ce3..ffa6efb4e80 100644
--- a/src/test/run-pass/early-ret-binop.rs
+++ b/src/test/run-pass/early-ret-binop.rs
@@ -1,4 +1,2 @@
-fn wsucc(n: int) -> int {
-    { ret n + 1 } == 0;
-}
-fn main() {}
+fn wsucc(n: int) -> int { { ret n + 1 } == 0; }
+fn main() { }
diff --git a/src/test/run-pass/else-if.rs b/src/test/run-pass/else-if.rs
index cf13a53d86a..5f85f13ae80 100644
--- a/src/test/run-pass/else-if.rs
+++ b/src/test/run-pass/else-if.rs
@@ -3,13 +3,13 @@
 fn main() {
     if 1 == 2 {
         assert (false);
-    } else if (2 == 3) {
+    } else if 2 == 3 {
         assert (false);
-    } else if (3 == 4) { assert (false); } else { assert (true); }
-    if 1 == 2 { assert (false); } else if (2 == 2) { assert (true); }
+    } else if 3 == 4 { assert (false); } else { assert (true); }
+    if 1 == 2 { assert (false); } else if 2 == 2 { assert (true); }
     if 1 == 2 {
         assert (false);
-    } else if (2 == 2) {
+    } else if 2 == 2 {
         if 1 == 1 {
             assert (true);
         } else { if 2 == 1 { assert (false); } else { assert (false); } }
@@ -17,4 +17,4 @@ fn main() {
     if 1 == 2 {
         assert (false);
     } else { if 1 == 2 { assert (false); } else { assert (true); } }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/empty-mutable-vec.rs b/src/test/run-pass/empty-mutable-vec.rs
index de1d84ae134..6dfd5446160 100644
--- a/src/test/run-pass/empty-mutable-vec.rs
+++ b/src/test/run-pass/empty-mutable-vec.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let v: [mutable int] = ~[mutable ]; }
+fn main() { let v: [mutable int] = [mutable]; }
diff --git a/src/test/run-pass/export-abstract-tag.rs b/src/test/run-pass/export-abstract-tag.rs
index 7ef167c6a0a..f30d128635b 100644
--- a/src/test/run-pass/export-abstract-tag.rs
+++ b/src/test/run-pass/export-abstract-tag.rs
@@ -10,4 +10,4 @@ mod foo {
     fn f() -> t { ret t1; }
 }
 
-fn main() { let v: foo::t = foo::f(); }
\ No newline at end of file
+fn main() { let v: foo::t = foo::f(); }
diff --git a/src/test/run-pass/export-multi.rs b/src/test/run-pass/export-multi.rs
index 9f382cb4b77..6229e60532e 100644
--- a/src/test/run-pass/export-multi.rs
+++ b/src/test/run-pass/export-multi.rs
@@ -4,13 +4,8 @@ import m::g;
 mod m {
     export f, g;
 
-    fn f() {}
-    fn g() {}
+    fn f() { }
+    fn g() { }
 }
 
-fn main() {
-    f();
-    g();
-    m::f();
-    m::g();
-}
\ No newline at end of file
+fn main() { f(); g(); m::f(); m::g(); }
diff --git a/src/test/run-pass/export-non-interference2.rs b/src/test/run-pass/export-non-interference2.rs
index b9ffd8e8a58..c32f718c4d1 100644
--- a/src/test/run-pass/export-non-interference2.rs
+++ b/src/test/run-pass/export-non-interference2.rs
@@ -9,4 +9,4 @@ mod foo {
     fn x() { log "x"; }
 }
 
-fn main() { foo::bar::y(); }
\ No newline at end of file
+fn main() { foo::bar::y(); }
diff --git a/src/test/run-pass/export-non-interference3.rs b/src/test/run-pass/export-non-interference3.rs
index bfb734525a1..14fba5d40c3 100644
--- a/src/test/run-pass/export-non-interference3.rs
+++ b/src/test/run-pass/export-non-interference3.rs
@@ -10,4 +10,4 @@ mod bar {
     fn x() { log "x"; }
 }
 
-fn main() { foo::x(); }
\ No newline at end of file
+fn main() { foo::x(); }
diff --git a/src/test/run-pass/export-tag-variant.rs b/src/test/run-pass/export-tag-variant.rs
index f7599d08728..12eaf63949b 100644
--- a/src/test/run-pass/export-tag-variant.rs
+++ b/src/test/run-pass/export-tag-variant.rs
@@ -5,4 +5,4 @@ mod foo {
     tag t { t1; }
 }
 
-fn main() { let v = foo::t1; }
\ No newline at end of file
+fn main() { let v = foo::t1; }
diff --git a/src/test/run-pass/export-unexported-dep.rs b/src/test/run-pass/export-unexported-dep.rs
index 8f1d54ea5a5..bc8451a4854 100644
--- a/src/test/run-pass/export-unexported-dep.rs
+++ b/src/test/run-pass/export-unexported-dep.rs
@@ -13,4 +13,4 @@ mod foo {
     fn g(v: t) { assert (v == t1); }
 }
 
-fn main() { foo::g(foo::f()); }
\ No newline at end of file
+fn main() { foo::g(foo::f()); }
diff --git a/src/test/run-pass/expr-alt-box.rs b/src/test/run-pass/expr-alt-box.rs
index a397874dbd9..84c9e424f46 100644
--- a/src/test/run-pass/expr-alt-box.rs
+++ b/src/test/run-pass/expr-alt-box.rs
@@ -11,4 +11,4 @@ fn test_str() {
     assert (res == "happy");
 }
 
-fn main() { test_box(); test_str(); }
\ No newline at end of file
+fn main() { test_box(); test_str(); }
diff --git a/src/test/run-pass/expr-alt-fail-all.rs b/src/test/run-pass/expr-alt-fail-all.rs
index 55f4e69524d..3ff8af3cb97 100644
--- a/src/test/run-pass/expr-alt-fail-all.rs
+++ b/src/test/run-pass/expr-alt-fail-all.rs
@@ -9,4 +9,4 @@ fn main() {
           true { 10 }
           false { alt true { true { fail } false { fail } } }
         };
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-alt-fail.rs b/src/test/run-pass/expr-alt-fail.rs
index fb3f0dac014..7dfffcc1120 100644
--- a/src/test/run-pass/expr-alt-fail.rs
+++ b/src/test/run-pass/expr-alt-fail.rs
@@ -4,8 +4,8 @@ fn test_simple() {
 }
 
 fn test_box() {
-    let r = alt true { true { ~[10] } false { fail } };
-    assert (r.(0) == 10);
+    let r = alt true { true { [10] } false { fail } };
+    assert (r[0] == 10);
 }
 
-fn main() { test_simple(); test_box(); }
\ No newline at end of file
+fn main() { test_simple(); test_box(); }
diff --git a/src/test/run-pass/expr-alt-generic-box1.rs b/src/test/run-pass/expr-alt-generic-box1.rs
index ec299544094..763f303bbd6 100644
--- a/src/test/run-pass/expr-alt-generic-box1.rs
+++ b/src/test/run-pass/expr-alt-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, eq: &compare<T>) {
     let actual: @T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-generic-box2.rs b/src/test/run-pass/expr-alt-generic-box2.rs
index f7e96af98d5..046d77cd438 100644
--- a/src/test/run-pass/expr-alt-generic-box2.rs
+++ b/src/test/run-pass/expr-alt-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-generic.rs b/src/test/run-pass/expr-alt-generic.rs
index cfecd0302a1..c9990a0c756 100644
--- a/src/test/run-pass/expr-alt-generic.rs
+++ b/src/test/run-pass/expr-alt-generic.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-struct.rs b/src/test/run-pass/expr-alt-struct.rs
index 51ef9e09457..e346c9d2a9f 100644
--- a/src/test/run-pass/expr-alt-struct.rs
+++ b/src/test/run-pass/expr-alt-struct.rs
@@ -15,4 +15,4 @@ fn test_tag() {
     assert (rs == happy);
 }
 
-fn main() { test_rec(); test_tag(); }
\ No newline at end of file
+fn main() { test_rec(); test_tag(); }
diff --git a/src/test/run-pass/expr-alt.rs b/src/test/run-pass/expr-alt.rs
index 8d4ddd288f6..93495115ba7 100644
--- a/src/test/run-pass/expr-alt.rs
+++ b/src/test/run-pass/expr-alt.rs
@@ -41,4 +41,4 @@ fn main() {
     test_inferrence();
     test_alt_as_alt_head();
     test_alt_as_block_result();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-block-box.rs b/src/test/run-pass/expr-block-box.rs
index 62971193037..c434db7a8bf 100644
--- a/src/test/run-pass/expr-block-box.rs
+++ b/src/test/run-pass/expr-block-box.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x = { @100 }; assert (*x == 100); }
\ No newline at end of file
+fn main() { let x = { @100 }; assert (*x == 100); }
diff --git a/src/test/run-pass/expr-block-fn.rs b/src/test/run-pass/expr-block-fn.rs
index dc8690f15ad..8b461bcf863 100644
--- a/src/test/run-pass/expr-block-fn.rs
+++ b/src/test/run-pass/expr-block-fn.rs
@@ -1,11 +1,11 @@
 
 
 fn test_fn() {
-    type t = fn() -> int ;
+    type t = fn() -> int;
 
     fn ten() -> int { ret 10; }
     let rs: t = { ten };
     assert (rs() == 10);
 }
 
-fn main() { test_fn(); }
\ No newline at end of file
+fn main() { test_fn(); }
diff --git a/src/test/run-pass/expr-block-generic-box1.rs b/src/test/run-pass/expr-block-generic-box1.rs
index d68f0cf5d89..5ab310cb309 100644
--- a/src/test/run-pass/expr-block-generic-box1.rs
+++ b/src/test/run-pass/expr-block-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, eq: &compare<T>) {
     let actual: @T = { expected };
diff --git a/src/test/run-pass/expr-block-generic-box2.rs b/src/test/run-pass/expr-block-generic-box2.rs
index d630b65c822..3f8293490f3 100644
--- a/src/test/run-pass/expr-block-generic-box2.rs
+++ b/src/test/run-pass/expr-block-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = { expected };
diff --git a/src/test/run-pass/expr-block-generic.rs b/src/test/run-pass/expr-block-generic.rs
index d7c17731559..52d463eae2a 100644
--- a/src/test/run-pass/expr-block-generic.rs
+++ b/src/test/run-pass/expr-block-generic.rs
@@ -4,7 +4,7 @@
 // -*- rust -*-
 
 // Tests for standalone blocks as expressions with dynamic type sizes
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = { expected };
diff --git a/src/test/run-pass/expr-block-ref.rs b/src/test/run-pass/expr-block-ref.rs
index 6a0a1700a94..59107298782 100644
--- a/src/test/run-pass/expr-block-ref.rs
+++ b/src/test/run-pass/expr-block-ref.rs
@@ -1,2 +1,2 @@
 // Regression test for issue #388
-fn main() { let x = { { @10 } }; }
\ No newline at end of file
+fn main() { let x = { { @10 } }; }
diff --git a/src/test/run-pass/expr-block-slot.rs b/src/test/run-pass/expr-block-slot.rs
index d36330f287f..f2a73836f01 100644
--- a/src/test/run-pass/expr-block-slot.rs
+++ b/src/test/run-pass/expr-block-slot.rs
@@ -4,4 +4,4 @@ fn main() {
     assert (a.a == 3);
     let c = { let d = {v: 3}; d };
     assert (c.v == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-block.rs b/src/test/run-pass/expr-block.rs
index d0fb65c5ffd..3aab0a64744 100644
--- a/src/test/run-pass/expr-block.rs
+++ b/src/test/run-pass/expr-block.rs
@@ -13,4 +13,4 @@ fn test_filled_with_stuff() {
     assert (rs == 10);
 }
 
-fn main() { test_basic(); test_rec(); test_filled_with_stuff(); }
\ No newline at end of file
+fn main() { test_basic(); test_rec(); test_filled_with_stuff(); }
diff --git a/src/test/run-pass/expr-copy.rs b/src/test/run-pass/expr-copy.rs
index 6fbaf4f7679..56f7dbb9996 100644
--- a/src/test/run-pass/expr-copy.rs
+++ b/src/test/run-pass/expr-copy.rs
@@ -1,5 +1 @@
-fn main() {
-    let x = 10;
-    let y = copy x;
-    log y;
-}
\ No newline at end of file
+fn main() { let x = 10; let y = copy x; log y; }
diff --git a/src/test/run-pass/expr-elseif-ref.rs b/src/test/run-pass/expr-elseif-ref.rs
index 1de7fa6e414..4235c21ac5f 100644
--- a/src/test/run-pass/expr-elseif-ref.rs
+++ b/src/test/run-pass/expr-elseif-ref.rs
@@ -2,6 +2,6 @@
 // values from the else if branch
 fn main() {
     let y: @uint = @10u;
-    let x = if false { y } else if (true) { y } else { y };
+    let x = if false { y } else if true { y } else { y };
     assert (*y == 10u);
 }
diff --git a/src/test/run-pass/expr-elseif-ref2.rs b/src/test/run-pass/expr-elseif-ref2.rs
index ef8559ef062..8a3af93dc90 100644
--- a/src/test/run-pass/expr-elseif-ref2.rs
+++ b/src/test/run-pass/expr-elseif-ref2.rs
@@ -1,4 +1,2 @@
 // Regression test for issue #388
-fn main() {
-    let x = if false { @0u } else if (true) { @10u } else { @0u };
-}
\ No newline at end of file
+fn main() { let x = if false { @0u } else if true { @10u } else { @0u }; }
diff --git a/src/test/run-pass/expr-empty-ret.rs b/src/test/run-pass/expr-empty-ret.rs
index 99ce1fac7b7..6044c6e8ff7 100644
--- a/src/test/run-pass/expr-empty-ret.rs
+++ b/src/test/run-pass/expr-empty-ret.rs
@@ -2,4 +2,4 @@
 
 fn f() { let x = alt true { true { 10 } false { ret } }; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/expr-fn.rs b/src/test/run-pass/expr-fn.rs
index 1bff51000b9..b7070ead5ed 100644
--- a/src/test/run-pass/expr-fn.rs
+++ b/src/test/run-pass/expr-fn.rs
@@ -4,8 +4,8 @@ fn test_int() {
 }
 
 fn test_vec() {
-    fn f() -> [int] { ~[10, 11] }
-    assert (f().(1) == 11);
+    fn f() -> [int] { [10, 11] }
+    assert (f()[1] == 11);
 }
 
 fn test_generic() {
diff --git a/src/test/run-pass/expr-if-box.rs b/src/test/run-pass/expr-if-box.rs
index 32881d23bae..7d9e2320e93 100644
--- a/src/test/run-pass/expr-if-box.rs
+++ b/src/test/run-pass/expr-if-box.rs
@@ -14,4 +14,4 @@ fn test_str() {
     assert (rs == "happy");
 }
 
-fn main() { test_box(); test_str(); }
\ No newline at end of file
+fn main() { test_box(); test_str(); }
diff --git a/src/test/run-pass/expr-if-fail-all.rs b/src/test/run-pass/expr-if-fail-all.rs
index f9ad1075605..347a7f5ce9a 100644
--- a/src/test/run-pass/expr-if-fail-all.rs
+++ b/src/test/run-pass/expr-if-fail-all.rs
@@ -1,3 +1,3 @@
 // When all branches of an if expression result in fail, the entire if
 // expression results in fail.
-fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; }
\ No newline at end of file
+fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; }
diff --git a/src/test/run-pass/expr-if-fail.rs b/src/test/run-pass/expr-if-fail.rs
index 4c9c8e07d4c..0a19c446388 100644
--- a/src/test/run-pass/expr-if-fail.rs
+++ b/src/test/run-pass/expr-if-fail.rs
@@ -6,8 +6,8 @@ fn test_else_fail() {
 }
 
 fn test_elseif_fail() {
-    let x = if false { 0 } else if (false) { fail } else { 10 };
+    let x = if false { 0 } else if false { fail } else { 10 };
     assert (x == 10);
 }
 
-fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); }
\ No newline at end of file
+fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); }
diff --git a/src/test/run-pass/expr-if-generic-box1.rs b/src/test/run-pass/expr-if-generic-box1.rs
index 82bbbb840a6..6d69cce9a1b 100644
--- a/src/test/run-pass/expr-if-generic-box1.rs
+++ b/src/test/run-pass/expr-if-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, not_expected: @T, eq: &compare<T>) {
     let actual: @T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-generic-box2.rs b/src/test/run-pass/expr-if-generic-box2.rs
index 7cf77d61686..b31fb91f229 100644
--- a/src/test/run-pass/expr-if-generic-box2.rs
+++ b/src/test/run-pass/expr-if-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) {
     let actual: T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-generic.rs b/src/test/run-pass/expr-if-generic.rs
index df466051ce4..99709ea396c 100644
--- a/src/test/run-pass/expr-if-generic.rs
+++ b/src/test/run-pass/expr-if-generic.rs
@@ -4,7 +4,7 @@
 // -*- rust -*-
 
 // Tests for if as expressions with dynamic type sizes
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) {
     let actual: T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-struct.rs b/src/test/run-pass/expr-if-struct.rs
index 481fbf3b21a..56728c67706 100644
--- a/src/test/run-pass/expr-if-struct.rs
+++ b/src/test/run-pass/expr-if-struct.rs
@@ -15,4 +15,4 @@ fn test_tag() {
     assert (rs == happy);
 }
 
-fn main() { test_rec(); test_tag(); }
\ No newline at end of file
+fn main() { test_rec(); test_tag(); }
diff --git a/src/test/run-pass/expr-if.rs b/src/test/run-pass/expr-if.rs
index 74c2a53eda1..43f3083f164 100644
--- a/src/test/run-pass/expr-if.rs
+++ b/src/test/run-pass/expr-if.rs
@@ -12,17 +12,17 @@ fn test_else() {
 }
 
 fn test_elseif1() {
-    let rs: bool = if true { true } else if (true) { false } else { false };
+    let rs: bool = if true { true } else if true { false } else { false };
     assert (rs);
 }
 
 fn test_elseif2() {
-    let rs: bool = if false { false } else if (true) { true } else { false };
+    let rs: bool = if false { false } else if true { true } else { false };
     assert (rs);
 }
 
 fn test_elseif3() {
-    let rs: bool = if false { false } else if (false) { false } else { true };
+    let rs: bool = if false { false } else if false { false } else { true };
     assert (rs);
 }
 
@@ -52,4 +52,4 @@ fn main() {
     test_inferrence();
     test_if_as_if_condition();
     test_if_as_block_result();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-scope.rs b/src/test/run-pass/expr-scope.rs
index d5a2a069f7f..53c8223c778 100644
--- a/src/test/run-pass/expr-scope.rs
+++ b/src/test/run-pass/expr-scope.rs
@@ -2,4 +2,4 @@
 // xfail-fast
 
 fn f() { }
-fn main() { ret ::f(); }
\ No newline at end of file
+fn main() { ret ::f(); }
diff --git a/src/test/run-pass/exterior.rs b/src/test/run-pass/exterior.rs
index ae34d051a2b..228f7dff061 100644
--- a/src/test/run-pass/exterior.rs
+++ b/src/test/run-pass/exterior.rs
@@ -13,4 +13,4 @@ fn main() {
     f(b);
     assert (a.z == 12);
     assert (b.z == 13);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fact.rs b/src/test/run-pass/fact.rs
index f47c2e9ece9..95af3b8a6b6 100644
--- a/src/test/run-pass/fact.rs
+++ b/src/test/run-pass/fact.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (f(5) == 120);
     // log "all done";
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fixed-point-bind-box.rs b/src/test/run-pass/fixed-point-bind-box.rs
index f93add461a4..4ca1cdb34c9 100644
--- a/src/test/run-pass/fixed-point-bind-box.rs
+++ b/src/test/run-pass/fixed-point-bind-box.rs
@@ -1,12 +1,12 @@
-fn fix_help<A, B>(f: @fn(@fn(&A) -> B , &A) -> B , x: &A) -> B {
+fn fix_help<A, B>(f: @fn(@fn(&A) -> B, &A) -> B, x: &A) -> B {
     ret f(@bind fix_help(f, _), x);
 }
 
-fn fix<A, B>(f: @fn(@fn(&A) -> B , &A) -> B ) -> @fn(&A) -> B  {
+fn fix<A, B>(f: @fn(@fn(&A) -> B, &A) -> B) -> @fn(&A) -> B {
     ret @bind fix_help(f, _);
 }
 
-fn fact_(f: @fn(&int) -> int , n: &int) -> int {
+fn fact_(f: @fn(&int) -> int, n: &int) -> int {
     // fun fact 0 = 1
     ret if n == 0 { 1 } else { n * f(n - 1) };
 }
diff --git a/src/test/run-pass/float-signature.rs b/src/test/run-pass/float-signature.rs
index f2e7229623a..8eb940d8883 100644
--- a/src/test/run-pass/float-signature.rs
+++ b/src/test/run-pass/float-signature.rs
@@ -5,4 +5,4 @@ fn main() {
     let n: float = 0.1;
     let m: float = foo(n);
     log m;
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/float.rs b/src/test/run-pass/float.rs
index b9014c9b085..a0b4a32d41a 100644
--- a/src/test/run-pass/float.rs
+++ b/src/test/run-pass/float.rs
@@ -7,4 +7,4 @@ fn main() {
            || pi > 1.0 {
         log "yes";
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/float2.rs b/src/test/run-pass/float2.rs
index 1eed1e37aec..26b5a64ebe5 100644
--- a/src/test/run-pass/float2.rs
+++ b/src/test/run-pass/float2.rs
@@ -21,4 +21,4 @@ fn main() {
     assert (h == i);
     assert (j > k);
     assert (k < a);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/floatlits.rs b/src/test/run-pass/floatlits.rs
index 13039f2bf3b..6f43ad9b760 100644
--- a/src/test/run-pass/floatlits.rs
+++ b/src/test/run-pass/floatlits.rs
@@ -7,4 +7,4 @@ fn main() {
     let g = 4.90000000001e-10;
     assert (g > 5e-11);
     assert (g < 5e-9);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fn-constraint.rs b/src/test/run-pass/fn-constraint.rs
index 2f7b81effec..f9ea572a735 100644
--- a/src/test/run-pass/fn-constraint.rs
+++ b/src/test/run-pass/fn-constraint.rs
@@ -7,4 +7,4 @@ fn main() {
     let b: uint = 4u;
     check (le(a, b));
     log safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fn-expr.rs b/src/test/run-pass/fn-expr.rs
index dfe4d2bd9a7..64b28e4a289 100644
--- a/src/test/run-pass/fn-expr.rs
+++ b/src/test/run-pass/fn-expr.rs
@@ -1 +1 @@
-fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); }
\ No newline at end of file
+fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); }
diff --git a/src/test/run-pass/fn-lval.rs b/src/test/run-pass/fn-lval.rs
index faa12c8720d..c62ad36052f 100644
--- a/src/test/run-pass/fn-lval.rs
+++ b/src/test/run-pass/fn-lval.rs
@@ -2,8 +2,8 @@
 
 
 // -*- rust -*-
-fn foo(f: fn(int) -> int ) { }
+fn foo(f: fn(int) -> int) { }
 
 fn id(x: int) -> int { ret x; }
 
-fn main() { foo(id); }
\ No newline at end of file
+fn main() { foo(id); }
diff --git a/src/test/run-pass/fn-type-infer.rs b/src/test/run-pass/fn-type-infer.rs
index c3513bdff8a..d9b6ac60ba3 100644
--- a/src/test/run-pass/fn-type-infer.rs
+++ b/src/test/run-pass/fn-type-infer.rs
@@ -1,4 +1,4 @@
 fn main() {
     // We should be able to type infer inside of lambdas.
     let f = fn () { let i = 10; };
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/for-destruct.rs b/src/test/run-pass/for-destruct.rs
index cc1702d247c..569d596e7b7 100644
--- a/src/test/run-pass/for-destruct.rs
+++ b/src/test/run-pass/for-destruct.rs
@@ -1,5 +1,5 @@
 fn main() {
-    for {x, y}: {x: int, y: int} in ~[{x: 10, y: 20}, {x: 30, y: 0}] {
-        assert x + y == 30;
+    for {x: x, y: y}: {x: int, y: int} in [{x: 10, y: 20}, {x: 30, y: 0}] {
+        assert (x + y == 30);
     }
 }
diff --git a/src/test/run-pass/for-each-destruct.rs b/src/test/run-pass/for-each-destruct.rs
index 935746473a9..59488f8730d 100644
--- a/src/test/run-pass/for-each-destruct.rs
+++ b/src/test/run-pass/for-each-destruct.rs
@@ -1,13 +1,8 @@
 iter x() -> {x: int, y: int} {
     let i = 0;
-    while i < 40 {
-        put {x: i, y: 30 - i};
-        i += 10;
-    }
+    while i < 40 { put {x: i, y: 30 - i}; i += 10; }
 }
 
 fn main() {
-    for each {x, y}: {x: int, y: int} in x() {
-        assert x + y == 30;
-    }
+    for each {x: x, y: y}: {x: int, y: int} in x() { assert (x + y == 30); }
 }
diff --git a/src/test/run-pass/for-loop-fail.rs b/src/test/run-pass/for-loop-fail.rs
index 2e52a5ae1f7..d605e1797e1 100644
--- a/src/test/run-pass/for-loop-fail.rs
+++ b/src/test/run-pass/for-loop-fail.rs
@@ -1 +1 @@
-fn main() { let x: [int] = ~[]; for i: int in x { fail "moop"; } }
+fn main() { let x: [int] = []; for i: int in x { fail "moop"; } }
diff --git a/src/test/run-pass/foreach-nested-2.rs b/src/test/run-pass/foreach-nested-2.rs
index ba42d7a6ac4..472bea23cfe 100644
--- a/src/test/run-pass/foreach-nested-2.rs
+++ b/src/test/run-pass/foreach-nested-2.rs
@@ -10,20 +10,20 @@ iter range(start: int, stop: int) -> int {
 }
 
 fn main() {
-    let a: [mutable int] = ~[mutable -1, -1, -1, -1, -1, -1, -1, -1];
+    let a: [mutable int] = [mutable -1, -1, -1, -1, -1, -1, -1, -1];
     let p: int = 0;
     for each i: int in two() {
         for each j: int in range(0, 2) {
             let tmp: int = 10 * i + j;
-            for each k: int in range(0, 2) { a.(p) = 10 * tmp + k; p += 1; }
+            for each k: int in range(0, 2) { a[p] = 10 * tmp + k; p += 1; }
         }
     }
-    assert (a.(0) == 0);
-    assert (a.(1) == 1);
-    assert (a.(2) == 10);
-    assert (a.(3) == 11);
-    assert (a.(4) == 100);
-    assert (a.(5) == 101);
-    assert (a.(6) == 110);
-    assert (a.(7) == 111);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 10);
+    assert (a[3] == 11);
+    assert (a[4] == 100);
+    assert (a[5] == 101);
+    assert (a[6] == 110);
+    assert (a[7] == 111);
 }
diff --git a/src/test/run-pass/foreach-nested.rs b/src/test/run-pass/foreach-nested.rs
index 4e90818621d..802381006e5 100644
--- a/src/test/run-pass/foreach-nested.rs
+++ b/src/test/run-pass/foreach-nested.rs
@@ -5,13 +5,13 @@
 iter two() -> int { put 0; put 1; }
 
 fn main() {
-    let a: [mutable int] = ~[mutable -1, -1, -1, -1];
+    let a: [mutable int] = [mutable -1, -1, -1, -1];
     let p: int = 0;
     for each i: int in two() {
-        for each j: int in two() { a.(p) = 10 * i + j; p += 1; }
+        for each j: int in two() { a[p] = 10 * i + j; p += 1; }
     }
-    assert (a.(0) == 0);
-    assert (a.(1) == 1);
-    assert (a.(2) == 10);
-    assert (a.(3) == 11);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 10);
+    assert (a[3] == 11);
 }
diff --git a/src/test/run-pass/fun-call-variants.rs b/src/test/run-pass/fun-call-variants.rs
index 6409767ab40..0469e804948 100644
--- a/src/test/run-pass/fun-call-variants.rs
+++ b/src/test/run-pass/fun-call-variants.rs
@@ -1,15 +1,13 @@
 // -*- rust -*-
-fn ho(f: fn(int) -> int ) -> int { let n: int = f(3); ret n; }
+fn ho(f: fn(int) -> int) -> int { let n: int = f(3); ret n; }
 
 fn direct(x: int) -> int { ret x + 1; }
 
 fn main() {
-    let a: int =
-        direct(3); // direct
+    let a: int = direct(3); // direct
     let b: int = ho(direct); // indirect unbound
 
-    let c: int =
-        ho(bind direct(_)); // indirect bound
+    let c: int = ho(bind direct(_)); // indirect bound
     assert (a == b);
     assert (b == c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fun-indirect-call.rs b/src/test/run-pass/fun-indirect-call.rs
index 7bbfd7b84e9..8c4068c425c 100644
--- a/src/test/run-pass/fun-indirect-call.rs
+++ b/src/test/run-pass/fun-indirect-call.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f() -> int { ret 42; }
 
-fn main() { let g: fn() -> int  = f; let i: int = g(); assert (i == 42); }
\ No newline at end of file
+fn main() { let g: fn() -> int = f; let i: int = g(); assert (i == 42); }
diff --git a/src/test/run-pass/generic-ivec-leak.rs b/src/test/run-pass/generic-ivec-leak.rs
index f9755e176b9..4e4508d08e9 100644
--- a/src/test/run-pass/generic-ivec-leak.rs
+++ b/src/test/run-pass/generic-ivec-leak.rs
@@ -1,4 +1,4 @@
 tag wrapper<T> { wrapped(T); }
 
-fn main() { let w = wrapped(~[1, 2, 3, 4, 5]); }
+fn main() { let w = wrapped([1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/generic-ivec.rs b/src/test/run-pass/generic-ivec.rs
index 39ba083a5a3..26298de5b94 100644
--- a/src/test/run-pass/generic-ivec.rs
+++ b/src/test/run-pass/generic-ivec.rs
@@ -1,3 +1,3 @@
 fn f<T>(v: @T) { }
-fn main() { f(@~[1, 2, 3, 4, 5]); }
+fn main() { f(@[1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/generic-temporary.rs b/src/test/run-pass/generic-temporary.rs
index 1abd0f7daf9..afac9e176ee 100644
--- a/src/test/run-pass/generic-temporary.rs
+++ b/src/test/run-pass/generic-temporary.rs
@@ -4,10 +4,10 @@ fn mk() -> int { ret 1; }
 
 fn chk(a: &int) { log a; assert (a == 1); }
 
-fn apply<T>(produce: fn() -> T , consume: fn(&T) ) { consume(produce()); }
+fn apply<T>(produce: fn() -> T, consume: fn(&T)) { consume(produce()); }
 
 fn main() {
-    let produce: fn() -> int  = mk;
-    let consume: fn(&int)  = chk;
+    let produce: fn() -> int = mk;
+    let consume: fn(&int) = chk;
     apply::<int>(produce, consume);
 }
diff --git a/src/test/run-pass/generic-tup.rs b/src/test/run-pass/generic-tup.rs
index bdd8ddf1268..8cacf51e9b5 100644
--- a/src/test/run-pass/generic-tup.rs
+++ b/src/test/run-pass/generic-tup.rs
@@ -1,7 +1,4 @@
-fn get_third<T>(t: &(T, T, T)) -> T {
-    let (_, _, x) = t;
-    ret x;
-}
+fn get_third<T>(t: &(T, T, T)) -> T { let (_, _, x) = t; ret x; }
 
 fn main() {
     log get_third((1, 2, 3));
diff --git a/src/test/run-pass/hashmap-memory.rs b/src/test/run-pass/hashmap-memory.rs
index ecf13f39595..31b34aa1464 100644
--- a/src/test/run-pass/hashmap-memory.rs
+++ b/src/test/run-pass/hashmap-memory.rs
@@ -26,9 +26,9 @@ mod map_reduce {
     export mapper;
     export map_reduce;
 
-    type putter = fn(str, str) ;
+    type putter = fn(str, str);
 
-    type mapper = fn(str, putter) ;
+    type mapper = fn(str, putter);
 
     tag ctrl_proto { find_reducer([u8], _chan<int>); mapper_done; }
 
@@ -92,5 +92,5 @@ mod map_reduce {
 }
 
 fn main() {
-    map_reduce::map_reduce(~["../src/test/run-pass/hashmap-memory.rs"]);
+    map_reduce::map_reduce(["../src/test/run-pass/hashmap-memory.rs"]);
 }
diff --git a/src/test/run-pass/hello.rs b/src/test/run-pass/hello.rs
index 5e442db7fbe..fa917bd4902 100644
--- a/src/test/run-pass/hello.rs
+++ b/src/test/run-pass/hello.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { log "hello, world."; }
\ No newline at end of file
+fn main() { log "hello, world."; }
diff --git a/src/test/run-pass/i32-sub.rs b/src/test/run-pass/i32-sub.rs
index a83e95a73b8..5dd3ce8de2c 100644
--- a/src/test/run-pass/i32-sub.rs
+++ b/src/test/run-pass/i32-sub.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); }
\ No newline at end of file
+fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); }
diff --git a/src/test/run-pass/i8-incr.rs b/src/test/run-pass/i8-incr.rs
index f825d54bba1..4a51fd58517 100644
--- a/src/test/run-pass/i8-incr.rs
+++ b/src/test/run-pass/i8-incr.rs
@@ -8,4 +8,4 @@ fn main() {
     x = x + 1i8;
     x = x - 1i8;
     assert (x == y);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/if-bot.rs b/src/test/run-pass/if-bot.rs
index 8ef6bab684e..35452a2ba6d 100644
--- a/src/test/run-pass/if-bot.rs
+++ b/src/test/run-pass/if-bot.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let i: int = if false { fail } else { 5 }; log i; }
\ No newline at end of file
+fn main() { let i: int = if false { fail } else { 5 }; log i; }
diff --git a/src/test/run-pass/if-check-precond.rs b/src/test/run-pass/if-check-precond.rs
index 88c744642d0..eadffd7b75a 100644
--- a/src/test/run-pass/if-check-precond.rs
+++ b/src/test/run-pass/if-check-precond.rs
@@ -1,11 +1,11 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn print_even(x: uint) : even(x) { log x; }
 
 fn foo(x: uint) { if check even(x) { print_even(x); } else { fail; } }
 
-fn main() { foo(2u); }
\ No newline at end of file
+fn main() { foo(2u); }
diff --git a/src/test/run-pass/if-check.rs b/src/test/run-pass/if-check.rs
index 220b784e12e..090330bef0e 100644
--- a/src/test/run-pass/if-check.rs
+++ b/src/test/run-pass/if-check.rs
@@ -1,9 +1,9 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn foo(x: uint) { if check even(x) { log x; } else { fail; } }
 
-fn main() { foo(2u); }
\ No newline at end of file
+fn main() { foo(2u); }
diff --git a/src/test/run-pass/if-ret.rs b/src/test/run-pass/if-ret.rs
index 3dc897683fc..87cd9647243 100644
--- a/src/test/run-pass/if-ret.rs
+++ b/src/test/run-pass/if-ret.rs
@@ -1,3 +1,3 @@
 fn foo() { if (ret) { } }
 
-fn main() { foo(); }
\ No newline at end of file
+fn main() { foo(); }
diff --git a/src/test/run-pass/import-from-native.rs b/src/test/run-pass/import-from-native.rs
index 03c49b2adfe..b8837692c07 100644
--- a/src/test/run-pass/import-from-native.rs
+++ b/src/test/run-pass/import-from-native.rs
@@ -1,6 +1,6 @@
 mod spam {
-    fn ham() {}
-    fn eggs() {}
+    fn ham() { }
+    fn eggs() { }
 }
 
 native "rust" mod rustrt {
@@ -9,7 +9,4 @@ native "rust" mod rustrt {
     export eggs;
 }
 
-fn main() {
-    rustrt::ham();
-    rustrt::eggs();
-}
\ No newline at end of file
+fn main() { rustrt::ham(); rustrt::eggs(); }
diff --git a/src/test/run-pass/import-from.rs b/src/test/run-pass/import-from.rs
index b42793d16df..d8314e6b0b8 100644
--- a/src/test/run-pass/import-from.rs
+++ b/src/test/run-pass/import-from.rs
@@ -1,11 +1,8 @@
 import spam::{ham, eggs};
 
 mod spam {
-    fn ham() {}
-    fn eggs() {}
+    fn ham() { }
+    fn eggs() { }
 }
 
-fn main() {
-    ham();
-    eggs();
-}
\ No newline at end of file
+fn main() { ham(); eggs(); }
diff --git a/src/test/run-pass/import-glob-0.rs b/src/test/run-pass/import-glob-0.rs
index e5e9ab90d0d..51144e492ce 100644
--- a/src/test/run-pass/import-glob-0.rs
+++ b/src/test/run-pass/import-glob-0.rs
@@ -27,4 +27,4 @@ mod dug {
 }
 
 
-fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); }
\ No newline at end of file
+fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); }
diff --git a/src/test/run-pass/import-glob-1.rs b/src/test/run-pass/import-glob-1.rs
index 64c5a47ec17..d9c1b653217 100644
--- a/src/test/run-pass/import-glob-1.rs
+++ b/src/test/run-pass/import-glob-1.rs
@@ -1,40 +1,40 @@
 import a1::b1::word_traveler;
 
 mod a1 {
-     //
+    //
     mod b1 {
-         //
+        //
         import a2::b1::*;
-         //         <-\
+        //         <-\
         export word_traveler; //           |
     }
-     //           |
+    //           |
     mod b2 {
-         //           |
+        //           |
         import a2::b2::*;
-         // <-\  -\   |
+        // <-\  -\   |
         export word_traveler; //   |   |   |
     } //   |   |   |
 }
- //   |   |   |
- //   |   |   |
- mod a2 {
-      //   |   |   |
-     native "cdecl" mod b1 = "" {
-          //   |   |   |
-         import a1::b2::*;
-          //   | <-/  -/
-         export word_traveler; //   |
-     }
-      //   |
-     mod b2 {
-          //   |
-         fn word_traveler() { //   |
-             log "ahoy!"; //  -/
-         } //
-     } //
- }
- //
+//   |   |   |
+//   |   |   |
+mod a2 {
+    //   |   |   |
+    native "cdecl" mod b1 = "" {
+        //   |   |   |
+        import a1::b2::*;
+        //   | <-/  -/
+        export word_traveler; //   |
+    }
+    //   |
+    mod b2 {
+        //   |
+        fn word_traveler() { //   |
+            log "ahoy!"; //  -/
+        } //
+    } //
+}
+//
 
 
-fn main() { word_traveler(); }
\ No newline at end of file
+fn main() { word_traveler(); }
diff --git a/src/test/run-pass/import-glob-circular.rs b/src/test/run-pass/import-glob-circular.rs
index bc97c7925eb..4035790b934 100644
--- a/src/test/run-pass/import-glob-circular.rs
+++ b/src/test/run-pass/import-glob-circular.rs
@@ -47,4 +47,4 @@ mod test2 {
 
 
 
-fn main() { test1(); test2(); }
\ No newline at end of file
+fn main() { test1(); test2(); }
diff --git a/src/test/run-pass/import-glob-crate.rs b/src/test/run-pass/import-glob-crate.rs
index c32973fa377..fca6c1d61bd 100644
--- a/src/test/run-pass/import-glob-crate.rs
+++ b/src/test/run-pass/import-glob-crate.rs
@@ -4,6 +4,6 @@ import std::vec::*;
 
 fn main() {
     let v = init_elt(0, 0u);
-    v += ~[4, 2];
-    assert (reversed(v) == ~[2, 4]);
+    v += [4, 2];
+    assert (reversed(v) == [2, 4]);
 }
diff --git a/src/test/run-pass/import.rs b/src/test/run-pass/import.rs
index 31622c1fee8..ffd84fda952 100644
--- a/src/test/run-pass/import.rs
+++ b/src/test/run-pass/import.rs
@@ -8,4 +8,4 @@ mod bar {
     fn thing() { x(10); z(10); }
 }
 
-fn main() { bar::thing(); }
\ No newline at end of file
+fn main() { bar::thing(); }
diff --git a/src/test/run-pass/import2.rs b/src/test/run-pass/import2.rs
index f8810e1bf4a..5b287cd7ddd 100644
--- a/src/test/run-pass/import2.rs
+++ b/src/test/run-pass/import2.rs
@@ -5,4 +5,4 @@ mod zed {
     fn bar() { log "bar"; }
 }
 
-fn main() { bar(); }
\ No newline at end of file
+fn main() { bar(); }
diff --git a/src/test/run-pass/import3.rs b/src/test/run-pass/import3.rs
index 687074d55be..bd38defe405 100644
--- a/src/test/run-pass/import3.rs
+++ b/src/test/run-pass/import3.rs
@@ -8,4 +8,4 @@ mod baz {
     }
 }
 
-fn main() { bar(); }
\ No newline at end of file
+fn main() { bar(); }
diff --git a/src/test/run-pass/import6.rs b/src/test/run-pass/import6.rs
index bc57537580f..33898c35a35 100644
--- a/src/test/run-pass/import6.rs
+++ b/src/test/run-pass/import6.rs
@@ -9,4 +9,4 @@ mod bar {
     import zed::baz;
     export baz;
 }
-fn main() { baz(); }
\ No newline at end of file
+fn main() { baz(); }
diff --git a/src/test/run-pass/import8.rs b/src/test/run-pass/import8.rs
index ed559347824..884dcebacdf 100644
--- a/src/test/run-pass/import8.rs
+++ b/src/test/run-pass/import8.rs
@@ -6,4 +6,4 @@ mod foo {
     fn x(y: int) { log y; }
 }
 
-fn main() { x(10); z(10); }
\ No newline at end of file
+fn main() { x(10); z(10); }
diff --git a/src/test/run-pass/infer-fn-tail-expr.rs b/src/test/run-pass/infer-fn-tail-expr.rs
index 9134f3a78de..4658ea4329c 100644
--- a/src/test/run-pass/infer-fn-tail-expr.rs
+++ b/src/test/run-pass/infer-fn-tail-expr.rs
@@ -1,5 +1,5 @@
 // issue #680
 
-fn f() -> [int] { ~[] }
+fn f() -> [int] { [] }
 
 fn main() { }
diff --git a/src/test/run-pass/inner-module.rs b/src/test/run-pass/inner-module.rs
index f9ef1b040de..6fcc0a79af0 100644
--- a/src/test/run-pass/inner-module.rs
+++ b/src/test/run-pass/inner-module.rs
@@ -9,4 +9,4 @@ mod inner {
     fn hello() { inner2::hello(); }
 }
 
-fn main() { inner::hello(); inner::inner2::hello(); }
\ No newline at end of file
+fn main() { inner::hello(); inner::inner2::hello(); }
diff --git a/src/test/run-pass/int.rs b/src/test/run-pass/int.rs
index 2d2422d9f87..2c91b5920b7 100644
--- a/src/test/run-pass/int.rs
+++ b/src/test/run-pass/int.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: int = 10; }
\ No newline at end of file
+fn main() { let x: int = 10; }
diff --git a/src/test/run-pass/integral-indexing.rs b/src/test/run-pass/integral-indexing.rs
index d03963df2ed..ed17e36bcb2 100644
--- a/src/test/run-pass/integral-indexing.rs
+++ b/src/test/run-pass/integral-indexing.rs
@@ -3,7 +3,7 @@
 
 // This is a testcase for issue #94.
 fn main() {
-    let v: [int] = ~[0, 1, 2, 3, 4, 5];
+    let v: [int] = [0, 1, 2, 3, 4, 5];
     let s: str = "abcdef";
     assert (v[3u] == 3);
     assert (v[3u8] == 3);
diff --git a/src/test/run-pass/interior-vec.rs b/src/test/run-pass/interior-vec.rs
index 15186078343..4c722b3cc64 100644
--- a/src/test/run-pass/interior-vec.rs
+++ b/src/test/run-pass/interior-vec.rs
@@ -5,25 +5,24 @@ native "rust-intrinsic" mod rusti {
 }
 
 fn main() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     assert (ivec_len(v) == 0u); // zero-length
-    let x = ~[1, 2];
+    let x = [1, 2];
     assert (ivec_len(x) == 2u); // on stack
-    let y = ~[1, 2, 3, 4, 5];
+    let y = [1, 2, 3, 4, 5];
     assert (ivec_len(y) == 5u); // on heap
 
-    v += ~[];
+    v += [];
     assert (ivec_len(v) == 0u); // zero-length append
-    x += ~[3];
+    x += [3];
     assert (ivec_len(x) == 3u); // on-stack append
-    y += ~[6, 7, 8, 9];
+    y += [6, 7, 8, 9];
     assert (ivec_len(y) == 9u); // on-heap append
 
     let vv = v + v;
     assert (ivec_len(vv) == 0u); // zero-length add
-    let xx = x + ~[4];
+    let xx = x + [4];
     assert (ivec_len(xx) == 4u); // on-stack add
-    let yy = y + ~[10, 11];
+    let yy = y + [10, 11];
     assert (ivec_len(yy) == 11u); // on-heap add
 }
-
diff --git a/src/test/run-pass/issue-506.rs b/src/test/run-pass/issue-506.rs
index 3487c1a7f37..1fb76cfd62b 100644
--- a/src/test/run-pass/issue-506.rs
+++ b/src/test/run-pass/issue-506.rs
@@ -9,11 +9,6 @@ native "rust" mod rustrt {
     fn task_yield();
 }
 
-fn yield_wrap() {
-    rustrt::task_yield();
-}
+fn yield_wrap() { rustrt::task_yield(); }
 
-fn main() {
-    let f = yield_wrap;
-    task::_spawn(f);
-}
+fn main() { let f = yield_wrap; task::_spawn(f); }
diff --git a/src/test/run-pass/issue-687.rs b/src/test/run-pass/issue-687.rs
index 8b9fef446da..2b6c2d9938b 100644
--- a/src/test/run-pass/issue-687.rs
+++ b/src/test/run-pass/issue-687.rs
@@ -10,8 +10,8 @@ import std::comm::send;
 tag msg { closed; received([u8]); }
 
 fn producer(c: _chan<[u8]>) {
-    send(c, ~[1u8, 2u8, 3u8, 4u8]);
-    let empty: [u8] = ~[];
+    send(c, [1u8, 2u8, 3u8, 4u8]);
+    let empty: [u8] = [];
     send(c, empty);
 }
 
@@ -22,10 +22,7 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) {
         log "waiting for bytes";
         let data = p.recv();
         log "got bytes";
-        if vec::len(data) == 0u {
-            log "got empty bytes, quitting";
-            break;
-        }
+        if vec::len(data) == 0u { log "got empty bytes, quitting"; break; }
         log "sending non-empty buffer of length";
         log vec::len(data);
         send(msg, received(data));
@@ -39,8 +36,8 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) {
 fn main() {
     let p: _port<msg> = mk_port();
     let recv_reader: _port<_chan<[u8]>> = mk_port();
-    let pack = task::_spawn(bind packager(recv_reader.mk_chan(),
-                                          p.mk_chan()));
+    let pack =
+        task::_spawn(bind packager(recv_reader.mk_chan(), p.mk_chan()));
 
     let source_chan: _chan<[u8]> = recv_reader.recv();
     let prod = task::_spawn(bind producer(source_chan));
diff --git a/src/test/run-pass/item-attributes.rs b/src/test/run-pass/item-attributes.rs
index 8d34414cc07..352fa4ac53e 100644
--- a/src/test/run-pass/item-attributes.rs
+++ b/src/test/run-pass/item-attributes.rs
@@ -167,7 +167,7 @@ mod test_distinguish_syntax_ext {
     use std;
 
     fn f() {
-        #fmt("test%s", "s");
+        #fmt["test%s", "s"];
         #[attr = "val"]
         fn g() { }
     }
diff --git a/src/test/run-pass/item-name-overload.rs b/src/test/run-pass/item-name-overload.rs
index 489fe8c39a3..02930d65cfa 100644
--- a/src/test/run-pass/item-name-overload.rs
+++ b/src/test/run-pass/item-name-overload.rs
@@ -10,4 +10,4 @@ mod bar {
     fn baz() { }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/ivec-add.rs b/src/test/run-pass/ivec-add.rs
index 8dd2c32f86b..17b0a77d6ad 100644
--- a/src/test/run-pass/ivec-add.rs
+++ b/src/test/run-pass/ivec-add.rs
@@ -1,14 +1,14 @@
-fn double<T>(a: &T) -> [T] { ret ~[a] + ~[a]; }
+fn double<T>(a: &T) -> [T] { ret [a] + [a]; }
 
-fn double_int(a: int) -> [int] { ret ~[a] + ~[a]; }
+fn double_int(a: int) -> [int] { ret [a] + [a]; }
 
 fn main() {
     let d = double(1);
-    assert (d.(0) == 1);
-    assert (d.(1) == 1);
+    assert (d[0] == 1);
+    assert (d[1] == 1);
 
     d = double_int(1);
-    assert (d.(0) == 1);
-    assert (d.(1) == 1);
+    assert (d[0] == 1);
+    assert (d[1] == 1);
 }
 
diff --git a/src/test/run-pass/ivec-pass-by-value.rs b/src/test/run-pass/ivec-pass-by-value.rs
index 213e1384658..557c3dc9b3e 100644
--- a/src/test/run-pass/ivec-pass-by-value.rs
+++ b/src/test/run-pass/ivec-pass-by-value.rs
@@ -1,3 +1,3 @@
 fn f(a: [int]) { }
-fn main() { f(~[1, 2, 3, 4, 5]); }
+fn main() { f([1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/ivec-tag.rs b/src/test/run-pass/ivec-tag.rs
index 41cc89aed7e..5efe202b66e 100644
--- a/src/test/run-pass/ivec-tag.rs
+++ b/src/test/run-pass/ivec-tag.rs
@@ -8,8 +8,9 @@ import std::comm::mk_port;
 import std::comm::send;
 
 fn producer(c: _chan<[u8]>) {
-    send(c, ~[1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8,
-              8u8, 9u8, 10u8, 11u8, 12u8, 13u8 ]);
+    send(c,
+         [1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8, 8u8, 9u8, 10u8, 11u8, 12u8,
+          13u8]);
 }
 
 fn main() {
diff --git a/src/test/run-pass/join.rs b/src/test/run-pass/join.rs
index 5545aadb1fb..91fba0bad40 100644
--- a/src/test/run-pass/join.rs
+++ b/src/test/run-pass/join.rs
@@ -13,4 +13,4 @@ fn main() {
     log_err "3";
 }
 
-fn child() { log_err "2"; }
\ No newline at end of file
+fn child() { log_err "2"; }
diff --git a/src/test/run-pass/lambda-infer-unresolved.rs b/src/test/run-pass/lambda-infer-unresolved.rs
index 921b5568b0b..7bfba99baac 100644
--- a/src/test/run-pass/lambda-infer-unresolved.rs
+++ b/src/test/run-pass/lambda-infer-unresolved.rs
@@ -1,7 +1,7 @@
 // This should typecheck even though the type of e is not fully
 // resolved when we finish typechecking the lambda.
 fn main() {
-    let e = @{mutable refs: ~[], n: 0};
-    let f = lambda() { log_err e.n; };
-    e.refs += ~[1];
+    let e = @{mutable refs: [], n: 0};
+    let f = lambda () { log_err e.n; };
+    e.refs += [1];
 }
diff --git a/src/test/run-pass/lambda-no-leak.rs b/src/test/run-pass/lambda-no-leak.rs
index 183c1ae1446..0643de4bcfb 100644
--- a/src/test/run-pass/lambda-no-leak.rs
+++ b/src/test/run-pass/lambda-no-leak.rs
@@ -2,6 +2,6 @@
 fn force(f: &fn()) { f() }
 fn main() {
     let x = 7;
-    lambda() { log_err x; };
-    force(lambda() { log_err x; });
+    lambda () { log_err x; }
+    force(lambda () { log_err x; });
 }
diff --git a/src/test/run-pass/large-records.rs b/src/test/run-pass/large-records.rs
index 004e3a8c225..8c5afc031d1 100644
--- a/src/test/run-pass/large-records.rs
+++ b/src/test/run-pass/large-records.rs
@@ -30,4 +30,4 @@ fn f() {
          l: 0};
 }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/lazy-and-or.rs b/src/test/run-pass/lazy-and-or.rs
index 348ce5de599..26edb631273 100644
--- a/src/test/run-pass/lazy-and-or.rs
+++ b/src/test/run-pass/lazy-and-or.rs
@@ -9,4 +9,4 @@ fn main() {
     log x || incr(y);
     assert (y == 10);
     if true && x { assert (true); } else { assert (false); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/lazy-init.rs b/src/test/run-pass/lazy-init.rs
index d36ad1b387f..b5f53400229 100644
--- a/src/test/run-pass/lazy-init.rs
+++ b/src/test/run-pass/lazy-init.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); }
diff --git a/src/test/run-pass/leak-tag-copy.rs b/src/test/run-pass/leak-tag-copy.rs
index 48b11174da5..7c5eb538bc2 100644
--- a/src/test/run-pass/leak-tag-copy.rs
+++ b/src/test/run-pass/leak-tag-copy.rs
@@ -2,4 +2,4 @@
 
 tag t { a; b(@int); }
 
-fn main() { let x = b(@10); x = a; }
\ No newline at end of file
+fn main() { let x = b(@10); x = a; }
diff --git a/src/test/run-pass/let-destruct-fresh-mem.rs b/src/test/run-pass/let-destruct-fresh-mem.rs
index fa2798ecc66..9a41ef7f084 100644
--- a/src/test/run-pass/let-destruct-fresh-mem.rs
+++ b/src/test/run-pass/let-destruct-fresh-mem.rs
@@ -1,10 +1,10 @@
 fn main() {
     let u = {x: 10, y: @{a: 20}};
-    let {x, y: @{a}} = u;
+    let {x: x, y: @{a: a}} = u;
     x = 100;
     a = 100;
-    assert x == 100;
-    assert a == 100;
-    assert u.x == 10;
-    assert u.y.a == 20;
+    assert (x == 100);
+    assert (a == 100);
+    assert (u.x == 10);
+    assert (u.y.a == 20);
 }
diff --git a/src/test/run-pass/let-destruct.rs b/src/test/run-pass/let-destruct.rs
index 7d59645ff04..bdc7c6a798c 100644
--- a/src/test/run-pass/let-destruct.rs
+++ b/src/test/run-pass/let-destruct.rs
@@ -1,8 +1,6 @@
-tag xx {
-    xx(int);
-}
+tag xx = int;
 
 fn main() {
-    let @{x:xx(x), y} = @{x: xx(10), y: 20};
-    assert x + y == 30;
+    let @{x: xx(x), y: y} = @{x: xx(10), y: 20};
+    assert (x + y == 30);
 }
diff --git a/src/test/run-pass/linear-for-loop.rs b/src/test/run-pass/linear-for-loop.rs
index a36848106f6..319ce032d8d 100644
--- a/src/test/run-pass/linear-for-loop.rs
+++ b/src/test/run-pass/linear-for-loop.rs
@@ -1,7 +1,7 @@
 
 
 fn main() {
-    let x = ~[1, 2, 3];
+    let x = [1, 2, 3];
     let y = 0;
     for i: int in x { log i; y += i; }
     log y;
diff --git a/src/test/run-pass/list.rs b/src/test/run-pass/list.rs
index e81c0d12fd2..272ec4b3b6f 100644
--- a/src/test/run-pass/list.rs
+++ b/src/test/run-pass/list.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 tag list { cons(int, @list); nil; }
 
-fn main() { cons(10, @cons(11, @cons(12, @nil))); }
\ No newline at end of file
+fn main() { cons(10, @cons(11, @cons(12, @nil))); }
diff --git a/src/test/run-pass/log-err-phi.rs b/src/test/run-pass/log-err-phi.rs
index 0623daed212..0317f90573b 100644
--- a/src/test/run-pass/log-err-phi.rs
+++ b/src/test/run-pass/log-err-phi.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { if false { log_err "foo" + "bar"; } }
\ No newline at end of file
+fn main() { if false { log_err "foo" + "bar"; } }
diff --git a/src/test/run-pass/long-while.rs b/src/test/run-pass/long-while.rs
index 59cbd10d64a..4e68287b18f 100644
--- a/src/test/run-pass/long-while.rs
+++ b/src/test/run-pass/long-while.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } }
\ No newline at end of file
+fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } }
diff --git a/src/test/run-pass/loop-scope.rs b/src/test/run-pass/loop-scope.rs
index fc5618d823d..85d39ee0bbc 100644
--- a/src/test/run-pass/loop-scope.rs
+++ b/src/test/run-pass/loop-scope.rs
@@ -1,5 +1,5 @@
 fn main() {
-    let x = ~[10, 20, 30];
+    let x = [10, 20, 30];
     let sum = 0;
     for x in x { sum += x; }
     assert (sum == 60);
diff --git a/src/test/run-pass/macro-2.rs b/src/test/run-pass/macro-2.rs
index 4aae975a5e9..497742e9e4f 100644
--- a/src/test/run-pass/macro-2.rs
+++ b/src/test/run-pass/macro-2.rs
@@ -1,5 +1,9 @@
 fn main() {
-  #macro([#mylambda[x,body], {fn f(x: int) -> int { ret body }; f}]);
+    #macro[[#mylambda[x, body],
+            {
+                fn f(x: int) -> int { ret body }
+                f
+            }]];
 
-  assert(#mylambda[y,y*2](8) == 16);
-}
\ No newline at end of file
+    assert (#mylambda[y, y * 2](8) == 16);
+}
diff --git a/src/test/run-pass/macro-3.rs b/src/test/run-pass/macro-3.rs
index f143c4f058f..3e8de676073 100644
--- a/src/test/run-pass/macro-3.rs
+++ b/src/test/run-pass/macro-3.rs
@@ -1,5 +1,5 @@
 fn main() {
-  #macro([#trivial[], 1*2*4*2*1]);
+    #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]];
 
-  assert(#trivial[] == 16);
+    assert (#trivial[] == 16);
 }
diff --git a/src/test/run-pass/macro-by-example-1.rs b/src/test/run-pass/macro-by-example-1.rs
index 08e5c4e249f..520adef92eb 100644
--- a/src/test/run-pass/macro-by-example-1.rs
+++ b/src/test/run-pass/macro-by-example-1.rs
@@ -1,7 +1,7 @@
 fn main() {
-    #macro([#apply[f, [x, ...]], f(x, ...)]);
+    #macro[[#apply[f, [x, ...]], f(x, ...)]];
 
     fn add(a: int, b: int) -> int { ret a + b; }
 
     assert (#apply[add, [1, 15]] == 16);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/macro-by-example-2.rs b/src/test/run-pass/macro-by-example-2.rs
index 58da59e2a7c..e1a7b97e888 100644
--- a/src/test/run-pass/macro-by-example-2.rs
+++ b/src/test/run-pass/macro-by-example-2.rs
@@ -1,6 +1,6 @@
 fn main() {
-    #macro([#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]],
-           [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]);
+    #macro[[#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]],
+           [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]];
 
 
     assert (#zip_or_unzip[[1, 2, 3, 4], [5, 6, 7, 8]] ==
@@ -9,41 +9,38 @@ fn main() {
                 [[1, 2, 3, 4], [5, 6, 7, 8]]);
 
 
-    #macro([#nested[[[x, ...], ...], [[y, ...], ...]],
-            [[[x, y], ...], ...]]);
+    #macro[[#nested[[[x, ...], ...], [[y, ...], ...]], [[[x, y], ...], ...]]];
     assert (#nested[[[1, 2, 3, 4, 5], [7, 8, 9, 10, 11, 12]],
                     [[-1, -2, -3, -4, -5], [-7, -8, -9, -10, -11, -12]]] ==
                 [[[1, -1], [2, -2], [3, -3], [4, -4], [5, -5]],
                  [[7, -7], [8, -8], [9, -9], [10, -10], [11, -11],
                   [12, -12]]]);
 
-    #macro([#dup[y, [x, ...]], [[y, x], ...]]);
+    #macro[[#dup[y, [x, ...]], [[y, x], ...]]];
 
     assert (#dup[1, [1, 2, 3, 4]] == [[1, 1], [1, 2], [1, 3], [1, 4]]);
 
 
-    #macro([#lambda[x, #<t>, body, #<s>],
+    #macro[[#lambda[x, #<t>, body, #<s>],
             {
                 fn result(x: t) -> s { ret body }
                 result
-            }]);
+            }]];
 
 
-    assert ((#lambda[i, #<uint>, i + 4u, #<uint>])(12u) == 16u);
+    assert (#lambda[i, #<uint>, i + 4u, #<uint>](12u) == 16u);
 
-    #macro[[#sum[x, xs, ...], x + #sum[xs, ...]],
-           [#sum[], 0]];
+    #macro[[#sum[x, xs, ...], x + #sum[xs, ...]], [#sum[], 0]];
 
-    assert (#sum[1,2,3,4] == 10);
+    assert (#sum[1, 2, 3, 4] == 10);
 
 
     #macro[[#transcr_mixed[a, as, ...], #sum[6, as, ...] * a]];
 
     assert (#transcr_mixed[10, 5, 4, 3, 2, 1] == 210);
 
-    #macro[[#surround[pre, [xs, ...], post],
-            [pre, xs, ..., post]]];
+    #macro[[#surround[pre, [xs, ...], post], [pre, xs, ..., post]]];
 
-    assert (#surround[1, [2,3,4], 5] == [1,2,3,4,5]);
+    assert (#surround[1, [2, 3, 4], 5] == [1, 2, 3, 4, 5]);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/macro.rs b/src/test/run-pass/macro.rs
index 1b561e3c487..66f2ccc6a89 100644
--- a/src/test/run-pass/macro.rs
+++ b/src/test/run-pass/macro.rs
@@ -1,4 +1 @@
-fn main() {
-  #macro[[#m1[a], a*4]];
-  assert (#m1[2] == 8);
-}
+fn main() { #macro[[#m1[a], a * 4]]; assert (#m1[2] == 8); }
diff --git a/src/test/run-pass/main-ivec.rs b/src/test/run-pass/main-ivec.rs
index e3d1403411b..ec2403a9151 100644
--- a/src/test/run-pass/main-ivec.rs
+++ b/src/test/run-pass/main-ivec.rs
@@ -1,3 +1 @@
-fn main(args: [str]) {
-    for s in args { log s }
-}
\ No newline at end of file
+fn main(args: [str]) { for s in args { log s } }
diff --git a/src/test/run-pass/many.rs b/src/test/run-pass/many.rs
index 3413c6a3147..76cbc9fa19a 100644
--- a/src/test/run-pass/many.rs
+++ b/src/test/run-pass/many.rs
@@ -5,21 +5,21 @@ import std::task;
 import std::comm;
 
 fn sub(parent: comm::_chan<int>, id: int) {
-  if (id == 0) {
-      comm::send(parent, 0);
-  } else {
-      let p = comm::mk_port();
-      let child = task::_spawn(bind sub(p.mk_chan(), id-1));
-      let y = p.recv();
-      comm::send(parent, y + 1);
-  }
+    if id == 0 {
+        comm::send(parent, 0);
+    } else {
+        let p = comm::mk_port();
+        let child = task::_spawn(bind sub(p.mk_chan(), id - 1));
+        let y = p.recv();
+        comm::send(parent, y + 1);
+    }
 }
 
 fn main() {
-  let p = comm::mk_port();
-  let child = task::_spawn(bind sub(p.mk_chan(), 200));
-  let y = p.recv();
-  log "transmission complete";
-  log y;
-  assert (y == 200);
+    let p = comm::mk_port();
+    let child = task::_spawn(bind sub(p.mk_chan(), 200));
+    let y = p.recv();
+    log "transmission complete";
+    log y;
+    assert (y == 200);
 }
diff --git a/src/test/run-pass/maybe-mutable.rs b/src/test/run-pass/maybe-mutable.rs
index 5c941e7c477..f8436fe0717 100644
--- a/src/test/run-pass/maybe-mutable.rs
+++ b/src/test/run-pass/maybe-mutable.rs
@@ -9,8 +9,8 @@ fn len(v: [mutable? int]) -> uint {
 }
 
 fn main() {
-    let v0 = ~[1, 2, 3, 4, 5];
+    let v0 = [1, 2, 3, 4, 5];
     log len(v0);
-    let v1 = ~[mutable 1, 2, 3, 4, 5];
+    let v1 = [mutable 1, 2, 3, 4, 5];
     log len(v1);
 }
diff --git a/src/test/run-pass/mlist.rs b/src/test/run-pass/mlist.rs
index c6b8de4e400..5b5a2c3fdf0 100644
--- a/src/test/run-pass/mlist.rs
+++ b/src/test/run-pass/mlist.rs
@@ -1,4 +1,4 @@
 // -*- rust -*-
 tag mlist { cons(int, @mlist); nil; }
 
-fn main() { cons(10, @cons(11, @cons(12, @nil))); }
\ No newline at end of file
+fn main() { cons(10, @cons(11, @cons(12, @nil))); }
diff --git a/src/test/run-pass/move-1.rs b/src/test/run-pass/move-1.rs
index d0dcc0b743f..9124bd3e0a9 100644
--- a/src/test/run-pass/move-1.rs
+++ b/src/test/run-pass/move-1.rs
@@ -11,4 +11,4 @@ fn main() {
     assert (test(true, x) == 2);
     assert (test(true, x) == 2);
     assert (test(false, x) == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/move-2.rs b/src/test/run-pass/move-2.rs
index 0f36f5f2865..9309d718b15 100644
--- a/src/test/run-pass/move-2.rs
+++ b/src/test/run-pass/move-2.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); }
\ No newline at end of file
+fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); }
diff --git a/src/test/run-pass/move-4.rs b/src/test/run-pass/move-4.rs
index 6fc6c6b65f5..5a104555375 100644
--- a/src/test/run-pass/move-4.rs
+++ b/src/test/run-pass/move-4.rs
@@ -9,4 +9,4 @@ fn test(foo: @{a: int, b: int, c: int}) -> @{a: int, b: int, c: int} {
     ret quux;
 }
 
-fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); }
\ No newline at end of file
+fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); }
diff --git a/src/test/run-pass/move-arg-2.rs b/src/test/run-pass/move-arg-2.rs
index 07f40e403ff..9978478f177 100644
--- a/src/test/run-pass/move-arg-2.rs
+++ b/src/test/run-pass/move-arg-2.rs
@@ -1,12 +1,10 @@
-fn test(foo: -@[int]) {
-    assert (foo.(0) == 10);
-}
+fn test(foo: -@[int]) { assert (foo[0] == 10); }
 
 fn main() {
-    let x = @~[10];
+    let x = @[10];
     // Test forgetting a local by move-in
     test(x);
 
     // Test forgetting a temporary by move-in.
-    test(@~[10]);
+    test(@[10]);
 }
diff --git a/src/test/run-pass/move-arg.rs b/src/test/run-pass/move-arg.rs
index 131f69558ea..115d89e2bcd 100644
--- a/src/test/run-pass/move-arg.rs
+++ b/src/test/run-pass/move-arg.rs
@@ -1,8 +1,3 @@
-fn test(foo: -int) {
-    assert (foo == 10);
-}
+fn test(foo: -int) { assert (foo == 10); }
 
-fn main() {
-    let x = 10;
-    test(x);
-}
\ No newline at end of file
+fn main() { let x = 10; test(x); }
diff --git a/src/test/run-pass/move-scalar.rs b/src/test/run-pass/move-scalar.rs
index 2a2c805944e..0594ee91fe1 100644
--- a/src/test/run-pass/move-scalar.rs
+++ b/src/test/run-pass/move-scalar.rs
@@ -4,4 +4,4 @@ fn main() {
     let x: int;
     x <- y;
     assert (x == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/multi-let.rs b/src/test/run-pass/multi-let.rs
index fbc8db94bd0..ab9e6578fc6 100644
--- a/src/test/run-pass/multi-let.rs
+++ b/src/test/run-pass/multi-let.rs
@@ -1,4 +1 @@
-fn main() {
-    let x = 10, y = x;
-    assert (y == 10);
-}
\ No newline at end of file
+fn main() { let x = 10, y = x; assert (y == 10); }
diff --git a/src/test/run-pass/multi-src/bar.rs b/src/test/run-pass/multi-src/bar.rs
index 7b52a9e089a..949a34bb1c2 100644
--- a/src/test/run-pass/multi-src/bar.rs
+++ b/src/test/run-pass/multi-src/bar.rs
@@ -1,3 +1,3 @@
 
 
-fn other() { log "yes"; }
\ No newline at end of file
+fn other() { log "yes"; }
diff --git a/src/test/run-pass/multi-src/foo.rs b/src/test/run-pass/multi-src/foo.rs
index 63305812ef6..2c38317bf1d 100644
--- a/src/test/run-pass/multi-src/foo.rs
+++ b/src/test/run-pass/multi-src/foo.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { log "hello, multi-file world."; bar::other(); }
\ No newline at end of file
+fn main() { log "hello, multi-file world."; bar::other(); }
diff --git a/src/test/run-pass/multiline-comment.rs b/src/test/run-pass/multiline-comment.rs
index 90eaa93fda0..85e80ab201b 100644
--- a/src/test/run-pass/multiline-comment.rs
+++ b/src/test/run-pass/multiline-comment.rs
@@ -6,4 +6,4 @@
 /*
  * This is a /* depth-balanced */ multi-line comment.
  */
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/mutable-alias-vec.rs b/src/test/run-pass/mutable-alias-vec.rs
index b620c2236dc..a185dfd0027 100644
--- a/src/test/run-pass/mutable-alias-vec.rs
+++ b/src/test/run-pass/mutable-alias-vec.rs
@@ -3,10 +3,10 @@
 // -*- rust -*-
 use std;
 
-fn grow(v: &mutable [int]) { v += ~[1]; }
+fn grow(v: &mutable [int]) { v += [1]; }
 
 fn main() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     grow(v);
     grow(v);
     grow(v);
diff --git a/src/test/run-pass/mutable-vec-drop.rs b/src/test/run-pass/mutable-vec-drop.rs
index 58dc936083a..625bcb17f97 100644
--- a/src/test/run-pass/mutable-vec-drop.rs
+++ b/src/test/run-pass/mutable-vec-drop.rs
@@ -2,5 +2,5 @@
 fn main() {
     // This just tests whether the vec leaks its members.
     let pvec: [mutable @{a: int, b: int}] =
-        ~[mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}];
+        [mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}];
 }
diff --git a/src/test/run-pass/mutual-recursion-group.rs b/src/test/run-pass/mutual-recursion-group.rs
index 732d3a27177..f21bbf1a435 100644
--- a/src/test/run-pass/mutual-recursion-group.rs
+++ b/src/test/run-pass/mutual-recursion-group.rs
@@ -10,4 +10,4 @@ tag list { cons(@tree, @list); nil; }
 
 tag small_list { kons(int, @small_list); neel; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/native-mod-src/inner.rs b/src/test/run-pass/native-mod-src/inner.rs
index 0842fcb9f27..bee820cf3be 100644
--- a/src/test/run-pass/native-mod-src/inner.rs
+++ b/src/test/run-pass/native-mod-src/inner.rs
@@ -11,4 +11,4 @@ fn main() {
     libc.write(1, buf, 1024);
     libc.close(fd);
     libc.free(buf);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/native-opaque-type.rs b/src/test/run-pass/native-opaque-type.rs
index fa4a5e25e5a..6ec8b4dba6a 100644
--- a/src/test/run-pass/native-opaque-type.rs
+++ b/src/test/run-pass/native-opaque-type.rs
@@ -4,4 +4,4 @@ native "cdecl" mod libc = "" {
     type file_handle;
 }
 
-fn main() { assert (true); }
\ No newline at end of file
+fn main() { assert (true); }
diff --git a/src/test/run-pass/native-src/native.rs b/src/test/run-pass/native-src/native.rs
index eac66adb58a..164c55d0e9f 100644
--- a/src/test/run-pass/native-src/native.rs
+++ b/src/test/run-pass/native-src/native.rs
@@ -6,4 +6,4 @@ fn main() {
     libc.puts(rustrt.str_buf("hello, native world 1"));
     libc.puts(rustrt.str_buf("hello, native world 2"));
     libc.puts(rustrt.str_buf("hello, native world 3"));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/nested-obj-self.rs b/src/test/run-pass/nested-obj-self.rs
index 3ed72d8d8ef..f664ef50ee2 100644
--- a/src/test/run-pass/nested-obj-self.rs
+++ b/src/test/run-pass/nested-obj-self.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (s2 == "foo.m1");
     let s3: str = a.m3();
     assert (s3 == "bar.m1");
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/newtype-polymorphic.rs b/src/test/run-pass/newtype-polymorphic.rs
index 637b1b8103b..fc3002ba662 100644
--- a/src/test/run-pass/newtype-polymorphic.rs
+++ b/src/test/run-pass/newtype-polymorphic.rs
@@ -2,11 +2,11 @@ tag myvec<X> = [X];
 
 fn myvec_deref<X>(mv: &myvec<X>) -> [X] { ret *mv; }
 
-fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv.(0); }
+fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv[0]; }
 
 fn main() {
-    let mv = myvec(~[1, 2, 3]);
-    assert (myvec_deref(mv).(1) == 2);
+    let mv = myvec([1, 2, 3]);
+    assert (myvec_deref(mv)[1] == 2);
     assert (myvec_elt(mv) == 1);
-    assert (mv.(2) == 3);
+    assert (mv[2] == 3);
 }
diff --git a/src/test/run-pass/newtype.rs b/src/test/run-pass/newtype.rs
index b0e67f4121f..0b0a8c7b2d9 100644
--- a/src/test/run-pass/newtype.rs
+++ b/src/test/run-pass/newtype.rs
@@ -1,8 +1,8 @@
-tag mytype = {compute: fn(&mytype) -> int , val: int};
+tag mytype = {compute: fn(&mytype) -> int, val: int};
 
 fn compute(i: &mytype) -> int { ret i.val + 20; }
 
 fn main() {
     let myval = mytype({compute: compute, val: 30});
     assert (myval.compute(myval) == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/nil-pattern.rs b/src/test/run-pass/nil-pattern.rs
index af499adee57..927ff5be3e5 100644
--- a/src/test/run-pass/nil-pattern.rs
+++ b/src/test/run-pass/nil-pattern.rs
@@ -1 +1 @@
-fn main() { let x = (); alt x { () { } } }
\ No newline at end of file
+fn main() { let x = (); alt x { () { } } }
diff --git a/src/test/run-pass/obj-docs.rs b/src/test/run-pass/obj-docs.rs
index cdda794acff..de5a91e886b 100644
--- a/src/test/run-pass/obj-docs.rs
+++ b/src/test/run-pass/obj-docs.rs
@@ -9,55 +9,42 @@ fn main() {
 
     // Ref.Item.Obj
     obj counter(state: @mutable int) {
-        fn incr() {
-            *state += 1;
-            }
-        fn get() -> int {
-            ret *state;
-            }
-        }
+        fn incr() { *state += 1; }
+        fn get() -> int { ret *state; }
+    }
 
     let c: counter = counter(@mutable 1);
 
     c.incr();
     c.incr();
-    assert c.get() == 3;
+    assert (c.get() == 3);
 
     obj my_obj() {
-        fn get() -> int {
-            ret 3;
-        }
-        fn foo() -> int{
+        fn get() -> int { ret 3; }
+        fn foo() -> int {
             let c = self.get();
             ret c + 2; // returns 5
         }
     }
 
     let o = my_obj();
-    assert o.foo() == 5;
+    assert (o.foo() == 5);
 
     // Ref.Type.Obj
-    type taker = obj {
-        fn take(int);
-    };
+    type taker =
+        obj {
+            fn take(int);
+        };
 
     obj adder(x: @mutable int) {
-        fn take(y: int) {
-            *x += y;
-        }
+        fn take(y: int) { *x += y; }
     }
 
     obj sender(c: _chan<int>) {
-        fn take(z: int) {
-            send(c, z);
-        }
+        fn take(z: int) { send(c, z); }
     }
 
-    fn give_ints(t: taker) {
-        t.take(1);
-        t.take(2);
-        t.take(3);
-    }
+    fn give_ints(t: taker) { t.take(1); t.take(2); t.take(3); }
 
     let p = mk_port::<int>();
 
diff --git a/src/test/run-pass/obj-drop.rs b/src/test/run-pass/obj-drop.rs
index b807fe3dcfc..a823784e1b0 100644
--- a/src/test/run-pass/obj-drop.rs
+++ b/src/test/run-pass/obj-drop.rs
@@ -5,4 +5,4 @@ fn main() {
     // This just tests whether the obj leaks its box state members.
 
     let ob = handle(@0xf00f00);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-recursion.rs b/src/test/run-pass/obj-recursion.rs
index 7110683d9d1..3c4346af32e 100644
--- a/src/test/run-pass/obj-recursion.rs
+++ b/src/test/run-pass/obj-recursion.rs
@@ -2,7 +2,7 @@
 
 type adder =
     obj {
-        fn add() ;
+        fn add();
     };
 
 obj leaf_adder(x: int) {
@@ -16,4 +16,4 @@ obj delegate_adder(a: adder) {
 fn main() {
     let x = delegate_adder(delegate_adder(delegate_adder(leaf_adder(10))));
     x.add();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-2.rs b/src/test/run-pass/obj-self-2.rs
index 8b0dd4b1595..ca33b382792 100644
--- a/src/test/run-pass/obj-self-2.rs
+++ b/src/test/run-pass/obj-self-2.rs
@@ -9,4 +9,4 @@ fn main() {
     let i: int = 0;
     a.m1(i);
     a.m2(i);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-3.rs b/src/test/run-pass/obj-self-3.rs
index fcee2e1a087..29720216bd1 100644
--- a/src/test/run-pass/obj-self-3.rs
+++ b/src/test/run-pass/obj-self-3.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (i == 2);
     i = a.m3(i);
     assert (i == 4);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-4.rs b/src/test/run-pass/obj-self-4.rs
index 8c52593faa9..e13a39f0998 100644
--- a/src/test/run-pass/obj-self-4.rs
+++ b/src/test/run-pass/obj-self-4.rs
@@ -19,4 +19,4 @@ fn main() {
     assert (rs == 8);
     rs = o.get();
     assert (rs == 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self.rs b/src/test/run-pass/obj-self.rs
index 6e293fc344a..c6a1b141558 100644
--- a/src/test/run-pass/obj-self.rs
+++ b/src/test/run-pass/obj-self.rs
@@ -8,4 +8,4 @@ fn main() {
     let a = foo();
     a.m1();
     a.m2();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-with-vec.rs b/src/test/run-pass/obj-with-vec.rs
index db4050aaf94..1ce8cbc46bf 100644
--- a/src/test/run-pass/obj-with-vec.rs
+++ b/src/test/run-pass/obj-with-vec.rs
@@ -2,9 +2,9 @@
 
 fn main() {
     obj buf(data: [u8]) {
-        fn get(i: int) -> u8 { ret data.(i); }
+        fn get(i: int) -> u8 { ret data[i]; }
     }
-    let b = buf(~[1 as u8, 2 as u8, 3 as u8]);
+    let b = buf([1 as u8, 2 as u8, 3 as u8]);
     log b.get(1);
     assert (b.get(1) == 2 as u8);
 }
diff --git a/src/test/run-pass/opeq.rs b/src/test/run-pass/opeq.rs
index 03576541d47..b38a6313f54 100644
--- a/src/test/run-pass/opeq.rs
+++ b/src/test/run-pass/opeq.rs
@@ -16,4 +16,4 @@ fn main() {
     x /= 5;
     log x;
     assert (x == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/operator-associativity.rs b/src/test/run-pass/operator-associativity.rs
index 624d431b45a..af8c3ee6228 100644
--- a/src/test/run-pass/operator-associativity.rs
+++ b/src/test/run-pass/operator-associativity.rs
@@ -2,4 +2,4 @@
 
 
 // Testcase for issue #130, operator associativity.
-fn main() { assert (3 * 5 / 2 == 7); }
\ No newline at end of file
+fn main() { assert (3 * 5 / 2 == 7); }
diff --git a/src/test/run-pass/or-pattern.rs b/src/test/run-pass/or-pattern.rs
index 498a6777d9c..99682e0977a 100644
--- a/src/test/run-pass/or-pattern.rs
+++ b/src/test/run-pass/or-pattern.rs
@@ -8,4 +8,4 @@ fn main() {
     assert (or_alt(c) == 0);
     assert (or_alt(a(10, 100, 0u)) == 110);
     assert (or_alt(b(20, 200)) == 220);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/output-slot-variants.rs b/src/test/run-pass/output-slot-variants.rs
index fe318ec539c..41d5b2871b3 100644
--- a/src/test/run-pass/output-slot-variants.rs
+++ b/src/test/run-pass/output-slot-variants.rs
@@ -55,4 +55,4 @@ fn main() {
 
     ext_ext_mem = ret_ext_ext_mem(); // non-initializing
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/over-constrained-vregs.rs b/src/test/run-pass/over-constrained-vregs.rs
index 29840986793..98f4ab7a6d8 100644
--- a/src/test/run-pass/over-constrained-vregs.rs
+++ b/src/test/run-pass/over-constrained-vregs.rs
@@ -2,4 +2,4 @@
 
 
 // Regression test for issue #152.
-fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } }
\ No newline at end of file
+fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } }
diff --git a/src/test/run-pass/paren-free.rs b/src/test/run-pass/paren-free.rs
index cde723b835b..4d48c09175a 100644
--- a/src/test/run-pass/paren-free.rs
+++ b/src/test/run-pass/paren-free.rs
@@ -2,4 +2,4 @@ fn main() {
     let x = true;
     if x { let i = 10; while i > 0 { i -= 1; } }
     alt x { true { log "right"; } false { log "wrong"; } }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/parse-fail.rs b/src/test/run-pass/parse-fail.rs
index 3d7b372b9b4..0b4e959c9ee 100644
--- a/src/test/run-pass/parse-fail.rs
+++ b/src/test/run-pass/parse-fail.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn dont_call_me() { fail; log 1; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/polymorphic-iter.rs b/src/test/run-pass/polymorphic-iter.rs
index 46d3705649e..4f23b58f268 100644
--- a/src/test/run-pass/polymorphic-iter.rs
+++ b/src/test/run-pass/polymorphic-iter.rs
@@ -1,4 +1,2 @@
 iter iter2<@T>() -> T { }
-fn main() {
-    for each i: int in iter2() { }
-}
+fn main() { for each i: int in iter2() { } }
diff --git a/src/test/run-pass/pred-check.rs b/src/test/run-pass/pred-check.rs
index 4f7d6e92ec9..12b1ff5ed73 100644
--- a/src/test/run-pass/pred-check.rs
+++ b/src/test/run-pass/pred-check.rs
@@ -1,4 +1,4 @@
 // -*- rust -*-
 pred f(q: int) -> bool { ret true; }
 
-fn main() { let x = 0; check (f(x)); }
\ No newline at end of file
+fn main() { let x = 0; check (f(x)); }
diff --git a/src/test/run-pass/pred.rs b/src/test/run-pass/pred.rs
index e1ddf1c2ece..5c9a56c904c 100644
--- a/src/test/run-pass/pred.rs
+++ b/src/test/run-pass/pred.rs
@@ -11,4 +11,4 @@ fn main() {
     check (lt(a, c));
     f(a, b);
     f(a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/readalias.rs b/src/test/run-pass/readalias.rs
index 451aa290fa5..93b8b22aef5 100644
--- a/src/test/run-pass/readalias.rs
+++ b/src/test/run-pass/readalias.rs
@@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int};
 
 fn f(p: &point) { assert (p.z == 12); }
 
-fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
\ No newline at end of file
+fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
diff --git a/src/test/run-pass/rebind-fn.rs b/src/test/run-pass/rebind-fn.rs
index b10054de0cd..62d3ca16d11 100644
--- a/src/test/run-pass/rebind-fn.rs
+++ b/src/test/run-pass/rebind-fn.rs
@@ -1,11 +1,8 @@
 fn add(i: int, j: int) -> int { ret i + j; }
-fn binder(n: int) -> fn() -> int {
-    let f = bind add(n, _);
-    ret bind f(2);
-}
+fn binder(n: int) -> fn() -> int { let f = bind add(n, _); ret bind f(2); }
 fn main() {
     binder(5);
     let f = binder(1);
-    assert(f() == 3);
-    assert(binder(8)() == 10);
+    assert (f() == 3);
+    assert (binder(8)() == 10);
 }
diff --git a/src/test/run-pass/rec-auto.rs b/src/test/run-pass/rec-auto.rs
index 4162bebfb92..c23c359d621 100644
--- a/src/test/run-pass/rec-auto.rs
+++ b/src/test/run-pass/rec-auto.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 
 // Issue #50.
-fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; }
\ No newline at end of file
+fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; }
diff --git a/src/test/run-pass/rec-extend.rs b/src/test/run-pass/rec-extend.rs
index 6b307107ab0..cd0d089d28a 100644
--- a/src/test/run-pass/rec-extend.rs
+++ b/src/test/run-pass/rec-extend.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (right.y == 0);
     assert (up.x == 0);
     assert (up.y == 10);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/rec-tup.rs b/src/test/run-pass/rec-tup.rs
index e1656bf17b8..66cf866de9d 100644
--- a/src/test/run-pass/rec-tup.rs
+++ b/src/test/run-pass/rec-tup.rs
@@ -3,14 +3,8 @@ type point = {x: int, y: int};
 
 type rect = (point, point);
 
-fn fst(r: &rect) -> point {
-    let (fst, _) = r;
-    ret fst;
-}
-fn snd(r: &rect) -> point {
-    let (_, snd) = r;
-    ret snd;
-}
+fn fst(r: &rect) -> point { let (fst, _) = r; ret fst; }
+fn snd(r: &rect) -> point { let (_, snd) = r; ret snd; }
 
 fn f(r: rect, x1: int, y1: int, x2: int, y2: int) {
     assert (fst(r).x == x1);
diff --git a/src/test/run-pass/rec.rs b/src/test/run-pass/rec.rs
index b7a3f3a6d84..04867f72fa8 100644
--- a/src/test/run-pass/rec.rs
+++ b/src/test/run-pass/rec.rs
@@ -22,4 +22,4 @@ fn main() {
     assert (x == 10);
     f(r, 10, 20, 100, 200);
     f(r2, 10, 20, 100, 200);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/record-pat.rs b/src/test/run-pass/record-pat.rs
index 794a1a9ee04..f2f4c6af2c7 100644
--- a/src/test/run-pass/record-pat.rs
+++ b/src/test/run-pass/record-pat.rs
@@ -12,4 +12,4 @@ fn m(in: &t3) -> int {
 fn main() {
     assert (m(c({x: a(10), y: 5}, 4u)) == 10);
     assert (m(c({x: b(10u), y: 5}, 4u)) == 19);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/resource-destruct.rs b/src/test/run-pass/resource-destruct.rs
index 8d6d85899b1..25a3c79e1c3 100644
--- a/src/test/run-pass/resource-destruct.rs
+++ b/src/test/run-pass/resource-destruct.rs
@@ -6,4 +6,4 @@ fn main() {
     let my_total = @mutable 10;
     { let pt <- shrinky_pointer(my_total); assert (look_at(pt) == 10); }
     assert (*my_total == 9);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/resource-generic.rs b/src/test/run-pass/resource-generic.rs
index 6ab2eb308b6..34ecc55f2e4 100644
--- a/src/test/run-pass/resource-generic.rs
+++ b/src/test/run-pass/resource-generic.rs
@@ -1,4 +1,4 @@
-resource finish<T>(arg: {val: T, fin: fn(&T) }) { arg.fin(arg.val); }
+resource finish<T>(arg: {val: T, fin: fn(&T)}) { arg.fin(arg.val); }
 
 fn main() {
     let box = @mutable 10;
diff --git a/src/test/run-pass/resource-in-struct.rs b/src/test/run-pass/resource-in-struct.rs
index 6e7e8dc6bfd..758beb3d9e1 100644
--- a/src/test/run-pass/resource-in-struct.rs
+++ b/src/test/run-pass/resource-in-struct.rs
@@ -3,17 +3,15 @@
 
 type closable = @mutable bool;
 
-resource close_res(i: closable) {
-    *i = false;
-}
+resource close_res(i: closable) { *i = false; }
 
 tag option<T> { none; some(T); }
 
-fn sink(res: option<close_res>) {}
+fn sink(res: option<close_res>) { }
 
 fn main() {
     let c = @mutable true;
     sink(none);
     sink(some(close_res(c)));
-    assert !*c;
+    assert (!*c);
 }
diff --git a/src/test/run-pass/ret-bang.rs b/src/test/run-pass/ret-bang.rs
index e668ff9b0bc..55a4c5922c3 100644
--- a/src/test/run-pass/ret-bang.rs
+++ b/src/test/run-pass/ret-bang.rs
@@ -8,4 +8,4 @@ fn okay(i: uint) -> int {
     if i == 3u { my_err("I don't like three"); } else { ret 42; }
 }
 
-fn main() { okay(4u); }
\ No newline at end of file
+fn main() { okay(4u); }
diff --git a/src/test/run-pass/return-nil.rs b/src/test/run-pass/return-nil.rs
index 6e7b9d8b048..a7a55e60971 100644
--- a/src/test/run-pass/return-nil.rs
+++ b/src/test/run-pass/return-nil.rs
@@ -2,4 +2,4 @@
 
 fn f() { let x: () = (); ret x; }
 
-fn main() { let x = f(); }
\ No newline at end of file
+fn main() { let x = f(); }
diff --git a/src/test/run-pass/rt-circular-buffer.rs b/src/test/run-pass/rt-circular-buffer.rs
index 4a6839a8de5..0d84d1abe64 100644
--- a/src/test/run-pass/rt-circular-buffer.rs
+++ b/src/test/run-pass/rt-circular-buffer.rs
@@ -30,7 +30,7 @@ fn test_init() {
 fn test_grow() {
     let myport: comm::_port<record> = comm::mk_port();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val: record = {val1: 0u32, val2: 0u32, val3: 0u32};
         comm::send(mychan, val);
     }
@@ -48,11 +48,11 @@ fn test_shrink1() {
 fn test_shrink2() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val: record = {val1: 0u32, val2: 0u32, val3: 0u32};
         send(mychan, val);
     }
-    for each i: uint  in uint::range(0u, 100u) { let x = myport.recv(); }
+    for each i: uint in uint::range(0u, 100u) { let x = myport.recv(); }
 }
 
 
@@ -60,7 +60,7 @@ fn test_shrink2() {
 fn test_rotate() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val = {val1: i as u32, val2: i as u32, val3: i as u32};
         send(mychan, val);
         let x = myport.recv();
@@ -76,13 +76,13 @@ fn test_rotate() {
 fn test_rotate_grow() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each j: uint  in uint::range(0u, 10u) {
-        for each i: uint  in uint::range(0u, 10u) {
+    for each j: uint in uint::range(0u, 10u) {
+        for each i: uint in uint::range(0u, 10u) {
             let val: record =
                 {val1: i as u32, val2: i as u32, val3: i as u32};
             send(mychan, val);
         }
-        for each i: uint  in uint::range(0u, 10u) {
+        for each i: uint in uint::range(0u, 10u) {
             let x = myport.recv();
             assert (x.val1 == i as u32);
             assert (x.val2 == i as u32);
diff --git a/src/test/run-pass/self-shadowing-import.rs b/src/test/run-pass/self-shadowing-import.rs
index c9b70d35d46..7887990f080 100644
--- a/src/test/run-pass/self-shadowing-import.rs
+++ b/src/test/run-pass/self-shadowing-import.rs
@@ -11,4 +11,4 @@ mod c {
     fn bar() { assert (a::foo() == 1); }
 }
 
-fn main() { c::bar(); }
\ No newline at end of file
+fn main() { c::bar(); }
diff --git a/src/test/run-pass/seq-compare.rs b/src/test/run-pass/seq-compare.rs
index 265c45a101d..79a318eefd2 100644
--- a/src/test/run-pass/seq-compare.rs
+++ b/src/test/run-pass/seq-compare.rs
@@ -4,13 +4,13 @@ fn main() {
     assert ("hello" < "hellr");
     assert ("hello " > "hello");
     assert ("hello" != "there");
-    assert (~[1, 2, 3, 4] > ~[1, 2, 3]);
-    assert (~[1, 2, 3] < ~[1, 2, 3, 4]);
-    assert (~[1, 2, 4, 4] > ~[1, 2, 3, 4]);
-    assert (~[1, 2, 3, 4] < ~[1, 2, 4, 4]);
-    assert (~[1, 2, 3] <= ~[1, 2, 3]);
-    assert (~[1, 2, 3] <= ~[1, 2, 3, 3]);
-    assert (~[1, 2, 3, 4] > ~[1, 2, 3]);
-    assert (~[1, 2, 3] == ~[1, 2, 3]);
-    assert (~[1, 2, 3] != ~[1, 1, 3]);
-}
\ No newline at end of file
+    assert ([1, 2, 3, 4] > [1, 2, 3]);
+    assert ([1, 2, 3] < [1, 2, 3, 4]);
+    assert ([1, 2, 4, 4] > [1, 2, 3, 4]);
+    assert ([1, 2, 3, 4] < [1, 2, 4, 4]);
+    assert ([1, 2, 3] <= [1, 2, 3]);
+    assert ([1, 2, 3] <= [1, 2, 3, 3]);
+    assert ([1, 2, 3, 4] > [1, 2, 3]);
+    assert ([1, 2, 3] == [1, 2, 3]);
+    assert ([1, 2, 3] != [1, 1, 3]);
+}
diff --git a/src/test/run-pass/shadow.rs b/src/test/run-pass/shadow.rs
index e3f86246594..3fc3a015915 100644
--- a/src/test/run-pass/shadow.rs
+++ b/src/test/run-pass/shadow.rs
@@ -1,20 +1,15 @@
 // -*- rust -*-
 fn foo(c: [int]) {
     let a: int = 5;
-    let b: [int] = ~[];
+    let b: [int] = [];
 
 
     alt none::<int> {
-        some::<int>(_) { for i: int in c { log a; let a = 17; b += ~[a]; } }
-      _ {}
+      some::<int>(_) { for i: int in c { log a; let a = 17; b += [a]; } }
+      _ { }
     }
 }
 
 tag t<T> { none; some(T); }
 
-fn main() {
-    let x = 10;
-    let x = x + 20;
-    assert x == 30;
-    foo(~[]);
-}
+fn main() { let x = 10; let x = x + 20; assert (x == 30); foo([]); }
diff --git a/src/test/run-pass/simple-alt-generic-tag.rs b/src/test/run-pass/simple-alt-generic-tag.rs
index 39a9619b1c6..ac0e5ed6994 100644
--- a/src/test/run-pass/simple-alt-generic-tag.rs
+++ b/src/test/run-pass/simple-alt-generic-tag.rs
@@ -3,5 +3,6 @@
 tag opt<T> { none; }
 
 fn main() {
-    let x = none::<int>; alt x { none::<int>. { log "hello world"; } }
+    let x = none::<int>;
+    alt x { none::<int>. { log "hello world"; } }
 }
diff --git a/src/test/run-pass/simple-anon-objs.rs b/src/test/run-pass/simple-anon-objs.rs
index 8525ea8c8a3..5c2315d67d0 100644
--- a/src/test/run-pass/simple-anon-objs.rs
+++ b/src/test/run-pass/simple-anon-objs.rs
@@ -26,4 +26,4 @@ fn main() {
 
     assert (another_anon_obj.baz() == 4);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/simple-infer.rs b/src/test/run-pass/simple-infer.rs
index 6cf8df90222..03656fc8c1b 100644
--- a/src/test/run-pass/simple-infer.rs
+++ b/src/test/run-pass/simple-infer.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let n; n = 1; log n; }
\ No newline at end of file
+fn main() { let n; n = 1; log n; }
diff --git a/src/test/run-pass/simple-obj.rs b/src/test/run-pass/simple-obj.rs
index 1133cdc7630..6cb4caafe16 100644
--- a/src/test/run-pass/simple-obj.rs
+++ b/src/test/run-pass/simple-obj.rs
@@ -6,4 +6,4 @@ obj x() {
     fn hello() { log "hello, object world"; }
 }
 
-fn main() { let mx = x(); mx.hello(); }
\ No newline at end of file
+fn main() { let mx = x(); mx.hello(); }
diff --git a/src/test/run-pass/size-and-align.rs b/src/test/run-pass/size-and-align.rs
index 8628e359ccb..929ce3500f1 100644
--- a/src/test/run-pass/size-and-align.rs
+++ b/src/test/run-pass/size-and-align.rs
@@ -5,13 +5,13 @@
 tag clam<T> { a(T, int); b; }
 
 fn uhoh<T>(v: &[clam<T>]) {
-    alt v.(1) {
+    alt v[1] {
       a::<T>(t, u) { log "incorrect"; log u; fail; }
       b::<T>. { log "correct"; }
     }
 }
 
 fn main() {
-    let v: [clam<int>] = ~[b::<int>, b::<int>, a::<int>(42, 17)];
+    let v: [clam<int>] = [b::<int>, b::<int>, a::<int>(42, 17)];
     uhoh::<int>(v);
 }
diff --git a/src/test/run-pass/spawn-fn.rs b/src/test/run-pass/spawn-fn.rs
index 26495c4a085..03d450a9cfa 100644
--- a/src/test/run-pass/spawn-fn.rs
+++ b/src/test/run-pass/spawn-fn.rs
@@ -12,4 +12,4 @@ fn main() {
     task::_spawn(bind x("hello from third spawned fn", 67));
     let i: int = 30;
     while i > 0 { i = i - 1; log "parent sleeping"; yield(); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/spawn-module-qualified.rs b/src/test/run-pass/spawn-module-qualified.rs
index 46d0dfee616..f1d1a099ef2 100644
--- a/src/test/run-pass/spawn-module-qualified.rs
+++ b/src/test/run-pass/spawn-module-qualified.rs
@@ -2,12 +2,7 @@ use std;
 import std::task::join_id;
 import std::task::_spawn;
 
-fn main() {
-  let x = _spawn(bind m::child(10));
-  join_id(x);
-}
+fn main() { let x = _spawn(bind m::child(10)); join_id(x); }
 mod m {
-  fn child(i: int) {
-    log i;
-  }
+    fn child(i: int) { log i; }
 }
diff --git a/src/test/run-pass/spawn.rs b/src/test/run-pass/spawn.rs
index 1ef82f24a2d..29126d85018 100644
--- a/src/test/run-pass/spawn.rs
+++ b/src/test/run-pass/spawn.rs
@@ -4,10 +4,7 @@ use std;
 
 import std::task;
 
-fn main() {
-    let t = task::_spawn(bind child(10));
-    task::join_id(t);
-}
+fn main() { let t = task::_spawn(bind child(10)); task::join_id(t); }
 
 fn child(i: int) { log_err i; assert (i == 10); }
 
diff --git a/src/test/run-pass/standalone-method.rs b/src/test/run-pass/standalone-method.rs
index 3fe6763bf97..e9768339433 100644
--- a/src/test/run-pass/standalone-method.rs
+++ b/src/test/run-pass/standalone-method.rs
@@ -1,22 +1,18 @@
 // Test case for issue #435.
 obj foo() {
-    fn add5(n: int) -> int {
-        ret n + 5;
-    }
+    fn add5(n: int) -> int { ret n + 5; }
 }
 
-fn add5(n: int) -> int {
-    ret n + 5;
-}
+fn add5(n: int) -> int { ret n + 5; }
 
 fn main() {
     let fiveplusseven = bind add5(7);
-    assert add5(7) == 12;
-    assert fiveplusseven() == 12;
+    assert (add5(7) == 12);
+    assert (fiveplusseven() == 12);
 
     let my_foo = foo();
     let fiveplusseven_too = bind my_foo.add5(7);
-    assert my_foo.add5(7) == 12;
-    assert fiveplusseven_too() == 12;
+    assert (my_foo.add5(7) == 12);
+    assert (fiveplusseven_too() == 12);
 }
 
diff --git a/src/test/run-pass/stateful-obj.rs b/src/test/run-pass/stateful-obj.rs
index 7e3fa5602b4..97160244d16 100644
--- a/src/test/run-pass/stateful-obj.rs
+++ b/src/test/run-pass/stateful-obj.rs
@@ -16,4 +16,4 @@ fn main() {
     y.incr();
     log y.get();
     assert (y.get() == 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/str-append.rs b/src/test/run-pass/str-append.rs
index a27f729fe5d..e1fa92738cb 100644
--- a/src/test/run-pass/str-append.rs
+++ b/src/test/run-pass/str-append.rs
@@ -8,7 +8,7 @@ fn test1() {
     let s: str = "hello";
     s += "world";
     log s;
-    assert (s.(9) == 'd' as u8);
+    assert (s[9] == 'd' as u8);
 }
 
 fn test2() {
@@ -23,4 +23,4 @@ fn test2() {
     assert (str::eq(b, "ABCabcABC"));
 }
 
-fn main() { test1(); test2(); }
\ No newline at end of file
+fn main() { test1(); test2(); }
diff --git a/src/test/run-pass/str-concat.rs b/src/test/run-pass/str-concat.rs
index 57c0525cfd3..8fc48725875 100644
--- a/src/test/run-pass/str-concat.rs
+++ b/src/test/run-pass/str-concat.rs
@@ -7,5 +7,5 @@ fn main() {
     let b: str = "world";
     let s: str = a + b;
     log s;
-    assert (s.(9) == 'd' as u8);
-}
\ No newline at end of file
+    assert (s[9] == 'd' as u8);
+}
diff --git a/src/test/run-pass/str-growth.rs b/src/test/run-pass/str-growth.rs
index 35d29fec65a..5c0d34b3501 100644
--- a/src/test/run-pass/str-growth.rs
+++ b/src/test/run-pass/str-growth.rs
@@ -3,12 +3,12 @@
 fn main() {
     let s = "a";
     s += "b";
-    assert (s.(0) == 'a' as u8);
-    assert (s.(1) == 'b' as u8);
+    assert (s[0] == 'a' as u8);
+    assert (s[1] == 'b' as u8);
     s += "c";
     s += "d";
-    assert (s.(0) == 'a' as u8);
-    assert (s.(1) == 'b' as u8);
-    assert (s.(2) == 'c' as u8);
-    assert (s.(3) == 'd' as u8);
-}
\ No newline at end of file
+    assert (s[0] == 'a' as u8);
+    assert (s[1] == 'b' as u8);
+    assert (s[2] == 'c' as u8);
+    assert (s[3] == 'd' as u8);
+}
diff --git a/src/test/run-pass/str-idx.rs b/src/test/run-pass/str-idx.rs
index 0c619a213fa..4b5ea5f7961 100644
--- a/src/test/run-pass/str-idx.rs
+++ b/src/test/run-pass/str-idx.rs
@@ -5,4 +5,4 @@ fn main() {
     let c: u8 = s[4];
     log c;
     assert (c == 0x6f as u8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/str-multiline.rs b/src/test/run-pass/str-multiline.rs
index 45d6ad632ba..15a13083321 100644
--- a/src/test/run-pass/str-multiline.rs
+++ b/src/test/run-pass/str-multiline.rs
@@ -14,4 +14,4 @@ is a test";
                test";
     assert (str::eq(a, "this is a test"));
     assert (str::eq(b, "this is another test"));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/string-self-append.rs b/src/test/run-pass/string-self-append.rs
index 3b15df94ce4..94a9696adf0 100644
--- a/src/test/run-pass/string-self-append.rs
+++ b/src/test/run-pass/string-self-append.rs
@@ -13,4 +13,4 @@ fn main() {
         i -= 1;
         expected_len *= 2u;
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/structured-compare-recursive.rs b/src/test/run-pass/structured-compare-recursive.rs
index bc8bb76a480..cee650ed40e 100644
--- a/src/test/run-pass/structured-compare-recursive.rs
+++ b/src/test/run-pass/structured-compare-recursive.rs
@@ -2,4 +2,4 @@
 
 tag taggy { foo(@taggy); bar; }
 
-fn main() { assert (bar <= bar); }
\ No newline at end of file
+fn main() { assert (bar <= bar); }
diff --git a/src/test/run-pass/structured-compare.rs b/src/test/run-pass/structured-compare.rs
index e2d95a54575..04bc1d75da8 100644
--- a/src/test/run-pass/structured-compare.rs
+++ b/src/test/run-pass/structured-compare.rs
@@ -16,4 +16,4 @@ fn main() {
     assert (x != y);
     assert (x == large);
     assert (x != small);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/swap-1.rs b/src/test/run-pass/swap-1.rs
index 62b557eba63..c9fc58a93aa 100644
--- a/src/test/run-pass/swap-1.rs
+++ b/src/test/run-pass/swap-1.rs
@@ -1 +1 @@
-fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); }
\ No newline at end of file
+fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); }
diff --git a/src/test/run-pass/swap-2.rs b/src/test/run-pass/swap-2.rs
index 155d71399e5..5caf36f9b92 100644
--- a/src/test/run-pass/swap-2.rs
+++ b/src/test/run-pass/swap-2.rs
@@ -1,12 +1,12 @@
-fn swap<@T>(v: &[mutable T], i: int, j: int) { v.(i) <-> v.(j); }
+fn swap<@T>(v: &[mutable T], i: int, j: int) { v[i] <-> v[j]; }
 
 fn main() {
-    let a: [mutable int] = ~[mutable 0, 1, 2, 3, 4, 5, 6];
+    let a: [mutable int] = [mutable 0, 1, 2, 3, 4, 5, 6];
     swap(a, 2, 4);
-    assert (a.(2) == 4);
-    assert (a.(4) == 2);
+    assert (a[2] == 4);
+    assert (a[4] == 2);
     let n = 42;
-    n <-> a.(0);
-    assert (a.(0) == 42);
+    n <-> a[0];
+    assert (a[0] == 42);
     assert (n == 0);
 }
diff --git a/src/test/run-pass/syntax-extension-fmt.rs b/src/test/run-pass/syntax-extension-fmt.rs
index 22033e2acf2..c241a68e7f1 100644
--- a/src/test/run-pass/syntax-extension-fmt.rs
+++ b/src/test/run-pass/syntax-extension-fmt.rs
@@ -8,10 +8,10 @@ fn test(actual: str, expected: str) {
 }
 
 fn main() {
-    test(#fmt("hello %d friends and %s things", 10, "formatted"),
+    test(#fmt["hello %d friends and %s things", 10, "formatted"],
          "hello 10 friends and formatted things");
 
-    test(#fmt("test"), "test");
+    test(#fmt["test"], "test");
 
     // a quadratic optimization in LLVM (jump-threading) makes this test a
     // bit slow to compile unless we break it up
@@ -26,192 +26,192 @@ fn main() {
 fn part1() {
     // Simple tests for types
 
-    test(#fmt("%d", 1), "1");
-    test(#fmt("%i", 2), "2");
-    test(#fmt("%i", -1), "-1");
-    test(#fmt("%u", 10u), "10");
-    test(#fmt("%s", "test"), "test");
-    test(#fmt("%b", true), "true");
-    test(#fmt("%b", false), "false");
-    test(#fmt("%c", 'A'), "A");
-    test(#fmt("%x", 0xff_u), "ff");
-    test(#fmt("%X", 0x12ab_u), "12AB");
-    test(#fmt("%o", 10u), "12");
-    test(#fmt("%t", 0b11010101_u), "11010101");
+    test(#fmt["%d", 1], "1");
+    test(#fmt["%i", 2], "2");
+    test(#fmt["%i", -1], "-1");
+    test(#fmt["%u", 10u], "10");
+    test(#fmt["%s", "test"], "test");
+    test(#fmt["%b", true], "true");
+    test(#fmt["%b", false], "false");
+    test(#fmt["%c", 'A'], "A");
+    test(#fmt["%x", 0xff_u], "ff");
+    test(#fmt["%X", 0x12ab_u], "12AB");
+    test(#fmt["%o", 10u], "12");
+    test(#fmt["%t", 0b11010101_u], "11010101");
     // 32-bit limits
 
-    test(#fmt("%i", -2147483648), "-2147483648");
-    test(#fmt("%i", 2147483647), "2147483647");
-    test(#fmt("%u", 4294967295u), "4294967295");
-    test(#fmt("%x", 0xffffffff_u), "ffffffff");
-    test(#fmt("%o", 0xffffffff_u), "37777777777");
-    test(#fmt("%t", 0xffffffff_u), "11111111111111111111111111111111");
+    test(#fmt["%i", -2147483648], "-2147483648");
+    test(#fmt["%i", 2147483647], "2147483647");
+    test(#fmt["%u", 4294967295u], "4294967295");
+    test(#fmt["%x", 0xffffffff_u], "ffffffff");
+    test(#fmt["%o", 0xffffffff_u], "37777777777");
+    test(#fmt["%t", 0xffffffff_u], "11111111111111111111111111111111");
 }
 fn part2() {
     // Widths
 
-    test(#fmt("%1d", 500), "500");
-    test(#fmt("%10d", 500), "       500");
-    test(#fmt("%10d", -500), "      -500");
-    test(#fmt("%10u", 500u), "       500");
-    test(#fmt("%10s", "test"), "      test");
-    test(#fmt("%10b", true), "      true");
-    test(#fmt("%10x", 0xff_u), "        ff");
-    test(#fmt("%10X", 0xff_u), "        FF");
-    test(#fmt("%10o", 10u), "        12");
-    test(#fmt("%10t", 0xff_u), "  11111111");
-    test(#fmt("%10c", 'A'), "         A");
+    test(#fmt["%1d", 500], "500");
+    test(#fmt["%10d", 500], "       500");
+    test(#fmt["%10d", -500], "      -500");
+    test(#fmt["%10u", 500u], "       500");
+    test(#fmt["%10s", "test"], "      test");
+    test(#fmt["%10b", true], "      true");
+    test(#fmt["%10x", 0xff_u], "        ff");
+    test(#fmt["%10X", 0xff_u], "        FF");
+    test(#fmt["%10o", 10u], "        12");
+    test(#fmt["%10t", 0xff_u], "  11111111");
+    test(#fmt["%10c", 'A'], "         A");
     // Left justify
 
-    test(#fmt("%-10d", 500), "500       ");
-    test(#fmt("%-10d", -500), "-500      ");
-    test(#fmt("%-10u", 500u), "500       ");
-    test(#fmt("%-10s", "test"), "test      ");
-    test(#fmt("%-10b", true), "true      ");
-    test(#fmt("%-10x", 0xff_u), "ff        ");
-    test(#fmt("%-10X", 0xff_u), "FF        ");
-    test(#fmt("%-10o", 10u), "12        ");
-    test(#fmt("%-10t", 0xff_u), "11111111  ");
-    test(#fmt("%-10c", 'A'), "A         ");
+    test(#fmt["%-10d", 500], "500       ");
+    test(#fmt["%-10d", -500], "-500      ");
+    test(#fmt["%-10u", 500u], "500       ");
+    test(#fmt["%-10s", "test"], "test      ");
+    test(#fmt["%-10b", true], "true      ");
+    test(#fmt["%-10x", 0xff_u], "ff        ");
+    test(#fmt["%-10X", 0xff_u], "FF        ");
+    test(#fmt["%-10o", 10u], "12        ");
+    test(#fmt["%-10t", 0xff_u], "11111111  ");
+    test(#fmt["%-10c", 'A'], "A         ");
 }
 
 fn part3() {
     // Precision
 
-    test(#fmt("%.d", 0), "");
-    test(#fmt("%.u", 0u), "");
-    test(#fmt("%.x", 0u), "");
-    test(#fmt("%.t", 0u), "");
-    test(#fmt("%.d", 10), "10");
-    test(#fmt("%.d", -10), "-10");
-    test(#fmt("%.u", 10u), "10");
-    test(#fmt("%.s", "test"), "");
-    test(#fmt("%.x", 127u), "7f");
-    test(#fmt("%.o", 10u), "12");
-    test(#fmt("%.t", 3u), "11");
-    test(#fmt("%.c", 'A'), "A");
-    test(#fmt("%.0d", 0), "");
-    test(#fmt("%.0u", 0u), "");
-    test(#fmt("%.0x", 0u), "");
-    test(#fmt("%.0t", 0u), "");
-    test(#fmt("%.0d", 10), "10");
-    test(#fmt("%.0d", -10), "-10");
-    test(#fmt("%.0u", 10u), "10");
-    test(#fmt("%.0s", "test"), "");
-    test(#fmt("%.0x", 127u), "7f");
-    test(#fmt("%.0o", 10u), "12");
-    test(#fmt("%.0t", 3u), "11");
-    test(#fmt("%.0c", 'A'), "A");
-    test(#fmt("%.1d", 0), "0");
-    test(#fmt("%.1u", 0u), "0");
-    test(#fmt("%.1x", 0u), "0");
-    test(#fmt("%.1t", 0u), "0");
-    test(#fmt("%.1d", 10), "10");
-    test(#fmt("%.1d", -10), "-10");
-    test(#fmt("%.1u", 10u), "10");
-    test(#fmt("%.1s", "test"), "t");
-    test(#fmt("%.1x", 127u), "7f");
-    test(#fmt("%.1o", 10u), "12");
-    test(#fmt("%.1t", 3u), "11");
-    test(#fmt("%.1c", 'A'), "A");
+    test(#fmt["%.d", 0], "");
+    test(#fmt["%.u", 0u], "");
+    test(#fmt["%.x", 0u], "");
+    test(#fmt["%.t", 0u], "");
+    test(#fmt["%.d", 10], "10");
+    test(#fmt["%.d", -10], "-10");
+    test(#fmt["%.u", 10u], "10");
+    test(#fmt["%.s", "test"], "");
+    test(#fmt["%.x", 127u], "7f");
+    test(#fmt["%.o", 10u], "12");
+    test(#fmt["%.t", 3u], "11");
+    test(#fmt["%.c", 'A'], "A");
+    test(#fmt["%.0d", 0], "");
+    test(#fmt["%.0u", 0u], "");
+    test(#fmt["%.0x", 0u], "");
+    test(#fmt["%.0t", 0u], "");
+    test(#fmt["%.0d", 10], "10");
+    test(#fmt["%.0d", -10], "-10");
+    test(#fmt["%.0u", 10u], "10");
+    test(#fmt["%.0s", "test"], "");
+    test(#fmt["%.0x", 127u], "7f");
+    test(#fmt["%.0o", 10u], "12");
+    test(#fmt["%.0t", 3u], "11");
+    test(#fmt["%.0c", 'A'], "A");
+    test(#fmt["%.1d", 0], "0");
+    test(#fmt["%.1u", 0u], "0");
+    test(#fmt["%.1x", 0u], "0");
+    test(#fmt["%.1t", 0u], "0");
+    test(#fmt["%.1d", 10], "10");
+    test(#fmt["%.1d", -10], "-10");
+    test(#fmt["%.1u", 10u], "10");
+    test(#fmt["%.1s", "test"], "t");
+    test(#fmt["%.1x", 127u], "7f");
+    test(#fmt["%.1o", 10u], "12");
+    test(#fmt["%.1t", 3u], "11");
+    test(#fmt["%.1c", 'A'], "A");
 }
 fn part4() {
-    test(#fmt("%.5d", 0), "00000");
-    test(#fmt("%.5u", 0u), "00000");
-    test(#fmt("%.5x", 0u), "00000");
-    test(#fmt("%.5t", 0u), "00000");
-    test(#fmt("%.5d", 10), "00010");
-    test(#fmt("%.5d", -10), "-00010");
-    test(#fmt("%.5u", 10u), "00010");
-    test(#fmt("%.5s", "test"), "test");
-    test(#fmt("%.5x", 127u), "0007f");
-    test(#fmt("%.5o", 10u), "00012");
-    test(#fmt("%.5t", 3u), "00011");
-    test(#fmt("%.5c", 'A'), "A");
+    test(#fmt["%.5d", 0], "00000");
+    test(#fmt["%.5u", 0u], "00000");
+    test(#fmt["%.5x", 0u], "00000");
+    test(#fmt["%.5t", 0u], "00000");
+    test(#fmt["%.5d", 10], "00010");
+    test(#fmt["%.5d", -10], "-00010");
+    test(#fmt["%.5u", 10u], "00010");
+    test(#fmt["%.5s", "test"], "test");
+    test(#fmt["%.5x", 127u], "0007f");
+    test(#fmt["%.5o", 10u], "00012");
+    test(#fmt["%.5t", 3u], "00011");
+    test(#fmt["%.5c", 'A'], "A");
     // Bool precision. I'm not sure if it's good or bad to have bool
     // conversions support precision - it's not standard printf so we
     // can do whatever. For now I'm making it behave the same as string
     // conversions.
 
-    test(#fmt("%.b", true), "");
-    test(#fmt("%.0b", true), "");
-    test(#fmt("%.1b", true), "t");
+    test(#fmt["%.b", true], "");
+    test(#fmt["%.0b", true], "");
+    test(#fmt["%.1b", true], "t");
 }
 
 fn part5() {
     // Explicit + sign. Only for signed conversions
 
-    test(#fmt("%+d", 0), "+0");
-    test(#fmt("%+d", 1), "+1");
-    test(#fmt("%+d", -1), "-1");
+    test(#fmt["%+d", 0], "+0");
+    test(#fmt["%+d", 1], "+1");
+    test(#fmt["%+d", -1], "-1");
     // Leave space for sign
 
-    test(#fmt("% d", 0), " 0");
-    test(#fmt("% d", 1), " 1");
-    test(#fmt("% d", -1), "-1");
+    test(#fmt["% d", 0], " 0");
+    test(#fmt["% d", 1], " 1");
+    test(#fmt["% d", -1], "-1");
     // Plus overrides space
 
-    test(#fmt("% +d", 0), "+0");
-    test(#fmt("%+ d", 0), "+0");
+    test(#fmt["% +d", 0], "+0");
+    test(#fmt["%+ d", 0], "+0");
     // 0-padding
 
-    test(#fmt("%05d", 0), "00000");
-    test(#fmt("%05d", 1), "00001");
-    test(#fmt("%05d", -1), "-0001");
-    test(#fmt("%05u", 1u), "00001");
-    test(#fmt("%05x", 127u), "0007f");
-    test(#fmt("%05X", 127u), "0007F");
-    test(#fmt("%05o", 10u), "00012");
-    test(#fmt("%05t", 3u), "00011");
+    test(#fmt["%05d", 0], "00000");
+    test(#fmt["%05d", 1], "00001");
+    test(#fmt["%05d", -1], "-0001");
+    test(#fmt["%05u", 1u], "00001");
+    test(#fmt["%05x", 127u], "0007f");
+    test(#fmt["%05X", 127u], "0007F");
+    test(#fmt["%05o", 10u], "00012");
+    test(#fmt["%05t", 3u], "00011");
     // 0-padding a string is undefined but glibc does this:
 
-    test(#fmt("%05s", "test"), " test");
-    test(#fmt("%05c", 'A'), "    A");
-    test(#fmt("%05b", true), " true");
+    test(#fmt["%05s", "test"], " test");
+    test(#fmt["%05c", 'A'], "    A");
+    test(#fmt["%05b", true], " true");
     // Left-justify overrides 0-padding
 
-    test(#fmt("%-05d", 0), "0    ");
-    test(#fmt("%-05d", 1), "1    ");
-    test(#fmt("%-05d", -1), "-1   ");
-    test(#fmt("%-05u", 1u), "1    ");
-    test(#fmt("%-05x", 127u), "7f   ");
-    test(#fmt("%-05X", 127u), "7F   ");
-    test(#fmt("%-05o", 10u), "12   ");
-    test(#fmt("%-05t", 3u), "11   ");
-    test(#fmt("%-05s", "test"), "test ");
-    test(#fmt("%-05c", 'A'), "A    ");
-    test(#fmt("%-05b", true), "true ");
+    test(#fmt["%-05d", 0], "0    ");
+    test(#fmt["%-05d", 1], "1    ");
+    test(#fmt["%-05d", -1], "-1   ");
+    test(#fmt["%-05u", 1u], "1    ");
+    test(#fmt["%-05x", 127u], "7f   ");
+    test(#fmt["%-05X", 127u], "7F   ");
+    test(#fmt["%-05o", 10u], "12   ");
+    test(#fmt["%-05t", 3u], "11   ");
+    test(#fmt["%-05s", "test"], "test ");
+    test(#fmt["%-05c", 'A'], "A    ");
+    test(#fmt["%-05b", true], "true ");
 }
 fn part6() {
     // Precision overrides 0-padding
 
-    test(#fmt("%06.5d", 0), " 00000");
-    test(#fmt("%06.5u", 0u), " 00000");
-    test(#fmt("%06.5x", 0u), " 00000");
-    test(#fmt("%06.5d", 10), " 00010");
-    test(#fmt("%06.5d", -10), "-00010");
-    test(#fmt("%06.5u", 10u), " 00010");
-    test(#fmt("%06.5s", "test"), "  test");
-    test(#fmt("%06.5c", 'A'), "     A");
-    test(#fmt("%06.5x", 127u), " 0007f");
-    test(#fmt("%06.5X", 127u), " 0007F");
-    test(#fmt("%06.5o", 10u), " 00012");
+    test(#fmt["%06.5d", 0], " 00000");
+    test(#fmt["%06.5u", 0u], " 00000");
+    test(#fmt["%06.5x", 0u], " 00000");
+    test(#fmt["%06.5d", 10], " 00010");
+    test(#fmt["%06.5d", -10], "-00010");
+    test(#fmt["%06.5u", 10u], " 00010");
+    test(#fmt["%06.5s", "test"], "  test");
+    test(#fmt["%06.5c", 'A'], "     A");
+    test(#fmt["%06.5x", 127u], " 0007f");
+    test(#fmt["%06.5X", 127u], " 0007F");
+    test(#fmt["%06.5o", 10u], " 00012");
     // Signed combinations
 
-    test(#fmt("% 5d", 1), "    1");
-    test(#fmt("% 5d", -1), "   -1");
-    test(#fmt("%+5d", 1), "   +1");
-    test(#fmt("%+5d", -1), "   -1");
-    test(#fmt("% 05d", 1), " 0001");
-    test(#fmt("% 05d", -1), "-0001");
-    test(#fmt("%+05d", 1), "+0001");
-    test(#fmt("%+05d", -1), "-0001");
-    test(#fmt("%- 5d", 1), " 1   ");
-    test(#fmt("%- 5d", -1), "-1   ");
-    test(#fmt("%-+5d", 1), "+1   ");
-    test(#fmt("%-+5d", -1), "-1   ");
-    test(#fmt("%- 05d", 1), " 1   ");
-    test(#fmt("%- 05d", -1), "-1   ");
-    test(#fmt("%-+05d", 1), "+1   ");
-    test(#fmt("%-+05d", -1), "-1   ");
-}
\ No newline at end of file
+    test(#fmt["% 5d", 1], "    1");
+    test(#fmt["% 5d", -1], "   -1");
+    test(#fmt["%+5d", 1], "   +1");
+    test(#fmt["%+5d", -1], "   -1");
+    test(#fmt["% 05d", 1], " 0001");
+    test(#fmt["% 05d", -1], "-0001");
+    test(#fmt["%+05d", 1], "+0001");
+    test(#fmt["%+05d", -1], "-0001");
+    test(#fmt["%- 5d", 1], " 1   ");
+    test(#fmt["%- 5d", -1], "-1   ");
+    test(#fmt["%-+5d", 1], "+1   ");
+    test(#fmt["%-+5d", -1], "-1   ");
+    test(#fmt["%- 05d", 1], " 1   ");
+    test(#fmt["%- 05d", -1], "-1   ");
+    test(#fmt["%-+05d", 1], "+1   ");
+    test(#fmt["%-+05d", -1], "-1   ");
+}
diff --git a/src/test/run-pass/syntax-extension-minor.rs b/src/test/run-pass/syntax-extension-minor.rs
index f5f7f5564f6..50939997523 100644
--- a/src/test/run-pass/syntax-extension-minor.rs
+++ b/src/test/run-pass/syntax-extension-minor.rs
@@ -1,8 +1,8 @@
 
 fn main() {
     let asdf_fdsa = "<.<";
-    assert(#concat_idents[asd,f_f,dsa] == "<.<");
+    assert (#concat_idents[asd, f_f, dsa] == "<.<");
 
-    assert(#ident_to_str[use_mention_distinction]
-           == "use_mention_distinction");
+    assert (#ident_to_str[use_mention_distinction] ==
+                "use_mention_distinction");
 }
diff --git a/src/test/run-pass/tag.rs b/src/test/run-pass/tag.rs
index 1ea470252f9..534ab1dc395 100644
--- a/src/test/run-pass/tag.rs
+++ b/src/test/run-pass/tag.rs
@@ -12,4 +12,4 @@ fn f() {
 
 }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/tail-call-arg-leak.rs b/src/test/run-pass/tail-call-arg-leak.rs
index f771e9efc9b..b208d32009d 100644
--- a/src/test/run-pass/tail-call-arg-leak.rs
+++ b/src/test/run-pass/tail-call-arg-leak.rs
@@ -4,4 +4,4 @@
 // use of tail calls causes arg slot leaks, issue #160.
 fn inner(dummy: str, b: bool) { if b { be inner(dummy, false); } }
 
-fn main() { inner("hi", true); }
\ No newline at end of file
+fn main() { inner("hi", true); }
diff --git a/src/test/run-pass/tail-cps.rs b/src/test/run-pass/tail-cps.rs
index 81efa8f5502..a8a4436a2be 100644
--- a/src/test/run-pass/tail-cps.rs
+++ b/src/test/run-pass/tail-cps.rs
@@ -6,14 +6,14 @@ fn checktrue(rs: bool) -> bool { assert (rs); ret true; }
 
 fn main() { let k = checktrue; evenk(42, k); oddk(45, k); }
 
-fn evenk(n: int, k: fn(bool) -> bool ) -> bool {
+fn evenk(n: int, k: fn(bool) -> bool) -> bool {
     log "evenk";
     log n;
     if n == 0 { be k(true); } else { be oddk(n - 1, k); }
 }
 
-fn oddk(n: int, k: fn(bool) -> bool ) -> bool {
+fn oddk(n: int, k: fn(bool) -> bool) -> bool {
     log "oddk";
     log n;
     if n == 0 { be k(false); } else { be evenk(n - 1, k); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/tail-direct.rs b/src/test/run-pass/tail-direct.rs
index f0b50b07ce1..0bd771e7369 100644
--- a/src/test/run-pass/tail-direct.rs
+++ b/src/test/run-pass/tail-direct.rs
@@ -6,4 +6,4 @@ fn main() { assert (even(42)); assert (odd(45)); }
 
 fn even(n: int) -> bool { if n == 0 { ret true; } else { be odd(n - 1); } }
 
-fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } }
\ No newline at end of file
+fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } }
diff --git a/src/test/run-pass/task-comm-11.rs b/src/test/run-pass/task-comm-11.rs
index ab994c7f378..35b30cda1a2 100644
--- a/src/test/run-pass/task-comm-11.rs
+++ b/src/test/run-pass/task-comm-11.rs
@@ -4,7 +4,7 @@ import std::comm;
 import std::task;
 
 fn start(c: comm::_chan<comm::_chan<int>>) {
-    let p : comm::_port<int> = comm::mk_port();
+    let p: comm::_port<int> = comm::mk_port();
     comm::send(c, p.mk_chan());
 }
 
diff --git a/src/test/run-pass/task-comm-13.rs b/src/test/run-pass/task-comm-13.rs
index 2ae80750f45..7fb31f2d666 100644
--- a/src/test/run-pass/task-comm-13.rs
+++ b/src/test/run-pass/task-comm-13.rs
@@ -10,7 +10,7 @@ fn start(c: comm::_chan<int>, start: int, number_of_messages: int) {
 
 fn main() {
     log "Check that we don't deadlock.";
-    let p : comm::_port<int> = comm::mk_port();
+    let p: comm::_port<int> = comm::mk_port();
     let a = task::_spawn(bind start(p.mk_chan(), 0, 10));
     task::join_id(a);
     log "Joined task";
diff --git a/src/test/run-pass/task-comm-15.rs b/src/test/run-pass/task-comm-15.rs
index 84f3abe9b86..4ea320add2c 100644
--- a/src/test/run-pass/task-comm-15.rs
+++ b/src/test/run-pass/task-comm-15.rs
@@ -2,7 +2,7 @@ use std;
 import std::comm;
 import std::task;
 
-fn start(c : comm::chan<int>, n: int) {
+fn start(c: comm::chan<int>, n: int) {
     let i: int = n;
 
     while i > 0 { comm::send(c, 0); i = i - 1; }
diff --git a/src/test/run-pass/task-comm-16.rs b/src/test/run-pass/task-comm-16.rs
index 9b43986e2ed..6ac2df9d94a 100644
--- a/src/test/run-pass/task-comm-16.rs
+++ b/src/test/run-pass/task-comm-16.rs
@@ -23,29 +23,29 @@ fn test_rec() {
 fn test_vec() {
     let po = comm::mk_port();
     let ch = po.mk_chan();
-    let v0: [int] = ~[0, 1, 2];
+    let v0: [int] = [0, 1, 2];
     send(ch, v0);
     let v1: [int];
     v1 = po.recv();
-    assert (v1.(0) == 0);
-    assert (v1.(1) == 1);
-    assert (v1.(2) == 2);
+    assert (v1[0] == 0);
+    assert (v1[1] == 1);
+    assert (v1[2] == 2);
 }
 
 fn test_str() {
     // FIXME: re-enable this once strings are unique and sendable
-/*
-    let po = comm::mk_port();
-    let ch = po.mk_chan();
-    let s0: str = "test";
-    send(ch, s0);
-    let s1: str;
-    s1 = po.recv();
-    assert (s1.(0) as u8 == 't' as u8);
-    assert (s1.(1) as u8 == 'e' as u8);
-    assert (s1.(2) as u8 == 's' as u8);
-    assert (s1.(3) as u8 == 't' as u8);
-*/
+    /*
+        let po = comm::mk_port();
+        let ch = po.mk_chan();
+        let s0: str = "test";
+        send(ch, s0);
+        let s1: str;
+        s1 = po.recv();
+        assert (s1.(0) as u8 == 't' as u8);
+        assert (s1.(1) as u8 == 'e' as u8);
+        assert (s1.(2) as u8 == 's' as u8);
+        assert (s1.(3) as u8 == 't' as u8);
+    */
 }
 
 fn test_tag() {
@@ -80,10 +80,4 @@ fn test_chan() {
     assert (i == 10);
 }
 
-fn main() {
-    test_rec();
-    test_vec();
-    test_str();
-    test_tag();
-    test_chan();
-}
+fn main() { test_rec(); test_vec(); test_str(); test_tag(); test_chan(); }
diff --git a/src/test/run-pass/task-comm-3.rs b/src/test/run-pass/task-comm-3.rs
index ac3430aec3f..f8522282800 100644
--- a/src/test/run-pass/task-comm-3.rs
+++ b/src/test/run-pass/task-comm-3.rs
@@ -14,7 +14,7 @@ fn test00_start(ch: _chan<int>, message: int, count: int) {
     let i: int = 0;
     while i < count {
         log "Sending Message";
-        send(ch, message+0);
+        send(ch, message + 0);
         i = i + 1;
     }
     log "Ending test00_start";
@@ -34,8 +34,7 @@ fn test00() {
     // Create and spawn tasks...
     let tasks = [];
     while i < number_of_tasks {
-        tasks +=
-            [task::_spawn(bind test00_start(ch, i, number_of_messages))];
+        tasks += [task::_spawn(bind test00_start(ch, i, number_of_messages))];
         i = i + 1;
     }
 
diff --git a/src/test/run-pass/task-comm-4.rs b/src/test/run-pass/task-comm-4.rs
index 30342d877f0..b54020cbe0f 100644
--- a/src/test/run-pass/task-comm-4.rs
+++ b/src/test/run-pass/task-comm-4.rs
@@ -42,4 +42,4 @@ fn test00() {
     sum += r;
     log r;
     assert (sum == 1 + 2 + 3 + 4 + 5 + 6 + 7 + 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-5.rs b/src/test/run-pass/task-comm-5.rs
index bb3a1e4dc70..dd07023b2e9 100644
--- a/src/test/run-pass/task-comm-5.rs
+++ b/src/test/run-pass/task-comm-5.rs
@@ -10,8 +10,8 @@ fn test00() {
     let c = p.mk_chan();
     let number_of_messages: int = 1000;
     let i: int = 0;
-    while i < number_of_messages { comm::send(c, i+0); i += 1; }
+    while i < number_of_messages { comm::send(c, i + 0); i += 1; }
     i = 0;
     while i < number_of_messages { r = p.recv(); sum += r; i += 1; }
     assert (sum == number_of_messages * (number_of_messages - 1) / 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-6.rs b/src/test/run-pass/task-comm-6.rs
index 41dc6d203ad..036f96981ff 100644
--- a/src/test/run-pass/task-comm-6.rs
+++ b/src/test/run-pass/task-comm-6.rs
@@ -15,10 +15,10 @@ fn test00() {
     let number_of_messages: int = 1000;
     let i: int = 0;
     while i < number_of_messages {
-        send(c0, i+0);
-        send(c1, i+0);
-        send(c2, i+0);
-        send(c3, i+0);
+        send(c0, i + 0);
+        send(c1, i + 0);
+        send(c2, i + 0);
+        send(c3, i + 0);
         i += 1;
     }
     i = 0;
@@ -37,4 +37,4 @@ fn test00() {
     // assert (sum == 4 * ((number_of_messages *
     //                   (number_of_messages - 1)) / 2));
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-8.rs b/src/test/run-pass/task-comm-8.rs
index 649e23f9806..0acff8cc022 100644
--- a/src/test/run-pass/task-comm-8.rs
+++ b/src/test/run-pass/task-comm-8.rs
@@ -4,7 +4,7 @@ import std::comm;
 
 fn main() { test00(); }
 
-fn test00_start(c : comm::_chan<int>, start: int, number_of_messages: int) {
+fn test00_start(c: comm::_chan<int>, start: int, number_of_messages: int) {
     let i: int = 0;
     while i < number_of_messages { comm::send(c, start + i); i += 1; }
 }
diff --git a/src/test/run-pass/task-comm-9.rs b/src/test/run-pass/task-comm-9.rs
index a197ebdf507..46dd1d89e51 100644
--- a/src/test/run-pass/task-comm-9.rs
+++ b/src/test/run-pass/task-comm-9.rs
@@ -6,7 +6,7 @@ fn main() { test00(); }
 
 fn test00_start(c: comm::_chan<int>, number_of_messages: int) {
     let i: int = 0;
-    while i < number_of_messages { comm::send(c, i+0); i += 1; }
+    while i < number_of_messages { comm::send(c, i + 0); i += 1; }
 }
 
 fn test00() {
@@ -15,8 +15,7 @@ fn test00() {
     let p = comm::mk_port();
     let number_of_messages: int = 10;
 
-    let t0 = task::_spawn(bind test00_start(p.mk_chan(),
-                                            number_of_messages));
+    let t0 = task::_spawn(bind test00_start(p.mk_chan(), number_of_messages));
 
     let i: int = 0;
     while i < number_of_messages { r = p.recv(); sum += r; log r; i += 1; }
diff --git a/src/test/run-pass/task-comm.rs b/src/test/run-pass/task-comm.rs
index c468d1c89d6..f5a6a111608 100644
--- a/src/test/run-pass/task-comm.rs
+++ b/src/test/run-pass/task-comm.rs
@@ -20,7 +20,11 @@ fn main() {
 fn test00_start(ch: _chan<int>, message: int, count: int) {
     log "Starting test00_start";
     let i: int = 0;
-    while i < count { log "Sending Message"; send(ch, message+0); i = i + 1; }
+    while i < count {
+        log "Sending Message";
+        send(ch, message + 0);
+        i = i + 1;
+    }
     log "Ending test00_start";
 }
 
@@ -39,22 +43,19 @@ fn test00() {
         i = i + 1;
         tasks += [task::spawn(bind test00_start(ch, i, number_of_messages))];
     }
-
     let sum: int = 0;
     for t: task_id in tasks {
         i = 0;
-        while i < number_of_messages {
-            sum += po.recv();
-            i = i + 1;
-        }
+        while i < number_of_messages { sum += po.recv(); i = i + 1; }
     }
 
     for t: task_id in tasks { task::join_id(t); }
 
     log "Completed: Final number is: ";
     assert (sum ==
-            number_of_messages *
-            (number_of_tasks * number_of_tasks + number_of_tasks) / 2);
+                number_of_messages *
+                    (number_of_tasks * number_of_tasks + number_of_tasks) /
+                    2);
 }
 
 fn test01() {
@@ -96,11 +97,7 @@ fn test04_start() {
 fn test04() {
     log "Spawning lots of tasks.";
     let i: int = 4;
-    while i > 0 {
-        i = i - 1;
-        let f = test04_start;
-        task::spawn(f);
-    }
+    while i > 0 { i = i - 1; let f = test04_start; task::spawn(f); }
     log "Finishing up.";
 }
 
@@ -138,7 +135,9 @@ fn test06() {
 
     let tasks = [];
     while i < number_of_tasks {
-        i = i + 1; tasks += [task::spawn(bind test06_start(i))]; }
+        i = i + 1;
+        tasks += [task::spawn(bind test06_start(i))];
+    }
 
 
     for t: task_id in tasks { task::join_id(t); }
diff --git a/src/test/run-pass/task-pin.rs b/src/test/run-pass/task-pin.rs
index a6592b885eb..407914dba2d 100644
--- a/src/test/run-pass/task-pin.rs
+++ b/src/test/run-pass/task-pin.rs
@@ -7,4 +7,4 @@ use std;
 
 import std::task;
 
-fn main() { task::pin(); task::unpin(); }
\ No newline at end of file
+fn main() { task::pin(); task::unpin(); }
diff --git a/src/test/run-pass/ternary.rs b/src/test/run-pass/ternary.rs
index 9c2aaf4ac4e..6adfada2c90 100644
--- a/src/test/run-pass/ternary.rs
+++ b/src/test/run-pass/ternary.rs
@@ -40,4 +40,4 @@ fn main() {
     test_associativity();
     test_lval();
     test_as_stmt();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/test-runner-hides-main.rs b/src/test/run-pass/test-runner-hides-main.rs
index 2edf36d1762..997664aa9c0 100644
--- a/src/test/run-pass/test-runner-hides-main.rs
+++ b/src/test/run-pass/test-runner-hides-main.rs
@@ -5,4 +5,4 @@ use std;
 
 // Building as a test runner means that a synthetic main will be run,
 // not ours
-fn main() { fail; }
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/run-pass/threads.rs b/src/test/run-pass/threads.rs
index 47982d12b90..aa999eb420d 100644
--- a/src/test/run-pass/threads.rs
+++ b/src/test/run-pass/threads.rs
@@ -4,15 +4,10 @@ use std;
 import std::task;
 
 fn main() {
-  let i = 10;
-  while (i > 0) {
-    task::_spawn(bind child(i));
-    i = i - 1;
-  }
-  log "main thread exiting";
+    let i = 10;
+    while i > 0 { task::_spawn(bind child(i)); i = i - 1; }
+    log "main thread exiting";
 }
 
-fn child(x : int) {
-  log x;
-}
+fn child(x: int) { log x; }
 
diff --git a/src/test/run-pass/tup.rs b/src/test/run-pass/tup.rs
index ab34e75a460..b12099b414a 100644
--- a/src/test/run-pass/tup.rs
+++ b/src/test/run-pass/tup.rs
@@ -15,4 +15,4 @@ fn main() {
     let p2: point = p;
     f(p, 10, 20);
     f(p2, 10, 20);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/type-in-nested-module.rs b/src/test/run-pass/type-in-nested-module.rs
index 2c91b35099e..059f22ba15c 100644
--- a/src/test/run-pass/type-in-nested-module.rs
+++ b/src/test/run-pass/type-in-nested-module.rs
@@ -8,4 +8,4 @@ mod a {
     }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/type-namespace.rs b/src/test/run-pass/type-namespace.rs
index f173ec0a69d..03c8ce0972a 100644
--- a/src/test/run-pass/type-namespace.rs
+++ b/src/test/run-pass/type-namespace.rs
@@ -2,4 +2,4 @@ type a = {a: int};
 
 fn a(a: a) -> int { ret a.a; }
 
-fn main() { let x: a = {a: 1}; assert (a(x) == 1); }
\ No newline at end of file
+fn main() { let x: a = {a: 1}; assert (a(x) == 1); }
diff --git a/src/test/run-pass/type-param-constraints.rs b/src/test/run-pass/type-param-constraints.rs
index e1c80d31fb7..a5ea4c223d4 100644
--- a/src/test/run-pass/type-param-constraints.rs
+++ b/src/test/run-pass/type-param-constraints.rs
@@ -1,6 +1,6 @@
-fn p_foo<T>(pinned: &T) {  }
-fn s_foo<@T>(shared: &T) {  }
-fn u_foo<~T>(unique: &T) {  }
+fn p_foo<T>(pinned: &T) { }
+fn s_foo<@T>(shared: &T) { }
+fn u_foo<~T>(unique: &T) { }
 
 resource r(i: int) { }
 
diff --git a/src/test/run-pass/type-param.rs b/src/test/run-pass/type-param.rs
index 36ef46420a9..be55ba86cac 100644
--- a/src/test/run-pass/type-param.rs
+++ b/src/test/run-pass/type-param.rs
@@ -1,5 +1,5 @@
 
 
-type lteq<T> = fn(&T) -> bool ;
+type lteq<T> = fn(&T) -> bool;
 
 fn main(args: [str]) { }
diff --git a/src/test/run-pass/type-params-in-for-each.rs b/src/test/run-pass/type-params-in-for-each.rs
index b8e2f5fc8a8..760e5dadfa1 100644
--- a/src/test/run-pass/type-params-in-for-each.rs
+++ b/src/test/run-pass/type-params-in-for-each.rs
@@ -5,8 +5,8 @@ iter range(lo: uint, hi: uint) -> uint {
     while lo_ < hi { put lo_; lo_ += 1u; }
 }
 
-fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint ) {
-    for each i: uint in range(0u, 256u) { let bucket: [T] = ~[]; }
+fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint) {
+    for each i: uint in range(0u, 256u) { let bucket: [T] = []; }
 }
 
 fn main() { }
diff --git a/src/test/run-pass/typestate-cfg-nesting.rs b/src/test/run-pass/typestate-cfg-nesting.rs
index 52702922764..ccde41545d9 100644
--- a/src/test/run-pass/typestate-cfg-nesting.rs
+++ b/src/test/run-pass/typestate-cfg-nesting.rs
@@ -6,4 +6,4 @@ fn main() {
     let x = 10;
     let y = 11;
     if true { while false { y = x; } } else { }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/typestate-multi-decl.rs b/src/test/run-pass/typestate-multi-decl.rs
index b0da5a7b226..18698226379 100644
--- a/src/test/run-pass/typestate-multi-decl.rs
+++ b/src/test/run-pass/typestate-multi-decl.rs
@@ -1,5 +1 @@
-fn main() {
- let x = 10, y = 20;
- let z = x + y;
- assert (z == 30);
-}
+fn main() { let x = 10, y = 20; let z = x + y; assert (z == 30); }
diff --git a/src/test/run-pass/typestate-transitive.rs b/src/test/run-pass/typestate-transitive.rs
index f2eda37e0d0..021dd7554b7 100644
--- a/src/test/run-pass/typestate-transitive.rs
+++ b/src/test/run-pass/typestate-transitive.rs
@@ -4,4 +4,4 @@ fn f(i: int) : p(i) -> int { i }
 
 fn g(i: int) : p(i) -> int { f(i) }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/u32-decr.rs b/src/test/run-pass/u32-decr.rs
index ba7af14dbce..d258effa663 100644
--- a/src/test/run-pass/u32-decr.rs
+++ b/src/test/run-pass/u32-decr.rs
@@ -6,4 +6,4 @@ fn main() {
     let word: u32 = 200000u32;
     word = word - 1u32;
     assert (word == 199999u32);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/u8-incr-decr.rs b/src/test/run-pass/u8-incr-decr.rs
index 8562a87c1a0..91bf0f9945e 100644
--- a/src/test/run-pass/u8-incr-decr.rs
+++ b/src/test/run-pass/u8-incr-decr.rs
@@ -15,4 +15,4 @@ fn main() {
     y = y - 9u8; // 0x9
 
     assert (x == y);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/u8-incr.rs b/src/test/run-pass/u8-incr.rs
index c1f0ee37c13..66304d33072 100644
--- a/src/test/run-pass/u8-incr.rs
+++ b/src/test/run-pass/u8-incr.rs
@@ -11,4 +11,4 @@ fn main() {
     // x = 14u8;
     // x = x + 1u8;
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/uint.rs b/src/test/run-pass/uint.rs
index 8e5795e0b6d..2083979b0ac 100644
--- a/src/test/run-pass/uint.rs
+++ b/src/test/run-pass/uint.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: uint = 10 as uint; }
\ No newline at end of file
+fn main() { let x: uint = 10 as uint; }
diff --git a/src/test/run-pass/unify-return-ty.rs b/src/test/run-pass/unify-return-ty.rs
index 0538618ff88..5bfdeb33847 100644
--- a/src/test/run-pass/unify-return-ty.rs
+++ b/src/test/run-pass/unify-return-ty.rs
@@ -6,6 +6,4 @@ import std::unsafe;
 
 fn null<T>() -> *T { unsafe::reinterpret_cast(0) }
 
-fn main() {
-    null::<int>();
-}
+fn main() { null::<int>(); }
diff --git a/src/test/run-pass/unit.rs b/src/test/run-pass/unit.rs
index 6b944d59c5d..815c760dfaa 100644
--- a/src/test/run-pass/unit.rs
+++ b/src/test/run-pass/unit.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f(u: ()) { ret u; }
 
-fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); }
\ No newline at end of file
+fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); }
diff --git a/src/test/run-pass/use-import-export.rs b/src/test/run-pass/use-import-export.rs
index 56b99e2c95f..99b87578d8d 100644
--- a/src/test/run-pass/use-import-export.rs
+++ b/src/test/run-pass/use-import-export.rs
@@ -8,4 +8,4 @@ mod bar {
     fn y() -> int { ret 1; }
 }
 
-fn main() { foo::x(); bar::y(); }
\ No newline at end of file
+fn main() { foo::x(); bar::y(); }
diff --git a/src/test/run-pass/utf8.rs b/src/test/run-pass/utf8.rs
index e7dc2780612..c27d7a23c0a 100644
--- a/src/test/run-pass/utf8.rs
+++ b/src/test/run-pass/utf8.rs
@@ -34,7 +34,7 @@ fn main() {
         for ab: u8 in a {
             log i;
             log ab;
-            let bb: u8 = b.(i);
+            let bb: u8 = b[i];
             log bb;
             assert (ab == bb);
             i += 1;
diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs
index c94cef4bba3..e7f7f9a1524 100644
--- a/src/test/run-pass/utf8_chars.rs
+++ b/src/test/run-pass/utf8_chars.rs
@@ -4,7 +4,7 @@ import std::vec;
 
 fn main() {
     // Chars of 1, 2, 3, and 4 bytes
-    let chs: [char] = ~['e', 'é', '€', 0x10000 as char];
+    let chs: [char] = ['e', 'é', '€', 0x10000 as char];
     let s: str = str::from_chars(chs);
 
     assert (str::byte_len(s) == 10u);
@@ -15,9 +15,9 @@ fn main() {
     assert (str::char_at(s, 1u) == 'é');
 
     assert (str::is_utf8(str::bytes(s)));
-    assert (!str::is_utf8(~[0x80_u8]));
-    assert (!str::is_utf8(~[0xc0_u8]));
-    assert (!str::is_utf8(~[0xc0_u8, 0x10_u8]));
+    assert (!str::is_utf8([0x80_u8]));
+    assert (!str::is_utf8([0xc0_u8]));
+    assert (!str::is_utf8([0xc0_u8, 0x10_u8]));
 
     let stack = "a×c€";
     assert (str::pop_char(stack) == '€');
diff --git a/src/test/run-pass/vec-append.rs b/src/test/run-pass/vec-append.rs
index 68076d41287..c045aa1e49f 100644
--- a/src/test/run-pass/vec-append.rs
+++ b/src/test/run-pass/vec-append.rs
@@ -10,26 +10,26 @@ import std::vec;
 const const_refcount: uint = 0x7bad_face_u;
 
 fn fast_growth() {
-    let v: [int] = ~[1, 2, 3, 4, 5];
-    v += ~[6, 7, 8, 9, 0];
-    log v.(9);
-    assert (v.(0) == 1);
-    assert (v.(7) == 8);
-    assert (v.(9) == 0);
+    let v: [int] = [1, 2, 3, 4, 5];
+    v += [6, 7, 8, 9, 0];
+    log v[9];
+    assert (v[0] == 1);
+    assert (v[7] == 8);
+    assert (v[9] == 0);
 }
 
 fn slow_growth() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     let u: [int] = v;
-    v += ~[17];
-    log v.(0);
-    assert (v.(0) == 17);
+    v += [17];
+    log v[0];
+    assert (v[0] == 17);
 }
 
 fn slow_growth2_helper(s: str) { // ref up: s
 
     obj acc(mutable v: [str]) {
-        fn add(s: &str) { v += ~[s]; }
+        fn add(s: &str) { v += [s]; }
     }
     let ss: str = s; // ref up: s
 
@@ -46,7 +46,7 @@ fn slow_growth2_helper(s: str) { // ref up: s
          * mumble, the existing str in the originally- shared vec.
          */
 
-        let v: [str] = ~[mumble]; // ref up: mumble
+        let v: [str] = [mumble]; // ref up: mumble
 
         let a: acc = acc(v);
 
@@ -56,9 +56,9 @@ fn slow_growth2_helper(s: str) { // ref up: s
         log str::refcount(mumble);
         assert (str::refcount(s) == const_refcount);
         assert (str::refcount(mumble) == const_refcount);
-        log v.(0);
+        log v[0];
         log vec::len::<str>(v);
-        assert (str::eq(v.(0), mumble));
+        assert (str::eq(v[0], mumble));
         assert (vec::len::<str>(v) == 1u);
     } // ref down: mumble, s,
 
diff --git a/src/test/run-pass/vec-concat.rs b/src/test/run-pass/vec-concat.rs
index 2804f8c0f10..e107d861a2a 100644
--- a/src/test/run-pass/vec-concat.rs
+++ b/src/test/run-pass/vec-concat.rs
@@ -3,11 +3,11 @@
 
 // -*- rust -*-
 fn main() {
-    let a: [int] = ~[1, 2, 3, 4, 5];
-    let b: [int] = ~[6, 7, 8, 9, 0];
+    let a: [int] = [1, 2, 3, 4, 5];
+    let b: [int] = [6, 7, 8, 9, 0];
     let v: [int] = a + b;
-    log v.(9);
-    assert (v.(0) == 1);
-    assert (v.(7) == 8);
-    assert (v.(9) == 0);
+    log v[9];
+    assert (v[0] == 1);
+    assert (v[7] == 8);
+    assert (v[9] == 0);
 }
diff --git a/src/test/run-pass/vec-drop.rs b/src/test/run-pass/vec-drop.rs
index dbd0bbcd82c..499b24d43f0 100644
--- a/src/test/run-pass/vec-drop.rs
+++ b/src/test/run-pass/vec-drop.rs
@@ -4,5 +4,5 @@ fn main() {
     // This just tests whether the vec leaks its members.
 
     let pvec: [@{x: int, y: int}] =
-        ~[@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}];
+        [@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}];
 }
diff --git a/src/test/run-pass/vec-growth.rs b/src/test/run-pass/vec-growth.rs
index c91d360c88b..7835b82c4d7 100644
--- a/src/test/run-pass/vec-growth.rs
+++ b/src/test/run-pass/vec-growth.rs
@@ -1,14 +1,14 @@
 
 
 fn main() {
-    let v = ~[1];
-    v += ~[2];
-    v += ~[3];
-    v += ~[4];
-    v += ~[5];
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
-    assert (v.(4) == 5);
-}
\ No newline at end of file
+    let v = [1];
+    v += [2];
+    v += [3];
+    v += [4];
+    v += [5];
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
+    assert (v[4] == 5);
+}
diff --git a/src/test/run-pass/vec-ivec-deadlock.rs b/src/test/run-pass/vec-ivec-deadlock.rs
index 2dae6e3fcb4..7c0515ce48b 100644
--- a/src/test/run-pass/vec-ivec-deadlock.rs
+++ b/src/test/run-pass/vec-ivec-deadlock.rs
@@ -1 +1 @@
-fn main() { let a = ~[1, 2, 3, 4, 5]; let b = ~[a, a]; b += b; }
\ No newline at end of file
+fn main() { let a = [1, 2, 3, 4, 5]; let b = [a, a]; b += b; }
diff --git a/src/test/run-pass/vec-late-init.rs b/src/test/run-pass/vec-late-init.rs
index c1f180ed237..6a84317747c 100644
--- a/src/test/run-pass/vec-late-init.rs
+++ b/src/test/run-pass/vec-late-init.rs
@@ -2,6 +2,6 @@
 
 fn main() {
     let later: [int];
-    if true { later = ~[1]; } else { later = ~[2]; }
-    log later.(0);
+    if true { later = [1]; } else { later = [2]; }
+    log later[0];
 }
diff --git a/src/test/run-pass/vec-push.rs b/src/test/run-pass/vec-push.rs
index 6e54bd7467e..c2f49311b1e 100644
--- a/src/test/run-pass/vec-push.rs
+++ b/src/test/run-pass/vec-push.rs
@@ -1,5 +1,5 @@
 
 
-fn push<T>(v: &mutable [mutable? T], t: &T) { v += ~[t]; }
+fn push<T>(v: &mutable [mutable? T], t: &T) { v += [t]; }
 
-fn main() { let v = ~[1, 2, 3]; push(v, 1); }
+fn main() { let v = [1, 2, 3]; push(v, 1); }
diff --git a/src/test/run-pass/vec.rs b/src/test/run-pass/vec.rs
index eef478a372e..95025f5b3cb 100644
--- a/src/test/run-pass/vec.rs
+++ b/src/test/run-pass/vec.rs
@@ -3,8 +3,8 @@
 
 // -*- rust -*-
 fn main() {
-    let v: [int] = ~[10, 20];
-    assert (v[0]== 10);
+    let v: [int] = [10, 20];
+    assert (v[0] == 10);
     assert (v[1] == 20);
     let x: int = 0;
     assert (v[x] == 10);
diff --git a/src/test/run-pass/vector-no-ann-2.rs b/src/test/run-pass/vector-no-ann-2.rs
index d2555618281..10a9cd9c6b8 100644
--- a/src/test/run-pass/vector-no-ann-2.rs
+++ b/src/test/run-pass/vector-no-ann-2.rs
@@ -1 +1 @@
-fn main() { let quux: @[uint] = @~[]; }
+fn main() { let quux: @[uint] = @[]; }
diff --git a/src/test/run-pass/while-and-do-while.rs b/src/test/run-pass/while-and-do-while.rs
index 3287791a7c0..c5b09cb8149 100644
--- a/src/test/run-pass/while-and-do-while.rs
+++ b/src/test/run-pass/while-and-do-while.rs
@@ -5,4 +5,4 @@ fn main() {
     let y: int = 0;
     while y < x { log y; log "hello"; y = y + 1; }
     do  { log "goodbye"; x = x - 1; log x; } while x > 0
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-flow-graph.rs b/src/test/run-pass/while-flow-graph.rs
index bf1840638de..2813cee0cd0 100644
--- a/src/test/run-pass/while-flow-graph.rs
+++ b/src/test/run-pass/while-flow-graph.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } }
\ No newline at end of file
+fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } }
diff --git a/src/test/run-pass/while-loop-constraints-2.rs b/src/test/run-pass/while-loop-constraints-2.rs
index e124ed58042..29ab411b31b 100644
--- a/src/test/run-pass/while-loop-constraints-2.rs
+++ b/src/test/run-pass/while-loop-constraints-2.rs
@@ -5,4 +5,4 @@ fn main() {
     let x: int;
     while z < 50 { z += 1; while false { x <- y; y = z; } log y; }
     assert (y == 42 && z == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-prelude-drop.rs b/src/test/run-pass/while-prelude-drop.rs
index badd2ae10bf..9688c436370 100644
--- a/src/test/run-pass/while-prelude-drop.rs
+++ b/src/test/run-pass/while-prelude-drop.rs
@@ -16,4 +16,4 @@ fn main() {
 
     // The auto slot for the result of make(i) should not leak.
     while make(i) != a { i += 1; }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-with-break.rs b/src/test/run-pass/while-with-break.rs
index 3dcbb96b040..f8050e3d3eb 100644
--- a/src/test/run-pass/while-with-break.rs
+++ b/src/test/run-pass/while-with-break.rs
@@ -9,7 +9,7 @@ fn main() {
         i = i + 1;
         if i == 95 {
             let v: [int] =
-                ~[1, 2, 3, 4, 5]; // we check that it is freed by break
+                [1, 2, 3, 4, 5]; // we check that it is freed by break
 
             log "breaking";
             break;
diff --git a/src/test/run-pass/wierd-exprs.rs b/src/test/run-pass/wierd-exprs.rs
index a8276c92bb6..de1613c4363 100644
--- a/src/test/run-pass/wierd-exprs.rs
+++ b/src/test/run-pass/wierd-exprs.rs
@@ -1,11 +1,9 @@
 // Just a grab bug of stuff that you wouldn't want to actualy write
 
-fn strange() -> bool {
-    let _x = ret true;
-}
+fn strange() -> bool { let _x = ret true; }
 
 fn funny() {
-    fn f(_x: ()) {}
+    fn f(_x: ()) { }
     f(ret);
 }
 
@@ -15,21 +13,16 @@ fn odd() {
 }
 
 fn what() {
-    fn the(x: @mutable bool){
-        ret while !*x { *x = true };
-    }
+    fn the(x: @mutable bool) { ret while !*x { *x = true }; }
     let i = @mutable false;
     let dont = bind the(i);
     dont();
-    assert *i;
+    assert (*i);
 }
 
 fn zombiejesus() {
-    do { while (ret) { if (ret) {
-        alt (ret) { _ {
-          ret ? ret : ret
-        }}
-    }}} while ret;
+    do  { while (ret) { if (ret) { alt (ret) { _ { ret ? ret : ret } } } } }
+        while ret
 }
 
 fn notsure() {
@@ -48,27 +41,18 @@ fn hammertime() -> int {
 
 fn canttouchthis() -> uint {
     pred p() -> bool { true }
-    let _a = (assert true) == (check p());
-    let _c = (check p()) == ();
+    let _a = (assert (true)) == (check (p()));
+    let _c = (check (p())) == ();
     let _b = (log 0) == (ret 0u);
 }
 
 fn angrydome() {
-    while true {
-        if (break) { }
-    }
+    while true { if break { } }
     let i = 0;
-    do {
-        i += 1;
-        if i == 1 {
-            alt cont { _ { } }
-        }
-    } while false;
+    do  { i += 1; if i == 1 { alt cont { _ { } } } } while false
 }
 
-fn evil_lincoln() {
-    let evil <- log "lincoln";
-}
+fn evil_lincoln() { let evil <- log "lincoln"; }
 
 fn main() {
     strange();
diff --git a/src/test/run-pass/writealias.rs b/src/test/run-pass/writealias.rs
index 0f779478533..fb7bf4c163a 100644
--- a/src/test/run-pass/writealias.rs
+++ b/src/test/run-pass/writealias.rs
@@ -10,4 +10,4 @@ fn main() {
     let x: point = {x: 10, y: 11, mutable z: 12};
     f(x);
     assert (x.z == 13);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/x86stdcall.rs b/src/test/run-pass/x86stdcall.rs
index dcc525d652f..52f9d47cd78 100644
--- a/src/test/run-pass/x86stdcall.rs
+++ b/src/test/run-pass/x86stdcall.rs
@@ -14,4 +14,4 @@ fn main() {
 
 #[cfg(target_os = "macos")]
 #[cfg(target_os = "linux")]
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/yield.rs b/src/test/run-pass/yield.rs
index 8de4b6c411f..dd8d2a046b7 100644
--- a/src/test/run-pass/yield.rs
+++ b/src/test/run-pass/yield.rs
@@ -14,4 +14,4 @@ fn main() {
     join_id(other);
 }
 
-fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; }
\ No newline at end of file
+fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; }
diff --git a/src/test/run-pass/yield1.rs b/src/test/run-pass/yield1.rs
index e53591dbe1a..9f5c326cc38 100644
--- a/src/test/run-pass/yield1.rs
+++ b/src/test/run-pass/yield1.rs
@@ -6,7 +6,8 @@ import std::task::*;
 fn main() {
     let c = child;
     let other = task::spawn(c);
-    log_err "1"; yield();
+    log_err "1";
+    yield();
     join_id(other);
 }
 
diff --git a/src/test/stdtest/bitv.rs b/src/test/stdtest/bitv.rs
index 7666063239d..249a43be13b 100644
--- a/src/test/stdtest/bitv.rs
+++ b/src/test/stdtest/bitv.rs
@@ -18,9 +18,9 @@ fn test_0_elements() {
 fn test_1_element() {
     let act;
     act = bitv::create(1u, false);
-    assert (bitv::eq_vec(act, ~[0u]));
+    assert (bitv::eq_vec(act, [0u]));
     act = bitv::create(1u, true);
-    assert (bitv::eq_vec(act, ~[1u]));
+    assert (bitv::eq_vec(act, [1u]));
 }
 
 #[test]
@@ -29,11 +29,11 @@ fn test_10_elements() {
     // all 0
 
     act = bitv::create(10u, false);
-    assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+    assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(10u, true);
-    assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
+    assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -42,7 +42,7 @@ fn test_10_elements() {
     bitv::set(act, 2u, true);
     bitv::set(act, 3u, true);
     bitv::set(act, 4u, true);
-    assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u]));
+    assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -51,7 +51,7 @@ fn test_10_elements() {
     bitv::set(act, 7u, true);
     bitv::set(act, 8u, true);
     bitv::set(act, 9u, true);
-    assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u]));
+    assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -59,7 +59,7 @@ fn test_10_elements() {
     bitv::set(act, 3u, true);
     bitv::set(act, 6u, true);
     bitv::set(act, 9u, true);
-    assert (bitv::eq_vec(act, ~[1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u]));
+    assert (bitv::eq_vec(act, [1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u]));
 }
 
 #[test]
@@ -69,16 +69,16 @@ fn test_31_elements() {
 
     act = bitv::create(31u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(31u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -91,9 +91,9 @@ fn test_31_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -106,9 +106,9 @@ fn test_31_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -120,9 +120,9 @@ fn test_31_elements() {
     bitv::set(act, 29u, true);
     bitv::set(act, 30u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -130,9 +130,9 @@ fn test_31_elements() {
     bitv::set(act, 17u, true);
     bitv::set(act, 30u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u]));
 }
 
 #[test]
@@ -142,16 +142,16 @@ fn test_32_elements() {
 
     act = bitv::create(32u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(32u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -164,9 +164,9 @@ fn test_32_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -179,9 +179,9 @@ fn test_32_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -194,9 +194,9 @@ fn test_32_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -205,9 +205,9 @@ fn test_32_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 1u]));
 }
 
 #[test]
@@ -217,16 +217,16 @@ fn test_33_elements() {
 
     act = bitv::create(33u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(33u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -239,9 +239,9 @@ fn test_33_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -254,9 +254,9 @@ fn test_33_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -269,9 +269,9 @@ fn test_33_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -281,8 +281,8 @@ fn test_33_elements() {
     bitv::set(act, 31u, true);
     bitv::set(act, 32u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 1u, 1u]));
 }
 
diff --git a/src/test/stdtest/comm.rs b/src/test/stdtest/comm.rs
index 7d20042e866..6b67acc51ea 100644
--- a/src/test/stdtest/comm.rs
+++ b/src/test/stdtest/comm.rs
@@ -15,7 +15,7 @@ fn send_recv() {
     comm::send(c, 42);
     let v = p.recv();
     log_err v;
-    assert(42 == v);
+    assert (42 == v);
 }
 
 #[test]
@@ -23,7 +23,7 @@ fn send_recv_fn() {
     let p = comm::port::<int>();
     let c = comm::chan::<int>(p);
     comm::send(c, 42);
-    assert(comm::recv(p) == 42);
+    assert (comm::recv(p) == 42);
 }
 
 #[test]
@@ -31,7 +31,7 @@ fn send_recv_fn_infer() {
     let p = comm::port();
     let c = comm::chan(p);
     comm::send(c, 42);
-    assert(comm::recv(p) == 42);
+    assert (comm::recv(p) == 42);
 }
 
 #[test]
diff --git a/src/test/stdtest/deque.rs b/src/test/stdtest/deque.rs
index d751bd5c45d..acdde57b86e 100644
--- a/src/test/stdtest/deque.rs
+++ b/src/test/stdtest/deque.rs
@@ -79,7 +79,7 @@ fn test_boxes(a: @int, b: @int, c: @int, d: @int) {
     assert (deq.get(3) == d);
 }
 
-type eqfn<T> = fn(&T, &T) -> bool ;
+type eqfn<T> = fn(&T, &T) -> bool;
 
 fn test_parameterized<@T>(e: eqfn<T>, a: &T, b: &T, c: &T, d: &T) {
     let deq: deque::t<T> = deque::create::<T>();
@@ -175,15 +175,14 @@ fn test() {
     log "test parameterized: taggy";
     let eq3: eqfn<taggy> = taggyeq;
     test_parameterized::<taggy>(eq3, one(1), two(1, 2), three(1, 2, 3),
-                              two(17, 42));
+                                two(17, 42));
 
     log "*** test parameterized: taggypar<int>";
     let eq4: eqfn<taggypar<int>> = taggypareq::<int>;
-    test_parameterized::<taggypar<int>>(eq4,
-                                      onepar::<int>(1),
-                                      twopar::<int>(1, 2),
-                                      threepar::<int>(1, 2, 3),
-                                      twopar::<int>(17, 42));
+    test_parameterized::<taggypar<int>>(eq4, onepar::<int>(1),
+                                        twopar::<int>(1, 2),
+                                        threepar::<int>(1, 2, 3),
+                                        twopar::<int>(17, 42));
     log "*** end test parameterized: taggypar::<int>";
 
     log "*** test parameterized: reccy";
diff --git a/src/test/stdtest/either.rs b/src/test/stdtest/either.rs
index 21b8184f496..82724b1c09a 100644
--- a/src/test/stdtest/either.rs
+++ b/src/test/stdtest/either.rs
@@ -20,60 +20,60 @@ fn test_either_right() {
 
 #[test]
 fn test_lefts() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = lefts(input);
-    assert (result == ~[10, 12, 14]);
+    assert (result == [10, 12, 14]);
 }
 
 #[test]
 fn test_lefts_none() {
-    let input: [t<int, int>] = ~[right(10), right(10)];
+    let input: [t<int, int>] = [right(10), right(10)];
     let result = lefts(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_lefts_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = lefts(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_rights() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = rights(input);
-    assert (result == ~[11, 13]);
+    assert (result == [11, 13]);
 }
 
 #[test]
 fn test_rights_none() {
-    let input: [t<int, int>] = ~[left(10), left(10)];
+    let input: [t<int, int>] = [left(10), left(10)];
     let result = rights(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_rights_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = rights(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_partition() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = partition(input);
-    assert (result.lefts.(0) == 10);
-    assert (result.lefts.(1) == 12);
-    assert (result.lefts.(2) == 14);
-    assert (result.rights.(0) == 11);
-    assert (result.rights.(1) == 13);
+    assert (result.lefts[0] == 10);
+    assert (result.lefts[1] == 12);
+    assert (result.lefts[2] == 14);
+    assert (result.rights[0] == 11);
+    assert (result.rights[1] == 13);
 }
 
 #[test]
 fn test_partition_no_lefts() {
-    let input: [t<int, int>] = ~[right(10), right(11)];
+    let input: [t<int, int>] = [right(10), right(11)];
     let result = partition(input);
     assert (len(result.lefts) == 0u);
     assert (len(result.rights) == 2u);
@@ -81,7 +81,7 @@ fn test_partition_no_lefts() {
 
 #[test]
 fn test_partition_no_rights() {
-    let input: [t<int, int>] = ~[left(10), left(11)];
+    let input: [t<int, int>] = [left(10), left(11)];
     let result = partition(input);
     assert (len(result.lefts) == 2u);
     assert (len(result.rights) == 0u);
@@ -89,7 +89,7 @@ fn test_partition_no_rights() {
 
 #[test]
 fn test_partition_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = partition(input);
     assert (len(result.lefts) == 0u);
     assert (len(result.rights) == 0u);
diff --git a/src/test/stdtest/getopts.rs b/src/test/stdtest/getopts.rs
index 10acbafcb12..55d67729129 100644
--- a/src/test/stdtest/getopts.rs
+++ b/src/test/stdtest/getopts.rs
@@ -27,8 +27,8 @@ fn check_fail_type(f: opt::fail_, ft: fail_type) {
 // Tests for reqopt
 #[test]
 fn test_reqopt_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test=20"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -41,8 +41,8 @@ fn test_reqopt_long() {
 
 #[test]
 fn test_reqopt_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -52,8 +52,8 @@ fn test_reqopt_long_missing() {
 
 #[test]
 fn test_reqopt_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -63,8 +63,8 @@ fn test_reqopt_long_no_arg() {
 
 #[test]
 fn test_reqopt_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -74,8 +74,8 @@ fn test_reqopt_long_multi() {
 
 #[test]
 fn test_reqopt_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -88,8 +88,8 @@ fn test_reqopt_short() {
 
 #[test]
 fn test_reqopt_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -99,8 +99,8 @@ fn test_reqopt_short_missing() {
 
 #[test]
 fn test_reqopt_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -110,8 +110,8 @@ fn test_reqopt_short_no_arg() {
 
 #[test]
 fn test_reqopt_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -123,8 +123,8 @@ fn test_reqopt_short_multi() {
 // Tests for optopt
 #[test]
 fn test_optopt_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -137,8 +137,8 @@ fn test_optopt_long() {
 
 #[test]
 fn test_optopt_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["blah"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -148,8 +148,8 @@ fn test_optopt_long_missing() {
 
 #[test]
 fn test_optopt_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -159,8 +159,8 @@ fn test_optopt_long_no_arg() {
 
 #[test]
 fn test_optopt_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -170,8 +170,8 @@ fn test_optopt_long_multi() {
 
 #[test]
 fn test_optopt_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -184,8 +184,8 @@ fn test_optopt_short() {
 
 #[test]
 fn test_optopt_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["blah"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -195,8 +195,8 @@ fn test_optopt_short_missing() {
 
 #[test]
 fn test_optopt_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -206,8 +206,8 @@ fn test_optopt_short_no_arg() {
 
 #[test]
 fn test_optopt_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -219,8 +219,8 @@ fn test_optopt_short_multi() {
 // Tests for optflag
 #[test]
 fn test_optflag_long() {
-    let args = ~["--test"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (opt::opt_present(m, "test")); }
@@ -230,8 +230,8 @@ fn test_optflag_long() {
 
 #[test]
 fn test_optflag_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["blah"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -241,8 +241,8 @@ fn test_optflag_long_missing() {
 
 #[test]
 fn test_optflag_long_arg() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) {
@@ -255,8 +255,8 @@ fn test_optflag_long_arg() {
 
 #[test]
 fn test_optflag_long_multi() {
-    let args = ~["--test", "--test"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test", "--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -266,8 +266,8 @@ fn test_optflag_long_multi() {
 
 #[test]
 fn test_optflag_short() {
-    let args = ~["-t"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (opt::opt_present(m, "t")); }
@@ -277,8 +277,8 @@ fn test_optflag_short() {
 
 #[test]
 fn test_optflag_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["blah"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -288,14 +288,14 @@ fn test_optflag_short_missing() {
 
 #[test]
 fn test_optflag_short_arg() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         // The next variable after the flag is just a free argument
 
-        assert (m.free.(0) == "20");
+        assert (m.free[0] == "20");
       }
       _ { fail; }
     }
@@ -303,8 +303,8 @@ fn test_optflag_short_arg() {
 
 #[test]
 fn test_optflag_short_multi() {
-    let args = ~["-t", "-t"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t", "-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -316,8 +316,8 @@ fn test_optflag_short_multi() {
 // Tests for optmulti
 #[test]
 fn test_optmulti_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -330,8 +330,8 @@ fn test_optmulti_long() {
 
 #[test]
 fn test_optmulti_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -341,8 +341,8 @@ fn test_optmulti_long_missing() {
 
 #[test]
 fn test_optmulti_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -352,15 +352,15 @@ fn test_optmulti_long_no_arg() {
 
 #[test]
 fn test_optmulti_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         assert (opt::opt_present(m, "test"));
         assert (opt::opt_str(m, "test") == "20");
-        assert (opt::opt_strs(m, "test").(0) == "20");
-        assert (opt::opt_strs(m, "test").(1) == "30");
+        assert (opt::opt_strs(m, "test")[0] == "20");
+        assert (opt::opt_strs(m, "test")[1] == "30");
       }
       _ { fail; }
     }
@@ -368,8 +368,8 @@ fn test_optmulti_long_multi() {
 
 #[test]
 fn test_optmulti_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -382,8 +382,8 @@ fn test_optmulti_short() {
 
 #[test]
 fn test_optmulti_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -393,8 +393,8 @@ fn test_optmulti_short_missing() {
 
 #[test]
 fn test_optmulti_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -404,15 +404,15 @@ fn test_optmulti_short_no_arg() {
 
 #[test]
 fn test_optmulti_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         assert (opt::opt_present(m, "t"));
         assert (opt::opt_str(m, "t") == "20");
-        assert (opt::opt_strs(m, "t").(0) == "20");
-        assert (opt::opt_strs(m, "t").(1) == "30");
+        assert (opt::opt_strs(m, "t")[0] == "20");
+        assert (opt::opt_strs(m, "t")[1] == "30");
       }
       _ { fail; }
     }
@@ -420,8 +420,8 @@ fn test_optmulti_short_multi() {
 
 #[test]
 fn test_unrecognized_option_long() {
-    let args = ~["--untest"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["--untest"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -431,8 +431,8 @@ fn test_unrecognized_option_long() {
 
 #[test]
 fn test_unrecognized_option_short() {
-    let args = ~["-t"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -443,23 +443,23 @@ fn test_unrecognized_option_short() {
 #[test]
 fn test_combined() {
     let args =
-        ~["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f",
+        ["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f",
          "-m", "40", "-m", "50"];
     let opts =
-        ~[opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"),
+        [opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"),
          opt::optflag("f"), opt::optmulti("m"), opt::optopt("notpresent")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (m.free.(0) == "prog");
-        assert (m.free.(1) == "free1");
+        assert (m.free[0] == "prog");
+        assert (m.free[1] == "free1");
         assert (opt::opt_str(m, "s") == "20");
-        assert (m.free.(2) == "free2");
+        assert (m.free[2] == "free2");
         assert (opt::opt_present(m, "flag"));
         assert (opt::opt_str(m, "long") == "30");
         assert (opt::opt_present(m, "f"));
-        assert (opt::opt_strs(m, "m").(0) == "40");
-        assert (opt::opt_strs(m, "m").(1) == "50");
+        assert (opt::opt_strs(m, "m")[0] == "40");
+        assert (opt::opt_strs(m, "m")[1] == "50");
         assert (!opt::opt_present(m, "notpresent"));
       }
       _ { fail; }
diff --git a/src/test/stdtest/int.rs b/src/test/stdtest/int.rs
index 936b1fa91d3..61d3448a175 100644
--- a/src/test/stdtest/int.rs
+++ b/src/test/stdtest/int.rs
@@ -22,4 +22,4 @@ fn test_pow() {
     assert (int::pow(-3, 2u) == 9);
     assert (int::pow(-3, 3u) == -27);
     assert (int::pow(4, 9u) == 262144);
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/io.rs b/src/test/stdtest/io.rs
index 002592d9020..08330c619fc 100644
--- a/src/test/stdtest/io.rs
+++ b/src/test/stdtest/io.rs
@@ -13,7 +13,7 @@ fn test_simple() {
     log frood;
     {
         let out: io::writer =
-            io::file_writer(tmpfile, ~[io::create, io::truncate]);
+            io::file_writer(tmpfile, [io::create, io::truncate]);
         out.write_str(frood);
     }
     let inp: io::reader = io::file_reader(tmpfile);
diff --git a/src/test/stdtest/list.rs b/src/test/stdtest/list.rs
index 4a44508efc4..9e05115a4f8 100644
--- a/src/test/stdtest/list.rs
+++ b/src/test/stdtest/list.rs
@@ -8,7 +8,7 @@ import std::option;
 
 #[test]
 fn test_from_vec() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     assert (car(l) == 0);
     assert (car(cdr(l)) == 1);
     assert (car(cdr(cdr(l))) == 2);
@@ -16,7 +16,7 @@ fn test_from_vec() {
 
 #[test]
 fn test_foldl() {
-    let l = from_vec(~[0, 1, 2, 3, 4]);
+    let l = from_vec([0, 1, 2, 3, 4]);
     fn add(a: &int, b: &uint) -> uint { ret (a as uint) + b; }
     let rs = list::foldl(l, 0u, add);
     assert (rs == 10u);
@@ -24,7 +24,7 @@ fn test_foldl() {
 
 #[test]
 fn test_find_success() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     fn match(i: &int) -> option::t<int> {
         ret if i == 2 { option::some(i) } else { option::none::<int> };
     }
@@ -34,7 +34,7 @@ fn test_find_success() {
 
 #[test]
 fn test_find_fail() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     fn match(i: &int) -> option::t<int> { ret option::none::<int>; }
     let rs = list::find(l, match);
     assert (rs == option::none::<int>);
@@ -42,7 +42,7 @@ fn test_find_fail() {
 
 #[test]
 fn test_has() {
-    let l = from_vec(~[5, 8, 6]);
+    let l = from_vec([5, 8, 6]);
     let empty = list::nil::<int>;
     assert (list::has(l, 5));
     assert (!list::has(l, 7));
@@ -52,7 +52,7 @@ fn test_has() {
 
 #[test]
 fn test_length() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     assert (list::length(l) == 3u);
 }
 
diff --git a/src/test/stdtest/net.rs b/src/test/stdtest/net.rs
index c1a26cb747d..9da7a12a060 100644
--- a/src/test/stdtest/net.rs
+++ b/src/test/stdtest/net.rs
@@ -3,10 +3,10 @@ import std::net;
 
 #[test]
 fn test_format_ip() {
-    assert(net::format_addr(net::ipv4(127u8,0u8,0u8,1u8)) == "127.0.0.1")
+    assert (net::format_addr(net::ipv4(127u8, 0u8, 0u8, 1u8)) == "127.0.0.1")
 }
 
 #[test]
 fn test_parse_ip() {
-    assert(net::parse_addr("127.0.0.1") == net::ipv4(127u8,0u8,0u8,1u8));
+    assert (net::parse_addr("127.0.0.1") == net::ipv4(127u8, 0u8, 0u8, 1u8));
 }
diff --git a/src/test/stdtest/path.rs b/src/test/stdtest/path.rs
index 5f7c34c5e05..911bc6b0dd9 100644
--- a/src/test/stdtest/path.rs
+++ b/src/test/stdtest/path.rs
@@ -14,4 +14,4 @@ fn test() {
 
     log fs::make_absolute("test-path");
     log fs::make_absolute("/usr/bin");
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/ptr.rs b/src/test/stdtest/ptr.rs
index 269febfc6b7..ef0ffa54a04 100644
--- a/src/test/stdtest/ptr.rs
+++ b/src/test/stdtest/ptr.rs
@@ -9,10 +9,10 @@ fn test() {
     let p = {mutable fst: 10, mutable snd: 20};
     let pptr: *mutable pair = ptr::addr_of(p);
     let iptr: *mutable int = unsafe::reinterpret_cast(pptr);
-    assert (*iptr == 10);
+    assert (*iptr == 10);;
     *iptr = 30;
     assert (*iptr == 30);
-    assert (p.fst == 30);
+    assert (p.fst == 30);;
 
     *pptr = {mutable fst: 50, mutable snd: 60};
     assert (*iptr == 50);
diff --git a/src/test/stdtest/qsort.rs b/src/test/stdtest/qsort.rs
index 4e557b533a4..250d77a4593 100644
--- a/src/test/stdtest/qsort.rs
+++ b/src/test/stdtest/qsort.rs
@@ -11,30 +11,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) {
     let f = ltequal;
     std::sort::quick_sort::<int>(f, v1);
     let i = 0u;
-    while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; }
+    while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
     {
-        let v1 = ~[mutable 1, 1, 1];
-        let v2 = ~[mutable 1, 1, 1];
+        let v1 = [mutable 1, 1, 1];
+        let v2 = [mutable 1, 1, 1];
         check_sort(v1, v2);
     }
     {
-        let v1: [mutable int] = ~[mutable ];
-        let v2: [mutable int] = ~[mutable ];
+        let v1: [mutable int] = [mutable];
+        let v2: [mutable int] = [mutable];
         check_sort(v1, v2);
     }
-    { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); }
+    { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); }
     {
-        let v1 = ~[mutable 9, 3, 3, 3, 9];
-        let v2 = ~[mutable 3, 3, 3, 9, 9];
+        let v1 = [mutable 9, 3, 3, 3, 9];
+        let v2 = [mutable 3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
@@ -42,18 +42,15 @@ fn test() {
 // Regression test for #705
 #[test]
 fn test_simple() {
-    let names = ~[mutable 2, 1, 3];
+    let names = [mutable 2, 1, 3];
 
-    let expected = ~[1, 2, 3];
+    let expected = [1, 2, 3];
 
     fn lteq(a: &int, b: &int) -> bool { int::le(a, b) }
     sort::quick_sort(lteq, names);
 
     let pairs = vec::zip(expected, vec::from_mut(names));
-    for (a, b) in pairs {
-        log #fmt("%d %d", a, b);
-        assert (a == b);
-    }
+    for (a, b) in pairs { log #fmt["%d %d", a, b]; assert (a == b); }
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/qsort3.rs b/src/test/stdtest/qsort3.rs
index 21f43218806..6c8df212218 100644
--- a/src/test/stdtest/qsort3.rs
+++ b/src/test/stdtest/qsort3.rs
@@ -9,30 +9,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) {
     let f2 = equal;
     std::sort::quick_sort3::<int>(f1, f2, v1);
     let i = 0u;
-    while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; }
+    while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
     {
-        let v1 = ~[mutable 1, 1, 1];
-        let v2 = ~[mutable 1, 1, 1];
+        let v1 = [mutable 1, 1, 1];
+        let v2 = [mutable 1, 1, 1];
         check_sort(v1, v2);
     }
     {
-        let v1: [mutable int] = ~[mutable ];
-        let v2: [mutable int] = ~[mutable ];
+        let v1: [mutable int] = [mutable];
+        let v2: [mutable int] = [mutable];
         check_sort(v1, v2);
     }
-    { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); }
+    { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); }
     {
-        let v1 = ~[mutable 9, 3, 3, 3, 9];
-        let v2 = ~[mutable 3, 3, 3, 9, 9];
+        let v1 = [mutable 9, 3, 3, 3, 9];
+        let v2 = [mutable 3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
diff --git a/src/test/stdtest/rand.rs b/src/test/stdtest/rand.rs
index bf394602fab..a8f13ed6704 100644
--- a/src/test/stdtest/rand.rs
+++ b/src/test/stdtest/rand.rs
@@ -26,4 +26,4 @@ fn test() {
     }
     log r1.next();
     log r1.next();
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/run.rs b/src/test/stdtest/run.rs
index 7476cb6621b..b60a3935500 100644
--- a/src/test/stdtest/run.rs
+++ b/src/test/stdtest/run.rs
@@ -11,9 +11,9 @@ import std::vec;
 #[cfg(target_os = "macos")]
 #[test]
 fn test_leaks() {
-    run::run_program("echo", ~[]);
-    run::start_program("echo", ~[]);
-    run::program_output("echo", ~[]);
+    run::run_program("echo", []);
+    run::start_program("echo", []);
+    run::program_output("echo", []);
 }
 
 // FIXME
@@ -28,8 +28,8 @@ fn test_pipes() {
     let pipe_out = os::pipe();
     let pipe_err = os::pipe();
 
-    let pid = run::spawn_process("cat", ~[],
-       pipe_in.in, pipe_out.out, pipe_err.out);
+    let pid =
+        run::spawn_process("cat", [], pipe_in.in, pipe_out.out, pipe_err.out);
     os::libc::close(pipe_in.in);
     os::libc::close(pipe_out.out);
     os::libc::close(pipe_err.out);
@@ -43,11 +43,10 @@ fn test_pipes() {
 
     log expected;
     log actual;
-    assert expected == actual;
+    assert (expected == actual);
 
     fn writeclose(fd: int, s: &str) {
-        let writer = io::new_writer(
-            io::fd_buf_writer(fd, option::none));
+        let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(s);
 
         os::libc::close(fd);
@@ -56,8 +55,7 @@ fn test_pipes() {
     fn readclose(fd: int) -> str {
         // Copied from run::program_output
         let file = os::fd_FILE(fd);
-        let reader = io::new_reader(
-            io::FILE_buf_reader(file, option::none));
+        let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
         let buf = "";
         while !reader.eof() {
             let bytes = reader.read_bytes(4096u);
@@ -66,4 +64,4 @@ fn test_pipes() {
         os::libc::fclose(file);
         ret buf;
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/sha1.rs b/src/test/stdtest/sha1.rs
index 74729fa52ae..6b72be20dd5 100644
--- a/src/test/stdtest/sha1.rs
+++ b/src/test/stdtest/sha1.rs
@@ -20,53 +20,43 @@ fn test() {
     // Test messages from FIPS 180-1
 
     let fips_180_1_tests: [test] =
-        ~[{input: "abc",
+        [{input: "abc",
           output:
-              ~[0xA9u8, 0x99u8, 0x3Eu8, 0x36u8,
-                0x47u8, 0x06u8, 0x81u8, 0x6Au8,
-                0xBAu8, 0x3Eu8, 0x25u8, 0x71u8,
-                0x78u8, 0x50u8, 0xC2u8, 0x6Cu8,
-                0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]},
+              [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8,
+               0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8,
+               0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]},
          {input:
               "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq",
           output:
-              ~[0x84u8, 0x98u8, 0x3Eu8, 0x44u8,
-                0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8,
-                0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8,
-                0xF9u8, 0x51u8, 0x29u8, 0xE5u8,
-                0xE5u8, 0x46u8, 0x70u8, 0xF1u8]},
+              [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8,
+               0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, 0xE5u8,
+               0xE5u8, 0x46u8, 0x70u8, 0xF1u8]},
          {input: a_million_letter_a(),
           output:
-              ~[0x34u8, 0xAAu8, 0x97u8, 0x3Cu8,
-                0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8,
-                0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8,
-                0xDBu8, 0xADu8, 0x27u8, 0x31u8,
-                0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}];
+              [0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8,
+               0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8, 0xDBu8, 0xADu8, 0x27u8, 0x31u8,
+               0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}];
     // Examples from wikipedia
 
     let wikipedia_tests: [test] =
-        ~[{input: "The quick brown fox jumps over the lazy dog",
+        [{input: "The quick brown fox jumps over the lazy dog",
           output:
-              ~[0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8,
-                0x7au8, 0x2du8, 0x28u8, 0xfcu8,
-                0xedu8, 0x84u8, 0x9eu8, 0xe1u8,
-                0xbbu8, 0x76u8, 0xe7u8, 0x39u8,
-                0x1bu8, 0x93u8, 0xebu8, 0x12u8]},
+              [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8,
+               0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, 0x39u8,
+               0x1bu8, 0x93u8, 0xebu8, 0x12u8]},
          {input: "The quick brown fox jumps over the lazy cog",
           output:
-              ~[0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8,
-                0xd2u8, 0x5eu8, 0x1bu8, 0x3au8,
-                0xfau8, 0xd3u8, 0xe8u8, 0x5au8,
-                0x0bu8, 0xd1u8, 0x7du8, 0x9bu8,
-                0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}];
+              [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8,
+               0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8,
+               0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}];
     let tests = fips_180_1_tests + wikipedia_tests;
     fn check_vec_eq(v0: &[u8], v1: &[u8]) {
         assert (vec::len::<u8>(v0) == vec::len::<u8>(v1));
         let len = vec::len::<u8>(v0);
         let i = 0u;
         while i < len {
-            let a = v0.(i);
-            let b = v1.(i);
+            let a = v0[i];
+            let b = v1[i];
             assert (a == b);
             i += 1u;
         }
diff --git a/src/test/stdtest/sort.rs b/src/test/stdtest/sort.rs
index be15881e65a..c42f950ce6b 100644
--- a/src/test/stdtest/sort.rs
+++ b/src/test/stdtest/sort.rs
@@ -7,22 +7,22 @@ fn check_sort(v1: &[int], v2: &[int]) {
     let f = lteq;
     let v3 = std::sort::merge_sort::<int>(f, v1);
     let i = 0u;
-    while i < len { log v3.(i); assert (v3.(i) == v2.(i)); i += 1u; }
+    while i < len { log v3[i]; assert (v3[i] == v2[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
-    { let v1 = ~[1, 1, 1]; let v2 = ~[1, 1, 1]; check_sort(v1, v2); }
-    { let v1: [int] = ~[]; let v2: [int] = ~[]; check_sort(v1, v2); }
-    { let v1 = ~[9]; let v2 = ~[9]; check_sort(v1, v2); }
+    { let v1 = [1, 1, 1]; let v2 = [1, 1, 1]; check_sort(v1, v2); }
+    { let v1: [int] = []; let v2: [int] = []; check_sort(v1, v2); }
+    { let v1 = [9]; let v2 = [9]; check_sort(v1, v2); }
     {
-        let v1 = ~[9, 3, 3, 3, 9];
-        let v2 = ~[3, 3, 3, 9, 9];
+        let v1 = [9, 3, 3, 3, 9];
+        let v2 = [3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
diff --git a/src/test/stdtest/str.rs b/src/test/stdtest/str.rs
index 8124e565f6a..ef225c82fd8 100644
--- a/src/test/stdtest/str.rs
+++ b/src/test/stdtest/str.rs
@@ -30,8 +30,8 @@ fn test_split() {
         let v = str::split(s, c as u8);
         log "split to: ";
         for z: str in v { log z; }
-        log "comparing: " + v.(i) + " vs. " + k;
-        assert (str::eq(v.(i), k));
+        log "comparing: " + v[i] + " vs. " + k;
+        assert (str::eq(v[i], k));
     }
     t("abc.hello.there", '.', 0, "abc");
     t("abc.hello.there", '.', 1, "hello");
@@ -70,10 +70,10 @@ fn test_substr() {
 #[test]
 fn test_concat() {
     fn t(v: &[str], s: &str) { assert (str::eq(str::concat(v), s)); }
-    t(~["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
-    let v: [str] = ~[];
+    t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
+    let v: [str] = [];
     t(v, "");
-    t(~["hi"], "hi");
+    t(["hi"], "hi");
 }
 
 #[test]
@@ -81,10 +81,10 @@ fn test_connect() {
     fn t(v: &[str], sep: &str, s: &str) {
         assert (str::eq(str::connect(v, sep), s));
     }
-    t(~["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
-    let v: [str] = ~[];
+    t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
+    let v: [str] = [];
     t(v, " ", "");
-    t(~["hi"], " ", "hi");
+    t(["hi"], " ", "hi");
 }
 
 #[test]
@@ -164,41 +164,41 @@ fn test_char_slice() {
 
 #[test]
 fn trim_left() {
-    assert str::trim_left("") == "";
-    assert str::trim_left("a") == "a";
-    assert str::trim_left("    ") == "";
-    assert str::trim_left("     blah") == "blah";
-    assert str::trim_left("   \u3000  wut") == "wut";
-    assert str::trim_left("hey ") == "hey ";
+    assert (str::trim_left("") == "");
+    assert (str::trim_left("a") == "a");
+    assert (str::trim_left("    ") == "");
+    assert (str::trim_left("     blah") == "blah");
+    assert (str::trim_left("   \u3000  wut") == "wut");
+    assert (str::trim_left("hey ") == "hey ");
 }
 
 #[test]
 fn trim_right() {
-    assert str::trim_right("") == "";
-    assert str::trim_right("a") == "a";
-    assert str::trim_right("    ") == "";
-    assert str::trim_right("blah     ") == "blah";
-    assert str::trim_right("wut   \u3000  ") == "wut";
-    assert str::trim_right(" hey") == " hey";
+    assert (str::trim_right("") == "");
+    assert (str::trim_right("a") == "a");
+    assert (str::trim_right("    ") == "");
+    assert (str::trim_right("blah     ") == "blah");
+    assert (str::trim_right("wut   \u3000  ") == "wut");
+    assert (str::trim_right(" hey") == " hey");
 }
 
 #[test]
 fn trim() {
-    assert str::trim("") == "";
-    assert str::trim("a") == "a";
-    assert str::trim("    ") == "";
-    assert str::trim("    blah     ") == "blah";
-    assert str::trim("\nwut   \u3000  ") == "wut";
-    assert str::trim(" hey dude ") == "hey dude";
+    assert (str::trim("") == "");
+    assert (str::trim("a") == "a");
+    assert (str::trim("    ") == "");
+    assert (str::trim("    blah     ") == "blah");
+    assert (str::trim("\nwut   \u3000  ") == "wut");
+    assert (str::trim(" hey dude ") == "hey dude");
 }
 
 #[test]
 fn is_whitespace() {
-    assert str::is_whitespace("");
-    assert str::is_whitespace(" ");
-    assert str::is_whitespace("\u2009"); // Thin space
-    assert str::is_whitespace("  \n\t   ");
-    assert !str::is_whitespace("   _   ");
+    assert (str::is_whitespace(""));
+    assert (str::is_whitespace(" "));
+    assert (str::is_whitespace("\u2009")); // Thin space
+    assert (str::is_whitespace("  \n\t   "));
+    assert (!str::is_whitespace("   _   "));
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/str_buf.rs b/src/test/stdtest/str_buf.rs
index 6b013ed8db2..8bb040dde9c 100644
--- a/src/test/stdtest/str_buf.rs
+++ b/src/test/stdtest/str_buf.rs
@@ -12,4 +12,4 @@ fn test() {
     assert (str::eq(s_cstr, s));
     let s_buf = str::str_from_buf(sb, 5u);
     assert (str::eq(s_buf, s));
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/task.rs b/src/test/stdtest/task.rs
index 517210b9c56..d30d6addd0b 100644
--- a/src/test/stdtest/task.rs
+++ b/src/test/stdtest/task.rs
@@ -37,7 +37,7 @@ fn test_lib_spawn() {
 
 #[test]
 fn test_lib_spawn2() {
-    fn foo(x : int) { assert(x == 42); }
+    fn foo(x: int) { assert (x == 42); }
     task::_spawn(bind foo(42));
 }
 
@@ -52,7 +52,7 @@ fn test_join_chan() {
     log_err "received task status message";
     log_err s;
     alt s {
-      task::exit(_, task::tr_success.) { /* yay! */ }
+      task::exit(_, task::tr_success.) {/* yay! */ }
       _ { fail "invalid task status received" }
     }
 }
@@ -68,7 +68,7 @@ fn test_join_chan_fail() {
     log_err "received task status message";
     log_err s;
     alt s {
-      task::exit(_, task::tr_failure.) { /* yay! */ }
+      task::exit(_, task::tr_failure.) {/* yay! */ }
       _ { fail "invalid task status received" }
     }
 }
@@ -78,5 +78,5 @@ fn test_join_convenient() {
     fn winner() { }
     let f = winner;
     let handle = task::spawn_joinable(f);
-    assert(task::tr_success == task::join(handle));
+    assert (task::tr_success == task::join(handle));
 }
diff --git a/src/test/stdtest/test.rs b/src/test/stdtest/test.rs
index e85829b4477..e32105c2f0a 100644
--- a/src/test/stdtest/test.rs
+++ b/src/test/stdtest/test.rs
@@ -26,7 +26,7 @@ fn ignored_tests_result_in_ignored() {
 
 #[test]
 fn first_free_arg_should_be_a_filter() {
-    let args = ~["progname", "filter"];
+    let args = ["progname", "filter"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
     assert (str::eq("filter", option::get(opts.filter)));
@@ -34,7 +34,7 @@ fn first_free_arg_should_be_a_filter() {
 
 #[test]
 fn parse_ignored_flag() {
-    let args = ~["progname", "filter", "--ignored"];
+    let args = ["progname", "filter", "--ignored"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
     assert (opts.run_ignored);
@@ -47,13 +47,13 @@ fn filter_for_ignored_option() {
 
     let opts = {filter: option::none, run_ignored: true};
     let tests =
-        ~[{name: "1", fn: fn () { }, ignore: true},
-          {name: "2", fn: fn () { }, ignore: false}];
+        [{name: "1", fn: fn () { }, ignore: true},
+         {name: "2", fn: fn () { }, ignore: false}];
     let filtered = test::filter_tests(opts, tests);
 
     assert (vec::len(filtered) == 1u);
-    assert (filtered.(0).name == "1");
-    assert (filtered.(0).ignore == false);
+    assert (filtered[0].name == "1");
+    assert (filtered[0].ignore == false);
 }
 
 #[test]
@@ -61,37 +61,35 @@ fn sort_tests() {
     let opts = {filter: option::none, run_ignored: false};
 
     let names =
-        ~["sha1::test", "int::test_to_str", "int::test_pow",
-          "test::do_not_run_ignored_tests",
-          "test::ignored_tests_result_in_ignored",
-          "test::first_free_arg_should_be_a_filter",
-          "test::parse_ignored_flag", "test::filter_for_ignored_option",
-          "test::sort_tests"];
+        ["sha1::test", "int::test_to_str", "int::test_pow",
+         "test::do_not_run_ignored_tests",
+         "test::ignored_tests_result_in_ignored",
+         "test::first_free_arg_should_be_a_filter",
+         "test::parse_ignored_flag", "test::filter_for_ignored_option",
+         "test::sort_tests"];
     let tests =
         {
             let testfn = fn () { };
-            let tests = ~[];
+            let tests = [];
             for name: str in names {
                 let test = {name: name, fn: testfn, ignore: false};
-                tests += ~[test];
+                tests += [test];
             }
             tests
         };
     let filtered = test::filter_tests(opts, tests);
 
     let expected =
-        ~["int::test_pow", "int::test_to_str", "sha1::test",
-          "test::do_not_run_ignored_tests", "test::filter_for_ignored_option",
-          "test::first_free_arg_should_be_a_filter",
-          "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag",
-          "test::sort_tests"];
+        ["int::test_pow", "int::test_to_str", "sha1::test",
+         "test::do_not_run_ignored_tests", "test::filter_for_ignored_option",
+         "test::first_free_arg_should_be_a_filter",
+         "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag",
+         "test::sort_tests"];
 
     let pairs = vec::zip(expected, filtered);
 
 
-    for (a, b) in pairs {
-        assert (a == b.name);
-    }
+    for (a, b) in pairs { assert (a == b.name); }
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/uint.rs b/src/test/stdtest/uint.rs
index 8b450b8a5ff..7361c76b70b 100644
--- a/src/test/stdtest/uint.rs
+++ b/src/test/stdtest/uint.rs
@@ -46,4 +46,4 @@ fn test_next_power_of_two() {
     assert (uint::next_power_of_two(37u) == 64u);
     assert (uint::next_power_of_two(38u) == 64u);
     assert (uint::next_power_of_two(39u) == 64u);
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/vec.rs b/src/test/stdtest/vec.rs
index 75b3998e28c..1ffe3982cd2 100644
--- a/src/test/stdtest/vec.rs
+++ b/src/test/stdtest/vec.rs
@@ -20,7 +20,7 @@ fn add(x: &uint, y: &uint) -> uint { ret x + y; }
 
 #[test]
 fn test_reserve_and_on_heap() {
-    let v: [int] = ~[1, 2];
+    let v: [int] = [1, 2];
     assert (!vec::on_heap(v));
     vec::reserve(v, 8u);
     assert (vec::on_heap(v));
@@ -29,26 +29,26 @@ fn test_reserve_and_on_heap() {
 #[test]
 fn test_unsafe_ptrs() {
     // Test on-stack copy-from-buf.
-    let a = ~[1, 2, 3];
+    let a = [1, 2, 3];
     let ptr = vec::to_ptr(a);
-    let b = ~[];
+    let b = [];
     vec::unsafe::copy_from_buf(b, ptr, 3u);
     assert (vec::len(b) == 3u);
-    assert (b.(0) == 1);
-    assert (b.(1) == 2);
-    assert (b.(2) == 3);
+    assert (b[0] == 1);
+    assert (b[1] == 2);
+    assert (b[2] == 3);
 
     // Test on-heap copy-from-buf.
-    let c = ~[1, 2, 3, 4, 5];
+    let c = [1, 2, 3, 4, 5];
     ptr = vec::to_ptr(c);
-    let d = ~[];
+    let d = [];
     vec::unsafe::copy_from_buf(d, ptr, 5u);
     assert (vec::len(d) == 5u);
-    assert (d.(0) == 1);
-    assert (d.(1) == 2);
-    assert (d.(2) == 3);
-    assert (d.(3) == 4);
-    assert (d.(4) == 5);
+    assert (d[0] == 1);
+    assert (d[1] == 2);
+    assert (d[2] == 3);
+    assert (d[3] == 4);
+    assert (d[4] == 5);
 }
 
 #[test]
@@ -56,18 +56,18 @@ fn test_init_fn() {
     // Test on-stack init_fn.
     let v = vec::init_fn(square, 3u);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
 
     // Test on-heap init_fn.
     v = vec::init_fn(square, 5u);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
-    assert (v.(3) == 9u);
-    assert (v.(4) == 16u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
+    assert (v[3] == 9u);
+    assert (v[4] == 16u);
 }
 
 #[test]
@@ -75,194 +75,194 @@ fn test_init_elt() {
     // Test on-stack init_elt.
     let v = vec::init_elt(10u, 2u);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 10u);
-    assert (v.(1) == 10u);
+    assert (v[0] == 10u);
+    assert (v[1] == 10u);
 
     // Test on-heap init_elt.
     v = vec::init_elt(20u, 6u);
-    assert (v.(0) == 20u);
-    assert (v.(1) == 20u);
-    assert (v.(2) == 20u);
-    assert (v.(3) == 20u);
-    assert (v.(4) == 20u);
-    assert (v.(5) == 20u);
+    assert (v[0] == 20u);
+    assert (v[1] == 20u);
+    assert (v[2] == 20u);
+    assert (v[3] == 20u);
+    assert (v[4] == 20u);
+    assert (v[5] == 20u);
 }
 
 #[test]
 fn test_is_empty() {
-    assert (vec::is_empty::<int>(~[]));
-    assert (!vec::is_empty(~[0]));
+    assert (vec::is_empty::<int>([]));
+    assert (!vec::is_empty([0]));
 }
 
 #[test]
 fn test_is_not_empty() {
-    assert (vec::is_not_empty(~[0]));
-    assert (!vec::is_not_empty::<int>(~[]));
+    assert (vec::is_not_empty([0]));
+    assert (!vec::is_not_empty::<int>([]));
 }
 
 #[test]
 fn test_head() {
-    let a = ~[11, 12];
+    let a = [11, 12];
     check (vec::is_not_empty(a));
     assert (vec::head(a) == 11);
 }
 
 #[test]
 fn test_tail() {
-    let a = ~[11];
+    let a = [11];
     check (vec::is_not_empty(a));
-    assert (vec::tail(a) == ~[]);
+    assert (vec::tail(a) == []);
 
-    a = ~[11, 12];
+    a = [11, 12];
     check (vec::is_not_empty(a));
-    assert (vec::tail(a) == ~[12]);
+    assert (vec::tail(a) == [12]);
 }
 
 #[test]
 fn test_last() {
-    let n = vec::last(~[]);
+    let n = vec::last([]);
     assert (n == none);
-    n = vec::last(~[1, 2, 3]);
+    n = vec::last([1, 2, 3]);
     assert (n == some(3));
-    n = vec::last(~[1, 2, 3, 4, 5]);
+    n = vec::last([1, 2, 3, 4, 5]);
     assert (n == some(5));
 }
 
 #[test]
 fn test_slice() {
     // Test on-stack -> on-stack slice.
-    let v = vec::slice(~[1, 2, 3], 1u, 3u);
+    let v = vec::slice([1, 2, 3], 1u, 3u);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 2);
-    assert (v.(1) == 3);
+    assert (v[0] == 2);
+    assert (v[1] == 3);
 
     // Test on-heap -> on-stack slice.
-    v = vec::slice(~[1, 2, 3, 4, 5], 0u, 3u);
+    v = vec::slice([1, 2, 3, 4, 5], 0u, 3u);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
 
     // Test on-heap -> on-heap slice.
-    v = vec::slice(~[1, 2, 3, 4, 5, 6], 1u, 6u);
+    v = vec::slice([1, 2, 3, 4, 5, 6], 1u, 6u);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 2);
-    assert (v.(1) == 3);
-    assert (v.(2) == 4);
-    assert (v.(3) == 5);
-    assert (v.(4) == 6);
+    assert (v[0] == 2);
+    assert (v[1] == 3);
+    assert (v[2] == 4);
+    assert (v[3] == 5);
+    assert (v[4] == 6);
 }
 
 #[test]
 fn test_pop() {
     // Test on-stack pop.
-    let v = ~[1, 2, 3];
+    let v = [1, 2, 3];
     let e = vec::pop(v);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
     assert (e == 3);
 
     // Test on-heap pop.
-    v = ~[1, 2, 3, 4, 5];
+    v = [1, 2, 3, 4, 5];
     e = vec::pop(v);
     assert (vec::len(v) == 4u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
     assert (e == 5);
 }
 
 #[test]
 fn test_grow() {
     // Test on-stack grow().
-    let v = ~[];
+    let v = [];
     vec::grow(v, 2u, 1);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 1);
+    assert (v[0] == 1);
+    assert (v[1] == 1);
 
     // Test on-heap grow().
     vec::grow(v, 3u, 2);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 1);
-    assert (v.(2) == 2);
-    assert (v.(3) == 2);
-    assert (v.(4) == 2);
+    assert (v[0] == 1);
+    assert (v[1] == 1);
+    assert (v[2] == 2);
+    assert (v[3] == 2);
+    assert (v[4] == 2);
 }
 
 #[test]
 fn test_grow_fn() {
-    let v = ~[];
+    let v = [];
     vec::grow_fn(v, 3u, square);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
 }
 
 #[test]
 fn test_grow_set() {
-    let v = ~[mutable 1, 2, 3];
+    let v = [mutable 1, 2, 3];
     vec::grow_set(v, 4u, 4, 5);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
-    assert (v.(4) == 5);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
+    assert (v[4] == 5);
 }
 
 #[test]
 fn test_map() {
     // Test on-stack map.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let w = vec::map(square_alias, v);
     assert (vec::len(w) == 3u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 4u);
-    assert (w.(2) == 9u);
+    assert (w[0] == 1u);
+    assert (w[1] == 4u);
+    assert (w[2] == 9u);
 
     // Test on-heap map.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     w = vec::map(square_alias, v);
     assert (vec::len(w) == 5u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 4u);
-    assert (w.(2) == 9u);
-    assert (w.(3) == 16u);
-    assert (w.(4) == 25u);
+    assert (w[0] == 1u);
+    assert (w[1] == 4u);
+    assert (w[2] == 9u);
+    assert (w[3] == 16u);
+    assert (w[4] == 25u);
 }
 
 #[test]
 fn test_map2() {
     fn times(x: &int, y: &int) -> int { ret x * y; }
     let f = times;
-    let v0 = ~[1, 2, 3, 4, 5];
-    let v1 = ~[5, 4, 3, 2, 1];
+    let v0 = [1, 2, 3, 4, 5];
+    let v1 = [5, 4, 3, 2, 1];
     let u = vec::map2::<int, int, int>(f, v0, v1);
     let i = 0;
-    while i < 5 { assert (v0.(i) * v1.(i) == u.(i)); i += 1; }
+    while i < 5 { assert (v0[i] * v1[i] == u[i]); i += 1; }
 }
 
 #[test]
 fn test_filter_map() {
     // Test on-stack filter-map.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let w = vec::filter_map(square_if_odd, v);
     assert (vec::len(w) == 2u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 9u);
+    assert (w[0] == 1u);
+    assert (w[1] == 9u);
 
     // Test on-heap filter-map.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     w = vec::filter_map(square_if_odd, v);
     assert (vec::len(w) == 3u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 9u);
-    assert (w.(2) == 25u);
+    assert (w[0] == 1u);
+    assert (w[1] == 9u);
+    assert (w[2] == 25u);
 
     fn halve(i: &int) -> option::t<int> {
         if i % 2 == 0 {
@@ -270,14 +270,14 @@ fn test_filter_map() {
         } else { ret option::none::<int>; }
     }
     fn halve_for_sure(i: &int) -> int { ret i / 2; }
-    let all_even: [int] = ~[0, 2, 8, 6];
-    let all_odd1: [int] = ~[1, 7, 3];
-    let all_odd2: [int] = ~[];
-    let mix: [int] = ~[9, 2, 6, 7, 1, 0, 0, 3];
-    let mix_dest: [int] = ~[1, 3, 0, 0];
+    let all_even: [int] = [0, 2, 8, 6];
+    let all_odd1: [int] = [1, 7, 3];
+    let all_odd2: [int] = [];
+    let mix: [int] = [9, 2, 6, 7, 1, 0, 0, 3];
+    let mix_dest: [int] = [1, 3, 0, 0];
     assert (filter_map(halve, all_even) == map(halve_for_sure, all_even));
-    assert (filter_map(halve, all_odd1) == ~[]);
-    assert (filter_map(halve, all_odd2) == ~[]);
+    assert (filter_map(halve, all_odd1) == []);
+    assert (filter_map(halve, all_odd2) == []);
     assert (filter_map(halve, mix) == mix_dest);
 
 }
@@ -285,49 +285,49 @@ fn test_filter_map() {
 #[test]
 fn test_foldl() {
     // Test on-stack fold.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let sum = vec::foldl(add, 0u, v);
     assert (sum == 6u);
 
     // Test on-heap fold.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     sum = vec::foldl(add, 0u, v);
     assert (sum == 15u);
 }
 
 #[test]
 fn test_any_and_all() {
-    assert (vec::any(is_three, ~[1u, 2u, 3u]));
-    assert (!vec::any(is_three, ~[0u, 1u, 2u]));
-    assert (vec::any(is_three, ~[1u, 2u, 3u, 4u, 5u]));
-    assert (!vec::any(is_three, ~[1u, 2u, 4u, 5u, 6u]));
-
-    assert (vec::all(is_three, ~[3u, 3u, 3u]));
-    assert (!vec::all(is_three, ~[3u, 3u, 2u]));
-    assert (vec::all(is_three, ~[3u, 3u, 3u, 3u, 3u]));
-    assert (!vec::all(is_three, ~[3u, 3u, 0u, 1u, 2u]));
+    assert (vec::any(is_three, [1u, 2u, 3u]));
+    assert (!vec::any(is_three, [0u, 1u, 2u]));
+    assert (vec::any(is_three, [1u, 2u, 3u, 4u, 5u]));
+    assert (!vec::any(is_three, [1u, 2u, 4u, 5u, 6u]));
+
+    assert (vec::all(is_three, [3u, 3u, 3u]));
+    assert (!vec::all(is_three, [3u, 3u, 2u]));
+    assert (vec::all(is_three, [3u, 3u, 3u, 3u, 3u]));
+    assert (!vec::all(is_three, [3u, 3u, 0u, 1u, 2u]));
 }
 
 #[test]
 fn test_zip_unzip() {
-    let v1 = ~[1, 2, 3];
-    let v2 = ~[4, 5, 6];
+    let v1 = [1, 2, 3];
+    let v2 = [4, 5, 6];
     let z1 = vec::zip(v1, v2);
 
-    assert ((1, 4) == z1.(0));
-    assert ((2, 5) == z1.(1));
-    assert ((3, 6) == z1.(2));
+    assert ((1, 4) == z1[0]);
+    assert ((2, 5) == z1[1]);
+    assert ((3, 6) == z1[2]);
 
     let (left, right) = vec::unzip(z1);
 
-    assert ((1, 4) == (left.(0), right.(0)));
-    assert ((2, 5) == (left.(1), right.(1)));
-    assert ((3, 6) == (left.(2), right.(2)));
+    assert ((1, 4) == (left[0], right[0]));
+    assert ((2, 5) == (left[1], right[1]));
+    assert ((3, 6) == (left[2], right[2]));
 }
 
 #[test]
 fn test_position() {
-    let v1: [int] = ~[1, 2, 3, 3, 2, 5];
+    let v1: [int] = [1, 2, 3, 3, 2, 5];
     assert (position(1, v1) == option::some::<uint>(0u));
     assert (position(2, v1) == option::some::<uint>(1u));
     assert (position(5, v1) == option::some::<uint>(5u));
@@ -338,28 +338,28 @@ fn test_position() {
 fn test_position_pred() {
     fn less_than_three(i: &int) -> bool { ret i < 3; }
     fn is_eighteen(i: &int) -> bool { ret i == 18; }
-    let v1: [int] = ~[5, 4, 3, 2, 1];
+    let v1: [int] = [5, 4, 3, 2, 1];
     assert (position_pred(less_than_three, v1) == option::some::<uint>(3u));
     assert (position_pred(is_eighteen, v1) == option::none::<uint>);
 }
 
 #[test]
 fn reverse_and_reversed() {
-    let v: [mutable int] = ~[mutable 10, 20];
-    assert (v.(0) == 10);
-    assert (v.(1) == 20);
+    let v: [mutable int] = [mutable 10, 20];
+    assert (v[0] == 10);
+    assert (v[1] == 20);
     vec::reverse(v);
-    assert (v.(0) == 20);
-    assert (v.(1) == 10);
-    let v2 = vec::reversed::<int>(~[10, 20]);
-    assert (v2.(0) == 20);
-    assert (v2.(1) == 10);
-    v.(0) = 30;
-    assert (v2.(0) == 20);
+    assert (v[0] == 20);
+    assert (v[1] == 10);
+    let v2 = vec::reversed::<int>([10, 20]);
+    assert (v2[0] == 20);
+    assert (v2[1] == 10);
+    v[0] = 30;
+    assert (v2[0] == 20);
     // Make sure they work with 0-length vectors too.
 
-    let v4 = vec::reversed::<int>(~[]);
-    let v3: [mutable int] = ~[mutable];
+    let v4 = vec::reversed::<int>([]);
+    let v3: [mutable int] = [mutable];
     vec::reverse::<int>(v3);
 }
 
diff --git a/src/test/stdtest/vec_str_conversions.rs b/src/test/stdtest/vec_str_conversions.rs
index cc52ec80e95..8e245db256f 100644
--- a/src/test/stdtest/vec_str_conversions.rs
+++ b/src/test/stdtest/vec_str_conversions.rs
@@ -16,8 +16,8 @@ fn test_simple() {
     let n2: uint = vec::len::<u8>(v);
     assert (n1 == n2);
     while i < n1 {
-        let a: u8 = s1.(i);
-        let b: u8 = s2.(i);
+        let a: u8 = s1[i];
+        let b: u8 = s2[i];
         log a;
         log b;
         assert (a == b);