diff options
| author | Brian Anderson <banderson@mozilla.com> | 2011-09-02 15:34:58 -0700 |
|---|---|---|
| committer | Brian Anderson <banderson@mozilla.com> | 2011-09-02 22:11:42 -0700 |
| commit | 5c49e4f4e92997869de1f75f9089c9db7e7a6ebe (patch) | |
| tree | 947f6d58da06e589a0ab0627319917a9d2352a8c | |
| parent | b5f905342337a3dc12bdc5dc6d98d3ecdf60439d (diff) | |
| download | rust-5c49e4f4e92997869de1f75f9089c9db7e7a6ebe.tar.gz rust-5c49e4f4e92997869de1f75f9089c9db7e7a6ebe.zip | |
Reformat. Issue #855
194 files changed, 5106 insertions, 5789 deletions
diff --git a/src/comp/back/abi.rs b/src/comp/back/abi.rs index e71ed2eeff9..3d0a1ba8c09 100644 --- a/src/comp/back/abi.rs +++ b/src/comp/back/abi.rs @@ -88,13 +88,13 @@ const worst_case_glue_call_args: int = 7; const abi_version: uint = 1u; -fn memcpy_glue_name() -> istr { ret ~"rust_memcpy_glue"; } +fn memcpy_glue_name() -> str { ret "rust_memcpy_glue"; } -fn bzero_glue_name() -> istr { ret ~"rust_bzero_glue"; } +fn bzero_glue_name() -> str { ret "rust_bzero_glue"; } -fn yield_glue_name() -> istr { ret ~"rust_yield_glue"; } +fn yield_glue_name() -> str { ret "rust_yield_glue"; } -fn no_op_type_glue_name() -> istr { ret ~"rust_no_op_type_glue"; } +fn no_op_type_glue_name() -> str { ret "rust_no_op_type_glue"; } // // Local Variables: // mode: rust diff --git a/src/comp/back/link.rs b/src/comp/back/link.rs index 553478d7ed1..0bbdafd1e6b 100644 --- a/src/comp/back/link.rs +++ b/src/comp/back/link.rs @@ -31,37 +31,35 @@ tag output_type { output_type_exe; } -fn llvm_err(sess: session::session, msg: &istr) { +fn llvm_err(sess: session::session, msg: &str) { let buf = llvm::LLVMRustGetLastError(); if buf == std::ptr::null() { sess.fatal(msg); - } else { - sess.fatal( - msg + ~": " + str::str_from_cstr(buf)); - } + } else { sess.fatal(msg + ": " + str::str_from_cstr(buf)); } } fn link_intrinsics(sess: session::session, llmod: ModuleRef) { - let path = - fs::connect(sess.get_opts().sysroot, - ~"lib/intrinsics.bc"); - let membuf = str::as_buf(path, { |buf| - llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf) - }); + let path = fs::connect(sess.get_opts().sysroot, "lib/intrinsics.bc"); + let membuf = + str::as_buf( + path, + {|buf| + llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf) + }); if membuf as uint == 0u { - llvm_err(sess, ~"installation problem: couldn't open " + path); + llvm_err(sess, "installation problem: couldn't open " + path); fail; } let llintrinsicsmod = llvm::LLVMRustParseBitcode(membuf); llvm::LLVMDisposeMemoryBuffer(membuf); if llintrinsicsmod as uint == 0u { - llvm_err(sess, ~"installation problem: couldn't parse intrinsics.bc"); + llvm_err(sess, "installation problem: couldn't parse intrinsics.bc"); fail; } let linkres = llvm::LLVMLinkModules(llmod, llintrinsicsmod); llvm::LLVMDisposeModule(llintrinsicsmod); if linkres == False { - llvm_err(sess, ~"couldn't link the module with the intrinsics"); + llvm_err(sess, "couldn't link the module with the intrinsics"); fail; } } @@ -77,15 +75,15 @@ mod write { // Decides what to call an intermediate file, given the name of the output // and the extension to use. - fn mk_intermediate_name(output_path: &istr, extension: &istr) -> istr { + fn mk_intermediate_name(output_path: &str, extension: &str) -> str { let dot_pos = str::index(output_path, '.' as u8); let stem; if dot_pos < 0 { stem = output_path; } else { stem = str::substr(output_path, 0u, dot_pos as uint); } - ret stem + ~"." + extension; + ret stem + "." + extension; } - fn run_passes(sess: session::session, llmod: ModuleRef, output: &istr) { + fn run_passes(sess: session::session, llmod: ModuleRef, output: &str) { let opts = sess.get_opts(); if opts.time_llvm_passes { llvm::LLVMRustEnableTimePasses(); } link_intrinsics(sess, llmod); @@ -102,17 +100,19 @@ mod write { alt opts.output_type { output_type_bitcode. { if opts.optimize != 0u { - let filename = mk_intermediate_name(output, ~"no-opt.bc"); - str::as_buf(filename, { |buf| - llvm::LLVMWriteBitcodeToFile(llmod, buf) - }); + let filename = mk_intermediate_name(output, "no-opt.bc"); + str::as_buf(filename, + {|buf| + llvm::LLVMWriteBitcodeToFile(llmod, buf) + }); } } _ { - let filename = mk_intermediate_name(output, ~"bc"); - str::as_buf(filename, { |buf| - llvm::LLVMWriteBitcodeToFile(llmod, buf) - }); + let filename = mk_intermediate_name(output, "bc"); + str::as_buf(filename, + {|buf| + llvm::LLVMWriteBitcodeToFile(llmod, buf) + }); } } } @@ -183,25 +183,28 @@ mod write { if opts.save_temps { // Always output the bitcode file with --save-temps - let filename = mk_intermediate_name(output, ~"opt.bc"); + let filename = mk_intermediate_name(output, "opt.bc"); llvm::LLVMRunPassManager(pm.llpm, llmod); - str::as_buf(filename, { |buf| - llvm::LLVMWriteBitcodeToFile(llmod, buf) - }); + str::as_buf(filename, + {|buf| + llvm::LLVMWriteBitcodeToFile(llmod, buf) + }); pm = mk_pass_manager(); // Save the assembly file if -S is used if opts.output_type == output_type_assembly { let _: () = - str::as_buf(x86::get_target_triple(), { |buf_t| - str::as_buf(output, { |buf_o| + str::as_buf(x86::get_target_triple(), {|buf_t| + str::as_buf(output, {|buf_o| llvm::LLVMRustWriteOutputFile( - pm.llpm, llmod, + pm.llpm, + llmod, buf_t, buf_o, LLVMAssemblyFile, CodeGenOptLevel) - })}); + }) + }); } @@ -210,28 +213,32 @@ mod write { if opts.output_type == output_type_object || opts.output_type == output_type_exe { let _: () = - str::as_buf(x86::get_target_triple(), { |buf_t| - str::as_buf(output, { |buf_o| - llvm::LLVMRustWriteOutputFile( - pm.llpm, llmod, - buf_t, - buf_o, - LLVMObjectFile, - CodeGenOptLevel) - })}); + str::as_buf(x86::get_target_triple(), {|buf_t| + str::as_buf(output, {|buf_o| + llvm::LLVMRustWriteOutputFile(pm.llpm, + llmod, + buf_t, + buf_o, + LLVMObjectFile, + CodeGenOptLevel) + }) + }); } } else { // If we aren't saving temps then just output the file // type corresponding to the '-c' or '-S' flag used - let _: () = str::as_buf(x86::get_target_triple(), { |buf_t| - str::as_buf(output, { |buf_o| - llvm::LLVMRustWriteOutputFile(pm.llpm, llmod, - buf_t, - buf_o, - FileType, - CodeGenOptLevel) - })}); + let _: () = + str::as_buf(x86::get_target_triple(), {|buf_t| + str::as_buf(output, {|buf_o| + llvm::LLVMRustWriteOutputFile(pm.llpm, + llmod, + buf_t, + buf_o, + FileType, + CodeGenOptLevel) + }) + }); } // Clean up and return @@ -243,9 +250,8 @@ mod write { // flag, then output it here llvm::LLVMRunPassManager(pm.llpm, llmod); - str::as_buf(output, { |buf| - llvm::LLVMWriteBitcodeToFile(llmod, buf) - }); + str::as_buf(output, + {|buf| llvm::LLVMWriteBitcodeToFile(llmod, buf) }); llvm::LLVMDisposeModule(llmod); if opts.time_llvm_passes { llvm::LLVMRustPrintPassTimings(); } } @@ -303,30 +309,30 @@ mod write { * */ -type link_meta = {name: istr, vers: istr, extras_hash: istr}; +type link_meta = {name: str, vers: str, extras_hash: str}; -fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr, +fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str, sha: sha1) -> link_meta { type provided_metas = - {name: option::t<istr>, - vers: option::t<istr>, + {name: option::t<str>, + vers: option::t<str>, cmh_items: [@ast::meta_item]}; fn provided_link_metas(sess: &session::session, c: &ast::crate) -> provided_metas { - let name: option::t<istr> = none; - let vers: option::t<istr> = none; + let name: option::t<str> = none; + let vers: option::t<str> = none; let cmh_items: [@ast::meta_item] = []; let linkage_metas = attr::find_linkage_metas(c.node.attrs); attr::require_unique_names(sess, linkage_metas); for meta: @ast::meta_item in linkage_metas { - if attr::get_meta_item_name(meta) == ~"name" { + if attr::get_meta_item_name(meta) == "name" { alt attr::get_meta_item_value_str(meta) { some(v) { name = some(v); } none. { cmh_items += [meta]; } } - } else if attr::get_meta_item_name(meta) == ~"vers" { + } else if attr::get_meta_item_name(meta) == "vers" { alt attr::get_meta_item_value_str(meta) { some(v) { vers = some(v); } none. { cmh_items += [meta]; } @@ -338,12 +344,12 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr, // This calculates CMH as defined above fn crate_meta_extras_hash(sha: sha1, _crate: &ast::crate, - metas: &provided_metas) -> istr { - fn len_and_str(s: &istr) -> istr { + metas: &provided_metas) -> str { + fn len_and_str(s: &str) -> str { ret #fmt["%u_%s", str::byte_len(s), s]; } - fn len_and_str_lit(l: &ast::lit) -> istr { + fn len_and_str_lit(l: &ast::lit) -> str { ret len_and_str(pprust::lit_to_str(@l)); } @@ -357,9 +363,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr, sha.input_str(len_and_str(key)); sha.input_str(len_and_str_lit(value)); } - ast::meta_word(name) { - sha.input_str(len_and_str(name)); - } + ast::meta_word(name) { sha.input_str(len_and_str(name)); } ast::meta_list(_, _) { // FIXME (#607): Implement this fail "unimplemented meta_item variant"; @@ -369,40 +373,37 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr, ret truncated_sha1_result(sha); } - fn warn_missing(sess: &session::session, name: &istr, default: &istr) { + fn warn_missing(sess: &session::session, name: &str, default: &str) { if !sess.get_opts().library { ret; } - sess.warn( - #fmt["missing crate link meta '%s', using '%s' as default", + sess.warn(#fmt["missing crate link meta '%s', using '%s' as default", name, default]); } fn crate_meta_name(sess: &session::session, _crate: &ast::crate, - output: &istr, metas: &provided_metas) -> istr { + output: &str, metas: &provided_metas) -> str { ret alt metas.name { some(v) { v } none. { let name = { - let os = str::split( - fs::basename(output), - '.' as u8); + let os = str::split(fs::basename(output), '.' as u8); assert (vec::len(os) >= 2u); vec::pop(os); - str::connect(os, ~".") + str::connect(os, ".") }; - warn_missing(sess, ~"name", name); + warn_missing(sess, "name", name); name } }; } fn crate_meta_vers(sess: &session::session, _crate: &ast::crate, - metas: &provided_metas) -> istr { + metas: &provided_metas) -> str { ret alt metas.vers { some(v) { v } none. { - let vers = ~"0.0"; - warn_missing(sess, ~"vers", vers); + let vers = "0.0"; + warn_missing(sess, "vers", vers); vers } }; @@ -416,32 +417,32 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr, ret {name: name, vers: vers, extras_hash: extras_hash}; } -fn truncated_sha1_result(sha: sha1) -> istr { +fn truncated_sha1_result(sha: sha1) -> str { ret str::substr(sha.result_str(), 0u, 16u); } // This calculates STH for a symbol, as defined above fn symbol_hash(tcx: ty::ctxt, sha: sha1, t: ty::t, link_meta: &link_meta) -> - istr { + str { // NB: do *not* use abbrevs here as we want the symbol names // to be independent of one another in the crate. sha.reset(); sha.input_str(link_meta.name); - sha.input_str(~"-"); + sha.input_str("-"); // FIXME: This wants to be link_meta.meta_hash sha.input_str(link_meta.name); - sha.input_str(~"-"); + sha.input_str("-"); sha.input_str(encoder::encoded_ty(tcx, t)); let hash = truncated_sha1_result(sha); // Prefix with _ so that it never blends into adjacent digits - ret ~"_" + hash; + ret "_" + hash; } -fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> istr { - let hash = ~""; +fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> str { + let hash = ""; alt ccx.type_sha1s.find(t) { some(h) { hash = h; } none. { @@ -452,48 +453,46 @@ fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> istr { ret hash; } -fn mangle(ss: &[istr]) -> istr { +fn mangle(ss: &[str]) -> str { // Follow C++ namespace-mangling style - let n = ~"_ZN"; // Begin name-sequence. + let n = "_ZN"; // Begin name-sequence. - for s: istr in ss { - n += #fmt["%u%s", str::byte_len(s), s]; - } - n += ~"E"; // End name-sequence. + for s: str in ss { n += #fmt["%u%s", str::byte_len(s), s]; } + n += "E"; // End name-sequence. ret n; } -fn exported_name(path: &[istr], hash: &istr, _vers: &istr) -> istr { +fn exported_name(path: &[str], hash: &str, _vers: &str) -> str { // FIXME: versioning isn't working yet ret mangle(path + [hash]); // + "@" + vers; } -fn mangle_exported_name(ccx: &@crate_ctxt, path: &[istr], t: ty::t) -> istr { +fn mangle_exported_name(ccx: &@crate_ctxt, path: &[str], t: ty::t) -> str { let hash = get_symbol_hash(ccx, t); ret exported_name(path, hash, ccx.link_meta.vers); } -fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: ty::t, name: &istr) - -> istr { +fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: ty::t, name: &str) + -> str { let s = util::ppaux::ty_to_short_str(ccx.tcx, t); let hash = get_symbol_hash(ccx, t); ret mangle([name, s, hash]); } -fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[istr], - flav: &istr) -> istr { +fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[str], + flav: &str) -> str { ret mangle(path + [ccx.names.next(flav)]); } -fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[istr]) -> istr { +fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[str]) -> str { ret mangle(path); } -fn mangle_internal_name_by_seq(ccx: &@crate_ctxt, flav: &istr) -> istr { +fn mangle_internal_name_by_seq(ccx: &@crate_ctxt, flav: &str) -> str { ret ccx.names.next(flav); } // diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs index dc007a1d3f2..c3ae653316b 100644 --- a/src/comp/back/upcall.rs +++ b/src/comp/back/upcall.rs @@ -46,16 +46,14 @@ type upcalls = fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef, taskptr_type: TypeRef, llmod: ModuleRef) -> @upcalls { - fn decl(llmod: ModuleRef, name: &istr, tys: [TypeRef], rv: TypeRef) -> + fn decl(llmod: ModuleRef, name: &str, tys: [TypeRef], rv: TypeRef) -> ValueRef { let arg_tys: [TypeRef] = []; for t: TypeRef in tys { arg_tys += [t]; } let fn_ty = T_fn(arg_tys, rv); - ret trans::decl_cdecl_fn(llmod, - ~"upcall_" + name, fn_ty); + ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty); } - fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef, - name: &istr, + fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef, name: &str, tys: [TypeRef], rv: TypeRef) -> ValueRef { ret decl(llmod, name, [taskptr_type] + tys, rv); } @@ -64,44 +62,45 @@ fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef, let dr = bind decl(llmod, _, _, _); let empty_vec: [TypeRef] = []; - ret @{grow_task: dv(~"grow_task", [T_size_t()]), - _yield: dv(~"yield", empty_vec), - sleep: dv(~"sleep", [T_size_t()]), - _fail: dv(~"fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]), - kill: dv(~"kill", [taskptr_type]), - exit: dv(~"exit", empty_vec), + ret @{grow_task: dv("grow_task", [T_size_t()]), + _yield: dv("yield", empty_vec), + sleep: dv("sleep", [T_size_t()]), + _fail: dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]), + kill: dv("kill", [taskptr_type]), + exit: dv("exit", empty_vec), malloc: - d(~"malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), - free: dv(~"free", [T_ptr(T_i8()), T_int()]), + d("malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), + free: dv("free", [T_ptr(T_i8()), T_int()]), shared_malloc: - d(~"shared_malloc", [T_size_t(), T_ptr(tydesc_type)], + d("shared_malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), - shared_free: dv(~"shared_free", [T_ptr(T_i8())]), - mark: d(~"mark", [T_ptr(T_i8())], T_int()), + shared_free: dv("shared_free", [T_ptr(T_i8())]), + mark: d("mark", [T_ptr(T_i8())], T_int()), get_type_desc: - d(~"get_type_desc", + d("get_type_desc", [T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(), T_ptr(T_ptr(tydesc_type)), T_int()], T_ptr(tydesc_type)), vec_grow: - d(~"vec_grow", [T_ptr(T_ptr(T_opaque_vec())), T_int()], + d("vec_grow", [T_ptr(T_ptr(T_opaque_vec())), T_int()], T_void()), vec_push: - d(~"vec_push", + d("vec_push", [T_ptr(T_ptr(T_opaque_vec())), T_ptr(tydesc_type), T_ptr(T_i8())], T_void()), cmp_type: - dr(~"cmp_type", + dr("cmp_type", [T_ptr(T_i1()), taskptr_type, T_ptr(tydesc_type), T_ptr(T_ptr(tydesc_type)), T_ptr(T_i8()), T_ptr(T_i8()), T_i8()], T_void()), log_type: - dr(~"log_type", + dr("log_type", [taskptr_type, T_ptr(tydesc_type), T_ptr(T_i8()), T_i32()], T_void()), - dynastack_mark: d(~"dynastack_mark", [], T_ptr(T_i8())), - dynastack_alloc: d(~"dynastack_alloc_2", - [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), - dynastack_free: d(~"dynastack_free", [T_ptr(T_i8())], T_void())}; + dynastack_mark: d("dynastack_mark", [], T_ptr(T_i8())), + dynastack_alloc: + d("dynastack_alloc_2", [T_size_t(), T_ptr(tydesc_type)], + T_ptr(T_i8())), + dynastack_free: d("dynastack_free", [T_ptr(T_i8())], T_void())}; } // // Local Variables: diff --git a/src/comp/back/x86.rs b/src/comp/back/x86.rs index 02b33ff105c..80f0245a3cd 100644 --- a/src/comp/back/x86.rs +++ b/src/comp/back/x86.rs @@ -4,32 +4,30 @@ import lib::llvm::llvm::ModuleRef; import std::str; import std::os::target_os; -fn get_module_asm() -> istr { ret ~""; } +fn get_module_asm() -> str { ret ""; } -fn get_meta_sect_name() -> istr { - if str::eq(target_os(), ~"macos") { ret ~"__DATA,__note.rustc"; } - if str::eq(target_os(), ~"win32") { ret ~".note.rustc"; } - ret ~".note.rustc"; +fn get_meta_sect_name() -> str { + if str::eq(target_os(), "macos") { ret "__DATA,__note.rustc"; } + if str::eq(target_os(), "win32") { ret ".note.rustc"; } + ret ".note.rustc"; } -fn get_data_layout() -> istr { - if str::eq(target_os(), ~"macos") { - ret ~"e-p:32:32:32-i1:8:8-i8:8:8-i16:16:16" + - ~"-i32:32:32-i64:32:64" + - ~"-f32:32:32-f64:32:64-v64:64:64" + - ~"-v128:128:128-a0:0:64-f80:128:128" + - ~"-n8:16:32"; +fn get_data_layout() -> str { + if str::eq(target_os(), "macos") { + ret "e-p:32:32:32-i1:8:8-i8:8:8-i16:16:16" + "-i32:32:32-i64:32:64" + + "-f32:32:32-f64:32:64-v64:64:64" + + "-v128:128:128-a0:0:64-f80:128:128" + "-n8:16:32"; } - if str::eq(target_os(), ~"win32") { - ret ~"e-p:32:32-f64:64:64-i64:64:64-f80:32:32-n8:16:32"; + if str::eq(target_os(), "win32") { + ret "e-p:32:32-f64:64:64-i64:64:64-f80:32:32-n8:16:32"; } - ret ~"e-p:32:32-f64:32:64-i64:32:64-f80:32:32-n8:16:32"; + ret "e-p:32:32-f64:32:64-i64:32:64-f80:32:32-n8:16:32"; } -fn get_target_triple() -> istr { - if str::eq(target_os(), ~"macos") { ret ~"i686-apple-darwin"; } - if str::eq(target_os(), ~"win32") { ret ~"i686-pc-mingw32"; } - ret ~"i686-unknown-linux-gnu"; +fn get_target_triple() -> str { + if str::eq(target_os(), "macos") { ret "i686-apple-darwin"; } + if str::eq(target_os(), "win32") { ret "i686-pc-mingw32"; } + ret "i686-unknown-linux-gnu"; } // // Local Variables: diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs index 829c40ed803..9f8249215e8 100644 --- a/src/comp/driver/rustc.rs +++ b/src/comp/driver/rustc.rs @@ -41,29 +41,26 @@ import back::link::output_type; tag pp_mode { ppm_normal; ppm_expanded; ppm_typed; ppm_identified; } -fn default_configuration(sess: session::session, - argv0: &istr, input: &istr) -> +fn default_configuration(sess: session::session, argv0: &str, input: &str) -> ast::crate_cfg { let libc = alt sess.get_targ_cfg().os { - session::os_win32. { ~"msvcrt.dll" } - session::os_macos. { ~"libc.dylib" } - session::os_linux. { ~"libc.so.6" } - _ { ~"libc.so" } + session::os_win32. { "msvcrt.dll" } + session::os_macos. { "libc.dylib" } + session::os_linux. { "libc.so.6" } + _ { "libc.so" } }; let mk = attr::mk_name_value_item_str; ret [ // Target bindings. - mk(~"target_os", std::os::target_os()), - mk(~"target_arch", ~"x86"), - mk(~"target_libc", libc), + mk("target_os", std::os::target_os()), mk("target_arch", "x86"), + mk("target_libc", libc), // Build bindings. - mk(~"build_compiler", argv0), - mk(~"build_input", input)]; + mk("build_compiler", argv0), mk("build_input", input)]; } -fn build_configuration(sess: session::session, argv0: &istr, input: &istr) -> +fn build_configuration(sess: session::session, argv0: &str, input: &str) -> ast::crate_cfg { // Combine the configuration requested by the session (command line) with // some default and generated configuration items @@ -72,51 +69,46 @@ fn build_configuration(sess: session::session, argv0: &istr, input: &istr) -> // If the user wants a test runner, then add the test cfg let gen_cfg = { - if sess.get_opts().test - && !attr::contains_name(user_cfg, ~"test") { - [attr::mk_word_item(~"test")] + if sess.get_opts().test && !attr::contains_name(user_cfg, "test") + { + [attr::mk_word_item("test")] } else { [] } }; ret user_cfg + gen_cfg + default_cfg; } // Convert strings provided as --cfg [cfgspec] into a crate_cfg -fn parse_cfgspecs(cfgspecs: &[istr]) -> ast::crate_cfg { +fn parse_cfgspecs(cfgspecs: &[str]) -> ast::crate_cfg { // FIXME: It would be nice to use the parser to parse all varieties of // meta_item here. At the moment we just support the meta_word variant. let words = []; - for s: istr in cfgspecs { - words += [attr::mk_word_item(s)]; - } + for s: str in cfgspecs { words += [attr::mk_word_item(s)]; } ret words; } -fn input_is_stdin(filename: &istr) -> bool { filename == ~"-" } +fn input_is_stdin(filename: &str) -> bool { filename == "-" } -fn parse_input(sess: session::session, cfg: &ast::crate_cfg, - input: &istr) -> @ast::crate { +fn parse_input(sess: session::session, cfg: &ast::crate_cfg, input: &str) -> + @ast::crate { if !input_is_stdin(input) { - parser::parse_crate_from_file( - input, cfg, sess.get_parse_sess()) + parser::parse_crate_from_file(input, cfg, sess.get_parse_sess()) } else { parse_input_src(sess, cfg, input).crate } } -fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, - infile: &istr) -> {crate: @ast::crate, src: istr} { +fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, infile: &str) + -> {crate: @ast::crate, src: str} { let srcbytes = - if infile != ~"-" { + if infile != "-" { io::file_reader(infile) } else { io::stdin() }.read_whole_stream(); let src = str::unsafe_from_bytes(srcbytes); let crate = - parser::parse_crate_from_source_str( - infile, - src, cfg, - sess.get_parse_sess()); + parser::parse_crate_from_source_str(infile, src, cfg, + sess.get_parse_sess()); ret {crate: crate, src: src}; } -fn time<@T>(do_it: bool, what: &istr, thunk: fn() -> T) -> T { +fn time<@T>(do_it: bool, what: &str, thunk: fn() -> T) -> T { if !do_it { ret thunk(); } let start = std::time::precise_time_s(); let rv = thunk(); @@ -126,61 +118,60 @@ fn time<@T>(do_it: bool, what: &istr, thunk: fn() -> T) -> T { ret rv; } -fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: &istr, - output: &istr) { +fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: &str, + output: &str) { let time_passes = sess.get_opts().time_passes; let crate = - time(time_passes, ~"parsing", bind parse_input(sess, cfg, input)); + time(time_passes, "parsing", bind parse_input(sess, cfg, input)); if sess.get_opts().parse_only { ret; } crate = - time(time_passes, ~"configuration", + time(time_passes, "configuration", bind front::config::strip_unconfigured_items(crate)); if sess.get_opts().test { crate = - time(time_passes, ~"building test harness", + time(time_passes, "building test harness", bind front::test::modify_for_testing(crate)); } crate = - time(time_passes, ~"expansion", + time(time_passes, "expansion", bind syntax::ext::expand::expand_crate(sess, crate)); let ast_map = - time(time_passes, ~"ast indexing", + time(time_passes, "ast indexing", bind middle::ast_map::map_crate(*crate)); - time(time_passes, ~"external crate/lib resolution", + time(time_passes, "external crate/lib resolution", bind creader::read_crates(sess, *crate)); let {def_map: def_map, ext_map: ext_map} = - time(time_passes, ~"resolution", + time(time_passes, "resolution", bind resolve::resolve_crate(sess, ast_map, crate)); let freevars = - time(time_passes, ~"freevar finding", + time(time_passes, "freevar finding", bind freevars::annotate_freevars(def_map, crate)); let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, ast_map, freevars); - time(time_passes, ~"typechecking", - bind typeck::check_crate(ty_cx, crate)); - time(time_passes, ~"alt checking", + time(time_passes, "typechecking", bind typeck::check_crate(ty_cx, crate)); + time(time_passes, "alt checking", bind middle::check_alt::check_crate(ty_cx, crate)); if sess.get_opts().run_typestate { - time(time_passes, ~"typestate checking", + time(time_passes, "typestate checking", bind middle::tstate::ck::check_crate(ty_cx, crate)); } - let mut_map = time(time_passes, ~"mutability checking", - bind middle::mut::check_crate(ty_cx, crate)); - time(time_passes, ~"alias checking", + let mut_map = + time(time_passes, "mutability checking", + bind middle::mut::check_crate(ty_cx, crate)); + time(time_passes, "alias checking", bind middle::alias::check_crate(ty_cx, crate)); - time(time_passes, ~"kind checking", - bind kind::check_crate(ty_cx, crate)); + time(time_passes, "kind checking", bind kind::check_crate(ty_cx, crate)); if sess.get_opts().no_trans { ret; } - let llmod = time(time_passes, ~"translation", - bind trans::trans_crate(sess, crate, ty_cx, - output, - ast_map, mut_map)); - time(time_passes, ~"LLVM passes", + let llmod = + time(time_passes, "translation", + bind trans::trans_crate(sess, crate, ty_cx, output, ast_map, + mut_map)); + time(time_passes, "LLVM passes", bind link::write::run_passes(sess, llmod, output)); } fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, - input: &istr, ppm: pp_mode) { + input: &str, ppm: pp_mode) { fn ann_paren_for_expr(node: &pprust::ann_node) { alt node { pprust::node_expr(s, expr) { pprust::popen(s); } _ { } } } @@ -188,11 +179,9 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, alt node { pprust::node_expr(s, expr) { pp::space(s.s); - pp::word(s.s, ~"as"); + pp::word(s.s, "as"); pp::space(s.s); - pp::word( - s.s, - ppaux::ty_to_str(tcx, ty::expr_ty(tcx, expr))); + pp::word(s.s, ppaux::ty_to_str(tcx, ty::expr_ty(tcx, expr))); pprust::pclose(s); } _ { } @@ -202,18 +191,16 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, alt node { pprust::node_item(s, item) { pp::space(s.s); - pprust::synth_comment( - s, int::to_str(item.id, 10u)); + pprust::synth_comment(s, int::to_str(item.id, 10u)); } pprust::node_block(s, blk) { pp::space(s.s); - pprust::synth_comment( - s, ~"block " + int::to_str(blk.node.id, 10u)); + pprust::synth_comment(s, + "block " + int::to_str(blk.node.id, 10u)); } pprust::node_expr(s, expr) { pp::space(s.s); - pprust::synth_comment( - s, int::to_str(expr.id, 10u)); + pprust::synth_comment(s, int::to_str(expr.id, 10u)); pprust::pclose(s); } _ { } @@ -249,26 +236,20 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, } ppm_normal. { ann = pprust::no_ann(); } } - pprust::print_crate(sess.get_codemap(), crate, - input, - io::string_reader(src), - io::stdout(), ann); + pprust::print_crate(sess.get_codemap(), crate, input, + io::string_reader(src), io::stdout(), ann); } -fn version(argv0: &istr) { - let vers = ~"unknown version"; +fn version(argv0: &str) { + let vers = "unknown version"; let env_vers = #env["CFG_VERSION"]; if str::byte_len(env_vers) != 0u { vers = env_vers; } - io::stdout().write_str( - #fmt["%s %s\n", - argv0, - vers]); + io::stdout().write_str(#fmt["%s %s\n", argv0, vers]); } -fn usage(argv0: &istr) { - io::stdout().write_str( - #fmt["usage: %s [options] <input>\n", argv0] + - ~" +fn usage(argv0: &str) { + io::stdout().write_str(#fmt["usage: %s [options] <input>\n", argv0] + + " options: -h --help display this message @@ -304,41 +285,39 @@ options: "); } -fn get_os(triple: &istr) -> session::os { - ret if str::find(triple, ~"win32") >= 0 || - str::find(triple, ~"mingw32") >= 0 { +fn get_os(triple: &str) -> session::os { + ret if str::find(triple, "win32") >= 0 || + str::find(triple, "mingw32") >= 0 { session::os_win32 - } else if str::find(triple, ~"darwin") >= 0 { + } else if str::find(triple, "darwin") >= 0 { session::os_macos - } else if str::find(triple, ~"linux") >= 0 { + } else if str::find(triple, "linux") >= 0 { session::os_linux - } else { log_err ~"Unknown operating system!"; fail }; + } else { log_err "Unknown operating system!"; fail }; } -fn get_arch(triple: &istr) -> session::arch { - ret if str::find(triple, ~"i386") >= 0 || - str::find(triple, ~"i486") >= 0 || - str::find(triple, ~"i586") >= 0 || - str::find(triple, ~"i686") >= 0 || - str::find(triple, ~"i786") >= 0 { +fn get_arch(triple: &str) -> session::arch { + ret if str::find(triple, "i386") >= 0 || str::find(triple, "i486") >= 0 || + str::find(triple, "i586") >= 0 || + str::find(triple, "i686") >= 0 || + str::find(triple, "i786") >= 0 { session::arch_x86 - } else if str::find(triple, ~"x86_64") >= 0 { + } else if str::find(triple, "x86_64") >= 0 { session::arch_x64 - } else if str::find(triple, ~"arm") >= 0 || - str::find(triple, ~"xscale") >= 0 { + } else if str::find(triple, "arm") >= 0 || + str::find(triple, "xscale") >= 0 { session::arch_arm - } else { log_err ~"Unknown architecture! " + triple; fail }; + } else { log_err "Unknown architecture! " + triple; fail }; } -fn get_default_sysroot(binary: &istr) -> istr { +fn get_default_sysroot(binary: &str) -> str { let dirname = fs::dirname(binary); - if str::eq(dirname, binary) { ret ~"."; } + if str::eq(dirname, binary) { ret "."; } ret dirname; } fn build_target_config() -> @session::config { - let triple: istr = - str::str_from_cstr(llvm::llvm::LLVMRustGetHostTriple()); + let triple: str = str::str_from_cstr(llvm::llvm::LLVMRustGetHostTriple()); let target_cfg: @session::config = @{os: get_os(triple), arch: get_arch(triple), @@ -348,51 +327,49 @@ fn build_target_config() -> @session::config { ret target_cfg; } -fn build_session_options(binary: &istr, match: &getopts::match, - binary_dir: &istr) -> @session::options { - let library = opt_present(match, ~"lib"); - let static = opt_present(match, ~"static"); +fn build_session_options(binary: &str, match: &getopts::match, + binary_dir: &str) -> @session::options { + let library = opt_present(match, "lib"); + let static = opt_present(match, "static"); - let library_search_paths = [binary_dir + ~"/lib"]; - let lsp_vec = getopts::opt_strs(match, ~"L"); - for lsp: istr in lsp_vec { - library_search_paths += [lsp]; - } + let library_search_paths = [binary_dir + "/lib"]; + let lsp_vec = getopts::opt_strs(match, "L"); + for lsp: str in lsp_vec { library_search_paths += [lsp]; } - let parse_only = opt_present(match, ~"parse-only"); - let no_trans = opt_present(match, ~"no-trans"); + let parse_only = opt_present(match, "parse-only"); + let no_trans = opt_present(match, "no-trans"); let output_type = if parse_only || no_trans { link::output_type_none - } else if opt_present(match, ~"S") { + } else if opt_present(match, "S") { link::output_type_assembly - } else if opt_present(match, ~"c") { + } else if opt_present(match, "c") { link::output_type_object - } else if opt_present(match, ~"emit-llvm") { + } else if opt_present(match, "emit-llvm") { link::output_type_bitcode } else { link::output_type_exe }; - let verify = !opt_present(match, ~"noverify"); - let save_temps = opt_present(match, ~"save-temps"); - let debuginfo = opt_present(match, ~"g"); - let stats = opt_present(match, ~"stats"); - let time_passes = opt_present(match, ~"time-passes"); - let time_llvm_passes = opt_present(match, ~"time-llvm-passes"); - let run_typestate = !opt_present(match, ~"no-typestate"); - let sysroot_opt = getopts::opt_maybe_str(match, ~"sysroot"); + let verify = !opt_present(match, "noverify"); + let save_temps = opt_present(match, "save-temps"); + let debuginfo = opt_present(match, "g"); + let stats = opt_present(match, "stats"); + let time_passes = opt_present(match, "time-passes"); + let time_llvm_passes = opt_present(match, "time-llvm-passes"); + let run_typestate = !opt_present(match, "no-typestate"); + let sysroot_opt = getopts::opt_maybe_str(match, "sysroot"); let opt_level: uint = - if opt_present(match, ~"O") { - if opt_present(match, ~"OptLevel") { + if opt_present(match, "O") { + if opt_present(match, "OptLevel") { log_err "error: -O and --OptLevel both provided"; fail; } 2u - } else if opt_present(match, ~"OptLevel") { - alt getopts::opt_str(match, ~"OptLevel") { - ~"0" { 0u } - ~"1" { 1u } - ~"2" { 2u } - ~"3" { 3u } + } else if opt_present(match, "OptLevel") { + alt getopts::opt_str(match, "OptLevel") { + "0" { 0u } + "1" { 1u } + "2" { 2u } + "3" { 3u } _ { log_err "error: optimization level needs " + "to be between 0-3"; @@ -405,10 +382,9 @@ fn build_session_options(binary: &istr, match: &getopts::match, none. { get_default_sysroot(binary) } some(s) { s } }; - let cfg = parse_cfgspecs( - getopts::opt_strs(match, ~"cfg")); - let test = opt_present(match, ~"test"); - let do_gc = opt_present(match, ~"gc"); + let cfg = parse_cfgspecs(getopts::opt_strs(match, "cfg")); + let test = opt_present(match, "test"); + let do_gc = opt_present(match, "gc"); let sopts: @session::options = @{library: library, static: static, @@ -439,32 +415,31 @@ fn build_session(sopts: @session::options) -> session::session { none, 0u); } -fn parse_pretty(sess: session::session, name: &istr) -> pp_mode { - if str::eq(name, ~"normal") { +fn parse_pretty(sess: session::session, name: &str) -> pp_mode { + if str::eq(name, "normal") { ret ppm_normal; - } else if str::eq(name, ~"expanded") { + } else if str::eq(name, "expanded") { ret ppm_expanded; - } else if str::eq(name, ~"typed") { + } else if str::eq(name, "typed") { ret ppm_typed; - } else if str::eq(name, ~"identified") { ret ppm_identified; } - sess.fatal(~"argument to `pretty` must be one of `normal`, `typed`, or " - + ~"`identified`"); + } else if str::eq(name, "identified") { ret ppm_identified; } + sess.fatal("argument to `pretty` must be one of `normal`, `typed`, or " + + "`identified`"); } fn opts() -> [getopts::opt] { - ret [optflag(~"h"), optflag(~"help"), optflag(~"v"), optflag(~"version"), - optflag(~"glue"), optflag(~"emit-llvm"), optflagopt(~"pretty"), - optflag(~"ls"), optflag(~"parse-only"), optflag(~"no-trans"), - optflag(~"O"), optopt(~"OptLevel"), optmulti(~"L"), - optflag(~"S"), optflag(~"c"), optopt(~"o"), optflag(~"g"), - optflag(~"save-temps"), optopt(~"sysroot"), optflag(~"stats"), - optflag(~"time-passes"), optflag(~"time-llvm-passes"), - optflag(~"no-typestate"), optflag(~"noverify"), optmulti(~"cfg"), - optflag(~"test"), optflag(~"lib"), optflag(~"static"), - optflag(~"gc")]; + ret [optflag("h"), optflag("help"), optflag("v"), optflag("version"), + optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"), + optflag("ls"), optflag("parse-only"), optflag("no-trans"), + optflag("O"), optopt("OptLevel"), optmulti("L"), optflag("S"), + optflag("c"), optopt("o"), optflag("g"), optflag("save-temps"), + optopt("sysroot"), optflag("stats"), optflag("time-passes"), + optflag("time-llvm-passes"), optflag("no-typestate"), + optflag("noverify"), optmulti("cfg"), optflag("test"), + optflag("lib"), optflag("static"), optflag("gc")]; } -fn main(args: [istr]) { +fn main(args: [str]) { let binary = vec::shift(args); let binary_dir = fs::dirname(binary); let match = @@ -475,49 +450,45 @@ fn main(args: [istr]) { fail } }; - if opt_present(match, ~"h") || opt_present(match, ~"help") { + if opt_present(match, "h") || opt_present(match, "help") { usage(binary); ret; } - if opt_present(match, ~"v") || opt_present(match, ~"version") { + if opt_present(match, "v") || opt_present(match, "version") { version(binary); ret; } let sopts = build_session_options(binary, match, binary_dir); let sess = build_session(sopts); - let n_inputs = vec::len::<istr>(match.free); - let output_file = getopts::opt_maybe_str(match, ~"o"); - let glue = opt_present(match, ~"glue"); + let n_inputs = vec::len::<str>(match.free); + let output_file = getopts::opt_maybe_str(match, "o"); + let glue = opt_present(match, "glue"); if glue { if n_inputs > 0u { - sess.fatal(~"No input files allowed with --glue."); + sess.fatal("No input files allowed with --glue."); } - let out = option::from_maybe::<istr>(~"glue.bc", output_file); + let out = option::from_maybe::<str>("glue.bc", output_file); middle::trans::make_common_glue(sess, out); ret; } if n_inputs == 0u { - sess.fatal(~"No input filename given."); + sess.fatal("No input filename given."); } else if n_inputs > 1u { - sess.fatal(~"Multiple input filenames provided."); + sess.fatal("Multiple input filenames provided."); } let ifile = match.free[0]; - let saved_out_filename: istr = ~""; - let cfg = build_configuration(sess, binary, - ifile); + let saved_out_filename: str = ""; + let cfg = build_configuration(sess, binary, ifile); let pretty = - option::map::<istr, + option::map::<str, pp_mode>(bind parse_pretty(sess, _), - getopts::opt_default(match, ~"pretty", - ~"normal")); + getopts::opt_default(match, "pretty", + "normal")); alt pretty { - some::<pp_mode>(ppm) { - pretty_print_input(sess, cfg, ifile, ppm); - ret; - } + some::<pp_mode>(ppm) { pretty_print_input(sess, cfg, ifile, ppm); ret; } none::<pp_mode>. {/* continue */ } } - let ls = opt_present(match, ~"ls"); + let ls = opt_present(match, "ls"); if ls { metadata::creader::list_file_metadata(ifile, io::stdout()); ret; } let stop_after_codegen = @@ -532,21 +503,22 @@ fn main(args: [istr]) { let parts = if !input_is_stdin(ifile) { str::split(ifile, '.' as u8) - } else { [~"default", ~"rs"] }; + } else { ["default", "rs"] }; vec::pop(parts); - saved_out_filename = str::connect(parts, ~"."); + saved_out_filename = str::connect(parts, "."); let suffix = alt sopts.output_type { - link::output_type_none. { ~"none" } - link::output_type_bitcode. { ~"bc" } - link::output_type_assembly. { ~"s" } + link::output_type_none. { "none" } + link::output_type_bitcode. { "bc" } + link::output_type_assembly. { "s" } + // Object and exe output both use the '.o' extension here link::output_type_object. | link::output_type_exe. { - ~"o" + "o" } }; - let ofile = saved_out_filename + ~"." + suffix; + let ofile = saved_out_filename + "." + suffix; compile_input(sess, cfg, ifile, ofile); } some(ofile) { @@ -554,7 +526,7 @@ fn main(args: [istr]) { // FIXME: what about windows? This will create a foo.exe.o. saved_out_filename = ofile; let temp_filename = - if !stop_after_codegen { ofile + ~".o" } else { ofile }; + if !stop_after_codegen { ofile + ".o" } else { ofile }; compile_input(sess, cfg, ifile, temp_filename); } } @@ -565,39 +537,37 @@ fn main(args: [istr]) { // TODO: Factor this out of main. if stop_after_codegen { ret; } - let glu: istr = binary_dir + ~"/lib/glue.o"; - let main: istr = binary_dir + ~"/lib/main.o"; - let stage: istr = ~"-L" + binary_dir + ~"/lib"; - let prog: istr = ~"gcc"; + let glu: str = binary_dir + "/lib/glue.o"; + let main: str = binary_dir + "/lib/main.o"; + let stage: str = "-L" + binary_dir + "/lib"; + let prog: str = "gcc"; // The invocations of gcc share some flags across platforms let gcc_args = - [stage, - ~"-Lrt", ~"-lrustrt", glu, - ~"-m32", ~"-o", saved_out_filename, - saved_out_filename + ~".o"]; + [stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename, + saved_out_filename + ".o"]; let lib_cmd; let os = sess.get_targ_cfg().os; if os == session::os_macos { - lib_cmd = ~"-dynamiclib"; - } else { lib_cmd = ~"-shared"; } + lib_cmd = "-dynamiclib"; + } else { lib_cmd = "-shared"; } // Converts a library file name into a gcc -l argument - fn unlib(config: @session::config, filename: &istr) -> istr { + fn unlib(config: @session::config, filename: &str) -> str { let rmlib = - bind fn (config: @session::config, filename: &istr) -> istr { - if config.os == session::os_macos || - config.os == session::os_linux && - str::find(filename, ~"lib") == 0 { - ret str::slice(filename, 3u, - str::byte_len(filename)); - } else { ret filename; } - }(config, _); - fn rmext(filename: &istr) -> istr { + bind fn (config: @session::config, filename: &str) -> str { + if config.os == session::os_macos || + config.os == session::os_linux && + str::find(filename, "lib") == 0 { + ret str::slice(filename, 3u, + str::byte_len(filename)); + } else { ret filename; } + }(config, _); + fn rmext(filename: &str) -> str { let parts = str::split(filename, '.' as u8); vec::pop(parts); - ret str::connect(parts, ~"."); + ret str::connect(parts, "."); } ret alt config.os { session::os_macos. { rmext(rmlib(filename)) } @@ -607,53 +577,48 @@ fn main(args: [istr]) { } let cstore = sess.get_cstore(); - for cratepath: istr in cstore::get_used_crate_files(cstore) { - if str::ends_with(cratepath, ~".rlib") { + for cratepath: str in cstore::get_used_crate_files(cstore) { + if str::ends_with(cratepath, ".rlib") { gcc_args += [cratepath]; cont; } let cratepath = cratepath; let dir = fs::dirname(cratepath); - if dir != ~"" { gcc_args += [~"-L" + dir]; } + if dir != "" { gcc_args += ["-L" + dir]; } let libarg = unlib(sess.get_targ_cfg(), fs::basename(cratepath)); - gcc_args += [~"-l" + libarg]; + gcc_args += ["-l" + libarg]; } let ula = cstore::get_used_link_args(cstore); - for arg: istr in ula { gcc_args += [arg]; } + for arg: str in ula { gcc_args += [arg]; } let used_libs = cstore::get_used_libraries(cstore); - for l: istr in used_libs { gcc_args += [~"-l" + l]; } + for l: str in used_libs { gcc_args += ["-l" + l]; } if sopts.library { gcc_args += [lib_cmd]; } else { // FIXME: why do we hardcode -lm? - gcc_args += [~"-lm", main]; + gcc_args += ["-lm", main]; } // We run 'gcc' here let err_code = run::run_program(prog, gcc_args); if 0 != err_code { - sess.err( - #fmt["linking with gcc failed with code %d", err_code]); - sess.note( - #fmt["gcc arguments: %s", - str::connect(gcc_args, ~" ")]); + sess.err(#fmt["linking with gcc failed with code %d", err_code]); + sess.note(#fmt["gcc arguments: %s", str::connect(gcc_args, " ")]); sess.abort_if_errors(); } // Clean up on Darwin if sess.get_targ_cfg().os == session::os_macos { - run::run_program(~"dsymutil", - [saved_out_filename]); + run::run_program("dsymutil", [saved_out_filename]); } // Remove the temporary object file if we aren't saving temps if !sopts.save_temps { - run::run_program(~"rm", - [saved_out_filename + ~".o"]); + run::run_program("rm", [saved_out_filename + ".o"]); } } @@ -664,13 +629,13 @@ mod test { #[test] fn test_switch_implies_cfg_test() { let match = - alt getopts::getopts([~"--test"], opts()) { + alt getopts::getopts(["--test"], opts()) { getopts::success(m) { m } }; - let sessopts = build_session_options(~"whatever", match, ~"whatever"); + let sessopts = build_session_options("whatever", match, "whatever"); let sess = build_session(sessopts); - let cfg = build_configuration(sess, ~"whatever", ~"whatever"); - assert (attr::contains_name(cfg, ~"test")); + let cfg = build_configuration(sess, "whatever", "whatever"); + assert (attr::contains_name(cfg, "test")); } // When the user supplies --test and --cfg test, don't implicitly add @@ -678,13 +643,13 @@ mod test { #[test] fn test_switch_implies_cfg_test_unless_cfg_test() { let match = - alt getopts::getopts([~"--test", ~"--cfg=test"], opts()) { + alt getopts::getopts(["--test", "--cfg=test"], opts()) { getopts::success(m) { m } }; - let sessopts = build_session_options(~"whatever", match, ~"whatever"); + let sessopts = build_session_options("whatever", match, "whatever"); let sess = build_session(sessopts); - let cfg = build_configuration(sess, ~"whatever", ~"whatever"); - let test_items = attr::find_meta_items_by_name(cfg, ~"test"); + let cfg = build_configuration(sess, "whatever", "whatever"); + let test_items = attr::find_meta_items_by_name(cfg, "test"); assert (vec::len(test_items) == 1u); } } diff --git a/src/comp/driver/session.rs b/src/comp/driver/session.rs index 312cdc58f69..13d17ef6303 100644 --- a/src/comp/driver/session.rs +++ b/src/comp/driver/session.rs @@ -37,15 +37,15 @@ type options = time_passes: bool, time_llvm_passes: bool, output_type: back::link::output_type, - library_search_paths: [istr], - sysroot: istr, + library_search_paths: [str], + sysroot: str, cfg: ast::crate_cfg, test: bool, parse_only: bool, no_trans: bool, do_gc: bool}; -type crate_metadata = {name: istr, data: [u8]}; +type crate_metadata = {name: str, data: [u8]}; obj session(targ_cfg: @config, opts: @options, @@ -58,54 +58,46 @@ obj session(targ_cfg: @config, fn get_targ_cfg() -> @config { ret targ_cfg; } fn get_opts() -> @options { ret opts; } fn get_cstore() -> metadata::cstore::cstore { cstore } - fn span_fatal(sp: span, msg: &istr) -> ! { + fn span_fatal(sp: span, msg: &str) -> ! { // FIXME: Use constants, but rustboot doesn't know how to export them. codemap::emit_error(some(sp), msg, parse_sess.cm); fail; } - fn fatal(msg: &istr) -> ! { + fn fatal(msg: &str) -> ! { codemap::emit_error(none, msg, parse_sess.cm); fail; } - fn span_err(sp: span, msg: &istr) { + fn span_err(sp: span, msg: &str) { codemap::emit_error(some(sp), msg, parse_sess.cm); err_count += 1u; } - fn err(msg: &istr) { + fn err(msg: &str) { codemap::emit_error(none, msg, parse_sess.cm); err_count += 1u; } fn abort_if_errors() { - if err_count > 0u { self.fatal(~"aborting due to previous errors"); } + if err_count > 0u { self.fatal("aborting due to previous errors"); } } - fn span_warn(sp: span, msg: &istr) { + fn span_warn(sp: span, msg: &str) { // FIXME: Use constants, but rustboot doesn't know how to export them. codemap::emit_warning(some(sp), msg, parse_sess.cm); } - fn warn(msg: &istr) { - codemap::emit_warning(none, msg, parse_sess.cm); - } - fn span_note(sp: span, msg: &istr) { + fn warn(msg: &str) { codemap::emit_warning(none, msg, parse_sess.cm); } + fn span_note(sp: span, msg: &str) { // FIXME: Use constants, but rustboot doesn't know how to export them. codemap::emit_note(some(sp), msg, parse_sess.cm); } - fn note(msg: &istr) { - codemap::emit_note(none, msg, parse_sess.cm); - } - fn span_bug(sp: span, msg: &istr) -> ! { - self.span_fatal(sp, - #fmt["internal compiler error %s", - msg]); + fn note(msg: &str) { codemap::emit_note(none, msg, parse_sess.cm); } + fn span_bug(sp: span, msg: &str) -> ! { + self.span_fatal(sp, #fmt["internal compiler error %s", msg]); } - fn bug(msg: &istr) -> ! { - self.fatal( - #fmt["internal compiler error %s", - msg]); + fn bug(msg: &str) -> ! { + self.fatal(#fmt["internal compiler error %s", msg]); } - fn span_unimpl(sp: span, msg: &istr) -> ! { - self.span_bug(sp, ~"unimplemented " + msg); + fn span_unimpl(sp: span, msg: &str) -> ! { + self.span_bug(sp, "unimplemented " + msg); } - fn unimpl(msg: &istr) -> ! { self.bug(~"unimplemented " + msg); } + fn unimpl(msg: &str) -> ! { self.bug("unimplemented " + msg); } fn get_codemap() -> codemap::codemap { ret parse_sess.cm; } fn lookup_pos(pos: uint) -> codemap::loc { ret codemap::lookup_char_pos(parse_sess.cm, pos); @@ -114,7 +106,7 @@ obj session(targ_cfg: @config, fn next_node_id() -> ast::node_id { ret syntax::parse::parser::next_node_id(parse_sess); } - fn span_str(sp: span) -> istr { + fn span_str(sp: span) -> str { ret codemap::span_to_str(sp, self.get_codemap()); } fn set_main_id(d: node_id) { main_fn = some(d); } diff --git a/src/comp/front/attr.rs b/src/comp/front/attr.rs index 731e05125da..edb6da5b257 100644 --- a/src/comp/front/attr.rs +++ b/src/comp/front/attr.rs @@ -32,7 +32,7 @@ export mk_attr; // linkage fn find_linkage_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] { let metas: [@ast::meta_item] = []; - for attr: ast::attribute in find_attrs_by_name(attrs, ~"link") { + for attr: ast::attribute in find_attrs_by_name(attrs, "link") { alt attr.node.value.node { ast::meta_list(_, items) { metas += items; } _ { log "ignoring link attribute that has incorrect type"; } @@ -80,13 +80,10 @@ fn get_meta_item_name(meta: &@ast::meta_item) -> ast::ident { // Gets the string value if the meta_item is a meta_name_value variant // containing a string, otherwise none -fn get_meta_item_value_str(meta: &@ast::meta_item) -> option::t<istr> { +fn get_meta_item_value_str(meta: &@ast::meta_item) -> option::t<str> { alt meta.node { ast::meta_name_value(_, v) { - alt v.node { - ast::lit_str(s) { option::some(s) } - _ { option::none } - } + alt v.node { ast::lit_str(s) { option::some(s) } _ { option::none } } } _ { option::none } } @@ -124,10 +121,10 @@ fn eq(a: @ast::meta_item, b: @ast::meta_item) -> bool { fn contains(haystack: &[@ast::meta_item], needle: @ast::meta_item) -> bool { log #fmt["looking for %s", - syntax::print::pprust::meta_item_to_str(*needle)]; + syntax::print::pprust::meta_item_to_str(*needle)]; for item: @ast::meta_item in haystack { log #fmt["looking in %s", - syntax::print::pprust::meta_item_to_str(*item)]; + syntax::print::pprust::meta_item_to_str(*item)]; if eq(item, needle) { log "found it!"; ret true; } } log "found it not :("; @@ -163,11 +160,11 @@ fn sort_meta_items(items: &[@ast::meta_item]) -> [@ast::meta_item] { ret v2; } -fn remove_meta_items_by_name(items: &[@ast::meta_item], name: &istr) -> +fn remove_meta_items_by_name(items: &[@ast::meta_item], name: &str) -> [@ast::meta_item] { let filter = - bind fn (item: &@ast::meta_item, name: &istr) -> + bind fn (item: &@ast::meta_item, name: &str) -> option::t<@ast::meta_item> { if get_meta_item_name(item) != name { option::some(item) @@ -183,8 +180,7 @@ fn require_unique_names(sess: &session::session, metas: &[@ast::meta_item]) { let name = get_meta_item_name(meta); if map.contains_key(name) { sess.span_fatal(meta.span, - #fmt["duplicate meta item `%s`", - name]); + #fmt["duplicate meta item `%s`", name]); } map.insert(name, ()); } @@ -194,8 +190,7 @@ fn span<@T>(item: &T) -> ast::spanned<T> { ret {node: item, span: ast_util::dummy_sp()}; } -fn mk_name_value_item_str(name: ast::ident, - value: &istr) -> @ast::meta_item { +fn mk_name_value_item_str(name: ast::ident, value: &str) -> @ast::meta_item { let value_lit = span(ast::lit_str(value)); ret mk_name_value_item(name, value_lit); } diff --git a/src/comp/front/config.rs b/src/comp/front/config.rs index be02086cc01..0d391f63c34 100644 --- a/src/comp/front/config.rs +++ b/src/comp/front/config.rs @@ -77,7 +77,8 @@ fn fold_block(cfg: &ast::crate_cfg, b: &ast::blk_, fld: fold::ast_fold) -> let filtered_stmts = vec::filter_map(filter, b.stmts); ret {stmts: vec::map(fld.fold_stmt, filtered_stmts), expr: option::map(fld.fold_expr, b.expr), - id: b.id, rules: b.rules}; + id: b.id, + rules: b.rules}; } fn item_in_cfg(cfg: &ast::crate_cfg, item: &@ast::item) -> bool { @@ -94,7 +95,7 @@ fn native_item_in_cfg(cfg: &ast::crate_cfg, item: &@ast::native_item) -> fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool { // The "cfg" attributes on the item - let item_cfg_attrs = attr::find_attrs_by_name(attrs, ~"cfg"); + let item_cfg_attrs = attr::find_attrs_by_name(attrs, "cfg"); let item_has_cfg_attrs = vec::len(item_cfg_attrs) > 0u; if !item_has_cfg_attrs { ret true; } @@ -108,7 +109,7 @@ fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool { [@ast::meta_item] { alt cfg_item.node { ast::meta_list(name, items) { - assert (name == ~"cfg"); + assert (name == "cfg"); inner_items + items } _ { inner_items } diff --git a/src/comp/front/test.rs b/src/comp/front/test.rs index ae2a663c3db..997ca4e47a7 100644 --- a/src/comp/front/test.rs +++ b/src/comp/front/test.rs @@ -65,7 +65,7 @@ fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold) -> fn nomain(item: &@ast::item) -> option::t<@ast::item> { alt item.node { ast::item_fn(f, _) { - if item.ident == ~"main" { + if item.ident == "main" { option::none } else { option::some(item) } } @@ -92,8 +92,7 @@ fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) -> @ast::item { cx.path += [i.ident]; - log #fmt["current path: %s", - ast_util::path_name_i(cx.path)]; + log #fmt["current path: %s", ast_util::path_name_i(cx.path)]; if is_test_fn(i) { log "this is a test function"; @@ -109,7 +108,7 @@ fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) -> fn is_test_fn(i: &@ast::item) -> bool { let has_test_attr = - vec::len(attr::find_attrs_by_name(i.attrs, ~"test")) > 0u; + vec::len(attr::find_attrs_by_name(i.attrs, "test")) > 0u; fn has_test_signature(i: &@ast::item) -> bool { alt i.node { @@ -127,7 +126,7 @@ fn is_test_fn(i: &@ast::item) -> bool { } fn is_ignored(i: &@ast::item) -> bool { - attr::contains_name(attr::attr_metas(i.attrs), ~"ignore") + attr::contains_name(attr::attr_metas(i.attrs), "ignore") } fn add_test_module(cx: &test_ctxt, m: &ast::_mod) -> ast::_mod { @@ -162,21 +161,18 @@ fn mk_test_module(cx: &test_ctxt) -> @ast::item { let testmod: ast::_mod = {view_items: [], items: [mainfn, testsfn]}; let item_ = ast::item_mod(testmod); let item: ast::item = - {ident: ~"__test", + {ident: "__test", attrs: [], id: cx.next_node_id(), node: item_, span: dummy_sp()}; - log #fmt["Synthetic test module:\n%s\n", - pprust::item_to_str(@item)]; + log #fmt["Synthetic test module:\n%s\n", pprust::item_to_str(@item)]; ret @item; } -fn nospan<@T>(t: &T) -> ast::spanned<T> { - ret {node: t, span: dummy_sp()}; -} +fn nospan<@T>(t: &T) -> ast::spanned<T> { ret {node: t, span: dummy_sp()}; } fn mk_tests(cx: &test_ctxt) -> @ast::item { let ret_ty = mk_test_desc_vec_ty(cx); @@ -193,15 +189,15 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item { // The vector of test_descs for this crate let test_descs = mk_test_desc_vec(cx); - let body_: ast::blk_ = checked_blk([], option::some(test_descs), - cx.next_node_id()); + let body_: ast::blk_ = + checked_blk([], option::some(test_descs), cx.next_node_id()); let body = nospan(body_); let fn_ = {decl: decl, proto: proto, body: body}; let item_ = ast::item_fn(fn_, []); let item: ast::item = - {ident: ~"tests", + {ident: "tests", attrs: [], id: cx.next_node_id(), node: item_, @@ -222,7 +218,7 @@ fn empty_fn_ty() -> ast::ty { fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty { let test_desc_ty_path: ast::path = nospan({global: false, - idents: [~"std", ~"test", ~"test_desc"], + idents: ["std", "test", "test_desc"], types: []}); let test_desc_ty: ast::ty = @@ -249,8 +245,7 @@ fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr { fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { let path = test.path; - log #fmt["encoding %s", - ast_util::path_name_i(path)]; + log #fmt["encoding %s", ast_util::path_name_i(path)]; let name_lit: ast::lit = nospan(ast::lit_str(ast_util::path_name_i(path))); @@ -260,7 +255,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { span: dummy_sp()}; let name_field: ast::field = - nospan({mut: ast::imm, ident: ~"name", expr: @name_expr}); + nospan({mut: ast::imm, ident: "name", expr: @name_expr}); let fn_path: ast::path = nospan({global: false, idents: path, types: []}); @@ -270,7 +265,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { span: dummy_sp()}; let fn_field: ast::field = - nospan({mut: ast::imm, ident: ~"fn", expr: @fn_expr}); + nospan({mut: ast::imm, ident: "fn", expr: @fn_expr}); let ignore_lit: ast::lit = nospan(ast::lit_bool(test.ignore)); @@ -280,7 +275,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { span: dummy_sp()}; let ignore_field: ast::field = - nospan({mut: ast::imm, ident: ~"ignore", expr: @ignore_expr}); + nospan({mut: ast::imm, ident: "ignore", expr: @ignore_expr}); let desc_rec_: ast::expr_ = ast::expr_rec([name_field, fn_field, ignore_field], option::none); @@ -295,7 +290,7 @@ fn mk_main(cx: &test_ctxt) -> @ast::item { let args_ty: ast::ty = nospan(ast::ty_vec(args_mt)); let args_arg: ast::arg = - {mode: ast::val, ty: @args_ty, ident: ~"args", id: cx.next_node_id()}; + {mode: ast::val, ty: @args_ty, ident: "args", id: cx.next_node_id()}; let ret_ty = nospan(ast::ty_nil); @@ -310,15 +305,15 @@ fn mk_main(cx: &test_ctxt) -> @ast::item { let test_main_call_expr = mk_test_main_call(cx); - let body_: ast::blk_ = checked_blk([], option::some(test_main_call_expr), - cx.next_node_id()); + let body_: ast::blk_ = + checked_blk([], option::some(test_main_call_expr), cx.next_node_id()); let body = {node: body_, span: dummy_sp()}; let fn_ = {decl: decl, proto: proto, body: body}; let item_ = ast::item_fn(fn_, []); let item: ast::item = - {ident: ~"main", + {ident: "main", attrs: [], id: cx.next_node_id(), node: item_, @@ -330,7 +325,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr { // Get the args passed to main so we can pass the to test_main let args_path: ast::path = - nospan({global: false, idents: [~"args"], types: []}); + nospan({global: false, idents: ["args"], types: []}); let args_path_expr_: ast::expr_ = ast::expr_path(args_path); @@ -339,7 +334,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr { // Call __test::test to generate the vector of test_descs let test_path: ast::path = - nospan({global: false, idents: [~"tests"], types: []}); + nospan({global: false, idents: ["tests"], types: []}); let test_path_expr_: ast::expr_ = ast::expr_path(test_path); @@ -354,24 +349,20 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr { // Call std::test::test_main let test_main_path: ast::path = nospan({global: false, - idents: [~"std", ~"test", ~"test_main"], + idents: ["std", "test", "test_main"], types: []}); let test_main_path_expr_: ast::expr_ = ast::expr_path(test_main_path); let test_main_path_expr: ast::expr = - {id: cx.next_node_id(), - node: test_main_path_expr_, - span: dummy_sp()}; + {id: cx.next_node_id(), node: test_main_path_expr_, span: dummy_sp()}; let test_main_call_expr_: ast::expr_ = ast::expr_call(@test_main_path_expr, [@args_path_expr, @test_call_expr]); let test_main_call_expr: ast::expr = - {id: cx.next_node_id(), - node: test_main_call_expr_, - span: dummy_sp()}; + {id: cx.next_node_id(), node: test_main_call_expr_, span: dummy_sp()}; ret @test_main_call_expr; } diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs index 105490ac223..431893b0201 100644 --- a/src/comp/lib/llvm.rs +++ b/src/comp/lib/llvm.rs @@ -810,18 +810,14 @@ native "cdecl" mod llvm = "rustllvm" { fn LLVMPassManagerBuilderSetDisableUnrollLoops(PMB: PassManagerBuilderRef, Value: Bool); fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls( - PMB: PassManagerBuilderRef, - Value: Bool); + PMB: PassManagerBuilderRef, Value: Bool); fn LLVMPassManagerBuilderUseInlinerWithThreshold( - PMB: PassManagerBuilderRef, - threshold: uint); + PMB: PassManagerBuilderRef, threshold: uint); fn LLVMPassManagerBuilderPopulateModulePassManager( - PMB: PassManagerBuilderRef, - PM: PassManagerRef); + PMB: PassManagerBuilderRef, PM: PassManagerRef); fn LLVMPassManagerBuilderPopulateFunctionPassManager( - PMB: PassManagerBuilderRef, - PM: PassManagerRef); + PMB: PassManagerBuilderRef, PM: PassManagerRef); /** Destroys a memory buffer. */ fn LLVMDisposeMemoryBuffer(MemBuf: MemoryBufferRef); @@ -899,10 +895,10 @@ native "cdecl" mod llvm = "rustllvm" { /* Memory-managed object interface to type handles. */ -obj type_names(type_names: std::map::hashmap<TypeRef, istr>, - named_types: std::map::hashmap<istr, TypeRef>) { +obj type_names(type_names: std::map::hashmap<TypeRef, str>, + named_types: std::map::hashmap<str, TypeRef>) { - fn associate(s: &istr, t: TypeRef) { + fn associate(s: &str, t: TypeRef) { assert (!named_types.contains_key(s)); assert (!type_names.contains_key(t)); type_names.insert(t, s); @@ -911,15 +907,11 @@ obj type_names(type_names: std::map::hashmap<TypeRef, istr>, fn type_has_name(t: TypeRef) -> bool { ret type_names.contains_key(t); } - fn get_name(t: TypeRef) -> istr { ret type_names.get(t); } + fn get_name(t: TypeRef) -> str { ret type_names.get(t); } - fn name_has_type(s: &istr) -> bool { - ret named_types.contains_key(s); - } + fn name_has_type(s: &str) -> bool { ret named_types.contains_key(s); } - fn get_type(s: &istr) -> TypeRef { - ret named_types.get(s); - } + fn get_type(s: &str) -> TypeRef { ret named_types.get(s); } } fn mk_type_names() -> type_names { @@ -931,17 +923,17 @@ fn mk_type_names() -> type_names { let hasher: std::map::hashfn<TypeRef> = hash; let eqer: std::map::eqfn<TypeRef> = eq; - let tn = std::map::mk_hashmap::<TypeRef, istr>(hasher, eqer); + let tn = std::map::mk_hashmap::<TypeRef, str>(hasher, eqer); ret type_names(tn, nt); } -fn type_to_str(names: type_names, ty: TypeRef) -> istr { +fn type_to_str(names: type_names, ty: TypeRef) -> str { ret type_to_str_inner(names, [], ty); } fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> - istr { + str { if names.type_has_name(ty) { ret names.get_name(ty); } @@ -949,12 +941,11 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> let kind: int = llvm::LLVMGetTypeKind(ty); - fn tys_str(names: type_names, outer: &[TypeRef], - tys: &[TypeRef]) -> istr { - let s: istr = ~""; + fn tys_str(names: type_names, outer: &[TypeRef], tys: &[TypeRef]) -> str { + let s: str = ""; let first: bool = true; for t: TypeRef in tys { - if first { first = false; } else { s += ~", "; } + if first { first = false; } else { s += ", "; } s += type_to_str_inner(names, outer, t); } ret s; @@ -965,81 +956,87 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> + // FIXME: more enum-as-int constants determined from Core::h; // horrible, horrible. Complete as needed. 0 { - ret ~"Void"; + ret "Void"; } - 1 { ret ~"Float"; } - 2 { ret ~"Double"; } - 3 { ret ~"X86_FP80"; } - 4 { ret ~"FP128"; } - 5 { ret ~"PPC_FP128"; } - 6 { ret ~"Label"; } + 1 { ret "Float"; } + 2 { ret "Double"; } + 3 { ret "X86_FP80"; } + 4 { ret "FP128"; } + 5 { ret "PPC_FP128"; } + 6 { ret "Label"; } + 7 { - ret ~"i" + std::int::str( - llvm::LLVMGetIntTypeWidth(ty) as int); + ret "i" + std::int::str(llvm::LLVMGetIntTypeWidth(ty) as int); } + 8 { - let s = ~"fn("; + let s = "fn("; let out_ty: TypeRef = llvm::LLVMGetReturnType(ty); let n_args: uint = llvm::LLVMCountParamTypes(ty); let args: [TypeRef] = vec::init_elt::<TypeRef>(0 as TypeRef, n_args); llvm::LLVMGetParamTypes(ty, vec::to_ptr(args)); s += tys_str(names, outer, args); - s += ~") -> "; + s += ") -> "; s += type_to_str_inner(names, outer, out_ty); ret s; } + 9 { - let s: istr = ~"{"; + let s: str = "{"; let n_elts: uint = llvm::LLVMCountStructElementTypes(ty); let elts: [TypeRef] = vec::init_elt::<TypeRef>(0 as TypeRef, n_elts); llvm::LLVMGetStructElementTypes(ty, vec::to_ptr(elts)); s += tys_str(names, outer, elts); - s += ~"}"; + s += "}"; ret s; } + 10 { let el_ty = llvm::LLVMGetElementType(ty); - ret ~"[" + type_to_str_inner(names, outer, el_ty) + ~"]"; + ret "[" + type_to_str_inner(names, outer, el_ty) + "]"; } + 11 { let i: uint = 0u; for tout: TypeRef in outer0 { i += 1u; if tout as int == ty as int { let n: uint = vec::len::<TypeRef>(outer0) - i; - ret ~"*\\" + std::int::str(n as int); + ret "*\\" + std::int::str(n as int); } } - ret ~"*" + + ret "*" + type_to_str_inner(names, outer, llvm::LLVMGetElementType(ty)); } + 12 { - ret ~"Opaque"; + ret "Opaque"; } - 13 { ret ~"Vector"; } - 14 { ret ~"Metadata"; } + 13 { ret "Vector"; } + 14 { ret "Metadata"; } _ { log_err #fmt["unknown TypeKind %d", kind as int]; fail; } } } @@ -1069,10 +1066,9 @@ resource target_data_res(TD: TargetDataRef) { type target_data = {lltd: TargetDataRef, dtor: @target_data_res}; -fn mk_target_data(string_rep: &istr) -> target_data { - let lltd = str::as_buf(string_rep, { |buf| - llvm::LLVMCreateTargetData(buf) - }); +fn mk_target_data(string_rep: &str) -> target_data { + let lltd = + str::as_buf(string_rep, {|buf| llvm::LLVMCreateTargetData(buf) }); ret {lltd: lltd, dtor: @target_data_res(lltd)}; } diff --git a/src/comp/metadata/common.rs b/src/comp/metadata/common.rs index 05c0de1bb2b..9d6a2c745f8 100644 --- a/src/comp/metadata/common.rs +++ b/src/comp/metadata/common.rs @@ -67,7 +67,7 @@ const tag_items_data_item_inlineness: uint = 0x27u; // djb's cdb hashes. fn hash_node_id(node_id: &int) -> uint { ret 177573u ^ (node_id as uint); } -fn hash_path(s: &istr) -> uint { +fn hash_path(s: &str) -> uint { let h = 5381u; for ch: u8 in str::bytes(s) { h = (h << 5u) + h ^ (ch as uint); } ret h; diff --git a/src/comp/metadata/creader.rs b/src/comp/metadata/creader.rs index 4fd911a1bad..2c74f03612e 100644 --- a/src/comp/metadata/creader.rs +++ b/src/comp/metadata/creader.rs @@ -34,8 +34,7 @@ fn read_crates(sess: session::session, crate: &ast::crate) { let e = @{sess: sess, crate_cache: @std::map::new_str_hash::<int>(), - library_search_paths: - sess.get_opts().library_search_paths, + library_search_paths: sess.get_opts().library_search_paths, mutable next_crate_num: 1}; let v = visit::mk_simple_visitor(@{visit_view_item: @@ -47,8 +46,8 @@ fn read_crates(sess: session::session, crate: &ast::crate) { type env = @{sess: session::session, - crate_cache: @hashmap<istr, int>, - library_search_paths: [istr], + crate_cache: @hashmap<str, int>, + library_search_paths: [str], mutable next_crate_num: ast::crate_num}; fn visit_view_item(e: env, i: &@ast::view_item) { @@ -68,14 +67,11 @@ fn visit_item(e: env, i: &@ast::item) { ret; } let cstore = e.sess.get_cstore(); - if !cstore::add_used_library(cstore, - m.native_name) { ret; } + if !cstore::add_used_library(cstore, m.native_name) { ret; } for a: ast::attribute in - attr::find_attrs_by_name(i.attrs, ~"link_args") { + attr::find_attrs_by_name(i.attrs, "link_args") { alt attr::get_meta_item_value_str(attr::attr_meta(a)) { - some(linkarg) { - cstore::add_used_link_args(cstore, linkarg); - } + some(linkarg) { cstore::add_used_link_args(cstore, linkarg); } none. {/* fallthrough */ } } } @@ -85,12 +81,11 @@ fn visit_item(e: env, i: &@ast::item) { } // A diagnostic function for dumping crate metadata to an output stream -fn list_file_metadata(path: &istr, out: io::writer) { +fn list_file_metadata(path: &str, out: io::writer) { alt get_metadata_section(path) { option::some(bytes) { decoder::list_crate_metadata(bytes, out); } option::none. { - out.write_str( - ~"Could not find metadata in " + path + ~".\n"); + out.write_str("Could not find metadata in " + path + ".\n"); } } } @@ -104,8 +99,7 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool { for needed: @ast::meta_item in metas { if !attr::contains(linkage_metas, needed) { - log #fmt["missing %s", - pprust::meta_item_to_str(*needed)]; + log #fmt["missing %s", pprust::meta_item_to_str(*needed)]; ret false; } } @@ -113,19 +107,18 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool { } fn default_native_lib_naming(sess: session::session, static: bool) -> - {prefix: istr, suffix: istr} { - if static { ret {prefix: ~"lib", suffix: ~".rlib"}; } + {prefix: str, suffix: str} { + if static { ret {prefix: "lib", suffix: ".rlib"}; } alt sess.get_targ_cfg().os { - session::os_win32. { ret {prefix: ~"", suffix: ~".dll"}; } - session::os_macos. { ret {prefix: ~"lib", suffix: ~".dylib"}; } - session::os_linux. { ret {prefix: ~"lib", suffix: ~".so"}; } + session::os_win32. { ret {prefix: "", suffix: ".dll"}; } + session::os_macos. { ret {prefix: "lib", suffix: ".dylib"}; } + session::os_linux. { ret {prefix: "lib", suffix: ".so"}; } } } fn find_library_crate(sess: &session::session, ident: &ast::ident, - metas: &[@ast::meta_item], - library_search_paths: &[istr]) - -> option::t<{ident: istr, data: @[u8]}> { + metas: &[@ast::meta_item], library_search_paths: &[str]) + -> option::t<{ident: str, data: @[u8]}> { attr::require_unique_names(sess, metas); @@ -133,7 +126,7 @@ fn find_library_crate(sess: &session::session, ident: &ast::ident, // is using the wrong type of meta item let crate_name = { - let name_items = attr::find_meta_items_by_name(metas, ~"name"); + let name_items = attr::find_meta_items_by_name(metas, "name"); alt vec::last(name_items) { some(i) { alt attr::get_meta_item_value_str(i) { @@ -147,49 +140,41 @@ fn find_library_crate(sess: &session::session, ident: &ast::ident, let nn = default_native_lib_naming(sess, sess.get_opts().static); let x = - find_library_crate_aux(nn, crate_name, - metas, library_search_paths); + find_library_crate_aux(nn, crate_name, metas, library_search_paths); if x != none || sess.get_opts().static { ret x; } let nn2 = default_native_lib_naming(sess, true); - ret find_library_crate_aux(nn2, crate_name, - metas, library_search_paths); + ret find_library_crate_aux(nn2, crate_name, metas, library_search_paths); } -fn find_library_crate_aux(nn: &{prefix: istr, suffix: istr}, - crate_name: &istr, +fn find_library_crate_aux(nn: &{prefix: str, suffix: str}, crate_name: &str, metas: &[@ast::meta_item], - library_search_paths: &[istr]) -> - option::t<{ident: istr, data: @[u8]}> { - let prefix: istr = nn.prefix + crate_name; - let suffix: istr = nn.suffix; + library_search_paths: &[str]) -> + option::t<{ident: str, data: @[u8]}> { + let prefix: str = nn.prefix + crate_name; + let suffix: str = nn.suffix; // FIXME: we could probably use a 'glob' function in std::fs but it will // be much easier to write once the unsafe module knows more about FFI // tricks. Currently the glob(3) interface is a bit more than we can // stomach from here, and writing a C++ wrapper is more work than just // manually filtering fs::list_dir here. - for library_search_path: istr in library_search_paths { + for library_search_path: str in library_search_paths { log #fmt["searching %s", library_search_path]; - for path: istr in fs::list_dir(library_search_path) { + for path: str in fs::list_dir(library_search_path) { log #fmt["searching %s", path]; - let f: istr = fs::basename(path); - if !(str::starts_with(f, prefix) && str::ends_with(f, suffix)) - { - log #fmt["skipping %s, doesn't look like %s*%s", - path, - prefix, + let f: str = fs::basename(path); + if !(str::starts_with(f, prefix) && str::ends_with(f, suffix)) { + log #fmt["skipping %s, doesn't look like %s*%s", path, prefix, suffix]; cont; } alt get_metadata_section(path) { option::some(cvec) { if !metadata_matches(cvec, metas) { - log #fmt["skipping %s, metadata doesn't match", - path]; + log #fmt["skipping %s, metadata doesn't match", path]; cont; } - log #fmt["found %s with matching metadata", - path]; + log #fmt["found %s with matching metadata", path]; ret some({ident: path, data: cvec}); } _ { } @@ -199,10 +184,11 @@ fn find_library_crate_aux(nn: &{prefix: istr, suffix: istr}, ret none; } -fn get_metadata_section(filename: &istr) -> option::t<@[u8]> { - let mb = str::as_buf(filename, { |buf| - llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf) - }); +fn get_metadata_section(filename: &str) -> option::t<@[u8]> { + let mb = + str::as_buf(filename, {|buf| + llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf) + }); if mb as int == 0 { ret option::none::<@[u8]>; } let of = mk_object_file(mb); let si = mk_section_iter(of.llof); @@ -221,17 +207,14 @@ fn get_metadata_section(filename: &istr) -> option::t<@[u8]> { } fn load_library_crate(sess: &session::session, span: span, ident: &ast::ident, - metas: &[@ast::meta_item], - library_search_paths: &[istr]) - -> {ident: istr, data: @[u8]} { + metas: &[@ast::meta_item], library_search_paths: &[str]) + -> {ident: str, data: @[u8]} { alt find_library_crate(sess, ident, metas, library_search_paths) { some(t) { ret t; } none. { - sess.span_fatal(span, - #fmt["can't find crate for '%s'", - ident]); + sess.span_fatal(span, #fmt["can't find crate for '%s'", ident]); } } } @@ -254,13 +237,11 @@ fn resolve_crate(e: env, ident: &ast::ident, metas: [@ast::meta_item], // Now resolve the crates referenced by this crate let cnum_map = resolve_crate_deps(e, cdata); - let cmeta = {name: ident, - data: cdata, cnum_map: cnum_map}; + let cmeta = {name: ident, data: cdata, cnum_map: cnum_map}; let cstore = e.sess.get_cstore(); cstore::set_crate_data(cstore, cnum, cmeta); - cstore::add_used_crate_file(cstore, - cfilename); + cstore::add_used_crate_file(cstore, cfilename); ret cnum; } else { ret e.crate_cache.get(ident); } } @@ -285,9 +266,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map { // This is a new one so we've got to load it // FIXME: Need better error reporting than just a bogus span let fake_span = ast_util::dummy_sp(); - let local_cnum = resolve_crate(e, - cname, - [], fake_span); + let local_cnum = resolve_crate(e, cname, [], fake_span); cnum_map.insert(extrn_cnum, local_cnum); } } diff --git a/src/comp/metadata/csearch.rs b/src/comp/metadata/csearch.rs index a729c596375..d526ee05247 100644 --- a/src/comp/metadata/csearch.rs +++ b/src/comp/metadata/csearch.rs @@ -11,7 +11,7 @@ export lookup_defs; export get_tag_variants; export get_type; -fn get_symbol(cstore: &cstore::cstore, def: ast::def_id) -> istr { +fn get_symbol(cstore: &cstore::cstore, def: ast::def_id) -> str { let cdata = cstore::get_crate_data(cstore, def.crate).data; ret decoder::get_symbol(cdata, def.node); } @@ -63,7 +63,7 @@ fn translate_def_id(sess: &session::session, searched_crate: ast::crate_num, let local_cnum = alt cmeta.cnum_map.find(ext_cnum) { option::some(n) { n } - option::none. { sess.bug(~"didn't find a crate in the cnum_map") } + option::none. { sess.bug("didn't find a crate in the cnum_map") } }; ret {crate: local_cnum, node: node_id}; diff --git a/src/comp/metadata/cstore.rs b/src/comp/metadata/cstore.rs index c5f161394bd..ed737e046ec 100644 --- a/src/comp/metadata/cstore.rs +++ b/src/comp/metadata/cstore.rs @@ -29,7 +29,7 @@ export get_use_stmt_cnum; // own crate numbers. type cnum_map = map::hashmap<ast::crate_num, ast::crate_num>; -type crate_metadata = {name: istr, data: @[u8], cnum_map: cnum_map}; +type crate_metadata = {name: str, data: @[u8], cnum_map: cnum_map}; // This is a bit of an experiment at encapsulating the data in cstore. By // keeping all the data in a non-exported tag variant, it's impossible for @@ -41,9 +41,9 @@ tag cstore { private(cstore_private); } type cstore_private = @{metas: map::hashmap<ast::crate_num, crate_metadata>, use_crate_map: use_crate_map, - mutable used_crate_files: [istr], - mutable used_libraries: [istr], - mutable used_link_args: [istr]}; + mutable used_crate_files: [str], + mutable used_libraries: [str], + mutable used_link_args: [str]}; // Map from node_id's of local use statements to crate numbers type use_crate_map = map::hashmap<ast::node_id, ast::crate_num>; @@ -82,18 +82,18 @@ iter iter_crate_data(cstore: &cstore) -> } } -fn add_used_crate_file(cstore: &cstore, lib: &istr) { +fn add_used_crate_file(cstore: &cstore, lib: &str) { if !vec::member(lib, p(cstore).used_crate_files) { p(cstore).used_crate_files += [lib]; } } -fn get_used_crate_files(cstore: &cstore) -> [istr] { +fn get_used_crate_files(cstore: &cstore) -> [str] { ret p(cstore).used_crate_files; } -fn add_used_library(cstore: &cstore, lib: &istr) -> bool { - if lib == ~"" { ret false; } +fn add_used_library(cstore: &cstore, lib: &str) -> bool { + if lib == "" { ret false; } if vec::member(lib, p(cstore).used_libraries) { ret false; } @@ -101,15 +101,15 @@ fn add_used_library(cstore: &cstore, lib: &istr) -> bool { ret true; } -fn get_used_libraries(cstore: &cstore) -> [istr] { +fn get_used_libraries(cstore: &cstore) -> [str] { ret p(cstore).used_libraries; } -fn add_used_link_args(cstore: &cstore, args: &istr) { +fn add_used_link_args(cstore: &cstore, args: &str) { p(cstore).used_link_args += str::split(args, ' ' as u8); } -fn get_used_link_args(cstore: &cstore) -> [istr] { +fn get_used_link_args(cstore: &cstore) -> [str] { ret p(cstore).used_link_args; } diff --git a/src/comp/metadata/decoder.rs b/src/comp/metadata/decoder.rs index e99e9d274da..7803e6922a1 100644 --- a/src/comp/metadata/decoder.rs +++ b/src/comp/metadata/decoder.rs @@ -83,7 +83,7 @@ fn item_family(item: &ebml::doc) -> u8 { ret ebml::doc_as_uint(fam) as u8; } -fn item_symbol(item: &ebml::doc) -> istr { +fn item_symbol(item: &ebml::doc) -> str { let sym = ebml::get_doc(item, tag_items_data_item_symbol); ret str::unsafe_from_bytes(ebml::doc_data(sym)); } @@ -96,7 +96,7 @@ fn variant_tag_id(d: &ebml::doc) -> ast::def_id { fn item_type(item: &ebml::doc, this_cnum: ast::crate_num, tcx: ty::ctxt, extres: &external_resolver) -> ty::t { fn parse_external_def_id(this_cnum: ast::crate_num, - extres: &external_resolver, s: &istr) -> + extres: &external_resolver, s: &str) -> ast::def_id { let buf = str::bytes(s); let external_def_id = parse_def_id(buf); @@ -149,16 +149,15 @@ fn tag_variant_ids(item: &ebml::doc, this_cnum: ast::crate_num) -> // Given a path and serialized crate metadata, returns the ID of the // definition the path refers to. fn resolve_path(path: &[ast::ident], data: @[u8]) -> [ast::def_id] { - fn eq_item(data: &[u8], s: &istr) -> bool { + fn eq_item(data: &[u8], s: &str) -> bool { ret str::eq(str::unsafe_from_bytes(data), s); } - let s = str::connect(path, ~"::"); + let s = str::connect(path, "::"); let md = ebml::new_doc(data); let paths = ebml::get_doc(md, tag_paths); let eqer = bind eq_item(_, s); let result: [ast::def_id] = []; - for doc: ebml::doc in lookup_hash(paths, eqer, - hash_path(s)) { + for doc: ebml::doc in lookup_hash(paths, eqer, hash_path(s)) { let did_doc = ebml::get_doc(doc, tag_def_id); result += [parse_def_id(ebml::doc_data(did_doc))]; } @@ -222,7 +221,7 @@ fn get_type_param_kinds(data: @[u8], id: ast::node_id) -> [ast::kind] { ret item_ty_param_kinds(lookup_item(id, data)); } -fn get_symbol(data: @[u8], id: ast::node_id) -> istr { +fn get_symbol(data: @[u8], id: ast::node_id) -> str { ret item_symbol(lookup_item(id, data)); } @@ -268,7 +267,7 @@ fn family_has_type_params(fam_ch: u8) -> bool { }; } -fn read_path(d: &ebml::doc) -> {path: istr, pos: uint} { +fn read_path(d: &ebml::doc) -> {path: str, pos: uint} { let desc = ebml::doc_data(d); let pos = ebml::be_uint_from_bytes(@desc, 0u, 4u); let pathbytes = vec::slice::<u8>(desc, 4u, vec::len::<u8>(desc)); @@ -276,23 +275,23 @@ fn read_path(d: &ebml::doc) -> {path: istr, pos: uint} { ret {path: path, pos: pos}; } -fn describe_def(items: &ebml::doc, id: ast::def_id) -> istr { - if id.crate != ast::local_crate { ret ~"external"; } +fn describe_def(items: &ebml::doc, id: ast::def_id) -> str { + if id.crate != ast::local_crate { ret "external"; } ret item_family_to_str(item_family(find_item(id.node, items))); } -fn item_family_to_str(fam: u8) -> istr { +fn item_family_to_str(fam: u8) -> str { alt fam as char { - 'c' { ret ~"const"; } - 'f' { ret ~"fn"; } - 'p' { ret ~"pure fn"; } - 'F' { ret ~"native fn"; } - 'y' { ret ~"type"; } - 'T' { ret ~"native type"; } - 't' { ret ~"type"; } - 'm' { ret ~"mod"; } - 'n' { ret ~"native mod"; } - 'v' { ret ~"tag"; } + 'c' { ret "const"; } + 'f' { ret "fn"; } + 'p' { ret "pure fn"; } + 'F' { ret "native fn"; } + 'y' { ret "type"; } + 'T' { ret "native type"; } + 't' { ret "type"; } + 'm' { ret "mod"; } + 'n' { ret "native mod"; } + 'v' { ret "tag"; } } } @@ -347,29 +346,25 @@ fn get_attributes(md: &ebml::doc) -> [ast::attribute] { fn list_meta_items(meta_items: &ebml::doc, out: io::writer) { for mi: @ast::meta_item in get_meta_items(meta_items) { - out.write_str( - #fmt["%s\n", - pprust::meta_item_to_str(*mi)]); + out.write_str(#fmt["%s\n", pprust::meta_item_to_str(*mi)]); } } fn list_crate_attributes(md: &ebml::doc, out: io::writer) { - out.write_str(~"=Crate Attributes=\n"); + out.write_str("=Crate Attributes=\n"); for attr: ast::attribute in get_attributes(md) { - out.write_str( - #fmt["%s\n", - pprust::attribute_to_str(attr)]); + out.write_str(#fmt["%s\n", pprust::attribute_to_str(attr)]); } - out.write_str(~"\n\n"); + out.write_str("\n\n"); } fn get_crate_attributes(data: @[u8]) -> [ast::attribute] { ret get_attributes(ebml::new_doc(data)); } -type crate_dep = {cnum: ast::crate_num, ident: istr}; +type crate_dep = {cnum: ast::crate_num, ident: str}; fn get_crate_deps(data: @[u8]) -> [crate_dep] { let deps: [crate_dep] = []; @@ -385,19 +380,17 @@ fn get_crate_deps(data: @[u8]) -> [crate_dep] { } fn list_crate_deps(data: @[u8], out: io::writer) { - out.write_str(~"=External Dependencies=\n"); + out.write_str("=External Dependencies=\n"); for dep: crate_dep in get_crate_deps(data) { - out.write_str( - #fmt["%d %s\n", dep.cnum, - dep.ident]); + out.write_str(#fmt["%d %s\n", dep.cnum, dep.ident]); } - out.write_str(~"\n"); + out.write_str("\n"); } fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) { - out.write_str(~"=Items=\n"); + out.write_str("=Items=\n"); let paths = ebml::get_doc(md, tag_paths); let items = ebml::get_doc(md, tag_items); let index = ebml::get_doc(paths, tag_index); @@ -410,13 +403,11 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) { let def = ebml::doc_at(bytes, data.pos); let did_doc = ebml::get_doc(def, tag_def_id); let did = parse_def_id(ebml::doc_data(did_doc)); - out.write_str( - #fmt["%s (%s)\n", - data.path, - describe_def(items, did)]); + out.write_str(#fmt["%s (%s)\n", data.path, + describe_def(items, did)]); } } - out.write_str(~"\n"); + out.write_str("\n"); } fn list_crate_metadata(bytes: &@[u8], out: io::writer) { diff --git a/src/comp/metadata/encoder.rs b/src/comp/metadata/encoder.rs index e1a9e54a6c5..342ddcc887d 100644 --- a/src/comp/metadata/encoder.rs +++ b/src/comp/metadata/encoder.rs @@ -26,7 +26,7 @@ type abbrev_map = map::hashmap<ty::t, tyencode::ty_abbrev>; type encode_ctxt = {ccx: @crate_ctxt, type_abbrevs: abbrev_map}; // Path table encoding -fn encode_name(ebml_w: &ebml::writer, name: &istr) { +fn encode_name(ebml_w: &ebml::writer, name: &str) { ebml::start_tag(ebml_w, tag_paths_data_name); ebml_w.writer.write(str::bytes(name)); ebml::end_tag(ebml_w); @@ -41,7 +41,7 @@ fn encode_def_id(ebml_w: &ebml::writer, id: &def_id) { type entry<T> = {val: T, pos: uint}; fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant], - path: &[istr], index: &mutable [entry<istr>]) { + path: &[str], index: &mutable [entry<str>]) { for variant: variant in variants { add_to_index(ebml_w, path, index, variant.node.name); ebml::start_tag(ebml_w, tag_paths_data_item); @@ -51,16 +51,16 @@ fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant], } } -fn add_to_index(ebml_w: &ebml::writer, path: &[istr], - index: &mutable [entry<istr>], name: &istr) { +fn add_to_index(ebml_w: &ebml::writer, path: &[str], + index: &mutable [entry<str>], name: &str) { let full_path = path + [name]; index += - [{val: str::connect(full_path, ~"::"), pos: ebml_w.writer.tell()}]; + [{val: str::connect(full_path, "::"), pos: ebml_w.writer.tell()}]; } fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod, - path: &[istr], - index: &mutable [entry<istr>]) { + path: &[str], + index: &mutable [entry<str>]) { for nitem: @native_item in nmod.items { add_to_index(ebml_w, path, index, nitem.ident); ebml::start_tag(ebml_w, tag_paths_data_item); @@ -71,7 +71,7 @@ fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod, } fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, - path: &[istr], index: &mutable [entry<istr>]) { + path: &[str], index: &mutable [entry<str>]) { for it: @item in module.items { if !ast_util::is_exported(it.ident, module) { cont; } alt it.node { @@ -94,9 +94,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, it.ident); encode_def_id(ebml_w, local_def(it.id)); - encode_module_item_paths(ebml_w, _mod, - path + [it.ident], - index); + encode_module_item_paths(ebml_w, _mod, path + [it.ident], index); ebml::end_tag(ebml_w); } item_native_mod(nmod) { @@ -104,10 +102,8 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, it.ident); encode_def_id(ebml_w, local_def(it.id)); - encode_native_module_item_paths( - ebml_w, nmod, - path + [it.ident], - index); + encode_native_module_item_paths(ebml_w, nmod, path + [it.ident], + index); ebml::end_tag(ebml_w); } item_ty(_, tps) { @@ -153,9 +149,9 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, } } -fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<istr>] { - let index: [entry<istr>] = []; - let path: [istr] = []; +fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<str>] { + let index: [entry<str>] = []; + let path: [str] = []; ebml::start_tag(ebml_w, tag_paths); encode_module_item_paths(ebml_w, crate.node.module, path, index); ebml::end_tag(ebml_w); @@ -176,9 +172,7 @@ fn encode_inlineness(ebml_w: &ebml::writer, c: u8) { ebml::end_tag(ebml_w); } -fn def_to_str(did: &def_id) -> istr { - ret #fmt["%d:%d", did.crate, did.node]; -} +fn def_to_str(did: &def_id) -> str { ret #fmt["%d:%d", did.crate, did.node]; } fn encode_type_param_kinds(ebml_w: &ebml::writer, tps: &[ty_param]) { ebml::start_tag(ebml_w, tag_items_data_item_ty_param_kinds); @@ -441,9 +435,7 @@ fn encode_index<T>(ebml_w: &ebml::writer, buckets: &[@[entry<T>]], ebml::end_tag(ebml_w); } -fn write_str(writer: &io::writer, s: &istr) { - writer.write_str(s); -} +fn write_str(writer: &io::writer, s: &str) { writer.write_str(s); } fn write_int(writer: &io::writer, n: &int) { writer.write_be_uint(n as uint, 4u); @@ -505,24 +497,22 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] { fn synthesize_link_attr(ecx: &@encode_ctxt, items: &[@meta_item]) -> attribute { - assert (ecx.ccx.link_meta.name != ~""); - assert (ecx.ccx.link_meta.vers != ~""); + assert (ecx.ccx.link_meta.name != ""); + assert (ecx.ccx.link_meta.vers != ""); let name_item = - attr::mk_name_value_item_str( - ~"name", ecx.ccx.link_meta.name); + attr::mk_name_value_item_str("name", ecx.ccx.link_meta.name); let vers_item = - attr::mk_name_value_item_str( - ~"vers", ecx.ccx.link_meta.vers); + attr::mk_name_value_item_str("vers", ecx.ccx.link_meta.vers); let other_items = { - let tmp = attr::remove_meta_items_by_name(items, ~"name"); - attr::remove_meta_items_by_name(tmp, ~"vers") + let tmp = attr::remove_meta_items_by_name(items, "name"); + attr::remove_meta_items_by_name(tmp, "vers") }; let meta_items = [name_item, vers_item] + other_items; - let link_item = attr::mk_list_item(~"link", meta_items); + let link_item = attr::mk_list_item("link", meta_items); ret attr::mk_attr(link_item); } @@ -531,7 +521,7 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] { let found_link_attr = false; for attr: attribute in crate.node.attrs { attrs += - if attr::get_attr_name(attr) != ~"link" { + if attr::get_attr_name(attr) != "link" { [attr] } else { alt attr.node.value.node { @@ -551,9 +541,9 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] { fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) { - fn get_ordered_names(cstore: &cstore::cstore) -> [istr] { + fn get_ordered_names(cstore: &cstore::cstore) -> [str] { type hashkv = @{key: crate_num, val: cstore::crate_metadata}; - type numname = {crate: crate_num, ident: istr}; + type numname = {crate: crate_num, ident: str}; // Pull the cnums and names out of cstore let pairs: [mutable numname] = [mutable]; @@ -575,7 +565,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) { } // Return just the names - fn name(kv: &numname) -> istr { kv.ident } + fn name(kv: &numname) -> str { kv.ident } // mutable -> immutable hack for vec::map let immpairs = vec::slice(pairs, 0u, vec::len(pairs)); ret vec::map(name, immpairs); @@ -586,7 +576,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) { // FIXME: This is not nearly enough to support correct versioning // but is enough to get transitive crate dependencies working. ebml::start_tag(ebml_w, tag_crate_deps); - for cname: istr in get_ordered_names(cstore) { + for cname: str in get_ordered_names(cstore) { ebml::start_tag(ebml_w, tag_crate_dep); ebml_w.writer.write(str::bytes(cname)); ebml::end_tag(ebml_w); @@ -594,7 +584,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) { ebml::end_tag(ebml_w); } -fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> istr { +fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> str { let abbrevs = map::mk_hashmap(ty::hash_ty, ty::eq_ty); let ecx = @{ccx: cx, type_abbrevs: abbrevs}; @@ -630,7 +620,7 @@ fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> istr { } // Get the encoded string for a type -fn encoded_ty(tcx: &ty::ctxt, t: ty::t) -> istr { +fn encoded_ty(tcx: &ty::ctxt, t: ty::t) -> str { let cx = @{ds: def_to_str, tcx: tcx, abbrevs: tyencode::ac_no_abbrevs}; let sw = io::string_writer(); tyencode::enc_ty(sw.get_writer(), cx, t); diff --git a/src/comp/metadata/tydecode.rs b/src/comp/metadata/tydecode.rs index c72bc020288..1adbc2d47a2 100644 --- a/src/comp/metadata/tydecode.rs +++ b/src/comp/metadata/tydecode.rs @@ -20,7 +20,7 @@ export parse_ty_data; // data buffer. Whatever format you choose should not contain pipe characters. // Callback to translate defs to strs or back: -type str_def = fn(&istr) -> ast::def_id; +type str_def = fn(&str) -> ast::def_id; type pstate = {data: @[u8], crate: int, mutable pos: uint, len: uint, tcx: ty::ctxt}; @@ -42,7 +42,7 @@ fn parse_ident(st: @pstate, sd: str_def, last: char) -> ast::ident { fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool) -> ast::ident { - let rslt = ~""; + let rslt = ""; while !is_last(peek(st) as char) { rslt += str::unsafe_from_byte(next(st)); } @@ -224,7 +224,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { assert (next(st) as char == '['); let fields: [ty::field] = []; while peek(st) as char != ']' { - let name = ~""; + let name = ""; while peek(st) as char != '=' { name += str::unsafe_from_byte(next(st)); } @@ -277,7 +277,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { 'W' { proto = ast::proto_iter; } 'F' { proto = ast::proto_fn; } } - let name = ~""; + let name = ""; while peek(st) as char != '[' { name += str::unsafe_from_byte(next(st)); } @@ -342,10 +342,8 @@ fn parse_mt(st: @pstate, sd: str_def) -> ty::mt { } fn parse_def(st: @pstate, sd: str_def) -> ast::def_id { - let def = ~""; - while peek(st) as char != '|' { - def += str::unsafe_from_byte(next(st)); - } + let def = ""; + while peek(st) as char != '|' { def += str::unsafe_from_byte(next(st)); } st.pos = st.pos + 1u; ret sd(def); } diff --git a/src/comp/metadata/tyencode.rs b/src/comp/metadata/tyencode.rs index 46015f72cf8..1688b8b7d12 100644 --- a/src/comp/metadata/tyencode.rs +++ b/src/comp/metadata/tyencode.rs @@ -19,14 +19,14 @@ export ac_use_abbrevs; export enc_ty; type ctxt = - // Def -> str Callback: - // The type context. - {ds: fn(&def_id) -> istr, tcx: ty::ctxt, abbrevs: abbrev_ctxt}; + // Def -> str Callback: + // The type context. + {ds: fn(&def_id) -> str, tcx: ty::ctxt, abbrevs: abbrev_ctxt}; // Compact string representation for ty.t values. API ty_str & parse_from_str. // Extra parameters are for converting to/from def_ids in the string rep. // Whatever format you choose should not contain pipe characters. -type ty_abbrev = {pos: uint, len: uint, s: @istr}; +type ty_abbrev = {pos: uint, len: uint, s: @str}; tag abbrev_ctxt { ac_no_abbrevs; ac_use_abbrevs(hashmap<ty::t, ty_abbrev>); } @@ -40,7 +40,7 @@ fn cx_uses_abbrevs(cx: &@ctxt) -> bool { fn enc_ty(w: &io::writer, cx: &@ctxt, t: ty::t) { alt cx.abbrevs { ac_no_abbrevs. { - let result_str: @istr; + let result_str: @str; alt cx.tcx.short_names_cache.find(t) { some(s) { result_str = s; } none. { @@ -71,8 +71,8 @@ fn enc_ty(w: &io::writer, cx: &@ctxt, t: ty::t) { // I.e. it's actually an abbreviation. let s = - ~"#" + uint::to_str(pos, 16u) + ~":" + - uint::to_str(len, 16u) + ~"#"; + "#" + uint::to_str(pos, 16u) + ":" + + uint::to_str(len, 16u) + "#"; let a = {pos: pos, len: len, s: @s}; abbrevs.insert(t, a); } @@ -100,29 +100,29 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { ty::ty_float. { w.write_char('l'); } ty::ty_machine(mach) { alt mach { - ty_u8. { w.write_str(~"Mb"); } - ty_u16. { w.write_str(~"Mw"); } - ty_u32. { w.write_str(~"Ml"); } - ty_u64. { w.write_str(~"Md"); } - ty_i8. { w.write_str(~"MB"); } - ty_i16. { w.write_str(~"MW"); } - ty_i32. { w.write_str(~"ML"); } - ty_i64. { w.write_str(~"MD"); } - ty_f32. { w.write_str(~"Mf"); } - ty_f64. { w.write_str(~"MF"); } + ty_u8. { w.write_str("Mb"); } + ty_u16. { w.write_str("Mw"); } + ty_u32. { w.write_str("Ml"); } + ty_u64. { w.write_str("Md"); } + ty_i8. { w.write_str("MB"); } + ty_i16. { w.write_str("MW"); } + ty_i32. { w.write_str("ML"); } + ty_i64. { w.write_str("MD"); } + ty_f32. { w.write_str("Mf"); } + ty_f64. { w.write_str("MF"); } } } ty::ty_char. { w.write_char('c'); } ty::ty_istr. { w.write_char('S'); } ty::ty_tag(def, tys) { - w.write_str(~"t["); + w.write_str("t["); w.write_str(cx.ds(def)); w.write_char('|'); for t: ty::t in tys { enc_ty(w, cx, t); } w.write_char(']'); } ty::ty_tup(ts) { - w.write_str(~"T["); + w.write_str("T["); for t in ts { enc_ty(w, cx, t); } w.write_char(']'); } @@ -131,7 +131,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { ty::ty_ptr(mt) { w.write_char('*'); enc_mt(w, cx, mt); } ty::ty_vec(mt) { w.write_char('I'); enc_mt(w, cx, mt); } ty::ty_rec(fields) { - w.write_str(~"R["); + w.write_str("R["); for field: ty::field in fields { w.write_str(field.ident); w.write_char('='); @@ -155,7 +155,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { enc_ty_fn(w, cx, args, out, return, []); } ty::ty_obj(methods) { - w.write_str(~"O["); + w.write_str("O["); for m: ty::method in methods { enc_proto(w, m.proto); w.write_str(m.ident); @@ -164,17 +164,14 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { w.write_char(']'); } ty::ty_res(def, ty, tps) { - w.write_str(~"r["); + w.write_str("r["); w.write_str(cx.ds(def)); w.write_char('|'); enc_ty(w, cx, ty); for t: ty::t in tps { enc_ty(w, cx, t); } w.write_char(']'); } - ty::ty_var(id) { - w.write_char('X'); - w.write_str(int::str(id)); - } + ty::ty_var(id) { w.write_char('X'); w.write_str(int::str(id)); } ty::ty_native(def) { w.write_char('E'); w.write_str(cx.ds(def)); @@ -182,15 +179,15 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { } ty::ty_param(id, k) { alt k { - kind_unique. { w.write_str(~"pu"); } - kind_shared. { w.write_str(~"ps"); } - kind_pinned. { w.write_str(~"pp"); } + kind_unique. { w.write_str("pu"); } + kind_shared. { w.write_str("ps"); } + kind_pinned. { w.write_str("pp"); } } w.write_str(uint::str(id)); } ty::ty_type. { w.write_char('Y'); } ty::ty_constr(ty, cs) { - w.write_str(~"A["); + w.write_str("A["); enc_ty(w, cx, ty); for tc: @ty::type_constr in cs { enc_ty_constr(w, cx, tc); } w.write_char(']'); @@ -244,9 +241,7 @@ fn enc_constr(w: &io::writer, cx: &@ctxt, c: &@ty::constr) { alt a.node { carg_base. { w.write_char('*'); } carg_ident(i) { w.write_uint(i); } - carg_lit(l) { - w.write_str(lit_to_str(l)); - } + carg_lit(l) { w.write_str(lit_to_str(l)); } } } w.write_char(')'); @@ -262,10 +257,8 @@ fn enc_ty_constr(w: &io::writer, cx: &@ctxt, c: &@ty::type_constr) { if semi { w.write_char(';'); } else { semi = true; } alt a.node { carg_base. { w.write_char('*'); } - carg_ident(p) { - w.write_str(path_to_str(p)); } - carg_lit(l) { - w.write_str(lit_to_str(l)); } + carg_ident(p) { w.write_str(path_to_str(p)); } + carg_lit(l) { w.write_str(lit_to_str(l)); } } } w.write_char(')'); diff --git a/src/comp/middle/alias.rs b/src/comp/middle/alias.rs index e957bb7163d..f191a7bc9db 100644 --- a/src/comp/middle/alias.rs +++ b/src/comp/middle/alias.rs @@ -32,37 +32,45 @@ type restrict = type scope = @[restrict]; -tag local_info { - local(uint); -} +tag local_info { local(uint); } -type ctx = {tcx: ty::ctxt, - local_map: std::map::hashmap<node_id, local_info>, - mutable next_local: uint}; +type ctx = + {tcx: ty::ctxt, + local_map: std::map::hashmap<node_id, local_info>, + mutable next_local: uint}; fn check_crate(tcx: ty::ctxt, crate: &@ast::crate) { // Stores information about object fields and function // arguments that's otherwise not easily available. - let cx = @{tcx: tcx, - local_map: std::map::new_int_hash(), - mutable next_local: 0u}; - let v = @{visit_fn: visit_fn, - visit_expr: bind visit_expr(cx, _, _, _), - visit_decl: bind visit_decl(cx, _, _, _) - with *visit::default_visitor::<scope>()}; + let cx = + @{tcx: tcx, + local_map: std::map::new_int_hash(), + mutable next_local: 0u}; + let v = + @{visit_fn: visit_fn, + visit_expr: bind visit_expr(cx, _, _, _), + visit_decl: bind visit_decl(cx, _, _, _) + with *visit::default_visitor::<scope>()}; visit::visit_crate(*crate, @[], visit::mk_vt(v)); tcx.sess.abort_if_errors(); } -fn visit_fn(f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span, - _name: &fn_ident, _id: ast::node_id, sc: &scope, v: &vt<scope>) { +fn visit_fn(f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span, _name: &fn_ident, + _id: ast::node_id, sc: &scope, v: &vt<scope>) { visit::visit_fn_decl(f.decl, sc, v); - let scope = alt f.proto { - // Blocks need to obey any restrictions from the enclosing scope. - ast::proto_block. | ast::proto_closure. { sc } - // Non capturing functions start out fresh. - _ { @[] } - }; + let scope = + alt f.proto { + + // Blocks need to obey any restrictions from the enclosing scope. + ast::proto_block. | ast::proto_closure. { + sc + } + + // Non capturing functions start out fresh. + _ { + @[] + } + }; v.visit_block(f.body, scope, v); } @@ -80,8 +88,8 @@ fn visit_expr(cx: &@ctx, ex: &@ast::expr, sc: &scope, v: &vt<scope>) { let root = expr_root(cx.tcx, ex, false); if mut_field(root.ds) { cx.tcx.sess.span_err(ex.span, - ~"result of put must be" + - ~" immutably rooted"); + "result of put must be" + + " immutably rooted"); } visit_expr(cx, ex, sc, v); } @@ -140,8 +148,8 @@ fn visit_decl(cx: &@ctx, d: &@ast::decl, sc: &scope, v: &vt<scope>) { } } -fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) - -> [restrict] { +fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> + [restrict] { let fty = ty::type_autoderef(cx.tcx, ty::expr_ty(cx.tcx, f)); let arg_ts = ty::ty_fn_args(cx.tcx, fty); let mut_roots: [{arg: uint, node: node_id}] = []; @@ -157,27 +165,27 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) let dnum = ast_util::def_id_of_def(def).node; mut_roots += [{arg: i, node: dnum}]; } - _ {} + _ { } } } let root_var = path_def_id(cx, root.ex); - let unsafe_t = alt inner_mut(root.ds) { - some(t) { some(t) } - _ { none } - }; - restricts += [@{root_var: root_var, - local_id: cx.next_local, - bindings: [arg.id], - unsafe_ty: unsafe_t, - depends_on: deps(sc, root_var), - mutable ok: valid}]; + let unsafe_t = + alt inner_mut(root.ds) { some(t) { some(t) } _ { none } }; + restricts += + [@{root_var: root_var, + local_id: cx.next_local, + bindings: [arg.id], + unsafe_ty: unsafe_t, + depends_on: deps(sc, root_var), + mutable ok: valid}]; } i += 1u; } - let f_may_close = alt f.node { - ast::expr_path(_) { def_is_local(cx.tcx.def_map.get(f.id), true) } - _ { true } - }; + let f_may_close = + alt f.node { + ast::expr_path(_) { def_is_local(cx.tcx.def_map.get(f.id), true) } + _ { true } + }; if f_may_close { let i = 0u; for r in restricts { @@ -185,37 +193,39 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) cx.tcx.sess.span_err(f.span, #fmt["function may alias with argument \ %u, which is not immutably rooted", - i]); + i]); } i += 1u; } } let j = 0u; - for @{unsafe_ty, _} in restricts { + for @{unsafe_ty: unsafe_ty, _} in restricts { alt unsafe_ty { some(ty) { let i = 0u; for arg_t: ty::arg in arg_ts { let mut_alias = arg_t.mode == ty::mo_alias(true); if i != j && - ty_can_unsafely_include(cx, ty, arg_t.ty, mut_alias) { - cx.tcx.sess.span_err(args[i].span, + ty_can_unsafely_include(cx, ty, arg_t.ty, mut_alias) { + cx.tcx.sess.span_err( + args[i].span, #fmt["argument %u may alias with argument %u, \ - which is not immutably rooted", i, j]); + which is not immutably rooted", + i, j]); } i += 1u; } } - _ {} + _ { } } j += 1u; } // Ensure we're not passing a root by mutable alias. - for {node, arg} in mut_roots { + for {node: node, arg: arg} in mut_roots { let mut_alias_to_root = false; let mut_alias_to_root_count = 0u; - for @{root_var, _} in restricts { + for @{root_var: root_var, _} in restricts { alt root_var { some(root) { if node == root { @@ -226,13 +236,13 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) } } } - none. {} + none. { } } } if mut_alias_to_root { cx.tcx.sess.span_err(args[arg].span, - ~"passing a mutable alias to a variable \ + "passing a mutable alias to a variable \ that roots another alias"); } } @@ -248,12 +258,14 @@ fn check_alt(cx: &ctx, input: &@ast::expr, arms: &[ast::arm], sc: &scope, let new_sc = sc; if vec::len(dnums) > 0u { let root_var = path_def_id(cx, root.ex); - new_sc = @(*sc + [@{root_var: root_var, - local_id: cx.next_local, - bindings: dnums, - unsafe_ty: inner_mut(root.ds), - depends_on: deps(sc, root_var), - mutable ok: valid}]); + new_sc = + @(*sc + + [@{root_var: root_var, + local_id: cx.next_local, + bindings: dnums, + unsafe_ty: inner_mut(root.ds), + depends_on: deps(sc, root_var), + mutable ok: valid}]); } register_locals(cx, a.pats[0]); visit::visit_arm(a, new_sc, v); @@ -284,8 +296,9 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk, ty::ty_vec(mt) { if mt.mut != ast::imm { unsafe = some(seq_t); } } ty::ty_istr. {/* no-op */ } _ { - cx.tcx.sess.span_unimpl(seq.span, ~"unknown seq type " + - util::ppaux::ty_to_str(cx.tcx, seq_t)); + cx.tcx.sess.span_unimpl(seq.span, + "unknown seq type " + + util::ppaux::ty_to_str(cx.tcx, seq_t)); } } let root_var = path_def_id(cx, root.ex); @@ -305,12 +318,11 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id, let def = cx.tcx.def_map.get(id); if !def_is_local(def, true) { ret; } let my_defnum = ast_util::def_id_of_def(def).node; - let my_local_id = alt cx.local_map.find(my_defnum) { - some(local(id)) { id } - _ { 0u } - }; + let my_local_id = + alt cx.local_map.find(my_defnum) { some(local(id)) { id } _ { 0u } }; let var_t = ty::expr_ty(cx.tcx, ex); for r: restrict in *sc { + // excludes variables introduced since the alias was made if my_local_id < r.local_id { alt r.unsafe_ty { @@ -319,7 +331,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id, r.ok = val_taken(ex.span, p); } } - _ {} + _ { } } } else if vec::member(my_defnum, r.bindings) { test_scope(cx, sc, r, p); @@ -333,9 +345,7 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) { let def = cx.tcx.def_map.get(dest.id); let dnum = ast_util::def_id_of_def(def).node; for r: restrict in *sc { - if r.root_var == some(dnum) { - r.ok = overwritten(dest.span, p); - } + if r.root_var == some(dnum) { r.ok = overwritten(dest.span, p); } } } _ { visit_expr(cx, dest, sc, v); } @@ -358,19 +368,17 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) { let msg = alt prob { overwritten(sp, wpt) { - {span: sp, msg: ~"overwriting " + - ast_util::path_name(wpt)} + {span: sp, msg: "overwriting " + ast_util::path_name(wpt)} } val_taken(sp, vpt) { {span: sp, - msg: ~"taking the value of " + - ast_util::path_name(vpt)} + msg: "taking the value of " + ast_util::path_name(vpt)} } }; cx.tcx.sess.span_err(msg.span, - msg.msg + ~" will invalidate alias " + - ast_util::path_name(p) + - ~", which is still used"); + msg.msg + " will invalidate alias " + + ast_util::path_name(p) + + ", which is still used"); } } @@ -384,7 +392,7 @@ fn deps(sc: &scope, root: &option::t<node_id>) -> [uint] { i += 1u; } } - _ {} + _ { } } ret result; } @@ -438,6 +446,7 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t, } + // These may contain anything. ty::ty_fn(_, _, _, _, _) { ret true; @@ -445,6 +454,7 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t, ty::ty_obj(_) { ret true; } + // A type param may include everything, but can only be // treated as opaque downstream, and is thus safe unless we // saw mutable fields, in which case the whole thing can be @@ -460,11 +470,13 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t, fn def_is_local(d: &ast::def, objfields_count: bool) -> bool { ret alt d { - ast::def_local(_) | ast::def_arg(_, _) | ast::def_binding(_) | - ast::def_upvar(_, _, _) { true } - ast::def_obj_field(_, _) { objfields_count } - _ { false } - }; + ast::def_local(_) | ast::def_arg(_, _) | ast::def_binding(_) | + ast::def_upvar(_, _, _) { + true + } + ast::def_obj_field(_, _) { objfields_count } + _ { false } + }; } // Local Variables: diff --git a/src/comp/middle/ast_map.rs b/src/comp/middle/ast_map.rs index a0b1a96e3d6..356d2b46b8c 100644 --- a/src/comp/middle/ast_map.rs +++ b/src/comp/middle/ast_map.rs @@ -131,7 +131,7 @@ mod test { fn test_node_span_item() { let expected: codemap::span = ast_util::mk_sp(20u, 30u); let node = - node_item(@{ident: ~"test", + node_item(@{ident: "test", attrs: [], id: 0, node: item_mod({view_items: [], items: []}), @@ -143,7 +143,7 @@ mod test { fn test_node_span_obj_ctor() { let expected: codemap::span = ast_util::mk_sp(20u, 30u); let node = - node_obj_ctor(@{ident: ~"test", + node_obj_ctor(@{ident: "test", attrs: [], id: 0, node: item_mod({view_items: [], items: []}), @@ -155,7 +155,7 @@ mod test { fn test_node_span_native_item() { let expected: codemap::span = ast_util::mk_sp(20u, 30u); let node = - node_native_item(@{ident: ~"test", + node_native_item(@{ident: "test", attrs: [], node: native_item_ty, id: 0, diff --git a/src/comp/middle/check_alt.rs b/src/comp/middle/check_alt.rs index a764388fdf7..ce5e937cf69 100644 --- a/src/comp/middle/check_alt.rs +++ b/src/comp/middle/check_alt.rs @@ -34,7 +34,7 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) { j += 1; } if !reachable { - tcx.sess.span_err(arm_pat.span, ~"unreachable pattern"); + tcx.sess.span_err(arm_pat.span, "unreachable pattern"); } } i += 1; @@ -106,7 +106,7 @@ fn check_local(tcx: &ty::ctxt, loc: &@local, s: &(), v: &visit::vt<()>) { visit::visit_local(loc, s, v); if is_refutable(tcx, loc.node.pat) { tcx.sess.span_err(loc.node.pat.span, - ~"refutable pattern in local binding"); + "refutable pattern in local binding"); } } diff --git a/src/comp/middle/freevars.rs b/src/comp/middle/freevars.rs index 706e814a01c..50d4d1c062b 100644 --- a/src/comp/middle/freevars.rs +++ b/src/comp/middle/freevars.rs @@ -29,53 +29,50 @@ type freevar_map = hashmap<ast::node_id, freevar_info>; // Since we want to be able to collect upvars in some arbitrary piece // of the AST, we take a walker function that we invoke with a visitor // in order to start the search. -fn collect_freevars(def_map: &resolve::def_map, - walker: &fn(&visit::vt<int>)) -> freevar_info { +fn collect_freevars(def_map: &resolve::def_map, walker: &fn(&visit::vt<int>)) + -> freevar_info { let seen = new_int_hash(); let refs = @mutable []; - fn ignore_item(_i: &@ast::item, _depth: &int, _v: &visit::vt<int>) {} + fn ignore_item(_i: &@ast::item, _depth: &int, _v: &visit::vt<int>) { } - let walk_expr = lambda(expr: &@ast::expr, depth: &int, - v: &visit::vt<int>) { - alt expr.node { - ast::expr_fn(f) { - if f.proto == ast::proto_block || - f.proto == ast::proto_closure { - visit::visit_expr(expr, depth + 1, v); - } - } - ast::expr_for_each(dcl, x, b) { - v.visit_local(dcl, depth, v); - v.visit_expr(x, depth, v); - v.visit_block(b, depth + 1, v); - } - ast::expr_path(path) { - let def = def_map.get(expr.id), i = 0; - while i < depth { - alt {def} { - ast::def_upvar(_, inner, _) { - def = *inner; - } - _ { break; } + let walk_expr = + lambda (expr: &@ast::expr, depth: &int, v: &visit::vt<int>) { + alt expr.node { + ast::expr_fn(f) { + if f.proto == ast::proto_block || + f.proto == ast::proto_closure { + visit::visit_expr(expr, depth + 1, v); } - i += 1; - } - if i == depth { // Made it to end of loop - let dnum = ast_util::def_id_of_def(def).node; - if !seen.contains_key(dnum) { - *refs += [def]; - seen.insert(dnum, ()); + } + ast::expr_for_each(dcl, x, b) { + v.visit_local(dcl, depth, v); + v.visit_expr(x, depth, v); + v.visit_block(b, depth + 1, v); + } + ast::expr_path(path) { + let def = def_map.get(expr.id), i = 0; + while i < depth { + alt { def } { + ast::def_upvar(_, inner, _) { def = *inner; } + _ { break; } + } + i += 1; } + if i == depth { // Made it to end of loop + let dnum = ast_util::def_id_of_def(def).node; + if !seen.contains_key(dnum) { + *refs += [def]; + seen.insert(dnum, ()); + } + } + } + _ { visit::visit_expr(expr, depth, v); } } - } - _ { visit::visit_expr(expr, depth, v); } - } - }; + }; - walker(visit::mk_vt(@{visit_item: ignore_item, - visit_expr: walk_expr - with *visit::default_visitor()})); + walker(visit::mk_vt(@{visit_item: ignore_item, visit_expr: walk_expr + with *visit::default_visitor()})); ret @*refs; } @@ -84,30 +81,34 @@ fn collect_freevars(def_map: &resolve::def_map, // efficient as it fully recomputes the free variables at every // node of interest rather than building up the free variables in // one pass. This could be improved upon if it turns out to matter. -fn annotate_freevars(def_map: &resolve::def_map, - crate: &@ast::crate) -> freevar_map { +fn annotate_freevars(def_map: &resolve::def_map, crate: &@ast::crate) -> + freevar_map { let freevars = new_int_hash(); - let walk_fn = lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span, - i: &ast::fn_ident, nid: ast::node_id) { - let start_walk = lambda (v: &visit::vt<int>) { - v.visit_fn(f, tps, sp, i, nid, 1, v); - }; - let vars = collect_freevars(def_map, start_walk); - freevars.insert(nid, vars); - }; - let walk_expr = lambda (expr: &@ast::expr) { - alt expr.node { - ast::expr_for_each(local, _, body) { - let start_walk = lambda (v: &visit::vt<int>) { - v.visit_block(body, 1, v); - }; + let walk_fn = + lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span, + i: &ast::fn_ident, nid: ast::node_id) { + let start_walk = + lambda (v: &visit::vt<int>) { + v.visit_fn(f, tps, sp, i, nid, 1, v); + }; let vars = collect_freevars(def_map, start_walk); - freevars.insert(body.node.id, vars); - } - _ { } - } - }; + freevars.insert(nid, vars); + }; + let walk_expr = + lambda (expr: &@ast::expr) { + alt expr.node { + ast::expr_for_each(local, _, body) { + let start_walk = + lambda (v: &visit::vt<int>) { + v.visit_block(body, 1, v); + }; + let vars = collect_freevars(def_map, start_walk); + freevars.insert(body.node.id, vars); + } + _ { } + } + }; let visitor = visit::mk_simple_visitor(@{visit_fn: walk_fn, visit_expr: walk_expr @@ -119,10 +120,7 @@ fn annotate_freevars(def_map: &resolve::def_map, fn get_freevars(tcx: &ty::ctxt, fid: ast::node_id) -> freevar_info { alt tcx.freevars.find(fid) { - none. { - fail ~"get_freevars: " + int::str(fid) - + ~" has no freevars"; - } + none. { fail "get_freevars: " + int::str(fid) + " has no freevars"; } some(d) { ret d; } } } diff --git a/src/comp/middle/gc.rs b/src/comp/middle/gc.rs index f0e366f0e9e..e25f952a6c8 100644 --- a/src/comp/middle/gc.rs +++ b/src/comp/middle/gc.rs @@ -4,7 +4,7 @@ import lib::llvm::False; import lib::llvm::True; import lib::llvm::llvm::ValueRef; import middle::trans; -import middle::trans::{ get_tydesc, tps_normal }; +import middle::trans::{get_tydesc, tps_normal}; import middle::trans_common::*; import middle::ty; import std::option::none; @@ -21,10 +21,12 @@ type ctxt = @{mutable next_tydesc_num: uint}; fn mk_ctxt() -> ctxt { ret @{mutable next_tydesc_num: 0u}; } -fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: &istr) -> ValueRef { - let llglobal = str::as_buf(name, { |buf| - lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf) - }); +fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: &str) -> ValueRef { + let llglobal = + str::as_buf(name, + {|buf| + lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf) + }); lll::LLVMSetInitializer(llglobal, llval); lll::LLVMSetGlobalConstant(llglobal, True); ret llglobal; @@ -48,7 +50,7 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt { bcx = td_r.result.bcx; let lltydesc = td_r.result.val; - let gcroot = bcx_ccx(bcx).intrinsics.get(~"llvm.gcroot"); + let gcroot = bcx_ccx(bcx).intrinsics.get("llvm.gcroot"); let llvalptr = bld::PointerCast(bcx, llval, T_ptr(T_ptr(T_i8()))); alt td_r.kind { @@ -65,30 +67,31 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt { let lldestindex = add_global(bcx_ccx(bcx), C_struct([C_int(0), C_uint(number)]), - ~"rust_gc_tydesc_dest_index"); + "rust_gc_tydesc_dest_index"); let llsrcindex = add_global(bcx_ccx(bcx), C_struct([C_int(1), C_uint(number)]), - ~"rust_gc_tydesc_src_index"); + "rust_gc_tydesc_src_index"); lldestindex = lll::LLVMConstPointerCast(lldestindex, T_ptr(T_i8())); llsrcindex = lll::LLVMConstPointerCast(llsrcindex, T_ptr(T_i8())); - lltydescptr = bld::PointerCast(llderivedtydescs, lltydescptr, - T_ptr(T_ptr(T_i8()))); + lltydescptr = + bld::PointerCast(llderivedtydescs, lltydescptr, + T_ptr(T_ptr(T_i8()))); bld::Call(llderivedtydescs, gcroot, [lltydescptr, lldestindex]); bld::Call(bcx, gcroot, [llvalptr, llsrcindex]); } tk_param. { - bcx_tcx(cx).sess.bug(~"we should never be trying to root values " + - ~"of a type parameter"); + bcx_tcx(cx).sess.bug("we should never be trying to root values " + + "of a type parameter"); } tk_static. { // Static type descriptor. let llstaticgcmeta = add_global(bcx_ccx(bcx), C_struct([C_int(2), lltydesc]), - ~"rust_gc_tydesc_static_gc_meta"); + "rust_gc_tydesc_static_gc_meta"); let llstaticgcmetaptr = lll::LLVMConstPointerCast(llstaticgcmeta, T_ptr(T_i8())); @@ -109,6 +112,7 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool { } + ty::ty_rec(fields) { for f in fields { if type_is_gc_relevant(cx, f.mt.ty) { ret true; } } ret false; @@ -119,6 +123,7 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool { } + ty::ty_tag(did, tps) { let variants = ty::tag_variants(cx, did); for variant in variants { @@ -131,19 +136,22 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool { } + ty::ty_vec(tm) { ret type_is_gc_relevant(cx, tm.ty); } ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); } - ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _) - | ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) | + + ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _) | + ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) | ty::ty_res(_, _, _) { ret true; } + ty::ty_var(_) { fail "ty_var in type_is_gc_relevant"; } diff --git a/src/comp/middle/kind.rs b/src/comp/middle/kind.rs index 744d328f0f7..052eccb304d 100644 --- a/src/comp/middle/kind.rs +++ b/src/comp/middle/kind.rs @@ -96,11 +96,11 @@ fn lower_kind(a: kind, b: kind) -> kind { if kind_lteq(a, b) { a } else { b } } -fn kind_to_str(k: kind) -> istr { +fn kind_to_str(k: kind) -> str { alt k { - ast::kind_pinned. { ~"pinned" } - ast::kind_unique. { ~"unique" } - ast::kind_shared. { ~"shared" } + ast::kind_pinned. { "pinned" } + ast::kind_unique. { "unique" } + ast::kind_shared. { "shared" } } } @@ -112,7 +112,7 @@ fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr) -> } fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind, - descr: &istr) { + descr: &str) { let tk = type_and_kind(tcx, e); log #fmt["for %s: want %s type, got %s type %s", descr, kind_to_str(k_need), kind_to_str(tk.kind), @@ -121,36 +121,35 @@ fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind, if !kind_lteq(k_need, tk.kind) { let s = #fmt["mismatched kinds for %s: needed %s type, got %s type %s", - descr, kind_to_str(k_need), - kind_to_str(tk.kind), + descr, kind_to_str(k_need), kind_to_str(tk.kind), util::ppaux::ty_to_str(tcx, tk.ty)]; tcx.sess.span_err(e.span, s); } } fn need_shared_lhs_rhs(tcx: &ty::ctxt, a: &@ast::expr, b: &@ast::expr, - op: &istr) { - need_expr_kind(tcx, a, ast::kind_shared, op + ~" lhs"); - need_expr_kind(tcx, b, ast::kind_shared, op + ~" rhs"); + op: &str) { + need_expr_kind(tcx, a, ast::kind_shared, op + " lhs"); + need_expr_kind(tcx, b, ast::kind_shared, op + " rhs"); } fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) { alt e.node { - ast::expr_move(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"<-"); } - ast::expr_assign(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"="); } - ast::expr_assign_op(_, a, b) { need_shared_lhs_rhs(tcx, a, b, ~"op="); } - ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"<->"); } + ast::expr_move(a, b) { need_shared_lhs_rhs(tcx, a, b, "<-"); } + ast::expr_assign(a, b) { need_shared_lhs_rhs(tcx, a, b, "="); } + ast::expr_assign_op(_, a, b) { need_shared_lhs_rhs(tcx, a, b, "op="); } + ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, "<->"); } ast::expr_copy(a) { - need_expr_kind(tcx, a, ast::kind_shared, ~"'copy' operand"); + need_expr_kind(tcx, a, ast::kind_shared, "'copy' operand"); } ast::expr_ret(option::some(a)) { - need_expr_kind(tcx, a, ast::kind_shared, ~"'ret' operand"); + need_expr_kind(tcx, a, ast::kind_shared, "'ret' operand"); } ast::expr_be(a) { - need_expr_kind(tcx, a, ast::kind_shared, ~"'be' operand"); + need_expr_kind(tcx, a, ast::kind_shared, "'be' operand"); } ast::expr_fail(option::some(a)) { - need_expr_kind(tcx, a, ast::kind_shared, ~"'fail' operand"); + need_expr_kind(tcx, a, ast::kind_shared, "'fail' operand"); } ast::expr_call(callee, _) { let tpt = ty::expr_ty_params_and_ty(tcx, callee); @@ -159,8 +158,8 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) { // that all the types we're supplying as typarams conform to the // typaram kind constraints on that item. if vec::len(tpt.params) != 0u { - let callee_def = ast_util::def_id_of_def( - tcx.def_map.get(callee.id)); + let callee_def = + ast_util::def_id_of_def(tcx.def_map.get(callee.id)); let item_tk = ty::lookup_item_type(tcx, callee_def); let i = 0; assert (vec::len(item_tk.kinds) == vec::len(tpt.params)); diff --git a/src/comp/middle/mut.rs b/src/comp/middle/mut.rs index bf54a5d01d6..1721a6e130f 100644 --- a/src/comp/middle/mut.rs +++ b/src/comp/middle/mut.rs @@ -12,8 +12,8 @@ type deref = @{mut: bool, kind: deref_t, outer_t: ty::t}; // vec of dereferences that were used on this root. Note that, in this vec, // the inner derefs come in front, so foo.bar[1] becomes rec(ex=foo, // ds=[index,field]) -fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool) - -> {ex: @expr, ds: @[deref]} { +fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool) -> + {ex: @expr, ds: @[deref]} { fn maybe_auto_unbox(tcx: &ty::ctxt, t: ty::t) -> {t: ty::t, ds: [deref]} { let ds = []; while true { @@ -32,13 +32,11 @@ fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool) ty::ty_tag(did, tps) { let variants = ty::tag_variants(tcx, did); if vec::len(variants) != 1u || - vec::len(variants[0].args) != 1u { + vec::len(variants[0].args) != 1u { break; } ds += [@{mut: false, kind: unbox, outer_t: t}]; - t = - ty::substitute_type_params(tcx, tps, - variants[0].args[0]); + t = ty::substitute_type_params(tcx, tps, variants[0].args[0]); } _ { break; } } @@ -121,21 +119,25 @@ type ctx = {tcx: ty::ctxt, mut_map: mut_map}; fn check_crate(tcx: ty::ctxt, crate: &@crate) -> mut_map { let cx = @{tcx: tcx, mut_map: std::map::new_int_hash()}; - let v = @{visit_expr: bind visit_expr(cx, _, _, _), - visit_decl: bind visit_decl(cx, _, _, _) - with *visit::default_visitor::<()>()}; + let v = + @{visit_expr: bind visit_expr(cx, _, _, _), + visit_decl: bind visit_decl(cx, _, _, _) + with *visit::default_visitor::<()>()}; visit::visit_crate(*crate, (), visit::mk_vt(v)); ret cx.mut_map; } tag msg { msg_assign; msg_move_out; msg_mut_alias; } -fn mk_err(cx: &@ctx, span: &syntax::codemap::span, msg: msg, name: &istr) { - cx.tcx.sess.span_err(span, alt msg { - msg_assign. { ~"assigning to " + name } - msg_move_out. { ~"moving out of " + name } - msg_mut_alias. { ~"passing " + name + ~" by mutable alias" } - }); +fn mk_err(cx: &@ctx, span: &syntax::codemap::span, msg: msg, name: &str) { + cx.tcx.sess.span_err(span, + alt msg { + msg_assign. { "assigning to " + name } + msg_move_out. { "moving out of " + name } + msg_mut_alias. { + "passing " + name + " by mutable alias" + } + }); } fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) { @@ -145,9 +147,7 @@ fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) { for loc: @local in locs { alt loc.node.init { some(init) { - if init.op == init_move { - check_move_rhs(cx, init.expr); - } + if init.op == init_move { check_move_rhs(cx, init.expr); } } none. { } } @@ -159,9 +159,7 @@ fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) { fn visit_expr(cx: &@ctx, ex: &@expr, e: &(), v: &visit::vt<()>) { alt ex.node { - expr_call(f, args) { - check_call(cx, f, args); - } + expr_call(f, args) { check_call(cx, f, args); } expr_swap(lhs, rhs) { check_lval(cx, lhs, msg_assign); check_lval(cx, rhs, msg_assign); @@ -173,7 +171,7 @@ fn visit_expr(cx: &@ctx, ex: &@expr, e: &(), v: &visit::vt<()>) { expr_assign(dest, src) | expr_assign_op(_, dest, src) { check_lval(cx, dest, msg_assign); } - _ {} + _ { } } visit::visit_expr(ex, e, v); } @@ -184,20 +182,21 @@ fn check_lval(cx: &@ctx, dest: &@expr, msg: msg) { let def = cx.tcx.def_map.get(dest.id); alt is_immutable_def(def) { some(name) { mk_err(cx, dest.span, msg, name); } - _ {} + _ { } } cx.mut_map.insert(ast_util::def_id_of_def(def).node, ()); } _ { let root = expr_root(cx.tcx, dest, false); if vec::len(*root.ds) == 0u { - mk_err(cx, dest.span, msg, ~"non-lvalue"); + mk_err(cx, dest.span, msg, "non-lvalue"); } else if !root.ds[0].mut { - let name = alt root.ds[0].kind { - mut::unbox. { ~"immutable box" } - mut::field. { ~"immutable field" } - mut::index. { ~"immutable vec content" } - }; + let name = + alt root.ds[0].kind { + mut::unbox. { "immutable box" } + mut::field. { "immutable field" } + mut::index. { "immutable vec content" } + }; mk_err(cx, dest.span, msg, name); } } @@ -209,7 +208,7 @@ fn check_move_rhs(cx: &@ctx, src: &@expr) { expr_path(p) { alt cx.tcx.def_map.get(src.id) { def_obj_field(_, _) { - mk_err(cx, src.span, msg_move_out, ~"object field"); + mk_err(cx, src.span, msg_move_out, "object field"); } _ { } } @@ -217,17 +216,19 @@ fn check_move_rhs(cx: &@ctx, src: &@expr) { } _ { let root = expr_root(cx.tcx, src, false); + // Not a path and no-derefs means this is a temporary. if vec::len(*root.ds) != 0u { - cx.tcx.sess.span_err(src.span, ~"moving out of a data structure"); + cx.tcx.sess.span_err(src.span, "moving out of a data structure"); } } } } fn check_call(cx: &@ctx, f: &@expr, args: &[@expr]) { - let arg_ts = ty::ty_fn_args(cx.tcx, ty::type_autoderef - (cx.tcx, ty::expr_ty(cx.tcx, f))); + let arg_ts = + ty::ty_fn_args(cx.tcx, + ty::type_autoderef(cx.tcx, ty::expr_ty(cx.tcx, f))); let i = 0u; for arg_t: ty::arg in arg_ts { if arg_t.mode == ty::mo_alias(true) { @@ -237,17 +238,18 @@ fn check_call(cx: &@ctx, f: &@expr, args: &[@expr]) { } } -fn is_immutable_def(def: &def) -> option::t<istr> { +fn is_immutable_def(def: &def) -> option::t<str> { alt def { def_fn(_, _) | def_mod(_) | def_native_mod(_) | def_const(_) | - def_use(_) { some(~"static item") } - def_obj_field(_, imm.) { some(~"immutable object field") } - def_arg(_, alias(false)) { some(~"immutable alias") } + def_use(_) { + some("static item") + } + def_obj_field(_, imm.) { some("immutable object field") } + def_arg(_, alias(false)) { some("immutable alias") } def_upvar(_, inner, mut) { - if !mut { some(~"upvar") } - else { is_immutable_def(*inner) } + if !mut { some("upvar") } else { is_immutable_def(*inner) } } - def_binding(_) { some(~"binding") } + def_binding(_) { some("binding") } _ { none } } } diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs index 3fcf6bde032..a08458f910d 100644 --- a/src/comp/middle/resolve.rs +++ b/src/comp/middle/resolve.rs @@ -74,10 +74,10 @@ tag import_state { option::t<def>); /* module */ } -type ext_hash = hashmap<{did: def_id, ident: istr, ns: namespace}, def>; +type ext_hash = hashmap<{did: def_id, ident: str, ns: namespace}, def>; fn new_ext_hash() -> ext_hash { - type key = {did: def_id, ident: istr, ns: namespace}; + type key = {did: def_id, ident: str, ns: namespace}; fn hash(v: &key) -> uint { ret str::hash(v.ident) + util::common::hash_def(v.did) + alt v.ns { @@ -110,7 +110,7 @@ type indexed_mod = {m: option::t<ast::_mod>, index: mod_index, mutable glob_imports: [glob_imp_def], - glob_imported_names: hashmap<istr, import_state>}; + glob_imported_names: hashmap<str, import_state>}; /* native modules can't contain tags, and we don't store their ASTs because we @@ -127,7 +127,7 @@ type env = mod_map: hashmap<ast::node_id, @indexed_mod>, ext_map: hashmap<def_id, [ident]>, ext_cache: ext_hash, - mutable reported: [{ident: istr, sc: scope}], + mutable reported: [{ident: str, sc: scope}], sess: session}; @@ -242,6 +242,7 @@ fn map_crate(e: &@env, c: &@ast::crate) { alt vi.node { + //if it really is a glob import, that is ast::view_item_import_glob(path, _) { let imp = follow_import(*e, sc, path, vi.span); @@ -323,8 +324,8 @@ fn resolve_names(e: &@env, c: &@ast::crate) { } _ { e.sess.span_err(p.span, - ~"not a tag variant: " + - ast_util::path_name(p)); + "not a tag variant: " + + ast_util::path_name(p)); } } } @@ -430,8 +431,8 @@ fn follow_import(e: &env, sc: &scopes, path: &[ident], sp: &span) -> ast::def_mod(_) | ast::def_native_mod(_) { ret dcur; } _ { e.sess.span_err(sp, - str::connect(path, ~"::") + - ~" does not name a module."); + str::connect(path, "::") + + " does not name a module."); ret none; } } @@ -448,8 +449,8 @@ fn resolve_constr(e: @env, c: &@ast::constr, sc: &scopes, _v: &vt<scopes>) { } _ { e.sess.span_err(c.span, - ~"Non-predicate in constraint: " + - path_to_str(c.node.path)); + "Non-predicate in constraint: " + + path_to_str(c.node.path)); } } } @@ -475,8 +476,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, alt lookup_in_scope(e, sc, sp, ids[0], ns_module) { some(dcur) { dcur } none. { - unresolved_err(e, sc, sp, ids[0], - ns_name(ns_module)); + unresolved_err(e, sc, sp, ids[0], ns_name(ns_module)); remove_if_unresolved(e.imports, defid.node); ret () } @@ -498,8 +498,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, { some(dcur) { dcur } none. { - unresolved_err(e, sc, sp, ids[i], - ns_name(ns_module)); + unresolved_err(e, sc, sp, ids[i], ns_name(ns_module)); remove_if_unresolved(e.imports, defid.node); ret () // FIXME (issue #521) } @@ -512,7 +511,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, val: &option::t<def>, typ: &option::t<def>, md: &option::t<def>) { if is_none(val) && is_none(typ) && is_none(md) { - unresolved_err(e, sc, sp, name, ~"import"); + unresolved_err(e, sc, sp, name, "import"); } else { e.imports.insert(defid.node, resolved(val, typ, md)); } } fn remove_if_unresolved(imports: hashmap<ast::node_id, import_state>, @@ -532,16 +531,15 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, // Utilities -fn ns_name(ns: namespace) -> istr { +fn ns_name(ns: namespace) -> str { alt ns { - ns_type. { ret ~"typename"; } - ns_value. { ret ~"name"; } - ns_module. { ret ~"modulename"; } + ns_type. { ret "typename"; } + ns_value. { ret "name"; } + ns_module. { ret "modulename"; } } } -fn unresolved_err(e: &env, sc: &scopes, sp: &span, - name: &ident, kind: &istr) { +fn unresolved_err(e: &env, sc: &scopes, sp: &span, name: &ident, kind: &str) { fn find_fn_or_mod_scope(sc: scopes) -> scope { while true { alt sc { @@ -559,19 +557,18 @@ fn unresolved_err(e: &env, sc: &scopes, sp: &span, fail; } let err_scope = find_fn_or_mod_scope(sc); - for rs: {ident: istr, sc: scope} in e.reported { - if str::eq(rs.ident, name) - && err_scope == rs.sc { ret; } + for rs: {ident: str, sc: scope} in e.reported { + if str::eq(rs.ident, name) && err_scope == rs.sc { ret; } } e.reported += [{ident: name, sc: err_scope}]; e.sess.span_err(sp, mk_unresolved_msg(name, kind)); } -fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &istr) -> ! { +fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &str) -> ! { e.sess.span_fatal(sp, mk_unresolved_msg(id, kind)); } -fn mk_unresolved_msg(id: &ident, kind: &istr) -> istr { +fn mk_unresolved_msg(id: &ident, kind: &str) -> str { ret #fmt["unresolved %s: %s", kind, id]; } @@ -603,8 +600,7 @@ fn lookup_path_strict(e: &env, sc: &scopes, sp: &span, pth: &ast::path_, fn lookup_in_scope_strict(e: &env, sc: scopes, sp: &span, name: &ident, ns: namespace) -> option::t<def> { alt lookup_in_scope(e, sc, sp, name, ns) { - none. { unresolved_err(e, sc, sp, name, - ns_name(ns)); ret none; } + none. { unresolved_err(e, sc, sp, name, ns_name(ns)); ret none; } some(d) { ret some(d); } } } @@ -629,10 +625,12 @@ fn scope_closes(sc: &scope) -> option::t<bool> { fn def_is_local(d: &def) -> bool { ret alt d { - ast::def_arg(_, _) | ast::def_local(_) | ast::def_binding(_) | - ast::def_upvar(_, _, _) { true } - _ { false } - }; + ast::def_arg(_, _) | ast::def_local(_) | ast::def_binding(_) | + ast::def_upvar(_, _, _) { + true + } + _ { false } + }; } fn def_is_obj_field(d: &def) -> bool { @@ -715,24 +713,23 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident, if !is_none(fnd) { let df = option::get(fnd); let local = def_is_local(df); - if left_fn && local || - left_fn_level2 && def_is_obj_field(df) || - scope_is_fn(hd) && left_fn && def_is_ty_arg(df) { - let msg = alt ns { - ns_type. { - ~"Attempt to use a type argument out of scope" - } - _ { - ~"attempted dynamic environment-capture" - } - }; + if left_fn && local || left_fn_level2 && def_is_obj_field(df) + || scope_is_fn(hd) && left_fn && def_is_ty_arg(df) { + let msg = + alt ns { + ns_type. { + "Attempt to use a type argument out of scope" + } + _ { "attempted dynamic environment-capture" } + }; e.sess.span_fatal(sp, msg); } else if local { let i = vec::len(closing); while i > 0u { i -= 1u; - df = ast::def_upvar(ast_util::def_id_of_def(df), - @df, closing[i]); + df = + ast::def_upvar(ast_util::def_id_of_def(df), @df, + closing[i]); fnd = some(df); } } @@ -742,16 +739,13 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident, left_fn_level2 = true; } else if ns == ns_value || ns == ns_type { left_fn = scope_is_fn(hd); - alt scope_closes(hd) { - some(mut) { closing += [mut]; } - _ {} - } + alt scope_closes(hd) { some(mut) { closing += [mut]; } _ { } } } sc = *tl; } } } - e.sess.bug(~"reached unreachable code in lookup_in_scope"); // sigh + e.sess.bug("reached unreachable code in lookup_in_scope"); // sigh } @@ -912,8 +906,7 @@ fn found_def_item(i: &@ast::item, ns: namespace) -> option::t<def> { fn lookup_in_mod_strict(e: &env, sc: &scopes, m: def, sp: &span, name: &ident, ns: namespace, dr: dir) -> option::t<def> { alt lookup_in_mod(e, m, sp, name, ns, dr) { - none. { unresolved_err(e, sc, sp, name, - ns_name(ns)); ret none; } + none. { unresolved_err(e, sc, sp, name, ns_name(ns)); ret none; } some(d) { ret some(d); } } } @@ -924,15 +917,13 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace, if defid.crate != ast::local_crate { // examining a module in an external crate - let cached = e.ext_cache.find({did: defid, - ident: name, ns: ns}); + let cached = e.ext_cache.find({did: defid, ident: name, ns: ns}); if !is_none(cached) { ret cached; } let path = [name]; if defid.node != -1 { path = e.ext_map.get(defid) + path; } let fnd = lookup_external(e, defid.crate, path, ns); if !is_none(fnd) { - e.ext_cache.insert({did: defid, - ident: name, ns: ns}, + e.ext_cache.insert({did: defid, ident: name, ns: ns}, option::get(fnd)); } ret fnd; @@ -962,7 +953,7 @@ fn lookup_import(e: &env, defid: def_id, ns: namespace) -> option::t<def> { resolve_import(e, local_def(node_id), name, path, span, scopes); ret lookup_import(e, defid, ns); } - resolving(sp) { e.sess.span_err(sp, ~"cyclic import"); ret none; } + resolving(sp) { e.sess.span_err(sp, "cyclic import"); ret none; } resolved(val, typ, md) { ret alt ns { ns_value. { val } ns_type. { typ } ns_module. { md } }; } @@ -1026,13 +1017,11 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident, } else { for match: glob_imp_def in matches { let sp = match.item.span; - e.sess.span_note( - sp, #fmt["'%s' is imported here", id]); + e.sess.span_note(sp, #fmt["'%s' is imported here", id]); } e.sess.span_fatal(sp, - ~"'" + id - + ~"' is glob-imported from" + - ~" multiple different modules."); + "'" + id + "' is glob-imported from" + + " multiple different modules."); } } // since we don't know what names we have in advance, @@ -1043,11 +1032,10 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident, let val = per_ns(e, info, sp, id, ns_value, dr); let typ = per_ns(e, info, sp, id, ns_type, dr); let md = per_ns(e, info, sp, id, ns_module, dr); - info.glob_imported_names.insert(id, - resolved(val, typ, md)); + info.glob_imported_names.insert(id, resolved(val, typ, md)); } alt info.glob_imported_names.get(id) { - todo(_, _, _, _, _) { e.sess.bug(~"Shouldn't've put a todo in."); } + todo(_, _, _, _, _) { e.sess.bug("Shouldn't've put a todo in."); } resolving(sp) { ret none::<def>; //circularity is okay in import globs @@ -1101,11 +1089,10 @@ fn lookup_in_mie(e: &env, mie: &mod_index_entry, ns: namespace) -> // Module indexing -fn add_to_index(index: &hashmap<ident, list<mod_index_entry>>, - id: &ident, ent: &mod_index_entry) { +fn add_to_index(index: &hashmap<ident, list<mod_index_entry>>, id: &ident, + ent: &mod_index_entry) { alt index.find(id) { - none. { index.insert(id, - cons(ent, @nil::<mod_index_entry>)); } + none. { index.insert(id, cons(ent, @nil::<mod_index_entry>)); } some(prev) { index.insert(id, cons(ent, @prev)); } } } @@ -1119,11 +1106,13 @@ fn index_mod(md: &ast::_mod) -> mod_index { } + ast::view_item_import(ident, _, id) { add_to_index(index, ident, mie_import_ident(id, it.span)); } + ast::view_item_import_from(_, idents, _) { for ident in idents { add_to_index(index, ident.node.name, @@ -1132,6 +1121,7 @@ fn index_mod(md: &ast::_mod) -> mod_index { } + //globbed imports have to be resolved lazily. ast::view_item_import_glob(_, _) | ast::view_item_export(_, _) { } @@ -1238,26 +1228,25 @@ fn check_mod_name(e: &env, name: &ident, entries: list<mod_index_entry>) { let saw_mod = false; let saw_type = false; let saw_value = false; - fn dup(e: &env, sp: &span, word: &istr, name: &ident) { - e.sess.span_fatal(sp, ~"duplicate definition of " + - word + name); + fn dup(e: &env, sp: &span, word: &str, name: &ident) { + e.sess.span_fatal(sp, "duplicate definition of " + word + name); } while true { alt entries { cons(entry, rest) { if !is_none(lookup_in_mie(e, entry, ns_value)) { if saw_value { - dup(e, mie_span(entry), ~"", name); + dup(e, mie_span(entry), "", name); } else { saw_value = true; } } if !is_none(lookup_in_mie(e, entry, ns_type)) { if saw_type { - dup(e, mie_span(entry), ~"type ", name); + dup(e, mie_span(entry), "type ", name); } else { saw_type = true; } } if !is_none(lookup_in_mie(e, entry, ns_module)) { if saw_mod { - dup(e, mie_span(entry), ~"module ", name); + dup(e, mie_span(entry), "module ", name); } else { saw_mod = true; } } entries = *rest; @@ -1288,20 +1277,20 @@ fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) { ast::item_fn(f, ty_params) { check_fn(*e, i.span, f); ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, - ~"type parameter"); + "type parameter"); } ast::item_obj(ob, ty_params, _) { fn field_name(field: &ast::obj_field) -> ident { ret field.ident; } - ensure_unique(*e, i.span, ob.fields, field_name, ~"object field"); + ensure_unique(*e, i.span, ob.fields, field_name, "object field"); for m: @ast::method in ob.methods { check_fn(*e, m.span, m.node.meth); } ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, - ~"type parameter"); + "type parameter"); } ast::item_tag(_, ty_params) { ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, - ~"type parameter"); + "type parameter"); } _ { } } @@ -1316,28 +1305,28 @@ fn check_pat(ch: checker, p: &@ast::pat) { fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) { visit::visit_arm(a, x, v); - let ch0 = checker(*e, ~"binding"); + let ch0 = checker(*e, "binding"); check_pat(ch0, a.pats[0]); let seen0 = ch0.seen; let i = vec::len(a.pats); while i > 1u { i -= 1u; - let ch = checker(*e, ~"binding"); + let ch = checker(*e, "binding"); check_pat(ch, a.pats[i]); // Ensure the bindings introduced in this pattern are the same as in // the first pattern. if vec::len(ch.seen) != vec::len(seen0) { e.sess.span_err(a.pats[i].span, - ~"inconsistent number of bindings"); + "inconsistent number of bindings"); } else { for name: ident in ch.seen { if is_none(vec::find(bind str::eq(name, _), seen0)) { // Fight the alias checker let name_ = name; e.sess.span_err(a.pats[i].span, - ~"binding " + name_ + - ~" does not occur in first pattern"); + "binding " + name_ + + " does not occur in first pattern"); } } } @@ -1346,15 +1335,15 @@ fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) { fn check_block(e: &@env, b: &ast::blk, x: &(), v: &vt<()>) { visit::visit_block(b, x, v); - let values = checker(*e, ~"value"); - let types = checker(*e, ~"type"); - let mods = checker(*e, ~"module"); + let values = checker(*e, "value"); + let types = checker(*e, "type"); + let mods = checker(*e, "module"); for st: @ast::stmt in b.node.stmts { alt st.node { ast::stmt_decl(d, _) { alt d.node { ast::decl_local(locs) { - let local_values = checker(*e, ~"value"); + let local_values = checker(*e, "value"); for loc in locs { for each p in ast_util::pat_bindings(loc.node.pat) { let ident = alt p.node { pat_bind(n) { n } }; @@ -1394,14 +1383,14 @@ fn check_block(e: &@env, b: &ast::blk, x: &(), v: &vt<()>) { fn check_fn(e: &env, sp: &span, f: &ast::_fn) { fn arg_name(a: &ast::arg) -> ident { ret a.ident; } - ensure_unique(e, sp, f.decl.inputs, arg_name, ~"argument"); + ensure_unique(e, sp, f.decl.inputs, arg_name, "argument"); } fn check_expr(e: &@env, ex: &@ast::expr, x: &(), v: &vt<()>) { alt ex.node { ast::expr_rec(fields, _) { fn field_name(f: &ast::field) -> ident { ret f.node.ident; } - ensure_unique(*e, ex.span, fields, field_name, ~"field"); + ensure_unique(*e, ex.span, fields, field_name, "field"); } _ { } } @@ -1412,16 +1401,16 @@ fn check_ty(e: &@env, ty: &@ast::ty, x: &(), v: &vt<()>) { alt ty.node { ast::ty_rec(fields) { fn field_name(f: &ast::ty_field) -> ident { ret f.node.ident; } - ensure_unique(*e, ty.span, fields, field_name, ~"field"); + ensure_unique(*e, ty.span, fields, field_name, "field"); } _ { } } visit::visit_ty(ty, x, v); } -type checker = @{mutable seen: [ident], kind: istr, sess: session}; +type checker = @{mutable seen: [ident], kind: str, sess: session}; -fn checker(e: &env, kind: &istr) -> checker { +fn checker(e: &env, kind: &str) -> checker { let seen: [ident] = []; ret @{mutable seen: seen, kind: kind, sess: e.sess}; } @@ -1429,8 +1418,7 @@ fn checker(e: &env, kind: &istr) -> checker { fn check_name(ch: &checker, sp: &span, name: &ident) { for s: ident in ch.seen { if str::eq(s, name) { - ch.sess.span_fatal(sp, ~"duplicate " + ch.kind - + ~" name: " + name); + ch.sess.span_fatal(sp, "duplicate " + ch.kind + " name: " + name); } } } @@ -1442,23 +1430,23 @@ fn add_name(ch: &checker, sp: &span, name: &ident) { fn ident_id(i: &ident) -> ident { ret i; } fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident, - kind: &istr) { + kind: &str) { let ch = checker(e, kind); for elt: T in elts { add_name(ch, sp, id(elt)); } } fn check_bad_exports(e: &@env) { - fn lookup_glob_any(e: &env, info: &@indexed_mod, sp: &span, - ident: &ident) -> bool { - ret !option::is_none(lookup_glob_in_mod(e, info, sp, ident, - ns_module, inside)) || - !option::is_none(lookup_glob_in_mod(e, info, sp, ident, - ns_value, inside)) || - !option::is_none(lookup_glob_in_mod(e, info, sp, ident, - ns_type, inside)); + fn lookup_glob_any(e: &env, info: &@indexed_mod, sp: &span, ident: &ident) + -> bool { + ret !option::is_none(lookup_glob_in_mod(e, info, sp, ident, ns_module, + inside)) || + !option::is_none(lookup_glob_in_mod(e, info, sp, ident, + ns_value, inside)) || + !option::is_none(lookup_glob_in_mod(e, info, sp, ident, + ns_type, inside)); } - for each @{val, _} in e.mod_map.items() { + for each @{val: val, _} in e.mod_map.items() { alt val.m { some(m) { for vi in m.view_items { @@ -1466,17 +1454,18 @@ fn check_bad_exports(e: &@env) { ast::view_item_export(idents, _) { for ident in idents { if !val.index.contains_key(ident) && - !lookup_glob_any(*e, val, vi.span, ident) { - e.sess.span_warn(vi.span, ~"exported item " + - ident + ~" is not defined"); + !lookup_glob_any(*e, val, vi.span, ident) { + e.sess.span_warn(vi.span, + "exported item " + ident + + " is not defined"); } } } - _ {} + _ { } } } } - none. {} + none. { } } } } diff --git a/src/comp/middle/shape.rs b/src/comp/middle/shape.rs index 73627cfc67a..6740fc0966d 100644 --- a/src/comp/middle/shape.rs +++ b/src/comp/middle/shape.rs @@ -84,15 +84,18 @@ fn eq_res_info(a: &res_info, b: &res_info) -> bool { ret a.did.crate == b.did.crate && a.did.node == b.did.node && a.t == b.t; } -fn mk_global(ccx: &@crate_ctxt, name: &istr, llval: ValueRef, - internal: bool) -> ValueRef { - let llglobal = str::as_buf(name, { |buf| - lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf) - }); +fn mk_global(ccx: &@crate_ctxt, name: &str, llval: ValueRef, internal: bool) + -> ValueRef { + let llglobal = + str::as_buf(name, + {|buf| + lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, + val_ty(llval), buf) + }); lib::llvm::llvm::LLVMSetInitializer(llglobal, llval); lib::llvm::llvm::LLVMSetGlobalConstant(llglobal, True); - if (internal) { + if internal { lib::llvm::llvm::LLVMSetLinkage(llglobal, lib::llvm::LLVMInternalLinkage as lib::llvm::llvm::Linkage); @@ -256,10 +259,13 @@ fn s_float(_tcx: &ty_ctxt) -> u8 { } fn mk_ctxt(llmod: ModuleRef) -> ctxt { - let llshapetablesty = trans_common::T_named_struct(~"shapes"); - let llshapetables = str::as_buf(~"shapes", { |buf| - lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty, buf) - }); + let llshapetablesty = trans_common::T_named_struct("shapes"); + let llshapetables = + str::as_buf("shapes", + {|buf| + lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty, + buf) + }); ret {mutable next_tag_id: 0u16, pad: 0u16, @@ -292,17 +298,20 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } + ty::ty_int. { s += [s_int(ccx.tcx)]; } ty::ty_float. { s += [s_float(ccx.tcx)]; } + ty::ty_uint. | ty::ty_ptr(_) | ty::ty_type. | ty::ty_native(_) { s += [s_uint(ccx.tcx)]; } + ty::ty_machine(ast::ty_i8.) { s += [shape_i8]; } @@ -314,6 +323,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { ty::ty_machine(ast::ty_i64.) { s += [shape_i64]; } + ty::ty_istr. { s += [shape_vec]; add_bool(s, true); // type is POD @@ -321,6 +331,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { add_substr(s, shape_of(ccx, unit_ty, ty_param_map)); } + ty::ty_tag(did, tps) { alt tag_kind(ccx, did) { tk_unit. { @@ -358,6 +369,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } + ty::ty_box(mt) { s += [shape_box]; add_substr(s, shape_of(ccx, mt.ty, ty_param_map)); @@ -387,6 +399,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } + ty::ty_fn(_, _, _, _, _) { s += [shape_fn]; } @@ -394,6 +407,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { ty::ty_obj(_) { s += [shape_obj]; } + ty::ty_res(did, raw_subt, tps) { let subt = ty::substitute_type_params(ccx.tcx, tps, raw_subt); let ri = {did: did, t: subt}; @@ -409,15 +423,17 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } + ty::ty_var(n) { fail "shape_of ty_var"; } + ty::ty_param(n, _) { // Find the type parameter in the parameter list. let found = false; let i = 0u; - while (i < vec::len(ty_param_map)) { + while i < vec::len(ty_param_map) { if n == ty_param_map[i] { s += [shape_var, i as u8]; found = true; @@ -425,7 +441,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } i += 1u; } - assert found; + assert (found); } } @@ -433,15 +449,11 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] { } // FIXME: We might discover other variants as we traverse these. Handle this. -fn shape_of_variant(ccx: &@crate_ctxt, - v: &ty::variant_info, +fn shape_of_variant(ccx: &@crate_ctxt, v: &ty::variant_info, ty_param_count: uint) -> [u8] { let ty_param_map = []; let i = 0u; - while (i < ty_param_count) { - ty_param_map += [i]; - i += 1u; - } + while i < ty_param_count { ty_param_map += [i]; i += 1u; } let s = []; for t: ty::t in v.args { s += shape_of(ccx, t, ty_param_map); } @@ -540,7 +552,7 @@ fn gen_tag_shapes(ccx: &@crate_ctxt) -> ValueRef { header += data; header += lv_table; - ret mk_global(ccx, ~"tag_shapes", C_bytes(header), true); + ret mk_global(ccx, "tag_shapes", C_bytes(header), true); } fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef { @@ -553,7 +565,7 @@ fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef { i += 1u; } - ret mk_global(ccx, ~"resource_shapes", C_struct(dtors), true); + ret mk_global(ccx, "resource_shapes", C_struct(dtors), true); } fn gen_shape_tables(ccx: &@crate_ctxt) { diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs index 315b11340ba..16621d779e8 100644 --- a/src/comp/middle/trans.rs +++ b/src/comp/middle/trans.rs @@ -82,14 +82,16 @@ fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) -> let atys: [TypeRef] = []; for arg: ty::arg in inputs { let t: TypeRef = type_of_inner(cx, sp, arg.ty); - t = alt arg.mode { - ty::mo_alias(_) { T_ptr(t) } - ty::mo_move. { T_ptr(t) } - _ { - if ty::type_is_structural(cx.tcx, arg.ty) { T_ptr(t) } - else { t } - } - }; + t = + alt arg.mode { + ty::mo_alias(_) { T_ptr(t) } + ty::mo_move. { T_ptr(t) } + _ { + if ty::type_is_structural(cx.tcx, arg.ty) { + T_ptr(t) + } else { t } + } + }; atys += [t]; } ret atys; @@ -224,7 +226,7 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: ty::t) -> TypeRef { ret T_struct([T_i32(), type_of_inner(cx, sp, sub1)]); } ty::ty_var(_) { - cx.tcx.sess.span_fatal(sp, ~"trans::type_of called on ty_var"); + cx.tcx.sess.span_fatal(sp, "trans::type_of called on ty_var"); } ty::ty_param(_, _) { llty = T_typaram(cx.tn); } ty::ty_type. { llty = T_ptr(cx.tydesc_type); } @@ -286,17 +288,17 @@ fn type_of_or_i8(bcx: &@block_ctxt, typ: ty::t) -> TypeRef { // Name sanitation. LLVM will happily accept identifiers with weird names, but // gas doesn't! -fn sanitize(s: &istr) -> istr { - let result = ~""; +fn sanitize(s: &str) -> str { + let result = ""; for c: u8 in s { if c == '@' as u8 { - result += ~"boxed_"; + result += "boxed_"; } else { if c == ',' as u8 { - result += ~"_"; + result += "_"; } else { if c == '{' as u8 || c == '(' as u8 { - result += ~"_of_"; + result += "_of_"; } else { if c != 10u8 && c != '}' as u8 && c != ')' as u8 && c != ' ' as u8 && c != '\t' as u8 && c != ';' as u8 @@ -312,7 +314,7 @@ fn sanitize(s: &istr) -> istr { } -fn log_fn_time(ccx: &@crate_ctxt, name: &istr, start: &time::timeval, +fn log_fn_time(ccx: &@crate_ctxt, name: &str, start: &time::timeval, end: &time::timeval) { let elapsed = 1000 * (end.sec - start.sec as int) + @@ -321,98 +323,83 @@ fn log_fn_time(ccx: &@crate_ctxt, name: &istr, start: &time::timeval, } -fn decl_fn(llmod: ModuleRef, name: &istr, cc: uint, llty: TypeRef) -> +fn decl_fn(llmod: ModuleRef, name: &str, cc: uint, llty: TypeRef) -> ValueRef { - let llfn: ValueRef = str::as_buf(name, { |buf| - llvm::LLVMAddFunction(llmod, buf, llty) - }); + let llfn: ValueRef = + str::as_buf(name, {|buf| llvm::LLVMAddFunction(llmod, buf, llty) }); llvm::LLVMSetFunctionCallConv(llfn, cc); ret llfn; } -fn decl_cdecl_fn(llmod: ModuleRef, name: &istr, llty: TypeRef) -> ValueRef { +fn decl_cdecl_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> ValueRef { ret decl_fn(llmod, name, lib::llvm::LLVMCCallConv, llty); } -fn decl_fastcall_fn(llmod: ModuleRef, name: &istr, - llty: TypeRef) -> ValueRef { +fn decl_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> ValueRef { let llfn = decl_fn(llmod, name, lib::llvm::LLVMFastCallConv, llty); - let _: () = str::as_buf(~"rust", { |buf| - llvm::LLVMSetGC(llfn, buf) - }); + let _: () = str::as_buf("rust", {|buf| llvm::LLVMSetGC(llfn, buf) }); ret llfn; } // Only use this if you are going to actually define the function. It's // not valid to simply declare a function as internal. -fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &istr, llty: TypeRef) -> +fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> ValueRef { let llfn = decl_fn(llmod, name, lib::llvm::LLVMFastCallConv, llty); llvm::LLVMSetLinkage(llfn, lib::llvm::LLVMInternalLinkage as llvm::Linkage); - let _: () = str::as_buf(~"rust", { |buf| - llvm::LLVMSetGC(llfn, buf) - }); + let _: () = str::as_buf("rust", {|buf| llvm::LLVMSetGC(llfn, buf) }); ret llfn; } -fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &istr) -> ValueRef { +fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &str) -> ValueRef { ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(cx)], T_void())); } -fn get_extern_fn(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef, - name: &istr, cc: uint, ty: TypeRef) -> ValueRef { - if externs.contains_key(name) { - ret externs.get(name); - } +fn get_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef, + name: &str, cc: uint, ty: TypeRef) -> ValueRef { + if externs.contains_key(name) { ret externs.get(name); } let f = decl_fn(llmod, name, cc, ty); externs.insert(name, f); ret f; } -fn get_extern_const(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef, - name: &istr, ty: TypeRef) -> ValueRef { - if externs.contains_key(name) { - ret externs.get(name); - } - let c = str::as_buf(name, { |buf| - llvm::LLVMAddGlobal(llmod, ty, buf) - }); +fn get_extern_const(externs: &hashmap<str, ValueRef>, llmod: ModuleRef, + name: &str, ty: TypeRef) -> ValueRef { + if externs.contains_key(name) { ret externs.get(name); } + let c = str::as_buf(name, {|buf| llvm::LLVMAddGlobal(llmod, ty, buf) }); externs.insert(name, c); ret c; } -fn get_simple_extern_fn(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef, - name: &istr, n_args: int) -> ValueRef { +fn get_simple_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef, + name: &str, n_args: int) -> ValueRef { let inputs = std::vec::init_elt::<TypeRef>(T_int(), n_args as uint); let output = T_int(); let t = T_fn(inputs, output); ret get_extern_fn(externs, llmod, name, lib::llvm::LLVMCCallConv, t); } -fn trans_native_call(cx: &@block_ctxt, externs: &hashmap<istr, ValueRef>, - llmod: ModuleRef, name: &istr, args: &[ValueRef]) -> +fn trans_native_call(cx: &@block_ctxt, externs: &hashmap<str, ValueRef>, + llmod: ModuleRef, name: &str, args: &[ValueRef]) -> ValueRef { let n: int = std::vec::len::<ValueRef>(args) as int; let llnative: ValueRef = get_simple_extern_fn(externs, llmod, name, n); let call_args: [ValueRef] = []; - for a: ValueRef in args { - call_args += [ZExtOrBitCast(cx, a, T_int())]; - } + for a: ValueRef in args { call_args += [ZExtOrBitCast(cx, a, T_int())]; } ret Call(cx, llnative, call_args); } fn trans_non_gc_free(cx: &@block_ctxt, v: ValueRef) -> @block_ctxt { Call(cx, bcx_ccx(cx).upcalls.free, - [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8())), - C_int(0)]); + [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8())), C_int(0)]); ret cx; } fn trans_shared_free(cx: &@block_ctxt, v: ValueRef) -> @block_ctxt { Call(cx, bcx_ccx(cx).upcalls.shared_free, - [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8()))]); + [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8()))]); ret cx; } @@ -479,8 +466,8 @@ fn alloca(cx: &@block_ctxt, t: TypeRef) -> ValueRef { ret Alloca(new_raw_block_ctxt(cx.fcx, cx.fcx.llstaticallocas), t); } -fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t) - -> ValueRef { +fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t) -> + ValueRef { let bcx = cx; let dy_cx = new_raw_block_ctxt(cx.fcx, cx.fcx.lldynamicallocas); let lltaskptr = bcx_fcx(bcx).lltaskptr; @@ -502,8 +489,8 @@ fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t) ret PointerCast(dy_cx, llresult, T_ptr(t)); } -fn mk_obstack_token(ccx: &@crate_ctxt, fcx: @fn_ctxt, - lltaskptr: ValueRef) -> ValueRef { +fn mk_obstack_token(ccx: &@crate_ctxt, fcx: @fn_ctxt, lltaskptr: ValueRef) -> + ValueRef { let cx = new_raw_block_ctxt(fcx, fcx.lldynamicallocas); ret Call(cx, ccx.upcalls.dynastack_mark, [lltaskptr]); } @@ -544,7 +531,7 @@ fn simplify_type(ccx: &@crate_ctxt, typ: ty::t) -> ty::t { fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: ty::t) -> uint { if ty::type_has_dynamic_size(cx.tcx, t) { cx.tcx.sess.span_fatal(sp, - ~"dynamically sized type passed to \ + "dynamically sized type passed to \ static_size_of_tag()"); } if cx.tag_sizes.contains_key(t) { ret cx.tag_sizes.get(t); } @@ -572,7 +559,7 @@ fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: ty::t) -> uint { ret max_size; } _ { - cx.tcx.sess.span_fatal(sp, ~"non-tag passed to static_size_of_tag()"); + cx.tcx.sess.span_fatal(sp, "non-tag passed to static_size_of_tag()"); } } } @@ -793,8 +780,9 @@ fn GEP_tup_like(cx: &@block_ctxt, t: ty::t, base: ValueRef, ixs: &[int]) -> // appropriate. @llblobptr is the data part of a tag value; its actual type is // meaningless, as it will be cast away. fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id, - variant_id: &ast::def_id, ty_substs: &[ty::t], ix: uint) - : valid_variant_index(ix, cx, tag_id, variant_id) -> result { + variant_id: &ast::def_id, ty_substs: &[ty::t], + ix: uint) : valid_variant_index(ix, cx, tag_id, variant_id) -> + result { let variant = ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id); // Synthesize a tuple type so that GEP_tup_like() can work its magic. // Separately, store the type of the element we're interested in. @@ -849,7 +837,7 @@ fn trans_raw_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) -> let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type)); let rval = Call(cx, bcx_ccx(cx).upcalls.malloc, - [cx.fcx.lltaskptr, llsize, tydesc]); + [cx.fcx.lltaskptr, llsize, tydesc]); ret rslt(cx, PointerCast(cx, rval, llptr_ty)); } @@ -862,7 +850,7 @@ fn trans_shared_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type)); let rval = Call(cx, bcx_ccx(cx).upcalls.shared_malloc, - [cx.fcx.lltaskptr, llsize, tydesc]); + [cx.fcx.lltaskptr, llsize, tydesc]); ret rslt(cx, PointerCast(cx, rval, llptr_ty)); } @@ -951,8 +939,7 @@ fn linearize_ty_params(cx: &@block_ctxt, t: ty::t) -> fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef, llalign: ValueRef, llroottydesc: ValueRef, llfirstparam: ValueRef, n_params: uint, - obj_params: uint) - -> ValueRef { + obj_params: uint) -> ValueRef { let llmyroottydesc = alloca(cx, bcx_ccx(cx).tydesc_type); // By convention, desc 0 is the root descriptor. @@ -975,11 +962,7 @@ fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef, // Objects and closures store their type parameters differently (in the object // or closure itself rather than in the type descriptor). -tag ty_param_storage { - tps_normal; - tps_obj(uint); - tps_fn(uint); -} +tag ty_param_storage { tps_normal; tps_obj(uint); tps_fn(uint); } fn get_derived_tydesc(cx: &@block_ctxt, t: ty::t, escapes: bool, storage: ty_param_storage, @@ -1034,27 +1017,28 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: ty::t, escapes: bool, let llfirstparam = PointerCast(bcx, llparamtydescs, - T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type))); + T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type))); // The top bit indicates whether this type descriptor describes an object // (0) or a function (1). let obj_params; alt storage { - tps_normal. { obj_params = 0u; } - tps_obj(np) { obj_params = np; } - tps_fn(np) { obj_params = 0x80000000u | np; } + tps_normal. { obj_params = 0u; } + tps_obj(np) { obj_params = np; } + tps_fn(np) { obj_params = 0x80000000u | np; } } let v; if escapes { let td_val = Call(bcx, bcx_ccx(bcx).upcalls.get_type_desc, - [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val, - align.val, C_uint(1u + n_params), - llfirstparam, C_uint(obj_params)]); + [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val, + align.val, C_uint(1u + n_params), llfirstparam, + C_uint(obj_params)]); v = td_val; } else { - v = trans_stack_local_derived_tydesc(bcx, sz.val, align.val, root, + v = + trans_stack_local_derived_tydesc(bcx, sz.val, align.val, root, llfirstparam, n_params, obj_params); } @@ -1077,13 +1061,12 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: ty::t, escapes: bool, if id < vec::len(cx.fcx.lltydescs) { ret {kind: tk_param, result: rslt(cx, cx.fcx.lltydescs[id])}; } else { - bcx_tcx(cx).sess.span_bug( - cx.sp, - ~"Unbound typaram in get_tydesc: " + - ~"orig_t = " + - ty_to_str(bcx_tcx(cx), orig_t) + - ~" ty_param = " + - std::uint::str(id)); + bcx_tcx(cx).sess.span_bug(cx.sp, + "Unbound typaram in get_tydesc: " + + "orig_t = " + + ty_to_str(bcx_tcx(cx), orig_t) + + " ty_param = " + + std::uint::str(id)); } } none. {/* fall through */ } @@ -1094,7 +1077,6 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: ty::t, escapes: bool, ret {kind: tk_derived, result: get_derived_tydesc(cx, t, escapes, storage, static_ti)}; } - // Otherwise, generate a tydesc if necessary, and return it. let info = get_static_tydesc(cx, t, []); static_ti = some::<@tydesc_info>(info); @@ -1147,7 +1129,7 @@ fn set_glue_inlining(cx: &@local_ctxt, f: ValueRef, t: ty::t) { // Generates the declaration for (but doesn't emit) a type descriptor. fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint]) -> @tydesc_info { - log ~"+++ declare_tydesc " + ty_to_str(cx.ccx.tcx, t); + log "+++ declare_tydesc " + ty_to_str(cx.ccx.tcx, t); let ccx = cx.ccx; let llsize; let llalign; @@ -1164,12 +1146,14 @@ fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint]) } let name; if cx.ccx.sess.get_opts().debuginfo { - name = mangle_internal_name_by_type_only(cx.ccx, t, ~"tydesc"); + name = mangle_internal_name_by_type_only(cx.ccx, t, "tydesc"); name = sanitize(name); - } else { name = mangle_internal_name_by_seq(cx.ccx, ~"tydesc"); } - let gvar = str::as_buf(name, { |buf| - llvm::LLVMAddGlobal(ccx.llmod, ccx.tydesc_type, buf) - }); + } else { name = mangle_internal_name_by_seq(cx.ccx, "tydesc"); } + let gvar = + str::as_buf(name, + {|buf| + llvm::LLVMAddGlobal(ccx.llmod, ccx.tydesc_type, buf) + }); let info = @{ty: t, tydesc: gvar, @@ -1180,7 +1164,7 @@ fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint]) mutable free_glue: none::<ValueRef>, mutable cmp_glue: none::<ValueRef>, ty_params: ty_params}; - log ~"--- declare_tydesc " + ty_to_str(cx.ccx.tcx, t); + log "--- declare_tydesc " + ty_to_str(cx.ccx.tcx, t); ret info; } @@ -1190,21 +1174,20 @@ tag glue_helper { } fn declare_generic_glue(cx: &@local_ctxt, t: ty::t, llfnty: TypeRef, - name: &istr) -> ValueRef { + name: &str) -> ValueRef { let name = name; let fn_nm; if cx.ccx.sess.get_opts().debuginfo { - fn_nm = mangle_internal_name_by_type_only(cx.ccx, t, ~"glue_" + name); + fn_nm = mangle_internal_name_by_type_only(cx.ccx, t, "glue_" + name); fn_nm = sanitize(fn_nm); - } else { fn_nm = mangle_internal_name_by_seq(cx.ccx, ~"glue_" + name); } + } else { fn_nm = mangle_internal_name_by_seq(cx.ccx, "glue_" + name); } let llfn = decl_cdecl_fn(cx.ccx.llmod, fn_nm, llfnty); set_glue_inlining(cx, llfn, t); ret llfn; } fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t, - llfn: ValueRef, - helper: &glue_helper, + llfn: ValueRef, helper: &glue_helper, ty_params: &[uint]) -> ValueRef { let fcx = new_fn_ctxt(cx, sp, llfn); llvm::LLVMSetLinkage(llfn, @@ -1242,9 +1225,7 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t, let llrawptr0 = llvm::LLVMGetParam(llfn, 4u); let llval0 = BitCast(bcx, llrawptr0, llty); alt helper { - default_helper(helper) { - helper(bcx, llval0, t); - } + default_helper(helper) { helper(bcx, llval0, t); } copy_helper(helper) { let llrawptr1 = llvm::LLVMGetParam(llfn, 5u); let llval1 = BitCast(bcx, llrawptr1, llty); @@ -1256,8 +1237,8 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t, } fn make_generic_glue(cx: &@local_ctxt, sp: &span, t: ty::t, llfn: ValueRef, - helper: &glue_helper, ty_params: &[uint], - name: &istr) -> ValueRef { + helper: &glue_helper, ty_params: &[uint], name: &str) -> + ValueRef { if !cx.ccx.sess.get_opts().stats { ret make_generic_glue_inner(cx, sp, t, llfn, helper, ty_params); } @@ -1265,8 +1246,7 @@ fn make_generic_glue(cx: &@local_ctxt, sp: &span, t: ty::t, llfn: ValueRef, let start = time::get_time(); let llval = make_generic_glue_inner(cx, sp, t, llfn, helper, ty_params); let end = time::get_time(); - log_fn_time(cx.ccx, ~"glue " + name + ~" " + - ty_to_short_str(cx.ccx.tcx, t), + log_fn_time(cx.ccx, "glue " + name + " " + ty_to_short_str(cx.ccx.tcx, t), start, end); ret llval; } @@ -1317,7 +1297,7 @@ fn emit_tydescs(ccx: &@crate_ctxt) { cmp_glue, // cmp_glue C_shape(ccx, shape), // shape shape_tables, // shape_tables - C_int(0), // n_params + C_int(0), // n_params C_int(0)]); // n_obj_params let gvar = ti.tydesc; @@ -1354,56 +1334,56 @@ fn incr_refcnt_of_boxed(cx: &@block_ctxt, box_ptr: ValueRef) -> @block_ctxt { fn make_free_glue(bcx: &@block_ctxt, v0: ValueRef, t: ty::t) { // NB: v is an *alias* of type t here, not a direct value. - let bcx = alt ty::struct(bcx_tcx(bcx), t) { - ty::ty_box(body_mt) { - let v = Load(bcx, v0); - let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]); - let bcx = drop_ty(bcx, body, body_mt.ty); - if !bcx_ccx(bcx).sess.get_opts().do_gc { - trans_non_gc_free(bcx, v) - } else { bcx } - } - ty::ty_uniq(_) { fail "free uniq unimplemented"; } - ty::ty_obj(_) { - // Call through the obj's own fields-drop glue first. - // Then free the body. - let box_cell = - GEP(bcx, v0, [C_int(0), C_int(abi::obj_field_box)]); - let b = Load(bcx, box_cell); - let ccx = bcx_ccx(bcx); - let llbox_ty = T_opaque_obj_ptr(*ccx); - b = PointerCast(bcx, b, llbox_ty); - let body = - GEP(bcx, b, [C_int(0), C_int(abi::box_rc_field_body)]); - let tydescptr = - GEP(bcx, body, [C_int(0), C_int(abi::obj_body_elt_tydesc)]); - let tydesc = Load(bcx, tydescptr); - let ti = none; - call_tydesc_glue_full(bcx, body, tydesc, - abi::tydesc_field_drop_glue, ti); - if !bcx_ccx(bcx).sess.get_opts().do_gc { - trans_non_gc_free(bcx, b) - } else { bcx } - } - ty::ty_fn(_, _, _, _, _) { - // Call through the closure's own fields-drop glue first. - // Then free the body. - let box_cell = GEP(bcx, v0, [C_int(0), C_int(abi::fn_field_box)]); - let v = Load(bcx, box_cell); - let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]); - let bindings = - GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_bindings)]); - let tydescptr = - GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_tydesc)]); - let ti = none; - call_tydesc_glue_full(bcx, bindings, Load(bcx, tydescptr), - abi::tydesc_field_drop_glue, ti); - if !bcx_ccx(bcx).sess.get_opts().do_gc { - trans_non_gc_free(bcx, v) - } else { bcx } - } - _ { bcx } - }; + let bcx = + alt ty::struct(bcx_tcx(bcx), t) { + ty::ty_box(body_mt) { + let v = Load(bcx, v0); + let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]); + let bcx = drop_ty(bcx, body, body_mt.ty); + if !bcx_ccx(bcx).sess.get_opts().do_gc { + trans_non_gc_free(bcx, v) + } else { bcx } + } + ty::ty_uniq(_) { fail "free uniq unimplemented"; } + ty::ty_obj(_) { + // Call through the obj's own fields-drop glue first. + // Then free the body. + let box_cell = + GEP(bcx, v0, [C_int(0), C_int(abi::obj_field_box)]); + let b = Load(bcx, box_cell); + let ccx = bcx_ccx(bcx); + let llbox_ty = T_opaque_obj_ptr(*ccx); + b = PointerCast(bcx, b, llbox_ty); + let body = GEP(bcx, b, [C_int(0), C_int(abi::box_rc_field_body)]); + let tydescptr = + GEP(bcx, body, [C_int(0), C_int(abi::obj_body_elt_tydesc)]); + let tydesc = Load(bcx, tydescptr); + let ti = none; + call_tydesc_glue_full(bcx, body, tydesc, + abi::tydesc_field_drop_glue, ti); + if !bcx_ccx(bcx).sess.get_opts().do_gc { + trans_non_gc_free(bcx, b) + } else { bcx } + } + ty::ty_fn(_, _, _, _, _) { + // Call through the closure's own fields-drop glue first. + // Then free the body. + let box_cell = GEP(bcx, v0, [C_int(0), C_int(abi::fn_field_box)]); + let v = Load(bcx, box_cell); + let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]); + let bindings = + GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_bindings)]); + let tydescptr = + GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_tydesc)]); + let ti = none; + call_tydesc_glue_full(bcx, bindings, Load(bcx, tydescptr), + abi::tydesc_field_drop_glue, ti); + if !bcx_ccx(bcx).sess.get_opts().do_gc { + trans_non_gc_free(bcx, v) + } else { bcx } + } + _ { bcx } + }; build_return(bcx); } @@ -1448,8 +1428,8 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id, let ccx = bcx_ccx(cx); let inner_t_s = ty::substitute_type_params(ccx.tcx, tps, inner_t); let tup_ty = ty::mk_tup(ccx.tcx, [ty::mk_int(ccx.tcx), inner_t_s]); - let drop_cx = new_sub_block_ctxt(cx, ~"drop res"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let drop_cx = new_sub_block_ctxt(cx, "drop res"); + let next_cx = new_sub_block_ctxt(cx, "next"); let drop_flag = GEP_tup_like(cx, tup_ty, rs, [0, 0]); cx = drop_flag.bcx; @@ -1462,11 +1442,9 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id, // Find and call the actual destructor. let dtor_pair = trans_common::get_res_dtor(ccx, cx.sp, did, inner_t); let dtor_addr = - Load(cx, GEP(cx, dtor_pair, - [C_int(0), C_int(abi::fn_field_code)])); + Load(cx, GEP(cx, dtor_pair, [C_int(0), C_int(abi::fn_field_code)])); let dtor_env = - Load(cx, GEP(cx, dtor_pair, - [C_int(0), C_int(abi::fn_field_box)])); + Load(cx, GEP(cx, dtor_pair, [C_int(0), C_int(abi::fn_field_box)])); let args = [cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env]; for tp: ty::t in tps { let ti: option::t<@tydesc_info> = none; @@ -1478,9 +1456,8 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id, // value here, but the dtor expects a type that still has opaque pointers // for type variables. let val_llty = - lib::llvm::fn_ty_param_tys( - llvm::LLVMGetElementType( - llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)]; + lib::llvm::fn_ty_param_tys(llvm::LLVMGetElementType( + llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)]; let val_cast = BitCast(cx, val.val, val_llty); FastCall(cx, dtor_addr, args + [val_cast]); @@ -1493,17 +1470,16 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id, fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef, full_alias: ValueRef, t: ty::t) -> @block_ctxt { let ccx = bcx_ccx(cx); - let rc_adj_cx = new_sub_block_ctxt(cx, ~"rc--"); - let free_cx = new_sub_block_ctxt(cx, ~"free"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let rc_adj_cx = new_sub_block_ctxt(cx, "rc--"); + let free_cx = new_sub_block_ctxt(cx, "free"); + let next_cx = new_sub_block_ctxt(cx, "next"); let box_ptr = Load(cx, box_ptr_alias); let llbox_ty = T_opaque_obj_ptr(*ccx); box_ptr = PointerCast(cx, box_ptr, llbox_ty); let null_test = IsNull(cx, box_ptr); CondBr(cx, null_test, next_cx.llbb, rc_adj_cx.llbb); let rc_ptr = - GEP(rc_adj_cx, box_ptr, - [C_int(0), C_int(abi::box_rc_field_refcnt)]); + GEP(rc_adj_cx, box_ptr, [C_int(0), C_int(abi::box_rc_field_refcnt)]); let rc = Load(rc_adj_cx, rc_ptr); rc = Sub(rc_adj_cx, rc, C_int(1)); Store(rc_adj_cx, rc, rc_ptr); @@ -1516,11 +1492,9 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef, // Structural comparison: a rather involved form of glue. -fn maybe_name_value(cx: &@crate_ctxt, v: ValueRef, s: &istr) { +fn maybe_name_value(cx: &@crate_ctxt, v: ValueRef, s: &str) { if cx.sess.get_opts().save_temps { - let _: () = str::as_buf(s, { |buf| - llvm::LLVMSetValueName(v, buf) - }); + let _: () = str::as_buf(s, {|buf| llvm::LLVMSetValueName(v, buf) }); } } @@ -1553,21 +1527,21 @@ fn compare_scalar_types(cx: @block_ctxt, lhs: ValueRef, rhs: ValueRef, } } ty::ty_type. { - trans_fail(cx, none, ~"attempt to compare values of type type"); + trans_fail(cx, none, "attempt to compare values of type type"); // This is a bit lame, because we return a dummy block to the // caller that's actually unreachable, but I don't think it // matters. - ret rslt(new_sub_block_ctxt(cx, ~"after_fail_dummy"), C_bool(false)); + ret rslt(new_sub_block_ctxt(cx, "after_fail_dummy"), C_bool(false)); } ty::ty_native(_) { trans_fail(cx, none::<span>, - ~"attempt to compare values of type native"); - ret rslt(new_sub_block_ctxt(cx, ~"after_fail_dummy"), C_bool(false)); + "attempt to compare values of type native"); + ret rslt(new_sub_block_ctxt(cx, "after_fail_dummy"), C_bool(false)); } _ { // Should never get here, because t is scalar. - bcx_ccx(cx).sess.bug(~"non-scalar type passed to \ + bcx_ccx(cx).sess.bug("non-scalar type passed to \ compare_scalar_types"); } } @@ -1620,17 +1594,17 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, } else { r = ICmp(cx, op, lhs, rhs); } ret r; } - let last_cx = new_sub_block_ctxt(cx, ~"last"); - let eq_cx = new_sub_block_ctxt(cx, ~"eq"); + let last_cx = new_sub_block_ctxt(cx, "last"); + let eq_cx = new_sub_block_ctxt(cx, "eq"); let eq_result = generic_cmp(eq_cx, nt, eq_cmp, lhs, rhs); Br(eq_cx, last_cx.llbb); - let lt_cx = new_sub_block_ctxt(cx, ~"lt"); + let lt_cx = new_sub_block_ctxt(cx, "lt"); let lt_result = generic_cmp(lt_cx, nt, lt_cmp, lhs, rhs); Br(lt_cx, last_cx.llbb); - let le_cx = new_sub_block_ctxt(cx, ~"le"); + let le_cx = new_sub_block_ctxt(cx, "le"); let le_result = generic_cmp(le_cx, nt, le_cmp, lhs, rhs); Br(le_cx, last_cx.llbb); - let unreach_cx = new_sub_block_ctxt(cx, ~"unreach"); + let unreach_cx = new_sub_block_ctxt(cx, "unreach"); Unreachable(unreach_cx); let llswitch = Switch(cx, llop, unreach_cx.llbb, 3u); llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_eq), eq_cx.llbb); @@ -1638,7 +1612,7 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb); let last_result = Phi(last_cx, T_i1(), [eq_result, lt_result, le_result], - [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); + [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); ret rslt(last_cx, last_result); } @@ -1664,13 +1638,13 @@ fn incr_ptr(cx: &@block_ctxt, p: ValueRef, incr: ValueRef, pp: ValueRef) { // Iterates through the elements of a structural type. fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, f: &val_and_ty_fn) -> @block_ctxt { - fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) - -> @block_ctxt { + fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) -> + @block_ctxt { let box_ptr = Load(cx, box_cell); let tnil = ty::mk_nil(bcx_tcx(cx)); let tbox = ty::mk_imm_box(bcx_tcx(cx), tnil); - let inner_cx = new_sub_block_ctxt(cx, ~"iter box"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let inner_cx = new_sub_block_ctxt(cx, "iter box"); + let next_cx = new_sub_block_ctxt(cx, "next"); let null_test = IsNull(cx, box_ptr); CondBr(cx, null_test, next_cx.llbb, inner_cx.llbb); let inner_cx = f(inner_cx, box_cell, tbox); @@ -1689,7 +1663,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, let j = 0u; let v_id = variant.id; for a: ty::arg in args { - check valid_variant_index(j, cx, tid, v_id); + check (valid_variant_index(j, cx, tid, v_id)); let rslt = GEP_tag(cx, a_tup, tid, v_id, tps, j); let llfldp_a = rslt.val; cx = rslt.bcx; @@ -1706,7 +1680,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, ty::ty_rec(fields) { let i: int = 0; for fld: ty::field in fields { - let {bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]); + let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]); cx = f(bcx, llfld_a, fld.mt.ty); i += 1; } @@ -1714,7 +1688,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, ty::ty_tup(args) { let i = 0; for arg in args { - let {bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]); + let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]); cx = f(bcx, llfld_a, arg); i += 1; } @@ -1724,7 +1698,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, let inner1 = ty::substitute_type_params(tcx, tps, inner); let inner_t_s = ty::substitute_type_params(tcx, tps, inner); let tup_t = ty::mk_tup(tcx, [ty::mk_int(tcx), inner_t_s]); - let {bcx, val: llfld_a} = GEP_tup_like(cx, tup_t, av, [0, 1]); + let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, tup_t, av, [0, 1]); ret f(bcx, llfld_a, inner1); } ty::ty_tag(tid, tps) { @@ -1745,55 +1719,52 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t, // NB: we must hit the discriminant first so that structural // comparison know not to proceed when the discriminants differ. cx = f(cx, lldiscrim_a_ptr, ty::mk_int(bcx_tcx(cx))); - let unr_cx = new_sub_block_ctxt(cx, ~"tag-iter-unr"); + let unr_cx = new_sub_block_ctxt(cx, "tag-iter-unr"); Unreachable(unr_cx); let llswitch = Switch(cx, lldiscrim_a, unr_cx.llbb, n_variants); - let next_cx = new_sub_block_ctxt(cx, ~"tag-iter-next"); + let next_cx = new_sub_block_ctxt(cx, "tag-iter-next"); let i = 0u; for variant: ty::variant_info in variants { let variant_cx = - new_sub_block_ctxt(cx, ~"tag-iter-variant-" + - uint::to_str(i, 10u)); + new_sub_block_ctxt(cx, + "tag-iter-variant-" + + uint::to_str(i, 10u)); llvm::LLVMAddCase(llswitch, C_int(i as int), variant_cx.llbb); - variant_cx = iter_variant(variant_cx, llunion_a_ptr, variant, - tps, tid, f); + variant_cx = + iter_variant(variant_cx, llunion_a_ptr, variant, tps, tid, f); Br(variant_cx, next_cx.llbb); i += 1u; } ret next_cx; } ty::ty_fn(_, _, _, _, _) { - let box_cell_a = - GEP(cx, av, [C_int(0), C_int(abi::fn_field_box)]); + let box_cell_a = GEP(cx, av, [C_int(0), C_int(abi::fn_field_box)]); ret iter_boxpp(cx, box_cell_a, f); } ty::ty_obj(_) { - let box_cell_a = - GEP(cx, av, [C_int(0), C_int(abi::obj_field_box)]); + let box_cell_a = GEP(cx, av, [C_int(0), C_int(abi::obj_field_box)]); ret iter_boxpp(cx, box_cell_a, f); } - _ { bcx_ccx(cx).sess.unimpl(~"type in iter_structural_ty"); } + _ { bcx_ccx(cx).sess.unimpl("type in iter_structural_ty"); } } ret cx; } // Iterates through a pointer range, until the src* hits the src_lim*. -fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, - src: ValueRef, src_lim: ValueRef, - elt_sz: ValueRef, f: &val_pair_fn) -> @block_ctxt { +fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, src: ValueRef, + src_lim: ValueRef, elt_sz: ValueRef, f: &val_pair_fn) -> + @block_ctxt { let bcx = cx; let dst_int: ValueRef = vp2i(bcx, dst); let src_int: ValueRef = vp2i(bcx, src); let src_lim_int: ValueRef = vp2i(bcx, src_lim); - let cond_cx = new_scope_block_ctxt(cx, ~"sequence-iter cond"); - let body_cx = new_scope_block_ctxt(cx, ~"sequence-iter body"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let cond_cx = new_scope_block_ctxt(cx, "sequence-iter cond"); + let body_cx = new_scope_block_ctxt(cx, "sequence-iter body"); + let next_cx = new_sub_block_ctxt(cx, "next"); Br(bcx, cond_cx.llbb); - let dst_curr: ValueRef = - Phi(cond_cx, T_int(), [dst_int], [bcx.llbb]); - let src_curr: ValueRef = - Phi(cond_cx, T_int(), [src_int], [bcx.llbb]); + let dst_curr: ValueRef = Phi(cond_cx, T_int(), [dst_int], [bcx.llbb]); + let src_curr: ValueRef = Phi(cond_cx, T_int(), [src_int], [bcx.llbb]); let end_test = ICmp(cond_cx, lib::llvm::LLVMIntULT, src_curr, src_lim_int); CondBr(cond_cx, end_test, body_cx.llbb, next_cx.llbb); @@ -1808,8 +1779,7 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, ret next_cx; } -fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef, - src_lim: ValueRef, +fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef, src_lim: ValueRef, elt_ty: &ty::t, f: &val_and_ty_fn) -> @block_ctxt { fn adaptor_fn(f: val_and_ty_fn, elt_ty: ty::t, cx: &@block_ctxt, _dst: ValueRef, src: ValueRef) -> @block_ctxt { @@ -1832,11 +1802,11 @@ fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef, // Iterates through the elements of a vec or str. -fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn) - -> @block_ctxt { +fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn) -> + @block_ctxt { fn iter_sequence_body(bcx: @block_ctxt, v: ValueRef, elt_ty: ty::t, - f: &val_and_ty_fn, trailing_null: bool) - -> @block_ctxt { + f: &val_and_ty_fn, trailing_null: bool) -> + @block_ctxt { let llunit_ty = type_of_or_i8(bcx, elt_ty); let p0 = tvec::get_dataptr(bcx, v, llunit_ty); let len = tvec::get_fill(bcx, v); @@ -1846,24 +1816,20 @@ fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn) bcx = unit_sz.bcx; len = Sub(bcx, len, unit_sz.val); } - let p1 = - vi2p(bcx, Add(bcx, vp2i(bcx, p0), len), T_ptr(llunit_ty)); + let p1 = vi2p(bcx, Add(bcx, vp2i(bcx, p0), len), T_ptr(llunit_ty)); ret iter_sequence_inner(bcx, p0, p1, elt_ty, f); } alt ty::struct(bcx_tcx(cx), t) { - ty::ty_vec(elt) { - ret iter_sequence_body(cx, v, elt.ty, f, false); - } + ty::ty_vec(elt) { ret iter_sequence_body(cx, v, elt.ty, f, false); } ty::ty_istr. { let et = ty::mk_mach(bcx_tcx(cx), ast::ty_u8); ret iter_sequence_body(cx, v, et, f, true); } _ { - bcx_ccx(cx).sess.bug( - ~"unexpected type in trans::iter_sequence: " - + ty_to_str(cx.fcx.lcx.ccx.tcx, t)); + bcx_ccx(cx).sess.bug("unexpected type in trans::iter_sequence: " + + ty_to_str(cx.fcx.lcx.ccx.tcx, t)); } } } @@ -1897,11 +1863,11 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int, let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), - ~"take"); + "take"); ti.take_glue = some::<ValueRef>(glue_fn); make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, default_helper(make_take_glue), - ti.ty_params, ~"take"); + ti.ty_params, "take"); log #fmt["--- lazily_emit_tydesc_glue TAKE %s", ty_to_str(bcx_tcx(cx), ti.ty)]; } @@ -1915,16 +1881,16 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int, let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), - ~"drop"); + "drop"); ti.drop_glue = some::<ValueRef>(glue_fn); make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, default_helper(make_drop_glue), - ti.ty_params, ~"drop"); + ti.ty_params, "drop"); log #fmt["--- lazily_emit_tydesc_glue DROP %s", ty_to_str(bcx_tcx(cx), ti.ty)]; } } - } else if field == abi::tydesc_field_free_glue { + } else if field == abi::tydesc_field_free_glue { alt { ti.free_glue } { some(_) { } none. { @@ -1933,11 +1899,11 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int, let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), - ~"free"); + "free"); ti.free_glue = some::<ValueRef>(glue_fn); make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, default_helper(make_free_glue), - ti.ty_params, ~"free"); + ti.ty_params, "free"); log #fmt["--- lazily_emit_tydesc_glue FREE %s", ty_to_str(bcx_tcx(cx), ti.ty)]; } @@ -1978,8 +1944,7 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef, let llrawptr = PointerCast(cx, v, T_ptr(T_i8())); let lltydescs = - GEP(cx, tydesc, - [C_int(0), C_int(abi::tydesc_field_first_param)]); + GEP(cx, tydesc, [C_int(0), C_int(abi::tydesc_field_first_param)]); lltydescs = Load(cx, lltydescs); let llfn; @@ -1992,14 +1957,14 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef, } Call(cx, llfn, - [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, - C_null(T_ptr(T_nil())), lltydescs, llrawptr]); + [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, C_null(T_ptr(T_nil())), + lltydescs, llrawptr]); } fn call_tydesc_glue(cx: &@block_ctxt, v: ValueRef, t: ty::t, field: int) -> - @block_ctxt { + @block_ctxt { let ti: option::t<@tydesc_info> = none::<@tydesc_info>; - let {bcx, val: td} = get_tydesc(cx, t, false, tps_normal, ti).result; + let {bcx: bcx, val: td} = get_tydesc(cx, t, false, tps_normal, ti).result; call_tydesc_glue_full(bcx, v, td, field, ti); ret bcx; } @@ -2012,25 +1977,28 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: ty::t, let bcx = cx; let r = spill_if_immediate(bcx, lhs, t); - let lllhs = r.val; bcx = r.bcx; + let lllhs = r.val; + bcx = r.bcx; r = spill_if_immediate(bcx, rhs, t); - let llrhs = r.val; bcx = r.bcx; + let llrhs = r.val; + bcx = r.bcx; let llrawlhsptr = BitCast(bcx, lllhs, T_ptr(T_i8())); let llrawrhsptr = BitCast(bcx, llrhs, T_ptr(T_i8())); let ti = none::<@tydesc_info>; r = get_tydesc(bcx, t, false, tps_normal, ti).result; - let lltydesc = r.val; bcx = r.bcx; + let lltydesc = r.val; + bcx = r.bcx; lazily_emit_tydesc_glue(bcx, abi::tydesc_field_cmp_glue, ti); - let lltydescs = GEP(bcx, lltydesc, - [C_int(0), C_int(abi::tydesc_field_first_param)]); + let lltydescs = + GEP(bcx, lltydesc, [C_int(0), C_int(abi::tydesc_field_first_param)]); lltydescs = Load(bcx, lltydescs); let llfn; alt ti { none. { - let llfnptr = GEP(bcx, lltydesc, - [C_int(0), C_int(abi::tydesc_field_cmp_glue)]); + let llfnptr = + GEP(bcx, lltydesc, [C_int(0), C_int(abi::tydesc_field_cmp_glue)]); llfn = Load(bcx, llfnptr); } some(sti) { llfn = option::get(sti.cmp_glue); } @@ -2038,8 +2006,8 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: ty::t, let llcmpresultptr = alloca(bcx, T_i1()); let llargs: [ValueRef] = - [llcmpresultptr, bcx.fcx.lltaskptr, lltydesc, lltydescs, - llrawlhsptr, llrawrhsptr, llop]; + [llcmpresultptr, bcx.fcx.lltaskptr, lltydesc, lltydescs, llrawlhsptr, + llrawrhsptr, llop]; Call(bcx, llfn, llargs); ret rslt(bcx, Load(bcx, llcmpresultptr)); } @@ -2083,16 +2051,15 @@ fn call_memmove(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, // LLVM complains -- not even a constant element of a tydesc works). let i = bcx_ccx(cx).intrinsics; - assert (i.contains_key(~"llvm.memmove.p0i8.p0i8.i32")); - let memmove = i.get(~"llvm.memmove.p0i8.p0i8.i32"); + assert (i.contains_key("llvm.memmove.p0i8.p0i8.i32")); + let memmove = i.get("llvm.memmove.p0i8.p0i8.i32"); let src_ptr = PointerCast(cx, src, T_ptr(T_i8())); let dst_ptr = PointerCast(cx, dst, T_ptr(T_i8())); let size = IntCast(cx, n_bytes, T_i32()); let align = C_int(1); let volatile = C_bool(false); ret rslt(cx, - Call(cx, memmove, - [dst_ptr, src_ptr, size, align, volatile])); + Call(cx, memmove, [dst_ptr, src_ptr, size, align, volatile])); } fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef, @@ -2100,8 +2067,8 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef, // FIXME: switch to the 64-bit variant when on such a platform. let i = bcx_ccx(cx).intrinsics; - assert (i.contains_key(~"llvm.memset.p0i8.i32")); - let memset = i.get(~"llvm.memset.p0i8.i32"); + assert (i.contains_key("llvm.memset.p0i8.i32")); + let memset = i.get("llvm.memset.p0i8.i32"); let dst_ptr = PointerCast(cx, dst, T_ptr(T_i8())); let size = IntCast(cx, n_bytes, T_i32()); let align = @@ -2110,8 +2077,7 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef, } else { IntCast(cx, C_int(0), T_i32()) }; let volatile = C_bool(false); ret rslt(cx, - Call(cx, memset, - [dst_ptr, C_u8(0u), size, align, volatile])); + Call(cx, memset, [dst_ptr, C_u8(0u), size, align, volatile])); } fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: ty::t) -> @@ -2144,12 +2110,12 @@ fn type_is_structural_or_param(tcx: &ty::ctxt, t: ty::t) -> bool { fn copy_val(cx: &@block_ctxt, action: copy_action, dst: ValueRef, src: ValueRef, t: ty::t) -> @block_ctxt { if type_is_structural_or_param(bcx_ccx(cx).tcx, t) && - action == DROP_EXISTING { - let do_copy_cx = new_sub_block_ctxt(cx, ~"do_copy"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + action == DROP_EXISTING { + let do_copy_cx = new_sub_block_ctxt(cx, "do_copy"); + let next_cx = new_sub_block_ctxt(cx, "next"); let self_assigning = - ICmp(cx, lib::llvm::LLVMIntNE, - PointerCast(cx, dst, val_ty(src)), src); + ICmp(cx, lib::llvm::LLVMIntNE, PointerCast(cx, dst, val_ty(src)), + src); CondBr(cx, self_assigning, do_copy_cx.llbb, next_cx.llbb); do_copy_cx = copy_val_no_check(do_copy_cx, action, dst, src, t); Br(do_copy_cx, next_cx.llbb); @@ -2164,7 +2130,7 @@ fn copy_val_no_check(cx: &@block_ctxt, action: copy_action, dst: ValueRef, // FIXME this is just a clunky stopgap. we should do proper checking in an // earlier pass. if !ty::type_is_copyable(ccx.tcx, t) { - ccx.sess.span_fatal(cx.sp, ~"Copying a non-copyable type."); + ccx.sess.span_fatal(cx.sp, "Copying a non-copyable type."); } if ty::type_is_scalar(ccx.tcx, t) || ty::type_is_native(ccx.tcx, t) { @@ -2172,23 +2138,20 @@ fn copy_val_no_check(cx: &@block_ctxt, action: copy_action, dst: ValueRef, ret cx; } else if ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t) { ret cx; - } else if ty::type_is_boxed(ccx.tcx, t) || - ty::type_is_vec(ccx.tcx, t) { - let bcx = if action == DROP_EXISTING { - drop_ty(cx, dst, t) - } else { cx }; + } else if ty::type_is_boxed(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t) { + let bcx = + if action == DROP_EXISTING { drop_ty(cx, dst, t) } else { cx }; Store(bcx, src, dst); bcx = take_ty(bcx, dst, t); ret bcx; } else if type_is_structural_or_param(ccx.tcx, t) { - let bcx = if action == DROP_EXISTING { - drop_ty(cx, dst, t) - } else { cx }; + let bcx = + if action == DROP_EXISTING { drop_ty(cx, dst, t) } else { cx }; bcx = memmove_ty(bcx, dst, src, t).bcx; ret take_ty(bcx, dst, t); } - ccx.sess.bug(~"unexpected type in trans::copy_val_no_check: " + - ty_to_str(ccx.tcx, t)); + ccx.sess.bug("unexpected type in trans::copy_val_no_check: " + + ty_to_str(ccx.tcx, t)); } @@ -2201,19 +2164,15 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef, src: &lval_result, t: ty::t) -> @block_ctxt { let src_val = src.res.val; let tcx = bcx_tcx(cx); - if ty::type_is_scalar(tcx, t) || - ty::type_is_native(tcx, t) { + if ty::type_is_scalar(tcx, t) || ty::type_is_native(tcx, t) { if src.is_mem { src_val = Load(cx, src_val); } Store(cx, src_val, dst); ret cx; } else if ty::type_is_nil(tcx, t) || ty::type_is_bot(tcx, t) { ret cx; - } else if ty::type_is_unique(tcx, t) || - ty::type_is_boxed(tcx, t) { + } else if ty::type_is_unique(tcx, t) || ty::type_is_boxed(tcx, t) { if src.is_mem { src_val = Load(cx, src_val); } - if action == DROP_EXISTING { - cx = drop_ty(cx, dst, t); - } + if action == DROP_EXISTING { cx = drop_ty(cx, dst, t); } Store(cx, src_val, dst); if src.is_mem { ret zero_alloca(cx, src.res.val, t).bcx; } @@ -2230,8 +2189,8 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef, ret cx; } } - bcx_ccx(cx).sess.bug(~"unexpected type in trans::move_val: " + - ty_to_str(tcx, t)); + bcx_ccx(cx).sess.bug("unexpected type in trans::move_val: " + + ty_to_str(tcx, t)); } fn move_val_if_temp(cx: @block_ctxt, action: copy_action, dst: ValueRef, @@ -2278,7 +2237,7 @@ fn trans_crate_lit(cx: &@crate_ctxt, lit: &ast::lit) -> ValueRef { ast::lit_bool(b) { ret C_bool(b); } ast::lit_nil. { ret C_nil(); } ast::lit_str(s) { - cx.sess.span_unimpl(lit.span, ~"unique string in this context"); + cx.sess.span_unimpl(lit.span, "unique string in this context"); } } } @@ -2341,7 +2300,7 @@ fn trans_unary(cx: &@block_ctxt, op: ast::unop, e: &@ast::expr, ret rslt(bcx, sub.box); } ast::deref. { - bcx_ccx(cx).sess.bug(~"deref expressions should have been \ + bcx_ccx(cx).sess.bug("deref expressions should have been \ translated using trans_lval(), not \ trans_unary()"); } @@ -2438,8 +2397,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> result_t { while true { alt ty::struct(ccx.tcx, t1) { ty::ty_box(mt) { - let body = - GEP(cx, v1, [C_int(0), C_int(abi::box_rc_field_body)]); + let body = GEP(cx, v1, [C_int(0), C_int(abi::box_rc_field_body)]); t1 = mt.ty; // Since we're changing levels of box indirection, we may have @@ -2484,10 +2442,10 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr, ast::and. { // Lazy-eval and let lhs_res = trans_expr(cx, a); - let rhs_cx = new_scope_block_ctxt(cx, ~"rhs"); + let rhs_cx = new_scope_block_ctxt(cx, "rhs"); let rhs_res = trans_expr(rhs_cx, b); - let lhs_false_cx = new_scope_block_ctxt(cx, ~"lhs false"); + let lhs_false_cx = new_scope_block_ctxt(cx, "lhs false"); let lhs_false_res = rslt(lhs_false_cx, C_bool(false)); // The following line ensures that any cleanups for rhs @@ -2502,9 +2460,9 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr, ast::or. { // Lazy-eval or let lhs_res = trans_expr(cx, a); - let rhs_cx = new_scope_block_ctxt(cx, ~"rhs"); + let rhs_cx = new_scope_block_ctxt(cx, "rhs"); let rhs_res = trans_expr(rhs_cx, b); - let lhs_true_cx = new_scope_block_ctxt(cx, ~"lhs true"); + let lhs_true_cx = new_scope_block_ctxt(cx, "lhs true"); let lhs_true_res = rslt(lhs_true_cx, C_bool(true)); // see the and case for an explanation @@ -2550,17 +2508,15 @@ fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) -> } // We have >1 incoming edges. Make a join block and br+phi them into it. - let join_cx = new_sub_block_ctxt(parent_cx, ~"join"); + let join_cx = new_sub_block_ctxt(parent_cx, "join"); for r: result in live { Br(r.bcx, join_cx.llbb); } let phi = Phi(join_cx, t, vals, bbs); ret rslt(join_cx, phi); } fn join_branches(parent_cx: &@block_ctxt, ins: &[result]) -> @block_ctxt { - let out = new_sub_block_ctxt(parent_cx, ~"join"); - for r: result in ins { - if !is_terminated(r.bcx) { Br(r.bcx, out.llbb); } - } + let out = new_sub_block_ctxt(parent_cx, "join"); + for r: result in ins { if !is_terminated(r.bcx) { Br(r.bcx, out.llbb); } } ret out; } @@ -2579,9 +2535,9 @@ fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk, } else { ret cond_res; } } - let then_cx = new_scope_block_ctxt(cx, ~"then"); + let then_cx = new_scope_block_ctxt(cx, "then"); let then_res = trans_block(then_cx, thn, output); - let else_cx = new_scope_block_ctxt(cx, ~"else"); + let else_cx = new_scope_block_ctxt(cx, "else"); // Synthesize a block here to act as the else block // containing an if expression. Needed in order for the // else scope to behave like a normal block scope. A tad @@ -2613,17 +2569,19 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, // obviously a bug. fn inner(cx: &@block_ctxt, local: @ast::local, curr: ValueRef, t: ty::t, body: &ast::blk, outer_next_cx: @block_ctxt) -> @block_ctxt { - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let next_cx = new_sub_block_ctxt(cx, "next"); let scope_cx = new_loop_scope_block_ctxt(cx, option::some::<@block_ctxt>(next_cx), - outer_next_cx, ~"for loop scope"); + outer_next_cx, "for loop scope"); Br(cx, scope_cx.llbb); let local_res = alloc_local(scope_cx, local); let bcx = copy_val(local_res.bcx, INIT, local_res.val, curr, t); add_clean(scope_cx, local_res.val, t); - let bcx = trans_alt::bind_irrefutable_pat - (bcx, local.node.pat, local_res.val, cx.fcx.lllocals, false); + let bcx = + trans_alt::bind_irrefutable_pat(bcx, local.node.pat, + local_res.val, cx.fcx.lllocals, + false); bcx = trans_block(bcx, body, return).bcx; if !is_terminated(bcx) { Br(bcx, next_cx.llbb); @@ -2631,11 +2589,12 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, } ret next_cx; } - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let next_cx = new_sub_block_ctxt(cx, "next"); let seq_ty = ty::expr_ty(bcx_tcx(cx), seq); let seq_res = trans_expr(cx, seq); - let bcx = iter_sequence(seq_res.bcx, seq_res.val, seq_ty, - bind inner(_, local, _, _, body, next_cx)); + let bcx = + iter_sequence(seq_res.bcx, seq_res.val, seq_ty, + bind inner(_, local, _, _, body, next_cx)); Br(bcx, next_cx.llbb); ret rslt(next_cx, C_nil()); } @@ -2742,8 +2701,8 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], // Given a context and a list of upvars, build a closure. This just // collects the upvars and packages them up for build_environment. -fn build_closure(cx: &@block_ctxt, upvars: &@[ast::def], copying: bool) - -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { +fn build_closure(cx: &@block_ctxt, upvars: &@[ast::def], copying: bool) -> + {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { let closure_vals: [lval_result] = []; let closure_tys: [ty::t] = []; // If we need to, package up the iterator body to call @@ -2785,11 +2744,9 @@ fn find_environment_tydescs(bcx: &@block_ctxt, envty: ty::t, let llenv = GEPi(bcx, closure, [0, abi::box_rc_field_body]); // Load the tydesc and find the size of the body let lldesc = - Load(bcx, GEPi(bcx, llenv, - [0, abi::closure_elt_tydesc])); + Load(bcx, GEPi(bcx, llenv, [0, abi::closure_elt_tydesc])); let llsz = - Load(bcx, GEPi(bcx, lldesc, - [0, abi::tydesc_field_size])); + Load(bcx, GEPi(bcx, lldesc, [0, abi::tydesc_field_size])); // Get the bindings pointer and add the size to it let llbinds = GEPi(bcx, llenv, [0, abi::closure_elt_bindings]); @@ -2885,10 +2842,8 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, let llenv = build_closure(cx, upvars, false); // Step 2: Declare foreach body function. - let s: istr = - mangle_internal_name_by_path_and_seq(lcx.ccx, - lcx.path, - ~"foreach"); + let s: str = + mangle_internal_name_by_path_and_seq(lcx.ccx, lcx.path, "foreach"); // The 'env' arg entering the body function is a fake env member (as in // the env-part of the normal rust calling convention) that actually @@ -2899,8 +2854,7 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, type_of_fn_from_ty(lcx.ccx, cx.sp, ty::mk_iter_body_fn(lcx.ccx.tcx, decl_ty), 0u); let lliterbody: ValueRef = - decl_internal_fastcall_fn(lcx.ccx.llmod, - s, iter_body_llty); + decl_internal_fastcall_fn(lcx.ccx.llmod, s, iter_body_llty); let fcx = new_fn_ctxt_w_id(lcx, cx.sp, lliterbody, body.node.id); fcx.iterbodyty = cx.fcx.iterbodyty; @@ -2936,11 +2890,11 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, fn trans_while(cx: &@block_ctxt, cond: &@ast::expr, body: &ast::blk) -> result { - let next_cx = new_sub_block_ctxt(cx, ~"while next"); - let cond_cx = new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>, - next_cx, ~"while cond"); - let body_cx = - new_scope_block_ctxt(cond_cx, ~"while loop body"); + let next_cx = new_sub_block_ctxt(cx, "while next"); + let cond_cx = + new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>, next_cx, + "while cond"); + let body_cx = new_scope_block_ctxt(cond_cx, "while loop body"); let body_res = trans_block(body_cx, body, return); let cond_res = trans_expr(cond_cx, cond); Br(body_res.bcx, cond_cx.llbb); @@ -2952,10 +2906,10 @@ fn trans_while(cx: &@block_ctxt, cond: &@ast::expr, body: &ast::blk) -> fn trans_do_while(cx: &@block_ctxt, body: &ast::blk, cond: &@ast::expr) -> result { - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let next_cx = new_sub_block_ctxt(cx, "next"); let body_cx = new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>, next_cx, - ~"do-while loop body"); + "do-while loop body"); let body_res = trans_block(body_cx, body, return); if is_terminated(body_res.bcx) { // This is kind of ridiculous, but no permutations @@ -3003,8 +2957,7 @@ fn trans_external_path(cx: &@block_ctxt, did: &ast::def_id, tpt: &ty::ty_param_kinds_and_ty) -> ValueRef { let lcx = cx.fcx.lcx; let name = csearch::get_symbol(lcx.ccx.sess.get_cstore(), did); - ret get_extern_const(lcx.ccx.externs, lcx.ccx.llmod, - name, + ret get_extern_const(lcx.ccx.externs, lcx.ccx.llmod, name, type_of_ty_param_kinds_and_ty(lcx, cx.sp, tpt)); } @@ -3045,9 +2998,11 @@ fn lookup_discriminant(lcx: &@local_ctxt, vid: &ast::def_id) -> ValueRef { // It's an external discriminant that we haven't seen yet. assert (vid.crate != ast::local_crate); let sym = csearch::get_symbol(lcx.ccx.sess.get_cstore(), vid); - let gvar = str::as_buf(sym, { |buf| - llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf) - }); + let gvar = + str::as_buf(sym, + {|buf| + llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf) + }); llvm::LLVMSetLinkage(gvar, lib::llvm::LLVMExternalLinkage as llvm::Linkage); llvm::LLVMSetGlobalConstant(gvar, True); @@ -3081,14 +3036,15 @@ fn trans_local_var(cx: &@block_ctxt, def: &ast::def) -> lval_result { ret lval_mem(cx, cx.fcx.llobjfields.get(did.node)); } _ { - bcx_ccx(cx).sess.span_unimpl - (cx.sp, ~"unsupported def type in trans_local_def"); + bcx_ccx(cx).sess.span_unimpl( + cx.sp, + "unsupported def type in trans_local_def"); } } } -fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def, - id: ast::node_id) -> lval_result { +fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def, id: ast::node_id) -> + lval_result { let ccx = bcx_ccx(cx); alt def { ast::def_fn(did, _) { @@ -3114,8 +3070,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def, if std::vec::len(ty::tag_variants(ccx.tcx, tid)) != 1u { let lldiscrim_gv = lookup_discriminant(bcx.fcx.lcx, vid); let lldiscrim = Load(bcx, lldiscrim_gv); - let lldiscrimptr = - GEP(bcx, lltagptr, [C_int(0), C_int(0)]); + let lldiscrimptr = GEP(bcx, lltagptr, [C_int(0), C_int(0)]); Store(bcx, lldiscrim, lldiscrimptr); } ret lval_val(bcx, lltagptr); @@ -3162,8 +3117,7 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: ty::t, } ty::ty_obj(methods) { let ix: uint = ty::method_idx(bcx_ccx(cx).sess, sp, field, methods); - let vtbl = - GEP(r.bcx, r.val, [C_int(0), C_int(abi::obj_field_vtbl)]); + let vtbl = GEP(r.bcx, r.val, [C_int(0), C_int(abi::obj_field_vtbl)]); vtbl = Load(r.bcx, vtbl); let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u)); @@ -3181,7 +3135,7 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: ty::t, ret {llobj: some::<ValueRef>(r.val), method_ty: some::<ty::t>(fn_ty) with lvo}; } - _ { bcx_ccx(cx).sess.unimpl(~"field variant in trans_field"); } + _ { bcx_ccx(cx).sess.unimpl("field variant in trans_field"); } } } @@ -3208,19 +3162,19 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr, let unit_ty = node_id_type(bcx_ccx(cx), id); let unit_sz = size_of(bcx, unit_ty); bcx = unit_sz.bcx; - maybe_name_value(bcx_ccx(cx), unit_sz.val, ~"unit_sz"); + maybe_name_value(bcx_ccx(cx), unit_sz.val, "unit_sz"); let scaled_ix = Mul(bcx, ix_val, unit_sz.val); - maybe_name_value(bcx_ccx(cx), scaled_ix, ~"scaled_ix"); + maybe_name_value(bcx_ccx(cx), scaled_ix, "scaled_ix"); let lim = tvec::get_fill(bcx, v); let body = tvec::get_dataptr(bcx, v, type_of_or_i8(bcx, unit_ty)); let bounds_check = ICmp(bcx, lib::llvm::LLVMIntULT, scaled_ix, lim); - let fail_cx = new_sub_block_ctxt(bcx, ~"fail"); - let next_cx = new_sub_block_ctxt(bcx, ~"next"); + let fail_cx = new_sub_block_ctxt(bcx, "fail"); + let next_cx = new_sub_block_ctxt(bcx, "next"); let ncx = bcx_ccx(next_cx); CondBr(bcx, bounds_check, next_cx.llbb, fail_cx.llbb); // fail: bad bounds check. - trans_fail(fail_cx, some::<span>(sp), ~"bounds check"); + trans_fail(fail_cx, some::<span>(sp), "bounds check"); let elt = if check type_has_static_size(ncx, unit_ty) { let elt_1 = GEP(next_cx, body, [ix_val]); let llunitty = type_of(ncx, sp, unit_ty); @@ -3256,8 +3210,7 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result { alt ty::struct(ccx.tcx, t) { ty::ty_box(_) { InBoundsGEP(sub.bcx, sub.val, - [C_int(0), - C_int(abi::box_rc_field_body)]) + [C_int(0), C_int(abi::box_rc_field_body)]) } ty::ty_uniq(_) { fail "uniq lval translation unimplemented" } ty::ty_res(_, _, _) { @@ -3286,7 +3239,7 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result { } _ { // Shouldn't happen. - bcx_ccx(cx).sess.bug(~"trans_lval called on \ + bcx_ccx(cx).sess.bug("trans_lval called on \ expr_self_method in \ a context without llself"); } @@ -3392,7 +3345,7 @@ fn trans_cast(cx: &@block_ctxt, e: &@ast::expr, id: ast::node_id) -> result { {in: native_., out: native_.} { PointerCast(e_res.bcx, e_res.val, ll_t_out) } - _ { ccx.sess.bug(~"Translating unsupported cast.") } + _ { ccx.sess.bug("Translating unsupported cast.") } }; ret rslt(e_res.bcx, newval); } @@ -3430,8 +3383,8 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t, // construct and return that thunk. // Give the thunk a name, type, and value. - let s: istr = - mangle_internal_name_by_path_and_seq(ccx, cx.path, ~"thunk"); + let s: str = + mangle_internal_name_by_path_and_seq(ccx, cx.path, "thunk"); let llthunk_ty: TypeRef = get_pair_fn_ty(type_of(ccx, sp, incoming_fty)); let llthunk: ValueRef = @@ -3529,6 +3482,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t, let is_val = out_arg.mode == ty::mo_val; alt arg { + // Arg provided at binding time; thunk copies it from // closure. some(e) { @@ -3554,6 +3508,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t, } + // Arg will be provided when the thunk is invoked. none. { let arg: ValueRef = llvm::LLVMGetParam(llthunk, a); @@ -3701,7 +3656,8 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, lldestty0: TypeRef, } } else if type_is_immediate(ccx, e_ty) && !lv.is_mem { let r = do_spill(bcx, val, e_ty); - val = r.val; bcx = r.bcx; + val = r.val; + bcx = r.bcx; } if !is_bot && ty::type_contains_params(ccx.tcx, arg.ty) { @@ -3834,7 +3790,7 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr, // NB: 'f' isn't necessarily a function; it might be an entire self-call // expression because of the hack that allows us to process self-calls // with trans_call. - let cx = new_scope_block_ctxt(in_cx, ~"call"); + let cx = new_scope_block_ctxt(in_cx, "call"); Br(in_cx, cx.llbb); let f_res = trans_lval_gen(cx, f); let fn_ty: ty::t; @@ -3866,8 +3822,7 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr, let pair = res.val; faddr = GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_code)]); faddr = Load(bcx, faddr); - let llclosure = - GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_box)]); + let llclosure = GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_box)]); llenv = Load(bcx, llclosure); } } @@ -3915,11 +3870,9 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr, for {v: v, t: t}: {v: ValueRef, t: ty::t} in args_res.to_zero { zero_alloca(bcx, v, t) } - for v: ValueRef in args_res.to_revoke { - revoke_clean(bcx, v) - } + for v: ValueRef in args_res.to_revoke { revoke_clean(bcx, v) } bcx = trans_block_cleanups(bcx, cx); - let next_cx = new_sub_block_ctxt(in_cx, ~"next"); + let next_cx = new_sub_block_ctxt(in_cx, "next"); Br(bcx, next_cx.llbb); bcx = next_cx; } @@ -3975,8 +3928,8 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field], if str::eq(f.node.ident, tf.ident) { expr_provided = true; let lv = trans_lval(bcx, f.node.expr); - bcx = move_val_if_temp(lv.res.bcx, INIT, dst_res.val, - lv, e_ty); + bcx = + move_val_if_temp(lv.res.bcx, INIT, dst_res.val, lv, e_ty); break; } } @@ -4029,12 +3982,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let ccx = bcx_ccx(cx); let llfnty: TypeRef = type_of_fn_from_ty(ccx, e.span, node_id_type(ccx, e.id), 0u); - let sub_cx = extend_path(cx.fcx.lcx, - ccx.names.next(~"anon")); - let s = mangle_internal_name_by_path(ccx, - sub_cx.path); - let llfn = decl_internal_fastcall_fn(ccx.llmod, - s, llfnty); + let sub_cx = extend_path(cx.fcx.lcx, ccx.names.next("anon")); + let s = mangle_internal_name_by_path(ccx, sub_cx.path); + let llfn = decl_internal_fastcall_fn(ccx.llmod, s, llfnty); let fn_res = trans_closure(some(cx), some(llfnty), sub_cx, e.span, f, llfn, @@ -4043,16 +3993,15 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> alt fn_res { some(fn_pair) { fn_pair } none. { - {fn_pair: create_fn_pair(ccx, s, - llfnty, llfn, false), + {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false), bcx: cx} } }; ret rslt(fn_pair.bcx, fn_pair.fn_pair); } ast::expr_block(blk) { - let sub_cx = new_scope_block_ctxt(cx, ~"block-expr body"); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let sub_cx = new_scope_block_ctxt(cx, "block-expr body"); + let next_cx = new_sub_block_ctxt(cx, "next"); let sub = with_out_method(bind trans_block(sub_cx, blk, _), cx, e.id, output); @@ -4073,8 +4022,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let t = ty::expr_ty(bcx_tcx(cx), src); // FIXME: calculate copy init-ness in typestate. - let bcx = move_val(rhs_res.res.bcx, DROP_EXISTING, lhs_res.res.val, - rhs_res, t); + let bcx = + move_val(rhs_res.res.bcx, DROP_EXISTING, lhs_res.res.val, rhs_res, + t); ret rslt(bcx, C_nil()); } ast::expr_assign(dst, src) { @@ -4084,8 +4034,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let rhs = trans_lval(lhs_res.res.bcx, src); let t = ty::expr_ty(bcx_tcx(cx), src); // FIXME: calculate copy init-ness in typestate. - let bcx = move_val_if_temp(rhs.res.bcx, DROP_EXISTING, - lhs_res.res.val, rhs, t); + let bcx = + move_val_if_temp(rhs.res.bcx, DROP_EXISTING, lhs_res.res.val, rhs, + t); ret rslt(bcx, C_nil()); } ast::expr_swap(dst, src) { @@ -4095,13 +4046,13 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let rhs_res = trans_lval(lhs_res.res.bcx, src); let t = ty::expr_ty(bcx_tcx(cx), src); - let {bcx, val: tmp_alloc} = alloc_ty(rhs_res.res.bcx, t); + let {bcx: bcx, val: tmp_alloc} = alloc_ty(rhs_res.res.bcx, t); // Swap through a temporary. bcx = move_val(bcx, INIT, tmp_alloc, lhs_res, t); bcx = move_val(bcx, INIT, lhs_res.res.val, rhs_res, t); - bcx = move_val(bcx, INIT, rhs_res.res.val, - lval_mem(bcx, tmp_alloc), t); + bcx = + move_val(bcx, INIT, rhs_res.res.val, lval_mem(bcx, tmp_alloc), t); ret rslt(bcx, C_nil()); } ast::expr_assign_op(op, dst, src) { @@ -4115,14 +4066,15 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> ty::ty_vec(_) { alt src.node { ast::expr_vec(args, _) { - let bcx = tvec::trans_append_literal - (lhs_res.res.bcx, lhs_res.res.val, t, args); + let bcx = + tvec::trans_append_literal(lhs_res.res.bcx, + lhs_res.res.val, t, args); ret rslt(bcx, C_nil()); } - _ {} + _ { } } } - _ {} + _ { } } // FIXME Fill in lhs_res.res.bcx.sp @@ -4141,8 +4093,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> trans_eager_binop(rhs_res.bcx, op, lhs_val, t, rhs_res.val, t); // FIXME: calculate copy init-ness in typestate. // This is always a temporary, so can always be safely moved - let bcx = move_val(v.bcx, DROP_EXISTING, lhs_res.res.val, - lval_val(v.bcx, v.val), t); + let bcx = + move_val(v.bcx, DROP_EXISTING, lhs_res.res.val, + lval_val(v.bcx, v.val), t); ret rslt(bcx, C_nil()); } ast::expr_bind(f, args) { ret trans_bind(cx, f, args, e.id); } @@ -4153,12 +4106,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> ast::expr_vec(args, _) { ret tvec::trans_vec(cx, args, e.id); } ast::expr_rec(args, base) { ret trans_rec(cx, args, base, e.id); } ast::expr_tup(args) { ret trans_tup(cx, args, e.id); } - ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug(~"unexpanded macro"); } + ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug("unexpanded macro"); } ast::expr_fail(expr) { ret trans_fail_expr(cx, some(e.span), expr); } ast::expr_log(lvl, a) { ret trans_log(lvl, cx, a); } - ast::expr_assert(a) { ret trans_check_expr(cx, a, ~"Assertion"); } + ast::expr_assert(a) { ret trans_check_expr(cx, a, "Assertion"); } ast::expr_check(ast::checked., a) { - ret trans_check_expr(cx, a, ~"Predicate"); + ret trans_check_expr(cx, a, "Predicate"); } ast::expr_check(ast::unchecked., a) { /* Claims are turned on and off by a global variable @@ -4168,12 +4121,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> otherwise. */ let c = get_extern_const(bcx_ccx(cx).externs, bcx_ccx(cx).llmod, - ~"check_claims", T_bool()); + "check_claims", T_bool()); let cond = Load(cx, c); - let then_cx = new_scope_block_ctxt(cx, ~"claim_then"); - let check_res = trans_check_expr(then_cx, a, ~"Claim"); - let else_cx = new_scope_block_ctxt(cx, ~"else"); + let then_cx = new_scope_block_ctxt(cx, "claim_then"); + let check_res = trans_check_expr(then_cx, a, "Claim"); + let else_cx = new_scope_block_ctxt(cx, "else"); let els = rslt(else_cx, C_nil()); CondBr(cx, cond, then_cx.llbb, else_cx.llbb); @@ -4188,7 +4141,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> // that is_call_expr(ex) -- but we don't support that // yet // FIXME - check ast_util::is_call_expr(ex); + check (ast_util::is_call_expr(ex)); ret trans_be(cx, ex); } ast::expr_anon_obj(anon_obj) { @@ -4236,7 +4189,7 @@ fn with_out_method(work: fn(&out_method) -> result, cx: @block_ctxt, // immediate-ness of the type. fn type_is_immediate(ccx: &@crate_ctxt, t: ty::t) -> bool { ret ty::type_is_scalar(ccx.tcx, t) || ty::type_is_boxed(ccx.tcx, t) || - ty::type_is_native(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t); + ty::type_is_native(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t); } fn do_spill(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> result { @@ -4271,27 +4224,28 @@ fn load_if_immediate(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> ValueRef { fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result { let lcx = cx.fcx.lcx; - let modname = str::connect(lcx.module_path, ~"::"); + let modname = str::connect(lcx.module_path, "::"); let global; if lcx.ccx.module_data.contains_key(modname) { global = lcx.ccx.module_data.get(modname); } else { let s = - link::mangle_internal_name_by_path_and_seq( - lcx.ccx, - lcx.module_path, - ~"loglevel"); - global = str::as_buf(s, { |buf| - llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf) - }); + link::mangle_internal_name_by_path_and_seq(lcx.ccx, + lcx.module_path, + "loglevel"); + global = + str::as_buf(s, + {|buf| + llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf) + }); llvm::LLVMSetGlobalConstant(global, False); llvm::LLVMSetInitializer(global, C_null(T_int())); llvm::LLVMSetLinkage(global, lib::llvm::LLVMInternalLinkage as llvm::Linkage); lcx.ccx.module_data.insert(modname, global); } - let log_cx = new_scope_block_ctxt(cx, ~"log"); - let after_cx = new_sub_block_ctxt(cx, ~"after"); + let log_cx = new_scope_block_ctxt(cx, "log"); + let after_cx = new_sub_block_ctxt(cx, "after"); let load = Load(cx, global); let test = ICmp(cx, lib::llvm::LLVMIntSGE, load, C_int(lvl)); CondBr(cx, test, log_cx.llbb, after_cx.llbb); @@ -4319,12 +4273,12 @@ fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result { ret rslt(after_cx, C_nil()); } -fn trans_check_expr(cx: &@block_ctxt, e: &@ast::expr, s: &istr) -> result { +fn trans_check_expr(cx: &@block_ctxt, e: &@ast::expr, s: &str) -> result { let cond_res = trans_expr(cx, e); - let expr_str = s + ~" " + expr_to_str(e) + ~" failed"; - let fail_cx = new_sub_block_ctxt(cx, ~"fail"); + let expr_str = s + " " + expr_to_str(e) + " failed"; + let fail_cx = new_sub_block_ctxt(cx, "fail"); trans_fail(fail_cx, some::<span>(e.span), expr_str); - let next_cx = new_sub_block_ctxt(cx, ~"next"); + let next_cx = new_sub_block_ctxt(cx, "next"); CondBr(cond_res.bcx, cond_res.val, next_cx.llbb, fail_cx.llbb); ret rslt(next_cx, C_nil()); } @@ -4340,21 +4294,23 @@ fn trans_fail_expr(cx: &@block_ctxt, sp_opt: &option::t<span>, bcx = expr_res.bcx; if ty::type_is_str(tcx, e_ty) { - let data = tvec::get_dataptr( - bcx, expr_res.val, - type_of_or_i8(bcx, ty::mk_mach(tcx, ast::ty_u8))); + let data = + tvec::get_dataptr(bcx, expr_res.val, + type_of_or_i8(bcx, + ty::mk_mach(tcx, + ast::ty_u8))); ret trans_fail_value(bcx, sp_opt, data); } else { bcx_ccx(cx).sess.span_bug(expr.span, - ~"fail called with unsupported type " - + ty_to_str(tcx, e_ty)); + "fail called with unsupported type " + + ty_to_str(tcx, e_ty)); } } - _ { ret trans_fail(bcx, sp_opt, ~"explicit failure"); } + _ { ret trans_fail(bcx, sp_opt, "explicit failure"); } } } -fn trans_fail(cx: &@block_ctxt, sp_opt: &option::t<span>, fail_str: &istr) -> +fn trans_fail(cx: &@block_ctxt, sp_opt: &option::t<span>, fail_str: &str) -> result { let V_fail_str = C_cstr(bcx_ccx(cx), fail_str); ret trans_fail_value(cx, sp_opt, V_fail_str); @@ -4370,7 +4326,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>, V_filename = C_cstr(bcx_ccx(cx), loc.filename); V_line = loc.line as int; } - none. { V_filename = C_cstr(bcx_ccx(cx), ~"<runtime>"); V_line = 0; } + none. { V_filename = C_cstr(bcx_ccx(cx), "<runtime>"); V_line = 0; } } let V_str = PointerCast(cx, V_fail_str, T_ptr(T_i8())); V_filename = PointerCast(cx, V_filename, T_ptr(T_i8())); @@ -4381,7 +4337,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>, } fn trans_put(in_cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { - let cx = new_scope_block_ctxt(in_cx, ~"put"); + let cx = new_scope_block_ctxt(in_cx, "put"); Br(in_cx, cx.llbb); let llcallee = C_nil(); let llenv = C_nil(); @@ -4413,7 +4369,7 @@ fn trans_put(in_cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { } FastCall(bcx, llcallee, llargs); bcx = trans_block_cleanups(bcx, cx); - let next_cx = new_sub_block_ctxt(in_cx, ~"next"); + let next_cx = new_sub_block_ctxt(in_cx, "next"); Br(bcx, next_cx.llbb); ret rslt(next_cx, C_nil()); } @@ -4454,7 +4410,7 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result { _ { Br(bcx, cleanup_cx.llbb); } } } - ret rslt(new_sub_block_ctxt(bcx, ~"break_cont.unreachable"), + ret rslt(new_sub_block_ctxt(bcx, "break_cont.unreachable"), C_nil()); } _ { @@ -4463,9 +4419,9 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result { parent_none. { bcx_ccx(cx).sess.span_fatal(sp, if to_end { - ~"Break" - } else { ~"Cont" } + - ~" outside a loop"); + "Break" + } else { "Cont" } + + " outside a loop"); } } } @@ -4473,7 +4429,7 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result { } // If we get here without returning, it's a bug - bcx_ccx(cx).sess.bug(~"in trans::trans_break_cont()"); + bcx_ccx(cx).sess.bug("in trans::trans_break_cont()"); } fn trans_break(sp: &span, cx: &@block_ctxt) -> result { @@ -4503,9 +4459,7 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { }; if is_local { bcx = move_val(bcx, INIT, cx.fcx.llretptr, lv, t); - } else { - bcx = move_val_if_temp(bcx, INIT, cx.fcx.llretptr, lv, t); - } + } else { bcx = move_val_if_temp(bcx, INIT, cx.fcx.llretptr, lv, t); } } _ { let t = llvm::LLVMGetElementType(val_ty(cx.fcx.llretptr)); @@ -4524,14 +4478,14 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { } } build_return(bcx); - ret rslt(new_sub_block_ctxt(bcx, ~"ret.unreachable"), C_nil()); + ret rslt(new_sub_block_ctxt(bcx, "ret.unreachable"), C_nil()); } fn build_return(bcx: &@block_ctxt) { Br(bcx, bcx_fcx(bcx).llreturn); } // fn trans_be(cx: &@block_ctxt, e: &@ast::expr) -> result { -fn trans_be(cx: &@block_ctxt, e: &@ast::expr) - : ast_util::is_call_expr(e) -> result { +fn trans_be(cx: &@block_ctxt, e: &@ast::expr) : ast_util::is_call_expr(e) -> + result { // FIXME: Turn this into a real tail call once // calling convention issues are settled @@ -4545,9 +4499,7 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result { // Make a note to drop this slot on the way out. add_clean(bcx, llptr, ty); - if (must_zero(local)) { - bcx = zero_alloca(bcx, llptr, ty).bcx; - } + if must_zero(local) { bcx = zero_alloca(bcx, llptr, ty).bcx; } alt local.node.init { some(init) { @@ -4575,9 +4527,7 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result { fn must_zero(local: &@ast::local) -> bool { alt local.node.init { - some(init) { - might_not_init(init.expr) - } + some(init) { might_not_init(init.expr) } none. { true } } } @@ -4585,25 +4535,24 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result { fn might_not_init(expr: &@ast::expr) -> bool { type env = @mutable bool; let e = @mutable false; - let visitor = visit::mk_vt(@{ - visit_expr: fn(ex: &@ast::expr, e: &env, v: &vt<env>) { - // FIXME: Probably also need to account for expressions that - // fail but since we don't unwind yet, it doesn't seem to be a - // problem - let might_not_init = alt ex.node { - ast::expr_ret(_) { true } - ast::expr_break. { true } - ast::expr_cont. { true } - _ { false } - }; - if might_not_init { - *e = true; - } else { - visit::visit_expr(ex, e, v); - } - } - with *visit::default_visitor() - }); + // FIXME: Probably also need to account for expressions that + // fail but since we don't unwind yet, it doesn't seem to be a + // problem + let visitor = + visit::mk_vt( + @{visit_expr: + fn (ex: &@ast::expr, e: &env, v: &vt<env>) { + let might_not_init = + alt ex.node { + ast::expr_ret(_) { true } + ast::expr_break. { true } + ast::expr_cont. { true } + _ { false } + }; + if might_not_init { + *e = true; + } else { visit::visit_expr(ex, e, v); } + } with *visit::default_visitor()}); visitor.visit_expr(expr, e, visitor); ret *e; } @@ -4642,7 +4591,7 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result { ast::decl_item(i) { trans_item(cx.fcx.lcx, *i); } } } - _ { bcx_ccx(cx).sess.unimpl(~"stmt variant"); } + _ { bcx_ccx(cx).sess.unimpl("stmt variant"); } } ret rslt(bcx, C_nil()); } @@ -4650,15 +4599,14 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result { // You probably don't want to use this one. See the // next three functions instead. fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind, - name: &istr) -> @block_ctxt { - let s = ~""; + name: &str) -> @block_ctxt { + let s = ""; if cx.lcx.ccx.sess.get_opts().save_temps || cx.lcx.ccx.sess.get_opts().debuginfo { s = cx.lcx.ccx.names.next(name); } - let llbb: BasicBlockRef = str::as_buf(s, { |buf| - llvm::LLVMAppendBasicBlock(cx.llfn, buf) - }); + let llbb: BasicBlockRef = + str::as_buf(s, {|buf| llvm::LLVMAppendBasicBlock(cx.llfn, buf) }); ret @{llbb: llbb, mutable terminated: false, parent: parent, @@ -4671,25 +4619,25 @@ fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind, // Use this when you're at the top block of a function or the like. fn new_top_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt { - ret new_block_ctxt(fcx, parent_none, SCOPE_BLOCK, ~"function top level"); + ret new_block_ctxt(fcx, parent_none, SCOPE_BLOCK, "function top level"); } // Use this when you're at a curly-brace or similar lexical scope. -fn new_scope_block_ctxt(bcx: &@block_ctxt, n: &istr) -> @block_ctxt { +fn new_scope_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt { ret new_block_ctxt(bcx.fcx, parent_some(bcx), SCOPE_BLOCK, n); } fn new_loop_scope_block_ctxt(bcx: &@block_ctxt, _cont: &option::t<@block_ctxt>, - _break: &@block_ctxt, n: &istr) -> @block_ctxt { + _break: &@block_ctxt, n: &str) -> @block_ctxt { ret new_block_ctxt(bcx.fcx, parent_some(bcx), LOOP_SCOPE_BLOCK(_cont, _break), n); } // Use this when you're making a general CFG BB within a scope. -fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &istr) -> @block_ctxt { +fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt { ret new_block_ctxt(bcx.fcx, parent_some(bcx), NON_SCOPE_BLOCK, n); } @@ -4734,7 +4682,7 @@ fn trans_fn_cleanups(fcx: &@fn_ctxt, cx: &@block_ctxt) { some(lltoken_) { let lltoken = lltoken_; // satisfy alias checker Call(cx, fcx_ccx(fcx).upcalls.dynastack_free, - [fcx.lltaskptr, lltoken]); + [fcx.lltaskptr, lltoken]); } none. {/* nothing to do */ } } @@ -4818,9 +4766,9 @@ fn alloc_local(cx: &@block_ctxt, local: &@ast::local) -> result { alt local.node.pat.node { ast::pat_bind(ident) { if bcx_ccx(cx).sess.get_opts().debuginfo { - let _: () = str::as_buf(ident, { |buf| - llvm::LLVMSetValueName(r.val, buf) - }); + let _: () = + str::as_buf(ident, + {|buf| llvm::LLVMSetValueName(r.val, buf) }); } } _ { } @@ -4887,7 +4835,7 @@ fn trans_block(cx: &@block_ctxt, b: &ast::blk, output: &out_method) -> } fn new_local_ctxt(ccx: &@crate_ctxt) -> @local_ctxt { - let pth: [istr] = []; + let pth: [str] = []; ret @{path: pth, module_path: [ccx.link_meta.name], obj_typarams: [], @@ -4904,21 +4852,21 @@ fn mk_standard_basic_blocks(llfn: ValueRef) -> dt: BasicBlockRef, da: BasicBlockRef, rt: BasicBlockRef} { - ret {sa: str::as_buf(~"statuc_allocas", { |buf| - llvm::LLVMAppendBasicBlock(llfn, buf) - }), - ca: str::as_buf(~"copy_args", { |buf| - llvm::LLVMAppendBasicBlock(llfn, buf) - }), - dt: str::as_buf(~"derived_tydescs", { |buf| - llvm::LLVMAppendBasicBlock(llfn, buf) - }), - da: str::as_buf(~"dynamic_allocas", { |buf| - llvm::LLVMAppendBasicBlock(llfn, buf) - }), - rt: str::as_buf(~"return", { |buf| - llvm::LLVMAppendBasicBlock(llfn, buf) - })}; + ret {sa: + str::as_buf("statuc_allocas", + {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }), + ca: + str::as_buf("copy_args", + {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }), + dt: + str::as_buf("derived_tydescs", + {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }), + da: + str::as_buf("dynamic_allocas", + {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }), + rt: + str::as_buf("return", + {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) })}; } @@ -5028,8 +4976,8 @@ fn create_llargs_for_fn_args(cx: &@fn_ctxt, proto: ast::proto, } } -fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt, - args: &[ast::arg], arg_tys: &[ty::arg]) { +fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt, args: &[ast::arg], + arg_tys: &[ty::arg]) { let llcopyargs = new_raw_block_ctxt(fcx, fcx.llcopyargs); let bcx = llcopyargs; let arg_n: uint = 0u; @@ -5037,6 +4985,7 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt, let arg_ty = arg_tys[arg_n].ty; alt aarg.mode { ast::val. { + // Structural types are passed by pointer, and we use the // pointed-to memory for the local. if !type_is_structural_or_param(fcx_tcx(fcx), arg_ty) { @@ -5060,7 +5009,7 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt, ast::move. { add_clean(scope, bcx.fcx.llargs.get(aarg.id), arg_ty); } - _ {} + _ { } } arg_n += 1u; } @@ -5090,14 +5039,13 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) { let fields_tup_ty = ty::mk_tup(fcx.lcx.ccx.tcx, field_tys); let n_typarams = std::vec::len::<ast::ty_param>(bcx.fcx.lcx.obj_typarams); let llobj_box_ty: TypeRef = T_obj_ptr(*bcx_ccx(bcx), n_typarams); - let box_cell = - GEP(bcx, llself.v, [C_int(0), C_int(abi::obj_field_box)]); + let box_cell = GEP(bcx, llself.v, [C_int(0), C_int(abi::obj_field_box)]); let box_ptr = Load(bcx, box_cell); box_ptr = PointerCast(bcx, box_ptr, llobj_box_ty); let obj_typarams = GEP(bcx, box_ptr, - [C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::obj_body_elt_typarams)]); + [C_int(0), C_int(abi::box_rc_field_body), + C_int(abi::obj_body_elt_typarams)]); // The object fields immediately follow the type parameters, so we skip // over them to get the pointer. @@ -5139,10 +5087,8 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) { // lldynamicallocas -> lltop edges, and builds the return block. fn finish_fn(fcx: &@fn_ctxt, lltop: BasicBlockRef) { Br(new_raw_block_ctxt(fcx, fcx.llstaticallocas), fcx.llcopyargs); - Br(new_raw_block_ctxt(fcx, fcx.llcopyargs), - fcx.llderivedtydescs_first); - Br(new_raw_block_ctxt(fcx, fcx.llderivedtydescs), - fcx.lldynamicallocas); + Br(new_raw_block_ctxt(fcx, fcx.llcopyargs), fcx.llderivedtydescs_first); + Br(new_raw_block_ctxt(fcx, fcx.llderivedtydescs), fcx.lldynamicallocas); Br(new_raw_block_ctxt(fcx, fcx.lldynamicallocas), lltop); let ret_cx = new_raw_block_ctxt(fcx, fcx.llreturn); @@ -5245,8 +5191,7 @@ fn trans_fn(cx: @local_ctxt, sp: &span, f: &ast::_fn, llfndecl: ValueRef, let start = time::get_time(); trans_fn_inner(cx, sp, f, llfndecl, ty_self, ty_params, id); let end = time::get_time(); - log_fn_time(cx.ccx, str::connect(cx.path, ~"::"), - start, end); + log_fn_time(cx.ccx, str::connect(cx.path, "::"), start, end); } fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn, @@ -5255,7 +5200,7 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn, let llctor_decl; alt cx.ccx.item_ids.find(ctor_id) { some(x) { llctor_decl = x; } - _ { cx.ccx.sess.span_fatal(sp, ~"unbound ctor_id in trans_res_ctor"); } + _ { cx.ccx.sess.span_fatal(sp, "unbound ctor_id in trans_res_ctor"); } } let fcx = new_fn_ctxt(cx, sp, llctor_decl); let ret_t = ty::ret_ty_of_fn(cx.ccx.tcx, ctor_id); @@ -5268,8 +5213,7 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn, let arg; alt fcx.llargs.find(dtor.decl.inputs[0].id) { some(x) { arg = load_if_immediate(bcx, x, arg_t); } - _ { cx.ccx.sess.span_fatal( - sp, ~"unbound dtor decl in trans_res_ctor"); } + _ { cx.ccx.sess.span_fatal(sp, "unbound dtor decl in trans_res_ctor"); } } let llretptr = fcx.llretptr; if ty::type_has_dynamic_size(cx.ccx.tcx, ret_t) { @@ -5303,7 +5247,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, fn_args += [{mode: ast::alias(false), ty: varg.ty, - ident: ~"arg" + uint::to_str(i, 10u), + ident: "arg" + uint::to_str(i, 10u), id: varg.id}]; } assert (cx.ccx.item_ids.contains_key(variant.node.id)); @@ -5312,7 +5256,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, some(x) { llfndecl = x; } _ { cx.ccx.sess.span_fatal(variant.span, - ~"unbound variant id in trans_tag_variant"); + "unbound variant id in trans_tag_variant"); } } let fcx = new_fn_ctxt(cx, variant.span, llfndecl); @@ -5337,7 +5281,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, } else { let lltagptr = PointerCast(bcx, fcx.llretptr, - T_opaque_tag_ptr(fcx.lcx.ccx.tn)); + T_opaque_tag_ptr(fcx.lcx.ccx.tn)); let lldiscrimptr = GEP(bcx, lltagptr, [C_int(0), C_int(0)]); Store(bcx, C_int(index), lldiscrimptr); GEP(bcx, lltagptr, [C_int(0), C_int(1)]) @@ -5346,9 +5290,8 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, let t_id = ast_util::local_def(tag_id); let v_id = ast_util::local_def(variant.node.id); for va: ast::variant_arg in variant.node.args { - check valid_variant_index(i, bcx, t_id, v_id); - let rslt = - GEP_tag(bcx, llblobptr, t_id, v_id, ty_param_substs, i); + check (valid_variant_index(i, bcx, t_id, v_id)); + let rslt = GEP_tag(bcx, llblobptr, t_id, v_id, ty_param_substs, i); bcx = rslt.bcx; let lldestptr = rslt.val; // If this argument to this function is a tag, it'll have come in to @@ -5359,7 +5302,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, alt fcx.llargs.find(va.id) { some(x) { llargptr = PointerCast(bcx, x, val_ty(lldestptr)); } none. { - bcx_ccx(bcx).sess.bug(~"unbound argptr in \ + bcx_ccx(bcx).sess.bug("unbound argptr in \ trans_tag_variant"); } } @@ -5384,7 +5327,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, fn trans_const_expr(cx: &@crate_ctxt, e: @ast::expr) -> ValueRef { alt e.node { ast::expr_lit(lit) { ret trans_crate_lit(cx, *lit); } - _ { cx.sess.span_unimpl(e.span, ~"consts that's not a plain literal"); } + _ { cx.sess.span_unimpl(e.span, "consts that's not a plain literal"); } } } @@ -5399,7 +5342,7 @@ fn trans_const(cx: &@crate_ctxt, e: @ast::expr, id: ast::node_id) { llvm::LLVMSetInitializer(g, v); llvm::LLVMSetGlobalConstant(g, True); } - _ { cx.sess.span_fatal(e.span, ~"Unbound const in trans_const"); } + _ { cx.sess.span_fatal(e.span, "Unbound const in trans_const"); } } } @@ -5413,7 +5356,7 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) { } _ { cx.ccx.sess.span_fatal(item.span, - ~"unbound function item in trans_item"); + "unbound function item in trans_item"); } } } @@ -5432,15 +5375,14 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) { trans_fn(cx, item.span, dtor, lldtor_decl, none, tps, dtor_id); } _ { - cx.ccx.sess.span_fatal(item.span, ~"unbound dtor in trans_item"); + cx.ccx.sess.span_fatal(item.span, "unbound dtor in trans_item"); } } } ast::item_mod(m) { let sub_cx = @{path: cx.path + [item.ident], - module_path: cx.module_path - + [item.ident] with *cx}; + module_path: cx.module_path + [item.ident] with *cx}; trans_mod(sub_cx, m); } ast::item_tag(variants, tps) { @@ -5473,14 +5415,14 @@ fn get_pair_fn_ty(llpairty: TypeRef) -> TypeRef { ret struct_elt(llpairty, 0u); } -fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], flav: &istr, +fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], flav: &str, ty_params: &[ast::ty_param], node_id: ast::node_id) { decl_fn_and_pair_full(ccx, sp, path, flav, ty_params, node_id, node_id_type(ccx, node_id)); } -fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[istr], - _flav: &istr, ty_params: &[ast::ty_param], +fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str], + _flav: &str, ty_params: &[ast::ty_param], node_id: ast::node_id, node_type: ty::t) { let path = path; let llfty = @@ -5491,15 +5433,13 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[istr], type_of_fn(ccx, sp, proto, inputs, output, std::vec::len::<ast::ty_param>(ty_params)); } - _ { ccx.sess.bug( - ~"decl_fn_and_pair(): fn item doesn't have fn type!"); } + _ { ccx.sess.bug("decl_fn_and_pair(): fn item doesn't have fn type!"); } } - let s: istr = mangle_internal_name_by_path(ccx, path); - let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod, - s, llfty); + let s: str = mangle_internal_name_by_path(ccx, path); + let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod, s, llfty); // Declare the global constant pair that points to it. - let ps: istr = mangle_exported_name(ccx, path, node_type); + let ps: str = mangle_exported_name(ccx, path, node_type); register_fn_pair(ccx, ps, llfty, llfn, node_id); let is_main: bool = is_main_name(path) && !ccx.sess.get_opts().library; @@ -5512,18 +5452,15 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, main_node_type: ty::t) { if ccx.main_fn != none::<ValueRef> { - ccx.sess.span_fatal(sp, ~"multiple 'main' functions"); + ccx.sess.span_fatal(sp, "multiple 'main' functions"); } let main_takes_argv = alt ty::struct(ccx.tcx, main_node_type) { - ty::ty_fn(_, args, _, _, _) { - std::vec::len(args) != 0u - } + ty::ty_fn(_, args, _, _, _) { std::vec::len(args) != 0u } }; - let llfn = create_main(ccx, sp, main_llfn, - main_takes_argv); + let llfn = create_main(ccx, sp, main_llfn, main_takes_argv); ccx.main_fn = some(llfn); fn create_main(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, @@ -5531,13 +5468,11 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, let unit_ty = ty::mk_istr(ccx.tcx); let vecarg_ty: ty::arg = {mode: ty::mo_val, - ty: - ty::mk_vec(ccx.tcx, - {ty: unit_ty, mut: ast::imm})}; + ty: ty::mk_vec(ccx.tcx, {ty: unit_ty, mut: ast::imm})}; let llfty = type_of_fn(ccx, sp, ast::proto_fn, [vecarg_ty], ty::mk_nil(ccx.tcx), 0u); - let llfdecl = decl_fastcall_fn(ccx.llmod, ~"_rust_main", llfty); + let llfdecl = decl_fastcall_fn(ccx.llmod, "_rust_main", llfty); let fcx = new_fn_ctxt(new_local_ctxt(ccx), sp, llfdecl); @@ -5563,11 +5498,14 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, // Create a closure: a pair containing (1) a ValueRef, pointing to where the // fn's definition is in the executable we're creating, and (2) a pointer to // space for the function's environment. -fn create_fn_pair(cx: &@crate_ctxt, ps: &istr, llfnty: TypeRef, - llfn: ValueRef, external: bool) -> ValueRef { - let gvar = str::as_buf(ps, { |buf| - llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty), buf) - }); +fn create_fn_pair(cx: &@crate_ctxt, ps: &str, llfnty: TypeRef, llfn: ValueRef, + external: bool) -> ValueRef { + let gvar = + str::as_buf(ps, + {|buf| + llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty), + buf) + }); let pair = C_struct([llfn, C_null(T_opaque_closure_ptr(*cx))]); llvm::LLVMSetInitializer(gvar, pair); llvm::LLVMSetGlobalConstant(gvar, True); @@ -5595,7 +5533,7 @@ fn create_real_fn_pair(cx: &@block_ctxt, llfnty: TypeRef, llfn: ValueRef, ret pair; } -fn register_fn_pair(cx: &@crate_ctxt, ps: &istr, llfnty: TypeRef, +fn register_fn_pair(cx: &@crate_ctxt, ps: &str, llfnty: TypeRef, llfn: ValueRef, id: ast::node_id) { // FIXME: We should also hide the unexported pairs in crates. @@ -5614,7 +5552,7 @@ fn native_fn_ty_param_count(cx: &@crate_ctxt, id: ast::node_id) -> uint { alt cx.ast_map.find(id) { some(ast_map::node_native_item(i)) { i } }; alt native_item.node { ast::native_item_ty. { - cx.sess.bug(~"decl_native_fn_and_pair(): native fn isn't \ + cx.sess.bug("decl_native_fn_and_pair(): native fn isn't \ actually a fn"); } ast::native_item_fn(_, _, tps) { @@ -5633,21 +5571,20 @@ fn native_fn_wrapper_type(cx: &@crate_ctxt, sp: &span, ty_param_count: uint, } } -fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], - name: &istr, id: ast::node_id) { +fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], + name: &str, id: ast::node_id) { let path = path; let num_ty_param = native_fn_ty_param_count(ccx, id); // Declare the wrapper. let t = node_id_type(ccx, id); let wrapper_type = native_fn_wrapper_type(ccx, sp, num_ty_param, t); - let s: istr = mangle_internal_name_by_path(ccx, path); + let s: str = mangle_internal_name_by_path(ccx, path); let wrapper_fn: ValueRef = - decl_internal_fastcall_fn(ccx.llmod, - s, wrapper_type); + decl_internal_fastcall_fn(ccx.llmod, s, wrapper_type); // Declare the global constant pair that points to it. - let ps: istr = mangle_exported_name(ccx, path, node_id_type(ccx, id)); + let ps: str = mangle_exported_name(ccx, path, node_id_type(ccx, id)); register_fn_pair(ccx, ps, wrapper_type, wrapper_fn, id); // Build the wrapper. @@ -5733,14 +5670,12 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], } ret TruncOrBitCast(cx, v, T_int()); } - if ty::type_is_fp(bcx_tcx(cx), t) { - ret FPToSI(cx, v, T_int()); - } + if ty::type_is_fp(bcx_tcx(cx), t) { ret FPToSI(cx, v, T_int()); } } ret vp2i(cx, v); } - fn trans_simple_native_abi(bcx: &@block_ctxt, name: &istr, + fn trans_simple_native_abi(bcx: &@block_ctxt, name: &str, call_args: &mutable [ValueRef], fn_type: ty::t, uses_retptr: bool, cc: uint) -> {val: ValueRef, rptr: ValueRef} { @@ -5792,7 +5727,7 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], rptr = result.rptr; } ast::native_abi_rust_intrinsic. { - let external_name = ~"rust_intrinsic_" + name; + let external_name = "rust_intrinsic_" + name; let result = trans_simple_native_abi(bcx, external_name, call_args, fn_type, uses_retptr, lib::llvm::LLVMCCallConv); @@ -5808,7 +5743,8 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], rptr = result.rptr; } _ { - r = trans_native_call(new_raw_block_ctxt(bcx.fcx, bcx.llbb), + r = + trans_native_call(new_raw_block_ctxt(bcx.fcx, bcx.llbb), ccx.externs, ccx.llmod, name, call_args); rptr = BitCast(bcx, fcx.llretptr, T_ptr(T_i32())); } @@ -5823,23 +5759,22 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], finish_fn(fcx, lltop); } -fn item_path(item: &@ast::item) -> [istr] { ret [item.ident]; } +fn item_path(item: &@ast::item) -> [str] { ret [item.ident]; } -fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[istr], - _v: &vt<[istr]>) { +fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[str], + _v: &vt<[str]>) { alt i.node { ast::native_item_fn(_, _, _) { if !ccx.obj_methods.contains_key(i.id) { - decl_native_fn_and_pair(ccx, i.span, pt, - i.ident, i.id); + decl_native_fn_and_pair(ccx, i.span, pt, i.ident, i.id); } } _ { } } } -fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr], - v: &vt<[istr]>) { +fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[str], + v: &vt<[str]>) { visit::visit_item(i, pt + item_path(i), v); alt i.node { ast::item_const(_, _) { @@ -5860,29 +5795,29 @@ fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr], } } -fn collect_item_2(ccx: &@crate_ctxt, i: &@ast::item, pt: &[istr], - v: &vt<[istr]>) { +fn collect_item_2(ccx: &@crate_ctxt, i: &@ast::item, pt: &[str], + v: &vt<[str]>) { let new_pt = pt + item_path(i); visit::visit_item(i, new_pt, v); alt i.node { ast::item_fn(f, tps) { if !ccx.obj_methods.contains_key(i.id) { - decl_fn_and_pair(ccx, i.span, new_pt, ~"fn", tps, i.id); + decl_fn_and_pair(ccx, i.span, new_pt, "fn", tps, i.id); } } ast::item_obj(ob, tps, ctor_id) { - decl_fn_and_pair(ccx, i.span, new_pt, ~"obj_ctor", tps, ctor_id); + decl_fn_and_pair(ccx, i.span, new_pt, "obj_ctor", tps, ctor_id); for m: @ast::method in ob.methods { ccx.obj_methods.insert(m.node.id, ()); } } ast::item_res(_, dtor_id, tps, ctor_id) { - decl_fn_and_pair(ccx, i.span, new_pt, ~"res_ctor", tps, ctor_id); + decl_fn_and_pair(ccx, i.span, new_pt, "res_ctor", tps, ctor_id); // Note that the destructor is associated with the item's id, not // the dtor_id. This is a bit counter-intuitive, but simplifies // ty_res, which would have to carry around two def_ids otherwise // -- one to identify the type, and one to find the dtor symbol. - decl_fn_and_pair_full(ccx, i.span, new_pt, ~"res_dtor", tps, i.id, + decl_fn_and_pair_full(ccx, i.span, new_pt, "res_dtor", tps, i.id, node_id_type(ccx, dtor_id)); } _ { } @@ -5900,17 +5835,16 @@ fn collect_items(ccx: &@crate_ctxt, crate: @ast::crate) { visit::visit_crate(*crate, [], visit::mk_vt(visitor2)); } -fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr], - v: &vt<[istr]>) { +fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str], + v: &vt<[str]>) { let new_pt = pt + item_path(i); visit::visit_item(i, new_pt, v); alt i.node { ast::item_tag(variants, tps) { for variant: ast::variant in variants { if std::vec::len(variant.node.args) != 0u { - decl_fn_and_pair(ccx, i.span, - new_pt + [variant.node.name], - ~"tag", tps, variant.node.id); + decl_fn_and_pair(ccx, i.span, new_pt + [variant.node.name], + "tag", tps, variant.node.id); } } } @@ -5927,8 +5861,8 @@ fn collect_tag_ctors(ccx: &@crate_ctxt, crate: @ast::crate) { // The constant translation pass. -fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[istr], - v: &vt<[istr]>) { +fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[str], + v: &vt<[str]>) { let new_pt = pt + item_path(it); visit::visit_item(it, new_pt, v); alt it.node { @@ -5937,14 +5871,13 @@ fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[istr], let n_variants = std::vec::len::<ast::variant>(variants); while i < n_variants { let variant = variants[i]; - let p = new_pt + [it.ident, - variant.node.name, - ~"discrim"]; - let s = mangle_exported_name(ccx, p, - ty::mk_int(ccx.tcx)); - let discrim_gvar = str::as_buf(s, { |buf| - llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf) - }); + let p = new_pt + [it.ident, variant.node.name, "discrim"]; + let s = mangle_exported_name(ccx, p, ty::mk_int(ccx.tcx)); + let discrim_gvar = + str::as_buf(s, + {|buf| + llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf) + }); if n_variants != 1u { llvm::LLVMSetInitializer(discrim_gvar, C_int(i as int)); llvm::LLVMSetGlobalConstant(discrim_gvar, True); @@ -5975,7 +5908,7 @@ fn vi2p(cx: &@block_ctxt, v: ValueRef, t: TypeRef) -> ValueRef { fn p2i(v: ValueRef) -> ValueRef { ret llvm::LLVMConstPtrToInt(v, T_int()); } -fn declare_intrinsics(llmod: ModuleRef) -> hashmap<istr, ValueRef> { +fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> { let T_memmove32_args: [TypeRef] = [T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()]; let T_memmove64_args: [TypeRef] = @@ -5986,75 +5919,74 @@ fn declare_intrinsics(llmod: ModuleRef) -> hashmap<istr, ValueRef> { [T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()]; let T_trap_args: [TypeRef] = []; let gcroot = - decl_cdecl_fn(llmod, ~"llvm.gcroot", + decl_cdecl_fn(llmod, "llvm.gcroot", T_fn([T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void())); let gcread = - decl_cdecl_fn(llmod, ~"llvm.gcread", + decl_cdecl_fn(llmod, "llvm.gcread", T_fn([T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void())); let memmove32 = - decl_cdecl_fn(llmod, ~"llvm.memmove.p0i8.p0i8.i32", + decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32", T_fn(T_memmove32_args, T_void())); let memmove64 = - decl_cdecl_fn(llmod, ~"llvm.memmove.p0i8.p0i8.i64", + decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i64", T_fn(T_memmove64_args, T_void())); let memset32 = - decl_cdecl_fn(llmod, ~"llvm.memset.p0i8.i32", + decl_cdecl_fn(llmod, "llvm.memset.p0i8.i32", T_fn(T_memset32_args, T_void())); let memset64 = - decl_cdecl_fn(llmod, ~"llvm.memset.p0i8.i64", + decl_cdecl_fn(llmod, "llvm.memset.p0i8.i64", T_fn(T_memset64_args, T_void())); - let trap = decl_cdecl_fn(llmod, ~"llvm.trap", - T_fn(T_trap_args, T_void())); + let trap = decl_cdecl_fn(llmod, "llvm.trap", T_fn(T_trap_args, T_void())); let intrinsics = new_str_hash::<ValueRef>(); - intrinsics.insert(~"llvm.gcroot", gcroot); - intrinsics.insert(~"llvm.gcread", gcread); - intrinsics.insert(~"llvm.memmove.p0i8.p0i8.i32", memmove32); - intrinsics.insert(~"llvm.memmove.p0i8.p0i8.i64", memmove64); - intrinsics.insert(~"llvm.memset.p0i8.i32", memset32); - intrinsics.insert(~"llvm.memset.p0i8.i64", memset64); - intrinsics.insert(~"llvm.trap", trap); + intrinsics.insert("llvm.gcroot", gcroot); + intrinsics.insert("llvm.gcread", gcread); + intrinsics.insert("llvm.memmove.p0i8.p0i8.i32", memmove32); + intrinsics.insert("llvm.memmove.p0i8.p0i8.i64", memmove64); + intrinsics.insert("llvm.memset.p0i8.i32", memset32); + intrinsics.insert("llvm.memset.p0i8.i64", memset64); + intrinsics.insert("llvm.trap", trap); ret intrinsics; } fn trap(bcx: &@block_ctxt) { let v: [ValueRef] = []; - alt bcx_ccx(bcx).intrinsics.find(~"llvm.trap") { + alt bcx_ccx(bcx).intrinsics.find("llvm.trap") { some(x) { Call(bcx, x, v); } - _ { bcx_ccx(bcx).sess.bug(~"unbound llvm.trap in trap"); } + _ { bcx_ccx(bcx).sess.bug("unbound llvm.trap in trap"); } } } fn decl_no_op_type_glue(llmod: ModuleRef, taskptr_type: TypeRef) -> ValueRef { let ty = T_fn([taskptr_type, T_ptr(T_i8())], T_void()); - ret decl_fastcall_fn(llmod, - abi::no_op_type_glue_name(), ty); + ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty); } fn make_glues(llmod: ModuleRef, taskptr_type: TypeRef) -> @glue_fns { ret @{no_op_type_glue: decl_no_op_type_glue(llmod, taskptr_type)}; } -fn make_common_glue(sess: &session::session, output: &istr) { +fn make_common_glue(sess: &session::session, output: &str) { // FIXME: part of this is repetitive and is probably a good idea // to autogen it. let task_type = T_task(); let taskptr_type = T_ptr(task_type); - let llmod = str::as_buf(~"rust_out", { |buf| - llvm::LLVMModuleCreateWithNameInContext(buf, - llvm::LLVMGetGlobalContext()) - }); - let _: () = str::as_buf(x86::get_data_layout(), { |buf| - llvm::LLVMSetDataLayout(llmod, buf) - }); - let _: () = str::as_buf(x86::get_target_triple(), { |buf| - llvm::LLVMSetTarget(llmod, buf) - }); + let llmod = + str::as_buf("rust_out", {|buf| + llvm::LLVMModuleCreateWithNameInContext( + buf, llvm::LLVMGetGlobalContext()) + }); + let _: () = + str::as_buf(x86::get_data_layout(), + {|buf| llvm::LLVMSetDataLayout(llmod, buf) }); + let _: () = + str::as_buf(x86::get_target_triple(), + {|buf| llvm::LLVMSetTarget(llmod, buf) }); mk_target_data(x86::get_data_layout()); declare_intrinsics(llmod); - let _: () = str::as_buf(x86::get_module_asm(), { |buf| - llvm::LLVMSetModuleInlineAsm(llmod, buf) - }); + let _: () = + str::as_buf(x86::get_module_asm(), + {|buf| llvm::LLVMSetModuleInlineAsm(llmod, buf) }); make_glues(llmod, taskptr_type); link::write::run_passes(sess, llmod, output); } @@ -6062,15 +5994,14 @@ fn make_common_glue(sess: &session::session, output: &istr) { fn create_module_map(ccx: &@crate_ctxt) -> ValueRef { let elttype = T_struct([T_int(), T_int()]); let maptype = T_array(elttype, ccx.module_data.size() + 1u); - let map = str::as_buf(~"_rust_mod_map", { |buf| - llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) - }); + let map = + str::as_buf("_rust_mod_map", + {|buf| llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) }); llvm::LLVMSetLinkage(map, lib::llvm::LLVMInternalLinkage as llvm::Linkage); let elts: [ValueRef] = []; - for each item: @{key: istr, val: ValueRef} in ccx.module_data.items() { - let elt = C_struct([p2i(C_cstr(ccx, item.key)), - p2i(item.val)]); + for each item: @{key: str, val: ValueRef} in ccx.module_data.items() { + let elt = C_struct([p2i(C_cstr(ccx, item.key)), p2i(item.val)]); elts += [elt]; } let term = C_struct([C_int(0), C_int(0)]); @@ -6086,11 +6017,12 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef { let i = 1; let cstore = ccx.sess.get_cstore(); while cstore::have_crate_data(cstore, i) { - let nm = ~"_rust_crate_map_" + - cstore::get_crate_data(cstore, i).name; - let cr = str::as_buf(nm, { |buf| - llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf) - }); + let nm = "_rust_crate_map_" + cstore::get_crate_data(cstore, i).name; + let cr = + str::as_buf(nm, + {|buf| + llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf) + }); subcrates += [p2i(cr)]; i += 1; } @@ -6098,13 +6030,13 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef { let mapname; if ccx.sess.get_opts().library { mapname = ccx.link_meta.name; - } else { mapname = ~"toplevel"; } - let sym_name = ~"_rust_crate_map_" + mapname; + } else { mapname = "toplevel"; } + let sym_name = "_rust_crate_map_" + mapname; let arrtype = T_array(T_int(), std::vec::len::<ValueRef>(subcrates)); let maptype = T_struct([T_int(), arrtype]); - let map = str::as_buf(sym_name, { |buf| - llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) - }); + let map = + str::as_buf(sym_name, + {|buf| llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) }); llvm::LLVMSetLinkage(map, lib::llvm::LLVMExternalLinkage as llvm::Linkage); llvm::LLVMSetInitializer(map, @@ -6115,24 +6047,28 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef { fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) { if !cx.sess.get_opts().library { ret; } - let llmeta = C_postr( - metadata::encoder::encode_metadata(cx, crate)); + let llmeta = C_postr(metadata::encoder::encode_metadata(cx, crate)); let llconst = trans_common::C_struct([llmeta]); - let llglobal = str::as_buf(~"rust_metadata", { |buf| - llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst), buf) - }); + let llglobal = + str::as_buf("rust_metadata", + {|buf| + llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst), buf) + }); llvm::LLVMSetInitializer(llglobal, llconst); - let _: () = str::as_buf(x86::get_meta_sect_name(), { |buf| - llvm::LLVMSetSection(llglobal, buf) - }); + let _: () = + str::as_buf(x86::get_meta_sect_name(), + {|buf| llvm::LLVMSetSection(llglobal, buf) }); llvm::LLVMSetLinkage(llglobal, lib::llvm::LLVMInternalLinkage as llvm::Linkage); let t_ptr_i8 = T_ptr(T_i8()); llglobal = llvm::LLVMConstBitCast(llglobal, t_ptr_i8); - let llvm_used = str::as_buf(~"llvm.used", { |buf| - llvm::LLVMAddGlobal(cx.llmod, T_array(t_ptr_i8, 1u), buf) - }); + let llvm_used = + str::as_buf("llvm.used", + {|buf| + llvm::LLVMAddGlobal(cx.llmod, T_array(t_ptr_i8, 1u), + buf) + }); llvm::LLVMSetLinkage(llvm_used, lib::llvm::LLVMAppendingLinkage as llvm::Linkage); llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, [llglobal])); @@ -6140,39 +6076,40 @@ fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) { // Writes the current ABI version into the crate. fn write_abi_version(ccx: &@crate_ctxt) { - shape::mk_global(ccx, ~"rust_abi_version", C_uint(abi::abi_version), + shape::mk_global(ccx, "rust_abi_version", C_uint(abi::abi_version), false); } fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, - output: &istr, amap: &ast_map::map, mut_map: mut::mut_map) - -> ModuleRef { - let llmod = str::as_buf(~"rust_out", { |buf| - llvm::LLVMModuleCreateWithNameInContext(buf, - llvm::LLVMGetGlobalContext()) - }); - let _: () = str::as_buf(x86::get_data_layout(), { |buf| - llvm::LLVMSetDataLayout(llmod, buf) - }); - let _: () = str::as_buf(x86::get_target_triple(), { |buf| - llvm::LLVMSetTarget(llmod, buf) - }); + output: &str, amap: &ast_map::map, mut_map: mut::mut_map) -> + ModuleRef { + let llmod = + str::as_buf("rust_out", {|buf| + llvm::LLVMModuleCreateWithNameInContext( + buf, llvm::LLVMGetGlobalContext()) + }); + let _: () = + str::as_buf(x86::get_data_layout(), + {|buf| llvm::LLVMSetDataLayout(llmod, buf) }); + let _: () = + str::as_buf(x86::get_target_triple(), + {|buf| llvm::LLVMSetTarget(llmod, buf) }); let td = mk_target_data(x86::get_data_layout()); let tn = mk_type_names(); let intrinsics = declare_intrinsics(llmod); let task_type = T_task(); let taskptr_type = T_ptr(task_type); - tn.associate(~"taskptr", taskptr_type); + tn.associate("taskptr", taskptr_type); let tydesc_type = T_tydesc(taskptr_type); - tn.associate(~"tydesc", tydesc_type); + tn.associate("tydesc", tydesc_type); let glues = make_glues(llmod, taskptr_type); let hasher = ty::hash_ty; let eqer = ty::eq_ty; let tag_sizes = map::mk_hashmap::<ty::t, uint>(hasher, eqer); let tydescs = map::mk_hashmap::<ty::t, @tydesc_info>(hasher, eqer); let lltypes = map::mk_hashmap::<ty::t, TypeRef>(hasher, eqer); - let sha1s = map::mk_hashmap::<ty::t, istr>(hasher, eqer); - let short_names = map::mk_hashmap::<ty::t, istr>(hasher, eqer); + let sha1s = map::mk_hashmap::<ty::t, str>(hasher, eqer); + let short_names = map::mk_hashmap::<ty::t, str>(hasher, eqer); let sha = std::sha1::mk_sha1(); let ccx = @{sess: sess, @@ -6183,13 +6120,12 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, intrinsics: intrinsics, item_ids: new_int_hash::<ValueRef>(), ast_map: amap, - item_symbols: new_int_hash::<istr>(), + item_symbols: new_int_hash::<str>(), mutable main_fn: none::<ValueRef>, - link_meta: link::build_link_meta(sess, *crate, - output, sha), + link_meta: link::build_link_meta(sess, *crate, output, sha), tag_sizes: tag_sizes, discrims: new_int_hash::<ValueRef>(), - discrim_symbols: new_int_hash::<istr>(), + discrim_symbols: new_int_hash::<str>(), fn_pairs: new_int_hash::<ValueRef>(), consts: new_int_hash::<ValueRef>(), obj_methods: new_int_hash::<()>(), @@ -6239,9 +6175,8 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, log_err #fmt["n_real_glues: %u", ccx.stats.n_real_glues]; - for timing: {ident: istr, time: int} in *ccx.stats.fn_times { - log_err #fmt["time: %s took %d ms", - timing.ident, timing.time]; + for timing: {ident: str, time: int} in *ccx.stats.fn_times { + log_err #fmt["time: %s took %d ms", timing.ident, timing.time]; } } ret llmod; diff --git a/src/comp/middle/trans_alt.rs b/src/comp/middle/trans_alt.rs index e81f6b5b97f..5bb5afacb29 100644 --- a/src/comp/middle/trans_alt.rs +++ b/src/comp/middle/trans_alt.rs @@ -57,7 +57,7 @@ fn variant_opt(ccx: &@crate_ctxt, pat_id: ast::node_id) -> opt { } type bind_map = [{ident: ast::ident, val: ValueRef}]; -fn assoc(key: &istr, list: &bind_map) -> option::t<ValueRef> { +fn assoc(key: &str, list: &bind_map) -> option::t<ValueRef> { for elt: {ident: ast::ident, val: ValueRef} in list { if str::eq(elt.ident, key) { ret some(elt.val); } } @@ -67,9 +67,10 @@ fn assoc(key: &istr, list: &bind_map) -> option::t<ValueRef> { type match_branch = @{pats: [@ast::pat], bound: bind_map, - data: @{body: BasicBlockRef, - guard: option::t<@ast::expr>, - id_map: ast_util::pat_id_map}}; + data: + @{body: BasicBlockRef, + guard: option::t<@ast::expr>, + id_map: ast_util::pat_id_map}}; type match = [match_branch]; fn matches_always(p: &@ast::pat) -> bool { @@ -89,16 +90,18 @@ fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match { for br: match_branch in m { alt e(br.pats[col]) { some(sub) { - let pats = vec::slice(br.pats, 0u, col) + sub + + let pats = + vec::slice(br.pats, 0u, col) + sub + vec::slice(br.pats, col + 1u, vec::len(br.pats)); - let new_br = @{pats: pats, - bound: alt br.pats[col].node { - ast::pat_bind(name) { - br.bound + [{ident: name, val: val}] - } - _ { br.bound } - } - with *br}; + let new_br = + @{pats: pats, + bound: + alt br.pats[col].node { + ast::pat_bind(name) { + br.bound + [{ident: name, val: val}] + } + _ { br.bound } + } with *br}; result += [new_br]; } none. { } @@ -211,15 +214,14 @@ fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id, vec::len(ty::tag_variant_with_id(ccx.tcx, vdefs.tg, vdefs.var).args); if size > 0u && vec::len(variants) != 1u { let tagptr = - PointerCast(bcx, val, - trans_common::T_opaque_tag_ptr(ccx.tn)); + PointerCast(bcx, val, trans_common::T_opaque_tag_ptr(ccx.tn)); blobptr = GEP(bcx, tagptr, [C_int(0), C_int(1)]); } let i = 0u; let vdefs_tg = vdefs.tg; let vdefs_var = vdefs.var; while i < size { - check valid_variant_index(i, bcx, vdefs_tg, vdefs_var); + check (valid_variant_index(i, bcx, vdefs_tg, vdefs_var)); let r = trans::GEP_tag(bcx, blobptr, vdefs_tg, vdefs_var, ty_param_substs, i); @@ -298,26 +300,25 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let data = m[0].data; alt data.guard { some(e) { - let guard_cx = new_scope_block_ctxt(bcx, ~"submatch_guard"); - let next_cx = new_sub_block_ctxt(bcx, ~"submatch_next"); - let else_cx = new_sub_block_ctxt(bcx, ~"submatch_else"); + let guard_cx = new_scope_block_ctxt(bcx, "submatch_guard"); + let next_cx = new_sub_block_ctxt(bcx, "submatch_next"); + let else_cx = new_sub_block_ctxt(bcx, "submatch_else"); Br(bcx, guard_cx.llbb); // Temporarily set bindings. They'll be rewritten to PHI nodes for // the actual arm block. - for each @{key, val} in data.id_map.items() { - bcx.fcx.lllocals.insert - (val, option::get(assoc(key, - m[0].bound))); + for each @{key: key, val: val} in data.id_map.items() { + bcx.fcx.lllocals.insert(val, + option::get(assoc(key, m[0].bound))); } let {bcx: guard_bcx, val: guard_val} = trans::trans_expr(guard_cx, e); guard_bcx = trans::trans_block_cleanups(guard_bcx, guard_cx); CondBr(guard_bcx, guard_val, next_cx.llbb, else_cx.llbb); - compile_submatch(else_cx, vec::slice(m, 1u, vec::len(m)), - vals, f, exits); + compile_submatch(else_cx, vec::slice(m, 1u, vec::len(m)), vals, f, + exits); bcx = next_cx; } - _ {} + _ { } } exits += [{bound: m[0].bound, from: bcx.llbb, to: data.body}]; Br(bcx, data.body); @@ -380,8 +381,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let box = Load(bcx, val); let unboxed = InBoundsGEP(bcx, box, - [C_int(0), - C_int(back::abi::box_rc_field_body)]); + [C_int(0), C_int(back::abi::box_rc_field_body)]); compile_submatch(bcx, enter_box(m, col, val), [unboxed] + vals_left, f, exits); ret; @@ -400,7 +400,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], } else { let tagptr = PointerCast(bcx, val, - trans_common::T_opaque_tag_ptr(ccx.tn)); + trans_common::T_opaque_tag_ptr(ccx.tn)); let discrimptr = GEP(bcx, tagptr, [C_int(0), C_int(0)]); test_val = Load(bcx, discrimptr); kind = switch; @@ -415,7 +415,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let else_cx = alt kind { no_branch. | single. { bcx } - _ { new_sub_block_ctxt(bcx, ~"match_else") } + _ { new_sub_block_ctxt(bcx, "match_else") } }; let sw = if kind == switch { @@ -424,7 +424,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], // Compile subtrees for each option for opt: opt in opts { - let opt_cx = new_sub_block_ctxt(bcx, ~"match_case"); + let opt_cx = new_sub_block_ctxt(bcx, "match_case"); alt kind { single. { Br(bcx, opt_cx.llbb); } switch. { @@ -433,7 +433,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], llvm::LLVMAddCase(sw, r.val, opt_cx.llbb); } compare. { - let compare_cx = new_scope_block_ctxt(bcx, ~"compare_scope"); + let compare_cx = new_scope_block_ctxt(bcx, "compare_scope"); Br(bcx, compare_cx.llbb); bcx = compare_cx; let r = trans_opt(bcx, opt); @@ -442,7 +442,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let eq = trans::trans_compare(bcx, ast::eq, test_val, t, r.val, t); let cleanup_cx = trans::trans_block_cleanups(bcx, compare_cx); - bcx = new_sub_block_ctxt(bcx, ~"compare_next"); + bcx = new_sub_block_ctxt(bcx, "compare_next"); CondBr(cleanup_cx, eq.val, opt_cx.llbb, bcx.llbb); } _ { } @@ -509,15 +509,14 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm], } for a: ast::arm in arms { - let body = new_scope_block_ctxt(cx, ~"case_body"); + let body = new_scope_block_ctxt(cx, "case_body"); let id_map = ast_util::pat_id_map(a.pats[0]); bodies += [body]; for p: @ast::pat in a.pats { - match += [@{pats: [p], - bound: [], - data: @{body: body.llbb, - guard: a.guard, - id_map: id_map}}]; + match += + [@{pats: [p], + bound: [], + data: @{body: body.llbb, guard: a.guard, id_map: id_map}}]; } } @@ -526,8 +525,8 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm], fn mk_fail(cx: &@block_ctxt, sp: &span, done: @mutable option::t<BasicBlockRef>) -> BasicBlockRef { alt *done { some(bb) { ret bb; } _ { } } - let fail_cx = new_sub_block_ctxt(cx, ~"case_fallthrough"); - trans::trans_fail(fail_cx, some(sp), ~"non-exhaustive match failure"); + let fail_cx = new_sub_block_ctxt(cx, "case_fallthrough"); + trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure");; *done = some(fail_cx.llbb); ret fail_cx.llbb; } @@ -568,8 +567,9 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, check type_has_static_size(ccx, ty); let llty = trans::type_of(ccx, pat.span, ty); let alloc = trans::alloca(bcx, llty); - bcx = trans::copy_val(bcx, trans::INIT, alloc, - trans::load_if_immediate(bcx, val, ty), ty); + bcx = + trans::copy_val(bcx, trans::INIT, alloc, + trans::load_if_immediate(bcx, val, ty), ty); table.insert(pat.id, alloc); trans_common::add_clean(bcx, alloc, ty); } else { table.insert(pat.id, val); } @@ -606,9 +606,9 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, } ast::pat_box(inner) { let box = Load(bcx, val); - let unboxed = InBoundsGEP(bcx, box, - [C_int(0), - C_int(back::abi::box_rc_field_body)]); + let unboxed = + InBoundsGEP(bcx, box, + [C_int(0), C_int(back::abi::box_rc_field_body)]); bcx = bind_irrefutable_pat(bcx, inner, unboxed, table, true); } ast::pat_wild. | ast::pat_lit(_) { } diff --git a/src/comp/middle/trans_build.rs b/src/comp/middle/trans_build.rs index 1355bbff0aa..52b976e2844 100644 --- a/src/comp/middle/trans_build.rs +++ b/src/comp/middle/trans_build.rs @@ -1,8 +1,8 @@ import std::{vec, str}; import std::str::sbuf; import lib::llvm::llvm; -import llvm::{ValueRef, TypeRef, BasicBlockRef, BuilderRef, - Opcode, ModuleRef}; +import llvm::{ValueRef, TypeRef, BasicBlockRef, BuilderRef, Opcode, + ModuleRef}; import trans_common::block_ctxt; fn B(cx: &@block_ctxt) -> BuilderRef { @@ -12,277 +12,212 @@ fn B(cx: &@block_ctxt) -> BuilderRef { } fn RetVoid(cx: &@block_ctxt) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildRetVoid(B(cx)); } fn Ret(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildRet(B(cx), V); } fn AggregateRet(cx: &@block_ctxt, RetVals: &[ValueRef]) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildAggregateRet(B(cx), vec::to_ptr(RetVals), vec::len(RetVals)); } fn Br(cx: &@block_ctxt, Dest: BasicBlockRef) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildBr(B(cx), Dest); } fn CondBr(cx: &@block_ctxt, If: ValueRef, Then: BasicBlockRef, Else: BasicBlockRef) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildCondBr(B(cx), If, Then, Else); } -fn Switch(cx: &@block_ctxt, V: ValueRef, Else: BasicBlockRef, - NumCases: uint) -> ValueRef { - assert (!cx.terminated);; +fn Switch(cx: &@block_ctxt, V: ValueRef, Else: BasicBlockRef, NumCases: uint) + -> ValueRef { + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildSwitch(B(cx), V, Else, NumCases); } -fn IndirectBr(cx: &@block_ctxt, Addr: ValueRef, - NumDests: uint) -> ValueRef { - assert (!cx.terminated);; +fn IndirectBr(cx: &@block_ctxt, Addr: ValueRef, NumDests: uint) -> ValueRef { + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildIndirectBr(B(cx), Addr, NumDests); } fn Invoke(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef], Then: BasicBlockRef, Catch: BasicBlockRef) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildInvoke(B(cx), Fn, vec::to_ptr(Args), - vec::len(Args), Then, Catch, buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildInvoke(B(cx), Fn, vec::to_ptr(Args), + vec::len(Args), Then, Catch, + buf) + }); } fn Unreachable(cx: &@block_ctxt) -> ValueRef { - assert (!cx.terminated);; + assert (!cx.terminated); cx.terminated = true; ret llvm::LLVMBuildUnreachable(B(cx)); } /* Arithmetic */ fn Add(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildAdd(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildAdd(B(cx), LHS, RHS, buf) }); } fn NSWAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNSWAdd(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNSWAdd(B(cx), LHS, RHS, buf) }); } fn NUWAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNUWAdd(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNUWAdd(B(cx), LHS, RHS, buf) }); } fn FAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFAdd(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFAdd(B(cx), LHS, RHS, buf) }); } fn Sub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSub(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildSub(B(cx), LHS, RHS, buf) }); } fn NSWSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNSWSub(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNSWSub(B(cx), LHS, RHS, buf) }); } fn NUWSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNUWSub(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNUWSub(B(cx), LHS, RHS, buf) }); } fn FSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFSub(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFSub(B(cx), LHS, RHS, buf) }); } fn Mul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildMul(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildMul(B(cx), LHS, RHS, buf) }); } fn NSWMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNSWMul(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNSWMul(B(cx), LHS, RHS, buf) }); } fn NUWMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNUWMul(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNUWMul(B(cx), LHS, RHS, buf) }); } fn FMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFMul(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFMul(B(cx), LHS, RHS, buf) }); } fn UDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildUDiv(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildUDiv(B(cx), LHS, RHS, buf) }); } fn SDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSDiv(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildSDiv(B(cx), LHS, RHS, buf) }); } fn ExactSDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildExactSDiv(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildExactSDiv(B(cx), LHS, RHS, buf) }); } fn FDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFDiv(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFDiv(B(cx), LHS, RHS, buf) }); } fn URem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildURem(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildURem(B(cx), LHS, RHS, buf) }); } fn SRem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSRem(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildSRem(B(cx), LHS, RHS, buf) }); } fn FRem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFRem(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFRem(B(cx), LHS, RHS, buf) }); } fn Shl(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildShl(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildShl(B(cx), LHS, RHS, buf) }); } fn LShr(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildLShr(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildLShr(B(cx), LHS, RHS, buf) }); } fn AShr(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildAShr(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildAShr(B(cx), LHS, RHS, buf) }); } fn And(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildAnd(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildAnd(B(cx), LHS, RHS, buf) }); } fn Or(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildOr(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildOr(B(cx), LHS, RHS, buf) }); } fn Xor(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildXor(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildXor(B(cx), LHS, RHS, buf) }); } -fn BinOp(cx: &@block_ctxt, Op: Opcode, LHS: ValueRef, - RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildBinOp(B(cx), Op, LHS, RHS, buf) - }); +fn BinOp(cx: &@block_ctxt, Op: Opcode, LHS: ValueRef, RHS: ValueRef) -> + ValueRef { + ret str::as_buf("", + {|buf| llvm::LLVMBuildBinOp(B(cx), Op, LHS, RHS, buf) }); } fn Neg(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNeg(B(cx), V, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNeg(B(cx), V, buf) }); } fn NSWNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNSWNeg(B(cx), V, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNSWNeg(B(cx), V, buf) }); } fn NUWNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNUWNeg(B(cx), V, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNUWNeg(B(cx), V, buf) }); } fn FNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFNeg(B(cx), V, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildFNeg(B(cx), V, buf) }); } fn Not(cx: &@block_ctxt, V: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildNot(B(cx), V, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildNot(B(cx), V, buf) }); } /* Memory */ fn Malloc(cx: &@block_ctxt, Ty: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildMalloc(B(cx), Ty, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildMalloc(B(cx), Ty, buf) }); } fn ArrayMalloc(cx: &@block_ctxt, Ty: TypeRef, Val: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildArrayMalloc(B(cx), Ty, Val, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildArrayMalloc(B(cx), Ty, Val, buf) }); } fn Alloca(cx: &@block_ctxt, Ty: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildAlloca(B(cx), Ty, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildAlloca(B(cx), Ty, buf) }); } fn ArrayAlloca(cx: &@block_ctxt, Ty: TypeRef, Val: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildArrayAlloca(B(cx), Ty, Val, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildArrayAlloca(B(cx), Ty, Val, buf) }); } fn Free(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef { @@ -290,194 +225,185 @@ fn Free(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef { } fn Load(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildLoad(B(cx), PointerVal, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildLoad(B(cx), PointerVal, buf) }); } fn Store(cx: &@block_ctxt, Val: ValueRef, Ptr: ValueRef) -> ValueRef { ret llvm::LLVMBuildStore(B(cx), Val, Ptr); } -fn GEP(cx: &@block_ctxt, Pointer: ValueRef, - Indices: &[ValueRef]) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildGEP(B(cx), Pointer, vec::to_ptr(Indices), - vec::len(Indices), buf) - }); +fn GEP(cx: &@block_ctxt, Pointer: ValueRef, Indices: &[ValueRef]) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildGEP(B(cx), Pointer, + vec::to_ptr(Indices), + vec::len(Indices), buf) + }); } -fn InBoundsGEP(cx: &@block_ctxt, Pointer: ValueRef, - Indices: &[ValueRef]) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildInBoundsGEP(B(cx), Pointer, vec::to_ptr(Indices), - vec::len(Indices), buf) - }); +fn InBoundsGEP(cx: &@block_ctxt, Pointer: ValueRef, Indices: &[ValueRef]) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildInBoundsGEP(B(cx), Pointer, + vec::to_ptr(Indices), + vec::len(Indices), buf) + }); } fn StructGEP(cx: &@block_ctxt, Pointer: ValueRef, Idx: uint) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildStructGEP(B(cx), Pointer, Idx, buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildStructGEP(B(cx), Pointer, Idx, buf) + }); } fn GlobalString(cx: &@block_ctxt, _Str: sbuf) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildGlobalString(B(cx), _Str, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildGlobalString(B(cx), _Str, buf) }); } fn GlobalStringPtr(cx: &@block_ctxt, _Str: sbuf) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildGlobalStringPtr(B(cx), _Str, buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildGlobalStringPtr(B(cx), _Str, buf) + }); } /* Casts */ fn Trunc(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildTrunc(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildTrunc(B(cx), Val, DestTy, buf) }); } fn ZExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildZExt(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildZExt(B(cx), Val, DestTy, buf) }); } fn SExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSExt(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildSExt(B(cx), Val, DestTy, buf) }); } fn FPToUI(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFPToUI(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildFPToUI(B(cx), Val, DestTy, buf) }); } fn FPToSI(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFPToSI(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildFPToSI(B(cx), Val, DestTy, buf) }); } fn UIToFP(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildUIToFP(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildUIToFP(B(cx), Val, DestTy, buf) }); } fn SIToFP(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSIToFP(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildSIToFP(B(cx), Val, DestTy, buf) }); } fn FPTrunc(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFPTrunc(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildFPTrunc(B(cx), Val, DestTy, buf) }); } fn FPExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFPExt(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildFPExt(B(cx), Val, DestTy, buf) }); } -fn PtrToInt(cx: &@block_ctxt, Val: ValueRef, - DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildPtrToInt(B(cx), Val, DestTy, buf) - }); +fn PtrToInt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildPtrToInt(B(cx), Val, DestTy, buf) + }); } -fn IntToPtr(cx: &@block_ctxt, Val: ValueRef, - DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildIntToPtr(B(cx), Val, DestTy, buf) - }); +fn IntToPtr(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildIntToPtr(B(cx), Val, DestTy, buf) + }); } fn BitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildBitCast(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildBitCast(B(cx), Val, DestTy, buf) }); } -fn ZExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, - DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildZExtOrBitCast(B(cx), Val, DestTy, buf) - }); +fn ZExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildZExtOrBitCast(B(cx), Val, DestTy, buf) + }); } -fn SExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, - DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSExtOrBitCast(B(cx), Val, DestTy, buf) - }); +fn SExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildSExtOrBitCast(B(cx), Val, DestTy, buf) + }); } -fn TruncOrBitCast(cx: &@block_ctxt, Val: ValueRef, - DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildTruncOrBitCast(B(cx), Val, DestTy, buf) - }); +fn TruncOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildTruncOrBitCast(B(cx), Val, DestTy, buf) + }); } -fn Cast(cx: &@block_ctxt, Op: Opcode, Val: ValueRef, - DestTy: TypeRef, _Name: sbuf) -> - ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildCast(B(cx), Op, Val, DestTy, buf) - }); +fn Cast(cx: &@block_ctxt, Op: Opcode, Val: ValueRef, DestTy: TypeRef, + _Name: sbuf) -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildCast(B(cx), Op, Val, DestTy, buf) + }); } fn PointerCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildPointerCast(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildPointerCast(B(cx), Val, DestTy, buf) + }); } fn IntCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildIntCast(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildIntCast(B(cx), Val, DestTy, buf) }); } fn FPCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFPCast(B(cx), Val, DestTy, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildFPCast(B(cx), Val, DestTy, buf) }); } /* Comparisons */ -fn ICmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, - RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildICmp(B(cx), Op, LHS, RHS, buf) - }); +fn ICmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, RHS: ValueRef) -> + ValueRef { + ret str::as_buf("", + {|buf| llvm::LLVMBuildICmp(B(cx), Op, LHS, RHS, buf) }); } -fn FCmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, - RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildFCmp(B(cx), Op, LHS, RHS, buf) - }); +fn FCmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, RHS: ValueRef) -> + ValueRef { + ret str::as_buf("", + {|buf| llvm::LLVMBuildFCmp(B(cx), Op, LHS, RHS, buf) }); } /* Miscellaneous instructions */ fn Phi(cx: &@block_ctxt, Ty: TypeRef, vals: &[ValueRef], bbs: &[BasicBlockRef]) -> ValueRef { - let phi = str::as_buf(~"", { |buf| - llvm::LLVMBuildPhi(B(cx), Ty, buf) - }); + let phi = str::as_buf("", {|buf| llvm::LLVMBuildPhi(B(cx), Ty, buf) }); assert (vec::len::<ValueRef>(vals) == vec::len::<BasicBlockRef>(bbs)); llvm::LLVMAddIncoming(phi, vec::to_ptr(vals), vec::to_ptr(bbs), vec::len(vals)); @@ -491,93 +417,101 @@ fn AddIncomingToPhi(phi: ValueRef, vals: &[ValueRef], bbs: &[BasicBlockRef]) { } fn Call(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef]) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), - vec::len(Args), buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), + vec::len(Args), buf) + }); } fn FastCall(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef]) -> ValueRef { - let v = str::as_buf(~"", { |buf| - llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), vec::len(Args), buf) - }); + let v = + str::as_buf("", + {|buf| + llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), + vec::len(Args), buf) + }); llvm::LLVMSetInstructionCallConv(v, lib::llvm::LLVMFastCallConv); ret v; } -fn CallWithConv(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef], - Conv: uint) -> ValueRef { - let v = str::as_buf(~"", { |buf| - llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), vec::len(Args), buf) - }); +fn CallWithConv(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef], Conv: uint) + -> ValueRef { + let v = + str::as_buf("", + {|buf| + llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), + vec::len(Args), buf) + }); llvm::LLVMSetInstructionCallConv(v, Conv); ret v; } -fn Select(cx: &@block_ctxt, If: ValueRef, Then: ValueRef, - Else: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildSelect(B(cx), If, Then, Else, buf) - }); +fn Select(cx: &@block_ctxt, If: ValueRef, Then: ValueRef, Else: ValueRef) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildSelect(B(cx), If, Then, Else, buf) + }); } fn VAArg(cx: &@block_ctxt, list: ValueRef, Ty: TypeRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildVAArg(B(cx), list, Ty, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildVAArg(B(cx), list, Ty, buf) }); } -fn ExtractElement(cx: &@block_ctxt, VecVal: ValueRef, - Index: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildExtractElement(B(cx), VecVal, Index, buf) - }); +fn ExtractElement(cx: &@block_ctxt, VecVal: ValueRef, Index: ValueRef) -> + ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildExtractElement(B(cx), VecVal, Index, + buf) + }); } fn InsertElement(cx: &@block_ctxt, VecVal: ValueRef, EltVal: ValueRef, - Index: ValueRef) -> - ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildInsertElement(B(cx), VecVal, EltVal, Index, buf) - }); + Index: ValueRef) -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildInsertElement(B(cx), VecVal, EltVal, + Index, buf) + }); } -fn ShuffleVector(cx: &@block_ctxt, V1: ValueRef, V2: ValueRef, - Mask: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildShuffleVector(B(cx), V1, V2, Mask, buf) - }); +fn ShuffleVector(cx: &@block_ctxt, V1: ValueRef, V2: ValueRef, Mask: ValueRef) + -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildShuffleVector(B(cx), V1, V2, Mask, buf) + }); } fn ExtractValue(cx: &@block_ctxt, AggVal: ValueRef, Index: uint) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildExtractValue(B(cx), AggVal, Index, buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildExtractValue(B(cx), AggVal, Index, buf) + }); } -fn InsertValue(cx: &@block_ctxt, AggVal: ValueRef, - EltVal: ValueRef, Index: uint) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildInsertValue(B(cx), AggVal, EltVal, Index, buf) - }); +fn InsertValue(cx: &@block_ctxt, AggVal: ValueRef, EltVal: ValueRef, + Index: uint) -> ValueRef { + ret str::as_buf("", + {|buf| + llvm::LLVMBuildInsertValue(B(cx), AggVal, EltVal, + Index, buf) + }); } fn IsNull(cx: &@block_ctxt, Val: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildIsNull(B(cx), Val, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildIsNull(B(cx), Val, buf) }); } fn IsNotNull(cx: &@block_ctxt, Val: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildIsNotNull(B(cx), Val, buf) - }); + ret str::as_buf("", {|buf| llvm::LLVMBuildIsNotNull(B(cx), Val, buf) }); } fn PtrDiff(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef { - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildPtrDiff(B(cx), LHS, RHS, buf) - }); + ret str::as_buf("", + {|buf| llvm::LLVMBuildPtrDiff(B(cx), LHS, RHS, buf) }); } fn Trap(cx: &@block_ctxt) -> ValueRef { @@ -585,14 +519,15 @@ fn Trap(cx: &@block_ctxt) -> ValueRef { let BB: BasicBlockRef = llvm::LLVMGetInsertBlock(b); let FN: ValueRef = llvm::LLVMGetBasicBlockParent(BB); let M: ModuleRef = llvm::LLVMGetGlobalParent(FN); - let T: ValueRef = str::as_buf(~"llvm.trap", { |buf| - llvm::LLVMGetNamedFunction(M, buf) - }); + let T: ValueRef = + str::as_buf("llvm.trap", {|buf| llvm::LLVMGetNamedFunction(M, buf) }); assert (T as int != 0); let Args: [ValueRef] = []; - ret str::as_buf(~"", { |buf| - llvm::LLVMBuildCall(b, T, vec::to_ptr(Args), vec::len(Args), buf) - }); + ret str::as_buf("", + {|buf| + llvm::LLVMBuildCall(b, T, vec::to_ptr(Args), + vec::len(Args), buf) + }); } // diff --git a/src/comp/middle/trans_common.rs b/src/comp/middle/trans_common.rs index b18f81bb45c..2943edd4333 100644 --- a/src/comp/middle/trans_common.rs +++ b/src/comp/middle/trans_common.rs @@ -62,9 +62,7 @@ import trans::type_of_fn_full; import trans::drop_ty; obj namegen(mutable i: int) { - fn next(prefix: &istr) -> istr { - i += 1; ret prefix + int::str(i); - } + fn next(prefix: &str) -> str { i += 1; ret prefix + int::str(i); } } type derived_tydesc_info = {lltydesc: ValueRef, escapes: bool}; @@ -109,11 +107,9 @@ type stats = mutable n_glues_created: uint, mutable n_null_glues: uint, mutable n_real_glues: uint, - fn_times: @mutable [{ident: istr, time: int}]}; + fn_times: @mutable [{ident: str, time: int}]}; -resource BuilderRef_res(B: llvm::BuilderRef) { - llvm::LLVMDisposeBuilder(B); -} +resource BuilderRef_res(B: llvm::BuilderRef) { llvm::LLVMDisposeBuilder(B); } // Crate context. Every crate we compile has one of these. type crate_ctxt = @@ -125,27 +121,27 @@ type crate_ctxt = llmod: ModuleRef, td: target_data, tn: type_names, - externs: hashmap<istr, ValueRef>, - intrinsics: hashmap<istr, ValueRef>, + externs: hashmap<str, ValueRef>, + intrinsics: hashmap<str, ValueRef>, item_ids: hashmap<ast::node_id, ValueRef>, ast_map: ast_map::map, - item_symbols: hashmap<ast::node_id, istr>, + item_symbols: hashmap<ast::node_id, str>, mutable main_fn: option::t<ValueRef>, link_meta: link::link_meta, tag_sizes: hashmap<ty::t, uint>, discrims: hashmap<ast::node_id, ValueRef>, - discrim_symbols: hashmap<ast::node_id, istr>, + discrim_symbols: hashmap<ast::node_id, str>, fn_pairs: hashmap<ast::node_id, ValueRef>, consts: hashmap<ast::node_id, ValueRef>, obj_methods: hashmap<ast::node_id, ()>, tydescs: hashmap<ty::t, @tydesc_info>, - module_data: hashmap<istr, ValueRef>, + module_data: hashmap<str, ValueRef>, lltypes: hashmap<ty::t, TypeRef>, glues: @glue_fns, names: namegen, sha: std::sha1::sha1, - type_sha1s: hashmap<ty::t, istr>, - type_short_names: hashmap<ty::t, istr>, + type_sha1s: hashmap<ty::t, str>, + type_short_names: hashmap<ty::t, str>, tcx: ty::ctxt, mut_map: mut::mut_map, stats: stats, @@ -158,8 +154,8 @@ type crate_ctxt = gc_cx: gc::ctxt}; type local_ctxt = - {path: [istr], - module_path: [istr], + {path: [str], + module_path: [str], obj_typarams: [ast::ty_param], obj_fields: [ast::obj_field], ccx: @crate_ctxt}; @@ -302,11 +298,12 @@ fn add_clean(cx: &@block_ctxt, val: ValueRef, ty: ty::t) { find_scope_cx(cx).cleanups += [clean(bind drop_ty(_, val, ty))]; } fn add_clean_temp(cx: &@block_ctxt, val: ValueRef, ty: ty::t) { - fn spill_and_drop(cx: &@block_ctxt, val: ValueRef, ty: ty::t) - -> @block_ctxt { + fn spill_and_drop(cx: &@block_ctxt, val: ValueRef, ty: ty::t) -> + @block_ctxt { let bcx = cx; let r = trans::spill_if_immediate(bcx, val, ty); - let spilled = r.val; bcx = r.bcx; + let spilled = r.val; + bcx = r.bcx; ret drop_ty(bcx, spilled, ty); } find_scope_cx(cx).cleanups += @@ -345,7 +342,7 @@ fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id, if did.crate == ast::local_crate { alt ccx.fn_pairs.find(did.node) { some(x) { ret x; } - _ { ccx.tcx.sess.bug(~"get_res_dtor: can't find resource dtor!"); } + _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); } } } @@ -355,9 +352,8 @@ fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id, [{mode: ty::mo_alias(false), ty: inner_t}], ty::mk_nil(ccx.tcx), params); ret trans::get_extern_const(ccx.externs, ccx.llmod, - csearch::get_symbol( - ccx.sess.get_cstore(), - did), + csearch::get_symbol(ccx.sess.get_cstore(), + did), T_fn_pair(*ccx, f_t)); } @@ -396,26 +392,24 @@ type block_ctxt = // llvm::LLVMAppendBasicBlock(llfn, name), which adds a basic // block to the function pointed to by llfn. We insert // instructions into that block by way of this block context. + // The block pointing to this one in the function's digraph. + // The 'kind' of basic block this is. + // A list of functions that run at the end of translating this + // block, cleaning up any variables that were introduced in the + // block and need to go out of scope at the end of it. + // The source span where this block comes from, for error + // reporting. FIXME this is not currently reliable + // The function context for the function to which this block is + // attached. {llbb: BasicBlockRef, mutable terminated: bool, - // The block pointing to this one in the function's digraph. parent: block_parent, - // The 'kind' of basic block this is. kind: block_kind, - // A list of functions that run at the end of translating this - // block, cleaning up any variables that were introduced in the - // block and need to go out of scope at the end of it. mutable cleanups: [cleanup], - // The source span where this block comes from, for error - // reporting. FIXME this is not currently reliable sp: span, - // The function context for the function to which this block is - // attached. fcx: @fn_ctxt}; -fn is_terminated(cx: &@block_ctxt) -> bool { - ret cx.terminated; -} +fn is_terminated(cx: &@block_ctxt) -> bool { ret cx.terminated; } // FIXME: we should be able to use option::t<@block_parent> here but // the infinite-tag check in rustboot gets upset. @@ -424,7 +418,7 @@ tag block_parent { parent_none; parent_some(@block_ctxt); } type result = {bcx: @block_ctxt, val: ValueRef}; type result_t = {bcx: @block_ctxt, val: ValueRef, ty: ty::t}; -fn extend_path(cx: @local_ctxt, name: &istr) -> @local_ctxt { +fn extend_path(cx: @local_ctxt, name: &str) -> @local_ctxt { ret @{path: cx.path + [name] with *cx}; } @@ -432,15 +426,13 @@ fn rslt(bcx: @block_ctxt, val: ValueRef) -> result { ret {bcx: bcx, val: val}; } -fn ty_str(tn: type_names, t: TypeRef) -> istr { +fn ty_str(tn: type_names, t: TypeRef) -> str { ret lib::llvm::type_to_str(tn, t); } fn val_ty(v: ValueRef) -> TypeRef { ret llvm::LLVMTypeOf(v); } -fn val_str(tn: type_names, v: ValueRef) -> istr { - ret ty_str(tn, val_ty(v)); -} +fn val_str(tn: type_names, v: ValueRef) -> str { ret ty_str(tn, val_ty(v)); } // Returns the nth element of the given LLVM structure type. fn struct_elt(llstructty: TypeRef, n: uint) -> TypeRef { @@ -456,8 +448,8 @@ fn find_scope_cx(cx: &@block_ctxt) -> @block_ctxt { alt cx.parent { parent_some(b) { ret find_scope_cx(b); } parent_none. { - cx.fcx.lcx.ccx.sess.bug(~"trans::find_scope_cx() " + - ~"called on parentless block_ctxt"); + cx.fcx.lcx.ccx.sess.bug("trans::find_scope_cx() " + + "called on parentless block_ctxt"); } } } @@ -543,20 +535,16 @@ fn T_fn_pair(cx: &crate_ctxt, tfn: TypeRef) -> TypeRef { fn T_ptr(t: TypeRef) -> TypeRef { ret llvm::LLVMPointerType(t, 0u); } fn T_struct(elts: &[TypeRef]) -> TypeRef { - ret llvm::LLVMStructType(to_ptr(elts), - std::vec::len(elts), False); + ret llvm::LLVMStructType(to_ptr(elts), std::vec::len(elts), False); } -fn T_named_struct(name: &istr) -> TypeRef { +fn T_named_struct(name: &str) -> TypeRef { let c = llvm::LLVMGetGlobalContext(); - ret str::as_buf(name, { |buf| - llvm::LLVMStructCreateNamed(c, buf) - }); + ret str::as_buf(name, {|buf| llvm::LLVMStructCreateNamed(c, buf) }); } fn set_struct_body(t: TypeRef, elts: &[TypeRef]) { - llvm::LLVMStructSetBody(t, to_ptr(elts), - std::vec::len(elts), False); + llvm::LLVMStructSetBody(t, to_ptr(elts), std::vec::len(elts), False); } fn T_empty_struct() -> TypeRef { ret T_struct([]); } @@ -566,25 +554,25 @@ fn T_empty_struct() -> TypeRef { ret T_struct([]); } // existing objects, use ccx.rust_object_type. Calling // T_rust_object() again will return a different one. fn T_rust_object() -> TypeRef { - let t = T_named_struct(~"rust_object"); + let t = T_named_struct("rust_object"); let e = T_ptr(T_empty_struct()); set_struct_body(t, [e, e]); ret t; } fn T_task() -> TypeRef { - let t = T_named_struct(~"task"); + let t = T_named_struct("task"); - // Refcount - // Delegate pointer - // Stack segment pointer - // Runtime SP - // Rust SP - // GC chain + // Refcount + // Delegate pointer + // Stack segment pointer + // Runtime SP + // Rust SP + // GC chain - // Domain pointer - // Crate cache pointer + // Domain pointer + // Crate cache pointer let elems = [T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), @@ -605,7 +593,7 @@ fn T_tydesc_field(cx: &crate_ctxt, field: int) -> TypeRef { } fn T_glue_fn(cx: &crate_ctxt) -> TypeRef { - let s = ~"glue_fn"; + let s = "glue_fn"; if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); } let t = T_tydesc_field(cx, abi::tydesc_field_drop_glue); cx.tn.associate(s, t); @@ -613,7 +601,7 @@ fn T_glue_fn(cx: &crate_ctxt) -> TypeRef { } fn T_cmp_glue_fn(cx: &crate_ctxt) -> TypeRef { - let s = ~"cmp_glue_fn"; + let s = "cmp_glue_fn"; if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); } let t = T_tydesc_field(cx, abi::tydesc_field_cmp_glue); cx.tn.associate(s, t); @@ -621,7 +609,7 @@ fn T_cmp_glue_fn(cx: &crate_ctxt) -> TypeRef { } fn T_tydesc(taskptr_type: TypeRef) -> TypeRef { - let tydesc = T_named_struct(~"tydesc"); + let tydesc = T_named_struct("tydesc"); let tydescpp = T_ptr(T_ptr(tydesc)); let pvoid = T_ptr(T_i8()); let glue_fn_ty = @@ -652,9 +640,7 @@ fn T_vec(t: TypeRef) -> TypeRef { } // Note that the size of this one is in bytes. -fn T_opaque_vec() -> TypeRef { - ret T_vec(T_i8()); -} +fn T_opaque_vec() -> TypeRef { ret T_vec(T_i8()); } fn T_box(t: TypeRef) -> TypeRef { ret T_struct([T_int(), t]); } @@ -673,7 +659,7 @@ fn T_taskptr(cx: &crate_ctxt) -> TypeRef { ret T_ptr(cx.task_type); } // This type must never be used directly; it must always be cast away. fn T_typaram(tn: &type_names) -> TypeRef { - let s = ~"typaram"; + let s = "typaram"; if tn.name_has_type(s) { ret tn.get_type(s); } let t = T_i8(); tn.associate(s, t); @@ -692,7 +678,7 @@ fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef, n_ty_params: uint) } fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef { - let s = ~"*closure"; + let s = "*closure"; if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); } let t = T_closure_ptr(cx, T_nil(), 0u); cx.tn.associate(s, t); @@ -700,7 +686,7 @@ fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef { } fn T_tag(tn: &type_names, size: uint) -> TypeRef { - let s = ~"tag_" + uint::to_str(size, 10u); + let s = "tag_" + uint::to_str(size, 10u); if tn.name_has_type(s) { ret tn.get_type(s); } let t = T_struct([T_int(), T_array(T_i8(), size)]); tn.associate(s, t); @@ -708,7 +694,7 @@ fn T_tag(tn: &type_names, size: uint) -> TypeRef { } fn T_opaque_tag(tn: &type_names) -> TypeRef { - let s = ~"opaque_tag"; + let s = "opaque_tag"; if tn.name_has_type(s) { ret tn.get_type(s); } let t = T_struct([T_int(), T_i8()]); tn.associate(s, t); @@ -754,16 +740,12 @@ fn C_integral(t: TypeRef, u: uint, sign_extend: Bool) -> ValueRef { ret llvm::LLVMRustConstSmallInt(t, u, sign_extend); } -fn C_float(s: &istr) -> ValueRef { - ret str::as_buf(s, { |buf| - llvm::LLVMConstRealOfString(T_float(), buf) - }); +fn C_float(s: &str) -> ValueRef { + ret str::as_buf(s, {|buf| llvm::LLVMConstRealOfString(T_float(), buf) }); } -fn C_floating(s: &istr, t: TypeRef) -> ValueRef { - ret str::as_buf(s, { |buf| - llvm::LLVMConstRealOfString(t, buf) - }); +fn C_floating(s: &str, t: TypeRef) -> ValueRef { + ret str::as_buf(s, {|buf| llvm::LLVMConstRealOfString(t, buf) }); } fn C_nil() -> ValueRef { @@ -787,13 +769,15 @@ fn C_u8(i: uint) -> ValueRef { ret C_integral(T_i8(), i, False); } // This is a 'c-like' raw string, which differs from // our boxed-and-length-annotated strings. -fn C_cstr(cx: &@crate_ctxt, s: &istr) -> ValueRef { - let sc = str::as_buf(s, { |buf| - llvm::LLVMConstString(buf, str::byte_len(s), False) - }); - let g = str::as_buf(cx.names.next(~"str"), { |buf| - llvm::LLVMAddGlobal(cx.llmod, val_ty(sc), buf) - }); +fn C_cstr(cx: &@crate_ctxt, s: &str) -> ValueRef { + let sc = + str::as_buf(s, + {|buf| + llvm::LLVMConstString(buf, str::byte_len(s), False) + }); + let g = + str::as_buf(cx.names.next("str"), + {|buf| llvm::LLVMAddGlobal(cx.llmod, val_ty(sc), buf) }); llvm::LLVMSetInitializer(g, sc); llvm::LLVMSetGlobalConstant(g, True); llvm::LLVMSetLinkage(g, lib::llvm::LLVMInternalLinkage as llvm::Linkage); @@ -801,10 +785,11 @@ fn C_cstr(cx: &@crate_ctxt, s: &istr) -> ValueRef { } // Returns a Plain Old LLVM String: -fn C_postr(s: &istr) -> ValueRef { - ret str::as_buf(s, { |buf| - llvm::LLVMConstString(buf, str::byte_len(s), False) - }); +fn C_postr(s: &str) -> ValueRef { + ret str::as_buf(s, + {|buf| + llvm::LLVMConstString(buf, str::byte_len(s), False) + }); } fn C_zero_byte_arr(size: uint) -> ValueRef { @@ -836,9 +821,11 @@ fn C_bytes(bytes: &[u8]) -> ValueRef { fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef { let llshape = C_bytes(bytes); - let llglobal = str::as_buf(ccx.names.next(~"shape"), { |buf| - llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), buf) - }); + let llglobal = + str::as_buf(ccx.names.next("shape"), + {|buf| + llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), buf) + }); llvm::LLVMSetInitializer(llglobal, llshape); llvm::LLVMSetGlobalConstant(llglobal, True); llvm::LLVMSetLinkage(llglobal, @@ -847,14 +834,16 @@ fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef { } -pure fn valid_variant_index(ix:uint, cx:@block_ctxt, tag_id: &ast::def_id, +pure fn valid_variant_index(ix: uint, cx: @block_ctxt, tag_id: &ast::def_id, variant_id: &ast::def_id) -> bool { + // Handwaving: it's ok to pretend this code is referentially // transparent, because the relevant parts of the type context don't // change. (We're not adding new variants during trans.) - unchecked { - let variant = ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id); - ix < vec::len(variant.args) + unchecked{ + let variant = + ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id); + ix < vec::len(variant.args) } } diff --git a/src/comp/middle/trans_objects.rs b/src/comp/middle/trans_objects.rs index cb48ef95d6d..ed2ee1ba74d 100644 --- a/src/comp/middle/trans_objects.rs +++ b/src/comp/middle/trans_objects.rs @@ -37,7 +37,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, let llctor_decl; alt ccx.item_ids.find(ctor_id) { some(x) { llctor_decl = x; } - _ { cx.ccx.sess.span_fatal(sp, ~"unbound llctor_decl in trans_obj"); } + _ { cx.ccx.sess.span_fatal(sp, "unbound llctor_decl in trans_obj"); } } // Much like trans_fn, we must create an LLVM function, but since we're @@ -79,8 +79,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // Grab onto the first and second elements of the pair. // abi::obj_field_vtbl and abi::obj_field_box simply specify words 0 and 1 // of 'pair'. - let pair_vtbl = - GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]); + let pair_vtbl = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]); let pair_box = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_box)]); // Make a vtable for this object: a static array of pointers to functions. @@ -135,8 +134,8 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, bcx = body_tydesc.bcx; let ti = none::<@tydesc_info>; - let r = GEP_tup_like(bcx, body_ty, body, - [0, abi::obj_body_elt_typarams]); + let r = + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_typarams]); bcx = r.bcx; let body_typarams = r.val; @@ -186,7 +185,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, } none. { bcx_ccx(bcx).sess.span_fatal(f.ty.span, - ~"internal error in trans_obj"); + "internal error in trans_obj"); } } } @@ -285,8 +284,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, add_clean_temp(bcx, pair, t); // Grab onto the first and second elements of the pair. - let pair_vtbl = - GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]); + let pair_vtbl = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]); let pair_box = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_box)]); vtbl = PointerCast(bcx, vtbl, T_ptr(T_empty_struct())); @@ -370,8 +368,9 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_inner_obj]); bcx = body_inner_obj.bcx; - bcx = copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val, - inner_obj_ty); + bcx = + copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val, + inner_obj_ty); } } @@ -435,7 +434,7 @@ fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, addtl_meths: [@ast::method]) ret some(fwding_mthd(fm)); } normal_mthd(_) { - cx.ccx.sess.bug(~"create_vtbl(): shouldn't be any \ + cx.ccx.sess.bug("create_vtbl(): shouldn't be any \ normal_mthds in meths here"); } } @@ -485,7 +484,7 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, } } _ { - cx.ccx.sess.bug(~"create_vtbl(): trying to extend a \ + cx.ccx.sess.bug("create_vtbl(): trying to extend a \ non-object"); } } @@ -526,7 +525,7 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, } } - ret finish_vtbl(cx, llmethods, ~"vtbl"); + ret finish_vtbl(cx, llmethods, "vtbl"); } // create_backwarding_vtbl: Create a vtable for the inner object of an @@ -549,7 +548,7 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t, } _ { // Shouldn't happen. - cx.ccx.sess.bug(~"create_backwarding_vtbl(): trying to extend a \ + cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \ non-object"); } } @@ -560,19 +559,20 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t, // being forwarded to. llmethods += [process_bkwding_mthd(cx, sp, @m, [], outer_obj_ty, [])]; } - ret finish_vtbl(cx, llmethods, ~"backwarding_vtbl"); + ret finish_vtbl(cx, llmethods, "backwarding_vtbl"); } // finish_vtbl: Given a vector of vtable entries, create the table in // read-only memory and return a pointer to it. -fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: &istr) -> +fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: &str) -> ValueRef { let vtbl = C_struct(llmethods); - let vtbl_name = mangle_internal_name_by_path( - cx.ccx, cx.path + [name]); - let gvar = str::as_buf(vtbl_name, { |buf| - llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), buf) - }); + let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + [name]); + let gvar = + str::as_buf(vtbl_name, + {|buf| + llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), buf) + }); llvm::LLVMSetInitializer(gvar, vtbl); llvm::LLVMSetGlobalConstant(gvar, True); llvm::LLVMSetLinkage(gvar, @@ -600,22 +600,19 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Create a local context that's aware of the name of the method we're // creating. - let mcx: @local_ctxt = @{path: cx.path - + [~"method", m.ident] with *cx}; + let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx}; // Make up a name for the backwarding function. - let fn_name: istr = ~"backwarding_fn"; - let s: istr = - mangle_internal_name_by_path_and_seq( - mcx.ccx, mcx.path, fn_name); + let fn_name: str = "backwarding_fn"; + let s: str = + mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name); // Get the backwarding function's type and declare it. let llbackwarding_fn_ty: TypeRef = type_of_fn_full(cx.ccx, sp, m.proto, true, m.inputs, m.output, std::vec::len::<ast::ty_param>(ty_params)); let llbackwarding_fn: ValueRef = - decl_internal_fastcall_fn( - cx.ccx.llmod, s, llbackwarding_fn_ty); + decl_internal_fastcall_fn(cx.ccx.llmod, s, llbackwarding_fn_ty); // Create a new function context and block context for the backwarding // function, holding onto a pointer to the first block. @@ -630,8 +627,8 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Cast to self-stack's type. let llenv = PointerCast(bcx, fcx.llenv, - T_ptr(T_struct([cx.ccx.rust_object_type, - T_ptr(cx.ccx.rust_object_type)]))); + T_ptr(T_struct([cx.ccx.rust_object_type, + T_ptr(cx.ccx.rust_object_type)]))); let llself_obj_ptr = GEP(bcx, llenv, [C_int(0), C_int(1)]); llself_obj_ptr = Load(bcx, llself_obj_ptr); @@ -656,7 +653,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, } _ { // Shouldn't happen. - cx.ccx.sess.bug(~"process_bkwding_mthd(): non-object type passed \ + cx.ccx.sess.bug("process_bkwding_mthd(): non-object type passed \ as outer_obj_ty"); } } @@ -731,22 +728,19 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Create a local context that's aware of the name of the method we're // creating. - let mcx: @local_ctxt = @{path: cx.path - + [~"method", m.ident] with *cx}; + let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx}; // Make up a name for the forwarding function. - let fn_name: istr = ~"forwarding_fn"; - let s: istr = - mangle_internal_name_by_path_and_seq( - mcx.ccx, mcx.path, fn_name); + let fn_name: str = "forwarding_fn"; + let s: str = + mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name); // Get the forwarding function's type and declare it. let llforwarding_fn_ty: TypeRef = type_of_fn_full(cx.ccx, sp, m.proto, true, m.inputs, m.output, std::vec::len::<ast::ty_param>(ty_params)); let llforwarding_fn: ValueRef = - decl_internal_fastcall_fn( - cx.ccx.llmod, s, llforwarding_fn_ty); + decl_internal_fastcall_fn(cx.ccx.llmod, s, llforwarding_fn_ty); // Create a new function context and block context for the forwarding // function, holding onto a pointer to the first block. @@ -782,8 +776,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Now, reach into the box and grab the body. let llself_obj_body = - GEP(bcx, llself_obj_box, - [C_int(0), C_int(abi::box_rc_field_body)]); + GEP(bcx, llself_obj_box, [C_int(0), C_int(abi::box_rc_field_body)]); // Now, we need to figure out exactly what type the body is supposed to be // cast to. @@ -811,8 +804,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // method's entry out of the vtable so that the forwarding function can // call it. let llinner_obj_vtbl = - GEP(bcx, llinner_obj.val, - [C_int(0), C_int(abi::obj_field_vtbl)]); + GEP(bcx, llinner_obj.val, [C_int(0), C_int(abi::obj_field_vtbl)]); llinner_obj_vtbl = Load(bcx, llinner_obj_vtbl); let llinner_obj_body = @@ -827,7 +819,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, } _ { // Shouldn't happen. - cx.ccx.sess.bug(~"process_fwding_mthd(): non-object type passed \ + cx.ccx.sess.bug("process_fwding_mthd(): non-object type passed \ as target_obj_ty"); } } @@ -846,8 +838,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, ty::ty_fn_proto(bcx_tcx(bcx), orig_mthd_ty), true, m.inputs, m.output, std::vec::len::<ast::ty_param>(ty_params)); - llorig_mthd = - PointerCast(bcx, llorig_mthd, T_ptr(T_ptr(llorig_mthd_ty))); + llorig_mthd = PointerCast(bcx, llorig_mthd, T_ptr(T_ptr(llorig_mthd_ty))); llorig_mthd = Load(bcx, llorig_mthd); // Set up the self-stack. @@ -860,8 +851,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, llinner_obj_body); // Cast self_stack back to pointer-to-object-type to make LLVM happy. - self_stack = - PointerCast(bcx, self_stack, T_ptr(cx.ccx.rust_object_type)); + self_stack = PointerCast(bcx, self_stack, T_ptr(cx.ccx.rust_object_type)); // Set up the three implicit arguments to the original method we'll need // to call. @@ -930,11 +920,9 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t, } } let mcx: @local_ctxt = - @{path: cx.path + [~"method", m.node.ident] with *cx}; - let s: istr = mangle_internal_name_by_path(mcx.ccx, - mcx.path); - let llfn: ValueRef = decl_internal_fastcall_fn( - cx.ccx.llmod, s, llfnty); + @{path: cx.path + ["method", m.node.ident] with *cx}; + let s: str = mangle_internal_name_by_path(mcx.ccx, mcx.path); + let llfn: ValueRef = decl_internal_fastcall_fn(cx.ccx.llmod, s, llfnty); // Every method on an object gets its node_id inserted into the crate-wide // item_ids map, together with the ValueRef that points to where that diff --git a/src/comp/middle/trans_vec.rs b/src/comp/middle/trans_vec.rs index 84d542bbdcd..10a5ed5ce7d 100644 --- a/src/comp/middle/trans_vec.rs +++ b/src/comp/middle/trans_vec.rs @@ -3,12 +3,11 @@ import std::option::none; import syntax::ast; import lib::llvm::llvm::{ValueRef, TypeRef}; import back::abi; -import trans::{call_memmove, trans_shared_malloc, llsize_of, - type_of_or_i8, incr_ptr, INIT, copy_val, load_if_immediate, - alloca, size_of, llderivedtydescs_block_ctxt, - lazily_emit_tydesc_glue, get_tydesc, load_inbounds, - move_val_if_temp, trans_lval, node_id_type, - new_sub_block_ctxt, tps_normal, do_spill_noroot}; +import trans::{call_memmove, trans_shared_malloc, llsize_of, type_of_or_i8, + incr_ptr, INIT, copy_val, load_if_immediate, alloca, size_of, + llderivedtydescs_block_ctxt, lazily_emit_tydesc_glue, + get_tydesc, load_inbounds, move_val_if_temp, trans_lval, + node_id_type, new_sub_block_ctxt, tps_normal, do_spill_noroot}; import trans_build::*; import trans_common::*; @@ -18,14 +17,14 @@ fn get_fill(bcx: &@block_ctxt, vptr: ValueRef) -> ValueRef { fn get_alloc(bcx: &@block_ctxt, vptr: ValueRef) -> ValueRef { Load(bcx, InBoundsGEP(bcx, vptr, [C_int(0), C_uint(abi::vec_elt_alloc)])) } -fn get_dataptr(bcx: &@block_ctxt, vpt: ValueRef, - unit_ty: TypeRef) -> ValueRef { +fn get_dataptr(bcx: &@block_ctxt, vpt: ValueRef, unit_ty: TypeRef) -> + ValueRef { let ptr = InBoundsGEP(bcx, vpt, [C_int(0), C_uint(abi::vec_elt_elems)]); PointerCast(bcx, ptr, T_ptr(unit_ty)) } -fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef) - -> ValueRef { +fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef) -> + ValueRef { let old_ty = val_ty(ptr); let bptr = PointerCast(bcx, ptr, T_ptr(T_i8())); ret PointerCast(bcx, InBoundsGEP(bcx, bptr, [bytes]), old_ty); @@ -34,53 +33,58 @@ fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef) fn alloc_raw(bcx: &@block_ctxt, fill: ValueRef, alloc: ValueRef) -> result { let llvecty = T_opaque_vec(); let vecsize = Add(bcx, alloc, llsize_of(llvecty)); - let {bcx, val: vecptr} = + let {bcx: bcx, val: vecptr} = trans_shared_malloc(bcx, T_ptr(llvecty), vecsize); - Store(bcx, fill, InBoundsGEP - (bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_fill)])); - Store(bcx, alloc, InBoundsGEP - (bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_alloc)])); + Store(bcx, fill, + InBoundsGEP(bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_fill)])); + Store(bcx, alloc, + InBoundsGEP(bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_alloc)])); ret {bcx: bcx, val: vecptr}; } -type alloc_result = {bcx: @block_ctxt, - val: ValueRef, - unit_ty: ty::t, - llunitsz: ValueRef, - llunitty: TypeRef}; +type alloc_result = + {bcx: @block_ctxt, + val: ValueRef, + unit_ty: ty::t, + llunitsz: ValueRef, + llunitty: TypeRef}; fn alloc(bcx: &@block_ctxt, vec_ty: &ty::t, elts: uint) -> alloc_result { let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty); let llunitty = type_of_or_i8(bcx, unit_ty); let llvecty = T_vec(llunitty); - let {bcx, val: unit_sz} = size_of(bcx, unit_ty); + let {bcx: bcx, val: unit_sz} = size_of(bcx, unit_ty); let fill = Mul(bcx, C_uint(elts), unit_sz); let alloc = if elts < 4u { Mul(bcx, C_int(4), unit_sz) } else { fill }; - let {bcx, val: vptr} = alloc_raw(bcx, fill, alloc); + let {bcx: bcx, val: vptr} = alloc_raw(bcx, fill, alloc); let vptr = PointerCast(bcx, vptr, T_ptr(llvecty)); add_clean_temp(bcx, vptr, vec_ty); - ret {bcx: bcx, val: vptr, unit_ty: unit_ty, - llunitsz: unit_sz, llunitty: llunitty}; + ret {bcx: bcx, + val: vptr, + unit_ty: unit_ty, + llunitsz: unit_sz, + llunitty: llunitty}; } fn duplicate(bcx: &@block_ctxt, vptrptr: ValueRef) -> @block_ctxt { let vptr = Load(bcx, vptrptr); let fill = get_fill(bcx, vptr); let size = Add(bcx, fill, llsize_of(T_opaque_vec())); - let {bcx, val: newptr} = trans_shared_malloc(bcx, val_ty(vptr), size); + let {bcx: bcx, val: newptr} = + trans_shared_malloc(bcx, val_ty(vptr), size); let bcx = call_memmove(bcx, newptr, vptr, size).bcx; Store(bcx, fill, InBoundsGEP(bcx, newptr, [C_int(0), C_uint(abi::vec_elt_alloc)])); Store(bcx, newptr, vptrptr); ret bcx; } -fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t) - -> @block_ctxt { +fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t) -> + @block_ctxt { let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty); let vptr = Load(bcx, vptrptr); - let drop_cx = new_sub_block_ctxt(bcx, ~"drop"); - let next_cx = new_sub_block_ctxt(bcx, ~"next"); + let drop_cx = new_sub_block_ctxt(bcx, "drop"); + let next_cx = new_sub_block_ctxt(bcx, "next"); let null_test = IsNull(bcx, vptr); CondBr(bcx, null_test, next_cx.llbb, drop_cx.llbb); if ty::type_needs_drop(bcx_tcx(bcx), unit_ty) { @@ -92,10 +96,14 @@ fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t) ret next_cx; } -fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr], - id: ast::node_id) -> result { +fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr], id: ast::node_id) -> + result { let vec_ty = node_id_type(bcx_ccx(bcx), id); - let {bcx, val: vptr, llunitsz, unit_ty, llunitty} = + let {bcx: bcx, + val: vptr, + llunitsz: llunitsz, + unit_ty: unit_ty, + llunitty: llunitty} = alloc(bcx, vec_ty, vec::len(args)); // Store the individual elements. @@ -104,24 +112,24 @@ fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr], for e in args { let lv = trans_lval(bcx, e); bcx = lv.res.bcx; - let lleltptr = if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { - InBoundsGEP(bcx, dataptr, [Mul(bcx, C_uint(i), llunitsz)]) - } else { - InBoundsGEP(bcx, dataptr, [C_uint(i)]) - }; + let lleltptr = + if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { + InBoundsGEP(bcx, dataptr, [Mul(bcx, C_uint(i), llunitsz)]) + } else { InBoundsGEP(bcx, dataptr, [C_uint(i)]) }; bcx = move_val_if_temp(bcx, INIT, lleltptr, lv, unit_ty); i += 1u; } ret rslt(bcx, vptr); } -fn trans_istr(bcx: &@block_ctxt, s: istr) -> result { +fn trans_istr(bcx: &@block_ctxt, s: str) -> result { let veclen = std::str::byte_len(s) + 1u; // +1 for \0 - let {bcx, val: sptr, _} = + let {bcx: bcx, val: sptr, _} = alloc(bcx, ty::mk_istr(bcx_tcx(bcx)), veclen); let llcstr = C_cstr(bcx_ccx(bcx), s); - let bcx = call_memmove(bcx, get_dataptr(bcx, sptr, T_i8()), - llcstr, C_uint(veclen)).bcx; + let bcx = + call_memmove(bcx, get_dataptr(bcx, sptr, T_i8()), llcstr, + C_uint(veclen)).bcx; ret rslt(bcx, sptr); } @@ -135,12 +143,13 @@ fn trans_append(cx: &@block_ctxt, vec_ty: ty::t, lhsptr: ValueRef, lhsptr = PointerCast(cx, lhsptr, T_ptr(T_ptr(T_opaque_vec()))); rhs = PointerCast(cx, rhs, T_ptr(T_opaque_vec())); } - let strings = alt ty::struct(bcx_tcx(cx), vec_ty) { - ty::ty_istr. { true } - ty::ty_vec(_) { false } - }; + let strings = + alt ty::struct(bcx_tcx(cx), vec_ty) { + ty::ty_istr. { true } + ty::ty_vec(_) { false } + }; - let {bcx, val: unit_sz} = size_of(cx, unit_ty); + let {bcx: bcx, val: unit_sz} = size_of(cx, unit_ty); let llunitty = type_of_or_i8(cx, unit_ty); let lhs = Load(bcx, lhsptr); @@ -161,18 +170,23 @@ fn trans_append(cx: &@block_ctxt, vec_ty: ty::t, lhsptr: ValueRef, if strings { lhs_off = Sub(bcx, lhs_off, C_int(1)); } let write_ptr = pointer_add(bcx, lhs_data, lhs_off); let write_ptr_ptr = do_spill_noroot(bcx, write_ptr); - let bcx = iter_vec_raw(bcx, rhs, vec_ty, rfill, { | &bcx, addr, _ty | - let write_ptr = Load(bcx, write_ptr_ptr); - let bcx = copy_val(bcx, INIT, write_ptr, - load_if_immediate(bcx, addr, unit_ty), unit_ty); - if dynamic { - // We have to increment by the dynamically-computed size. - incr_ptr(bcx, write_ptr, unit_sz, write_ptr_ptr); - } else { - incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr); - } - ret bcx; - }); + let bcx = + iter_vec_raw(bcx, rhs, vec_ty, rfill, + // We have to increment by the dynamically-computed size. + {|&bcx, addr, _ty| + let write_ptr = Load(bcx, write_ptr_ptr); + let bcx = + copy_val(bcx, INIT, write_ptr, + load_if_immediate(bcx, addr, unit_ty), + unit_ty); + if dynamic { + incr_ptr(bcx, write_ptr, unit_sz, write_ptr_ptr); + } else { + incr_ptr(bcx, write_ptr, C_int(1), + write_ptr_ptr); + } + ret bcx; + }); ret rslt(bcx, C_nil()); } @@ -180,7 +194,7 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t, vals: &[@ast::expr]) -> @block_ctxt { let elt_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty); let ti = none; - let {bcx, val: td} = + let {bcx: bcx, val: td} = get_tydesc(bcx, elt_ty, false, tps_normal, ti).result; trans::lazily_emit_tydesc_glue(bcx, abi::tydesc_field_take_glue, ti); let opaque_v = PointerCast(bcx, vptrptr, T_ptr(T_ptr(T_opaque_vec()))); @@ -188,7 +202,8 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t, let {bcx: e_bcx, val: elt} = trans::trans_expr(bcx, val); bcx = e_bcx; let r = trans::spill_if_immediate(bcx, elt, elt_ty); - let spilled = r.val; bcx = r.bcx; + let spilled = r.val; + bcx = r.bcx; Call(bcx, bcx_ccx(bcx).upcalls.vec_push, [bcx.fcx.lltaskptr, opaque_v, td, PointerCast(bcx, spilled, T_ptr(T_i8()))]); @@ -196,40 +211,41 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t, ret bcx; } -fn trans_add(bcx: &@block_ctxt, vec_ty: ty::t, lhs: ValueRef, - rhs: ValueRef) -> result { - let strings = alt ty::struct(bcx_tcx(bcx), vec_ty) { - ty::ty_istr. { true } - ty::ty_vec(_) { false } - }; +fn trans_add(bcx: &@block_ctxt, vec_ty: ty::t, lhs: ValueRef, rhs: ValueRef) + -> result { + let strings = + alt ty::struct(bcx_tcx(bcx), vec_ty) { + ty::ty_istr. { true } + ty::ty_vec(_) { false } + }; let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty); let llunitty = type_of_or_i8(bcx, unit_ty); - let {bcx, val: llunitsz} = size_of(bcx, unit_ty); + let {bcx: bcx, val: llunitsz} = size_of(bcx, unit_ty); let lhs_fill = get_fill(bcx, lhs); if strings { lhs_fill = Sub(bcx, lhs_fill, C_int(1)); } let rhs_fill = get_fill(bcx, rhs); let new_fill = Add(bcx, lhs_fill, rhs_fill); - let {bcx, val: new_vec} = alloc_raw(bcx, new_fill, new_fill); + let {bcx: bcx, val: new_vec} = alloc_raw(bcx, new_fill, new_fill); let new_vec = PointerCast(bcx, new_vec, T_ptr(T_vec(llunitty))); add_clean_temp(bcx, new_vec, vec_ty); - let write_ptr_ptr = do_spill_noroot(bcx, - get_dataptr(bcx, new_vec, llunitty)); - let copy_fn = bind fn(bcx: &@block_ctxt, addr: ValueRef, _ty: ty::t, - write_ptr_ptr: ValueRef, unit_ty: ty::t, - llunitsz: ValueRef) -> @block_ctxt { - let write_ptr = Load(bcx, write_ptr_ptr); - let bcx = copy_val(bcx, INIT, write_ptr, - load_if_immediate(bcx, addr, unit_ty), unit_ty); - if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { - // We have to increment by the dynamically-computed size. - incr_ptr(bcx, write_ptr, llunitsz, write_ptr_ptr); - } else { - incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr); - } - ret bcx; - } (_, _, _, write_ptr_ptr, unit_ty, llunitsz); + let write_ptr_ptr = + do_spill_noroot(bcx, get_dataptr(bcx, new_vec, llunitty)); + let copy_fn = + bind fn (bcx: &@block_ctxt, addr: ValueRef, _ty: ty::t, + write_ptr_ptr: ValueRef, unit_ty: ty::t, llunitsz: ValueRef) + -> @block_ctxt { + let write_ptr = Load(bcx, write_ptr_ptr); + let bcx = + copy_val(bcx, INIT, write_ptr, + load_if_immediate(bcx, addr, unit_ty), unit_ty); + if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { + // We have to increment by the dynamically-computed size. + incr_ptr(bcx, write_ptr, llunitsz, write_ptr_ptr); + } else { incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr); } + ret bcx; + }(_, _, _, write_ptr_ptr, unit_ty, llunitsz); let bcx = iter_vec_raw(bcx, lhs, vec_ty, lhs_fill, copy_fn); let bcx = iter_vec_raw(bcx, rhs, vec_ty, rhs_fill, copy_fn); @@ -241,10 +257,10 @@ type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result; type iter_vec_block = block(&@block_ctxt, ValueRef, ty::t) -> @block_ctxt; fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t, - fill: ValueRef, f: &iter_vec_block) -> @block_ctxt { + fill: ValueRef, f: &iter_vec_block) -> @block_ctxt { let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty); let llunitty = type_of_or_i8(bcx, unit_ty); - let {bcx, val: unit_sz} = size_of(bcx, unit_ty); + let {bcx: bcx, val: unit_sz} = size_of(bcx, unit_ty); let vptr = PointerCast(bcx, vptr, T_ptr(T_vec(llunitty))); let data_ptr = get_dataptr(bcx, vptr, llunitty); @@ -255,18 +271,19 @@ fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t, let data_ptr_ptr = do_spill_noroot(bcx, data_ptr); // Now perform the iteration. - let header_cx = new_sub_block_ctxt(bcx, ~"iter_vec_loop_header"); + let header_cx = new_sub_block_ctxt(bcx, "iter_vec_loop_header"); Br(bcx, header_cx.llbb); let data_ptr = Load(header_cx, data_ptr_ptr); - let not_yet_at_end = ICmp(header_cx, lib::llvm::LLVMIntULT, - data_ptr, data_end_ptr); - let body_cx = new_sub_block_ctxt(bcx, ~"iter_vec_loop_body"); - let next_cx = new_sub_block_ctxt(bcx, ~"iter_vec_next"); + let not_yet_at_end = + ICmp(header_cx, lib::llvm::LLVMIntULT, data_ptr, data_end_ptr); + let body_cx = new_sub_block_ctxt(bcx, "iter_vec_loop_body"); + let next_cx = new_sub_block_ctxt(bcx, "iter_vec_next"); CondBr(header_cx, not_yet_at_end, body_cx.llbb, next_cx.llbb); body_cx = f(body_cx, data_ptr, unit_ty); - let increment = if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { - unit_sz - } else { C_int(1) }; + let increment = + if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { + unit_sz + } else { C_int(1) }; incr_ptr(body_cx, data_ptr, increment, data_ptr_ptr); Br(body_cx, header_cx.llbb); @@ -274,9 +291,9 @@ fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t, } fn iter_vec(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t, - f: &iter_vec_block) -> @block_ctxt { - let vptr = Load(bcx, PointerCast(bcx, vptrptr, - T_ptr(T_ptr(T_opaque_vec())))); + f: &iter_vec_block) -> @block_ctxt { + let vptr = + Load(bcx, PointerCast(bcx, vptrptr, T_ptr(T_ptr(T_opaque_vec())))); ret iter_vec_raw(bcx, vptr, vec_ty, get_fill(bcx, vptr), f); } diff --git a/src/comp/middle/tstate/ann.rs b/src/comp/middle/tstate/ann.rs index d8d495d11a2..f88d803b7bf 100644 --- a/src/comp/middle/tstate/ann.rs +++ b/src/comp/middle/tstate/ann.rs @@ -239,8 +239,8 @@ fn implies(a: t, b: t) -> bool { ret tritv_doesntcare(tmp); } -fn trit_str(t: trit) -> istr { - alt t { dont_care. { ~"?" } ttrue. { ~"1" } tfalse. { ~"0" } } +fn trit_str(t: trit) -> str { + alt t { dont_care. { "?" } ttrue. { "1" } tfalse. { "0" } } } // // Local Variables: diff --git a/src/comp/middle/tstate/annotate.rs b/src/comp/middle/tstate/annotate.rs index 0be3d1776ba..5a97d6bc0ae 100644 --- a/src/comp/middle/tstate/annotate.rs +++ b/src/comp/middle/tstate/annotate.rs @@ -32,12 +32,12 @@ fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += [b.node.id]; } fn collect_ids_stmt(s: &@stmt, rs: @mutable [node_id]) { alt s.node { stmt_decl(_, id) { - log ~"node_id " + int::str(id); + log "node_id " + int::str(id); log_stmt(*s);; *rs += [id]; } stmt_expr(_, id) { - log ~"node_id " + int::str(id); + log "node_id " + int::str(id); log_stmt(*s);; *rs += [id]; } @@ -62,7 +62,7 @@ fn node_ids_in_fn(f: &_fn, tps: &[ty_param], sp: &span, i: &fn_ident, fn init_vecs(ccx: &crate_ctxt, node_ids: &[node_id], len: uint) { for i: node_id in node_ids { - log int::str(i) + ~" |-> " + uint::str(len); + log int::str(i) + " |-> " + uint::str(len); add_node(ccx, i, empty_ann(len)); } } diff --git a/src/comp/middle/tstate/auxiliary.rs b/src/comp/middle/tstate/auxiliary.rs index 62c883eb9f8..65015b4fea1 100644 --- a/src/comp/middle/tstate/auxiliary.rs +++ b/src/comp/middle/tstate/auxiliary.rs @@ -55,17 +55,17 @@ tag oper_type { } /* logging funs */ -fn def_id_to_str(d: def_id) -> istr { - ret int::str(d.crate) + ~"," + int::str(d.node); +fn def_id_to_str(d: def_id) -> str { + ret int::str(d.crate) + "," + int::str(d.node); } -fn comma_str(args: &[@constr_arg_use]) -> istr { - let rslt = ~""; +fn comma_str(args: &[@constr_arg_use]) -> str { + let rslt = ""; let comma = false; for a: @constr_arg_use in args { - if comma { rslt += ~", "; } else { comma = true; } + if comma { rslt += ", "; } else { comma = true; } alt a.node { - carg_base. { rslt += ~"*"; } + carg_base. { rslt += "*"; } carg_ident(i) { rslt += i.ident; } carg_lit(l) { rslt += lit_to_str(l); } } @@ -73,30 +73,28 @@ fn comma_str(args: &[@constr_arg_use]) -> istr { ret rslt; } -fn constraint_to_str(tcx: &ty::ctxt, c: &sp_constr) -> istr { +fn constraint_to_str(tcx: &ty::ctxt, c: &sp_constr) -> str { alt c.node { ninit(_, i) { - ret ~"init(" + i + ~" [" + - tcx.sess.span_str(c.span) + ~"])"; + ret "init(" + i + " [" + tcx.sess.span_str(c.span) + "])"; } npred(p, _, args) { - ret path_to_str(p) + ~"(" + - comma_str(args) + ~")" + ~"[" + - tcx.sess.span_str(c.span) + ~"]"; + ret path_to_str(p) + "(" + comma_str(args) + ")" + "[" + + tcx.sess.span_str(c.span) + "]"; } } } -fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> istr { - let s = ~""; +fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> str { + let s = ""; let comma = false; for p: norm_constraint in constraints(fcx) { alt tritv_get(v, p.bit_num) { dont_care. { } t { s += - if comma { ~", " } else { comma = true; ~"" } + - if t == tfalse { ~"!" } else { ~"" } + + if comma { ", " } else { comma = true; "" } + + if t == tfalse { "!" } else { "" } + constraint_to_str(fcx.ccx.tcx, p.c); } } @@ -107,8 +105,8 @@ fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> istr { fn log_tritv(fcx: &fn_ctxt, v: &tritv::t) { log tritv_to_str(fcx, v); } fn first_difference_string(fcx: &fn_ctxt, expected: &tritv::t, - actual: &tritv::t) -> istr { - let s: istr = ~""; + actual: &tritv::t) -> str { + let s: str = ""; for c: norm_constraint in constraints(fcx) { if tritv_get(expected, c.bit_num) == ttrue && tritv_get(actual, c.bit_num) != ttrue { @@ -120,12 +118,12 @@ fn first_difference_string(fcx: &fn_ctxt, expected: &tritv::t, fn log_tritv_err(fcx: fn_ctxt, v: tritv::t) { log_err tritv_to_str(fcx, v); } -fn tos(v: &[uint]) -> istr { - let rslt = ~""; +fn tos(v: &[uint]) -> str { + let rslt = ""; for i: uint in v { if i == 0u { - rslt += ~"0"; - } else if i == 1u { rslt += ~"1"; } else { rslt += ~"?"; } + rslt += "0"; + } else if i == 1u { rslt += "1"; } else { rslt += "?"; } } ret rslt; } @@ -170,11 +168,11 @@ fn log_states_err(pp: &pre_and_post_state) { log_cond_err(p2); } -fn print_ident(i: &ident) { log ~" " + i + ~" "; } +fn print_ident(i: &ident) { log " " + i + " "; } fn print_idents(idents: &mutable [ident]) { if vec::len::<ident>(idents) == 0u { ret; } - log ~"an ident: " + vec::pop::<ident>(idents); + log "an ident: " + vec::pop::<ident>(idents); print_idents(idents); } @@ -272,15 +270,15 @@ So we need context. And so it seems clearer to just have separate constraints. */ type fn_info = + /* list, accumulated during pre/postcondition + computation, of all local variables that may be + used */ + // Doesn't seem to work without the @ -- bug {constrs: constr_map, num_constraints: uint, cf: controlflow, i_return: tsconstr, i_diverge: tsconstr, - /* list, accumulated during pre/postcondition - computation, of all local variables that may be - used */ - // Doesn't seem to work without the @ -- bug used_vars: @mutable [node_id]}; fn tsconstr_to_def_id(t: &tsconstr) -> def_id { @@ -330,8 +328,7 @@ fn get_ts_ann(ccx: &crate_ctxt, i: node_id) -> option::t<ts_ann> { fn node_id_to_ts_ann(ccx: &crate_ctxt, id: node_id) -> ts_ann { alt get_ts_ann(ccx, id) { none. { - log_err ~"node_id_to_ts_ann: no ts_ann for node_id " - + int::str(id); + log_err "node_id_to_ts_ann: no ts_ann for node_id " + int::str(id); fail; } some(t) { ret t; } @@ -533,8 +530,7 @@ fn constraints_expr(cx: &ty::ctxt, e: @expr) -> [@ty::constr] { fn node_id_to_def_strict(cx: &ty::ctxt, id: node_id) -> def { alt cx.def_map.find(id) { none. { - log_err ~"node_id_to_def: node_id " - + int::str(id) + ~" has no def"; + log_err "node_id_to_def: node_id " + int::str(id) + " has no def"; fail; } some(d) { ret d; } @@ -579,26 +575,23 @@ fn constraints(fcx: &fn_ctxt) -> [norm_constraint] { // should freeze it at some earlier point. fn match_args(fcx: &fn_ctxt, occs: &@mutable [pred_args], occ: &[@constr_arg_use]) -> uint { - log ~"match_args: looking at " + - constr_args_to_str(fn (i: &inst) -> istr { - ret i.ident; - }, occ); + log "match_args: looking at " + + constr_args_to_str(fn (i: &inst) -> str { ret i.ident; }, occ); for pd: pred_args in *occs { - log ~"match_args: candidate " + pred_args_to_str(pd); + log "match_args: candidate " + pred_args_to_str(pd); fn eq(p: &inst, q: &inst) -> bool { ret p.node == q.node; } if ty::args_eq(eq, pd.node.args, occ) { ret pd.node.bit_num; } } - fcx.ccx.tcx.sess.bug(~"match_args: no match for occurring args"); + fcx.ccx.tcx.sess.bug("match_args: no match for occurring args"); } fn def_id_for_constr(tcx: ty::ctxt, t: node_id) -> def_id { alt tcx.def_map.find(t) { none. { - tcx.sess.bug(~"node_id_for_constr: bad node_id " - + int::str(t)); + tcx.sess.bug("node_id_for_constr: bad node_id " + int::str(t)); } some(def_fn(i, _)) { ret i; } - _ { tcx.sess.bug(~"node_id_for_constr: pred is not a function"); } + _ { tcx.sess.bug("node_id_for_constr: pred is not a function"); } } } @@ -612,12 +605,11 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use { carg_ident({ident: p.node.idents[0], node: id.node})); } some(_) { - tcx.sess.bug(~"exprs_to_constr_args: non-local variable " + - ~"as pred arg"); + tcx.sess.bug("exprs_to_constr_args: non-local variable " + + "as pred arg"); } none { - tcx.sess.bug(~"exprs_to_constr_args: NONE " + - ~"as pred arg"); + tcx.sess.bug("exprs_to_constr_args: NONE " + "as pred arg"); } } @@ -625,8 +617,8 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use { expr_lit(l) { ret @respan(e.span, carg_lit(l)); } _ { tcx.sess.span_fatal(e.span, - ~"Arguments to constrained functions must be " + - ~"literals or local variables"); + "Arguments to constrained functions must be " + + "literals or local variables"); } } } @@ -649,25 +641,23 @@ fn expr_to_constr(tcx: ty::ctxt, e: &@expr) -> sp_constr { } _ { tcx.sess.span_fatal(operator.span, - ~"Internal error: " + - ~" ill-formed operator \ + "Internal error: " + + " ill-formed operator \ in predicate"); } } } _ { tcx.sess.span_fatal(e.span, - ~"Internal error: " + ~" ill-formed predicate"); + "Internal error: " + " ill-formed predicate"); } } } -fn pred_args_to_str(p: &pred_args) -> istr { - ~"<" + uint::str(p.node.bit_num) + ~", " + - constr_args_to_str(fn (i: &inst) -> istr { - ret i.ident; - }, p.node.args) - + ~">" +fn pred_args_to_str(p: &pred_args) -> str { + "<" + uint::str(p.node.bit_num) + ", " + + constr_args_to_str(fn (i: &inst) -> str { ret i.ident; }, p.node.args) + + ">" } fn substitute_constr_args(cx: &ty::ctxt, actuals: &[@expr], c: &@ty::constr) @@ -687,7 +677,7 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) -> if i < num_actuals { ret expr_to_constr_arg(cx, actuals[i]); } else { - cx.sess.span_fatal(a.span, ~"Constraint argument out of bounds"); + cx.sess.span_fatal(a.span, "Constraint argument out of bounds"); } } carg_base. { ret @respan(a.span, carg_base); } @@ -766,18 +756,18 @@ fn find_in_subst_bool(s: &subst, id: node_id) -> bool { is_some(find_in_subst(id, s)) } -fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> istr { - let rslt = ~"<"; +fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> str { + let rslt = "<"; for i: constr_arg_general_<inst> in stuff { rslt += - ~" " + + " " + alt i { carg_ident(p) { p.ident } - carg_base. { ~"*" } - carg_lit(_) { ~"[lit]" } - } + ~" "; + carg_base. { "*" } + carg_lit(_) { "[lit]" } + } + " "; } - rslt += ~">"; + rslt += ">"; rslt } @@ -814,7 +804,7 @@ fn replace(subst: subst, d: pred_args) -> [constr_arg_general_<inst>] { fn path_to_ident(cx: &ty::ctxt, p: &path) -> ident { alt vec::last(p.node.idents) { - none. { cx.sess.span_fatal(p.span, ~"Malformed path"); } + none. { cx.sess.span_fatal(p.span, "Malformed path"); } some(i) { ret i; } } } @@ -829,13 +819,13 @@ fn local_node_id_to_def_id_strict(fcx: &fn_ctxt, sp: &span, i: &node_id) -> } some(_) { fcx.ccx.tcx.sess.span_fatal(sp, - ~"local_node_id_to_def_id: id \ + "local_node_id_to_def_id: id \ isn't a local"); } none. { // should really be bug. span_bug()? fcx.ccx.tcx.sess.span_fatal(sp, - ~"local_node_id_to_def_id: id \ + "local_node_id_to_def_id: id \ is unbound"); } } @@ -848,7 +838,9 @@ fn local_node_id_to_def(fcx: &fn_ctxt, i: &node_id) -> option::t<def> { fn local_node_id_to_def_id(fcx: &fn_ctxt, i: &node_id) -> option::t<def_id> { alt local_node_id_to_def(fcx, i) { some(def_local(id)) | some(def_arg(id, _)) | some(def_binding(id)) | - some(def_upvar(id, _, _)) { some(id) } + some(def_upvar(id, _, _)) { + some(id) + } _ { none } } } @@ -1048,23 +1040,27 @@ fn do_nothing<T>(_f: &_fn, _tp: &[ty_param], _sp: &span, _i: &fn_ident, fn args_to_constr_args(tcx: &ty::ctxt, args: &[arg], - indices:&[@sp_constr_arg<uint>]) -> [@constr_arg_use] { + indices: &[@sp_constr_arg<uint>]) -> + [@constr_arg_use] { let actuals: [@constr_arg_use] = []; let num_args = vec::len(args); - for a:@sp_constr_arg<uint> in indices { - actuals += [@respan(a.span, alt a.node { - carg_base. { carg_base } - carg_ident(i) { - if i < num_args { - carg_ident({ident: args[i].ident, node:args[i].id}) - } - else { - tcx.sess.span_bug(a.span, ~"Index out of bounds in \ + for a: @sp_constr_arg<uint> in indices { + actuals += + [@respan(a.span, + alt a.node { + carg_base. { carg_base } + carg_ident(i) { + if i < num_args { + carg_ident({ident: args[i].ident, + node: args[i].id}) + } else { + tcx.sess.span_bug(a.span, + "Index out of bounds in \ constraint arg"); - } - } - carg_lit(l) { carg_lit(l) } - })]; + } + } + carg_lit(l) { carg_lit(l) } + })]; } ret actuals; } @@ -1073,7 +1069,7 @@ fn ast_constr_to_ts_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) -> tsconstr { let tconstr = ty::ast_constr_to_constr(tcx, c); ret npred(tconstr.node.path, tconstr.node.id, - args_to_constr_args(tcx, args, tconstr.node.args)); + args_to_constr_args(tcx, args, tconstr.node.args)); } fn ast_constr_to_sp_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) -> @@ -1109,9 +1105,8 @@ fn callee_modes(fcx: &fn_ctxt, callee: node_id) -> [ty::mode] { } _ { // Shouldn't happen; callee should be ty_fn. - fcx.ccx.tcx.sess.bug( - ~"non-fn callee type in callee_modes: " + - util::ppaux::ty_to_str(fcx.ccx.tcx, ty)); + fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: " + + util::ppaux::ty_to_str(fcx.ccx.tcx, ty)); } } } diff --git a/src/comp/middle/tstate/bitvectors.rs b/src/comp/middle/tstate/bitvectors.rs index 208f984660a..8c37df3cec4 100644 --- a/src/comp/middle/tstate/bitvectors.rs +++ b/src/comp/middle/tstate/bitvectors.rs @@ -36,8 +36,8 @@ fn bit_num(fcx: &fn_ctxt, c: &tsconstr) -> uint { alt rslt { cinit(n, _, _) { ret n; } _ { - fcx.ccx.tcx.sess.bug(~"bit_num: asked for init constraint," + - ~" found a pred constraint"); + fcx.ccx.tcx.sess.bug("bit_num: asked for init constraint," + + " found a pred constraint"); } } } @@ -45,8 +45,8 @@ fn bit_num(fcx: &fn_ctxt, c: &tsconstr) -> uint { alt rslt { cpred(_, descs) { ret match_args(fcx, descs, args); } _ { - fcx.ccx.tcx.sess.bug(~"bit_num: asked for pred constraint," + - ~" found an init constraint"); + fcx.ccx.tcx.sess.bug("bit_num: asked for pred constraint," + + " found an init constraint"); } } } @@ -205,12 +205,12 @@ fn clear_in_poststate_expr(fcx: &fn_ctxt, e: &@expr, t: &poststate) { } some(_) {/* ignore args (for now...) */ } _ { - fcx.ccx.tcx.sess.bug(~"clear_in_poststate_expr: \ + fcx.ccx.tcx.sess.bug("clear_in_poststate_expr: \ unbound var"); } } } - _ { fcx.ccx.tcx.sess.bug(~"clear_in_poststate_expr"); } + _ { fcx.ccx.tcx.sess.bug("clear_in_poststate_expr"); } } } _ {/* do nothing */ } diff --git a/src/comp/middle/tstate/ck.rs b/src/comp/middle/tstate/ck.rs index cef36843ea6..8348fc27409 100644 --- a/src/comp/middle/tstate/ck.rs +++ b/src/comp/middle/tstate/ck.rs @@ -55,9 +55,7 @@ fn check_unused_vars(fcx: &fn_ctxt) { ninit(id, v) { if !vec_contains(fcx.enclosing.used_vars, id) && v[0] != '_' as u8 { - fcx.ccx.tcx.sess.span_warn(c.c.span, - ~"unused variable " - + v); + fcx.ccx.tcx.sess.span_warn(c.c.span, "unused variable " + v); } } _ {/* ignore pred constraints */ } @@ -82,15 +80,15 @@ fn check_states_expr(e: &@expr, fcx: &fn_ctxt, v: &visit::vt<fn_ctxt>) { */ if !implies(pres, prec) { - let s = ~""; + let s = ""; let diff = first_difference_string(fcx, prec, pres); s += - ~"Unsatisfied precondition constraint (for example, " + diff + - ~") for expression:\n"; + "Unsatisfied precondition constraint (for example, " + diff + + ") for expression:\n"; s += syntax::print::pprust::expr_to_str(e); - s += ~"\nPrecondition:\n"; + s += "\nPrecondition:\n"; s += tritv_to_str(fcx, prec); - s += ~"\nPrestate:\n"; + s += "\nPrestate:\n"; s += tritv_to_str(fcx, pres); fcx.ccx.tcx.sess.span_fatal(e.span, s); } @@ -114,15 +112,15 @@ fn check_states_stmt(s: &@stmt, fcx: &fn_ctxt, v: &visit::vt<fn_ctxt>) { */ if !implies(pres, prec) { - let ss = ~""; + let ss = ""; let diff = first_difference_string(fcx, prec, pres); ss += - ~"Unsatisfied precondition constraint (for example, " + diff + - ~") for statement:\n"; + "Unsatisfied precondition constraint (for example, " + diff + + ") for statement:\n"; ss += syntax::print::pprust::stmt_to_str(*s); - ss += ~"\nPrecondition:\n"; + ss += "\nPrecondition:\n"; ss += tritv_to_str(fcx, prec); - ss += ~"\nPrestate: \n"; + ss += "\nPrestate: \n"; ss += tritv_to_str(fcx, pres); fcx.ccx.tcx.sess.span_fatal(s.span, ss); } @@ -150,14 +148,12 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn, !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) && f.decl.cf == return { fcx.ccx.tcx.sess.span_err(f.body.span, - ~"In function " + - fcx.name + - ~", not all control paths \ + "In function " + fcx.name + + ", not all control paths \ return a value"); - fcx.ccx.tcx.sess.span_fatal( - f.decl.output.span, - ~"see declared return type of '" + - ty_to_str(f.decl.output) + ~"'"); + fcx.ccx.tcx.sess.span_fatal(f.decl.output.span, + "see declared return type of '" + + ty_to_str(f.decl.output) + "'"); } else if f.decl.cf == noreturn { // check that this really always fails @@ -166,9 +162,9 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn, if !promises(fcx, post, fcx.enclosing.i_diverge) { fcx.ccx.tcx.sess.span_fatal(f.body.span, - ~"In non-returning function " + + "In non-returning function " + fcx.name + - ~", some control paths may \ + ", some control paths may \ return to the caller"); } } @@ -197,11 +193,8 @@ fn fn_states(f: &_fn, tps: &[ast::ty_param], sp: &span, i: &fn_ident, assert (ccx.fm.contains_key(id)); let f_info = ccx.fm.get(id); - let name = option::from_maybe(~"anon", i); - let fcx = {enclosing: f_info, - id: id, - name: name, - ccx: ccx}; + let name = option::from_maybe("anon", i); + let fcx = {enclosing: f_info, id: id, name: name, ccx: ccx}; check_fn_states(fcx, f, tps, id, sp, i); } diff --git a/src/comp/middle/tstate/collect_locals.rs b/src/comp/middle/tstate/collect_locals.rs index 4c6ce536d7d..bac29c049da 100644 --- a/src/comp/middle/tstate/collect_locals.rs +++ b/src/comp/middle/tstate/collect_locals.rs @@ -18,7 +18,7 @@ type ctxt = {cs: @mutable [sp_constr], tcx: ty::ctxt}; fn collect_local(loc: &@local, cx: &ctxt, v: &visit::vt<ctxt>) { for each p: @pat in pat_bindings(loc.node.pat) { let ident = alt p.node { pat_bind(id) { id } }; - log ~"collect_local: pushing " + ident;; + log "collect_local: pushing " + ident;; *cx.cs += [respan(loc.span, ninit(p.id, ident))]; } visit::visit_local(loc, cx, v); @@ -30,6 +30,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) { expr_if_check(ex, _, _) { *cx.cs += [expr_to_constr(cx.tcx, ex)]; } + // If it's a call, generate appropriate instances of the // call's constraints. expr_call(operator, operands) { @@ -61,8 +62,7 @@ fn find_locals(tcx: &ty::ctxt, f: &_fn, tps: &[ty_param], sp: &span, fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map) -> uint { - log constraint_to_str(tcx, c) + ~" |-> " - + std::uint::str(next); + log constraint_to_str(tcx, c) + " |-> " + std::uint::str(next); alt c.node { ninit(id, i) { tbl.insert(local_def(id), cinit(next, c.span, i)); } npred(p, d_id, args) { @@ -70,8 +70,8 @@ fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map) some(ct) { alt ct { cinit(_, _, _) { - tcx.sess.bug(~"add_constraint: same def_id used" + - ~" as a variable and a pred"); + tcx.sess.bug("add_constraint: same def_id used" + + " as a variable and a pred"); } cpred(_, pds) { *pds += [respan(c.span, {args: args, bit_num: next})]; @@ -130,7 +130,7 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span, // and the name of the function, with a '!' appended to it, for the // "diverges" constraint let diverges_id = ccx.tcx.sess.next_node_id(); - let diverges_name = name + ~"!"; + let diverges_name = name + "!"; add_constraint(cx.tcx, respan(f_sp, ninit(diverges_id, diverges_name)), next, res_map); @@ -147,9 +147,8 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span, i_diverge: ninit(diverges_id, diverges_name), used_vars: v}; ccx.fm.insert(id, rslt); - log name + ~" has " - + std::uint::str(num_constraints(rslt)) - + ~" constraints"; + log name + " has " + std::uint::str(num_constraints(rslt)) + + " constraints"; } diff --git a/src/comp/middle/tstate/pre_post_conditions.rs b/src/comp/middle/tstate/pre_post_conditions.rs index a7f38516125..ac96fb3cde9 100644 --- a/src/comp/middle/tstate/pre_post_conditions.rs +++ b/src/comp/middle/tstate/pre_post_conditions.rs @@ -69,11 +69,11 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) { {constrs: @new_def_hash::<constraint>(), num_constraints: 0u, cf: return, - i_return: ninit(0, ~""), - i_diverge: ninit(0, ~""), + i_return: ninit(0, ""), + i_diverge: ninit(0, ""), used_vars: v}, id: 0, - name: ~"", + name: "", ccx: ccx}; find_pre_post_expr(fake_fcx, e); } @@ -373,7 +373,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { let rslt = expr_pp(fcx.ccx, e); clear_pp(rslt); for def in *freevars::get_freevars(fcx.ccx.tcx, e.id) { - handle_var_def(fcx, rslt, def, ~"upvar"); + handle_var_def(fcx, rslt, def, "upvar"); } } expr_block(b) { @@ -481,7 +481,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { let rslt = expr_pp(fcx.ccx, e); clear_pp(rslt); for def in *freevars::get_freevars(fcx.ccx.tcx, body.node.id) { - handle_var_def(fcx, rslt, def, ~"upvar"); + handle_var_def(fcx, rslt, def, "upvar"); } } expr_index(val, sub) { find_pre_post_exprs(fcx, [val, sub], e.id); } @@ -545,6 +545,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { + expr_bind(operator, maybe_args) { let args = []; let cmodes = callee_modes(fcx, operator.id); @@ -563,7 +564,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { } expr_break. { clear_pp(expr_pp(fcx.ccx, e)); } expr_cont. { clear_pp(expr_pp(fcx.ccx, e)); } - expr_mac(_) { fcx.ccx.tcx.sess.bug(~"unexpanded macro"); } + expr_mac(_) { fcx.ccx.tcx.sess.bug("unexpanded macro"); } expr_anon_obj(anon_obj) { alt anon_obj.inner_obj { some(ex) { @@ -614,7 +615,7 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) { pat_bind(n) { n } _ { fcx.ccx.tcx.sess.span_bug(pat.span, - ~"Impossible LHS"); + "Impossible LHS"); } }; alt p { @@ -651,7 +652,7 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) { } _ { fcx.ccx.tcx.sess.span_bug(pat.span, - ~"Impossible LHS"); + "Impossible LHS"); } } } diff --git a/src/comp/middle/tstate/states.rs b/src/comp/middle/tstate/states.rs index a2d33039158..af14db2e9c8 100644 --- a/src/comp/middle/tstate/states.rs +++ b/src/comp/middle/tstate/states.rs @@ -358,7 +358,7 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> expr_log(_, ex) { ret find_pre_post_state_sub(fcx, pres, ex, e.id, none); } - expr_mac(_) { fcx.ccx.tcx.sess.bug(~"unexpanded macro"); } + expr_mac(_) { fcx.ccx.tcx.sess.bug("unexpanded macro"); } expr_put(maybe_e) { alt maybe_e { some(arg) { @@ -751,6 +751,7 @@ fn find_pre_post_state_fn(fcx: &fn_ctxt, f: &_fn) -> bool { // Treat the tail expression as a return statement alt f.body.node.expr { some(tailexpr) { + // We don't want to clear the diverges bit for bottom typed things, // which really do diverge. I feel like there is a cleaner way // to do this than checking the type. diff --git a/src/comp/middle/tstate/tritv.rs b/src/comp/middle/tstate/tritv.rs index 78245adc22c..60a724de524 100644 --- a/src/comp/middle/tstate/tritv.rs +++ b/src/comp/middle/tstate/tritv.rs @@ -55,6 +55,7 @@ fn trit_minus(a: trit, b: trit) -> trit { ttrue. { dont_care } tfalse. { ttrue } + /* internally contradictory, but I guess it'll get flagged? */ dont_care. { @@ -66,6 +67,7 @@ fn trit_minus(a: trit, b: trit) -> trit { alt b { ttrue. { tfalse } + /* see above comment */ _ { tfalse @@ -83,6 +85,7 @@ fn trit_or(a: trit, b: trit) -> trit { alt b { ttrue. { dont_care } + /* FIXME: ?????? */ _ { tfalse @@ -101,17 +104,20 @@ fn trit_and(a: trit, b: trit) -> trit { alt a { dont_care. { b } + // also seems wrong for case b = ttrue ttrue. { alt b { dont_care. { ttrue } + // ??? Seems wrong ttrue. { ttrue } + // false wins, since if something is uninit // on one path, we care // (Rationale: it's always safe to assume that @@ -124,6 +130,7 @@ fn trit_and(a: trit, b: trit) -> trit { } + // Rationale: if it's uninit on one path, // we can consider it as uninit on all paths tfalse. { @@ -261,15 +268,15 @@ fn to_vec(v: &t) -> [uint] { ret rslt; } -fn to_str(v: &t) -> istr { +fn to_str(v: &t) -> str { let i: uint = 0u; - let rs: istr = ~""; + let rs: str = ""; while i < v.nbits { rs += alt tritv_get(v, i) { - dont_care. { ~"?" } - ttrue. { ~"1" } - tfalse. { ~"0" } + dont_care. { "?" } + ttrue. { "1" } + tfalse. { "0" } }; i += 1u; } diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs index 5b3197b1bd8..bd5eef137e9 100644 --- a/src/comp/middle/ty.rs +++ b/src/comp/middle/ty.rs @@ -211,7 +211,7 @@ type ctxt = freevars: freevars::freevar_map, tcache: type_cache, rcache: creader_cache, - short_names_cache: hashmap<t, @istr>, + short_names_cache: hashmap<t, @str>, has_pointer_cache: hashmap<t, bool>, kind_cache: hashmap<t, ast::kind>, ast_ty_to_ty_cache: hashmap<@ast::ty, option::t<t>>}; @@ -230,7 +230,7 @@ fn method_ty_to_fn_ty(cx: &ctxt, m: method) -> t { // Never construct these manually. These are interned. type raw_t = {struct: sty, - cname: option::t<istr>, + cname: option::t<str>, hash: uint, has_params: bool, has_vars: bool}; @@ -401,16 +401,16 @@ fn mk_ctxt(s: session::session, dm: resolve::def_map, short_names_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty), has_pointer_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty), kind_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty), - ast_ty_to_ty_cache: map::mk_hashmap(ast_util::hash_ty, - ast_util::eq_ty)}; + ast_ty_to_ty_cache: + map::mk_hashmap(ast_util::hash_ty, ast_util::eq_ty)}; populate_type_store(cx); ret cx; } // Type constructors -fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<istr>) -> @raw_t { - let cname: option::t<istr> = none; +fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t { + let cname: option::t<str> = none; let h = hash_type_info(st, cname); let has_params: bool = false; let has_vars: bool = false; @@ -486,11 +486,11 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<istr>) -> @raw_t { has_vars: has_vars}; } -fn intern(cx: &ctxt, st: &sty, cname: &option::t<istr>) { +fn intern(cx: &ctxt, st: &sty, cname: &option::t<str>) { interner::intern(*cx.ts, mk_raw_ty(cx, st, cname)); } -fn gen_ty_full(cx: &ctxt, st: &sty, cname: &option::t<istr>) -> t { +fn gen_ty_full(cx: &ctxt, st: &sty, cname: &option::t<str>) -> t { let raw_type = mk_raw_ty(cx, st, cname); ret interner::intern(*cx.ts, raw_type); } @@ -559,8 +559,8 @@ fn mk_constr(cx: &ctxt, t: t, cs: &[@type_constr]) -> t { fn mk_tup(cx: &ctxt, ts: &[t]) -> t { ret gen_ty(cx, ty_tup(ts)); } -fn mk_fn(cx: &ctxt, proto: &ast::proto, args: &[arg], ty: t, - cf: &controlflow, constrs: &[@constr]) -> t { +fn mk_fn(cx: &ctxt, proto: &ast::proto, args: &[arg], ty: t, cf: &controlflow, + constrs: &[@constr]) -> t { ret gen_ty(cx, ty_fn(proto, args, ty, cf, constrs)); } @@ -590,13 +590,11 @@ fn mk_iter_body_fn(cx: &ctxt, output: t) -> t { } // Returns the one-level-deep type structure of the given type. -fn struct(cx: &ctxt, typ: t) -> sty { - ret interner::get(*cx.ts, typ).struct; -} +fn struct(cx: &ctxt, typ: t) -> sty { ret interner::get(*cx.ts, typ).struct; } // Returns the canonical name of the given type. -fn cname(cx: &ctxt, typ: t) -> option::t<istr> { +fn cname(cx: &ctxt, typ: t) -> option::t<str> { ret interner::get(*cx.ts, typ).cname; } @@ -771,7 +769,7 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { // Type utilities -fn rename(cx: &ctxt, typ: t, new_cname: &istr) -> t { +fn rename(cx: &ctxt, typ: t, new_cname: &str) -> t { ret gen_ty_full(cx, struct(cx, typ), some(new_cname)); } @@ -826,18 +824,14 @@ fn type_is_sequence(cx: &ctxt, ty: t) -> bool { } fn type_is_str(cx: &ctxt, ty: t) -> bool { - alt struct(cx, ty) { - ty_istr. { ret true; } - _ { ret false; } - } + alt struct(cx, ty) { ty_istr. { ret true; } _ { ret false; } } } fn sequence_element_type(cx: &ctxt, ty: t) -> t { alt struct(cx, ty) { ty_istr. { ret mk_mach(cx, ast::ty_u8); } ty_vec(mt) { ret mt.ty; } - _ { cx.sess.bug( - ~"sequence_element_type called on non-sequence value"); } + _ { cx.sess.bug("sequence_element_type called on non-sequence value"); } } } @@ -856,9 +850,8 @@ fn get_element_type(cx: &ctxt, ty: t, i: uint) -> t { ty_rec(flds) { ret flds[i].mt.ty; } ty_tup(ts) { ret ts[i]; } _ { - cx.sess.bug(~"get_element_type called on type " + - ty_to_str(cx, ty) + - ~" - expected a \ + cx.sess.bug("get_element_type called on type " + ty_to_str(cx, ty) + + " - expected a \ tuple or record"); } } @@ -871,18 +864,15 @@ fn type_is_box(cx: &ctxt, ty: t) -> bool { } fn type_is_boxed(cx: &ctxt, ty: t) -> bool { - alt struct(cx, ty) { - ty_box(_) { ret true; } - _ { ret false; } - } + alt struct(cx, ty) { ty_box(_) { ret true; } _ { ret false; } } } fn type_is_vec(cx: &ctxt, ty: t) -> bool { ret alt struct(cx, ty) { - ty_vec(_) { true } - ty_istr. { true } - _ { false } - }; + ty_vec(_) { true } + ty_istr. { true } + _ { false } + }; } fn type_is_unique(cx: &ctxt, ty: t) -> bool { @@ -890,7 +880,8 @@ fn type_is_unique(cx: &ctxt, ty: t) -> bool { ty_uniq(_) { ret true; } ty_vec(_) { true } ty_istr. { true } - _ { ret false; } } + _ { ret false; } + } } fn type_is_scalar(cx: &ctxt, ty: t) -> bool { @@ -917,8 +908,12 @@ fn type_has_pointers(cx: &ctxt, ty: t) -> bool { let result = false; alt struct(cx, ty) { + // scalar types - ty_nil. {/* no-op */ } + ty_nil. { + /* no-op */ + + } ty_bot. {/* no-op */ } ty_bool. {/* no-op */ } ty_int. {/* no-op */ } @@ -980,6 +975,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { alt struct(cx, ty) { + // Scalar types are unique-kind, no substructure. ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float. | ty_machine(_) | ty_char. | ty_native(_) { @@ -987,12 +983,14 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // A handful of other built-in are unique too. ty_type. | ty_istr. | ty_native_fn(_, _, _) { // no-op } + // FIXME: obj is broken for now, since we aren't asserting // anything about its fields. ty_obj(_) { @@ -1000,6 +998,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // FIXME: the environment capture mode is not fully encoded // here yet, leading to weirdness around closure. ty_fn(proto, _, _, _, _) { @@ -1012,6 +1011,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // Those with refcounts-to-inner raise pinned to shared, // lower unique to shared. Therefore just set result to shared. ty_box(mt) { @@ -1019,6 +1019,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // Pointers and unique boxes / vecs raise pinned to shared, // otherwise pass through their pointee kind. ty_ptr(tm) | ty_vec(tm) { @@ -1028,6 +1029,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // Records lower to the lowest of their members. ty_rec(flds) { for f: field in flds { @@ -1036,6 +1038,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } } + // Tuples lower to the lowest of their members. ty_tup(tys) { for ty: t in tys { @@ -1045,6 +1048,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // Tags lower to the lowest of their variants. ty_tag(did, tps) { let variants = tag_variants(cx, did); @@ -1060,29 +1064,34 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind { } + // Resources are always pinned. ty_res(did, inner, tps) { result = ast::kind_pinned; } + ty_var(_) { fail; } + ty_param(_, k) { result = kind::lower_kind(result, k); } + ty_constr(t, _) { result = type_kind(cx, t); } + _ { - cx.sess.bug(~"missed case: " + ty_to_str(cx, ty)); + cx.sess.bug("missed case: " + ty_to_str(cx, ty)); } } @@ -1098,8 +1107,8 @@ fn type_is_native(cx: &ctxt, ty: t) -> bool { alt struct(cx, ty) { ty_native(_) { ret true; } _ { ret false; } } } -fn type_structurally_contains(cx: &ctxt, ty: t, - test: fn(&sty) -> bool) -> bool { +fn type_structurally_contains(cx: &ctxt, ty: t, test: fn(&sty) -> bool) -> + bool { let sty = struct(cx, ty); if test(sty) { ret true; } alt sty { @@ -1209,6 +1218,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool { let result = true; alt struct(cx, ty) { + // Scalar types ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. | ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) { @@ -1216,6 +1226,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool { } + // Boxed types ty_istr. | ty_box(_) | ty_vec(_) | ty_fn(_, _, _, _, _) | ty_native_fn(_, _, _) | ty_obj(_) { @@ -1223,6 +1234,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool { } + // Structural types ty_tag(did, tps) { let variants = tag_variants(cx, did); @@ -1248,6 +1260,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool { ty_constr(subt, _) { result = type_is_pod(cx, subt); } + ty_var(_) { fail "ty_var in type_is_pod"; } @@ -1389,6 +1402,7 @@ fn hash_type_structure(st: &sty) -> uint { } + // ??? ty_fn(_, args, rty, _, _) { ret hash_fn(27u, args, rty); @@ -1419,7 +1433,7 @@ fn hash_type_structure(st: &sty) -> uint { } } -fn hash_type_info(st: &sty, cname_opt: &option::t<istr>) -> uint { +fn hash_type_info(st: &sty, cname_opt: &option::t<str>) -> uint { let h = hash_type_structure(st); alt cname_opt { none. {/* no-op */ } @@ -1511,10 +1525,9 @@ fn node_id_to_ty_param_substs_opt_and_ty(cx: &ctxt, id: &ast::node_id) -> // Pull out the node type table. alt smallintmap::find(*cx.node_types, id as uint) { none. { - cx.sess.bug(~"node_id_to_ty_param_substs_opt_and_ty() called on " + - ~"an untyped node (" + - std::int::to_str(id, 10u) + - ~")"); + cx.sess.bug("node_id_to_ty_param_substs_opt_and_ty() called on " + + "an untyped node (" + std::int::to_str(id, 10u) + + ")"); } some(tpot) { ret tpot; } } @@ -1589,21 +1602,21 @@ fn ty_fn_args(cx: &ctxt, fty: t) -> [arg] { alt struct(cx, fty) { ty::ty_fn(_, a, _, _, _) { ret a; } ty::ty_native_fn(_, a, _) { ret a; } - _ { cx.sess.bug(~"ty_fn_args() called on non-fn type"); } + _ { cx.sess.bug("ty_fn_args() called on non-fn type"); } } } fn ty_fn_proto(cx: &ctxt, fty: t) -> ast::proto { alt struct(cx, fty) { ty::ty_fn(p, _, _, _, _) { ret p; } - _ { cx.sess.bug(~"ty_fn_proto() called on non-fn type"); } + _ { cx.sess.bug("ty_fn_proto() called on non-fn type"); } } } fn ty_fn_abi(cx: &ctxt, fty: t) -> ast::native_abi { alt struct(cx, fty) { ty::ty_native_fn(a, _, _) { ret a; } - _ { cx.sess.bug(~"ty_fn_abi() called on non-native-fn type"); } + _ { cx.sess.bug("ty_fn_abi() called on non-native-fn type"); } } } @@ -1611,7 +1624,7 @@ fn ty_fn_ret(cx: &ctxt, fty: t) -> t { alt struct(cx, fty) { ty::ty_fn(_, _, r, _, _) { ret r; } ty::ty_native_fn(_, _, r) { ret r; } - _ { cx.sess.bug(~"ty_fn_ret() called on non-fn type"); } + _ { cx.sess.bug("ty_fn_ret() called on non-fn type"); } } } @@ -1625,7 +1638,7 @@ fn is_fn_ty(cx: &ctxt, fty: t) -> bool { // Just checks whether it's a fn that returns bool, // not its purity. -fn is_pred_ty(cx: &ctxt, fty:t) -> bool { +fn is_pred_ty(cx: &ctxt, fty: t) -> bool { is_fn_ty(cx, fty) && type_is_bool(cx, ty_fn_ret(cx, fty)) } @@ -1685,15 +1698,14 @@ fn field_idx(sess: &session::session, sp: &span, id: &ast::ident, fields: &[field]) -> uint { let i: uint = 0u; for f: field in fields { if str::eq(f.ident, id) { ret i; } i += 1u; } - sess.span_fatal(sp, ~"unknown field '" + - id + ~"' of record"); + sess.span_fatal(sp, "unknown field '" + id + "' of record"); } fn method_idx(sess: &session::session, sp: &span, id: &ast::ident, meths: &[method]) -> uint { let i: uint = 0u; for m: method in meths { if str::eq(m.ident, id) { ret i; } i += 1u; } - sess.span_fatal(sp, ~"unknown method '" + id + ~"' of obj"); + sess.span_fatal(sp, "unknown method '" + id + "' of obj"); } fn sort_methods(meths: &[method]) -> [method] { @@ -1729,12 +1741,11 @@ fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: t) -> // variables, so in this case we have to be sure to die. tcx.sess.span_fatal( s, - ~"Type inference failed because I \ + "Type inference failed because I \ could not find a type\n that's both of the form " + ty_to_str(tcx, ty::mk_var(tcx, vid)) + - ~" and of the form " + - ty_to_str(tcx, rt) + - ~". Such a type would have to be infinitely \ + " and of the form " + ty_to_str(tcx, rt) + + ". Such a type would have to be infinitely \ large."); } _ { ret true; } @@ -1927,9 +1938,9 @@ mod unify { let result_mode; if expected_input.mode != actual_input.mode { - ret fn_common_res_err( - ures_err(terr_mode_mismatch(expected_input.mode, - actual_input.mode))); + ret fn_common_res_err(ures_err( + terr_mode_mismatch(expected_input.mode, + actual_input.mode))); } else { result_mode = expected_input.mode; } let result = unify_step(cx, expected_input.ty, actual_input.ty); alt result { @@ -1956,6 +1967,7 @@ mod unify { alt expected_cf { ast::return. { } + // ok ast::noreturn. { alt actual_cf { @@ -2069,6 +2081,7 @@ mod unify { alt struct(cx.tcx, actual) { + // If the RHS is a variable type, then just do the // appropriate binding. ty::ty_var(actual_id) { @@ -2117,6 +2130,7 @@ mod unify { ty::ty_nil. { ret struct_cmp(cx, expected, actual); } + // _|_ unifies with anything ty::ty_bot. { ret ures_ok(actual); @@ -2410,7 +2424,7 @@ mod unify { fn dump_var_bindings(tcx: ty_ctxt, vb: @var_bindings) { let i = 0u; while i < vec::len::<ufind::node>(vb.sets.nodes) { - let sets = ~""; + let sets = ""; let j = 0u; while j < vec::len::<option::t<uint>>(vb.sets.nodes) { if ufind::find(vb.sets, j) == i { sets += #fmt[" %u", j]; } @@ -2418,10 +2432,8 @@ mod unify { } let typespec; alt smallintmap::find::<t>(vb.types, i) { - none. { typespec = ~""; } - some(typ) { - typespec = ~" =" + ty_to_str(tcx, typ); - } + none. { typespec = ""; } + some(typ) { typespec = " =" + ty_to_str(tcx, typ); } } log_err #fmt["set %u:%s%s", i, typespec, sets]; i += 1u; @@ -2478,54 +2490,49 @@ mod unify { } } -fn type_err_to_str(err: &ty::type_err) -> istr { +fn type_err_to_str(err: &ty::type_err) -> str { alt err { - terr_mismatch. { ret ~"types differ"; } + terr_mismatch. { ret "types differ"; } terr_controlflow_mismatch. { - ret ~"returning function used where non-returning function" + - ~" was expected"; + ret "returning function used where non-returning function" + + " was expected"; } - terr_box_mutability. { ret ~"boxed values differ in mutability"; } - terr_vec_mutability. { ret ~"vectors differ in mutability"; } + terr_box_mutability. { ret "boxed values differ in mutability"; } + terr_vec_mutability. { ret "vectors differ in mutability"; } terr_tuple_size(e_sz, a_sz) { - ret ~"expected a tuple with " + - uint::to_str(e_sz, 10u) + - ~" elements but found one with " + - uint::to_str(a_sz, 10u) + - ~" elements"; + ret "expected a tuple with " + uint::to_str(e_sz, 10u) + + " elements but found one with " + uint::to_str(a_sz, 10u) + + " elements"; } terr_record_size(e_sz, a_sz) { - ret ~"expected a record with " + - uint::to_str(e_sz, 10u) + - ~" fields but found one with " + - uint::to_str(a_sz, 10u) + - ~" fields"; + ret "expected a record with " + uint::to_str(e_sz, 10u) + + " fields but found one with " + uint::to_str(a_sz, 10u) + + " fields"; } - terr_record_mutability. { ret ~"record elements differ in mutability"; } + terr_record_mutability. { ret "record elements differ in mutability"; } terr_record_fields(e_fld, a_fld) { - ret ~"expected a record with field '" + e_fld + - ~"' but found one with field '" + a_fld + ~"'"; + ret "expected a record with field '" + e_fld + + "' but found one with field '" + a_fld + "'"; } - terr_arg_count. { ret ~"incorrect number of function parameters"; } - terr_meth_count. { ret ~"incorrect number of object methods"; } + terr_arg_count. { ret "incorrect number of function parameters"; } + terr_meth_count. { ret "incorrect number of object methods"; } terr_obj_meths(e_meth, a_meth) { - ret ~"expected an obj with method '" + e_meth + - ~"' but found one with method '" + a_meth + ~"'"; + ret "expected an obj with method '" + e_meth + + "' but found one with method '" + a_meth + "'"; } terr_mode_mismatch(e_mode, a_mode) { - ret ~"expected argument mode " + mode_str_1(e_mode) + ~" but found " + + ret "expected argument mode " + mode_str_1(e_mode) + " but found " + mode_str_1(a_mode); } terr_constr_len(e_len, a_len) { - ret ~"Expected a type with " + - uint::str(e_len) + - ~" constraints, but found one with " + - uint::str(a_len) + ~" constraints"; + ret "Expected a type with " + uint::str(e_len) + + " constraints, but found one with " + uint::str(a_len) + + " constraints"; } terr_constr_mismatch(e_constr, a_constr) { - ret ~"Expected a type with constraint " + ty_constr_to_str(e_constr) + - ~" but found one with constraint " + - ty_constr_to_str(a_constr); + ret "Expected a type with constraint " + ty_constr_to_str(e_constr) + + " but found one with constraint " + + ty_constr_to_str(a_constr); } } } @@ -2543,8 +2550,7 @@ fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int, typ: t, if index < vec::len(*param_var_ids) { ret mk_var(cx, param_var_ids[index]); } else { - cx.sess.span_fatal( - sp, ~"Unbound type parameter in callee's type"); + cx.sess.span_fatal(sp, "Unbound type parameter in callee's type"); } } let new_typ = @@ -2595,7 +2601,7 @@ fn tag_variants(cx: &ctxt, id: &ast::def_id) -> [variant_info] { let item = alt cx.items.find(id.node) { some(i) { i } - none. { cx.sess.bug(~"expected to find cached node_item") } + none. { cx.sess.bug("expected to find cached node_item") } }; alt item { ast_map::node_item(item) { @@ -2634,7 +2640,7 @@ fn tag_variant_with_id(cx: &ctxt, tag_id: &ast::def_id, if def_eq(variant.id, variant_id) { ret variant; } i += 1u; } - cx.sess.bug(~"tag_variant_with_id(): no variant exists with that ID"); + cx.sess.bug("tag_variant_with_id(): no variant exists with that ID"); } @@ -2662,8 +2668,8 @@ fn ret_ty_of_fn_ty(cx: ctxt, a_ty: t) -> t { ty::ty_fn(_, _, ret_ty, _, _) { ret ret_ty; } ty::ty_native_fn(_, _, ret_ty) { ret ret_ty; } _ { - cx.sess.bug(~"ret_ty_of_fn_ty() called on non-function type: " + - ty_to_str(cx, a_ty)); + cx.sess.bug("ret_ty_of_fn_ty() called on non-function type: " + + ty_to_str(cx, a_ty)); } } } @@ -2750,13 +2756,13 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool { /*. add, shift, bit . sub, rel, logic . mult, eq, */ - /*other*/ - /*bool*/ - /*int*/ - /*float*/ - /*str*/ - /*vec*/ - /*bot*/ + /*other*/ + /*bool*/ + /*int*/ + /*float*/ + /*str*/ + /*vec*/ + /*bot*/ let tbl = [[f, f, f, f, t, t, f, f], [f, f, f, f, t, t, t, t], [t, t, t, t, t, t, t, f], [t, t, t, f, t, t, f, f], @@ -2776,11 +2782,11 @@ fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) -> id: pred_id}); } _ { - tcx.sess.span_fatal(c.span, - ~"Predicate " + - path_to_str(c.node.path) + - ~" is unbound or bound to a non-function or an \ - impure function"); + tcx.sess.span_fatal( + c.span, + "Predicate " + path_to_str(c.node.path) + + " is unbound or bound to a non-function or an \ + impure function"); } } } diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs index daa6e5f368d..04c0160269f 100644 --- a/src/comp/middle/typeck.rs +++ b/src/comp/middle/typeck.rs @@ -88,7 +88,7 @@ fn lookup_local(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> int { some(x) { x } _ { fcx.ccx.tcx.sess.span_fatal(sp, - ~"internal error looking up a local var") + "internal error looking up a local var") } } } @@ -98,7 +98,7 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def { some(x) { x } _ { fcx.ccx.tcx.sess.span_fatal(sp, - ~"internal error looking up a definition") + "internal error looking up a definition") } } } @@ -106,7 +106,7 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def { fn ident_for_local(loc: &@ast::local) -> ast::ident { ret alt loc.node.pat.node { ast::pat_bind(name) { name } - _ { ~"local" } + _ { "local" } }; // FIXME DESTR } @@ -145,14 +145,14 @@ fn ty_param_kinds_and_ty_for_def(fcx: &@fn_ctxt, sp: &span, defn: &ast::def) ret {kinds: no_kinds, ty: ty::mk_nil(fcx.ccx.tcx)}; } ast::def_ty(_) { - fcx.ccx.tcx.sess.span_fatal(sp, ~"expected value but found type"); + fcx.ccx.tcx.sess.span_fatal(sp, "expected value but found type"); } ast::def_upvar(_, inner, _) { ret ty_param_kinds_and_ty_for_def(fcx, sp, *inner); } _ { // FIXME: handle other names. - fcx.ccx.tcx.sess.unimpl(~"definition variant"); + fcx.ccx.tcx.sess.unimpl("definition variant"); } } } @@ -175,15 +175,15 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path, if param_var_len == 0u { fcx.ccx.tcx.sess.span_fatal( sp, - ~"this item does not take type parameters"); + "this item does not take type parameters"); } else if ty_substs_len > param_var_len { fcx.ccx.tcx.sess.span_fatal( sp, - ~"too many type parameter provided for this item"); + "too many type parameter provided for this item"); } else if ty_substs_len < param_var_len { fcx.ccx.tcx.sess.span_fatal( sp, - ~"not enough type parameters provided for this item"); + "not enough type parameters provided for this item"); } let ty_substs: [ty::t] = []; let i = 0u; @@ -197,7 +197,7 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path, ty_substs_opt = some::<[ty::t]>(ty_substs); if ty_param_count == 0u { fcx.ccx.tcx.sess.span_fatal(sp, - ~"this item does not take type \ + "this item does not take type \ parameters"); } } else { @@ -229,7 +229,7 @@ fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) -> ty::t { fix_err(_) { fcx.ccx.tcx.sess.span_fatal( sp, - ~"the type of this value must be known in this context"); + "the type of this value must be known in this context"); } } } @@ -272,7 +272,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> some(some(ty)) { ret ty; } some(none.) { tcx.sess.span_fatal(ast_ty.span, - ~"illegal recursive type \ + "illegal recursive type \ insert a tag in the cycle, \ if this is desired)"); } @@ -307,7 +307,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> } if vec::len(param_bindings) != vec::len(ty_param_kinds_and_ty.kinds) { tcx.sess.span_fatal(sp, - ~"Wrong number of type arguments for a \ + "Wrong number of type arguments for a \ polymorphic type"); } let typ = @@ -316,7 +316,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> ret typ; } let typ; - let cname = none::<istr>; + let cname = none::<str>; alt ast_ty.node { ast::ty_nil. { typ = ty::mk_nil(tcx); } ast::ty_bot. { typ = ty::mk_bot(tcx); } @@ -370,11 +370,10 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> some(ast::def_ty_arg(id, k)) { typ = ty::mk_param(tcx, id, k); } some(_) { tcx.sess.span_fatal(ast_ty.span, - ~"found type name used as a variable"); + "found type name used as a variable"); } _ { - tcx.sess.span_fatal( - ast_ty.span, ~"internal error in instantiate"); + tcx.sess.span_fatal(ast_ty.span, "internal error in instantiate"); } } cname = some(path_to_str(path)); @@ -411,14 +410,12 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> typ = ty::mk_constr(tcx, ast_ty_to_ty(tcx, getter, t), out_cs); } ast::ty_infer. { - tcx.sess.span_bug(ast_ty.span, ~"found ty_infer in unexpected place"); + tcx.sess.span_bug(ast_ty.span, "found ty_infer in unexpected place"); } } alt cname { none. {/* no-op */ } - some(cname_str) { - typ = ty::rename(tcx, typ, cname_str); - } + some(cname_str) { typ = ty::rename(tcx, typ, cname_str); } } tcx.ast_ty_to_ty_cache.insert(ast_ty, some(typ)); ret typ; @@ -590,10 +587,7 @@ mod collect { some(ast_map::node_native_item(native_item)) { tpt = ty_of_native_item(cx, native_item, ast::native_abi_cdecl); } - _ { - cx.tcx.sess.fatal( - ~"internal error " + std::int::str(id.node)); - } + _ { cx.tcx.sess.fatal("internal error " + std::int::str(id.node)); } } ret tpt; } @@ -871,9 +865,9 @@ mod collect { let visit = visit::mk_simple_visitor(@{visit_item: bind convert(cx, abi, _), visit_native_item: - bind convert_native(cx, abi, _) - with - *visit::default_simple_visitor()}); + bind convert_native(cx, abi, _) + with + *visit::default_simple_visitor()}); visit::visit_crate(*crate, (), visit); } } @@ -965,14 +959,13 @@ mod demand { ty::t { full(fcx, sp, expected, actual, [], false).ty } - fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: ty::t, - actual: ty::t) -> ty::t { + fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: ty::t, actual: ty::t) + -> ty::t { full(fcx, sp, expected, actual, [], true).ty } - fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: ty::t, - actual: ty::t, ty_param_substs_0: &[ty::t]) -> - ty_param_substs_and_ty { + fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: ty::t, actual: ty::t, + ty_param_substs_0: &[ty::t]) -> ty_param_substs_and_ty { full(fcx, sp, expected, actual, ty_param_substs_0, false) } @@ -1013,14 +1006,12 @@ mod demand { ures_err(err) { let e_err = resolve_type_vars_if_possible(fcx, expected); let a_err = resolve_type_vars_if_possible(fcx, actual); - fcx.ccx.tcx.sess.span_err( - sp, - ~"mismatched types: expected " + - ty_to_str(fcx.ccx.tcx, e_err) + - ~" but found " + - ty_to_str(fcx.ccx.tcx, a_err) + ~" (" - + ty::type_err_to_str(err) - + ~")"); + fcx.ccx.tcx.sess.span_err(sp, + "mismatched types: expected " + + ty_to_str(fcx.ccx.tcx, e_err) + + " but found " + + ty_to_str(fcx.ccx.tcx, a_err) + " (" + + ty::type_err_to_str(err) + ")"); ret mk_result(fcx, expected, ty_param_subst_var_ids); } } @@ -1083,7 +1074,7 @@ mod writeback { fix_ok(new_type) { ret some(new_type); } fix_err(vid) { fcx.ccx.tcx.sess.span_err(sp, - ~"cannot determine a type \ + "cannot determine a type \ for this expression"); ret none; } @@ -1135,7 +1126,7 @@ mod writeback { resolve_type_vars_for_node(wbcx, e.span, input.id); } } - _ {} + _ { } } visit::visit_expr(e, wbcx, v); } @@ -1159,7 +1150,7 @@ mod writeback { fix_ok(lty) { write::ty_only(wbcx.fcx.ccx.tcx, l.node.id, lty); } fix_err(_) { wbcx.fcx.ccx.tcx.sess.span_err(l.span, - ~"cannot determine a type \ + "cannot determine a type \ for this local variable"); wbcx.success = false; } @@ -1381,10 +1372,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, #fmt["this pattern has %u field%s, but the \ corresponding variant has %u field%s", subpats_len, - if subpats_len == 1u { ~"" } else { ~"s" }, - arg_len, if arg_len == 1u { ~"" } else { ~"s" }]; - fcx.ccx.tcx.sess.span_fatal( - pat.span, s); + if subpats_len == 1u { "" } else { "s" }, + arg_len, if arg_len == 1u { "" } else { "s" }]; + fcx.ccx.tcx.sess.span_fatal(pat.span, s); } // TODO: vec::iter2 @@ -1401,10 +1391,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, #fmt["this pattern has %u field%s, \ but the corresponding \ variant has no fields", - subpats_len, - if subpats_len == 1u { - ~"" - } else { ~"s" }]); + subpats_len, + if subpats_len == 1u { + "" + } else { "s" }]); } write::ty_fixup(fcx, pat.id, path_tpot); } @@ -1414,7 +1404,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, fcx.ccx.tcx.sess.span_fatal( pat.span, #fmt["mismatched types: expected %s, found tag", - ty_to_str(fcx.ccx.tcx, expected)]); + ty_to_str(fcx.ccx.tcx, + expected)]); } } write::ty_fixup(fcx, pat.id, path_tpot); @@ -1427,7 +1418,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, fcx.ccx.tcx.sess.span_fatal( pat.span, #fmt["mismatched types: expected %s, found record", - ty_to_str(fcx.ccx.tcx, expected)]); + ty_to_str(fcx.ccx.tcx, + expected)]); } } let f_count = vec::len(fields); @@ -1438,9 +1430,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, #fmt["mismatched types: expected a record \ with %u fields, found one with %u \ fields", - ex_f_count, f_count]); + ex_f_count, f_count]); } - fn matches(name: &istr, f: &ty::field) -> bool { + fn matches(name: &str, f: &ty::field) -> bool { ret str::eq(name, f.ident); } for f: ast::field_pat in fields { @@ -1464,7 +1456,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, fcx.ccx.tcx.sess.span_fatal( pat.span, #fmt["mismatched types: expected %s, found tuple", - ty_to_str(fcx.ccx.tcx, expected)]); + ty_to_str(fcx.ccx.tcx, + expected)]); } } let e_count = vec::len(elts); @@ -1474,7 +1467,7 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, #fmt["mismatched types: expected a tuple \ with %u fields, found one with %u \ fields", - vec::len(ex_elts), e_count]); + vec::len(ex_elts), e_count]); } let i = 0u; for elt in elts { check_pat(fcx, map, elt, ex_elts[i]); i += 1u; } @@ -1487,11 +1480,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat, write::ty_only_fixup(fcx, pat.id, expected); } _ { - fcx.ccx.tcx.sess.span_fatal( - pat.span, - ~"mismatched types: expected " + - ty_to_str(fcx.ccx.tcx, expected) + - ~" found box"); + fcx.ccx.tcx.sess.span_fatal(pat.span, + "mismatched types: expected " + + ty_to_str(fcx.ccx.tcx, expected) + + " found box"); } } } @@ -1503,7 +1495,7 @@ fn require_impure(sess: &session::session, f_purity: &ast::purity, alt f_purity { ast::impure_fn. { ret; } ast::pure_fn. { - sess.span_fatal(sp, ~"Found impure expression in pure function decl"); + sess.span_fatal(sp, "Found impure expression in pure function decl"); } } } @@ -1518,7 +1510,7 @@ fn require_pure_call(ccx: @crate_ctxt, caller_purity: &ast::purity, _ { ccx.tcx.sess.span_fatal( sp, - ~"Pure function calls function not known to be pure"); + "Pure function calls function not known to be pure"); } } } @@ -1569,14 +1561,14 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, if call_kind != kind_for_each { fcx.ccx.tcx.sess.span_err( sp, - ~"calling iter outside of for each loop"); + "calling iter outside of for each loop"); } } _ { if call_kind == kind_for_each { fcx.ccx.tcx.sess.span_err( sp, - ~"calling non-iter as sequence of for each loop"); + "calling non-iter as sequence of for each loop"); } } } @@ -1589,12 +1581,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, arg_tys } _ { - fcx.ccx.tcx.sess.span_fatal( - f.span, - ~"mismatched types: \ + fcx.ccx.tcx.sess.span_fatal(f.span, + "mismatched types: \ expected function or native \ function but found " - + ty_to_str(fcx.ccx.tcx, fty)) + + ty_to_str(fcx.ccx.tcx, fty)) } }; @@ -1602,17 +1593,16 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let expected_arg_count = vec::len(arg_tys); let supplied_arg_count = vec::len(args); if expected_arg_count != supplied_arg_count { - fcx.ccx.tcx.sess.span_err( - sp, - #fmt["this function takes %u \ + fcx.ccx.tcx.sess.span_err(sp, + #fmt["this function takes %u \ parameter%s but %u parameter%s supplied", - expected_arg_count, - if expected_arg_count == 1u { - ~"" - } else { ~"s" }, supplied_arg_count, - if supplied_arg_count == 1u { - ~" was" - } else { ~"s were" }]); + expected_arg_count, + if expected_arg_count == 1u { + "" + } else { "s" }, supplied_arg_count, + if supplied_arg_count == 1u { + " was" + } else { "s were" }]); // HACK: build an arguments list with dummy arguments to // check against let dummy = {mode: ty::mo_val, ty: ty::mk_bot(fcx.ccx.tcx)}; @@ -1753,9 +1743,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let binopstr = ast_util::binop_to_str(binop); let t_str = ty_to_str(fcx.ccx.tcx, resolved_t); let errmsg = - ~"binary operation " + binopstr + - ~" cannot be applied to type `" + - t_str + ~"`"; + "binary operation " + binopstr + + " cannot be applied to type `" + t_str + "`"; fcx.ccx.tcx.sess.span_err(span, errmsg); } } @@ -1804,31 +1793,29 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, vec::len(variants[0].args) != 1u { tcx.sess.span_fatal( expr.span, - ~"can only dereference tags " + - ~"with a single variant which has a " - + ~"single argument"); + "can only dereference tags " + + "with a single variant which has a " + + "single argument"); } oper_t = ty::substitute_type_params(tcx, tps, variants[0].args[0]); } ty::ty_ptr(inner) { oper_t = inner.ty; } _ { - tcx.sess.span_fatal( - expr.span, - ~"dereferencing non-" + - ~"dereferenceable type: " + - ty_to_str(tcx, oper_t)); + tcx.sess.span_fatal(expr.span, + "dereferencing non-" + + "dereferenceable type: " + + ty_to_str(tcx, oper_t)); } } } ast::not. { if !type_is_integral(fcx, oper.span, oper_t) && structure_of(fcx, oper.span, oper_t) != ty::ty_bool { - tcx.sess.span_err( - expr.span, - #fmt["mismatched types: expected bool \ + tcx.sess.span_err(expr.span, + #fmt["mismatched types: expected bool \ or integer but found %s", - ty_to_str(tcx, oper_t)]); + ty_to_str(tcx, oper_t)]); } } ast::neg. { @@ -1836,9 +1823,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, if !(ty::type_is_integral(tcx, oper_t) || ty::type_is_fp(tcx, oper_t)) { tcx.sess.span_err(expr.span, - ~"applying unary minus to \ + "applying unary minus to \ non-numeric type " - + ty_to_str(tcx, oper_t)); + + ty_to_str(tcx, oper_t)); } } } @@ -1855,20 +1842,18 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, // supplied some, that's an error. if vec::len::<@ast::ty>(pth.node.types) > 0u { tcx.sess.span_fatal(expr.span, - ~"this kind of value does not \ + "this kind of value does not \ take type parameters"); } write::ty_only_fixup(fcx, id, tpt.ty); } } - ast::expr_mac(_) { tcx.sess.bug(~"unexpanded macro"); } + ast::expr_mac(_) { tcx.sess.bug("unexpanded macro"); } ast::expr_fail(expr_opt) { bot = true; alt expr_opt { none. {/* do nothing */ } - some(e) { - check_expr_with(fcx, e, ty::mk_istr(tcx)); - } + some(e) { check_expr_with(fcx, e, ty::mk_istr(tcx)); } } write::bot_ty(tcx, id); } @@ -1881,7 +1866,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let nil = ty::mk_nil(tcx); if !are_compatible(fcx, fcx.ret_ty, nil) { tcx.sess.span_err(expr.span, - ~"ret; in function returning non-nil"); + "ret; in function returning non-nil"); } } some(e) { check_expr_with(fcx, e, fcx.ret_ty); } @@ -1891,14 +1876,14 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, ast::expr_put(expr_opt) { require_impure(tcx.sess, fcx.purity, expr.span); if fcx.proto != ast::proto_iter { - tcx.sess.span_err(expr.span, ~"put in non-iterator"); + tcx.sess.span_err(expr.span, "put in non-iterator"); } alt expr_opt { none. { let nil = ty::mk_nil(tcx); if !are_compatible(fcx, fcx.ret_ty, nil) { tcx.sess.span_err(expr.span, - ~"put; in iterator yielding non-nil"); + "put; in iterator yielding non-nil"); } } some(e) { bot = check_expr_with(fcx, e, fcx.ret_ty); } @@ -1971,8 +1956,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, _ { tcx.sess.span_fatal( expr.span, - ~"mismatched types: expected vector or string but " - + ~"found " + ty_to_str(tcx, ety)); + "mismatched types: expected vector or string but " + + "found " + ty_to_str(tcx, ety)); } } bot |= check_for_or_for_each(fcx, decl, elt_ty, body, id); @@ -1986,7 +1971,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, } _ { tcx.sess.span_fatal(expr.span, - ~"sequence in for each loop not a call"); + "sequence in for each loop not a call"); } } bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq), body, id); @@ -2017,10 +2002,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let arm_non_bot = false; for arm: ast::arm in arms { alt arm.guard { - some(e) { - check_expr_with(fcx, e, ty::mk_bool(tcx)); - } - none. {} + some(e) { check_expr_with(fcx, e, ty::mk_bool(tcx)); } + none. { } } if !check_block(fcx, arm.body) { arm_non_bot = true; } let bty = block_ty(tcx, arm.body); @@ -2054,10 +2037,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, } ast::expr_block(b) { // If this is an unchecked block, turn off purity-checking - let fcx_for_block = alt b.node.rules { - ast::unchecked. { @{ purity: ast::impure_fn with *fcx } } - _ { fcx } - }; + let fcx_for_block = + alt b.node.rules { + ast::unchecked. { @{purity: ast::impure_fn with *fcx} } + _ { fcx } + }; bot = check_block(fcx_for_block, b); let typ = alt b.node.expr { @@ -2124,9 +2108,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, this_obj_sty = some(structure_of(fcx, expr.span, tpt.ty)); } none. { - tcx.sess.bug(~"didn't find " + - int::str(did.node) + - ~" in type cache"); + tcx.sess.bug("didn't find " + int::str(did.node) + + " in type cache"); } } } @@ -2135,7 +2118,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, } none. { // Shouldn't happen. - tcx.sess.span_err(expr.span, ~"self-call in non-object context"); + tcx.sess.span_err(expr.span, "self-call in non-object context"); } } @@ -2166,10 +2149,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, if !(type_is_scalar(fcx, expr.span, expr_ty(tcx, e)) && type_is_scalar(fcx, expr.span, t_1)) { tcx.sess.span_err(expr.span, - ~"non-scalar cast: " + - ty_to_str(tcx, expr_ty(tcx, e)) - + ~" as " + - ty_to_str(tcx, t_1)); + "non-scalar cast: " + + ty_to_str(tcx, expr_ty(tcx, e)) + " as " + + ty_to_str(tcx, t_1)); } write::ty_only_fixup(fcx, id, t_1); } @@ -2217,7 +2199,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, ty::ty_rec(flds) { base_fields = flds; } _ { tcx.sess.span_fatal(expr.span, - ~"record update has non-record base"); + "record update has non-record base"); } } write::ty_only_fixup(fcx, id, bexpr_t); @@ -2231,8 +2213,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, } if !found { tcx.sess.span_fatal(f.span, - ~"unknown field in record update: " + - f.node.ident); + "unknown field in record update: " + + f.node.ident); } } } @@ -2246,7 +2228,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, ty::ty_rec(fields) { let ix: uint = ty::field_idx(tcx.sess, expr.span, field, fields); if ix >= vec::len::<ty::field>(fields) { - tcx.sess.span_fatal(expr.span, ~"bad index on record"); + tcx.sess.span_fatal(expr.span, "bad index on record"); } write::ty_only_fixup(fcx, id, fields[ix].mt.ty); } @@ -2254,7 +2236,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let ix: uint = ty::method_idx(tcx.sess, expr.span, field, methods); if ix >= vec::len::<ty::method>(methods) { - tcx.sess.span_fatal(expr.span, ~"bad index on obj"); + tcx.sess.span_fatal(expr.span, "bad index on obj"); } let meth = methods[ix]; let t = @@ -2279,9 +2261,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, let idx_t = expr_ty(tcx, idx); if !type_is_integral(fcx, idx.span, idx_t) { tcx.sess.span_err(idx.span, - ~"mismatched types: expected \ + "mismatched types: expected \ integer but found " - + ty_to_str(tcx, idx_t)); + + ty_to_str(tcx, idx_t)); } alt structure_of(fcx, expr.span, base_t) { ty::ty_vec(mt) { write::ty_only_fixup(fcx, id, mt.ty); } @@ -2291,8 +2273,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, } _ { tcx.sess.span_fatal(expr.span, - ~"vector-indexing bad type: " + - ty_to_str(tcx, base_t)); + "vector-indexing bad type: " + + ty_to_str(tcx, base_t)); } } } @@ -2362,9 +2344,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, // The user is trying to extend a non-object. tcx.sess.span_fatal( e.span, - syntax::print::pprust::expr_to_str(e) + syntax::print::pprust::expr_to_str(e) + - ~" does not have object type"); + " does not have object type"); } } } @@ -2391,9 +2373,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, if new_type != m { ccx.tcx.sess.span_fatal( om.span, - ~"Attempted to override method " + "Attempted to override method " + m.ident + - ~" with one of a different type"); + " with one of a different type"); } ret none; } @@ -2435,7 +2417,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, check_expr_with(fcx, x, t); write::ty_only_fixup(fcx, id, ty::mk_uniq(tcx, t)); } - _ { tcx.sess.unimpl(~"expr type in typeck::check_expr"); } + _ { tcx.sess.unimpl("expr type in typeck::check_expr"); } } if bot { write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx)); } @@ -2468,8 +2450,8 @@ fn check_decl_local(fcx: &@fn_ctxt, local: &@ast::local) -> bool { alt fcx.locals.find(local.node.id) { none. { - fcx.ccx.tcx.sess.bug(~"check_decl_local: local id not found " + - ident_for_local(local)); + fcx.ccx.tcx.sess.bug("check_decl_local: local id not found " + + ident_for_local(local)); } some(i) { let t = ty::mk_var(fcx.ccx.tcx, i); @@ -2518,7 +2500,7 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool { } _ { false } } { - fcx.ccx.tcx.sess.span_warn(s.span, ~"unreachable statement"); + fcx.ccx.tcx.sess.span_warn(s.span, "unreachable statement"); warned = true; } bot |= check_stmt(fcx, s); @@ -2527,7 +2509,7 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool { none. { write::nil_ty(fcx.ccx.tcx, blk.node.id); } some(e) { if bot && !warned { - fcx.ccx.tcx.sess.span_warn(e.span, ~"unreachable expression"); + fcx.ccx.tcx.sess.span_warn(e.span, "unreachable expression"); } bot |= check_expr(fcx, e); let ety = expr_ty(fcx.ccx.tcx, e); @@ -2569,8 +2551,9 @@ fn check_pred_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool { alt e.node { ast::expr_call(operator, operands) { if !ty::is_pred_ty(fcx.ccx.tcx, expr_ty(fcx.ccx.tcx, operator)) { - fcx.ccx.tcx.sess.span_fatal(operator.span, - ~"Operator in constraint has non-boolean return type"); + fcx.ccx.tcx.sess.span_fatal( + operator.span, + "Operator in constraint has non-boolean return type"); } alt operator.node { @@ -2581,14 +2564,14 @@ fn check_pred_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool { } _ { fcx.ccx.tcx.sess.span_fatal(operator.span, - ~"Impure function as operator \ + "Impure function as operator \ in constraint"); } } for operand: @ast::expr in operands { if !ast_util::is_constraint_arg(operand) { let s = - ~"Constraint args must be \ + "Constraint args must be \ slot variables or literals"; fcx.ccx.tcx.sess.span_fatal(e.span, s); } @@ -2596,70 +2579,76 @@ slot variables or literals"; } _ { let s = - ~"In a constraint, expected the \ + "In a constraint, expected the \ constraint name to be an explicit name"; fcx.ccx.tcx.sess.span_fatal(e.span, s); } } } - _ { fcx.ccx.tcx.sess.span_fatal( - e.span, ~"check on non-predicate"); } + _ { fcx.ccx.tcx.sess.span_fatal(e.span, "check on non-predicate"); } } ret bot; } -fn check_constraints(fcx: &@fn_ctxt, cs: [@ast::constr], args:[ast::arg]) { +fn check_constraints(fcx: &@fn_ctxt, cs: [@ast::constr], args: [ast::arg]) { let c_args; let num_args = vec::len(args); for c: @ast::constr in cs { c_args = []; for a: @spanned<ast::fn_constr_arg> in c.node.args { - c_args += [@(alt a.node { - ast::carg_base. { - // "base" should not occur in a fn type thing, as of - // yet, b/c we don't allow constraints on the return type - - fcx.ccx.tcx.sess.span_bug(a.span, ~"check_constraints:\ + c_args += + [ + // "base" should not occur in a fn type thing, as of + // yet, b/c we don't allow constraints on the return type + + // Works b/c no higher-order polymorphism + /* + This is kludgy, and we probably shouldn't be assigning + node IDs here, but we're creating exprs that are + ephemeral, just for the purposes of typechecking. So + that's my justification. + */ + @alt a.node { + ast::carg_base. { + fcx.ccx.tcx.sess.span_bug(a.span, + "check_constraints:\ unexpected carg_base"); - } - ast::carg_lit(l) { - let tmp_node_id = fcx.ccx.tcx.sess.next_node_id(); - {id:tmp_node_id, node: ast::expr_lit(l), span:a.span} } - ast::carg_ident(i) { - if i < num_args { - let p : ast::path_ = - {global:false, idents:[(args[i]).ident], - // Works b/c no higher-order polymorphism - types:[]}; - /* - This is kludgy, and we probably shouldn't be assigning - node IDs here, but we're creating exprs that are - ephemeral, just for the purposes of typechecking. So - that's my justification. - */ - let arg_occ_node_id = fcx.ccx.tcx.sess.next_node_id(); - fcx.ccx.tcx.def_map.insert - (arg_occ_node_id, ast::def_arg(local_def(args[i].id), - args[i].mode)); - {id:arg_occ_node_id, - node: ast::expr_path(respan(a.span, p)), - span:a.span} - } - else { - fcx.ccx.tcx.sess.span_bug(a.span, ~"check_constraints:\ + } + ast::carg_lit(l) { + let tmp_node_id = fcx.ccx.tcx.sess.next_node_id(); + {id: tmp_node_id, node: ast::expr_lit(l), span: a.span} + } + ast::carg_ident(i) { + if i < num_args { + let p: ast::path_ = + {global: false, + idents: [args[i].ident], + types: []}; + let arg_occ_node_id = + fcx.ccx.tcx.sess.next_node_id(); + fcx.ccx.tcx.def_map.insert( + arg_occ_node_id, + ast::def_arg(local_def(args[i].id), + args[i].mode)); + {id: arg_occ_node_id, + node: ast::expr_path(respan(a.span, p)), + span: a.span} + } else { + fcx.ccx.tcx.sess.span_bug(a.span, + "check_constraints:\ carg_ident index out of bounds"); - } - } - })] + } + } + }] } let p_op: ast::expr_ = ast::expr_path(c.node.path); - let oper: @ast::expr = @{id:c.node.id, - node: p_op, span:c.span}; + let oper: @ast::expr = @{id: c.node.id, node: p_op, span: c.span}; // Another ephemeral expr let call_expr_id = fcx.ccx.tcx.sess.next_node_id(); - let call_expr = @{id: call_expr_id, - node: ast::expr_call(oper, c_args), - span: c.span}; + let call_expr = + @{id: call_expr_id, + node: ast::expr_call(oper, c_args), + span: c.span}; check_pred_expr(fcx, call_expr); } } @@ -2688,14 +2677,14 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, // function result type, if there is a tail expr. // We don't do this check for an iterator, as the tail expr doesn't // have to have the result type of the iterator. - alt (body.node.expr) { + alt body.node.expr { some(tail_expr) { if f.proto != ast::proto_iter { let tail_expr_ty = expr_ty(ccx.tcx, tail_expr); demand::simple(fcx, tail_expr.span, fcx.ret_ty, tail_expr_ty); } } - none. {} + none. { } } let args = ty::ty_fn_args(ccx.tcx, ty::node_id_to_type(ccx.tcx, id)); @@ -2762,15 +2751,15 @@ fn check_main_fn_ty(tcx: &ty::ctxt, main_id: &ast::node_id) { if !ok { let span = ast_map::node_span(tcx.items.get(main_id)); tcx.sess.span_err(span, - ~"wrong type in main function: found " + - ty_to_str(tcx, main_t)); + "wrong type in main function: found " + + ty_to_str(tcx, main_t)); } } _ { let span = ast_map::node_span(tcx.items.get(main_id)); tcx.sess.span_bug(span, - ~"main has a non-function type: found" + - ty_to_str(tcx, main_t)); + "main has a non-function type: found" + + ty_to_str(tcx, main_t)); } } } @@ -2779,7 +2768,7 @@ fn check_for_main_fn(tcx: &ty::ctxt, crate: &@ast::crate) { if !tcx.sess.get_opts().library { alt tcx.sess.get_main_id() { some(id) { check_main_fn_ty(tcx, id); } - none. { tcx.sess.span_err(crate.span, ~"main function not found"); } + none. { tcx.sess.span_err(crate.span, "main function not found"); } } } } diff --git a/src/comp/syntax/ast.rs b/src/comp/syntax/ast.rs index a6d04451ba1..84d9c28cfe1 100644 --- a/src/comp/syntax/ast.rs +++ b/src/comp/syntax/ast.rs @@ -6,7 +6,7 @@ import codemap::filename; type spanned<T> = {node: T, span: span}; -type ident = istr; +type ident = str; // Functions may or may not have names. type fn_ident = option::t<ident>; @@ -43,7 +43,7 @@ tag def { def_use(def_id); def_native_ty(def_id); def_native_fn(def_id); - def_upvar(def_id, @def, bool /* writable */); + def_upvar(def_id, @def, /* writable */bool); } // The set of meta_items that define the compilation environment of the crate, @@ -78,8 +78,8 @@ tag meta_item_ { type blk = spanned<blk_>; -type blk_ = {stmts: [@stmt], expr: option::t<@expr>, - id: node_id, rules: check_mode}; +type blk_ = + {stmts: [@stmt], expr: option::t<@expr>, id: node_id, rules: check_mode}; type pat = {id: node_id, node: pat_, span: span}; @@ -229,7 +229,7 @@ tag blk_sort { type mac = spanned<mac_>; tag mac_ { - mac_invoc(path, @expr, option::t<istr>); + mac_invoc(path, @expr, option::t<str>); mac_embed_type(@ty); mac_embed_block(blk); mac_ellipsis; @@ -238,13 +238,13 @@ tag mac_ { type lit = spanned<lit_>; tag lit_ { - lit_str(istr); + lit_str(str); lit_char(char); lit_int(int); lit_uint(uint); lit_mach_int(ty_mach, int); - lit_float(istr); - lit_mach_float(ty_mach, istr); + lit_float(str); + lit_mach_float(ty_mach, str); lit_nil; lit_bool(bool); } @@ -292,6 +292,7 @@ tag ty_ { ret/fail/break/cont. there is no syntax for this type. */ + /* bot represents the value of functions that don't return a value locally to their context. in contrast, things like log that do return, but don't return a meaningful value, have result type nil. */ @@ -379,6 +380,7 @@ tag controlflow { noreturn; // functions with return type _|_ that always // raise an error or exit (i.e. never return to the caller) + return; // everything else } @@ -412,7 +414,7 @@ tag native_abi { } type native_mod = - {native_name: istr, + {native_name: str, abi: native_abi, view_items: [@view_item], items: [@native_item]}; @@ -467,9 +469,11 @@ tag item_ { item_tag([variant], [ty_param]); item_obj(_obj, [ty_param], /* constructor id */node_id); item_res(_fn, - /* dtor */ + + /* dtor */ node_id, - /* dtor id */ + + /* dtor id */ [ty_param], /* ctor id */ @@ -485,7 +489,7 @@ type native_item = tag native_item_ { native_item_ty; - native_item_fn(option::t<istr>, fn_decl, [ty_param]); + native_item_fn(option::t<str>, fn_decl, [ty_param]); } // diff --git a/src/comp/syntax/ast_util.rs b/src/comp/syntax/ast_util.rs index d82a2302be5..c5d769c1299 100644 --- a/src/comp/syntax/ast_util.rs +++ b/src/comp/syntax/ast_util.rs @@ -13,11 +13,9 @@ fn mk_sp(lo: uint, hi: uint) -> span { // make this a const, once the compiler supports it fn dummy_sp() -> span { ret mk_sp(0u, 0u); } -fn path_name(p: &path) -> istr { path_name_i(p.node.idents) } +fn path_name(p: &path) -> str { path_name_i(p.node.idents) } -fn path_name_i(idents: &[ident]) -> istr { - str::connect(idents, ~"::") -} +fn path_name_i(idents: &[ident]) -> str { str::connect(idents, "::") } fn local_def(id: node_id) -> def_id { ret {crate: local_crate, node: id}; } @@ -45,7 +43,7 @@ fn def_id_of_def(d: def) -> def_id { } } -type pat_id_map = std::map::hashmap<istr, node_id>; +type pat_id_map = std::map::hashmap<str, node_id>; // This is used because same-named variables in alternative patterns need to // use the node_id of their namesake in the first pattern. @@ -82,27 +80,27 @@ fn pat_binding_ids(pat: &@pat) -> [node_id] { ret found; } -fn binop_to_str(op: binop) -> istr { +fn binop_to_str(op: binop) -> str { alt op { - add. { ret ~"+"; } - sub. { ret ~"-"; } - mul. { ret ~"*"; } - div. { ret ~"/"; } - rem. { ret ~"%"; } - and. { ret ~"&&"; } - or. { ret ~"||"; } - bitxor. { ret ~"^"; } - bitand. { ret ~"&"; } - bitor. { ret ~"|"; } - lsl. { ret ~"<<"; } - lsr. { ret ~">>"; } - asr. { ret ~">>>"; } - eq. { ret ~"=="; } - lt. { ret ~"<"; } - le. { ret ~"<="; } - ne. { ret ~"!="; } - ge. { ret ~">="; } - gt. { ret ~">"; } + add. { ret "+"; } + sub. { ret "-"; } + mul. { ret "*"; } + div. { ret "/"; } + rem. { ret "%"; } + and. { ret "&&"; } + or. { ret "||"; } + bitxor. { ret "^"; } + bitand. { ret "&"; } + bitor. { ret "|"; } + lsl. { ret "<<"; } + lsr. { ret ">>"; } + asr. { ret ">>>"; } + eq. { ret "=="; } + lt. { ret "<"; } + le. { ret "<="; } + ne. { ret "!="; } + ge. { ret ">="; } + gt. { ret ">"; } } } @@ -110,12 +108,12 @@ pure fn lazy_binop(b: binop) -> bool { alt b { and. { true } or. { true } _ { false } } } -fn unop_to_str(op: unop) -> istr { +fn unop_to_str(op: unop) -> str { alt op { - box(mt) { if mt == mut { ret ~"@mutable "; } ret ~"@"; } - deref. { ret ~"*"; } - not. { ret ~"!"; } - neg. { ret ~"-"; } + box(mt) { if mt == mut { ret "@mutable "; } ret "@"; } + deref. { ret "*"; } + not. { ret "!"; } + neg. { ret "-"; } } } @@ -123,18 +121,18 @@ fn is_path(e: &@expr) -> bool { ret alt e.node { expr_path(_) { true } _ { false } }; } -fn ty_mach_to_str(tm: ty_mach) -> istr { +fn ty_mach_to_str(tm: ty_mach) -> str { alt tm { - ty_u8. { ret ~"u8"; } - ty_u16. { ret ~"u16"; } - ty_u32. { ret ~"u32"; } - ty_u64. { ret ~"u64"; } - ty_i8. { ret ~"i8"; } - ty_i16. { ret ~"i16"; } - ty_i32. { ret ~"i32"; } - ty_i64. { ret ~"i64"; } - ty_f32. { ret ~"f32"; } - ty_f64. { ret ~"f64"; } + ty_u8. { ret "u8"; } + ty_u16. { ret "u16"; } + ty_u32. { ret "u32"; } + ty_u64. { ret "u64"; } + ty_i8. { ret "i8"; } + ty_i16. { ret "i16"; } + ty_i32. { ret "i32"; } + ty_i64. { ret "i64"; } + ty_f32. { ret "f32"; } + ty_f64. { ret "f64"; } } } @@ -190,8 +188,8 @@ fn block_from_expr(e: @expr) -> blk { ret {node: blk_, span: e.span}; } -fn checked_blk(stmts1: [@stmt], expr1: option::t<@expr>, id1: node_id) - -> blk_ { +fn checked_blk(stmts1: [@stmt], expr1: option::t<@expr>, id1: node_id) -> + blk_ { ret {stmts: stmts1, expr: expr1, id: id1, rules: checked}; } diff --git a/src/comp/syntax/codemap.rs b/src/comp/syntax/codemap.rs index 42120906b78..edb414b4e9b 100644 --- a/src/comp/syntax/codemap.rs +++ b/src/comp/syntax/codemap.rs @@ -7,7 +7,7 @@ import std::option; import std::option::some; import std::option::none; -type filename = istr; +type filename = str; type file_pos = {ch: uint, byte: uint}; @@ -66,15 +66,16 @@ fn lookup_byte_pos(map: codemap, pos: uint) -> loc { } tag opt_span { - //hack (as opposed to option::t), to make `span` compile + + //hack (as opposed to option::t), to make `span` compile os_none; os_some(@span); } type span = {lo: uint, hi: uint, expanded_from: opt_span}; -fn span_to_str(sp: &span, cm: &codemap) -> istr { +fn span_to_str(sp: &span, cm: &codemap) -> str { let cur = sp; - let res = ~""; + let res = ""; let prev_file = none; while true { let lo = lookup_char_pos(cm, cur.lo); @@ -82,16 +83,14 @@ fn span_to_str(sp: &span, cm: &codemap) -> istr { res += #fmt["%s:%u:%u: %u:%u", if some(lo.filename) == prev_file { - ~"-" - } else { - lo.filename - }, lo.line, lo.col, hi.line, hi.col]; + "-" + } else { lo.filename }, lo.line, lo.col, hi.line, hi.col]; alt cur.expanded_from { os_none. { break; } os_some(new_sp) { cur = *new_sp; prev_file = some(lo.filename); - res += ~"<<"; + res += "<<"; } } } @@ -99,13 +98,13 @@ fn span_to_str(sp: &span, cm: &codemap) -> istr { ret res; } -fn emit_diagnostic(sp: &option::t<span>, msg: &istr, kind: &istr, color: u8, +fn emit_diagnostic(sp: &option::t<span>, msg: &str, kind: &str, color: u8, cm: &codemap) { - let ss = ~""; + let ss = ""; let maybe_lines: option::t<@file_lines> = none; alt sp { some(ssp) { - ss = span_to_str(ssp, cm) + ~" "; + ss = span_to_str(ssp, cm) + " "; maybe_lines = some(span_to_lines(ssp, cm)); } none. { } @@ -114,9 +113,9 @@ fn emit_diagnostic(sp: &option::t<span>, msg: &istr, kind: &istr, color: u8, if term::color_supported() { term::fg(io::stdout().get_buf_writer(), color); } - io::stdout().write_str(#fmt[~"%s:", kind]); + io::stdout().write_str(#fmt["%s:", kind]); if term::color_supported() { term::reset(io::stdout().get_buf_writer()); } - io::stdout().write_str(#fmt[~" %s\n", msg]); + io::stdout().write_str(#fmt[" %s\n", msg]); maybe_highlight_lines(sp, cm, maybe_lines); } @@ -128,7 +127,7 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap, some(lines) { // If we're not looking at a real file then we can't re-open it to // pull out the lines - if lines.name == ~"-" { ret; } + if lines.name == "-" { ret; } // FIXME: reading in the entire file is the worst possible way to // get access to the necessary lines. @@ -145,19 +144,18 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap, } // Print the offending lines for line: uint in display_lines { - io::stdout().write_str( - #fmt[~"%s:%u ", fm.name, line + 1u]); + io::stdout().write_str(#fmt["%s:%u ", fm.name, line + 1u]); let s = get_line(fm, line as int, file); - if !str::ends_with(s, ~"\n") { s += ~"\n"; } + if !str::ends_with(s, "\n") { s += "\n"; } io::stdout().write_str(s); } if elided { let last_line = display_lines[vec::len(display_lines) - 1u]; - let s = #fmt[~"%s:%u ", fm.name, last_line + 1u]; + let s = #fmt["%s:%u ", fm.name, last_line + 1u]; let indent = str::char_len(s); - let out = ~""; - while indent > 0u { out += ~" "; indent -= 1u; } - out += ~"...\n"; + let out = ""; + while indent > 0u { out += " "; indent -= 1u; } + out += "...\n"; io::stdout().write_str(out); } @@ -173,34 +171,34 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap, // indent past |name:## | and the 0-offset column location let left = str::char_len(fm.name) + digits + lo.col + 3u; - let s = ~""; + let s = ""; while left > 0u { str::push_char(s, ' '); left -= 1u; } - s += ~"^"; + s += "^"; let hi = lookup_char_pos(cm, option::get(sp).hi); if hi.col != lo.col { // the ^ already takes up one space let width = hi.col - lo.col - 1u; while width > 0u { str::push_char(s, '~'); width -= 1u; } } - io::stdout().write_str(s + ~"\n"); + io::stdout().write_str(s + "\n"); } } _ { } } } -fn emit_warning(sp: &option::t<span>, msg: &istr, cm: &codemap) { - emit_diagnostic(sp, msg, ~"warning", 11u8, cm); +fn emit_warning(sp: &option::t<span>, msg: &str, cm: &codemap) { + emit_diagnostic(sp, msg, "warning", 11u8, cm); } -fn emit_error(sp: &option::t<span>, msg: &istr, cm: &codemap) { - emit_diagnostic(sp, msg, ~"error", 9u8, cm); +fn emit_error(sp: &option::t<span>, msg: &str, cm: &codemap) { + emit_diagnostic(sp, msg, "error", 9u8, cm); } -fn emit_note(sp: &option::t<span>, msg: &istr, cm: &codemap) { - emit_diagnostic(sp, msg, ~"note", 10u8, cm); +fn emit_note(sp: &option::t<span>, msg: &str, cm: &codemap) { + emit_diagnostic(sp, msg, "note", 10u8, cm); } -type file_lines = {name: istr, lines: [uint]}; +type file_lines = {name: str, lines: [uint]}; fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines { let lo = lookup_char_pos(cm, sp.lo); @@ -212,7 +210,7 @@ fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines { ret @{name: lo.filename, lines: lines}; } -fn get_line(fm: filemap, line: int, file: &istr) -> istr { +fn get_line(fm: filemap, line: int, file: &str) -> str { let begin: uint = fm.lines[line].byte - fm.start_pos.byte; let end: uint; if line as uint < vec::len(fm.lines) - 1u { @@ -229,10 +227,8 @@ fn get_line(fm: filemap, line: int, file: &istr) -> istr { ret str::slice(file, begin, end); } -fn get_filemap(cm: codemap, filename: istr) -> filemap { - for fm: filemap in cm.files { - if fm.name == filename { ret fm; } - } +fn get_filemap(cm: codemap, filename: str) -> filemap { + for fm: filemap in cm.files { if fm.name == filename { ret fm; } } //XXjdm the following triggers a mismatched type bug // (or expected function, found _|_) fail; // ("asking for " + filename + " which we don't know about"); diff --git a/src/comp/syntax/ext/base.rs b/src/comp/syntax/ext/base.rs index 2dcc43ef178..298f90237bc 100644 --- a/src/comp/syntax/ext/base.rs +++ b/src/comp/syntax/ext/base.rs @@ -8,10 +8,10 @@ import std::map::new_str_hash; import codemap; type syntax_expander = - fn(&ext_ctxt, span, @ast::expr, &option::t<istr>) -> @ast::expr; -type macro_def = {ident: istr, ext: syntax_extension}; + fn(&ext_ctxt, span, @ast::expr, &option::t<str>) -> @ast::expr; +type macro_def = {ident: str, ext: syntax_extension}; type macro_definer = - fn(&ext_ctxt, span, @ast::expr, &option::t<istr>) -> macro_def; + fn(&ext_ctxt, span, @ast::expr, &option::t<str>) -> macro_def; tag syntax_extension { normal(syntax_expander); @@ -20,25 +20,25 @@ tag syntax_extension { // A temporary hard-coded map of methods for expanding syntax extension // AST nodes into full ASTs -fn syntax_expander_table() -> hashmap<istr, syntax_extension> { +fn syntax_expander_table() -> hashmap<str, syntax_extension> { let syntax_expanders = new_str_hash::<syntax_extension>(); - syntax_expanders.insert(~"fmt", normal(ext::fmt::expand_syntax_ext)); - syntax_expanders.insert(~"env", normal(ext::env::expand_syntax_ext)); - syntax_expanders.insert(~"macro", + syntax_expanders.insert("fmt", normal(ext::fmt::expand_syntax_ext)); + syntax_expanders.insert("env", normal(ext::env::expand_syntax_ext)); + syntax_expanders.insert("macro", macro_defining(ext::simplext::add_new_extension)); - syntax_expanders.insert(~"concat_idents", + syntax_expanders.insert("concat_idents", normal(ext::concat_idents::expand_syntax_ext)); - syntax_expanders.insert(~"ident_to_str", + syntax_expanders.insert("ident_to_str", normal(ext::ident_to_str::expand_syntax_ext)); - syntax_expanders.insert(~"log_syntax", + syntax_expanders.insert("log_syntax", normal(ext::log_syntax::expand_syntax_ext)); ret syntax_expanders; } obj ext_ctxt(sess: @session, - crate_file_name_hack: istr, + crate_file_name_hack: str, mutable backtrace: codemap::opt_span) { - fn crate_file_name() -> istr { ret crate_file_name_hack; } + fn crate_file_name() -> str { ret crate_file_name_hack; } fn session() -> @session { ret sess; } @@ -58,30 +58,27 @@ obj ext_ctxt(sess: @session, let tmp = pre; backtrace = tmp; } - _ { self.bug(~"tried to pop without a push"); } + _ { self.bug("tried to pop without a push"); } } } - fn span_fatal(sp: span, msg: istr) -> ! { + fn span_fatal(sp: span, msg: str) -> ! { self.print_backtrace(); sess.span_fatal(sp, msg); } - fn span_err(sp: span, msg: istr) { + fn span_err(sp: span, msg: str) { self.print_backtrace(); sess.span_err(sp, msg); } - fn span_unimpl(sp: span, msg: istr) -> ! { + fn span_unimpl(sp: span, msg: str) -> ! { self.print_backtrace(); sess.span_unimpl(sp, msg); } - fn span_bug(sp: span, msg: istr) -> ! { + fn span_bug(sp: span, msg: str) -> ! { self.print_backtrace(); sess.span_bug(sp, msg); } - fn bug(msg: istr) -> ! { - self.print_backtrace(); - sess.bug(msg); - } + fn bug(msg: str) -> ! { self.print_backtrace(); sess.bug(msg); } fn next_id() -> ast::node_id { ret sess.next_node_id(); } } @@ -96,11 +93,10 @@ fn mk_ctxt(sess: &session) -> ext_ctxt { // super-ugly and needs a better solution. let crate_file_name_hack = sess.get_codemap().files[0].name; - ret ext_ctxt(@sess, crate_file_name_hack, - codemap::os_none); + ret ext_ctxt(@sess, crate_file_name_hack, codemap::os_none); } -fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &istr) -> istr { +fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &str) -> str { alt expr.node { ast::expr_lit(l) { alt l.node { @@ -112,8 +108,7 @@ fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &istr) -> istr { } } -fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr, - error: &istr) -> ast::ident { +fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr, error: &str) -> ast::ident { alt expr.node { ast::expr_path(p) { if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u { diff --git a/src/comp/syntax/ext/concat_idents.rs b/src/comp/syntax/ext/concat_idents.rs index f5ce004ea00..53ee6cb0397 100644 --- a/src/comp/syntax/ext/concat_idents.rs +++ b/src/comp/syntax/ext/concat_idents.rs @@ -3,17 +3,17 @@ import base::*; import syntax::ast; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, - _body: &option::t<istr>) -> @ast::expr { + _body: &option::t<str>) -> @ast::expr { let args: [@ast::expr] = alt arg.node { ast::expr_vec(elts, _) { elts } _ { - cx.span_fatal(sp, ~"#concat_idents requires a vector argument .") + cx.span_fatal(sp, "#concat_idents requires a vector argument .") } }; - let res: ast::ident = ~""; + let res: ast::ident = ""; for e: @ast::expr in args { - res += expr_to_ident(cx, e, ~"expected an ident"); + res += expr_to_ident(cx, e, "expected an ident"); } ret @{id: cx.next_id(), diff --git a/src/comp/syntax/ext/env.rs b/src/comp/syntax/ext/env.rs index 487b12d0bc2..081bfd80c1d 100644 --- a/src/comp/syntax/ext/env.rs +++ b/src/comp/syntax/ext/env.rs @@ -12,30 +12,28 @@ import base::*; export expand_syntax_ext; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, - _body: &option::t<istr>) -> @ast::expr { + _body: &option::t<str>) -> @ast::expr { let args: [@ast::expr] = alt arg.node { ast::expr_vec(elts, _) { elts } _ { - cx.span_fatal(sp, ~"#env requires arguments of the form `[...]`.") + cx.span_fatal(sp, "#env requires arguments of the form `[...]`.") } }; if vec::len::<@ast::expr>(args) != 1u { - cx.span_fatal(sp, ~"malformed #env call"); + cx.span_fatal(sp, "malformed #env call"); } // FIXME: if this was more thorough it would manufacture an // option::t<str> rather than just an maybe-empty string. - let var = expr_to_str(cx, args[0], ~"#env requires a string"); + let var = expr_to_str(cx, args[0], "#env requires a string"); alt generic_os::getenv(var) { - option::none. { ret make_new_str(cx, sp, ~""); } - option::some(s) { - ret make_new_str(cx, sp, s); - } + option::none. { ret make_new_str(cx, sp, ""); } + option::some(s) { ret make_new_str(cx, sp, s); } } } -fn make_new_str(cx: &ext_ctxt, sp: codemap::span, s: &istr) -> @ast::expr { +fn make_new_str(cx: &ext_ctxt, sp: codemap::span, s: &str) -> @ast::expr { ret make_new_lit(cx, sp, ast::lit_str(s)); } // diff --git a/src/comp/syntax/ext/expand.rs b/src/comp/syntax/ext/expand.rs index c2a3a201126..7037139bd93 100644 --- a/src/comp/syntax/ext/expand.rs +++ b/src/comp/syntax/ext/expand.rs @@ -15,7 +15,7 @@ import syntax::fold::*; import syntax::ext::base::*; -fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt, +fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt, e: &expr_, fld: ast_fold, orig: &fn(&expr_, ast_fold) -> expr_) -> expr_ { ret alt e { @@ -27,8 +27,7 @@ fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt, alt exts.find(extname) { none. { cx.span_fatal(pth.span, - #fmt["macro undefined: '%s'", - extname]) + #fmt["macro undefined: '%s'", extname]) } some(normal(ext)) { let expanded = ext(cx, pth.span, args, body); @@ -42,14 +41,12 @@ fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt, } some(macro_defining(ext)) { let named_extension = ext(cx, pth.span, args, body); - exts.insert( - named_extension.ident, - named_extension.ext); + exts.insert(named_extension.ident, named_extension.ext); ast::expr_rec([], none) } } } - _ { cx.span_bug(mac.span, ~"naked syntactic bit") } + _ { cx.span_bug(mac.span, "naked syntactic bit") } } } _ { orig(e, fld) } diff --git a/src/comp/syntax/ext/fmt.rs b/src/comp/syntax/ext/fmt.rs index 91a83b06267..aef3cc46902 100644 --- a/src/comp/syntax/ext/fmt.rs +++ b/src/comp/syntax/ext/fmt.rs @@ -16,26 +16,24 @@ import codemap::span; export expand_syntax_ext; fn expand_syntax_ext(cx: &ext_ctxt, sp: span, arg: @ast::expr, - _body: &option::t<istr>) -> @ast::expr { + _body: &option::t<str>) -> @ast::expr { let args: [@ast::expr] = alt arg.node { ast::expr_vec(elts, _) { elts } _ { - cx.span_fatal( - sp, ~"#fmt requires arguments of the form `[...]`.") + cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.") } }; if vec::len::<@ast::expr>(args) == 0u { - cx.span_fatal(sp, ~"#fmt requires a format string"); + cx.span_fatal(sp, "#fmt requires a format string"); } let fmt = expr_to_str(cx, args[0], - ~"first argument to #fmt must be a " - + ~"string literal."); + "first argument to #fmt must be a " + "string literal."); let fmtspan = args[0].span; log "Format string:"; log fmt; - fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: &istr) -> ! { + fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: &str) -> ! { cx.span_fatal(sp, msg); } let parse_fmt_err = bind parse_fmt_err_(cx, fmtspan, _); @@ -52,7 +50,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], let sp_lit = @{node: lit, span: sp}; ret @{id: cx.next_id(), node: ast::expr_lit(sp_lit), span: sp}; } - fn make_new_str(cx: &ext_ctxt, sp: span, s: &istr) -> @ast::expr { + fn make_new_str(cx: &ext_ctxt, sp: span, s: &str) -> @ast::expr { let lit = ast::lit_str(s); ret make_new_lit(cx, sp, lit); } @@ -103,14 +101,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], } fn make_path_vec(cx: &ext_ctxt, ident: &ast::ident) -> [ast::ident] { fn compiling_std(cx: &ext_ctxt) -> bool { - ret str::find(cx.crate_file_name(), ~"std.rc") >= 0; + ret str::find(cx.crate_file_name(), "std.rc") >= 0; } if compiling_std(cx) { - ret [~"extfmt", ~"rt", ident]; - } else { ret [~"std", ~"extfmt", ~"rt", ident]; } + ret ["extfmt", "rt", ident]; + } else { ret ["std", "extfmt", "rt", ident]; } } - fn make_rt_path_expr(cx: &ext_ctxt, sp: span, - ident: &istr) -> @ast::expr { + fn make_rt_path_expr(cx: &ext_ctxt, sp: span, ident: &str) -> @ast::expr { let path = make_path_vec(cx, ident); ret make_path_expr(cx, sp, path); } @@ -123,11 +120,11 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], for f: flag in flags { let fstr; alt f { - flag_left_justify. { fstr = ~"flag_left_justify"; } - flag_left_zero_pad. { fstr = ~"flag_left_zero_pad"; } - flag_space_for_sign. { fstr = ~"flag_space_for_sign"; } - flag_sign_always. { fstr = ~"flag_sign_always"; } - flag_alternate. { fstr = ~"flag_alternate"; } + flag_left_justify. { fstr = "flag_left_justify"; } + flag_left_zero_pad. { fstr = "flag_left_zero_pad"; } + flag_space_for_sign. { fstr = "flag_space_for_sign"; } + flag_sign_always. { fstr = "flag_sign_always"; } + flag_alternate. { fstr = "flag_alternate"; } } flagexprs += [make_rt_path_expr(cx, sp, fstr)]; } @@ -136,22 +133,22 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], // this is a hack placeholder flag if vec::len::<@ast::expr>(flagexprs) == 0u { - flagexprs += [make_rt_path_expr(cx, sp, ~"flag_none")]; + flagexprs += [make_rt_path_expr(cx, sp, "flag_none")]; } ret make_vec_expr(cx, sp, flagexprs); } fn make_count(cx: &ext_ctxt, sp: span, cnt: &count) -> @ast::expr { alt cnt { count_implied. { - ret make_rt_path_expr(cx, sp, ~"count_implied"); + ret make_rt_path_expr(cx, sp, "count_implied"); } count_is(c) { let count_lit = make_new_int(cx, sp, c); - let count_is_path = make_path_vec(cx, ~"count_is"); + let count_is_path = make_path_vec(cx, "count_is"); let count_is_args = [count_lit]; ret make_call(cx, sp, count_is_path, count_is_args); } - _ { cx.span_unimpl(sp, ~"unimplemented #fmt conversion"); } + _ { cx.span_unimpl(sp, "unimplemented #fmt conversion"); } } } fn make_ty(cx: &ext_ctxt, sp: span, t: &ty) -> @ast::expr { @@ -159,13 +156,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], alt t { ty_hex(c) { alt c { - case_upper. { rt_type = ~"ty_hex_upper"; } - case_lower. { rt_type = ~"ty_hex_lower"; } + case_upper. { rt_type = "ty_hex_upper"; } + case_lower. { rt_type = "ty_hex_lower"; } } } - ty_bits. { rt_type = ~"ty_bits"; } - ty_octal. { rt_type = ~"ty_octal"; } - _ { rt_type = ~"ty_default"; } + ty_bits. { rt_type = "ty_bits"; } + ty_octal. { rt_type = "ty_octal"; } + _ { rt_type = "ty_default"; } } ret make_rt_path_expr(cx, sp, rt_type); } @@ -173,10 +170,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], width_expr: @ast::expr, precision_expr: @ast::expr, ty_expr: @ast::expr) -> @ast::expr { ret make_rec_expr(cx, sp, - [{ident: ~"flags", ex: flags_expr}, - {ident: ~"width", ex: width_expr}, - {ident: ~"precision", ex: precision_expr}, - {ident: ~"ty", ex: ty_expr}]); + [{ident: "flags", ex: flags_expr}, + {ident: "width", ex: width_expr}, + {ident: "precision", ex: precision_expr}, + {ident: "ty", ex: ty_expr}]); } let rt_conv_flags = make_flags(cx, sp, cnv.flags); let rt_conv_width = make_count(cx, sp, cnv.width); @@ -185,9 +182,9 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], ret make_conv_rec(cx, sp, rt_conv_flags, rt_conv_width, rt_conv_precision, rt_conv_ty); } - fn make_conv_call(cx: &ext_ctxt, sp: span, conv_type: &istr, - cnv: &conv, arg: @ast::expr) -> @ast::expr { - let fname = ~"conv_" + conv_type; + fn make_conv_call(cx: &ext_ctxt, sp: span, conv_type: &str, cnv: &conv, + arg: @ast::expr) -> @ast::expr { + let fname = "conv_" + conv_type; let path = make_path_vec(cx, fname); let cnv_expr = make_rt_conv_expr(cx, sp, cnv); let args = [cnv_expr, arg]; @@ -205,7 +202,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], _ { ret false; } } } - let unsupported = ~"conversion not supported in #fmt string"; + let unsupported = "conversion not supported in #fmt string"; alt cnv.param { option::none. { } _ { cx.span_unimpl(sp, unsupported); } @@ -216,15 +213,15 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], flag_sign_always. { if !is_signed_type(cnv) { cx.span_fatal(sp, - ~"+ flag only valid in " + - ~"signed #fmt conversion"); + "+ flag only valid in " + + "signed #fmt conversion"); } } flag_space_for_sign. { if !is_signed_type(cnv) { cx.span_fatal(sp, - ~"space flag only valid in " + - ~"signed #fmt conversions"); + "space flag only valid in " + + "signed #fmt conversions"); } } flag_left_zero_pad. { } @@ -242,28 +239,26 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], _ { cx.span_unimpl(sp, unsupported); } } alt cnv.ty { - ty_str. { ret make_conv_call(cx, arg.span, ~"str", cnv, arg); } + ty_str. { ret make_conv_call(cx, arg.span, "str", cnv, arg); } ty_int(sign) { alt sign { - signed. { ret make_conv_call(cx, arg.span, ~"int", cnv, arg); } + signed. { ret make_conv_call(cx, arg.span, "int", cnv, arg); } unsigned. { - ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); + ret make_conv_call(cx, arg.span, "uint", cnv, arg); } } } - ty_bool. { ret make_conv_call(cx, arg.span, ~"bool", cnv, arg); } - ty_char. { ret make_conv_call(cx, arg.span, ~"char", cnv, arg); } - ty_hex(_) { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); } - ty_bits. { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); } - ty_octal. { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); } + ty_bool. { ret make_conv_call(cx, arg.span, "bool", cnv, arg); } + ty_char. { ret make_conv_call(cx, arg.span, "char", cnv, arg); } + ty_hex(_) { ret make_conv_call(cx, arg.span, "uint", cnv, arg); } + ty_bits. { ret make_conv_call(cx, arg.span, "uint", cnv, arg); } + ty_octal. { ret make_conv_call(cx, arg.span, "uint", cnv, arg); } _ { cx.span_unimpl(sp, unsupported); } } } fn log_conv(c: conv) { alt c.param { - some(p) { - log ~"param: " + std::int::to_str(p, 10u); - } + some(p) { log "param: " + std::int::to_str(p, 10u); } _ { log "param: none"; } } for f: flag in c.flags { @@ -276,21 +271,17 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], } } alt c.width { - count_is(i) { log ~"width: count is " - + std::int::to_str(i, 10u); } + count_is(i) { log "width: count is " + std::int::to_str(i, 10u); } count_is_param(i) { - log ~"width: count is param " - + std::int::to_str(i, 10u); + log "width: count is param " + std::int::to_str(i, 10u); } count_is_next_param. { log "width: count is next param"; } count_implied. { log "width: count is implied"; } } alt c.precision { - count_is(i) { log ~"prec: count is " - + std::int::to_str(i, 10u); } + count_is(i) { log "prec: count is " + std::int::to_str(i, 10u); } count_is_param(i) { - log ~"prec: count is param " - + std::int::to_str(i, 10u); + log "prec: count is param " + std::int::to_str(i, 10u); } count_is_next_param. { log "prec: count is next param"; } count_implied. { log "prec: count is implied"; } @@ -317,7 +308,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], } let fmt_sp = args[0].span; let n = 0u; - let tmp_expr = make_new_str(cx, sp, ~""); + let tmp_expr = make_new_str(cx, sp, ""); let nargs = vec::len::<@ast::expr>(args); for pc: piece in pieces { alt pc { @@ -329,8 +320,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], n += 1u; if n >= nargs { cx.span_fatal(sp, - ~"not enough arguments to #fmt " + - ~"for the given format string"); + "not enough arguments to #fmt " + + "for the given format string"); } log "Building conversion:"; log_conv(conv); diff --git a/src/comp/syntax/ext/ident_to_str.rs b/src/comp/syntax/ext/ident_to_str.rs index f30d6932555..1cf015fcaf0 100644 --- a/src/comp/syntax/ext/ident_to_str.rs +++ b/src/comp/syntax/ext/ident_to_str.rs @@ -5,20 +5,20 @@ import base::*; import syntax::ast; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, - _body: &option::t<istr>) -> @ast::expr { + _body: &option::t<str>) -> @ast::expr { let args: [@ast::expr] = alt arg.node { ast::expr_vec(elts, _) { elts } _ { - cx.span_fatal(sp, ~"#ident_to_str requires a vector argument .") + cx.span_fatal(sp, "#ident_to_str requires a vector argument .") } }; if vec::len::<@ast::expr>(args) != 1u { - cx.span_fatal(sp, ~"malformed #ident_to_str call"); + cx.span_fatal(sp, "malformed #ident_to_str call"); } ret make_new_lit(cx, sp, ast::lit_str(expr_to_ident(cx, args[0u], - ~"expected an ident"))); + "expected an ident"))); } diff --git a/src/comp/syntax/ext/log_syntax.rs b/src/comp/syntax/ext/log_syntax.rs index a8fa657c20c..50e7e307bdc 100644 --- a/src/comp/syntax/ext/log_syntax.rs +++ b/src/comp/syntax/ext/log_syntax.rs @@ -4,11 +4,10 @@ import syntax::ast; import std::str; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, - _body: &option::t<istr>) -> @ast::expr { + _body: &option::t<str>) -> @ast::expr { cx.print_backtrace(); - std::io::stdout().write_line( - print::pprust::expr_to_str(arg)); + std::io::stdout().write_line(print::pprust::expr_to_str(arg)); //trivial expression ret @{id: cx.next_id(), node: ast::expr_rec([], option::none), span: sp}; diff --git a/src/comp/syntax/ext/simplext.rs b/src/comp/syntax/ext/simplext.rs index 3496791ce6e..4e76ec0d787 100644 --- a/src/comp/syntax/ext/simplext.rs +++ b/src/comp/syntax/ext/simplext.rs @@ -57,29 +57,29 @@ tag matchable { } /* for when given an incompatible bit of AST */ -fn match_error(cx: &ext_ctxt, m: &matchable, expected: &istr) -> ! { +fn match_error(cx: &ext_ctxt, m: &matchable, expected: &str) -> ! { alt m { match_expr(x) { cx.span_fatal(x.span, - ~"this argument is an expr, expected " + expected); + "this argument is an expr, expected " + expected); } match_path(x) { cx.span_fatal(x.span, - ~"this argument is a path, expected " + expected); + "this argument is a path, expected " + expected); } match_ident(x) { cx.span_fatal(x.span, - ~"this argument is an ident, expected " + expected); + "this argument is an ident, expected " + expected); } match_ty(x) { cx.span_fatal(x.span, - ~"this argument is a type, expected " + expected); + "this argument is a type, expected " + expected); } match_block(x) { cx.span_fatal(x.span, - ~"this argument is a block, expected " + expected); + "this argument is a block, expected " + expected); } - match_exact. { cx.bug(~"what is a match_exact doing in a bindings?"); } + match_exact. { cx.bug("what is a match_exact doing in a bindings?"); } } } @@ -102,7 +102,7 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) -> alt m.node { ast::mac_ellipsis. { if res != none { - cx.span_fatal(m.span, ~"only one ellipsis allowed"); + cx.span_fatal(m.span, "only one ellipsis allowed"); } res = some({pre: vec::slice(elts, 0u, idx - 1u), @@ -190,8 +190,7 @@ fn use_selectors_to_bind(b: &binders, e: @expr) -> option::t<bindings> { alt sel(match_expr(e)) { none. { ret none; } _ { } } } let never_mind: bool = false; - for each pair: @{key: ident, - val: selector} in b.real_binders.items() { + for each pair: @{key: ident, val: selector} in b.real_binders.items() { alt pair.val(match_expr(e)) { none. { never_mind = true; } some(mtc) { res.insert(pair.key, mtc); } @@ -252,8 +251,8 @@ fn follow_for_trans(cx: &ext_ctxt, mmaybe: &option::t<arb_depth<matchable>>, ret alt follow(m, idx_path) { seq(_, sp) { cx.span_fatal(sp, - ~"syntax matched under ... but not " + - ~"used that way.") + "syntax matched under ... but not " + + "used that way.") } leaf(m) { ret some(m) } } @@ -267,9 +266,7 @@ iter free_vars(b: &bindings, e: @expr) -> ident { let idents: hashmap<ident, ()> = new_str_hash::<()>(); fn mark_ident(i: &ident, _fld: ast_fold, b: &bindings, idents: &hashmap<ident, ()>) -> ident { - if b.contains_key(i) { - idents.insert(i, ()); - } + if b.contains_key(i) { idents.insert(i, ()); } ret i; } // using fold is a hack: we want visit, but it doesn't hit idents ) : @@ -309,13 +306,10 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], let len = vec::len(*ms); if old_len != len { let msg = - #fmt["'%s' occurs %u times, but ", - fv, len] + - #fmt["'%s' occurs %u times", - old_name, + #fmt["'%s' occurs %u times, but ", fv, len] + + #fmt["'%s' occurs %u times", old_name, old_len]; - cx.span_fatal( - repeat_me.span, msg); + cx.span_fatal(repeat_me.span, msg); } } } @@ -325,8 +319,8 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], alt repeat { none. { cx.span_fatal(repeat_me.span, - ~"'...' surrounds an expression without any" + - ~" repeating syntax variables"); + "'...' surrounds an expression without any" + + " repeating syntax variables"); } some({rep_count: rc, _}) { /* Whew, we now know how how many times to repeat */ @@ -354,7 +348,7 @@ fn transcribe_ident(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], i: &ident, _fld: ast_fold) -> ident { ret alt follow_for_trans(cx, b.find(i), idx_path) { some(match_ident(a_id)) { a_id.node } - some(m) { match_error(cx, m, ~"an identifier") } + some(m) { match_error(cx, m, "an identifier") } none. { i } } } @@ -369,7 +363,7 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], {global: false, idents: [id.node], types: []} } some(match_path(a_pth)) { a_pth.node } - some(m) { match_error(cx, m, ~"a path") } + some(m) { match_error(cx, m, "a path") } none. { p } } } @@ -394,7 +388,7 @@ fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], } some(match_path(a_pth)) { expr_path(a_pth) } some(match_expr(a_exp)) { a_exp.node } - some(m) { match_error(cx, m, ~"an expression") } + some(m) { match_error(cx, m, "an expression") } none. { orig(e, fld) } } } @@ -411,7 +405,7 @@ fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], some(id) { alt follow_for_trans(cx, b.find(id), idx_path) { some(match_ty(ty)) { ty.node } - some(m) { match_error(cx, m, ~"a type") } + some(m) { match_error(cx, m, "a type") } none. { orig(t, fld) } } } @@ -431,14 +425,14 @@ fn transcribe_block(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], orig: fn(&blk_, ast_fold) -> blk_) -> blk_ { ret alt block_to_ident(blk) { some(id) { - alt follow_for_trans(cx, b.find( - id), idx_path) { + alt follow_for_trans(cx, b.find(id), idx_path) { some(match_block(new_blk)) { new_blk.node } + // possibly allow promotion of ident/path/expr to blocks? some(m) { - match_error(cx, m, ~"a block") + match_error(cx, m, "a block") } none. { orig(blk, fld) } } @@ -469,12 +463,12 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { if vec::len(post) > 0u { cx.span_unimpl(e.span, - ~"matching after `...` not yet supported"); + "matching after `...` not yet supported"); } } {pre: pre, rep: none., post: post} { if post != [] { - cx.bug(~"elts_to_ell provided an invalid result"); + cx.bug("elts_to_ell provided an invalid result"); } p_t_s_r_length(cx, vec::len(pre), false, s, b); p_t_s_r_actual_vector(cx, pre, false, s, b); @@ -483,6 +477,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { } + /* TODO: handle embedded types and blocks, at least */ expr_mac(mac) { p_t_s_r_mac(cx, mac, s, b); @@ -494,7 +489,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { match_expr(e) { if e == pat { some(leaf(match_exact)) } else { none } } - _ { cx.bug(~"broken traversal in p_t_s_r") } + _ { cx.bug("broken traversal in p_t_s_r") } } } b.literal_ast_matchers += [bind select(cx, _, e)]; @@ -530,14 +525,13 @@ fn p_t_s_r_path(cx: &ext_ctxt, p: &path, s: &selector, b: &binders) { fn select(cx: &ext_ctxt, m: &matchable) -> match_result { ret alt m { match_expr(e) { some(leaf(specialize_match(m))) } - _ { cx.bug(~"broken traversal in p_t_s_r") } + _ { cx.bug("broken traversal in p_t_s_r") } } } if b.real_binders.contains_key(p_id) { - cx.span_fatal(p.span, ~"duplicate binding identifier"); + cx.span_fatal(p.span, "duplicate binding identifier"); } - b.real_binders.insert(p_id, - compose_sels(s, bind select(cx, _))); + b.real_binders.insert(p_id, compose_sels(s, bind select(cx, _))); } none. { } } @@ -560,16 +554,15 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) { match_expr(e) { alt e.node { expr_mac(mac) { fn_m(mac) } _ { none } } } - _ { cx.bug(~"broken traversal in p_t_s_r") } + _ { cx.bug("broken traversal in p_t_s_r") } } } - fn no_des(cx: &ext_ctxt, sp: &span, syn: &istr) -> ! { - cx.span_fatal(sp, ~"destructuring " - + syn + ~" is not yet supported"); + fn no_des(cx: &ext_ctxt, sp: &span, syn: &str) -> ! { + cx.span_fatal(sp, "destructuring " + syn + " is not yet supported"); } alt mac.node { - ast::mac_ellipsis. { cx.span_fatal(mac.span, ~"misused `...`"); } - ast::mac_invoc(_, _, _) { no_des(cx, mac.span, ~"macro calls"); } + ast::mac_ellipsis. { cx.span_fatal(mac.span, "misused `...`"); } + ast::mac_invoc(_, _, _) { no_des(cx, mac.span, "macro calls"); } ast::mac_embed_type(ty) { alt ty.node { ast::ty_path(pth, _) { @@ -583,13 +576,12 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) { } } let final_step = bind select_pt_1(cx, _, select_pt_2); - b.real_binders.insert( - id, compose_sels(s, final_step)); + b.real_binders.insert(id, compose_sels(s, final_step)); } - none. { no_des(cx, pth.span, ~"under `#<>`"); } + none. { no_des(cx, pth.span, "under `#<>`"); } } } - _ { no_des(cx, ty.span, ~"under `#<>`"); } + _ { no_des(cx, ty.span, "under `#<>`"); } } } ast::mac_embed_block(blk) { @@ -604,10 +596,9 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) { } } let final_step = bind select_pt_1(cx, _, select_pt_2); - b.real_binders.insert(id, - compose_sels(s, final_step)); + b.real_binders.insert(id, compose_sels(s, final_step)); } - none. { no_des(cx, blk.span, ~"under `#{}`"); } + none. { no_des(cx, blk.span, "under `#{}`"); } } } } @@ -635,7 +626,7 @@ fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint, _ { none } } } - _ { cx.bug(~"broken traversal in p_t_s_r") } + _ { cx.bug("broken traversal in p_t_s_r") } } } p_t_s_rec(cx, match_expr(repeat_me), @@ -680,7 +671,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, _ { none } } } - _ { cx.bug(~"broken traversal in p_t_s_r") } + _ { cx.bug("broken traversal in p_t_s_r") } } } p_t_s_rec(cx, match_expr(elts[idx]), @@ -690,25 +681,25 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, } fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, - _body: &option::t<istr>) -> base::macro_def { + _body: &option::t<str>) -> base::macro_def { let args: [@ast::expr] = alt arg.node { ast::expr_vec(elts, _) { elts } _ { cx.span_fatal(sp, - ~"#macro requires arguments of the form `[...]`.") + "#macro requires arguments of the form `[...]`.") } }; - let macro_name: option::t<istr> = none; + let macro_name: option::t<str> = none; let clauses: [@clause] = []; for arg: @expr in args { alt arg.node { expr_vec(elts, mut) { if vec::len(elts) != 2u { cx.span_fatal((*arg).span, - ~"extension clause must consist of [" + - ~"macro invocation, expansion body]"); + "extension clause must consist of [" + + "macro invocation, expansion body]"); } @@ -723,15 +714,15 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, some(other_id) { if id != other_id { cx.span_fatal(pth.span, - ~"macro name must be " + - ~"consistent"); + "macro name must be " + + "consistent"); } } } } none. { cx.span_fatal(pth.span, - ~"macro name must not be a path"); + "macro name must not be a path"); } } clauses += @@ -744,14 +735,14 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, } _ { cx.span_fatal(elts[0u].span, - ~"extension clause must" + - ~" start with a macro invocation."); + "extension clause must" + + " start with a macro invocation."); } } } _ { cx.span_fatal((*arg).span, - ~"extension must be [clause, " + ~" ...]"); + "extension must be [clause, " + " ...]"); } } } @@ -763,22 +754,22 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, some(id) { id } none. { cx.span_fatal(sp, - ~"macro definition must have " + - ~"at least one clause") + "macro definition must have " + + "at least one clause") } }, ext: normal(ext)}; fn generic_extension(cx: &ext_ctxt, sp: span, arg: @expr, - _body: &option::t<istr>, - clauses: [@clause]) -> @expr { + _body: &option::t<str>, clauses: [@clause]) -> + @expr { for c: @clause in clauses { alt use_selectors_to_bind(c.params, arg) { some(bindings) { ret transcribe(cx, bindings, c.body) } none. { cont; } } } - cx.span_fatal(sp, ~"no clauses match macro invocation"); + cx.span_fatal(sp, "no clauses match macro invocation"); } } diff --git a/src/comp/syntax/parse/eval.rs b/src/comp/syntax/parse/eval.rs index ee7c5a3d338..6535ecfe586 100644 --- a/src/comp/syntax/parse/eval.rs +++ b/src/comp/syntax/parse/eval.rs @@ -19,15 +19,14 @@ tag eval_mode { mode_depend; mode_parse; } type ctx = @{p: parser, mode: eval_mode, - mutable deps: [istr], + mutable deps: [str], sess: parser::parse_sess, mutable chpos: uint, mutable byte_pos: uint, cfg: ast::crate_cfg}; fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive], - prefix: &istr, - view_items: &mutable [@ast::view_item], + prefix: &str, view_items: &mutable [@ast::view_item], items: &mutable [@ast::item]) { for sub_cdir: @ast::crate_directive in cdirs { eval_crate_directive(cx, sub_cdir, prefix, view_items, items); @@ -35,34 +34,27 @@ fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive], } fn eval_crate_directives_to_mod(cx: ctx, cdirs: &[@ast::crate_directive], - prefix: &istr) -> ast::_mod { + prefix: &str) -> ast::_mod { let view_items: [@ast::view_item] = []; let items: [@ast::item] = []; eval_crate_directives(cx, cdirs, prefix, view_items, items); ret {view_items: view_items, items: items}; } -fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &istr, +fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &str, view_items: &mutable [@ast::view_item], items: &mutable [@ast::item]) { alt cdir.node { ast::cdir_src_mod(id, file_opt, attrs) { - let file_path = id + ~".rs"; - alt file_opt { - some(f) { - file_path = f; - } - none. { } - } - let full_path = if std::fs::path_is_absolute(file_path) { - file_path - } else { - prefix + std::fs::path_sep() + file_path - }; + let file_path = id + ".rs"; + alt file_opt { some(f) { file_path = f; } none. { } } + let full_path = + if std::fs::path_is_absolute(file_path) { + file_path + } else { prefix + std::fs::path_sep() + file_path }; if cx.mode == mode_depend { cx.deps += [full_path]; ret; } let p0 = - new_parser_from_file(cx.sess, cx.cfg, - full_path, cx.chpos, + new_parser_from_file(cx.sess, cx.cfg, full_path, cx.chpos, cx.byte_pos, SOURCE_FILE); let inner_attrs = parse_inner_attrs_and_next(p0); let mod_attrs = attrs + inner_attrs.inner; @@ -79,18 +71,11 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &istr, } ast::cdir_dir_mod(id, dir_opt, cdirs, attrs) { let path = id; - alt dir_opt { - some(d) { - path = d; - } - none. { } - } + alt dir_opt { some(d) { path = d; } none. { } } let full_path = if std::fs::path_is_absolute(path) { path - } else { - prefix + std::fs::path_sep() + path - }; + } else { prefix + std::fs::path_sep() + path }; let m0 = eval_crate_directives_to_mod(cx, cdirs, full_path); let i = @{ident: id, diff --git a/src/comp/syntax/parse/lexer.rs b/src/comp/syntax/parse/lexer.rs index e479377f3d7..f0d5bfeb729 100644 --- a/src/comp/syntax/parse/lexer.rs +++ b/src/comp/syntax/parse/lexer.rs @@ -19,29 +19,29 @@ type reader = fn next() -> char; fn init(); fn bump(); - fn get_str_from(uint) -> istr; - fn get_interner() -> @interner::interner<istr>; + fn get_str_from(uint) -> str; + fn get_interner() -> @interner::interner<str>; fn get_chpos() -> uint; fn get_byte_pos() -> uint; fn get_col() -> uint; fn get_filemap() -> codemap::filemap; - fn err(&istr); + fn err(&str); }; -fn new_reader(cm: &codemap::codemap, src: &istr, filemap: codemap::filemap, - itr: @interner::interner<istr>) -> reader { +fn new_reader(cm: &codemap::codemap, src: &str, filemap: codemap::filemap, + itr: @interner::interner<str>) -> reader { obj reader(cm: codemap::codemap, - src: istr, + src: str, len: uint, mutable col: uint, mutable pos: uint, mutable ch: char, mutable chpos: uint, - mutable strs: [istr], + mutable strs: [str], fm: codemap::filemap, - itr: @interner::interner<istr>) { + itr: @interner::interner<str>) { fn is_eof() -> bool { ret ch == -1 as char; } - fn get_str_from(start: uint) -> istr { + fn get_str_from(start: uint) -> str { // I'm pretty skeptical about this subtraction. What if there's a // multi-byte character before the mark? ret str::slice(src, start - 1u, pos - 1u); @@ -74,16 +74,14 @@ fn new_reader(cm: &codemap::codemap, src: &istr, filemap: codemap::filemap, ch = next.ch; } else { ch = -1 as char; } } - fn get_interner() -> @interner::interner<istr> { ret itr; } + fn get_interner() -> @interner::interner<str> { ret itr; } fn get_col() -> uint { ret col; } fn get_filemap() -> codemap::filemap { ret fm; } - fn err(m: &istr) { - codemap::emit_error( - some(ast_util::mk_sp(chpos, chpos)), - m, cm); + fn err(m: &str) { + codemap::emit_error(some(ast_util::mk_sp(chpos, chpos)), m, cm); } } - let strs: [istr] = []; + let strs: [str] = []; let rd = reader(cm, src, str::byte_len(src), 0u, 0u, -1 as char, filemap.start_pos.ch, strs, filemap, itr); @@ -148,9 +146,7 @@ fn consume_any_line_comment(rdr: &reader) { fn consume_block_comment(rdr: &reader) { let level: int = 1; while level > 0 { - if rdr.is_eof() { - rdr.err(~"unterminated block comment"); fail; - } + if rdr.is_eof() { rdr.err("unterminated block comment"); fail; } if rdr.curr() == '/' && rdr.next() == '*' { rdr.bump(); rdr.bump(); @@ -168,15 +164,15 @@ fn consume_block_comment(rdr: &reader) { be consume_whitespace_and_comments(rdr); } -fn digits_to_string(s: &istr) -> int { +fn digits_to_string(s: &str) -> int { let accum_int: int = 0; for c: u8 in s { accum_int *= 10; accum_int += dec_digit_val(c as char); } ret accum_int; } -fn scan_exponent(rdr: &reader) -> option::t<istr> { +fn scan_exponent(rdr: &reader) -> option::t<str> { let c = rdr.curr(); - let rslt = ~""; + let rslt = ""; if c == 'e' || c == 'E' { rslt += str::unsafe_from_bytes([c as u8]); rdr.bump(); @@ -188,13 +184,13 @@ fn scan_exponent(rdr: &reader) -> option::t<istr> { let exponent = scan_dec_digits(rdr); if str::byte_len(exponent) > 0u { ret some(rslt + exponent); - } else { rdr.err(~"scan_exponent: bad fp literal"); fail; } - } else { ret none::<istr>; } + } else { rdr.err("scan_exponent: bad fp literal"); fail; } + } else { ret none::<str>; } } -fn scan_dec_digits(rdr: &reader) -> istr { +fn scan_dec_digits(rdr: &reader) -> str { let c = rdr.curr(); - let rslt: istr = ~""; + let rslt: str = ""; while is_dec_digit(c) || c == '_' { if c != '_' { rslt += str::unsafe_from_bytes([c as u8]); } rdr.bump(); @@ -205,7 +201,7 @@ fn scan_dec_digits(rdr: &reader) -> istr { fn scan_number(c: char, rdr: &reader) -> token::token { let accum_int = 0; - let dec_str: istr = ~""; + let dec_str: str = ""; let is_dec_integer: bool = false; let n = rdr.next(); if c == '0' && n == 'x' { @@ -276,7 +272,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token { rdr.bump(); let dec_part = scan_dec_digits(rdr); - let float_str = dec_str + ~"." + dec_part; + let float_str = dec_str + "." + dec_part; c = rdr.curr(); let exponent_str = scan_exponent(rdr); alt exponent_str { some(s) { float_str += s; } none. { } } @@ -302,17 +298,15 @@ fn scan_number(c: char, rdr: &reader) -> token::token { } } else { - ret token::LIT_FLOAT(interner::intern::<istr>( - *rdr.get_interner(), - float_str)); + ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(), + float_str)); } } let maybe_exponent = scan_exponent(rdr); alt maybe_exponent { some(s) { - ret token::LIT_FLOAT(interner::intern::<istr>( - *rdr.get_interner(), - dec_str + s)); + ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(), + dec_str + s)); } none. { ret token::LIT_INT(accum_int); } } @@ -324,8 +318,7 @@ fn scan_numeric_escape(rdr: &reader, n_hex_digits: uint) -> char { let n = rdr.curr(); rdr.bump(); if !is_hex_digit(n) { - rdr.err( - #fmt["illegal numeric character escape: %d", n as int]); + rdr.err(#fmt["illegal numeric character escape: %d", n as int]); fail; } accum_int *= 16; @@ -344,7 +337,7 @@ fn next_token(rdr: &reader) -> {tok: token::token, chpos: uint, bpos: uint} { } fn next_token_inner(rdr: &reader) -> token::token { - let accum_str = ~""; + let accum_str = ""; let c = rdr.curr(); if is_alpha(c) || c == '_' { while is_alnum(c) || c == '_' { @@ -352,11 +345,10 @@ fn next_token_inner(rdr: &reader) -> token::token { rdr.bump(); c = rdr.curr(); } - if str::eq(accum_str, ~"_") { ret token::UNDERSCORE; } + if str::eq(accum_str, "_") { ret token::UNDERSCORE; } let is_mod_name = c == ':' && rdr.next() == ':'; - ret token::IDENT(interner::intern::<istr>( - *rdr.get_interner(), - accum_str), is_mod_name); + ret token::IDENT(interner::intern::<str>(*rdr.get_interner(), + accum_str), is_mod_name); } if is_dec_digit(c) { ret scan_number(c, rdr); } fn binop(rdr: &reader, op: token::binop) -> token::token { @@ -369,6 +361,7 @@ fn next_token_inner(rdr: &reader) -> token::token { alt c { + // One-byte tokens. '?' { rdr.bump(); @@ -408,6 +401,7 @@ fn next_token_inner(rdr: &reader) -> token::token { } + // Multi-byte tokens. '=' { rdr.bump(); @@ -468,15 +462,13 @@ fn next_token_inner(rdr: &reader) -> token::token { 'u' { c2 = scan_numeric_escape(rdr, 4u); } 'U' { c2 = scan_numeric_escape(rdr, 8u); } c2 { - rdr.err( - #fmt["unknown character escape: %d", - c2 as int]); + rdr.err(#fmt["unknown character escape: %d", c2 as int]); fail; } } } if rdr.curr() != '\'' { - rdr.err(~"unterminated character constant"); + rdr.err("unterminated character constant"); fail; } rdr.bump(); // advance curr past token @@ -509,9 +501,7 @@ fn next_token_inner(rdr: &reader) -> token::token { str::push_char(accum_str, scan_numeric_escape(rdr, 8u)); } c2 { - rdr.err( - #fmt["unknown string escape: %d", - c2 as int]); + rdr.err(#fmt["unknown string escape: %d", c2 as int]); fail; } } @@ -520,9 +510,8 @@ fn next_token_inner(rdr: &reader) -> token::token { } } rdr.bump(); - ret token::LIT_STR(interner::intern::<istr>( - *rdr.get_interner(), - accum_str)); + ret token::LIT_STR(interner::intern::<str>(*rdr.get_interner(), + accum_str)); } '-' { if rdr.next() == '>' { @@ -549,11 +538,7 @@ fn next_token_inner(rdr: &reader) -> token::token { '/' { ret binop(rdr, token::SLASH); } '^' { ret binop(rdr, token::CARET); } '%' { ret binop(rdr, token::PERCENT); } - c { - rdr.err( - #fmt["unkown start of token: %d", c as int]); - fail; - } + c { rdr.err(#fmt["unkown start of token: %d", c as int]); fail; } } } @@ -564,10 +549,10 @@ tag cmnt_style { blank_line; // Just a manual blank line "\n\n", for layout } -type cmnt = {style: cmnt_style, lines: [istr], pos: uint}; +type cmnt = {style: cmnt_style, lines: [str], pos: uint}; -fn read_to_eol(rdr: &reader) -> istr { - let val = ~""; +fn read_to_eol(rdr: &reader) -> str { + let val = ""; while rdr.curr() != '\n' && !rdr.is_eof() { str::push_char(val, rdr.curr()); rdr.bump(); @@ -576,7 +561,7 @@ fn read_to_eol(rdr: &reader) -> istr { ret val; } -fn read_one_line_comment(rdr: &reader) -> istr { +fn read_one_line_comment(rdr: &reader) -> str { let val = read_to_eol(rdr); assert (val[0] == '/' as u8 && val[1] == '/' as u8); ret val; @@ -594,7 +579,7 @@ fn consume_non_eol_whitespace(rdr: &reader) { fn push_blank_line_comment(rdr: &reader, comments: &mutable [cmnt]) { log ">>> blank-line comment"; - let v: [istr] = []; + let v: [str] = []; comments += [{style: blank_line, lines: v, pos: rdr.get_chpos()}]; } @@ -611,7 +596,7 @@ fn consume_whitespace_counting_blank_lines(rdr: &reader, fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt { log ">>> line comments"; let p = rdr.get_chpos(); - let lines: [istr] = []; + let lines: [str] = []; while rdr.curr() == '/' && rdr.next() == '/' { let line = read_one_line_comment(rdr); log line; @@ -624,52 +609,52 @@ fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt { pos: p}; } -fn all_whitespace(s: &istr, begin: uint, end: uint) -> bool { +fn all_whitespace(s: &str, begin: uint, end: uint) -> bool { let i: uint = begin; while i != end { if !is_whitespace(s[i] as char) { ret false; } i += 1u; } ret true; } -fn trim_whitespace_prefix_and_push_line(lines: &mutable [istr], s: &istr, +fn trim_whitespace_prefix_and_push_line(lines: &mutable [str], s: &str, col: uint) { let s1; if all_whitespace(s, 0u, col) { if col < str::byte_len(s) { s1 = str::slice(s, col, str::byte_len(s)); - } else { s1 = ~""; } + } else { s1 = ""; } } else { s1 = s; } - log ~"pushing line: " + s1; + log "pushing line: " + s1; lines += [s1]; } fn read_block_comment(rdr: &reader, code_to_the_left: bool) -> cmnt { log ">>> block comment"; let p = rdr.get_chpos(); - let lines: [istr] = []; + let lines: [str] = []; let col: uint = rdr.get_col(); rdr.bump(); rdr.bump(); - let curr_line = ~"/*"; + let curr_line = "/*"; let level: int = 1; while level > 0 { log #fmt["=== block comment level %d", level]; - if rdr.is_eof() { rdr.err(~"unterminated block comment"); fail; } + if rdr.is_eof() { rdr.err("unterminated block comment"); fail; } if rdr.curr() == '\n' { trim_whitespace_prefix_and_push_line(lines, curr_line, col); - curr_line = ~""; + curr_line = ""; rdr.bump(); } else { str::push_char(curr_line, rdr.curr()); if rdr.curr() == '/' && rdr.next() == '*' { rdr.bump(); rdr.bump(); - curr_line += ~"*"; + curr_line += "*"; level += 1; } else { if rdr.curr() == '*' && rdr.next() == '/' { rdr.bump(); rdr.bump(); - curr_line += ~"/"; + curr_line += "/"; level -= 1; } else { rdr.bump(); } } @@ -717,16 +702,14 @@ fn is_lit(t: &token::token) -> bool { } } -type lit = {lit: istr, pos: uint}; +type lit = {lit: str, pos: uint}; -fn gather_comments_and_literals(cm: &codemap::codemap, path: &istr, +fn gather_comments_and_literals(cm: &codemap::codemap, path: &str, srdr: io::reader) -> {cmnts: [cmnt], lits: [lit]} { let src = str::unsafe_from_bytes(srdr.read_whole_stream()); - let itr = @interner::mk::<istr>(str::hash, str::eq); - let rdr = new_reader(cm, src, - codemap::new_filemap( - path, 0u, 0u), itr); + let itr = @interner::mk::<str>(str::hash, str::eq); + let rdr = new_reader(cm, src, codemap::new_filemap(path, 0u, 0u), itr); let comments: [cmnt] = []; let literals: [lit] = []; let first_read: bool = true; @@ -748,7 +731,7 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: &istr, if is_lit(tok.tok) { literals += [{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}]; } - log ~"tok: " + token::to_str(rdr, tok.tok); + log "tok: " + token::to_str(rdr, tok.tok); first_read = false; } ret {cmnts: comments, lits: literals}; diff --git a/src/comp/syntax/parse/parser.rs b/src/comp/syntax/parse/parser.rs index 7be1d78d730..6c40115ecda 100644 --- a/src/comp/syntax/parse/parser.rs +++ b/src/comp/syntax/parse/parser.rs @@ -37,8 +37,8 @@ type parser = fn bump(); fn swap(token::token, uint, uint); fn look_ahead(uint) -> token::token; - fn fatal(&istr) -> ! ; - fn warn(&istr); + fn fatal(&str) -> ! ; + fn warn(&str); fn restrict(restriction); fn get_restriction() -> restriction; fn get_file_type() -> file_type; @@ -49,22 +49,21 @@ type parser = fn get_last_lo_pos() -> uint; fn get_last_hi_pos() -> uint; fn get_prec_table() -> @[op_spec]; - fn get_str(token::str_num) -> istr; + fn get_str(token::str_num) -> str; fn get_reader() -> lexer::reader; fn get_filemap() -> codemap::filemap; - fn get_bad_expr_words() -> hashmap<istr, ()>; + fn get_bad_expr_words() -> hashmap<str, ()>; fn get_chpos() -> uint; fn get_byte_pos() -> uint; fn get_id() -> node_id; fn get_sess() -> parse_sess; }; -fn new_parser_from_file(sess: parse_sess, cfg: &ast::crate_cfg, path: &istr, +fn new_parser_from_file(sess: parse_sess, cfg: &ast::crate_cfg, path: &str, chpos: uint, byte_pos: uint, ftype: file_type) -> parser { let src = io::read_whole_file_str(path); - let filemap = codemap::new_filemap( - path, chpos, byte_pos); + let filemap = codemap::new_filemap(path, chpos, byte_pos); sess.cm.files += [filemap]; let itr = @interner::mk(str::hash, str::eq); let rdr = lexer::new_reader(sess.cm, src, filemap, itr); @@ -83,7 +82,7 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader, mutable restr: restriction, rdr: lexer::reader, precs: @[op_spec], - bad_words: hashmap<istr, ()>) { + bad_words: hashmap<str, ()>) { fn peek() -> token::token { ret tok; } fn bump() { last_tok_span = tok_span; @@ -109,14 +108,12 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader, } ret buffer[distance - 1u].tok; } - fn fatal(m: &istr) -> ! { - codemap::emit_error(some(self.get_span()), - m, sess.cm); + fn fatal(m: &str) -> ! { + codemap::emit_error(some(self.get_span()), m, sess.cm); fail; } - fn warn(m: &istr) { - codemap::emit_warning(some(self.get_span()), - m, sess.cm); + fn warn(m: &str) { + codemap::emit_warning(some(self.get_span()), m, sess.cm); } fn restrict(r: restriction) { restr = r; } fn get_restriction() -> restriction { ret restr; } @@ -128,12 +125,12 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader, fn get_file_type() -> file_type { ret ftype; } fn get_cfg() -> ast::crate_cfg { ret cfg; } fn get_prec_table() -> @[op_spec] { ret precs; } - fn get_str(i: token::str_num) -> istr { + fn get_str(i: token::str_num) -> str { ret interner::get(*rdr.get_interner(), i); } fn get_reader() -> lexer::reader { ret rdr; } fn get_filemap() -> codemap::filemap { ret rdr.get_filemap(); } - fn get_bad_expr_words() -> hashmap<istr, ()> { ret bad_words; } + fn get_bad_expr_words() -> hashmap<str, ()> { ret bad_words; } fn get_chpos() -> uint { ret rdr.get_chpos(); } fn get_byte_pos() -> uint { ret rdr.get_byte_pos(); } fn get_id() -> node_id { ret next_node_id(sess); } @@ -148,48 +145,48 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader, // These are the words that shouldn't be allowed as value identifiers, // because, if used at the start of a line, they will cause the line to be // interpreted as a specific kind of statement, which would be confusing. -fn bad_expr_word_table() -> hashmap<istr, ()> { +fn bad_expr_word_table() -> hashmap<str, ()> { let words = new_str_hash(); - words.insert(~"mod", ()); - words.insert(~"if", ()); - words.insert(~"else", ()); - words.insert(~"while", ()); - words.insert(~"do", ()); - words.insert(~"alt", ()); - words.insert(~"for", ()); - words.insert(~"each", ()); - words.insert(~"break", ()); - words.insert(~"cont", ()); - words.insert(~"put", ()); - words.insert(~"ret", ()); - words.insert(~"be", ()); - words.insert(~"fail", ()); - words.insert(~"type", ()); - words.insert(~"resource", ()); - words.insert(~"check", ()); - words.insert(~"assert", ()); - words.insert(~"claim", ()); - words.insert(~"prove", ()); - words.insert(~"native", ()); - words.insert(~"fn", ()); - words.insert(~"lambda", ()); - words.insert(~"pure", ()); - words.insert(~"iter", ()); - words.insert(~"block", ()); - words.insert(~"import", ()); - words.insert(~"export", ()); - words.insert(~"let", ()); - words.insert(~"const", ()); - words.insert(~"log", ()); - words.insert(~"log_err", ()); - words.insert(~"tag", ()); - words.insert(~"obj", ()); - words.insert(~"copy", ()); + words.insert("mod", ()); + words.insert("if", ()); + words.insert("else", ()); + words.insert("while", ()); + words.insert("do", ()); + words.insert("alt", ()); + words.insert("for", ()); + words.insert("each", ()); + words.insert("break", ()); + words.insert("cont", ()); + words.insert("put", ()); + words.insert("ret", ()); + words.insert("be", ()); + words.insert("fail", ()); + words.insert("type", ()); + words.insert("resource", ()); + words.insert("check", ()); + words.insert("assert", ()); + words.insert("claim", ()); + words.insert("prove", ()); + words.insert("native", ()); + words.insert("fn", ()); + words.insert("lambda", ()); + words.insert("pure", ()); + words.insert("iter", ()); + words.insert("block", ()); + words.insert("import", ()); + words.insert("export", ()); + words.insert("let", ()); + words.insert("const", ()); + words.insert("log", ()); + words.insert("log_err", ()); + words.insert("tag", ()); + words.insert("obj", ()); + words.insert("copy", ()); ret words; } fn unexpected(p: &parser, t: token::token) -> ! { - let s: istr = ~"unexpected token: "; + let s: str = "unexpected token: "; s += token::to_str(p.get_reader(), t); p.fatal(s); } @@ -198,9 +195,9 @@ fn expect(p: &parser, t: token::token) { if p.peek() == t { p.bump(); } else { - let s: istr = ~"expecting "; + let s: str = "expecting "; s += token::to_str(p.get_reader(), t); - s += ~", found "; + s += ", found "; s += token::to_str(p.get_reader(), p.peek()); p.fatal(s); } @@ -214,9 +211,9 @@ fn expect_gt(p: &parser) { } else if p.peek() == token::BINOP(token::ASR) { p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u, p.get_hi_pos()); } else { - let s: istr = ~"expecting "; + let s: str = "expecting "; s += token::to_str(p.get_reader(), token::GT); - s += ~", found "; + s += ", found "; s += token::to_str(p.get_reader(), p.peek()); p.fatal(s); } @@ -228,11 +225,8 @@ fn spanned<@T>(lo: uint, hi: uint, node: &T) -> spanned<T> { fn parse_ident(p: &parser) -> ast::ident { alt p.peek() { - token::IDENT(i, _) { - p.bump(); - ret p.get_str(i); - } - _ { p.fatal(~"expecting ident"); } + token::IDENT(i, _) { p.bump(); ret p.get_str(i); } + _ { p.fatal("expecting ident"); } } } @@ -245,14 +239,14 @@ fn eat(p: &parser, tok: &token::token) -> bool { ret if p.peek() == tok { p.bump(); true } else { false }; } -fn is_word(p: &parser, word: &istr) -> bool { +fn is_word(p: &parser, word: &str) -> bool { ret alt p.peek() { token::IDENT(sid, false) { str::eq(word, p.get_str(sid)) } _ { false } }; } -fn eat_word(p: &parser, word: &istr) -> bool { +fn eat_word(p: &parser, word: &str) -> bool { alt p.peek() { token::IDENT(sid, false) { if str::eq(word, p.get_str(sid)) { @@ -264,10 +258,10 @@ fn eat_word(p: &parser, word: &istr) -> bool { } } -fn expect_word(p: &parser, word: &istr) { +fn expect_word(p: &parser, word: &str) { if !eat_word(p, word) { - p.fatal(~"expecting " + word + ~", found " + - token::to_str(p.get_reader(), p.peek())); + p.fatal("expecting " + word + ", found " + + token::to_str(p.get_reader(), p.peek())); } } @@ -276,7 +270,7 @@ fn check_bad_word(p: &parser) { token::IDENT(sid, false) { let w = p.get_str(sid); if p.get_bad_expr_words().contains_key(w) { - p.fatal(~"found " + w + ~" in expression position"); + p.fatal("found " + w + " in expression position"); } } _ { } @@ -294,7 +288,7 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ { let mode = ast::val; if p.peek() == token::BINOP(token::AND) { p.bump(); - mode = ast::alias(eat_word(p, ~"mutable")); + mode = ast::alias(eat_word(p, "mutable")); } let t = parse_ty(p, false); ret spanned(lo, t.span.hi, {mode: mode, ty: t}); @@ -323,11 +317,11 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ { } fn parse_proto(p: &parser) -> ast::proto { - if eat_word(p, ~"iter") { + if eat_word(p, "iter") { ret ast::proto_iter; - } else if eat_word(p, ~"fn") { + } else if eat_word(p, "fn") { ret ast::proto_fn; - } else if eat_word(p, ~"block") { + } else if eat_word(p, "block") { ret ast::proto_block; } else { unexpected(p, p.peek()); } } @@ -377,8 +371,7 @@ fn parse_ty_field(p: &parser) -> ast::ty_field { fn ident_index(p: &parser, args: &[ast::arg], i: &ast::ident) -> uint { let j = 0u; for a: ast::arg in args { if a.ident == i { ret j; } j += 1u; } - p.fatal(~"Unbound variable " + - i + ~" in constraint arg"); + p.fatal("Unbound variable " + i + " in constraint arg"); } fn parse_type_constr_arg(p: &parser) -> @ast::ty_constr_arg { @@ -467,7 +460,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool) idents: pth.node.idents, types: seq}), ann)); } - _ { p.fatal(~"type parameter instantiation only allowed for paths"); } + _ { p.fatal("type parameter instantiation only allowed for paths"); } } } @@ -484,43 +477,43 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty { let t: ast::ty_; // FIXME: do something with this - if eat_word(p, ~"bool") { + if eat_word(p, "bool") { t = ast::ty_bool; - } else if eat_word(p, ~"int") { + } else if eat_word(p, "int") { t = ast::ty_int; - } else if eat_word(p, ~"uint") { + } else if eat_word(p, "uint") { t = ast::ty_uint; - } else if eat_word(p, ~"float") { + } else if eat_word(p, "float") { t = ast::ty_float; - } else if eat_word(p, ~"str") { + } else if eat_word(p, "str") { t = ast::ty_istr; - } else if eat_word(p, ~"istr") { + } else if eat_word(p, "istr") { t = ast::ty_istr; - } else if eat_word(p, ~"char") { + } else if eat_word(p, "char") { t = ast::ty_char; /* } else if (eat_word(p, "task")) { t = ast::ty_task; */ - } else if eat_word(p, ~"i8") { + } else if eat_word(p, "i8") { t = ast::ty_machine(ast::ty_i8); - } else if eat_word(p, ~"i16") { + } else if eat_word(p, "i16") { t = ast::ty_machine(ast::ty_i16); - } else if eat_word(p, ~"i32") { + } else if eat_word(p, "i32") { t = ast::ty_machine(ast::ty_i32); - } else if eat_word(p, ~"i64") { + } else if eat_word(p, "i64") { t = ast::ty_machine(ast::ty_i64); - } else if eat_word(p, ~"u8") { + } else if eat_word(p, "u8") { t = ast::ty_machine(ast::ty_u8); - } else if eat_word(p, ~"u16") { + } else if eat_word(p, "u16") { t = ast::ty_machine(ast::ty_u16); - } else if eat_word(p, ~"u32") { + } else if eat_word(p, "u32") { t = ast::ty_machine(ast::ty_u32); - } else if eat_word(p, ~"u64") { + } else if eat_word(p, "u64") { t = ast::ty_machine(ast::ty_u64); - } else if eat_word(p, ~"f32") { + } else if eat_word(p, "f32") { t = ast::ty_machine(ast::ty_f32); - } else if eat_word(p, ~"f64") { + } else if eat_word(p, "f64") { t = ast::ty_machine(ast::ty_f64); } else if p.peek() == token::LPAREN { p.bump(); @@ -567,19 +560,19 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty { t = ast::ty_vec(parse_mt(p)); hi = p.get_hi_pos(); expect(p, token::RBRACKET); - } else if eat_word(p, ~"fn") { + } else if eat_word(p, "fn") { t = parse_ty_fn(ast::proto_fn, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if eat_word(p, ~"block") { + } else if eat_word(p, "block") { t = parse_ty_fn(ast::proto_block, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if eat_word(p, ~"iter") { + } else if eat_word(p, "iter") { t = parse_ty_fn(ast::proto_iter, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if eat_word(p, ~"obj") { + } else if eat_word(p, "obj") { t = parse_ty_obj(p, hi); - } else if eat_word(p, ~"mutable") { - p.warn(~"ignoring deprecated 'mutable' type constructor"); + } else if eat_word(p, "mutable") { + p.warn("ignoring deprecated 'mutable' type constructor"); let typ = parse_ty(p, false); t = typ.node; hi = typ.span.hi; @@ -587,13 +580,13 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty { let path = parse_path(p); t = ast::ty_path(path, p.get_id()); hi = path.span.hi; - } else { p.fatal(~"expecting type"); } + } else { p.fatal("expecting type"); } ret parse_ty_postfix(t, p, colons_before_params); } fn parse_arg_mode(p: &parser) -> ast::mode { if eat(p, token::BINOP(token::AND)) { - ast::alias(eat_word(p, ~"mutable")) + ast::alias(eat_word(p, "mutable")) } else if eat(p, token::BINOP(token::MINUS)) { ast::move } else { ast::val } @@ -685,9 +678,9 @@ fn parse_seq<T>(bra: token::token, ket: token::token, fn parse_lit(p: &parser) -> ast::lit { let sp = p.get_span(); let lit: ast::lit_ = ast::lit_nil; - if eat_word(p, ~"true") { + if eat_word(p, "true") { lit = ast::lit_bool(true); - } else if eat_word(p, ~"false") { + } else if eat_word(p, "false") { lit = ast::lit_bool(false); } else { alt p.peek() { @@ -706,10 +699,7 @@ fn parse_lit(p: &parser) -> ast::lit { lit = ast::lit_mach_float(tm, p.get_str(s)); } token::LIT_CHAR(c) { p.bump(); lit = ast::lit_char(c); } - token::LIT_STR(s) { - p.bump(); - lit = ast::lit_str(p.get_str(s)); - } + token::LIT_STR(s) { p.bump(); lit = ast::lit_str(p.get_str(s)); } token::LPAREN. { p.bump(); expect(p, token::RPAREN); @@ -777,7 +767,7 @@ fn parse_path_and_ty_param_substs(p: &parser) -> ast::path { } fn parse_mutability(p: &parser) -> ast::mutability { - if eat_word(p, ~"mutable") { + if eat_word(p, "mutable") { if p.peek() == token::QUES { p.bump(); ret ast::maybe_mut; } ret ast::mut; } @@ -825,12 +815,12 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { } else { ret mk_expr(p, lo, hi, ast::expr_tup(es)); } } else if p.peek() == token::LBRACE { p.bump(); - if is_word(p, ~"mutable") || + if is_word(p, "mutable") || is_plain_ident(p) && p.look_ahead(1u) == token::COLON { let fields = [parse_field(p, token::COLON)]; let base = none; while p.peek() != token::RBRACE { - if eat_word(p, ~"with") { base = some(parse_expr(p)); break; } + if eat_word(p, "with") { base = some(parse_expr(p)); break; } expect(p, token::COMMA); fields += [parse_field(p, token::COLON)]; } @@ -843,27 +833,27 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let blk = parse_block_tail(p, lo, ast::checked); ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk)); } - } else if eat_word(p, ~"if") { + } else if eat_word(p, "if") { ret parse_if_expr(p); - } else if eat_word(p, ~"for") { + } else if eat_word(p, "for") { ret parse_for_expr(p); - } else if eat_word(p, ~"while") { + } else if eat_word(p, "while") { ret parse_while_expr(p); - } else if eat_word(p, ~"do") { + } else if eat_word(p, "do") { ret parse_do_while_expr(p); - } else if eat_word(p, ~"alt") { + } else if eat_word(p, "alt") { ret parse_alt_expr(p); /* } else if (eat_word(p, "spawn")) { ret parse_spawn_expr(p); */ - } else if eat_word(p, ~"fn") { + } else if eat_word(p, "fn") { ret parse_fn_expr(p, ast::proto_fn); - } else if eat_word(p, ~"block") { + } else if eat_word(p, "block") { ret parse_fn_expr(p, ast::proto_block); - } else if eat_word(p, ~"lambda") { + } else if eat_word(p, "lambda") { ret parse_fn_expr(p, ast::proto_closure); - } else if eat_word(p, ~"unchecked") { + } else if eat_word(p, "unchecked") { expect(p, token::LBRACE); let blk = parse_block_tail(p, lo, ast::unchecked); ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk)); @@ -894,14 +884,12 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { token::LIT_STR(s) { let sp = p.get_span(); p.bump(); - let lit = - @{node: ast::lit_str(p.get_str(s)), - span: sp}; + let lit = @{node: ast::lit_str(p.get_str(s)), span: sp}; ex = ast::expr_lit(lit); } _ { ex = ast::expr_uniq(parse_expr(p)); } } - } else if eat_word(p, ~"obj") { + } else if eat_word(p, "obj") { // Anonymous object // Only make people type () if they're actually adding new fields @@ -916,7 +904,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let inner_obj: option::t<@ast::expr> = none; expect(p, token::LBRACE); while p.peek() != token::RBRACE { - if eat_word(p, ~"with") { + if eat_word(p, "with") { inner_obj = some(parse_expr(p)); } else { meths += [parse_method(p)]; } } @@ -930,7 +918,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { // "spanned". let ob = {fields: fields, methods: meths, inner_obj: inner_obj}; ex = ast::expr_anon_obj(ob); - } else if eat_word(p, ~"bind") { + } else if eat_word(p, "bind") { let e = parse_expr_res(p, RESTRICT_NO_CALL_EXPRS); fn parse_expr_opt(p: &parser) -> option::t<@ast::expr> { alt p.peek() { @@ -947,25 +935,25 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let ex_ext = parse_syntax_ext(p); hi = ex_ext.span.hi; ex = ex_ext.node; - } else if eat_word(p, ~"fail") { + } else if eat_word(p, "fail") { if can_begin_expr(p.peek()) { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_fail(some(e)); } else { ex = ast::expr_fail(none); } - } else if eat_word(p, ~"log") { + } else if eat_word(p, "log") { let e = parse_expr(p); ex = ast::expr_log(1, e); hi = e.span.hi; - } else if eat_word(p, ~"log_err") { + } else if eat_word(p, "log_err") { let e = parse_expr(p); ex = ast::expr_log(0, e); hi = e.span.hi; - } else if eat_word(p, ~"assert") { + } else if eat_word(p, "assert") { let e = parse_expr(p); ex = ast::expr_assert(e); hi = e.span.hi; - } else if eat_word(p, ~"check") { + } else if eat_word(p, "check") { /* Should be a predicate (pure boolean function) applied to arguments that are all either slot variables or literals. but the typechecker enforces that. */ @@ -973,7 +961,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_check(ast::checked, e); - } else if eat_word(p, ~"claim") { + } else if eat_word(p, "claim") { /* Same rules as check, except that if check-claims is enabled (a command-line flag), then the parser turns claims into check */ @@ -981,19 +969,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_check(ast::unchecked, e); - } else if eat_word(p, ~"ret") { + } else if eat_word(p, "ret") { if can_begin_expr(p.peek()) { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_ret(some(e)); } else { ex = ast::expr_ret(none); } - } else if eat_word(p, ~"break") { + } else if eat_word(p, "break") { ex = ast::expr_break; hi = p.get_hi_pos(); - } else if eat_word(p, ~"cont") { + } else if eat_word(p, "cont") { ex = ast::expr_cont; hi = p.get_hi_pos(); - } else if eat_word(p, ~"put") { + } else if eat_word(p, "put") { alt p.peek() { token::SEMI. { ex = ast::expr_put(none); } _ { @@ -1002,19 +990,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { ex = ast::expr_put(some(e)); } } - } else if eat_word(p, ~"be") { + } else if eat_word(p, "be") { let e = parse_expr(p); // FIXME: Is this the right place for this check? if /*check*/ast_util::is_call_expr(e) { hi = e.span.hi; ex = ast::expr_be(e); - } else { p.fatal(~"Non-call expression in tail call"); } - } else if eat_word(p, ~"copy") { + } else { p.fatal("Non-call expression in tail call"); } + } else if eat_word(p, "copy") { let e = parse_expr(p); ex = ast::expr_copy(e); hi = e.span.hi; - } else if eat_word(p, ~"self") { + } else if eat_word(p, "self") { expect(p, token::DOT); // The rest is a call expression. let f: @ast::expr = parse_self_method(p); @@ -1024,8 +1012,8 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { hi = es.span.hi; ex = ast::expr_call(f, es.node); } else if p.peek() == token::MOD_SEP || - is_ident(p.peek()) && !is_word(p, ~"true") && - !is_word(p, ~"false") { + is_ident(p.peek()) && !is_word(p, "true") && + !is_word(p, "false") { check_bad_word(p); let pth = parse_path_and_ty_param_substs(p); hi = pth.span.hi; @@ -1047,7 +1035,7 @@ fn parse_syntax_ext(p: &parser) -> @ast::expr { fn parse_syntax_ext_naked(p: &parser, lo: uint) -> @ast::expr { let pth = parse_path(p); if vec::len(pth.node.idents) == 0u { - p.fatal(~"expected a syntax expander name"); + p.fatal("expected a syntax expander name"); } //temporary for a backwards-compatible cycle: let es = @@ -1105,9 +1093,7 @@ fn parse_dot_or_call_expr_with(p: &parser, e: @ast::expr) -> @ast::expr { token::IDENT(i, _) { hi = p.get_hi_pos(); p.bump(); - e = mk_expr(p, lo, hi, - ast::expr_field( - e, p.get_str(i))); + e = mk_expr(p, lo, hi, ast::expr_field(e, p.get_str(i))); } t { unexpected(p, t); } } @@ -1119,8 +1105,8 @@ fn parse_dot_or_call_expr_with(p: &parser, e: @ast::expr) -> @ast::expr { } fn parse_prefix_expr(p: &parser) -> @ast::expr { - if eat_word(p, ~"mutable") { - p.warn(~"ignoring deprecated 'mutable' prefix operator"); + if eat_word(p, "mutable") { + p.warn("ignoring deprecated 'mutable' prefix operator"); } let lo = p.get_lo_pos(); let hi = p.get_hi_pos(); @@ -1223,7 +1209,7 @@ fn parse_more_binops(p: &parser, lhs: @ast::expr, min_prec: int) -> ret parse_more_binops(p, bin, min_prec); } } - if as_prec > min_prec && eat_word(p, ~"as") { + if as_prec > min_prec && eat_word(p, "as") { let rhs = parse_ty(p, true); let _as = mk_expr(p, lhs.span.lo, rhs.span.hi, ast::expr_cast(lhs, rhs)); @@ -1286,7 +1272,7 @@ fn parse_if_expr_1(p: &parser) -> let thn = parse_block(p); let els: option::t<@ast::expr> = none; let hi = thn.span.hi; - if eat_word(p, ~"else") { + if eat_word(p, "else") { let elexpr = parse_else_expr(p); els = some(elexpr); hi = elexpr.span.hi; @@ -1295,7 +1281,7 @@ fn parse_if_expr_1(p: &parser) -> } fn parse_if_expr(p: &parser) -> @ast::expr { - if eat_word(p, ~"check") { + if eat_word(p, "check") { let q = parse_if_expr_1(p); ret mk_expr(p, q.lo, q.hi, ast::expr_if_check(q.cond, q.then, q.els)); } else { @@ -1321,7 +1307,7 @@ fn parse_fn_block_expr(p: &parser) -> @ast::expr { } fn parse_else_expr(p: &parser) -> @ast::expr { - if eat_word(p, ~"if") { + if eat_word(p, "if") { ret parse_if_expr(p); } else { let blk = parse_block(p); @@ -1331,9 +1317,9 @@ fn parse_else_expr(p: &parser) -> @ast::expr { fn parse_for_expr(p: &parser) -> @ast::expr { let lo = p.get_last_lo_pos(); - let is_each = eat_word(p, ~"each"); + let is_each = eat_word(p, "each"); let decl = parse_local(p, false); - expect_word(p, ~"in"); + expect_word(p, "in"); let seq = parse_expr(p); let body = parse_block(p); let hi = body.span.hi; @@ -1353,7 +1339,7 @@ fn parse_while_expr(p: &parser) -> @ast::expr { fn parse_do_while_expr(p: &parser) -> @ast::expr { let lo = p.get_last_lo_pos(); let body = parse_block(p); - expect_word(p, ~"while"); + expect_word(p, "while"); let cond = parse_expr(p); let hi = cond.span.hi; ret mk_expr(p, lo, hi, ast::expr_do_while(body, cond)); @@ -1367,9 +1353,7 @@ fn parse_alt_expr(p: &parser) -> @ast::expr { while p.peek() != token::RBRACE { let pats = parse_pats(p); let guard = none; - if eat_word(p, ~"when") { - guard = some(parse_expr(p)); - } + if eat_word(p, "when") { guard = some(parse_expr(p)); } let blk = parse_block(p); arms += [{pats: pats, guard: guard, body: blk}]; } @@ -1402,6 +1386,7 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> { } + // Now that the the channel is the first argument to receive, // combining it with an initializer doesn't really make sense. // case (token::RECV) { @@ -1447,8 +1432,8 @@ fn parse_pat(p: &parser) -> @ast::pat { if p.peek() == token::UNDERSCORE { p.bump(); if p.peek() != token::RBRACE { - p.fatal(~"expecting }, found " + - token::to_str(p.get_reader(), p.peek())); + p.fatal("expecting }, found " + + token::to_str(p.get_reader(), p.peek())); } etc = true; break; @@ -1461,8 +1446,7 @@ fn parse_pat(p: &parser) -> @ast::pat { subpat = parse_pat(p); } else { if p.get_bad_expr_words().contains_key(fieldname) { - p.fatal(~"found " + fieldname - + ~" in binding position"); + p.fatal("found " + fieldname + " in binding position"); } subpat = @{id: p.get_id(), @@ -1501,17 +1485,15 @@ fn parse_pat(p: &parser) -> @ast::pat { token::LIT_STR(s) { let sp = p.get_span(); p.bump(); - let lit = - @{node: ast::lit_str(p.get_str(s)), - span: sp}; + let lit = @{node: ast::lit_str(p.get_str(s)), span: sp}; hi = lit.span.hi; pat = ast::pat_lit(lit); } - _ { p.fatal(~"expected string literal"); } + _ { p.fatal("expected string literal"); } } } tok { - if !is_ident(tok) || is_word(p, ~"true") || is_word(p, ~"false") { + if !is_ident(tok) || is_word(p, "true") || is_word(p, "false") { let lit = parse_lit(p); hi = lit.span.hi; pat = ast::pat_lit(@lit); @@ -1580,7 +1562,7 @@ fn parse_crate_stmt(p: &parser) -> @ast::stmt { fn parse_source_stmt(p: &parser) -> @ast::stmt { let lo = p.get_lo_pos(); - if eat_word(p, ~"let") { + if eat_word(p, "let") { let decl = parse_let(p); ret @spanned(lo, decl.span.hi, ast::stmt_decl(decl, p.get_id())); } else { @@ -1600,7 +1582,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt { if vec::len(item_attrs) > 0u { alt maybe_item { some(_) {/* fallthrough */ } - _ { ret p.fatal(~"expected item"); } + _ { ret p.fatal("expected item"); } } } @@ -1616,7 +1598,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt { let e = parse_expr(p); ret @spanned(lo, e.span.hi, ast::stmt_expr(e, p.get_id())); } - _ { p.fatal(~"expected statement"); } + _ { p.fatal("expected statement"); } } } } @@ -1677,6 +1659,7 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool { } + // We should not be calling this on a cdir. ast::stmt_crate_directive(cdir) { fail; @@ -1686,10 +1669,9 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool { fn parse_block(p: &parser) -> ast::blk { let lo = p.get_lo_pos(); - if eat_word(p, ~"unchecked") { + if eat_word(p, "unchecked") { be parse_block_tail(p, lo, ast::unchecked); - } - else { + } else { expect(p, token::LBRACE); be parse_block_tail(p, lo, ast::checked); } @@ -1716,8 +1698,8 @@ fn parse_block_tail(p: &parser, lo: uint, s: ast::check_mode) -> ast::blk { token::RBRACE. { expr = some(e); } t { if stmt_ends_with_semi(*stmt) { - p.fatal(~"expected ';' or '}' after " + - ~"expression but found " + + p.fatal("expected ';' or '}' after " + + "expression but found " + token::to_str(p.get_reader(), t)); } stmts += [stmt]; @@ -1935,7 +1917,7 @@ fn parse_mod_items(p: &parser, term: token::token, alt parse_item(p, attrs) { some(i) { items += [i]; } _ { - p.fatal(~"expected item but found " + + p.fatal("expected item but found " + token::to_str(p.get_reader(), p.peek())); } } @@ -1985,10 +1967,7 @@ fn parse_item_native_fn(p: &parser, attrs: &[ast::attribute]) -> let t = parse_fn_header(p); let decl = parse_fn_decl(p, ast::impure_fn, ast::il_normal); let link_name = none; - if p.peek() == token::EQ { - p.bump(); - link_name = some(parse_str(p)); - } + if p.peek() == token::EQ { p.bump(); link_name = some(parse_str(p)); } let hi = p.get_hi_pos(); expect(p, token::SEMI); ret @{ident: t.ident, @@ -2000,15 +1979,14 @@ fn parse_item_native_fn(p: &parser, attrs: &[ast::attribute]) -> fn parse_native_item(p: &parser, attrs: &[ast::attribute]) -> @ast::native_item { - if eat_word(p, ~"type") { + if eat_word(p, "type") { ret parse_item_native_type(p, attrs); - } else if eat_word(p, ~"fn") { + } else if eat_word(p, "fn") { ret parse_item_native_fn(p, attrs); } else { unexpected(p, p.peek()); } } -fn parse_native_mod_items(p: &parser, native_name: &istr, - abi: ast::native_abi, +fn parse_native_mod_items(p: &parser, native_name: &str, abi: ast::native_abi, first_item_attrs: &[ast::attribute]) -> ast::native_mod { // Shouldn't be any view items since we've already parsed an item attr @@ -2032,20 +2010,20 @@ fn parse_native_mod_items(p: &parser, native_name: &istr, fn parse_item_native_mod(p: &parser, attrs: &[ast::attribute]) -> @ast::item { let lo = p.get_last_lo_pos(); let abi = ast::native_abi_cdecl; - if !is_word(p, ~"mod") { + if !is_word(p, "mod") { let t = parse_str(p); - if str::eq(t, ~"cdecl") { - } else if str::eq(t, ~"rust") { + if str::eq(t, "cdecl") { + } else if str::eq(t, "rust") { abi = ast::native_abi_rust; - } else if str::eq(t, ~"llvm") { + } else if str::eq(t, "llvm") { abi = ast::native_abi_llvm; - } else if str::eq(t, ~"rust-intrinsic") { + } else if str::eq(t, "rust-intrinsic") { abi = ast::native_abi_rust_intrinsic; - } else if str::eq(t, ~"x86stdcall") { + } else if str::eq(t, "x86stdcall") { abi = ast::native_abi_x86stdcall; - } else { p.fatal(~"unsupported abi: " + t); } + } else { p.fatal("unsupported abi: " + t); } } - expect_word(p, ~"mod"); + expect_word(p, "mod"); let id = parse_ident(p); let native_name; if p.peek() == token::EQ { @@ -2087,8 +2065,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { // Newtype syntax if p.peek() == token::EQ { if p.get_bad_expr_words().contains_key(id) { - p.fatal(~"found " + id - + ~" in tag constructor position"); + p.fatal("found " + id + " in tag constructor position"); } p.bump(); let ty = parse_ty(p, false); @@ -2125,13 +2102,12 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { } expect(p, token::SEMI); p.get_id(); - let vr = {name: p.get_str(name), - args: args, id: p.get_id()}; + let vr = {name: p.get_str(name), args: args, id: p.get_id()}; variants += [spanned(vlo, vhi, vr)]; } token::RBRACE. {/* empty */ } _ { - p.fatal(~"expected name of variant or '}' but found " + + p.fatal("expected name of variant or '}' but found " + token::to_str(p.get_reader(), tok)); } } @@ -2142,42 +2118,42 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { } fn parse_auth(p: &parser) -> ast::_auth { - if eat_word(p, ~"unsafe") { + if eat_word(p, "unsafe") { ret ast::auth_unsafe; } else { unexpected(p, p.peek()); } } fn parse_item(p: &parser, attrs: &[ast::attribute]) -> option::t<@ast::item> { - if eat_word(p, ~"const") { + if eat_word(p, "const") { ret some(parse_item_const(p, attrs)); - } else if eat_word(p, ~"inline") { - expect_word(p, ~"fn"); + } else if eat_word(p, "inline") { + expect_word(p, "fn"); ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn, attrs, ast::il_inline)); - } else if is_word(p, ~"fn") && p.look_ahead(1u) != token::LPAREN { + } else if is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN { p.bump(); ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn, attrs, ast::il_normal)); - } else if eat_word(p, ~"pure") { - expect_word(p, ~"fn"); + } else if eat_word(p, "pure") { + expect_word(p, "fn"); ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn, attrs, ast::il_normal)); - } else if eat_word(p, ~"iter") { + } else if eat_word(p, "iter") { ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_iter, attrs, ast::il_normal)); - } else if eat_word(p, ~"mod") { + } else if eat_word(p, "mod") { ret some(parse_item_mod(p, attrs)); - } else if eat_word(p, ~"native") { + } else if eat_word(p, "native") { ret some(parse_item_native_mod(p, attrs)); } - if eat_word(p, ~"type") { + if eat_word(p, "type") { ret some(parse_item_type(p, attrs)); - } else if eat_word(p, ~"tag") { + } else if eat_word(p, "tag") { ret some(parse_item_tag(p, attrs)); - } else if is_word(p, ~"obj") && p.look_ahead(1u) != token::LPAREN { + } else if is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN { p.bump(); ret some(parse_item_obj(p, attrs)); - } else if eat_word(p, ~"resource") { + } else if eat_word(p, "resource") { ret some(parse_item_res(p, attrs)); } else { ret none; } } @@ -2297,18 +2273,19 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident, alt p.peek() { token::SEMI. { break; } token::MOD_SEP. { - if glob { p.fatal(~"cannot path into a glob"); } + if glob { p.fatal("cannot path into a glob"); } if option::is_some(from_idents) { - p.fatal(~"cannot path into import list"); + p.fatal("cannot path into import list"); } p.bump(); } - _ { p.fatal(~"expecting '::' or ';'"); } + _ { p.fatal("expecting '::' or ';'"); } } alt p.peek() { token::IDENT(_, _) { identifiers += [parse_ident(p)]; } + //the lexer can't tell the different kinds of stars apart ) : token::BINOP(token::STAR.) { glob = true; @@ -2316,6 +2293,7 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident, } + token::LBRACE. { fn parse_import_ident(p: &parser) -> ast::import_ident { let lo = p.get_lo_pos(); @@ -2327,22 +2305,23 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident, parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA), parse_import_ident, p).node; if vec::is_empty(from_idents_) { - p.fatal(~"at least one import is required"); + p.fatal("at least one import is required"); } from_idents = some(from_idents_); } + _ { - p.fatal(~"expecting an identifier, or '*'"); + p.fatal("expecting an identifier, or '*'"); } } } alt def_ident { some(i) { - if glob { p.fatal(~"globbed imports can't be renamed"); } + if glob { p.fatal("globbed imports can't be renamed"); } if option::is_some(from_idents) { - p.fatal(~"can't rename import list"); + p.fatal("can't rename import list"); } ret ast::view_item_import(i, identifiers, p.get_id()); } @@ -2367,10 +2346,9 @@ fn parse_full_import_name(p: &parser, def_ident: &ast::ident) -> alt p.peek() { token::IDENT(i, _) { p.bump(); - ret parse_rest_import_name( - p, p.get_str(i), some(def_ident)); + ret parse_rest_import_name(p, p.get_str(i), some(def_ident)); } - _ { p.fatal(~"expecting an identifier"); } + _ { p.fatal("expecting an identifier"); } } } @@ -2383,13 +2361,10 @@ fn parse_import(p: &parser) -> ast::view_item_ { p.bump(); ret parse_full_import_name(p, p.get_str(i)); } - _ { - ret parse_rest_import_name( - p, p.get_str(i), none); - } + _ { ret parse_rest_import_name(p, p.get_str(i), none); } } } - _ { p.fatal(~"expecting an identifier"); } + _ { p.fatal("expecting an identifier"); } } } @@ -2403,11 +2378,11 @@ fn parse_export(p: &parser) -> ast::view_item_ { fn parse_view_item(p: &parser) -> @ast::view_item { let lo = p.get_lo_pos(); let the_item = - if eat_word(p, ~"use") { + if eat_word(p, "use") { parse_use(p) - } else if eat_word(p, ~"import") { + } else if eat_word(p, "import") { parse_import(p) - } else if eat_word(p, ~"export") { parse_export(p) } else { fail }; + } else if eat_word(p, "export") { parse_export(p) } else { fail }; let hi = p.get_lo_pos(); expect(p, token::SEMI); ret @spanned(lo, hi, the_item); @@ -2417,8 +2392,8 @@ fn is_view_item(p: &parser) -> bool { alt p.peek() { token::IDENT(sid, false) { let st = p.get_str(sid); - ret str::eq(st, ~"use") || str::eq(st, ~"import") || - str::eq(st, ~"export"); + ret str::eq(st, "use") || str::eq(st, "import") || + str::eq(st, "export"); } _ { ret false; } } @@ -2436,21 +2411,19 @@ fn parse_native_view(p: &parser) -> [@ast::view_item] { ret items; } -fn parse_crate_from_source_file(input: &istr, cfg: &ast::crate_cfg, +fn parse_crate_from_source_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess) -> @ast::crate { let p = new_parser_from_file(sess, cfg, input, 0u, 0u, SOURCE_FILE); ret parse_crate_mod(p, cfg); } -fn parse_crate_from_source_str(name: &istr, source: &istr, - cfg: &ast::crate_cfg, +fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg, sess: &parse_sess) -> @ast::crate { let ftype = SOURCE_FILE; let filemap = codemap::new_filemap(name, 0u, 0u); sess.cm.files += [filemap]; let itr = @interner::mk(str::hash, str::eq); - let rdr = lexer::new_reader(sess.cm, source, - filemap, itr); + let rdr = lexer::new_reader(sess.cm, source, filemap, itr); let p = new_parser(sess, cfg, rdr, ftype); ret parse_crate_mod(p, cfg); } @@ -2468,7 +2441,7 @@ fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) -> @ast::crate { config: p.get_cfg()}); } -fn parse_str(p: &parser) -> istr { +fn parse_str(p: &parser) -> str { alt p.peek() { token::LIT_STR(s) { p.bump(); ret p.get_str(s); } _ { fail; } @@ -2489,8 +2462,8 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> let expect_mod = vec::len(outer_attrs) > 0u; let lo = p.get_lo_pos(); - if expect_mod || is_word(p, ~"mod") { - expect_word(p, ~"mod"); + if expect_mod || is_word(p, "mod") { + expect_word(p, "mod"); let id = parse_ident(p); let file_opt = alt p.peek() { @@ -2500,6 +2473,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> alt p.peek() { + // mod x = "foo.rs"; token::SEMI. { let hi = p.get_hi_pos(); @@ -2508,6 +2482,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> } + // mod x = "foo_dir" { ...directives... } token::LBRACE. { p.bump(); @@ -2523,7 +2498,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> } t { unexpected(p, t); } } - } else if eat_word(p, ~"auth") { + } else if eat_word(p, "auth") { let n = parse_path(p); expect(p, token::EQ); let a = parse_auth(p); @@ -2533,7 +2508,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> } else if is_view_item(p) { let vi = parse_view_item(p); ret spanned(lo, vi.span.hi, ast::cdir_view_item(vi)); - } else { ret p.fatal(~"expected crate directive"); } + } else { ret p.fatal("expected crate directive"); } } fn parse_crate_directives(p: &parser, term: token::token, @@ -2544,7 +2519,7 @@ fn parse_crate_directives(p: &parser, term: token::token, // seeing the terminator next, so if we do see it then fail the same way // parse_crate_directive would if vec::len(first_outer_attr) > 0u && p.peek() == term { - expect_word(p, ~"mod"); + expect_word(p, "mod"); } let cdirs: [@ast::crate_directive] = []; @@ -2555,17 +2530,16 @@ fn parse_crate_directives(p: &parser, term: token::token, ret cdirs; } -fn parse_crate_from_crate_file(input: &istr, cfg: &ast::crate_cfg, +fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess) -> @ast::crate { let p = new_parser_from_file(sess, cfg, input, 0u, 0u, CRATE_FILE); let lo = p.get_lo_pos(); - let prefix = - std::fs::dirname(p.get_filemap().name); + let prefix = std::fs::dirname(p.get_filemap().name); let leading_attrs = parse_inner_attrs_and_next(p); let crate_attrs = leading_attrs.inner; let first_cdir_attr = leading_attrs.next; let cdirs = parse_crate_directives(p, token::EOF, first_cdir_attr); - let deps: [istr] = []; + let deps: [str] = []; let cx = @{p: p, mode: eval::mode_parse, @@ -2584,15 +2558,14 @@ fn parse_crate_from_crate_file(input: &istr, cfg: &ast::crate_cfg, config: p.get_cfg()}); } -fn parse_crate_from_file(input: &istr, cfg: &ast::crate_cfg, - sess: &parse_sess) -> @ast::crate { - if str::ends_with(input, ~".rc") { +fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess) + -> @ast::crate { + if str::ends_with(input, ".rc") { parse_crate_from_crate_file(input, cfg, sess) - } else if str::ends_with(input, ~".rs") { + } else if str::ends_with(input, ".rs") { parse_crate_from_source_file(input, cfg, sess) } else { - codemap::emit_error(none, ~"unknown input file type: " - + input, + codemap::emit_error(none, "unknown input file type: " + input, sess.cm); fail } diff --git a/src/comp/syntax/parse/token.rs b/src/comp/syntax/parse/token.rs index 24d2a3b9a6f..153f5236c4b 100644 --- a/src/comp/syntax/parse/token.rs +++ b/src/comp/syntax/parse/token.rs @@ -84,62 +84,64 @@ tag token { EOF; } -fn binop_to_str(o: binop) -> istr { +fn binop_to_str(o: binop) -> str { alt o { - PLUS. { ret ~"+"; } - MINUS. { ret ~"-"; } - STAR. { ret ~"*"; } - SLASH. { ret ~"/"; } - PERCENT. { ret ~"%"; } - CARET. { ret ~"^"; } - AND. { ret ~"&"; } - OR. { ret ~"|"; } - LSL. { ret ~"<<"; } - LSR. { ret ~">>"; } - ASR. { ret ~">>>"; } + PLUS. { ret "+"; } + MINUS. { ret "-"; } + STAR. { ret "*"; } + SLASH. { ret "/"; } + PERCENT. { ret "%"; } + CARET. { ret "^"; } + AND. { ret "&"; } + OR. { ret "|"; } + LSL. { ret "<<"; } + LSR. { ret ">>"; } + ASR. { ret ">>>"; } } } -fn to_str(r: lexer::reader, t: token) -> istr { +fn to_str(r: lexer::reader, t: token) -> str { alt t { - EQ. { ret ~"="; } - LT. { ret ~"<"; } - LE. { ret ~"<="; } - EQEQ. { ret ~"=="; } - NE. { ret ~"!="; } - GE. { ret ~">="; } - GT. { ret ~">"; } - NOT. { ret ~"!"; } - TILDE. { ret ~"~"; } - OROR. { ret ~"||"; } - ANDAND. { ret ~"&&"; } + EQ. { ret "="; } + LT. { ret "<"; } + LE. { ret "<="; } + EQEQ. { ret "=="; } + NE. { ret "!="; } + GE. { ret ">="; } + GT. { ret ">"; } + NOT. { ret "!"; } + TILDE. { ret "~"; } + OROR. { ret "||"; } + ANDAND. { ret "&&"; } BINOP(op) { ret binop_to_str(op); } - BINOPEQ(op) { ret binop_to_str(op) + ~"="; } + BINOPEQ(op) { ret binop_to_str(op) + "="; } + /* Structural symbols */ AT. { - ret ~"@"; + ret "@"; } - DOT. { ret ~"."; } - ELLIPSIS. { ret ~"..."; } - COMMA. { ret ~","; } - SEMI. { ret ~";"; } - COLON. { ret ~":"; } - MOD_SEP. { ret ~"::"; } - QUES. { ret ~"?"; } - RARROW. { ret ~"->"; } - LARROW. { ret ~"<-"; } - DARROW. { ret ~"<->"; } - LPAREN. { ret ~"("; } - RPAREN. { ret ~")"; } - LBRACKET. { ret ~"["; } - RBRACKET. { ret ~"]"; } - LBRACE. { ret ~"{"; } - RBRACE. { ret ~"}"; } - POUND. { ret ~"#"; } - POUND_LBRACE. { ret ~"#{"; } - POUND_LT. { ret ~"#<"; } + DOT. { ret "."; } + ELLIPSIS. { ret "..."; } + COMMA. { ret ","; } + SEMI. { ret ";"; } + COLON. { ret ":"; } + MOD_SEP. { ret "::"; } + QUES. { ret "?"; } + RARROW. { ret "->"; } + LARROW. { ret "<-"; } + DARROW. { ret "<->"; } + LPAREN. { ret "("; } + RPAREN. { ret ")"; } + LBRACKET. { ret "["; } + RBRACKET. { ret "]"; } + LBRACE. { ret "{"; } + RBRACE. { ret "}"; } + POUND. { ret "#"; } + POUND_LBRACE. { ret "#{"; } + POUND_LT. { ret "#<"; } + /* Literals */ @@ -148,39 +150,35 @@ fn to_str(r: lexer::reader, t: token) -> istr { } LIT_UINT(u) { ret uint::to_str(u, 10u); } LIT_MACH_INT(tm, i) { - ret int::to_str(i, 10u) + ~"_" + ty_mach_to_str(tm); + ret int::to_str(i, 10u) + "_" + ty_mach_to_str(tm); } LIT_MACH_FLOAT(tm, s) { - ret interner::get::<istr>( - *r.get_interner(), s) + ~"_" + - ty_mach_to_str(tm); - } - LIT_FLOAT(s) { - ret interner::get::<istr>(*r.get_interner(), s); + ret interner::get::<str>(*r.get_interner(), s) + "_" + + ty_mach_to_str(tm); } + LIT_FLOAT(s) { ret interner::get::<str>(*r.get_interner(), s); } LIT_STR(s) { // FIXME: escape. - ret ~"\"" + - interner::get::<istr>(*r.get_interner(), s) - + ~"\""; + ret "\"" + interner::get::<str>(*r.get_interner(), s) + "\""; } LIT_CHAR(c) { // FIXME: escape. - let tmp = ~"'"; + let tmp = "'"; str::push_char(tmp, c); str::push_byte(tmp, '\'' as u8); ret tmp; } - LIT_BOOL(b) { if b { ret ~"true"; } else { ret ~"false"; } } + LIT_BOOL(b) { if b { ret "true"; } else { ret "false"; } } + /* Name components */ IDENT(s, _) { - ret interner::get::<istr>(*r.get_interner(), s); + ret interner::get::<str>(*r.get_interner(), s); } - IDX(i) { ret ~"_" + int::to_str(i, 10u); } - UNDERSCORE. { ret ~"_"; } - BRACEQUOTE(_) { ret ~"<bracequote>"; } - EOF. { ret ~"<eof>"; } + IDX(i) { ret "_" + int::to_str(i, 10u); } + UNDERSCORE. { ret "_"; } + BRACEQUOTE(_) { ret "<bracequote>"; } + EOF. { ret "<eof>"; } } } diff --git a/src/comp/syntax/print/pp.rs b/src/comp/syntax/print/pp.rs index ef92672435a..fad670fbefb 100644 --- a/src/comp/syntax/print/pp.rs +++ b/src/comp/syntax/print/pp.rs @@ -61,35 +61,33 @@ type break_t = {offset: int, blank_space: int}; type begin_t = {offset: int, breaks: breaks}; -tag token { STRING(istr, int); BREAK(break_t); BEGIN(begin_t); END; EOF; } +tag token { STRING(str, int); BREAK(break_t); BEGIN(begin_t); END; EOF; } -fn tok_str(t: token) -> istr { +fn tok_str(t: token) -> str { alt t { - STRING(s, len) { - ret #fmt[~"STR(%s,%d)", s, len]; - } - BREAK(_) { ret ~"BREAK"; } - BEGIN(_) { ret ~"BEGIN"; } - END. { ret ~"END"; } - EOF. { ret ~"EOF"; } + STRING(s, len) { ret #fmt["STR(%s,%d)", s, len]; } + BREAK(_) { ret "BREAK"; } + BEGIN(_) { ret "BEGIN"; } + END. { ret "END"; } + EOF. { ret "EOF"; } } } fn buf_str(toks: &[mutable token], szs: &[mutable int], left: uint, - right: uint, lim: uint) -> istr { + right: uint, lim: uint) -> str { let n = vec::len(toks); assert (n == vec::len(szs)); let i = left; let L = lim; - let s = ~"["; + let s = "["; while i != right && L != 0u { L -= 1u; - if i != left { s += ~", "; } - s += #fmt[~"%d=%s", szs[i], tok_str(toks[i])]; + if i != left { s += ", "; } + s += #fmt["%d=%s", szs[i], tok_str(toks[i])]; i += 1u; i %= n; } - s += ~"]"; + s += "]"; ret s; } @@ -104,7 +102,7 @@ fn mk_printer(out: io::writer, linewidth: uint) -> printer { // fall behind. let n: uint = 3u * linewidth; - log #fmt[~"mk_printer %u", linewidth]; + log #fmt["mk_printer %u", linewidth]; let token: [mutable token] = vec::init_elt_mut(EOF, n); let size: [mutable int] = vec::init_elt_mut(0, n); let scan_stack: [mutable uint] = vec::init_elt_mut(0u, n); @@ -244,7 +242,7 @@ obj printer(out: io::writer, fn replace_last_token(t: token) { token[right] = t; } fn pretty_print(t: token) { - log #fmt[~"pp [%u,%u]", left, right]; + log #fmt["pp [%u,%u]", left, right]; alt t { EOF. { if !scan_stack_empty { @@ -260,17 +258,17 @@ obj printer(out: io::writer, left = 0u; right = 0u; } else { self.advance_right(); } - log #fmt[~"pp BEGIN/buffer [%u,%u]", left, right]; + log #fmt["pp BEGIN/buffer [%u,%u]", left, right]; token[right] = t; size[right] = -right_total; self.scan_push(right); } END. { if scan_stack_empty { - log #fmt[~"pp END/print [%u,%u]", left, right]; + log #fmt["pp END/print [%u,%u]", left, right]; self.print(t, 0); } else { - log #fmt[~"pp END/buffer [%u,%u]", left, right]; + log #fmt["pp END/buffer [%u,%u]", left, right]; self.advance_right(); token[right] = t; size[right] = -1; @@ -284,7 +282,7 @@ obj printer(out: io::writer, left = 0u; right = 0u; } else { self.advance_right(); } - log #fmt[~"pp BREAK/buffer [%u,%u]", left, right]; + log #fmt["pp BREAK/buffer [%u,%u]", left, right]; self.check_stack(0); self.scan_push(right); token[right] = t; @@ -293,10 +291,10 @@ obj printer(out: io::writer, } STRING(s, len) { if scan_stack_empty { - log #fmt[~"pp STRING/print [%u,%u]", left, right]; + log #fmt["pp STRING/print [%u,%u]", left, right]; self.print(t, len); } else { - log #fmt[~"pp STRING/buffer [%u,%u]", left, right]; + log #fmt["pp STRING/buffer [%u,%u]", left, right]; self.advance_right(); token[right] = t; size[right] = len; @@ -307,10 +305,10 @@ obj printer(out: io::writer, } } fn check_stream() { - log #fmt[~"check_stream [%u, %u] with left_total=%d, right_total=%d", + log #fmt["check_stream [%u, %u] with left_total=%d, right_total=%d", left, right, left_total, right_total]; if right_total - left_total > space { - log #fmt[~"scan window is %d, longer than space on line (%d)", + log #fmt["scan window is %d, longer than space on line (%d)", right_total - left_total, space]; if !scan_stack_empty { if left == scan_stack[bottom] { @@ -392,7 +390,7 @@ obj printer(out: io::writer, } fn print_newline(amount: int) { log #fmt["NEWLINE %d", amount]; - out.write_str(~"\n"); + out.write_str("\n"); pending_indentation = 0; self.indent(amount); } @@ -406,16 +404,15 @@ obj printer(out: io::writer, if n != 0u { top = print_stack[n - 1u]; } ret top; } - fn write_str(s: &istr) { + fn write_str(s: &str) { while pending_indentation > 0 { - out.write_str(~" "); + out.write_str(" "); pending_indentation -= 1; } out.write_str(s); } fn print(x: token, L: int) { - log #fmt["print %s %d (remaining line space=%d)", - tok_str(x), L, + log #fmt["print %s %d (remaining line space=%d)", tok_str(x), L, space]; log buf_str(token, size, left, right, 6u); alt x { @@ -495,15 +492,15 @@ fn end(p: printer) { p.pretty_print(END); } fn eof(p: printer) { p.pretty_print(EOF); } -fn word(p: printer, wrd: &istr) { +fn word(p: printer, wrd: &str) { p.pretty_print(STRING(wrd, str::char_len(wrd) as int)); } -fn huge_word(p: printer, wrd: &istr) { +fn huge_word(p: printer, wrd: &str) { p.pretty_print(STRING(wrd, size_infinity)); } -fn zero_word(p: printer, wrd: &istr) { p.pretty_print(STRING(wrd, 0)); } +fn zero_word(p: printer, wrd: &str) { p.pretty_print(STRING(wrd, 0)); } fn spaces(p: printer, n: uint) { break_offset(p, n, 0); } diff --git a/src/comp/syntax/print/pprust.rs b/src/comp/syntax/print/pprust.rs index 257404e7f65..33704b0e07c 100644 --- a/src/comp/syntax/print/pprust.rs +++ b/src/comp/syntax/print/pprust.rs @@ -74,11 +74,10 @@ const default_columns: uint = 78u; // Requires you to pass an input filename and reader so that // it can scan the input text for comments and literals to // copy forward. -fn print_crate(cm: &codemap, crate: @ast::crate, filename: &istr, +fn print_crate(cm: &codemap, crate: @ast::crate, filename: &str, in: io::reader, out: io::writer, ann: &pp_ann) { let boxes: [pp::breaks] = []; - let r = lexer::gather_comments_and_literals( - cm, filename, in); + let r = lexer::gather_comments_and_literals(cm, filename, in); let s = @{s: pp::mk_printer(out, default_columns), cm: some(cm), @@ -93,22 +92,22 @@ fn print_crate(cm: &codemap, crate: @ast::crate, filename: &istr, eof(s.s); } -fn ty_to_str(ty: &@ast::ty) -> istr { be to_str(ty, print_type); } +fn ty_to_str(ty: &@ast::ty) -> str { be to_str(ty, print_type); } -fn pat_to_str(pat: &@ast::pat) -> istr { be to_str(pat, print_pat); } +fn pat_to_str(pat: &@ast::pat) -> str { be to_str(pat, print_pat); } -fn expr_to_str(e: &@ast::expr) -> istr { be to_str(e, print_expr); } +fn expr_to_str(e: &@ast::expr) -> str { be to_str(e, print_expr); } -fn stmt_to_str(s: &ast::stmt) -> istr { be to_str(s, print_stmt); } +fn stmt_to_str(s: &ast::stmt) -> str { be to_str(s, print_stmt); } -fn item_to_str(i: &@ast::item) -> istr { be to_str(i, print_item); } +fn item_to_str(i: &@ast::item) -> str { be to_str(i, print_item); } -fn path_to_str(p: &ast::path) -> istr { +fn path_to_str(p: &ast::path) -> str { be to_str(p, bind print_path(_, _, false)); } -fn fun_to_str(f: &ast::_fn, name: &ast::ident, - params: &[ast::ty_param]) -> istr { +fn fun_to_str(f: &ast::_fn, name: &ast::ident, params: &[ast::ty_param]) -> + str { let writer = io::string_writer(); let s = rust_printer(writer.get_writer()); print_fn(s, f.decl, f.proto, name, params, f.decl.constraints); @@ -116,7 +115,7 @@ fn fun_to_str(f: &ast::_fn, name: &ast::ident, ret writer.get_str(); } -fn block_to_str(blk: &ast::blk) -> istr { +fn block_to_str(blk: &ast::blk) -> str { let writer = io::string_writer(); let s = rust_printer(writer.get_writer()); // containing cbox, will be closed by print-block at } @@ -130,11 +129,11 @@ fn block_to_str(blk: &ast::blk) -> istr { ret writer.get_str(); } -fn meta_item_to_str(mi: &ast::meta_item) -> istr { +fn meta_item_to_str(mi: &ast::meta_item) -> str { ret to_str(@mi, print_meta_item); } -fn attribute_to_str(attr: &ast::attribute) -> istr { +fn attribute_to_str(attr: &ast::attribute) -> str { be to_str(attr, print_attribute); } @@ -142,17 +141,17 @@ fn cbox(s: &ps, u: uint) { s.boxes += [pp::consistent]; pp::cbox(s.s, u); } fn box(s: &ps, u: uint, b: pp::breaks) { s.boxes += [b]; pp::box(s.s, u, b); } -fn nbsp(s: &ps) { word(s.s, ~" "); } +fn nbsp(s: &ps) { word(s.s, " "); } -fn word_nbsp(s: &ps, w: &istr) { word(s.s, w); nbsp(s); } +fn word_nbsp(s: &ps, w: &str) { word(s.s, w); nbsp(s); } -fn word_space(s: &ps, w: &istr) { word(s.s, w); space(s.s); } +fn word_space(s: &ps, w: &str) { word(s.s, w); space(s.s); } -fn popen(s: &ps) { word(s.s, ~"("); } +fn popen(s: &ps) { word(s.s, "("); } -fn pclose(s: &ps) { word(s.s, ~")"); } +fn pclose(s: &ps) { word(s.s, ")"); } -fn head(s: &ps, w: &istr) { +fn head(s: &ps, w: &str) { // outer-box is consistent cbox(s, indent_unit); // head-box is inconsistent @@ -162,14 +161,14 @@ fn head(s: &ps, w: &istr) { } fn bopen(s: &ps) { - word(s.s, ~"{"); + word(s.s, "{"); end(s); // close the head-box } fn bclose_(s: &ps, span: codemap::span, indented: uint) { maybe_print_comment(s, span.hi); break_offset_if_not_bol(s, 1u, -(indented as int)); - word(s.s, ~"}"); + word(s.s, "}"); end(s); // close the outer-box } fn bclose(s: &ps, span: codemap::span) { bclose_(s, span, indent_unit); } @@ -204,19 +203,19 @@ fn break_offset_if_not_bol(s: &ps, n: uint, off: int) { // Synthesizes a comment that was not textually present in the original source // file. -fn synth_comment(s: &ps, text: &istr) { - word(s.s, ~"/*"); +fn synth_comment(s: &ps, text: &str) { + word(s.s, "/*"); space(s.s); word(s.s, text); space(s.s); - word(s.s, ~"*/"); + word(s.s, "*/"); } fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN)) { box(s, 0u, b); let first = true; for elt: IN in elts { - if first { first = false; } else { word_space(s, ~","); } + if first { first = false; } else { word_space(s, ","); } op(s, elt); } end(s); @@ -233,7 +232,7 @@ fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN), op(s, elt); i += 1u; if i < len { - word(s.s, ~","); + word(s.s, ","); maybe_print_trailing_comment(s, get_span(elt), some(get_span(elts[i]).hi)); space_if_not_bol(s); @@ -268,53 +267,51 @@ fn print_type(s: &ps, ty: &@ast::ty) { maybe_print_comment(s, ty.span.lo); ibox(s, 0u); alt ty.node { - ast::ty_nil. { word(s.s, ~"()"); } - ast::ty_bool. { word(s.s, ~"bool"); } - ast::ty_bot. { word(s.s, ~"!"); } - ast::ty_int. { word(s.s, ~"int"); } - ast::ty_uint. { word(s.s, ~"uint"); } - ast::ty_float. { word(s.s, ~"float"); } - ast::ty_machine(tm) { - word(s.s, ast_util::ty_mach_to_str(tm)); - } - ast::ty_char. { word(s.s, ~"char"); } - ast::ty_istr. { word(s.s, ~"str"); } - ast::ty_box(mt) { word(s.s, ~"@"); print_mt(s, mt); } + ast::ty_nil. { word(s.s, "()"); } + ast::ty_bool. { word(s.s, "bool"); } + ast::ty_bot. { word(s.s, "!"); } + ast::ty_int. { word(s.s, "int"); } + ast::ty_uint. { word(s.s, "uint"); } + ast::ty_float. { word(s.s, "float"); } + ast::ty_machine(tm) { word(s.s, ast_util::ty_mach_to_str(tm)); } + ast::ty_char. { word(s.s, "char"); } + ast::ty_istr. { word(s.s, "str"); } + ast::ty_box(mt) { word(s.s, "@"); print_mt(s, mt); } ast::ty_vec(mt) { - word(s.s, ~"["); + word(s.s, "["); alt mt.mut { - ast::mut. { word_space(s, ~"mutable"); } - ast::maybe_mut. { word_space(s, ~"mutable?"); } + ast::mut. { word_space(s, "mutable"); } + ast::maybe_mut. { word_space(s, "mutable?"); } ast::imm. { } } print_type(s, mt.ty); - word(s.s, ~"]"); + word(s.s, "]"); } - ast::ty_ptr(mt) { word(s.s, ~"*"); print_mt(s, mt); } - ast::ty_task. { word(s.s, ~"task"); } + ast::ty_ptr(mt) { word(s.s, "*"); print_mt(s, mt); } + ast::ty_task. { word(s.s, "task"); } ast::ty_port(t) { - word(s.s, ~"port<"); + word(s.s, "port<"); print_type(s, t); - word(s.s, ~">"); + word(s.s, ">"); } ast::ty_chan(t) { - word(s.s, ~"chan<"); + word(s.s, "chan<"); print_type(s, t); - word(s.s, ~">"); + word(s.s, ">"); } ast::ty_rec(fields) { - word(s.s, ~"{"); + word(s.s, "{"); fn print_field(s: &ps, f: &ast::ty_field) { cbox(s, indent_unit); print_mutability(s, f.node.mt.mut); word(s.s, f.node.ident); - word_space(s, ~":"); + word_space(s, ":"); print_type(s, f.node.mt.ty); end(s); } fn get_span(f: &ast::ty_field) -> codemap::span { ret f.span; } commasep_cmnt(s, consistent, fields, print_field, get_span); - word(s.s, ~"}"); + word(s.s, "}"); } ast::ty_tup(elts) { popen(s); @@ -322,10 +319,10 @@ fn print_type(s: &ps, ty: &@ast::ty) { pclose(s); } ast::ty_fn(proto, inputs, output, cf, constrs) { - print_ty_fn(s, proto, none::<istr>, inputs, output, cf, constrs); + print_ty_fn(s, proto, none::<str>, inputs, output, cf, constrs); } ast::ty_obj(methods) { - head(s, ~"obj"); + head(s, "obj"); bopen(s); for m: ast::ty_method in methods { hardbreak_if_not_bol(s); @@ -333,13 +330,13 @@ fn print_type(s: &ps, ty: &@ast::ty) { maybe_print_comment(s, m.span.lo); print_ty_fn(s, m.node.proto, some(m.node.ident), m.node.inputs, m.node.output, m.node.cf, m.node.constrs); - word(s.s, ~";"); + word(s.s, ";"); end(s); } bclose(s, ty.span); } ast::ty_path(path, _) { print_path(s, path, false); } - ast::ty_type. { word(s.s, ~"type"); } + ast::ty_type. { word(s.s, "type"); } ast::ty_constr(t, cs) { print_type(s, t); space(s.s); @@ -357,29 +354,26 @@ fn print_native_item(s: &ps, item: &@ast::native_item) { ast::native_item_ty. { ibox(s, indent_unit); ibox(s, 0u); - word_nbsp(s, ~"type"); + word_nbsp(s, "type"); word(s.s, item.ident); end(s); // end the inner ibox - word(s.s, ~";"); + word(s.s, ";"); end(s); // end the outer ibox } + ast::native_item_fn(lname, decl, typarams) { print_fn(s, decl, ast::proto_fn, item.ident, typarams, decl.constraints); alt lname { none. { } - some(ss) { - space(s.s); - word_space(s, ~"="); - print_string(s, ss); - } + some(ss) { space(s.s); word_space(s, "="); print_string(s, ss); } } end(s); // end head-ibox - word(s.s, ~";"); + word(s.s, ";"); end(s); // end the outer fn box } } @@ -393,46 +387,46 @@ fn print_item(s: &ps, item: &@ast::item) { s.ann.pre(ann_node); alt item.node { ast::item_const(ty, expr) { - head(s, ~"const"); - word_space(s, item.ident + ~":"); + head(s, "const"); + word_space(s, item.ident + ":"); print_type(s, ty); space(s.s); end(s); // end the head-ibox - word_space(s, ~"="); + word_space(s, "="); print_expr(s, expr); - word(s.s, ~";"); + word(s.s, ";"); end(s); // end the outer cbox } ast::item_fn(_fn, typarams) { print_fn(s, _fn.decl, _fn.proto, item.ident, typarams, _fn.decl.constraints); - word(s.s, ~" "); + word(s.s, " "); print_block(s, _fn.body); } ast::item_mod(_mod) { - head(s, ~"mod"); + head(s, "mod"); word_nbsp(s, item.ident); bopen(s); print_mod(s, _mod, item.attrs); bclose(s, item.span); } ast::item_native_mod(nmod) { - head(s, ~"native"); + head(s, "native"); alt nmod.abi { - ast::native_abi_llvm. { word_nbsp(s, ~"\"llvm\""); } - ast::native_abi_rust. { word_nbsp(s, ~"\"rust\""); } - ast::native_abi_cdecl. { word_nbsp(s, ~"\"cdecl\""); } + ast::native_abi_llvm. { word_nbsp(s, "\"llvm\""); } + ast::native_abi_rust. { word_nbsp(s, "\"rust\""); } + ast::native_abi_cdecl. { word_nbsp(s, "\"cdecl\""); } ast::native_abi_rust_intrinsic. { - word_nbsp(s, ~"\"rust-intrinsic\""); + word_nbsp(s, "\"rust-intrinsic\""); } - ast::native_abi_x86stdcall. { word_nbsp(s, ~"\"x86stdcall\""); } + ast::native_abi_x86stdcall. { word_nbsp(s, "\"x86stdcall\""); } } - word_nbsp(s, ~"mod"); + word_nbsp(s, "mod"); word_nbsp(s, item.ident); if !str::eq(nmod.native_name, item.ident) { - word_space(s, ~"="); + word_space(s, "="); print_string(s, nmod.native_name); nbsp(s); } @@ -443,15 +437,15 @@ fn print_item(s: &ps, item: &@ast::item) { ast::item_ty(ty, params) { ibox(s, indent_unit); ibox(s, 0u); - word_nbsp(s, ~"type"); + word_nbsp(s, "type"); word(s.s, item.ident); print_type_params(s, params); end(s); // end the inner ibox space(s.s); - word_space(s, ~"="); + word_space(s, "="); print_type(s, ty); - word(s.s, ~";"); + word(s.s, ";"); end(s); // end the outer ibox } ast::item_tag(variants, params) { @@ -461,15 +455,15 @@ fn print_item(s: &ps, item: &@ast::item) { vec::len(variants[0].node.args) == 1u; if newtype { ibox(s, indent_unit); - word_space(s, ~"tag"); - } else { head(s, ~"tag"); } + word_space(s, "tag"); + } else { head(s, "tag"); } word(s.s, item.ident); print_type_params(s, params); space(s.s); if newtype { - word_space(s, ~"="); + word_space(s, "="); print_type(s, variants[0].node.args[0].ty); - word(s.s, ~";"); + word(s.s, ";"); end(s); } else { bopen(s); @@ -485,21 +479,21 @@ fn print_item(s: &ps, item: &@ast::item) { commasep(s, consistent, v.node.args, print_variant_arg); pclose(s); } - word(s.s, ~";"); + word(s.s, ";"); maybe_print_trailing_comment(s, v.span, none::<uint>); } bclose(s, item.span); } } ast::item_obj(_obj, params, _) { - head(s, ~"obj"); + head(s, "obj"); word(s.s, item.ident); print_type_params(s, params); popen(s); fn print_field(s: &ps, field: &ast::obj_field) { ibox(s, indent_unit); print_mutability(s, field.mut); - word_space(s, field.ident + ~":"); + word_space(s, field.ident + ":"); print_type(s, field.ty); end(s); } @@ -514,17 +508,17 @@ fn print_item(s: &ps, item: &@ast::item) { maybe_print_comment(s, meth.span.lo); print_fn(s, meth.node.meth.decl, meth.node.meth.proto, meth.node.ident, typarams, []); - word(s.s, ~" "); + word(s.s, " "); print_block(s, meth.node.meth.body); } bclose(s, item.span); } ast::item_res(dt, dt_id, tps, ct_id) { - head(s, ~"resource"); + head(s, "resource"); word(s.s, item.ident); print_type_params(s, tps); popen(s); - word_space(s, dt.decl.inputs[0].ident + ~":"); + word_space(s, dt.decl.inputs[0].ident + ":"); print_type(s, dt.decl.inputs[0].ty); pclose(s); space(s.s); @@ -551,7 +545,7 @@ fn print_inner_attributes(s: &ps, attrs: &[ast::attribute]) { alt attr.node.style { ast::attr_inner. { print_attribute(s, attr); - word(s.s, ~";"); + word(s.s, ";"); count += 1; } _ {/* fallthrough */ } @@ -563,9 +557,9 @@ fn print_inner_attributes(s: &ps, attrs: &[ast::attribute]) { fn print_attribute(s: &ps, attr: &ast::attribute) { hardbreak_if_not_bol(s); maybe_print_comment(s, attr.span.lo); - word(s.s, ~"#["); + word(s.s, "#["); print_meta_item(s, @attr.node.value); - word(s.s, ~"]"); + word(s.s, "]"); } fn print_stmt(s: &ps, st: &ast::stmt) { @@ -574,7 +568,7 @@ fn print_stmt(s: &ps, st: &ast::stmt) { ast::stmt_decl(decl, _) { print_decl(s, decl); } ast::stmt_expr(expr, _) { space_if_not_bol(s); print_expr(s, expr); } } - if parse::parser::stmt_ends_with_semi(st) { word(s.s, ~";"); } + if parse::parser::stmt_ends_with_semi(st) { word(s.s, ";"); } maybe_print_trailing_comment(s, st.span, none::<uint>); } @@ -586,16 +580,13 @@ tag embed_type { block_macro; block_block_fn; block_normal; } fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type, indented: uint) { - alt blk.node.rules { - ast::unchecked. { word(s.s, ~"unchecked"); } - _ {} - } + alt blk.node.rules { ast::unchecked. { word(s.s, "unchecked"); } _ { } } maybe_print_comment(s, blk.span.lo); let ann_node = node_block(s, blk); s.ann.pre(ann_node); alt embedded { - block_macro. { word(s.s, ~"#{"); end(s); } + block_macro. { word(s.s, "#{"); end(s); } block_block_fn. { end(s); } block_normal. { bopen(s); } } @@ -649,7 +640,7 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type, _ { false } }; - if last_expr_is_block && next_expr_is_ambig { word(s.s, ~";"); } + if last_expr_is_block && next_expr_is_ambig { word(s.s, ";"); } fn expr_is_ambig(ex: @ast::expr) -> bool { // We're going to walk the expression to the 'left' looking for @@ -712,8 +703,8 @@ fn print_maybe_parens_discrim(s: &ps, e: &@ast::expr) { fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, elseopt: &option::t<@ast::expr>, chk: bool) { - head(s, ~"if"); - if chk { word_nbsp(s, ~"check"); } + head(s, "if"); + if chk { word_nbsp(s, "check"); } print_maybe_parens_discrim(s, test); space(s.s); print_block(s, blk); @@ -723,11 +714,12 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, alt _else.node { + // "another else-if" ast::expr_if(i, t, e) { cbox(s, indent_unit - 1u); ibox(s, 0u); - word(s.s, ~" else if "); + word(s.s, " else if "); print_expr(s, i); space(s.s); print_block(s, t); @@ -735,11 +727,12 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, } + // "final else" ast::expr_block(b) { cbox(s, indent_unit - 1u); ibox(s, 0u); - word(s.s, ~" else "); + word(s.s, " else "); print_block(s, b); } } @@ -753,21 +746,21 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, fn print_mac(s: &ps, m: &ast::mac) { alt m.node { ast::mac_invoc(path, arg, body) { - word(s.s, ~"#"); + word(s.s, "#"); print_path(s, path, false); - alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, ~" "); } } + alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, " "); } } print_expr(s, arg); // FIXME: extension 'body' } ast::mac_embed_type(ty) { - word(s.s, ~"#<"); + word(s.s, "#<"); print_type(s, ty); - word(s.s, ~">"); + word(s.s, ">"); } ast::mac_embed_block(blk) { print_possibly_embedded_block(s, blk, block_normal, indent_unit); } - ast::mac_ellipsis. { word(s.s, ~"..."); } + ast::mac_ellipsis. { word(s.s, "..."); } } } @@ -779,38 +772,38 @@ fn print_expr(s: &ps, expr: &@ast::expr) { alt expr.node { ast::expr_vec(exprs, mut) { ibox(s, indent_unit); - word(s.s, ~"["); + word(s.s, "["); if mut == ast::mut { - word(s.s, ~"mutable"); + word(s.s, "mutable"); if vec::len(exprs) > 0u { nbsp(s); } } commasep_exprs(s, inconsistent, exprs); - word(s.s, ~"]"); + word(s.s, "]"); end(s); } ast::expr_rec(fields, wth) { fn print_field(s: &ps, field: &ast::field) { ibox(s, indent_unit); - if field.node.mut == ast::mut { word_nbsp(s, ~"mutable"); } + if field.node.mut == ast::mut { word_nbsp(s, "mutable"); } word(s.s, field.node.ident); - word_space(s, ~":"); + word_space(s, ":"); print_expr(s, field.node.expr); end(s); } fn get_span(field: &ast::field) -> codemap::span { ret field.span; } - word(s.s, ~"{"); + word(s.s, "{"); commasep_cmnt(s, consistent, fields, print_field, get_span); alt wth { some(expr) { if vec::len(fields) > 0u { space(s.s); } ibox(s, indent_unit); - word_space(s, ~"with"); + word_space(s, "with"); print_expr(s, expr); end(s); } _ { } } - word(s.s, ~"}"); + word(s.s, "}"); } ast::expr_tup(exprs) { popen(s); @@ -824,17 +817,17 @@ fn print_expr(s: &ps, expr: &@ast::expr) { pclose(s); } ast::expr_self_method(ident) { - word(s.s, ~"self."); + word(s.s, "self."); print_ident(s, ident); } ast::expr_bind(func, args) { fn print_opt(s: &ps, expr: &option::t<@ast::expr>) { alt expr { some(expr) { print_expr(s, expr); } - _ { word(s.s, ~"_"); } + _ { word(s.s, "_"); } } } - word_nbsp(s, ~"bind"); + word_nbsp(s, "bind"); print_expr(s, func); popen(s); commasep(s, inconsistent, args, print_opt); @@ -855,7 +848,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) { ast::expr_cast(expr, ty) { print_maybe_parens(s, expr, parse::parser::as_prec); space(s.s); - word_space(s, ~"as"); + word_space(s, "as"); print_type(s, ty); } ast::expr_if(test, blk, elseopt) { @@ -867,42 +860,42 @@ fn print_expr(s: &ps, expr: &@ast::expr) { ast::expr_ternary(test, then, els) { print_expr(s, test); space(s.s); - word_space(s, ~"?"); + word_space(s, "?"); print_expr(s, then); space(s.s); - word_space(s, ~":"); + word_space(s, ":"); print_expr(s, els); } ast::expr_while(test, blk) { - head(s, ~"while"); + head(s, "while"); print_maybe_parens_discrim(s, test); space(s.s); print_block(s, blk); } ast::expr_for(decl, expr, blk) { - head(s, ~"for"); + head(s, "for"); print_for_decl(s, decl, expr); space(s.s); print_block(s, blk); } ast::expr_for_each(decl, expr, blk) { - head(s, ~"for each"); + head(s, "for each"); print_for_decl(s, decl, expr); space(s.s); print_block(s, blk); } ast::expr_do_while(blk, expr) { - head(s, ~"do"); + head(s, "do"); space(s.s); print_block(s, blk); space(s.s); - word_space(s, ~"while"); + word_space(s, "while"); print_expr(s, expr); } ast::expr_alt(expr, arms) { cbox(s, alt_indent_unit); ibox(s, 4u); - word_nbsp(s, ~"alt"); + word_nbsp(s, "alt"); print_maybe_parens_discrim(s, expr); space(s.s); bopen(s); @@ -914,17 +907,13 @@ fn print_expr(s: &ps, expr: &@ast::expr) { for p: @ast::pat in arm.pats { if first { first = false; - } else { space(s.s); word_space(s, ~"|"); } + } else { space(s.s); word_space(s, "|"); } print_pat(s, p); } space(s.s); alt arm.guard { - some(e) { - word_space(s, ~"when"); - print_expr(s, e); - space(s.s); - } - none. {} + some(e) { word_space(s, "when"); print_expr(s, e); space(s.s); } + none. { } } print_possibly_embedded_block(s, arm.body, block_normal, alt_indent_unit); @@ -940,7 +929,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) { cbox(s, indent_unit); // head-box, will be closed by print-block at start ibox(s, 0u); - word(s.s, ~"{"); + word(s.s, "{"); print_fn_block_args(s, f.decl); print_possibly_embedded_block(s, f.body, block_block_fn, indent_unit); @@ -958,102 +947,100 @@ fn print_expr(s: &ps, expr: &@ast::expr) { ibox(s, 0u); print_block(s, blk); } - ast::expr_copy(e) { word_space(s, ~"copy"); print_expr(s, e); } + ast::expr_copy(e) { word_space(s, "copy"); print_expr(s, e); } ast::expr_move(lhs, rhs) { print_expr(s, lhs); space(s.s); - word_space(s, ~"<-"); + word_space(s, "<-"); print_expr(s, rhs); } ast::expr_assign(lhs, rhs) { print_expr(s, lhs); space(s.s); - word_space(s, ~"="); + word_space(s, "="); print_expr(s, rhs); } ast::expr_swap(lhs, rhs) { print_expr(s, lhs); space(s.s); - word_space(s, ~"<->"); + word_space(s, "<->"); print_expr(s, rhs); } ast::expr_assign_op(op, lhs, rhs) { print_expr(s, lhs); space(s.s); word(s.s, ast_util::binop_to_str(op)); - word_space(s, ~"="); + word_space(s, "="); print_expr(s, rhs); } ast::expr_field(expr, id) { print_expr_parens_if_unary(s, expr); - word(s.s, ~"."); + word(s.s, "."); word(s.s, id); } ast::expr_index(expr, index) { print_expr_parens_if_unary(s, expr); - word(s.s, ~"["); + word(s.s, "["); print_expr(s, index); - word(s.s, ~"]"); + word(s.s, "]"); } ast::expr_path(path) { print_path(s, path, true); } ast::expr_fail(maybe_fail_val) { - word(s.s, ~"fail"); + word(s.s, "fail"); alt maybe_fail_val { - some(expr) { word(s.s, ~" "); print_expr(s, expr); } + some(expr) { word(s.s, " "); print_expr(s, expr); } _ { } } } - ast::expr_break. { word(s.s, ~"break"); } - ast::expr_cont. { word(s.s, ~"cont"); } + ast::expr_break. { word(s.s, "break"); } + ast::expr_cont. { word(s.s, "cont"); } ast::expr_ret(result) { - word(s.s, ~"ret"); + word(s.s, "ret"); alt result { - some(expr) { word(s.s, ~" "); print_expr(s, expr); } + some(expr) { word(s.s, " "); print_expr(s, expr); } _ { } } } ast::expr_put(result) { - word(s.s, ~"put"); + word(s.s, "put"); alt result { - some(expr) { word(s.s, ~" "); print_expr(s, expr); } + some(expr) { word(s.s, " "); print_expr(s, expr); } _ { } } } - ast::expr_be(result) { word_nbsp(s, ~"be"); print_expr(s, result); } + ast::expr_be(result) { word_nbsp(s, "be"); print_expr(s, result); } ast::expr_log(lvl, expr) { - alt lvl { - 1 { word_nbsp(s, ~"log"); } 0 { word_nbsp(s, ~"log_err"); } - } + alt lvl { 1 { word_nbsp(s, "log"); } 0 { word_nbsp(s, "log_err"); } } print_expr(s, expr); } ast::expr_check(m, expr) { alt m { - ast::unchecked. { word_nbsp(s, ~"claim"); } - ast::checked. { word_nbsp(s, ~"check"); } + ast::unchecked. { word_nbsp(s, "claim"); } + ast::checked. { word_nbsp(s, "check"); } } popen(s); print_expr(s, expr); pclose(s); } ast::expr_assert(expr) { - word_nbsp(s, ~"assert"); + word_nbsp(s, "assert"); popen(s); print_expr(s, expr); pclose(s); } ast::expr_mac(m) { print_mac(s, m); } ast::expr_anon_obj(anon_obj) { - head(s, ~"obj"); + head(s, "obj"); // Fields popen(s); fn print_field(s: &ps, field: &ast::anon_obj_field) { ibox(s, indent_unit); print_mutability(s, field.mut); - word_space(s, field.ident + ~":"); + word_space(s, field.ident + ":"); print_type(s, field.ty); space(s.s); - word_space(s, ~"="); + word_space(s, "="); print_expr(s, field.expr); end(s); } @@ -1077,18 +1064,18 @@ fn print_expr(s: &ps, expr: &@ast::expr) { maybe_print_comment(s, meth.span.lo); print_fn(s, meth.node.meth.decl, meth.node.meth.proto, meth.node.ident, typarams, []); - word(s.s, ~" "); + word(s.s, " "); print_block(s, meth.node.meth.body); } // With object alt anon_obj.inner_obj { none. { } - some(e) { space(s.s); word_space(s, ~"with"); print_expr(s, e); } + some(e) { space(s.s); word_space(s, "with"); print_expr(s, e); } } bclose(s, expr.span); } - ast::expr_uniq(expr) { word(s.s, ~"~"); print_expr(s, expr); } + ast::expr_uniq(expr) { word(s.s, "~"); print_expr(s, expr); } } s.ann.post(ann_node); end(s); @@ -1105,7 +1092,7 @@ fn print_local_decl(s: &ps, loc: &@ast::local) { print_pat(s, loc.node.pat); alt loc.node.ty.node { ast::ty_infer. { } - _ { word_space(s, ~":"); print_type(s, loc.node.ty); } + _ { word_space(s, ":"); print_type(s, loc.node.ty); } } } @@ -1115,7 +1102,7 @@ fn print_decl(s: &ps, decl: &@ast::decl) { ast::decl_local(locs) { space_if_not_bol(s); ibox(s, indent_unit); - word_nbsp(s, ~"let"); + word_nbsp(s, "let"); fn print_local(s: &ps, loc: &@ast::local) { ibox(s, indent_unit); print_local_decl(s, loc); @@ -1124,8 +1111,8 @@ fn print_decl(s: &ps, decl: &@ast::decl) { some(init) { nbsp(s); alt init.op { - ast::init_assign. { word_space(s, ~"="); } - ast::init_move. { word_space(s, ~"<-"); } + ast::init_assign. { word_space(s, "="); } + ast::init_move. { word_space(s, "<-"); } } print_expr(s, init.expr); } @@ -1139,30 +1126,28 @@ fn print_decl(s: &ps, decl: &@ast::decl) { } } -fn print_ident(s: &ps, ident: &ast::ident) { - word(s.s, ident); -} +fn print_ident(s: &ps, ident: &ast::ident) { word(s.s, ident); } fn print_for_decl(s: &ps, loc: &@ast::local, coll: &@ast::expr) { print_local_decl(s, loc); space(s.s); - word_space(s, ~"in"); + word_space(s, "in"); print_expr(s, coll); } fn print_path(s: &ps, path: &ast::path, colons_before_params: bool) { maybe_print_comment(s, path.span.lo); - if path.node.global { word(s.s, ~"::"); } + if path.node.global { word(s.s, "::"); } let first = true; for id: ast::ident in path.node.idents { - if first { first = false; } else { word(s.s, ~"::"); } + if first { first = false; } else { word(s.s, "::"); } word(s.s, id); } if vec::len(path.node.types) > 0u { - if colons_before_params { word(s.s, ~"::"); } - word(s.s, ~"<"); + if colons_before_params { word(s.s, "::"); } + word(s.s, "<"); commasep(s, inconsistent, path.node.types, print_type); - word(s.s, ~">"); + word(s.s, ">"); } } @@ -1171,7 +1156,7 @@ fn print_pat(s: &ps, pat: &@ast::pat) { let ann_node = node_pat(s, pat); s.ann.pre(ann_node); alt pat.node { - ast::pat_wild. { word(s.s, ~"_"); } + ast::pat_wild. { word(s.s, "_"); } ast::pat_bind(id) { word(s.s, id); } ast::pat_lit(lit) { print_literal(s, lit); } ast::pat_tag(path, args) { @@ -1180,31 +1165,31 @@ fn print_pat(s: &ps, pat: &@ast::pat) { popen(s); commasep(s, inconsistent, args, print_pat); pclose(s); - } else { word(s.s, ~"."); } + } else { word(s.s, "."); } } ast::pat_rec(fields, etc) { - word(s.s, ~"{"); + word(s.s, "{"); fn print_field(s: &ps, f: &ast::field_pat) { cbox(s, indent_unit); word(s.s, f.ident); - word_space(s, ~":"); + word_space(s, ":"); print_pat(s, f.pat); end(s); } fn get_span(f: &ast::field_pat) -> codemap::span { ret f.pat.span; } commasep_cmnt(s, consistent, fields, print_field, get_span); if etc { - if vec::len(fields) != 0u { word_space(s, ~","); } - word(s.s, ~"_"); + if vec::len(fields) != 0u { word_space(s, ","); } + word(s.s, "_"); } - word(s.s, ~"}"); + word(s.s, "}"); } ast::pat_tup(elts) { popen(s); commasep(s, inconsistent, elts, print_pat); pclose(s); } - ast::pat_box(inner) { word(s.s, ~"@"); print_pat(s, inner); } + ast::pat_box(inner) { word(s.s, "@"); print_pat(s, inner); } } s.ann.post(ann_node); } @@ -1213,7 +1198,7 @@ fn print_fn(s: &ps, decl: ast::fn_decl, proto: ast::proto, name: &ast::ident, typarams: &[ast::ty_param], constrs: [@ast::constr]) { alt decl.purity { ast::impure_fn. { head(s, proto_to_str(proto)); } - _ { head(s, ~"pure fn"); } + _ { head(s, "pure fn"); } } word(s.s, name); print_type_params(s, typarams); @@ -1225,7 +1210,7 @@ fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl, popen(s); fn print_arg(s: &ps, x: &ast::arg) { ibox(s, indent_unit); - word_space(s, x.ident + ~":"); + word_space(s, x.ident + ":"); print_alias(s, x.mode); print_type(s, x.ty); end(s); @@ -1236,13 +1221,13 @@ fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl, maybe_print_comment(s, decl.output.span.lo); if decl.output.node != ast::ty_nil { space_if_not_bol(s); - word_space(s, ~"->"); + word_space(s, "->"); print_type(s, decl.output); } } fn print_fn_block_args(s: &ps, decl: &ast::fn_decl) { - word(s.s, ~"|"); + word(s.s, "|"); fn print_arg(s: &ps, x: &ast::arg) { ibox(s, indent_unit); print_alias(s, x.mode); @@ -1250,36 +1235,36 @@ fn print_fn_block_args(s: &ps, decl: &ast::fn_decl) { end(s); } commasep(s, inconsistent, decl.inputs, print_arg); - word(s.s, ~"|"); + word(s.s, "|"); maybe_print_comment(s, decl.output.span.lo); } fn print_alias(s: &ps, m: ast::mode) { alt m { - ast::alias(true) { word_space(s, ~"&mutable"); } - ast::alias(false) { word(s.s, ~"&"); } - ast::move. { word(s.s, ~"-"); } + ast::alias(true) { word_space(s, "&mutable"); } + ast::alias(false) { word(s.s, "&"); } + ast::move. { word(s.s, "-"); } ast::val. { } } } fn print_kind(s: &ps, kind: ast::kind) { alt kind { - ast::kind_unique. { word(s.s, ~"~"); } - ast::kind_shared. { word(s.s, ~"@"); } + ast::kind_unique. { word(s.s, "~"); } + ast::kind_shared. { word(s.s, "@"); } _ {/* fallthrough */ } } } fn print_type_params(s: &ps, params: &[ast::ty_param]) { if vec::len(params) > 0u { - word(s.s, ~"<"); + word(s.s, "<"); fn printParam(s: &ps, param: &ast::ty_param) { print_kind(s, param.kind); word(s.s, param.ident); } commasep(s, inconsistent, params, printParam); - word(s.s, ~">"); + word(s.s, ">"); } } @@ -1289,7 +1274,7 @@ fn print_meta_item(s: &ps, item: &@ast::meta_item) { ast::meta_word(name) { word(s.s, name); } ast::meta_name_value(name, value) { word_space(s, name); - word_space(s, ~"="); + word_space(s, "="); print_literal(s, @value); } ast::meta_list(name, items) { @@ -1307,7 +1292,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) { maybe_print_comment(s, item.span.lo); alt item.node { ast::view_item_use(id, mta, _) { - head(s, ~"use"); + head(s, "use"); word(s.s, id); if vec::len(mta) > 0u { popen(s); @@ -1316,47 +1301,43 @@ fn print_view_item(s: &ps, item: &@ast::view_item) { } } ast::view_item_import(id, ids, _) { - head(s, ~"import"); + head(s, "import"); if !str::eq(id, ids[vec::len(ids) - 1u]) { word_space(s, id); - word_space(s, ~"="); + word_space(s, "="); } let first = true; for elt: ast::ident in ids { - if first { first = false; } else { word(s.s, ~"::"); } + if first { first = false; } else { word(s.s, "::"); } word(s.s, elt); } } ast::view_item_import_from(mod_path, idents, _) { - head(s, ~"import"); - for elt: ast::ident in mod_path { - word(s.s, elt); word(s.s, ~"::"); - } - word(s.s, ~"{"); + head(s, "import"); + for elt: ast::ident in mod_path { word(s.s, elt); word(s.s, "::"); } + word(s.s, "{"); commasep(s, inconsistent, idents, fn (s: &ps, w: &ast::import_ident) { word(s.s, w.node.name) }); - word(s.s, ~"}"); + word(s.s, "}"); } ast::view_item_import_glob(ids, _) { - head(s, ~"import"); + head(s, "import"); let first = true; for elt: ast::ident in ids { - if first { first = false; } else { word(s.s, ~"::"); } + if first { first = false; } else { word(s.s, "::"); } word(s.s, elt); } - word(s.s, ~"::*"); + word(s.s, "::*"); } ast::view_item_export(ids, _) { - head(s, ~"export"); + head(s, "export"); commasep(s, inconsistent, ids, - fn (s: &ps, w: &ast::ident) { - word(s.s, w) - }); + fn (s: &ps, w: &ast::ident) { word(s.s, w) }); } } - word(s.s, ~";"); + word(s.s, ";"); end(s); // end inner head-block end(s); // end outer head-block @@ -1380,6 +1361,7 @@ fn need_parens(expr: &@ast::expr, outer_prec: int) -> bool { ast::expr_ternary(_, _, _) { parse::parser::ternary_prec < outer_prec } + // This may be too conservative in some cases ast::expr_assign(_, _) { true @@ -1406,8 +1388,8 @@ fn print_maybe_parens(s: &ps, expr: &@ast::expr, outer_prec: int) { fn print_mutability(s: &ps, mut: &ast::mutability) { alt mut { - ast::mut. { word_nbsp(s, ~"mutable"); } - ast::maybe_mut. { word_nbsp(s, ~"mutable?"); } + ast::mut. { word_nbsp(s, "mutable"); } + ast::maybe_mut. { word_nbsp(s, "mutable?"); } ast::imm. {/* nothing */ } } } @@ -1422,13 +1404,7 @@ fn print_ty_fn(s: &ps, proto: &ast::proto, id: &option::t<ast::ident>, cf: &ast::controlflow, constrs: &[@ast::constr]) { ibox(s, indent_unit); word(s.s, proto_to_str(proto)); - alt id { - some(id) { - word(s.s, ~" "); - word(s.s, id); - } - _ { } - } + alt id { some(id) { word(s.s, " "); word(s.s, id); } _ { } } zerobreak(s.s); popen(s); fn print_arg(s: &ps, input: &ast::ty_arg) { @@ -1441,10 +1417,10 @@ fn print_ty_fn(s: &ps, proto: &ast::proto, id: &option::t<ast::ident>, if output.node != ast::ty_nil { space_if_not_bol(s); ibox(s, indent_unit); - word_space(s, ~"->"); + word_space(s, "->"); alt cf { ast::return. { print_type(s, output); } - ast::noreturn. { word_nbsp(s, ~"!"); } + ast::noreturn. { word_nbsp(s, "!"); } } end(s); } @@ -1495,25 +1471,19 @@ fn print_literal(s: &ps, lit: &@ast::lit) { maybe_print_comment(s, lit.span.lo); alt next_lit(s) { some(lt) { - if lt.pos == lit.span.lo { - word(s.s, lt.lit); - s.cur_lit += 1u; - ret; - } + if lt.pos == lit.span.lo { word(s.s, lt.lit); s.cur_lit += 1u; ret; } } _ { } } alt lit.node { - ast::lit_str(st) { - print_string(s, st); - } + ast::lit_str(st) { print_string(s, st); } ast::lit_char(ch) { word(s.s, - ~"'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') + - ~"'"); + "'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') + + "'"); } ast::lit_int(val) { word(s.s, int::str(val)); } - ast::lit_uint(val) { word(s.s, uint::str(val) + ~"u"); } + ast::lit_uint(val) { word(s.s, uint::str(val) + "u"); } ast::lit_float(fstr) { word(s.s, fstr); } ast::lit_mach_int(mach, val) { word(s.s, int::str(val as int)); @@ -1524,14 +1494,14 @@ fn print_literal(s: &ps, lit: &@ast::lit) { word(s.s, val); word(s.s, ast_util::ty_mach_to_str(mach)); } - ast::lit_nil. { word(s.s, ~"()"); } + ast::lit_nil. { word(s.s, "()"); } ast::lit_bool(val) { - if val { word(s.s, ~"true"); } else { word(s.s, ~"false"); } + if val { word(s.s, "true"); } else { word(s.s, "false"); } } } } -fn lit_to_str(l: &@ast::lit) -> istr { be to_str(l, print_literal); } +fn lit_to_str(l: &@ast::lit) -> str { be to_str(l, print_literal); } fn next_lit(s: &ps) -> option::t<lexer::lit> { alt s.literals { @@ -1568,26 +1538,22 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { } lexer::isolated. { pprust::hardbreak_if_not_bol(s); - for line: istr in cmnt.lines { + for line: str in cmnt.lines { // Don't print empty lines because they will end up as trailing // whitespace - if str::is_not_empty(line) { - word(s.s, line); - } + if str::is_not_empty(line) { word(s.s, line); } hardbreak(s.s); } } lexer::trailing. { - word(s.s, ~" "); + word(s.s, " "); if vec::len(cmnt.lines) == 1u { word(s.s, cmnt.lines[0]); hardbreak(s.s); } else { ibox(s, 0u); - for line: istr in cmnt.lines { - if str::is_not_empty(line) { - word(s.s, line); - } + for line: str in cmnt.lines { + if str::is_not_empty(line) { word(s.s, line); } hardbreak(s.s); } end(s); @@ -1597,7 +1563,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { // We need to do at least one, possibly two hardbreaks. let is_semi = alt s.s.last_token() { - pp::STRING(s, _) { s == ~";" } + pp::STRING(s, _) { s == ";" } _ { false } }; if is_semi || is_begin(s) || is_end(s) { hardbreak(s.s) } @@ -1606,24 +1572,24 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { } } -fn print_string(s: &ps, st: &istr) { - word(s.s, ~"\""); +fn print_string(s: &ps, st: &str) { + word(s.s, "\""); word(s.s, escape_str(st, '"')); - word(s.s, ~"\""); + word(s.s, "\""); } -fn escape_str(st: &istr, to_escape: char) -> istr { - let out: istr = ~""; +fn escape_str(st: &str, to_escape: char) -> str { + let out: str = ""; let len = str::byte_len(st); let i = 0u; while i < len { alt st[i] as char { - '\n' { out += ~"\\n"; } - '\t' { out += ~"\\t"; } - '\r' { out += ~"\\r"; } - '\\' { out += ~"\\\\"; } + '\n' { out += "\\n"; } + '\t' { out += "\\t"; } + '\r' { out += "\\r"; } + '\\' { out += "\\\\"; } cur { - if cur == to_escape { out += ~"\\"; } + if cur == to_escape { out += "\\"; } // FIXME some (or all?) non-ascii things should be escaped str::push_char(out, cur); @@ -1634,7 +1600,7 @@ fn escape_str(st: &istr, to_escape: char) -> istr { ret out; } -fn to_str<T>(t: &T, f: fn(&ps, &T)) -> istr { +fn to_str<T>(t: &T, f: fn(&ps, &T)) -> str { let writer = io::string_writer(); let s = rust_printer(writer.get_writer()); f(s, t); @@ -1655,23 +1621,22 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> { // Removing the aliases from the type of f in the next two functions // triggers memory corruption, but I haven't isolated the bug yet. FIXME -fn constr_args_to_str<T>(f: &fn(&T) -> istr, args: &[@ast::sp_constr_arg<T>]) - -> istr { +fn constr_args_to_str<T>(f: &fn(&T) -> str, args: &[@ast::sp_constr_arg<T>]) + -> str { let comma = false; - let s = ~"("; + let s = "("; for a: @ast::sp_constr_arg<T> in args { - if comma { s += ~", "; } else { comma = true; } + if comma { s += ", "; } else { comma = true; } s += constr_arg_to_str::<T>(f, a.node); } - s += ~")"; + s += ")"; ret s; } -fn constr_arg_to_str<T>(f: &fn(&T) -> istr, - c: &ast::constr_arg_general_<T>) -> - istr { +fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>) -> + str { alt c { - ast::carg_base. { ret ~"*"; } + ast::carg_base. { ret "*"; } ast::carg_ident(i) { ret f(i); } ast::carg_lit(l) { ret lit_to_str(l); } } @@ -1680,56 +1645,56 @@ fn constr_arg_to_str<T>(f: &fn(&T) -> istr, // needed b/c constr_args_to_str needs // something that takes an alias // (argh) -fn uint_to_str(i: &uint) -> istr { ret uint::str(i); } +fn uint_to_str(i: &uint) -> str { ret uint::str(i); } -fn ast_ty_fn_constr_to_str(c: &@ast::constr) -> istr { +fn ast_ty_fn_constr_to_str(c: &@ast::constr) -> str { ret path_to_str(c.node.path) + constr_args_to_str(uint_to_str, c.node.args); } // FIXME: fix repeated code -fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> istr { - let s = ~""; +fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> str { + let s = ""; let colon = true; for c: @ast::constr in constrs { - if colon { s += ~" : "; colon = false; } else { s += ~", "; } + if colon { s += " : "; colon = false; } else { s += ", "; } s += ast_ty_fn_constr_to_str(c); } ret s; } -fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> istr { +fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> str { decl.inputs[idx].ident } -fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> istr { +fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str { let arg_to_str = bind fn_arg_idx_to_str(decl, _); ret path_to_str(c.node.path) + constr_args_to_str(arg_to_str, c.node.args); } // FIXME: fix repeated code -fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> istr { - let s = ~""; +fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> str { + let s = ""; let colon = true; for c: @ast::constr in constrs { - if colon { s += ~" : "; colon = false; } else { s += ~", "; } + if colon { s += " : "; colon = false; } else { s += ", "; } s += ast_fn_constr_to_str(decl, c); } ret s; } -fn proto_to_str(p: &ast::proto) -> istr { +fn proto_to_str(p: &ast::proto) -> str { ret alt p { - ast::proto_fn. { ~"fn" } - ast::proto_iter. { ~"iter" } - ast::proto_block. { ~"block" } - ast::proto_closure. { ~"lambda" } + ast::proto_fn. { "fn" } + ast::proto_iter. { "iter" } + ast::proto_block. { "block" } + ast::proto_closure. { "lambda" } }; } -fn ty_constr_to_str(c: &@ast::ty_constr) -> istr { - fn ty_constr_path_to_str(p: &ast::path) -> istr { ~"*." + path_to_str(p) } +fn ty_constr_to_str(c: &@ast::ty_constr) -> str { + fn ty_constr_path_to_str(p: &ast::path) -> str { "*." + path_to_str(p) } ret path_to_str(c.node.path) + constr_args_to_str::<ast::path>(ty_constr_path_to_str, @@ -1737,11 +1702,11 @@ fn ty_constr_to_str(c: &@ast::ty_constr) -> istr { } -fn ast_ty_constrs_str(constrs: &[@ast::ty_constr]) -> istr { - let s = ~""; +fn ast_ty_constrs_str(constrs: &[@ast::ty_constr]) -> str { + let s = ""; let colon = true; for c: @ast::ty_constr in constrs { - if colon { s += ~" : "; colon = false; } else { s += ~", "; } + if colon { s += " : "; colon = false; } else { s += ", "; } s += ty_constr_to_str(c); } ret s; diff --git a/src/comp/util/common.rs b/src/comp/util/common.rs index 822cdbe0533..ba86b99261f 100644 --- a/src/comp/util/common.rs +++ b/src/comp/util/common.rs @@ -104,10 +104,7 @@ fn local_rhs_span(l: &@ast::local, def: &span) -> span { fn lit_eq(l: &@ast::lit, m: &@ast::lit) -> bool { alt l.node { ast::lit_str(s) { - alt m.node { - ast::lit_str(t) { ret s == t } - _ { ret false; } - } + alt m.node { ast::lit_str(t) { ret s == t } _ { ret false; } } } ast::lit_char(c) { alt m.node { ast::lit_char(d) { ret c == d; } _ { ret false; } } @@ -144,28 +141,28 @@ fn lit_eq(l: &@ast::lit, m: &@ast::lit) -> bool { tag call_kind { kind_call; kind_spawn; kind_bind; kind_for_each; } -fn call_kind_str(c: call_kind) -> istr { +fn call_kind_str(c: call_kind) -> str { alt c { - kind_call. { ~"Call" } - kind_spawn. { ~"Spawn" } - kind_bind. { ~"Bind" } - kind_for_each. { ~"For-Each" } + kind_call. { "Call" } + kind_spawn. { "Spawn" } + kind_bind. { "Bind" } + kind_for_each. { "For-Each" } } } fn is_main_name(path: &[ast::ident]) -> bool { - str::eq(option::get(std::vec::last(path)), ~"main") + str::eq(option::get(std::vec::last(path)), "main") } // FIXME mode this to std::float when editing the stdlib no longer // requires a snapshot -fn float_to_str(num: float, digits: uint) -> istr { - let accum = if num < 0.0 { num = -num; ~"-" } else { ~"" }; +fn float_to_str(num: float, digits: uint) -> str { + let accum = if num < 0.0 { num = -num; "-" } else { "" }; let trunc = num as uint; let frac = num - (trunc as float); accum += uint::str(trunc); if frac == 0.0 || digits == 0u { ret accum; } - accum += ~"."; + accum += "."; while digits > 0u && frac > 0.0 { frac *= 10.0; let digit = frac as uint; diff --git a/src/comp/util/ppaux.rs b/src/comp/util/ppaux.rs index f227836f492..8846d5c5380 100644 --- a/src/comp/util/ppaux.rs +++ b/src/comp/util/ppaux.rs @@ -21,32 +21,31 @@ import syntax::ast; import middle::ast_map; import metadata::csearch; -fn mode_str(m: &ty::mode) -> istr { +fn mode_str(m: &ty::mode) -> str { alt m { - mo_val. { ~"" } - mo_alias(false) { ~"&" } - mo_alias(true) { ~"&mutable " } - mo_move. { ~"-" } + mo_val. { "" } + mo_alias(false) { "&" } + mo_alias(true) { "&mutable " } + mo_move. { "-" } } } -fn mode_str_1(m: &ty::mode) -> istr { - alt m { mo_val. { ~"val" } _ { mode_str(m) } } +fn mode_str_1(m: &ty::mode) -> str { + alt m { mo_val. { "val" } _ { mode_str(m) } } } -fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> istr { - ret alt i { - none. { ~"anon" + int::str(id) } - some(s) { s } - }; +fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> str { + ret alt i { none. { "anon" + int::str(id) } some(s) { s } }; } -fn get_id_ident(cx: &ctxt, id: ast::def_id) -> istr { +fn get_id_ident(cx: &ctxt, id: ast::def_id) -> str { if id.crate != ast::local_crate { alt cx.ext_map.find(id) { - some(j) { str::connect(j, ~"::") } - _ { fail (~"get_id_ident: can't find item in ext_map, id.crate = " - + int::str(id.crate)) } + some(j) { str::connect(j, "::") } + _ { + fail "get_id_ident: can't find item in ext_map, id.crate = " + + int::str(id.crate) + } } } else { alt cx.items.find(id.node) { @@ -56,90 +55,79 @@ fn get_id_ident(cx: &ctxt, id: ast::def_id) -> istr { } } -fn ty_to_str(cx: &ctxt, typ: &t) -> istr { +fn ty_to_str(cx: &ctxt, typ: &t) -> str { fn fn_input_to_str(cx: &ctxt, input: &{mode: middle::ty::mode, ty: t}) -> - istr { + str { let s = mode_str(input.mode); ret s + ty_to_str(cx, input.ty); } fn fn_to_str(cx: &ctxt, proto: ast::proto, ident: option::t<ast::ident>, inputs: &[arg], output: t, cf: ast::controlflow, - constrs: &[@constr]) -> istr { + constrs: &[@constr]) -> str { let s = proto_to_str(proto); - alt ident { - some(i) { - s += ~" "; - s += i; - } - _ { } - } - s += ~"("; + alt ident { some(i) { s += " "; s += i; } _ { } } + s += "("; let strs = []; for a: arg in inputs { strs += [fn_input_to_str(cx, a)]; } - s += str::connect(strs, ~", "); - s += ~")"; + s += str::connect(strs, ", "); + s += ")"; if struct(cx, output) != ty_nil { alt cf { - ast::noreturn. { s += ~" -> !"; } - ast::return. { s += ~" -> " + ty_to_str(cx, output); } + ast::noreturn. { s += " -> !"; } + ast::return. { s += " -> " + ty_to_str(cx, output); } } } s += constrs_str(constrs); ret s; } - fn method_to_str(cx: &ctxt, m: &method) -> istr { + fn method_to_str(cx: &ctxt, m: &method) -> str { ret fn_to_str(cx, m.proto, some::<ast::ident>(m.ident), m.inputs, - m.output, m.cf, m.constrs) + ~";"; + m.output, m.cf, m.constrs) + ";"; } - fn field_to_str(cx: &ctxt, f: &field) -> istr { - ret f.ident + ~": " + mt_to_str(cx, f.mt); + fn field_to_str(cx: &ctxt, f: &field) -> str { + ret f.ident + ": " + mt_to_str(cx, f.mt); } - fn mt_to_str(cx: &ctxt, m: &mt) -> istr { + fn mt_to_str(cx: &ctxt, m: &mt) -> str { let mstr; alt m.mut { - ast::mut. { mstr = ~"mutable "; } - ast::imm. { mstr = ~""; } - ast::maybe_mut. { mstr = ~"mutable? "; } + ast::mut. { mstr = "mutable "; } + ast::imm. { mstr = ""; } + ast::maybe_mut. { mstr = "mutable? "; } } ret mstr + ty_to_str(cx, m.ty); } - alt cname(cx, typ) { - some(cs) { - ret cs; - } - _ { } - } + alt cname(cx, typ) { some(cs) { ret cs; } _ { } } ret alt struct(cx, typ) { - ty_native(_) { ~"native" } - ty_nil. { ~"()" } - ty_bot. { ~"_|_" } - ty_bool. { ~"bool" } - ty_int. { ~"int" } - ty_float. { ~"float" } - ty_uint. { ~"uint" } + ty_native(_) { "native" } + ty_nil. { "()" } + ty_bot. { "_|_" } + ty_bool. { "bool" } + ty_int. { "int" } + ty_float. { "float" } + ty_uint. { "uint" } ty_machine(tm) { ty_mach_to_str(tm) } - ty_char. { ~"char" } - ty_istr. { ~"istr" } - ty_box(tm) { ~"@" + mt_to_str(cx, tm) } - ty_uniq(t) { ~"~" + ty_to_str(cx, t) } - ty_vec(tm) { ~"[" + mt_to_str(cx, tm) + ~"]" } - ty_type. { ~"type" } + ty_char. { "char" } + ty_istr. { "istr" } + ty_box(tm) { "@" + mt_to_str(cx, tm) } + ty_uniq(t) { "~" + ty_to_str(cx, t) } + ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" } + ty_type. { "type" } ty_rec(elems) { - let strs: [istr] = []; + let strs: [str] = []; for fld: field in elems { strs += [field_to_str(cx, fld)]; } - ~"{" + str::connect(strs, ~",") + ~"}" + "{" + str::connect(strs, ",") + "}" } ty_tup(elems) { let strs = []; for elem in elems { strs += [ty_to_str(cx, elem)]; } - ~"(" + str::connect(strs, ~",") + ~")" + "(" + str::connect(strs, ",") + ")" } ty_tag(id, tps) { let s = get_id_ident(cx, id); if vec::len::<t>(tps) > 0u { - let strs: [istr] = []; + let strs: [str] = []; for typ: t in tps { strs += [ty_to_str(cx, typ)]; } - s += ~"[" + str::connect(strs, ~",") + ~"]"; + s += "[" + str::connect(strs, ",") + "]"; } s } @@ -153,42 +141,42 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> istr { ty_obj(meths) { let strs = []; for m: method in meths { strs += [method_to_str(cx, m)]; } - ~"obj {\n\t" + str::connect(strs, ~"\n\t") + ~"\n}" + "obj {\n\t" + str::connect(strs, "\n\t") + "\n}" } ty_res(id, _, _) { get_id_ident(cx, id) } - ty_var(v) { ~"<T" + int::str(v) + ~">" } + ty_var(v) { "<T" + int::str(v) + ">" } ty_param(id, _) { - ~"'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)]) + "'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)]) } _ { ty_to_short_str(cx, typ) } } } -fn ty_to_short_str(cx: &ctxt, typ: t) -> istr { +fn ty_to_short_str(cx: &ctxt, typ: t) -> str { let s = encoder::encoded_ty(cx, typ); if str::byte_len(s) >= 32u { s = str::substr(s, 0u, 32u); } ret s; } -fn constr_to_str(c: &@constr) -> istr { +fn constr_to_str(c: &@constr) -> str { ret path_to_str(c.node.path) + - pprust::constr_args_to_str(pprust::uint_to_str, c.node.args); + pprust::constr_args_to_str(pprust::uint_to_str, c.node.args); } -fn constrs_str(constrs: &[@constr]) -> istr { - let s = ~""; +fn constrs_str(constrs: &[@constr]) -> str { + let s = ""; let colon = true; for c: @constr in constrs { - if colon { s += ~" : "; colon = false; } else { s += ~", "; } + if colon { s += " : "; colon = false; } else { s += ", "; } s += constr_to_str(c); } ret s; } fn ty_constr_to_str<Q>(c: &@ast::spanned<ast::constr_general_<ast::path, Q>>) - -> istr { + -> str { ret path_to_str(c.node.path) + - constr_args_to_str::<ast::path>(path_to_str, c.node.args); + constr_args_to_str::<ast::path>(path_to_str, c.node.args); } // Local Variables: diff --git a/src/fuzzer/fuzzer.rs b/src/fuzzer/fuzzer.rs index b8a70dd1c9c..30128731782 100644 --- a/src/fuzzer/fuzzer.rs +++ b/src/fuzzer/fuzzer.rs @@ -20,28 +20,28 @@ import rustc::syntax::codemap; import rustc::syntax::parse::parser; import rustc::syntax::print::pprust; -fn write_file(filename: &istr, content: &istr) { +fn write_file(filename: &str, content: &str) { io::file_writer(filename, [io::create, io::truncate]).write_str(content); // Work around https://github.com/graydon/rust/issues/726 - std::run::run_program(~"chmod", [~"644", filename]); + std::run::run_program("chmod", ["644", filename]); } -fn file_contains(filename: &istr, needle: &istr) -> bool { +fn file_contains(filename: &str, needle: &str) -> bool { let contents = io::read_whole_file_str(filename); ret str::find(contents, needle) != -1; } -fn contains(haystack: &istr, needle: &istr) -> bool { +fn contains(haystack: &str, needle: &str) -> bool { str::find(haystack, needle) != -1 } -fn find_rust_files(files: &mutable [istr], path: &istr) { - if str::ends_with(path, ~".rs") { - if file_contains(path, ~"xfail-test") { +fn find_rust_files(files: &mutable [str], path: &str) { + if str::ends_with(path, ".rs") { + if file_contains(path, "xfail-test") { //log_err "Skipping " + path + " because it is marked as xfail-test"; } else { files += [path]; } } else if fs::file_is_dir(path) - && str::find(path, ~"compile-fail") == -1 { + && str::find(path, "compile-fail") == -1 { for p in fs::list_dir(path) { find_rust_files(files, p); } @@ -150,28 +150,28 @@ iter under(n: uint) -> uint { fn devnull() -> io::writer { std::io::string_writer().get_writer() } -fn as_str(f: fn(io::writer)) -> istr { +fn as_str(f: fn(io::writer)) -> str { let w = std::io::string_writer(); f(w.get_writer()); ret w.get_str(); } fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, - filename: &istr) { + filename: &str) { let exprs = steal_exprs(crate); let exprsL = vec::len(exprs); if exprsL < 100u { for each i: uint in under(uint::min(exprsL, 20u)) { - log_err ~"Replacing... " + pprust::expr_to_str(@exprs[i]); + log_err "Replacing... " + pprust::expr_to_str(@exprs[i]); for each j: uint in under(uint::min(exprsL, 5u)) { - log_err ~"With... " + pprust::expr_to_str(@exprs[j]); + log_err "With... " + pprust::expr_to_str(@exprs[j]); let crate2 = @replace_expr_in_crate(crate, i, exprs[j].node); // It would be best to test the *crate* for stability, but testing the // string for stability is easier and ok for now. let str3 = as_str(bind pprust::print_crate(codemap, crate2, filename, - io::string_reader(~""), _, + io::string_reader(""), _, pprust::no_ann())); // 1u would be sane here, but the pretty-printer currently has lots of whitespace and paren issues, // and https://github.com/graydon/rust/issues/766 is hilarious. @@ -186,61 +186,61 @@ fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, // - that would find many "false positives" or unimportant bugs // - that would be tricky, requiring use of tasks or serialization or randomness. // This seems to find plenty of bugs as it is :) -fn check_whole_compiler(code: &istr) { - let filename = ~"test.rs"; +fn check_whole_compiler(code: &str) { + let filename = "test.rs"; write_file(filename, code); let p = std::run::program_output( - ~"/Users/jruderman/code/rust/build/stage1/rustc", - [~"-c", filename]); + "/Users/jruderman/code/rust/build/stage1/rustc", + ["-c", filename]); //log_err #fmt("Status: %d", p.status); //log_err "Output: " + p.out; - if p.err != ~"" { - if contains(p.err, ~"argument of incompatible type") { + if p.err != "" { + if contains(p.err, "argument of incompatible type") { log_err "https://github.com/graydon/rust/issues/769"; } else if contains(p.err, - ~"Cannot create binary operator with two operands of differing type") + "Cannot create binary operator with two operands of differing type") { log_err "https://github.com/graydon/rust/issues/770"; - } else if contains(p.err, ~"May only branch on boolean predicates!") { + } else if contains(p.err, "May only branch on boolean predicates!") { log_err "https://github.com/graydon/rust/issues/770 or https://github.com/graydon/rust/issues/776"; - } else if contains(p.err, ~"Invalid constantexpr cast!") && - contains(code, ~"!") { + } else if contains(p.err, "Invalid constantexpr cast!") && + contains(code, "!") { log_err "https://github.com/graydon/rust/issues/777"; } else if contains(p.err, - ~"Both operands to ICmp instruction are not of the same type!") - && contains(code, ~"!") { + "Both operands to ICmp instruction are not of the same type!") + && contains(code, "!") { log_err "https://github.com/graydon/rust/issues/777 #issuecomment-1678487"; - } else if contains(p.err, ~"Ptr must be a pointer to Val type!") && - contains(code, ~"!") { + } else if contains(p.err, "Ptr must be a pointer to Val type!") && + contains(code, "!") { log_err "https://github.com/graydon/rust/issues/779"; - } else if contains(p.err, ~"Calling a function with bad signature!") && - (contains(code, ~"iter") || contains(code, ~"range")) { + } else if contains(p.err, "Calling a function with bad signature!") && + (contains(code, "iter") || contains(code, "range")) { log_err "https://github.com/graydon/rust/issues/771 - calling an iter fails"; - } else if contains(p.err, ~"Calling a function with a bad signature!") - && contains(code, ~"empty") { + } else if contains(p.err, "Calling a function with a bad signature!") + && contains(code, "empty") { log_err "https://github.com/graydon/rust/issues/775 - possibly a modification of run-pass/import-glob-crate.rs"; - } else if contains(p.err, ~"Invalid type for pointer element!") && - contains(code, ~"put") { + } else if contains(p.err, "Invalid type for pointer element!") && + contains(code, "put") { log_err "https://github.com/graydon/rust/issues/773 - put put ()"; - } else if contains(p.err, ~"pointer being freed was not allocated") && - contains(p.out, ~"Out of stack space, sorry") { + } else if contains(p.err, "pointer being freed was not allocated") && + contains(p.out, "Out of stack space, sorry") { log_err "https://github.com/graydon/rust/issues/768 + https://github.com/graydon/rust/issues/778" } else { - log_err ~"Stderr: " + p.err; + log_err "Stderr: " + p.err; fail "Unfamiliar error message"; } - } else if contains(p.out, ~"non-exhaustive match failure") && - contains(p.out, ~"alias.rs") { + } else if contains(p.out, "non-exhaustive match failure") && + contains(p.out, "alias.rs") { log_err "https://github.com/graydon/rust/issues/772"; - } else if contains(p.out, ~"non-exhaustive match failure") && - contains(p.out, ~"trans.rs") && contains(code, ~"put") { + } else if contains(p.out, "non-exhaustive match failure") && + contains(p.out, "trans.rs") && contains(code, "put") { log_err "https://github.com/graydon/rust/issues/774"; - } else if contains(p.out, ~"Out of stack space, sorry") { + } else if contains(p.out, "Out of stack space, sorry") { log_err "Possibly a variant of https://github.com/graydon/rust/issues/768"; } else if p.status == 256 { - if !contains(p.out, ~"error:") { + if !contains(p.out, "error:") { fail "Exited with status 256 without a span-error"; } } else if p.status == 11 { @@ -248,8 +248,8 @@ fn check_whole_compiler(code: &istr) { } else if p.status != 0 { fail "Unfamiliar status code"; } } -fn parse_and_print(code: &istr) -> istr { - let filename = ~"tmp.rs"; +fn parse_and_print(code: &str) -> str { + let filename = "tmp.rs"; let sess = @{cm: codemap::new_codemap(), mutable next_id: 0}; //write_file(filename, code); let crate = parser::parse_crate_from_source_str( @@ -260,19 +260,19 @@ fn parse_and_print(code: &istr) -> istr { pprust::no_ann())); } -fn content_is_dangerous_to_modify(code: &istr) -> bool { +fn content_is_dangerous_to_modify(code: &str) -> bool { let dangerous_patterns = - [~"obj", // not safe to steal; https://github.com/graydon/rust/issues/761 - ~"#macro", // not safe to steal things inside of it, because they have a special syntax - ~"#", // strange representation of the arguments to #fmt, for example - ~" be ", // don't want to replace its child with a non-call: "Non-call expression in tail call" - ~"@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768 + ["obj", // not safe to steal; https://github.com/graydon/rust/issues/761 + "#macro", // not safe to steal things inside of it, because they have a special syntax + "#", // strange representation of the arguments to #fmt, for example + " be ", // don't want to replace its child with a non-call: "Non-call expression in tail call" + "@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768 - for p: istr in dangerous_patterns { if contains(code, p) { ret true; } } + for p: str in dangerous_patterns { if contains(code, p) { ret true; } } ret false; } -fn content_is_confusing(code: &istr) -> +fn content_is_confusing(code: &str) -> bool { // https://github.com/graydon/rust/issues/671 // https://github.com/graydon/rust/issues/669 // https://github.com/graydon/rust/issues/669 @@ -282,16 +282,16 @@ fn content_is_confusing(code: &istr) -> // more precedence issues? let confusing_patterns = - [~"#macro", ~"][]", ~"][mutable]", ~"][mutable ]", ~"self", ~"spawn", - ~"bind", ~"\n\n\n\n\n", // https://github.com/graydon/rust/issues/759 - ~" : ", // https://github.com/graydon/rust/issues/760 - ~"if ret", ~"alt ret", ~"if fail", ~"alt fail"]; + ["#macro", "][]", "][mutable]", "][mutable ]", "self", "spawn", + "bind", "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759 + " : ", // https://github.com/graydon/rust/issues/760 + "if ret", "alt ret", "if fail", "alt fail"]; - for p: istr in confusing_patterns { if contains(code, p) { ret true; } } + for p: str in confusing_patterns { if contains(code, p) { ret true; } } ret false; } -fn file_is_confusing(filename: &istr) -> bool { +fn file_is_confusing(filename: &str) -> bool { // https://github.com/graydon/rust/issues/674 @@ -302,16 +302,16 @@ fn file_is_confusing(filename: &istr) -> bool { // which i can't reproduce using "rustc // --pretty normal"??? let confusing_files = - [~"block-expr-precedence.rs", ~"nil-pattern.rs", - ~"syntax-extension-fmt.rs", - ~"newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670 + ["block-expr-precedence.rs", "nil-pattern.rs", + "syntax-extension-fmt.rs", + "newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670 for f in confusing_files { if contains(filename, f) { ret true; } } ret false; } -fn check_roundtrip_convergence(code: &istr, maxIters: uint) { +fn check_roundtrip_convergence(code: &str, maxIters: uint) { let i = 0u; let new = code; @@ -329,16 +329,16 @@ fn check_roundtrip_convergence(code: &istr, maxIters: uint) { log_err #fmt["Converged after %u iterations", i]; } else { log_err #fmt["Did not converge after %u iterations!", i]; - write_file(~"round-trip-a.rs", old); - write_file(~"round-trip-b.rs", new); - std::run::run_program(~"diff", - [~"-w", ~"-u", ~"round-trip-a.rs", - ~"round-trip-b.rs"]); + write_file("round-trip-a.rs", old); + write_file("round-trip-b.rs", new); + std::run::run_program("diff", + ["-w", "-u", "round-trip-a.rs", + "round-trip-b.rs"]); fail "Mismatch"; } } -fn check_convergence(files: &[istr]) { +fn check_convergence(files: &[str]) { log_err #fmt["pp convergence tests: %u files", vec::len(files)]; for file in files { if !file_is_confusing(file) { @@ -352,14 +352,14 @@ fn check_convergence(files: &[istr]) { } } -fn check_variants(files: &[istr]) { +fn check_variants(files: &[str]) { for file in files { if !file_is_confusing(file) { let s = io::read_whole_file_str(file); if content_is_dangerous_to_modify(s) || content_is_confusing(s) { cont; } - log_err ~"check_variants: " + file; + log_err "check_variants: " + file; let sess = @{cm: codemap::new_codemap(), mutable next_id: 0}; let crate = parser::parse_crate_from_source_str( @@ -374,7 +374,7 @@ fn check_variants(files: &[istr]) { } } -fn main(args: [istr]) { +fn main(args: [str]) { if vec::len(args) != 2u { log_err #fmt["usage: %s <testdir>", args[0]]; ret; diff --git a/src/fuzzer/ivec_fuzz.rs b/src/fuzzer/ivec_fuzz.rs index 3dd24875c52..56d0d2ad97d 100644 --- a/src/fuzzer/ivec_fuzz.rs +++ b/src/fuzzer/ivec_fuzz.rs @@ -64,6 +64,7 @@ fn vec_edits<T>(v: &[T], xs: &[T]) -> [[T]] { //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; } + } for each i: uint in ix(0u, 1u, Lv) { edits += [vec_omit(v, i)]; } for each i: uint in ix(0u, 1u, Lv) { edits += [vec_dup(v, i)]; } diff --git a/src/lib/aio.rs b/src/lib/aio.rs index cdb0e3fb90d..8d8b036933d 100644 --- a/src/lib/aio.rs +++ b/src/lib/aio.rs @@ -45,6 +45,7 @@ tag request { type ctx = chan<request>; fn ip_to_sbuf(ip: net::ip_addr) -> *u8 { + // FIXME: This is broken. We're creating a vector, getting a pointer // to its buffer, then dropping the vector. On top of that, the vector // created by str::bytes is not null-terminated. @@ -97,8 +98,7 @@ fn accept_task(client: client, events: chan<server_event>) { fn server_task(ip: net::ip_addr, portnum: int, events: chan<server_event>, server: chan<server>) { let accepter = port(); - send(server, - rustrt::aio_serve(ip_to_sbuf(ip), portnum, chan(accepter))); + send(server, rustrt::aio_serve(ip_to_sbuf(ip), portnum, chan(accepter))); let client: client; while true { diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs index 87eba87ce49..019aa32f36a 100644 --- a/src/lib/bitv.rs +++ b/src/lib/bitv.rs @@ -151,11 +151,9 @@ fn to_vec(v: &t) -> [uint] { ret vec::init_fn::<uint>(sub, v.nbits); } -fn to_str(v: &t) -> istr { - let rs = ~""; - for i: uint in to_vec(v) { - if i == 1u { rs += ~"1"; } else { rs += ~"0"; } - } +fn to_str(v: &t) -> str { + let rs = ""; + for i: uint in to_vec(v) { if i == 1u { rs += "1"; } else { rs += "0"; } } ret rs; } diff --git a/src/lib/comm.rs b/src/lib/comm.rs index b5d1d3c7e93..f1ea9d485bc 100644 --- a/src/lib/comm.rs +++ b/src/lib/comm.rs @@ -12,8 +12,8 @@ native "rust" mod rustrt { type void; type rust_port; - fn chan_id_send<~T>(target_task: task::task, - target_port: port_id, data: -T); + fn chan_id_send<~T>(target_task: task::task, target_port: port_id, + data: -T); fn new_port(unit_sz: uint) -> *rust_port; fn del_port(po: *rust_port); diff --git a/src/lib/deque.rs b/src/lib/deque.rs index 5b2d8db418b..3cc75e2f3b6 100644 --- a/src/lib/deque.rs +++ b/src/lib/deque.rs @@ -27,6 +27,7 @@ fn create<@T>() -> t<T> { + fn grow<@T>(nelts: uint, lo: uint, elts: &[mutable cell<T>]) -> [mutable cell<T>] { assert (nelts == vec::len(elts)); diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs index d48fc67b43b..09d0bee1a60 100644 --- a/src/lib/ebml.rs +++ b/src/lib/ebml.rs @@ -67,7 +67,7 @@ fn get_doc(d: doc, tg: uint) -> doc { alt maybe_get_doc(d, tg) { some(d) { ret d; } none. { - log_err ~"failed to find block with tag " + uint::to_str(tg, 10u); + log_err "failed to find block with tag " + uint::to_str(tg, 10u); fail; } } diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs index 7f363b661da..edd99120872 100644 --- a/src/lib/extfmt.rs +++ b/src/lib/extfmt.rs @@ -67,30 +67,30 @@ mod ct { // A fragment of the output sequence - tag piece { piece_string(istr); piece_conv(conv); } - type error_fn = fn(&istr) -> ! ; + tag piece { piece_string(str); piece_conv(conv); } + type error_fn = fn(&str) -> ! ; - fn parse_fmt_string(s: &istr, error: error_fn) -> [piece] { + fn parse_fmt_string(s: &str, error: error_fn) -> [piece] { let pieces: [piece] = []; let lim = str::byte_len(s); - let buf = ~""; - fn flush_buf(buf: &istr, pieces: &mutable [piece]) -> istr { + let buf = ""; + fn flush_buf(buf: &str, pieces: &mutable [piece]) -> str { if str::byte_len(buf) > 0u { let piece = piece_string(buf); pieces += [piece]; } - ret ~""; + ret ""; } let i = 0u; while i < lim { let curr = str::substr(s, i, 1u); - if str::eq(curr, ~"%") { + if str::eq(curr, "%") { i += 1u; if i >= lim { - error(~"unterminated conversion at end of string"); + error("unterminated conversion at end of string"); } let curr2 = str::substr(s, i, 1u); - if str::eq(curr2, ~"%") { + if str::eq(curr2, "%") { i += 1u; } else { buf = flush_buf(buf, pieces); @@ -103,7 +103,7 @@ mod ct { buf = flush_buf(buf, pieces); ret pieces; } - fn peek_num(s: &istr, i: uint, lim: uint) -> + fn peek_num(s: &str, i: uint, lim: uint) -> option::t<{num: uint, next: uint}> { if i >= lim { ret none; } let c = s[i]; @@ -118,7 +118,7 @@ mod ct { } }; } - fn parse_conversion(s: &istr, i: uint, lim: uint, error: error_fn) -> + fn parse_conversion(s: &str, i: uint, lim: uint, error: error_fn) -> {piece: piece, next: uint} { let parm = parse_parameter(s, i, lim); let flags = parse_flags(s, parm.next, lim); @@ -133,7 +133,7 @@ mod ct { ty: ty.ty}), next: ty.next}; } - fn parse_parameter(s: &istr, i: uint, lim: uint) -> + fn parse_parameter(s: &str, i: uint, lim: uint) -> {param: option::t<int>, next: uint} { if i >= lim { ret {param: none, next: i}; } let num = peek_num(s, i, lim); @@ -148,14 +148,14 @@ mod ct { } }; } - fn parse_flags(s: &istr, i: uint, lim: uint) -> + fn parse_flags(s: &str, i: uint, lim: uint) -> {flags: [flag], next: uint} { let noflags: [flag] = []; if i >= lim { ret {flags: noflags, next: i}; } // FIXME: This recursion generates illegal instructions if the return // value isn't boxed. Only started happening after the ivec conversion - fn more_(f: flag, s: &istr, i: uint, lim: uint) -> + fn more_(f: flag, s: &str, i: uint, lim: uint) -> @{flags: [flag], next: uint} { let next = parse_flags(s, i + 1u, lim); let rest = next.flags; @@ -177,8 +177,8 @@ mod ct { *more(flag_alternate) } else { {flags: noflags, next: i} }; } - fn parse_count(s: &istr, i: uint, - lim: uint) -> {count: count, next: uint} { + fn parse_count(s: &str, i: uint, lim: uint) -> + {count: count, next: uint} { ret if i >= lim { {count: count_implied, next: i} } else if s[i] == '*' as u8 { @@ -198,7 +198,7 @@ mod ct { } }; } - fn parse_precision(s: &istr, i: uint, lim: uint) -> + fn parse_precision(s: &str, i: uint, lim: uint) -> {count: count, next: uint} { ret if i >= lim { {count: count_implied, next: i} @@ -214,32 +214,32 @@ mod ct { } } else { {count: count_implied, next: i} }; } - fn parse_type(s: &istr, i: uint, lim: uint, error: error_fn) -> + fn parse_type(s: &str, i: uint, lim: uint, error: error_fn) -> {ty: ty, next: uint} { - if i >= lim { error(~"missing type in conversion"); } + if i >= lim { error("missing type in conversion"); } let tstr = str::substr(s, i, 1u); // TODO: Do we really want two signed types here? // How important is it to be printf compatible? let t = - if str::eq(tstr, ~"b") { + if str::eq(tstr, "b") { ty_bool - } else if str::eq(tstr, ~"s") { + } else if str::eq(tstr, "s") { ty_str - } else if str::eq(tstr, ~"c") { + } else if str::eq(tstr, "c") { ty_char - } else if str::eq(tstr, ~"d") || str::eq(tstr, ~"i") { + } else if str::eq(tstr, "d") || str::eq(tstr, "i") { ty_int(signed) - } else if str::eq(tstr, ~"u") { + } else if str::eq(tstr, "u") { ty_int(unsigned) - } else if str::eq(tstr, ~"x") { + } else if str::eq(tstr, "x") { ty_hex(case_lower) - } else if str::eq(tstr, ~"X") { + } else if str::eq(tstr, "X") { ty_hex(case_upper) - } else if str::eq(tstr, ~"t") { + } else if str::eq(tstr, "t") { ty_bits - } else if str::eq(tstr, ~"o") { + } else if str::eq(tstr, "o") { ty_octal - } else { error(~"unknown type in conversion: " + tstr) }; + } else { error("unknown type in conversion: " + tstr) }; ret {ty: t, next: i + 1u}; } } @@ -270,20 +270,20 @@ mod rt { // instead just use a bool per flag type conv = {flags: [flag], width: count, precision: count, ty: ty}; - fn conv_int(cv: &conv, i: int) -> istr { + fn conv_int(cv: &conv, i: int) -> str { let radix = 10u; let prec = get_int_precision(cv); let s = int_to_str_prec(i, radix, prec); if 0 <= i { if have_flag(cv.flags, flag_sign_always) { - s = ~"+" + s; + s = "+" + s; } else if have_flag(cv.flags, flag_space_for_sign) { - s = ~" " + s; + s = " " + s; } } ret pad(cv, s, pad_signed); } - fn conv_uint(cv: &conv, u: uint) -> istr { + fn conv_uint(cv: &conv, u: uint) -> str { let prec = get_int_precision(cv); let rs = alt cv.ty { @@ -295,17 +295,17 @@ mod rt { }; ret pad(cv, rs, pad_unsigned); } - fn conv_bool(cv: &conv, b: bool) -> istr { - let s = if b { ~"true" } else { ~"false" }; + fn conv_bool(cv: &conv, b: bool) -> str { + let s = if b { "true" } else { "false" }; // run the boolean conversion through the string conversion logic, // giving it the same rules for precision, etc. ret conv_str(cv, s); } - fn conv_char(cv: &conv, c: char) -> istr { + fn conv_char(cv: &conv, c: char) -> str { ret pad(cv, str::from_char(c), pad_nozero); } - fn conv_str(cv: &conv, s: &istr) -> istr { + fn conv_str(cv: &conv, s: &str) -> str { // For strings, precision is the maximum characters // displayed @@ -324,18 +324,18 @@ mod rt { // Convert an int to string with minimum number of digits. If precision is // 0 and num is 0 then the result is the empty string. - fn int_to_str_prec(num: int, radix: uint, prec: uint) -> istr { + fn int_to_str_prec(num: int, radix: uint, prec: uint) -> str { ret if num < 0 { - ~"-" + uint_to_str_prec(-num as uint, radix, prec) + "-" + uint_to_str_prec(-num as uint, radix, prec) } else { uint_to_str_prec(num as uint, radix, prec) }; } // Convert a uint to string with a minimum number of digits. If precision // is 0 and num is 0 then the result is the empty string. Could move this // to uint: but it doesn't seem all that useful. - fn uint_to_str_prec(num: uint, radix: uint, prec: uint) -> istr { + fn uint_to_str_prec(num: uint, radix: uint, prec: uint) -> str { ret if prec == 0u && num == 0u { - ~"" + "" } else { let s = uint::to_str(num, radix); let len = str::char_len(s); @@ -354,13 +354,13 @@ mod rt { } // FIXME: This might be useful in str: but needs to be utf8 safe first - fn str_init_elt(c: char, n_elts: uint) -> istr { + fn str_init_elt(c: char, n_elts: uint) -> str { let svec = vec::init_elt::<u8>(c as u8, n_elts); ret str::unsafe_from_bytes(svec); } tag pad_mode { pad_signed; pad_unsigned; pad_nozero; } - fn pad(cv: &conv, s: &istr, mode: pad_mode) -> istr { + fn pad(cv: &conv, s: &str, mode: pad_mode) -> str { let uwidth; alt cv.width { count_implied. { ret s; } diff --git a/src/lib/fs.rs b/src/lib/fs.rs index 745c30c80b3..3ab6d3f5786 100644 --- a/src/lib/fs.rs +++ b/src/lib/fs.rs @@ -6,15 +6,15 @@ native "rust" mod rustrt { fn rust_file_is_dir(path: str::sbuf) -> int; } -fn path_sep() -> istr { ret str::from_char(os_fs::path_sep); } +fn path_sep() -> str { ret str::from_char(os_fs::path_sep); } -type path = istr; +type path = str; fn dirname(p: &path) -> path { let i: int = str::rindex(p, os_fs::path_sep as u8); if i == -1 { i = str::rindex(p, os_fs::alt_path_sep as u8); - if i == -1 { ret ~"."; } + if i == -1 { ret "."; } } ret str::substr(p, 0u, i as uint); } @@ -42,36 +42,28 @@ fn connect(pre: &path, post: &path) -> path { } fn file_is_dir(p: &path) -> bool { - ret str::as_buf(p, { |buf| - rustrt::rust_file_is_dir(buf) != 0 - }); + ret str::as_buf(p, {|buf| rustrt::rust_file_is_dir(buf) != 0 }); } -fn list_dir(p: &path) -> [istr] { +fn list_dir(p: &path) -> [str] { let p = p; let pl = str::byte_len(p); if pl == 0u || p[pl - 1u] as char != os_fs::path_sep { p += path_sep(); } - let full_paths: [istr] = []; - for filename: istr in os_fs::list_dir(p) { - if !str::eq(filename, ~".") { - if !str::eq(filename, ~"..") { full_paths += [p + filename]; } + let full_paths: [str] = []; + for filename: str in os_fs::list_dir(p) { + if !str::eq(filename, ".") { + if !str::eq(filename, "..") { full_paths += [p + filename]; } } } ret full_paths; } -fn path_is_absolute(p: &path) -> bool { - ret os_fs::path_is_absolute(p); -} +fn path_is_absolute(p: &path) -> bool { ret os_fs::path_is_absolute(p); } // FIXME: under Windows, we should prepend the current drive letter to paths // that start with a slash. fn make_absolute(p: &path) -> path { - if path_is_absolute(p) { - ret p; - } else { - ret connect(getcwd(), p); - } + if path_is_absolute(p) { ret p; } else { ret connect(getcwd(), p); } } // Local Variables: diff --git a/src/lib/fun_treemap.rs b/src/lib/fun_treemap.rs index 30ce4bc1b09..3d4894c4367 100644 --- a/src/lib/fun_treemap.rs +++ b/src/lib/fun_treemap.rs @@ -29,53 +29,41 @@ type treemap<@K, @V> = @tree_node<K, V>; fn init<@K, @V>() -> treemap<K, V> { @empty } -fn insert<@K, @V>(m : &treemap<K, V>, k : &K, v : &V) -> treemap<K,V> { +fn insert<@K, @V>(m: &treemap<K, V>, k: &K, v: &V) -> treemap<K, V> { @alt m { - @empty. { - node(@k, @v, @empty, @empty) - } - @node(@kk, vv, left, right) { - if k < kk { - node(@kk, vv, insert(left, k, v), right) - } else if k == kk { - node(@kk, @v, left, right) - } else { - node(@kk, vv, left, insert(right, k, v)) - } - } - } + @empty. { node(@k, @v, @empty, @empty) } + @node(@kk, vv, left, right) { + if k < kk { + node(@kk, vv, insert(left, k, v), right) + } else if k == kk { + node(@kk, @v, left, right) + } else { node(@kk, vv, left, insert(right, k, v)) } + } + } } -fn find<@K, @V>(m : &treemap<K, V>, k : &K) -> option<V> { - alt *m { - empty. { none } - node(@kk, @v, left, right) { - if k == kk { some(v) } - else if k < kk { find(left, k) } - else { find(right, k) } +fn find<@K, @V>(m: &treemap<K, V>, k: &K) -> option<V> { + alt *m { + empty. { none } + node(@kk, @v, left, right) { + if k == kk { + some(v) + } else if k < kk { find(left, k) } else { find(right, k) } + } } - } } // Performs an in-order traversal -fn traverse<@K, @V>(m : &treemap<K, V>, f : fn(&K, &V)) { - alt *m { - empty. { } - node(@k, @v, _, _) { - // copy v to make aliases work out - let v1 = v; - alt *m { - node(_, _, left, _) { - traverse(left, f); - } - } - f(k, v1); - alt *m { - node(_, _, _, right) { - traverse(right, f); - } +fn traverse<@K, @V>(m: &treemap<K, V>, f: fn(&K, &V)) { + alt *m { + empty. { } + node(@k, @v, _, _) { + // copy v to make aliases work out + let v1 = v; + alt *m { node(_, _, left, _) { traverse(left, f); } } + f(k, v1); + alt *m { node(_, _, _, right) { traverse(right, f); } } } } - } } diff --git a/src/lib/generic_os.rs b/src/lib/generic_os.rs index 169548d106a..8a34f76a387 100644 --- a/src/lib/generic_os.rs +++ b/src/lib/generic_os.rs @@ -3,40 +3,45 @@ import str::sbuf; #[cfg(target_os = "linux")] #[cfg(target_os = "macos")] -fn getenv(n: &istr) -> option::t<istr> { - let s = str::as_buf(n, { |buf| - os::libc::getenv(buf) - }); +fn getenv(n: &str) -> option::t<str> { + let s = str::as_buf(n, {|buf| os::libc::getenv(buf) }); ret if unsafe::reinterpret_cast(s) == 0 { - option::none::<istr> - } else { - let s = unsafe::reinterpret_cast(s); - option::some::<istr>(str::str_from_cstr(s)) - }; + option::none::<str> + } else { + let s = unsafe::reinterpret_cast(s); + option::some::<str>(str::str_from_cstr(s)) + }; } #[cfg(target_os = "linux")] #[cfg(target_os = "macos")] -fn setenv(n: &istr, v: &istr) { +fn setenv(n: &str, v: &str) { // FIXME (868) - let _: () = str::as_buf(n, { |nbuf| - // FIXME (868) - let _: () = str::as_buf(v, { |vbuf| - os::libc::setenv(nbuf, vbuf, 1); - }); - }); + let _: () = + str::as_buf(n, + // FIXME (868) + {|nbuf| + let _: () = + str::as_buf(v, + {|vbuf| + os::libc::setenv(nbuf, vbuf, 1); + }); + }); } #[cfg(target_os = "win32")] -fn getenv(n: &istr) -> option::t<istr> { +fn getenv(n: &str) -> option::t<str> { let nsize = 256u; while true { let v: [u8] = []; vec::reserve(v, nsize); - let res = str::as_buf(n, { |nbuf| - let vbuf = vec::to_ptr(v); - os::kernel32::GetEnvironmentVariableA(nbuf, vbuf, nsize) - }); + let res = + str::as_buf(n, + {|nbuf| + let vbuf = vec::to_ptr(v); + os::kernel32::GetEnvironmentVariableA(nbuf, vbuf, + nsize) + }); if res == 0u { ret option::none; } else if res < nsize { @@ -48,10 +53,10 @@ fn getenv(n: &istr) -> option::t<istr> { } #[cfg(target_os = "win32")] -fn setenv(n: &istr, v: &istr) { +fn setenv(n: &str, v: &str) { // FIXME (868) - let _: () = str::as_buf(n, { |nbuf| - let _: () = str::as_buf(v, { |vbuf| + let _: () = str::as_buf(n, {|nbuf| + let _: () = str::as_buf(v, {|vbuf| os::kernel32::SetEnvironmentVariableA(nbuf, vbuf); }); }); diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs index 3df28220651..c36f766a5dc 100644 --- a/src/lib/getopts.rs +++ b/src/lib/getopts.rs @@ -29,7 +29,7 @@ export opt_strs; export opt_maybe_str; export opt_default; -tag name { long(istr); short(char); } +tag name { long(str); short(char); } tag hasarg { yes; no; maybe; } @@ -37,41 +37,41 @@ tag occur { req; optional; multi; } type opt = {name: name, hasarg: hasarg, occur: occur}; -fn mkname(nm: &istr) -> name { +fn mkname(nm: &str) -> name { ret if str::char_len(nm) == 1u { short(str::char_at(nm, 0u)) } else { long(nm) }; } -fn reqopt(name: &istr) -> opt { +fn reqopt(name: &str) -> opt { ret {name: mkname(name), hasarg: yes, occur: req}; } -fn optopt(name: &istr) -> opt { +fn optopt(name: &str) -> opt { ret {name: mkname(name), hasarg: yes, occur: optional}; } -fn optflag(name: &istr) -> opt { +fn optflag(name: &str) -> opt { ret {name: mkname(name), hasarg: no, occur: optional}; } -fn optflagopt(name: &istr) -> opt { +fn optflagopt(name: &str) -> opt { ret {name: mkname(name), hasarg: maybe, occur: optional}; } -fn optmulti(name: &istr) -> opt { +fn optmulti(name: &str) -> opt { ret {name: mkname(name), hasarg: yes, occur: multi}; } -tag optval { val(istr); given; } +tag optval { val(str); given; } -type match = {opts: [opt], vals: [mutable [optval]], free: [istr]}; +type match = {opts: [opt], vals: [mutable [optval]], free: [str]}; -fn is_arg(arg: &istr) -> bool { +fn is_arg(arg: &str) -> bool { ret str::byte_len(arg) > 1u && arg[0] == '-' as u8; } -fn name_str(nm: &name) -> istr { +fn name_str(nm: &name) -> str { ret alt nm { short(ch) { str::from_char(ch) } long(s) { s } }; } @@ -83,36 +83,34 @@ fn find_opt(opts: &[opt], nm: &name) -> option::t<uint> { } tag fail_ { - argument_missing(istr); - unrecognized_option(istr); - option_missing(istr); - option_duplicated(istr); - unexpected_argument(istr); + argument_missing(str); + unrecognized_option(str); + option_missing(str); + option_duplicated(str); + unexpected_argument(str); } -fn fail_str(f: &fail_) -> istr { +fn fail_str(f: &fail_) -> str { ret alt f { - argument_missing(nm) { - ~"Argument to option '" + nm + ~"' missing." } - unrecognized_option(nm) { - ~"Unrecognized option: '" + nm + ~"'." } - option_missing(nm) { ~"Required option '" + nm + ~"' missing." } + argument_missing(nm) { "Argument to option '" + nm + "' missing." } + unrecognized_option(nm) { "Unrecognized option: '" + nm + "'." } + option_missing(nm) { "Required option '" + nm + "' missing." } option_duplicated(nm) { - ~"Option '" + nm + ~"' given more than once." + "Option '" + nm + "' given more than once." } unexpected_argument(nm) { - ~"Option " + nm + ~" does not take an argument." + "Option " + nm + " does not take an argument." } }; } tag result { success(match); failure(fail_); } -fn getopts(args: &[istr], opts: &[opt]) -> result { +fn getopts(args: &[str], opts: &[opt]) -> result { let n_opts = vec::len::<opt>(opts); fn f(_x: uint) -> [optval] { ret []; } let vals = vec::init_fn_mut::<[optval]>(f, n_opts); - let free: [istr] = []; + let free: [str] = []; let l = vec::len(args); let i = 0u; while i < l { @@ -120,13 +118,13 @@ fn getopts(args: &[istr], opts: &[opt]) -> result { let curlen = str::byte_len(cur); if !is_arg(cur) { free += [cur]; - } else if str::eq(cur, ~"--") { + } else if str::eq(cur, "--") { let j = i + 1u; while j < l { free += [args[j]]; j += 1u; } break; } else { let names; - let i_arg = option::none::<istr>; + let i_arg = option::none::<str>; if cur[1] == '-' as u8 { let tail = str::slice(cur, 2u, curlen); let eq = str::index(tail, '=' as u8); @@ -135,9 +133,9 @@ fn getopts(args: &[istr], opts: &[opt]) -> result { } else { names = [long(str::slice(tail, 0u, eq as uint))]; i_arg = - option::some::<istr>(str::slice(tail, - (eq as uint) + 1u, - curlen - 2u)); + option::some::<str>(str::slice(tail, + (eq as uint) + 1u, + curlen - 2u)); } } else { let j = 1u; @@ -158,13 +156,13 @@ fn getopts(args: &[istr], opts: &[opt]) -> result { } alt opts[optid].hasarg { no. { - if !option::is_none::<istr>(i_arg) { + if !option::is_none::<str>(i_arg) { ret failure(unexpected_argument(name_str(nm))); } vals[optid] += [given]; } maybe. { - if !option::is_none::<istr>(i_arg) { + if !option::is_none::<str>(i_arg) { vals[optid] += [val(option::get(i_arg))]; } else if name_pos < vec::len::<name>(names) || i + 1u == l || is_arg(args[i + 1u]) { @@ -172,8 +170,8 @@ fn getopts(args: &[istr], opts: &[opt]) -> result { } else { i += 1u; vals[optid] += [val(args[i])]; } } yes. { - if !option::is_none::<istr>(i_arg) { - vals[optid] += [val(option::get::<istr>(i_arg))]; + if !option::is_none::<str>(i_arg) { + vals[optid] += [val(option::get::<str>(i_arg))]; } else if i + 1u == l { ret failure(argument_missing(name_str(nm))); } else { i += 1u; vals[optid] += [val(args[i])]; } @@ -202,45 +200,45 @@ fn getopts(args: &[istr], opts: &[opt]) -> result { ret success({opts: opts, vals: vals, free: free}); } -fn opt_vals(m: &match, nm: &istr) -> [optval] { +fn opt_vals(m: &match, nm: &str) -> [optval] { ret alt find_opt(m.opts, mkname(nm)) { some(id) { m.vals[id] } - none. { log_err ~"No option '" + nm + ~"' defined."; fail } + none. { log_err "No option '" + nm + "' defined."; fail } }; } -fn opt_val(m: &match, nm: &istr) -> optval { ret opt_vals(m, nm)[0]; } +fn opt_val(m: &match, nm: &str) -> optval { ret opt_vals(m, nm)[0]; } -fn opt_present(m: &match, nm: &istr) -> bool { +fn opt_present(m: &match, nm: &str) -> bool { ret vec::len::<optval>(opt_vals(m, nm)) > 0u; } -fn opt_str(m: &match, nm: &istr) -> istr { +fn opt_str(m: &match, nm: &str) -> str { ret alt opt_val(m, nm) { val(s) { s } _ { fail } }; } -fn opt_strs(m: &match, nm: &istr) -> [istr] { - let acc: [istr] = []; +fn opt_strs(m: &match, nm: &str) -> [str] { + let acc: [str] = []; for v: optval in opt_vals(m, nm) { alt v { val(s) { acc += [s]; } _ { } } } ret acc; } -fn opt_maybe_str(m: &match, nm: &istr) -> option::t<istr> { +fn opt_maybe_str(m: &match, nm: &str) -> option::t<str> { let vals = opt_vals(m, nm); - if vec::len::<optval>(vals) == 0u { ret none::<istr>; } - ret alt vals[0] { val(s) { some::<istr>(s) } _ { none::<istr> } }; + if vec::len::<optval>(vals) == 0u { ret none::<str>; } + ret alt vals[0] { val(s) { some::<str>(s) } _ { none::<str> } }; } /// Returns none if the option was not present, `def` if the option was /// present but no argument was provided, and the argument if the option was /// present and an argument was provided. -fn opt_default(m: &match, nm: &istr, def: &istr) -> option::t<istr> { +fn opt_default(m: &match, nm: &str, def: &str) -> option::t<str> { let vals = opt_vals(m, nm); - if vec::len::<optval>(vals) == 0u { ret none::<istr>; } - ret alt vals[0] { val(s) { some::<istr>(s) } _ { some::<istr>(def) } } + if vec::len::<optval>(vals) == 0u { ret none::<str>; } + ret alt vals[0] { val(s) { some::<str>(s) } _ { some::<str>(def) } } } // Local Variables: // mode: rust; diff --git a/src/lib/int.rs b/src/lib/int.rs index 162cf727c49..ef80852c8d3 100644 --- a/src/lib/int.rs +++ b/src/lib/int.rs @@ -41,13 +41,13 @@ iter range(lo: int, hi: int) -> int { while lo_ < hi { put lo_; lo_ += 1; } } -fn to_str(n: int, radix: uint) -> istr { +fn to_str(n: int, radix: uint) -> str { assert (0u < radix && radix <= 16u); ret if n < 0 { - ~"-" + uint::to_str(-n as uint, radix) + "-" + uint::to_str(-n as uint, radix) } else { uint::to_str(n as uint, radix) }; } -fn str(i: int) -> istr { ret to_str(i, 10u); } +fn str(i: int) -> str { ret to_str(i, 10u); } fn pow(base: int, exponent: uint) -> int { ret if exponent == 0u { diff --git a/src/lib/io.rs b/src/lib/io.rs index 57ebb806f52..0889d3ec454 100644 --- a/src/lib/io.rs +++ b/src/lib/io.rs @@ -40,8 +40,8 @@ type reader = fn read_bytes(uint) -> [u8]; fn read_char() -> char; fn eof() -> bool; - fn read_line() -> istr; - fn read_c_str() -> istr; + fn read_line() -> str; + fn read_c_str() -> str; fn read_le_uint(uint) -> uint; fn read_le_int(uint) -> int; fn read_be_uint(uint) -> uint; @@ -60,8 +60,8 @@ obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) { fn read(len: uint) -> [u8] { let buf = []; vec::reserve::<u8>(buf, len); - let read = os::libc::fread(vec::unsafe::to_ptr::<u8>(buf), - 1u, len, f); + let read = + os::libc::fread(vec::unsafe::to_ptr::<u8>(buf), 1u, len, f); vec::unsafe::set_len::<u8>(buf, read); ret buf; } @@ -106,7 +106,7 @@ obj new_reader(rdr: buf_reader) { ret val as char; } fn eof() -> bool { ret rdr.eof(); } - fn read_line() -> istr { + fn read_line() -> str { let buf: [u8] = []; // No break yet in rustc @@ -119,7 +119,7 @@ obj new_reader(rdr: buf_reader) { } ret str::unsafe_from_bytes(buf); } - fn read_c_str() -> istr { + fn read_c_str() -> str { let buf: [u8] = []; let go_on = true; while go_on { @@ -174,13 +174,16 @@ fn stdin() -> reader { ret new_reader(FILE_buf_reader(rustrt::rust_get_stdin(), option::none)); } -fn file_reader(path: &istr) -> reader { - let f = str::as_buf(path, { |pathbuf| - str::as_buf(~"r", { |modebuf| - os::libc::fopen(pathbuf, modebuf) - }) - }); - if f as uint == 0u { log_err ~"error opening " + path; fail; } +fn file_reader(path: &str) -> reader { + let f = + str::as_buf(path, + {|pathbuf| + str::as_buf("r", + {|modebuf| + os::libc::fopen(pathbuf, modebuf) + }) + }); + if f as uint == 0u { log_err "error opening " + path; fail; } ret new_reader(FILE_buf_reader(f, option::some(@FILE_res(f)))); } @@ -219,7 +222,7 @@ fn new_byte_buf_reader(buf: &[u8]) -> buf_reader { ret byte_buf_reader(@{buf: buf, mutable pos: 0u}); } -fn string_reader(s: &istr) -> reader { +fn string_reader(s: &str) -> reader { ret new_reader(new_byte_buf_reader(str::bytes(s))); } @@ -279,7 +282,7 @@ obj fd_buf_writer(fd: int, res: option::t<@fd_res>) { } } -fn file_buf_writer(path: &istr, flags: &[fileflag]) -> buf_writer { +fn file_buf_writer(path: &str, flags: &[fileflag]) -> buf_writer { let fflags: int = os::libc_constants::O_WRONLY() | os::libc_constants::O_BINARY(); for f: fileflag in flags { @@ -290,11 +293,13 @@ fn file_buf_writer(path: &istr, flags: &[fileflag]) -> buf_writer { none. { } } } - let fd = str::as_buf(path, { |pathbuf| - os::libc::open(pathbuf, fflags, - os::libc_constants::S_IRUSR() | - os::libc_constants::S_IWUSR()) - }); + let fd = + str::as_buf(path, + {|pathbuf| + os::libc::open(pathbuf, fflags, + os::libc_constants::S_IRUSR() | + os::libc_constants::S_IWUSR()) + }); if fd < 0 { log_err "error opening file for writing"; log_err sys::rustrt::last_os_error(); @@ -308,8 +313,8 @@ type writer = // function will be provided for general encoded string output obj { fn get_buf_writer() -> buf_writer; - fn write_str(&istr); - fn write_line(&istr); + fn write_str(&str); + fn write_line(&str); fn write_char(char); fn write_int(int); fn write_uint(uint); @@ -334,20 +339,18 @@ fn uint_to_be_bytes(n: uint, size: uint) -> [u8] { obj new_writer(out: buf_writer) { fn get_buf_writer() -> buf_writer { ret out; } - fn write_str(s: &istr) { out.write(str::bytes(s)); } - fn write_line(s: &istr) { + fn write_str(s: &str) { out.write(str::bytes(s)); } + fn write_line(s: &str) { out.write(str::bytes(s)); - out.write(str::bytes(~"\n")); + out.write(str::bytes("\n")); } fn write_char(ch: char) { // FIXME needlessly consy out.write(str::bytes(str::from_char(ch))); } - fn write_int(n: int) { out.write(str::bytes( - int::to_str(n, 10u))); } - fn write_uint(n: uint) { out.write(str::bytes( - uint::to_str(n, 10u))); } + fn write_int(n: int) { out.write(str::bytes(int::to_str(n, 10u))); } + fn write_uint(n: uint) { out.write(str::bytes(uint::to_str(n, 10u))); } fn write_bytes(bytes: &[u8]) { out.write(bytes); } fn write_le_uint(n: uint, size: uint) { out.write(uint_to_le_bytes(n, size)); @@ -360,19 +363,22 @@ obj new_writer(out: buf_writer) { } } -fn file_writer(path: &istr, flags: &[fileflag]) -> writer { +fn file_writer(path: &str, flags: &[fileflag]) -> writer { ret new_writer(file_buf_writer(path, flags)); } // FIXME: fileflags -fn buffered_file_buf_writer(path: &istr) -> buf_writer { - let f = str::as_buf(path, { |pathbuf| - str::as_buf(~"w", { |modebuf| - os::libc::fopen(pathbuf, modebuf) - }) - }); - if f as uint == 0u { log_err ~"error opening " + path; fail; } +fn buffered_file_buf_writer(path: &str) -> buf_writer { + let f = + str::as_buf(path, + {|pathbuf| + str::as_buf("w", + {|modebuf| + os::libc::fopen(pathbuf, modebuf) + }) + }); + if f as uint == 0u { log_err "error opening " + path; fail; } ret FILE_writer(f, option::some(@FILE_res(f))); } @@ -384,7 +390,7 @@ fn stderr() -> writer { ret new_writer(fd_buf_writer(2, option::none)); } type str_writer = obj { fn get_writer() -> writer; - fn get_str() -> istr; + fn get_str() -> str; }; type mutable_byte_buf = @{mutable buf: [mutable u8], mutable pos: uint}; @@ -427,7 +433,7 @@ fn string_writer() -> str_writer { let buf: mutable_byte_buf = @{mutable buf: b, mutable pos: 0u}; obj str_writer_wrap(wr: writer, buf: mutable_byte_buf) { fn get_writer() -> writer { ret wr; } - fn get_str() -> istr { ret str::unsafe_from_bytes(buf.buf); } + fn get_str() -> str { ret str::unsafe_from_bytes(buf.buf); } } ret str_writer_wrap(new_writer(byte_buf_writer(buf)), buf); } @@ -447,11 +453,11 @@ fn seek_in_buf(offset: int, pos: uint, len: uint, whence: seek_style) -> ret bpos as uint; } -fn read_whole_file_str(file: &istr) -> istr { +fn read_whole_file_str(file: &str) -> str { str::unsafe_from_bytes(read_whole_file(file)) } -fn read_whole_file(file: &istr) -> [u8] { +fn read_whole_file(file: &str) -> [u8] { // FIXME: There's a lot of copying here file_reader(file).read_whole_stream() diff --git a/src/lib/linux_os.rs b/src/lib/linux_os.rs index 0081aa18265..b393d9a1e08 100644 --- a/src/lib/linux_os.rs +++ b/src/lib/linux_os.rs @@ -50,11 +50,11 @@ mod libc_constants { fn S_IWUSR() -> uint { ret 128u; } } -fn exec_suffix() -> istr { ret ~""; } +fn exec_suffix() -> str { ret ""; } -fn target_os() -> istr { ret ~"linux"; } +fn target_os() -> str { ret "linux"; } -fn dylib_filename(base: &istr) -> istr { ret ~"lib" + base + ~".so"; } +fn dylib_filename(base: &str) -> str { ret "lib" + base + ".so"; } fn pipe() -> {in: int, out: int} { let fds = {mutable in: 0, mutable out: 0}; @@ -63,9 +63,7 @@ fn pipe() -> {in: int, out: int} { } fn fd_FILE(fd: int) -> libc::FILE { - ret str::as_buf(~"r", { |modebuf| - libc::fdopen(fd, modebuf) - }); + ret str::as_buf("r", {|modebuf| libc::fdopen(fd, modebuf) }); } fn waitpid(pid: int) -> int { @@ -75,12 +73,10 @@ fn waitpid(pid: int) -> int { } native "rust" mod rustrt { - fn rust_getcwd() -> istr; + fn rust_getcwd() -> str; } -fn getcwd() -> istr { - ret rustrt::rust_getcwd(); -} +fn getcwd() -> str { ret rustrt::rust_getcwd(); } // Local Variables: diff --git a/src/lib/macos_os.rs b/src/lib/macos_os.rs index 2c244048113..e18fdd5b32f 100644 --- a/src/lib/macos_os.rs +++ b/src/lib/macos_os.rs @@ -47,11 +47,11 @@ mod libc_constants { fn S_IWUSR() -> uint { ret 512u; } } -fn exec_suffix() -> istr { ret ~""; } +fn exec_suffix() -> str { ret ""; } -fn target_os() -> istr { ret ~"macos"; } +fn target_os() -> str { ret "macos"; } -fn dylib_filename(base: &istr) -> istr { ret ~"lib" + base + ~".dylib"; } +fn dylib_filename(base: &str) -> str { ret "lib" + base + ".dylib"; } fn pipe() -> {in: int, out: int} { let fds = {mutable in: 0, mutable out: 0}; @@ -60,9 +60,7 @@ fn pipe() -> {in: int, out: int} { } fn fd_FILE(fd: int) -> libc::FILE { - ret str::as_buf(~"r", { |modebuf| - libc::fdopen(fd, modebuf) - }); + ret str::as_buf("r", {|modebuf| libc::fdopen(fd, modebuf) }); } fn waitpid(pid: int) -> int { @@ -72,12 +70,10 @@ fn waitpid(pid: int) -> int { } native "rust" mod rustrt { - fn rust_getcwd() -> istr; + fn rust_getcwd() -> str; } -fn getcwd() -> istr { - ret rustrt::rust_getcwd(); -} +fn getcwd() -> str { ret rustrt::rust_getcwd(); } // Local Variables: diff --git a/src/lib/map.rs b/src/lib/map.rs index a608e7b877b..d54eae03d10 100644 --- a/src/lib/map.rs +++ b/src/lib/map.rs @@ -194,7 +194,7 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { // Hash map constructors for basic types -fn new_str_hash<@V>() -> hashmap<istr, V> { +fn new_str_hash<@V>() -> hashmap<str, V> { ret mk_hashmap(str::hash, str::eq); } diff --git a/src/lib/net.rs b/src/lib/net.rs index 246574dd07b..be778d9858e 100644 --- a/src/lib/net.rs +++ b/src/lib/net.rs @@ -3,7 +3,7 @@ import uint; tag ip_addr { ipv4(u8, u8, u8, u8); } -fn format_addr(ip: ip_addr) -> istr { +fn format_addr(ip: ip_addr) -> str { alt ip { ipv4(a, b, c, d) { #fmt["%u.%u.%u.%u", a as uint, b as uint, c as uint, d as uint] @@ -12,10 +12,8 @@ fn format_addr(ip: ip_addr) -> istr { } } -fn parse_addr(ip: &istr) -> ip_addr { - let parts = vec::map( - { |&s| uint::from_str(s) }, - str::split(ip, ~"."[0])); +fn parse_addr(ip: &str) -> ip_addr { + let parts = vec::map({|&s| uint::from_str(s) }, str::split(ip, "."[0])); if vec::len(parts) != 4u { fail "Too many dots in IP address"; } for i in parts { if i > 255u { fail "Invalid IP Address part."; } } ipv4(parts[0] as u8, parts[1] as u8, parts[2] as u8, parts[3] as u8) diff --git a/src/lib/posix_fs.rs b/src/lib/posix_fs.rs index b31f9ca8637..8b4f06a6a9b 100644 --- a/src/lib/posix_fs.rs +++ b/src/lib/posix_fs.rs @@ -1,9 +1,9 @@ native "rust" mod rustrt { - fn rust_list_files(path: &istr) -> [istr]; + fn rust_list_files(path: &str) -> [str]; } -fn list_dir(path: &istr) -> [istr] { +fn list_dir(path: &str) -> [str] { ret rustrt::rust_list_files(path); // FIXME: No idea why, but this appears to corrupt memory on OSX. I @@ -30,7 +30,7 @@ fn list_dir(path: &istr) -> [istr] { } -fn path_is_absolute(p: &istr) -> bool { ret str::char_at(p, 0u) == '/'; } +fn path_is_absolute(p: &str) -> bool { ret str::char_at(p, 0u) == '/'; } const path_sep: char = '/'; diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs index 3558da2388a..a4adaace38a 100644 --- a/src/lib/run_program.rs +++ b/src/lib/run_program.rs @@ -12,29 +12,27 @@ native "rust" mod rustrt { int; } -fn arg_vec(prog: &istr, args: &[@istr]) -> [sbuf] { - let argptrs = str::as_buf(prog, { |buf| [buf] }); - for arg in args { - argptrs += str::as_buf(*arg, { |buf| [buf] }); - } +fn arg_vec(prog: &str, args: &[@str]) -> [sbuf] { + let argptrs = str::as_buf(prog, {|buf| [buf] }); + for arg in args { argptrs += str::as_buf(*arg, {|buf| [buf] }); } argptrs += [unsafe::reinterpret_cast(0)]; ret argptrs; } -fn spawn_process(prog: &istr, args: &[istr], in_fd: int, out_fd: int, +fn spawn_process(prog: &str, args: &[str], in_fd: int, out_fd: int, err_fd: int) -> int { // Note: we have to hold on to these vector references while we hold a // pointer to their buffers let prog = prog; - let args = vec::map({ |&arg| @arg }, args); + let args = vec::map({|&arg| @arg }, args); let argv = arg_vec(prog, args); let pid = - rustrt::rust_run_program(vec::unsafe::to_ptr(argv), - in_fd, out_fd, err_fd); + rustrt::rust_run_program(vec::unsafe::to_ptr(argv), in_fd, out_fd, + err_fd); ret pid; } -fn run_program(prog: &istr, args: &[istr]) -> int { +fn run_program(prog: &str, args: &[str]) -> int { ret os::waitpid(spawn_process(prog, args, 0, 0, 0)); } @@ -51,7 +49,7 @@ type program = resource program_res(p: program) { p.destroy(); } -fn start_program(prog: &istr, args: &[istr]) -> @program_res { +fn start_program(prog: &str, args: &[str]) -> @program_res { let pipe_input = os::pipe(); let pipe_output = os::pipe(); let pipe_err = os::pipe(); @@ -102,8 +100,8 @@ fn start_program(prog: &istr, args: &[istr]) -> @program_res { os::fd_FILE(pipe_err.in), false)); } -fn read_all(rd: &io::reader) -> istr { - let buf = ~""; +fn read_all(rd: &io::reader) -> str { + let buf = ""; while !rd.eof() { let bytes = rd.read_bytes(4096u); buf += str::unsafe_from_bytes(bytes); @@ -111,8 +109,8 @@ fn read_all(rd: &io::reader) -> istr { ret buf; } -fn program_output(prog: &istr, args: &[istr]) -> - {status: int, out: istr, err: istr} { +fn program_output(prog: &str, args: &[str]) -> + {status: int, out: str, err: str} { let pr = start_program(prog, args); pr.close_input(); ret {status: pr.finish(), diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs index b1c1a2ac229..25003a4b128 100644 --- a/src/lib/sha1.rs +++ b/src/lib/sha1.rs @@ -6,20 +6,21 @@ export sha1; export mk_sha1; -type sha1 = obj { +type sha1 = // Provide message input as bytes - fn input(&[u8]); // Provide message input as string - fn input_str(&istr); // Read the digest as a vector of 20 bytes. After calling this no further // input may provided until reset is called - fn result() -> [u8]; // Same as above, just a hex-string version. - fn result_str() -> istr; // Reset the sha1 state for reuse. This is called // automatically during construction - fn reset(); -}; + obj { + fn input(&[u8]); + fn input_str(&str); + fn result() -> [u8]; + fn result_str() -> str; + fn reset(); + }; // Some unexported constants @@ -215,14 +216,12 @@ fn mk_sha1() -> sha1 { st.computed = false; } fn input(msg: &[u8]) { add_input(st, msg); } - fn input_str(msg: &istr) { add_input(st, str::bytes(msg)); } + fn input_str(msg: &str) { add_input(st, str::bytes(msg)); } fn result() -> [u8] { ret mk_result(st); } - fn result_str() -> istr { + fn result_str() -> str { let r = mk_result(st); - let s = ~""; - for b: u8 in r { - s += uint::to_str(b as uint, 16u); - } + let s = ""; + for b: u8 in r { s += uint::to_str(b as uint, 16u); } ret s; } } diff --git a/src/lib/str.rs b/src/lib/str.rs index 662d0d0c228..a20c3f205ab 100644 --- a/src/lib/str.rs +++ b/src/lib/str.rs @@ -1,20 +1,20 @@ -export eq, lteq, hash, is_empty, is_not_empty, is_whitespace, byte_len, -index, rindex, find, starts_with, ends_with, substr, slice, split, -concat, connect, to_upper, replace, char_slice, trim_left, trim_right, trim, -unshift_char, shift_char, pop_char, push_char, is_utf8, from_chars, to_chars, -char_len, char_at, bytes, is_ascii, shift_byte, pop_byte, unsafe_from_byte, -unsafe_from_bytes, from_char, char_range_at, str_from_cstr, sbuf, -as_buf, push_byte, utf8_char_width, safe_slice; +export eq, lteq, hash, is_empty, is_not_empty, is_whitespace, byte_len, index, + rindex, find, starts_with, ends_with, substr, slice, split, concat, + connect, to_upper, replace, char_slice, trim_left, trim_right, trim, + unshift_char, shift_char, pop_char, push_char, is_utf8, from_chars, + to_chars, char_len, char_at, bytes, is_ascii, shift_byte, pop_byte, + unsafe_from_byte, unsafe_from_bytes, from_char, char_range_at, + str_from_cstr, sbuf, as_buf, push_byte, utf8_char_width, safe_slice; native "rust" mod rustrt { - fn rust_istr_push(s: &mutable istr, ch: u8); + fn rust_istr_push(s: &mutable str, ch: u8); } -fn eq(a: &istr, b: &istr) -> bool { a == b } +fn eq(a: &str, b: &str) -> bool { a == b } -fn lteq(a: &istr, b: &istr) -> bool { a <= b } +fn lteq(a: &str, b: &str) -> bool { a <= b } -fn hash(s: &istr) -> uint { +fn hash(s: &str) -> uint { // djb hash. // FIXME: replace with murmur. @@ -54,23 +54,19 @@ fn is_utf8(v: &[u8]) -> bool { ret true; } -fn is_ascii(s: &istr) -> bool { +fn is_ascii(s: &str) -> bool { let i: uint = byte_len(s); while i > 0u { i -= 1u; if s[i] & 128u8 != 0u8 { ret false; } } ret true; } /// Returns true if the string has length 0 -pure fn is_empty(s: &istr) -> bool { - for c: u8 in s { ret false; } ret true; -} +pure fn is_empty(s: &str) -> bool { for c: u8 in s { ret false; } ret true; } /// Returns true if the string has length greater than 0 -pure fn is_not_empty(s: &istr) -> bool { - !is_empty(s) -} +pure fn is_not_empty(s: &str) -> bool { !is_empty(s) } -fn is_whitespace(s: &istr) -> bool { +fn is_whitespace(s: &str) -> bool { let i = 0u; let len = char_len(s); while i < len { @@ -80,74 +76,68 @@ fn is_whitespace(s: &istr) -> bool { ret true; } -fn byte_len(s: &istr) -> uint { +fn byte_len(s: &str) -> uint { let v: [u8] = unsafe::reinterpret_cast(s); let vlen = vec::len(v); unsafe::leak(v); // There should always be a null terminator - assert vlen > 0u; + assert (vlen > 0u); ret vlen - 1u; } -fn bytes(s: &istr) -> [u8] { +fn bytes(s: &str) -> [u8] { let v = unsafe::reinterpret_cast(s); let vcopy = vec::slice(v, 0u, vec::len(v) - 1u); unsafe::leak(v); ret vcopy; } -fn unsafe_from_bytes(v: &[mutable? u8]) -> istr { +fn unsafe_from_bytes(v: &[mutable? u8]) -> str { let vcopy: [u8] = v + [0u8]; - let scopy: istr = unsafe::reinterpret_cast(vcopy); + let scopy: str = unsafe::reinterpret_cast(vcopy); unsafe::leak(vcopy); ret scopy; } -fn unsafe_from_byte(u: u8) -> istr { - unsafe_from_bytes([u]) -} +fn unsafe_from_byte(u: u8) -> str { unsafe_from_bytes([u]) } -fn push_utf8_bytes(s: &mutable istr, ch: char) { +fn push_utf8_bytes(s: &mutable str, ch: char) { let code = ch as uint; - let bytes = if code < max_one_b { - [code as u8] - } else if code < max_two_b { - [(code >> 6u & 31u | tag_two_b) as u8, - (code & 63u | tag_cont) as u8] - } else if code < max_three_b { - [(code >> 12u & 15u | tag_three_b) as u8, - (code >> 6u & 63u | tag_cont) as u8, - (code & 63u | tag_cont) as u8] - } else if code < max_four_b { - [(code >> 18u & 7u | tag_four_b) as u8, - (code >> 12u & 63u | tag_cont) as u8, - (code >> 6u & 63u | tag_cont) as u8, - (code & 63u | tag_cont) as u8] - } else if code < max_five_b { - [(code >> 24u & 3u | tag_five_b) as u8, - (code >> 18u & 63u | tag_cont) as u8, - (code >> 12u & 63u | tag_cont) as u8, - (code >> 6u & 63u | tag_cont) as u8, - (code & 63u | tag_cont) as u8] - } else { - [(code >> 30u & 1u | tag_six_b) as u8, - (code >> 24u & 63u | tag_cont) as u8, - (code >> 18u & 63u | tag_cont) as u8, - (code >> 12u & 63u | tag_cont) as u8, - (code >> 6u & 63u | tag_cont) as u8, - (code & 63u | tag_cont) as u8] - }; + let bytes = + if code < max_one_b { + [code as u8] + } else if code < max_two_b { + [code >> 6u & 31u | tag_two_b as u8, code & 63u | tag_cont as u8] + } else if code < max_three_b { + [code >> 12u & 15u | tag_three_b as u8, + code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8] + } else if code < max_four_b { + [code >> 18u & 7u | tag_four_b as u8, + code >> 12u & 63u | tag_cont as u8, + code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8] + } else if code < max_five_b { + [code >> 24u & 3u | tag_five_b as u8, + code >> 18u & 63u | tag_cont as u8, + code >> 12u & 63u | tag_cont as u8, + code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8] + } else { + [code >> 30u & 1u | tag_six_b as u8, + code >> 24u & 63u | tag_cont as u8, + code >> 18u & 63u | tag_cont as u8, + code >> 12u & 63u | tag_cont as u8, + code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8] + }; push_bytes(s, bytes); } -fn from_char(ch: char) -> istr { - let buf = ~""; +fn from_char(ch: char) -> str { + let buf = ""; push_utf8_bytes(buf, ch); ret buf; } -fn from_chars(chs: &[char]) -> istr { - let buf = ~""; +fn from_chars(chs: &[char]) -> str { + let buf = ""; for ch: char in chs { push_utf8_bytes(buf, ch); } ret buf; } @@ -166,7 +156,7 @@ fn utf8_char_width(b: u8) -> uint { ret 6u; } -fn char_range_at(s: &istr, i: uint) -> {ch: char, next: uint} { +fn char_range_at(s: &str, i: uint) -> {ch: char, next: uint} { let b0 = s[i]; let w = utf8_char_width(b0); assert (w != 0u); @@ -188,9 +178,9 @@ fn char_range_at(s: &istr, i: uint) -> {ch: char, next: uint} { ret {ch: val as char, next: i}; } -fn char_at(s: &istr, i: uint) -> char { ret char_range_at(s, i).ch; } +fn char_at(s: &str, i: uint) -> char { ret char_range_at(s, i).ch; } -fn char_len(s: &istr) -> uint { +fn char_len(s: &str) -> uint { let i = 0u; let len = 0u; let total = byte_len(s); @@ -204,7 +194,7 @@ fn char_len(s: &istr) -> uint { ret len; } -fn to_chars(s: &istr) -> [char] { +fn to_chars(s: &str) -> [char] { let buf: [char] = []; let i = 0u; let len = byte_len(s); @@ -216,9 +206,9 @@ fn to_chars(s: &istr) -> [char] { ret buf; } -fn push_char(s: &mutable istr, ch: char) { s += from_char(ch); } +fn push_char(s: &mutable str, ch: char) { s += from_char(ch); } -fn pop_char(s: &mutable istr) -> char { +fn pop_char(s: &mutable str) -> char { let end = byte_len(s); while end > 0u && s[end - 1u] & 192u8 == tag_cont_u8 { end -= 1u; } assert (end > 0u); @@ -227,31 +217,31 @@ fn pop_char(s: &mutable istr) -> char { ret ch; } -fn shift_char(s: &mutable istr) -> char { +fn shift_char(s: &mutable str) -> char { let r = char_range_at(s, 0u); s = substr(s, r.next, byte_len(s) - r.next); ret r.ch; } -fn unshift_char(s: &mutable istr, ch: char) { s = from_char(ch) + s; } +fn unshift_char(s: &mutable str, ch: char) { s = from_char(ch) + s; } -fn index(s: &istr, c: u8) -> int { +fn index(s: &str, c: u8) -> int { let i: int = 0; for k: u8 in s { if k == c { ret i; } i += 1; } ret -1; } -fn rindex(s: &istr, c: u8) -> int { +fn rindex(s: &str, c: u8) -> int { let n: int = byte_len(s) as int; while n >= 0 { if s[n] == c { ret n; } n -= 1; } ret n; } -fn find(haystack: &istr, needle: &istr) -> int { +fn find(haystack: &str, needle: &str) -> int { let haystack_len: int = byte_len(haystack) as int; let needle_len: int = byte_len(needle) as int; if needle_len == 0 { ret 0; } - fn match_at(haystack: &istr, needle: &istr, i: int) -> bool { + fn match_at(haystack: &str, needle: &str, i: int) -> bool { let j: int = i; for c: u8 in needle { if haystack[j] != c { ret false; } j += 1; } ret true; @@ -264,7 +254,7 @@ fn find(haystack: &istr, needle: &istr) -> int { ret -1; } -fn starts_with(haystack: &istr, needle: &istr) -> bool { +fn starts_with(haystack: &str, needle: &str) -> bool { let haystack_len: uint = byte_len(haystack); let needle_len: uint = byte_len(needle); if needle_len == 0u { ret true; } @@ -272,7 +262,7 @@ fn starts_with(haystack: &istr, needle: &istr) -> bool { ret eq(substr(haystack, 0u, needle_len), needle); } -fn ends_with(haystack: &istr, needle: &istr) -> bool { +fn ends_with(haystack: &str, needle: &str) -> bool { let haystack_len: uint = byte_len(haystack); let needle_len: uint = byte_len(needle); ret if needle_len == 0u { @@ -285,11 +275,11 @@ fn ends_with(haystack: &istr, needle: &istr) -> bool { }; } -fn substr(s: &istr, begin: uint, len: uint) -> istr { +fn substr(s: &str, begin: uint, len: uint) -> str { ret slice(s, begin, begin + len); } -fn slice(s: &istr, begin: uint, end: uint) -> istr { +fn slice(s: &str, begin: uint, end: uint) -> str { // FIXME: Typestate precondition assert (begin <= end); assert (end <= byte_len(s)); @@ -298,19 +288,18 @@ fn slice(s: &istr, begin: uint, end: uint) -> istr { let v2 = vec::slice(v, begin, end); unsafe::leak(v); v2 += [0u8]; - let s2: istr = unsafe::reinterpret_cast(v2); + let s2: str = unsafe::reinterpret_cast(v2); unsafe::leak(v2); ret s2; } -fn safe_slice(s: &istr, begin: uint, end: uint) - : uint::le(begin, end) -> istr { +fn safe_slice(s: &str, begin: uint, end: uint) : uint::le(begin, end) -> str { // would need some magic to make this a precondition assert (end <= byte_len(s)); ret slice(s, begin, end); } -fn shift_byte(s: &mutable istr) -> u8 { +fn shift_byte(s: &mutable str) -> u8 { let len = byte_len(s); assert (len > 0u); let b = s[0]; @@ -318,7 +307,7 @@ fn shift_byte(s: &mutable istr) -> u8 { ret b; } -fn pop_byte(s: &mutable istr) -> u8 { +fn pop_byte(s: &mutable str) -> u8 { let len = byte_len(s); assert (len > 0u); let b = s[len - 1u]; @@ -326,24 +315,20 @@ fn pop_byte(s: &mutable istr) -> u8 { ret b; } -fn push_byte(s: &mutable istr, b: u8) { - rustrt::rust_istr_push(s, b); -} +fn push_byte(s: &mutable str, b: u8) { rustrt::rust_istr_push(s, b); } -fn push_bytes(s: &mutable istr, bytes: &[u8]) { - for byte in bytes { - rustrt::rust_istr_push(s, byte); - } +fn push_bytes(s: &mutable str, bytes: &[u8]) { + for byte in bytes { rustrt::rust_istr_push(s, byte); } } -fn split(s: &istr, sep: u8) -> [istr] { - let v: [istr] = []; - let accum: istr = ~""; +fn split(s: &str, sep: u8) -> [str] { + let v: [str] = []; + let accum: str = ""; let ends_with_sep: bool = false; for c: u8 in s { if c == sep { v += [accum]; - accum = ~""; + accum = ""; ends_with_sep = true; } else { accum += unsafe_from_byte(c); ends_with_sep = false; } } @@ -351,16 +336,16 @@ fn split(s: &istr, sep: u8) -> [istr] { ret v; } -fn concat(v: &[istr]) -> istr { - let s: istr = ~""; - for ss: istr in v { s += ss; } +fn concat(v: &[str]) -> str { + let s: str = ""; + for ss: str in v { s += ss; } ret s; } -fn connect(v: &[istr], sep: &istr) -> istr { - let s: istr = ~""; +fn connect(v: &[str], sep: &str) -> str { + let s: str = ""; let first: bool = true; - for ss: istr in v { + for ss: str in v { if first { first = false; } else { s += sep; } s += ss; } @@ -368,8 +353,8 @@ fn connect(v: &[istr], sep: &istr) -> istr { } // FIXME: This only handles ASCII -fn to_upper(s: &istr) -> istr { - let outstr = ~""; +fn to_upper(s: &str) -> str { + let outstr = ""; let ascii_a = 'a' as u8; let ascii_z = 'z' as u8; let diff = 32u8; @@ -384,11 +369,11 @@ fn to_upper(s: &istr) -> istr { } // FIXME: This is super-inefficient -fn replace(s: &istr, from: &istr, to: &istr) : is_not_empty(from) -> istr { +fn replace(s: &str, from: &str, to: &str) : is_not_empty(from) -> str { // FIXME (694): Shouldn't have to check this check (is_not_empty(from)); if byte_len(s) == 0u { - ret ~""; + ret ""; } else if starts_with(s, from) { ret to + replace(slice(s, byte_len(from), byte_len(s)), from, to); } else { @@ -398,11 +383,11 @@ fn replace(s: &istr, from: &istr, to: &istr) : is_not_empty(from) -> istr { } // FIXME: Also not efficient -fn char_slice(s: &istr, begin: uint, end: uint) -> istr { +fn char_slice(s: &str, begin: uint, end: uint) -> str { from_chars(vec::slice(to_chars(s), begin, end)) } -fn trim_left(s: &istr) -> istr { +fn trim_left(s: &str) -> str { fn count_whities(s: &[char]) -> uint { let i = 0u; while i < vec::len(s) { @@ -416,7 +401,7 @@ fn trim_left(s: &istr) -> istr { ret from_chars(vec::slice(chars, whities, vec::len(chars))); } -fn trim_right(s: &istr) -> istr { +fn trim_right(s: &str) -> str { fn count_whities(s: &[char]) -> uint { let i = vec::len(s); while 0u < i { @@ -430,26 +415,21 @@ fn trim_right(s: &istr) -> istr { ret from_chars(vec::slice(chars, 0u, whities)); } -fn trim(s: &istr) -> istr { - trim_left(trim_right(s)) -} +fn trim(s: &str) -> str { trim_left(trim_right(s)) } type sbuf = *u8; -fn buf(s: &istr) -> sbuf { +fn buf(s: &str) -> sbuf { let saddr = ptr::addr_of(s); let vaddr: *[u8] = unsafe::reinterpret_cast(saddr); let buf = vec::to_ptr(*vaddr); ret buf; } -fn as_buf<T>(s: &istr, f: &block(sbuf) -> T) -> T { - let buf = buf(s); - f(buf) -} +fn as_buf<T>(s: &str, f: &block(sbuf) -> T) -> T { let buf = buf(s); f(buf) } -fn str_from_cstr(cstr: sbuf) -> istr { - let res = ~""; +fn str_from_cstr(cstr: sbuf) -> str { + let res = ""; let start = cstr; let curr = start; let i = 0u; @@ -459,4 +439,4 @@ fn str_from_cstr(cstr: sbuf) -> istr { curr = ptr::offset(start, i); } ret res; -} \ No newline at end of file +} diff --git a/src/lib/task.rs b/src/lib/task.rs index 71032bbcd64..fc7116f58b9 100644 --- a/src/lib/task.rs +++ b/src/lib/task.rs @@ -122,7 +122,7 @@ fn spawn_inner(thunk: -fn(), notify: option<comm::chan<task_notification>>) -> // set up the task pointer let task_ptr = rust_task_ptr(rustrt::get_task_pointer(id)); let regs = ptr::addr_of((**task_ptr).ctx.regs); - (*regs).edx = cast(*task_ptr); + (*regs).edx = cast(*task_ptr);; (*regs).esp = cast((**task_ptr).stack_ptr); assert (ptr::null() != (**task_ptr).stack_ptr); diff --git a/src/lib/term.rs b/src/lib/term.rs index f5189c49a43..cfec5ff6b8f 100644 --- a/src/lib/term.rs +++ b/src/lib/term.rs @@ -48,10 +48,10 @@ fn reset(writer: io::buf_writer) { } fn color_supported() -> bool { - let supported_terms = [~"xterm-color", ~"xterm", ~"screen-bce"]; - ret alt generic_os::getenv(~"TERM") { + let supported_terms = ["xterm-color", "xterm", "screen-bce"]; + ret alt generic_os::getenv("TERM") { option::some(env) { - for term: istr in supported_terms { + for term: str in supported_terms { if str::eq(term, env) { ret true; } } false diff --git a/src/lib/test.rs b/src/lib/test.rs index e8ab05a46ba..37fec12e9ce 100644 --- a/src/lib/test.rs +++ b/src/lib/test.rs @@ -35,7 +35,7 @@ native "rust" mod rustrt { // paths, i.e it should be a series of identifiers seperated by double // colons. This way if some test runner wants to arrange the tests // heirarchically it may. -type test_name = istr; +type test_name = str; // A function that runs a test. If the function returns successfully, // the test succeeds; if the function fails then the test fails. We @@ -49,7 +49,7 @@ type test_desc = {name: test_name, fn: test_fn, ignore: bool}; // The default console test runner. It accepts the command line // arguments and a vector of test_descs (generated at compile time). -fn test_main(args: &[istr], tests: &[test_desc]) { +fn test_main(args: &[str], tests: &[test_desc]) { check (vec::is_not_empty(args)); let opts = alt parse_opts(args) { @@ -59,21 +59,19 @@ fn test_main(args: &[istr], tests: &[test_desc]) { if !run_tests_console(opts, tests) { fail "Some tests failed"; } } -type test_opts = {filter: option::t<istr>, run_ignored: bool}; +type test_opts = {filter: option::t<str>, run_ignored: bool}; -type opt_res = either::t<test_opts, istr>; +type opt_res = either::t<test_opts, str>; // Parses command line arguments into test options -fn parse_opts(args: &[istr]) : vec::is_not_empty(args) -> opt_res { +fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res { let args_ = vec::tail(args); - let opts = [getopts::optflag(~"ignored")]; + let opts = [getopts::optflag("ignored")]; let match = alt getopts::getopts(args_, opts) { getopts::success(m) { m } - getopts::failure(f) { - ret either::right(getopts::fail_str(f)) - } + getopts::failure(f) { ret either::right(getopts::fail_str(f)) } }; let filter = @@ -81,7 +79,7 @@ fn parse_opts(args: &[istr]) : vec::is_not_empty(args) -> opt_res { option::some(match.free[0]) } else { option::none }; - let run_ignored = getopts::opt_present(match, ~"ignored"); + let run_ignored = getopts::opt_present(match, "ignored"); let test_opts = {filter: filter, run_ignored: run_ignored}; @@ -119,30 +117,26 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], alt event { te_filtered(filtered_tests) { st.total = vec::len(filtered_tests); - st.out.write_line( - #fmt["\nrunning %u tests", st.total]); - } - te_wait(test) { - st.out.write_str( - #fmt["test %s ... ", test.name]); + st.out.write_line(#fmt["\nrunning %u tests", st.total]); } + te_wait(test) { st.out.write_str(#fmt["test %s ... ", test.name]); } te_result(test, result) { alt result { tr_ok. { st.passed += 1u; write_ok(st.out, st.use_color); - st.out.write_line(~""); + st.out.write_line(""); } tr_failed. { st.failed += 1u; write_failed(st.out, st.use_color); - st.out.write_line(~""); + st.out.write_line(""); st.failures += [test]; } tr_ignored. { st.ignored += 1u; write_ignored(st.out, st.use_color); - st.out.write_line(~""); + st.out.write_line(""); } } } @@ -164,7 +158,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], let success = st.failed == 0u; if !success { - st.out.write_line(~"\nfailures:"); + st.out.write_line("\nfailures:"); for test: test_desc in st.failures { let testname = test.name; // Satisfy alias analysis st.out.write_line(#fmt[" %s", testname]); @@ -176,25 +170,24 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], // There's no parallelism at this point so it's safe to use color write_ok(st.out, true); } else { write_failed(st.out, true); } - st.out.write_str( - #fmt[". %u passed; %u failed; %u ignored\n\n", st.passed, + st.out.write_str(#fmt[". %u passed; %u failed; %u ignored\n\n", st.passed, st.failed, st.ignored]); ret success; fn write_ok(out: &io::writer, use_color: bool) { - write_pretty(out, ~"ok", term::color_green, use_color); + write_pretty(out, "ok", term::color_green, use_color); } fn write_failed(out: &io::writer, use_color: bool) { - write_pretty(out, ~"FAILED", term::color_red, use_color); + write_pretty(out, "FAILED", term::color_red, use_color); } fn write_ignored(out: &io::writer, use_color: bool) { - write_pretty(out, ~"ignored", term::color_yellow, use_color); + write_pretty(out, "ignored", term::color_yellow, use_color); } - fn write_pretty(out: &io::writer, word: &istr, color: u8, + fn write_pretty(out: &io::writer, word: &str, color: u8, use_color: bool) { if use_color && term::color_supported() { term::fg(out.get_buf_writer(), color); @@ -259,11 +252,11 @@ fn filter_tests(opts: &test_opts, tests: &[test_desc]) -> [test_desc] { let filter_str = alt opts.filter { option::some(f) { f } - option::none. { ~"" } + option::none. { "" } }; let filter = - bind fn (test: &test_desc, filter_str: &istr) -> + bind fn (test: &test_desc, filter_str: &str) -> option::t<test_desc> { if str::find(test.name, filter_str) >= 0 { ret option::some(test); diff --git a/src/lib/treemap.rs b/src/lib/treemap.rs index 8323bcfa67a..cdf9a67042b 100644 --- a/src/lib/treemap.rs +++ b/src/lib/treemap.rs @@ -17,82 +17,49 @@ export insert; export find; export traverse; -tag tree_node<@K, @V> { - empty; - node(@K, @V, treemap<K, V>, treemap<K, V>); -} +tag tree_node<@K, @V> { empty; node(@K, @V, treemap<K, V>, treemap<K, V>); } type treemap<@K, @V> = @mutable tree_node<K, V>; -fn init<@K, @V>() -> treemap<K,V> { @mutable empty } +fn init<@K, @V>() -> treemap<K, V> { @mutable empty } -fn insert<@K, @V>(m : &treemap<K, V>, k : &K, v : &V) { +fn insert<@K, @V>(m: &treemap<K, V>, k: &K, v: &V) { alt m { - @empty. { - *m = node(@k, @v, @mutable empty, @mutable empty); - } + @empty. { *m = node(@k, @v, @mutable empty, @mutable empty); } @node(@kk, _, _, _) { + // We have to name left and right individually, because // otherwise the alias checker complains. if k < kk { - alt m { - @node(_, _, left, _) { - insert(left, k, v); - } - } - } - else { - alt m { - @node(_, _, _, right) { - insert(right, k, v); - } - } - } + alt m { @node(_, _, left, _) { insert(left, k, v); } } + } else { alt m { @node(_, _, _, right) { insert(right, k, v); } } } } } } -fn find<@K, @V>(m : &treemap<K, V>, k : &K) -> option<V> { - alt *m { - empty. { none } - node(@kk, @v, _, _) { - if k == kk { some(v) } - // Again, ugliness to unpack left and right individually. - else if k < kk { - alt *m { - node(_, _, left, _) { - find(left, k) - } - } - } - else { - alt *m { - node(_, _, _, right) { - find(right, k) - } - } +fn find<@K, @V>(m: &treemap<K, V>, k: &K) -> option<V> { + alt *m { + empty. { none } + node(@kk, @v, _, _) { + if k == kk { + some(v) + } else if k < kk { + // Again, ugliness to unpack left and right individually. + alt *m { node(_, _, left, _) { find(left, k) } } + } else { alt *m { node(_, _, _, right) { find(right, k) } } } } } - } } // Performs an in-order traversal -fn traverse<@K, @V>(m : &treemap<K, V>, f : fn(&K, &V)) { - alt *m { - empty. { } - node(k, v, _, _) { - let k1 = k, v1 = v; - alt *m { - node(_, _, left, _) { - traverse(left, f); - } - } - f(*k1, *v1); - alt *m { - node(_, _, _, right) { - traverse(right, f); - } +fn traverse<@K, @V>(m: &treemap<K, V>, f: fn(&K, &V)) { + alt *m { + empty. { } + node(k, v, _, _) { + let k1 = k, v1 = v; + alt *m { node(_, _, left, _) { traverse(left, f); } } + f(*k1, *v1); + alt *m { node(_, _, _, right) { traverse(right, f); } } } } - } } diff --git a/src/lib/u64.rs b/src/lib/u64.rs index 0d4c0d3f74b..8082f7aef0d 100644 --- a/src/lib/u64.rs +++ b/src/lib/u64.rs @@ -1,36 +1,36 @@ -fn to_str(n: u64, radix: uint) -> istr { +fn to_str(n: u64, radix: uint) -> str { assert (0u < radix && radix <= 16u); let r64 = radix as u64; - fn digit(n: u64) -> istr { + fn digit(n: u64) -> str { ret alt n { - 0u64 { ~"0" } - 1u64 { ~"1" } - 2u64 { ~"2" } - 3u64 { ~"3" } - 4u64 { ~"4" } - 5u64 { ~"5" } - 6u64 { ~"6" } - 7u64 { ~"7" } - 8u64 { ~"8" } - 9u64 { ~"9" } - 10u64 { ~"a" } - 11u64 { ~"b" } - 12u64 { ~"c" } - 13u64 { ~"d" } - 14u64 { ~"e" } - 15u64 { ~"f" } + 0u64 { "0" } + 1u64 { "1" } + 2u64 { "2" } + 3u64 { "3" } + 4u64 { "4" } + 5u64 { "5" } + 6u64 { "6" } + 7u64 { "7" } + 8u64 { "8" } + 9u64 { "9" } + 10u64 { "a" } + 11u64 { "b" } + 12u64 { "c" } + 13u64 { "d" } + 14u64 { "e" } + 15u64 { "f" } _ { fail } }; } - if n == 0u64 { ret ~"0"; } + if n == 0u64 { ret "0"; } - let s = ~""; + let s = ""; while n > 0u64 { s = digit(n % r64) + s; n /= r64; } ret s; } -fn str(n: u64) -> istr { ret to_str(n, 10u); } +fn str(n: u64) -> str { ret to_str(n, 10u); } diff --git a/src/lib/uint.rs b/src/lib/uint.rs index e7f85074ef2..3553dc7e2cf 100644 --- a/src/lib/uint.rs +++ b/src/lib/uint.rs @@ -56,9 +56,9 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint { fail; } -fn from_str(s: &istr) -> uint { parse_buf(str::bytes(s), 10u) } +fn from_str(s: &str) -> uint { parse_buf(str::bytes(s), 10u) } -fn to_str(num: uint, radix: uint) -> istr { +fn to_str(num: uint, radix: uint) -> str { let n = num; assert (0u < radix && radix <= 16u); fn digit(n: uint) -> char { @@ -82,18 +82,18 @@ fn to_str(num: uint, radix: uint) -> istr { _ { fail } }; } - if n == 0u { ret ~"0"; } - let s: istr = ~""; + if n == 0u { ret "0"; } + let s: str = ""; while n != 0u { s += str::unsafe_from_byte(digit(n % radix) as u8); n /= radix; } - let s1: istr = ~""; + let s1: str = ""; let len: uint = str::byte_len(s); while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s[len]); } ret s1; } -fn str(i: uint) -> istr { ret to_str(i, 10u); } +fn str(i: uint) -> str { ret to_str(i, 10u); } // Local Variables: // mode: rust; diff --git a/src/lib/unsafe.rs b/src/lib/unsafe.rs index 0d382655b41..79e409d27fc 100644 --- a/src/lib/unsafe.rs +++ b/src/lib/unsafe.rs @@ -11,6 +11,4 @@ native "rust" mod rustrt { // Casts the value at `src` to U. The two types must have the same length. fn reinterpret_cast<T, @U>(src: &T) -> U { ret rusti::cast(src); } -fn leak<@T>(thing: -T) { - rustrt::leak(thing); -} \ No newline at end of file +fn leak<@T>(thing: -T) { rustrt::leak(thing); } diff --git a/src/lib/vec.rs b/src/lib/vec.rs index 40ad520998f..1ec736c6e87 100644 --- a/src/lib/vec.rs +++ b/src/lib/vec.rs @@ -262,8 +262,8 @@ fn position_pred<T>(f: fn(&T) -> bool, v: &[T]) -> option::t<uint> { } pure fn same_length<T, U>(xs: &[T], ys: &[U]) -> bool { - let xlen = unchecked { vec::len(xs) }; - let ylen = unchecked { vec::len(ys) }; + let xlen = unchecked{ vec::len(xs) }; + let ylen = unchecked{ vec::len(ys) }; xlen == ylen } @@ -311,39 +311,28 @@ fn reversed<@T>(v: &[T]) -> [T] { } // Generating vecs. -fn enum_chars(start:u8, end:u8) : u8::le(start, end) -> [char] { +fn enum_chars(start: u8, end: u8) : u8::le(start, end) -> [char] { let i = start; let r = []; - while (i <= end) { - r += [i as char]; - i += (1u as u8); - } + while i <= end { r += [i as char]; i += 1u as u8; } ret r; } -fn enum_uints(start:uint, end:uint) : uint::le(start, end) -> [uint] { +fn enum_uints(start: uint, end: uint) : uint::le(start, end) -> [uint] { let i = start; let r = []; - while (i <= end) { - r += [i]; - i += 1u; - } + while i <= end { r += [i]; i += 1u; } ret r; } // Iterate over a list with with the indexes iter iter2<@T>(v: &[T]) -> (uint, T) { let i = 0u; - for x in v { - put (i, x); - i += 1u; - } + for x in v { put (i, x); i += 1u; } } mod unsafe { - type vec_repr = {mutable fill: uint, - mutable alloc: uint, - data: u8}; + type vec_repr = {mutable fill: uint, mutable alloc: uint, data: u8}; fn from_buf<T>(ptr: *T, elts: uint) -> [T] { ret rustrt::vec_from_buf_shared(ptr, elts); @@ -360,9 +349,7 @@ mod unsafe { } } -fn to_ptr<T>(v: &[T]) -> *T { - ret unsafe::to_ptr(v); -} +fn to_ptr<T>(v: &[T]) -> *T { ret unsafe::to_ptr(v); } // Local Variables: // mode: rust; diff --git a/src/lib/win32_fs.rs b/src/lib/win32_fs.rs index 3633a014ca4..8052d0280fe 100644 --- a/src/lib/win32_fs.rs +++ b/src/lib/win32_fs.rs @@ -1,16 +1,16 @@ native "rust" mod rustrt { - fn rust_list_files(path: &istr) -> [istr]; + fn rust_list_files(path: &str) -> [str]; fn rust_file_is_dir(path: str) -> int; } -fn list_dir(path: &istr) -> [istr] { - let path = path + ~"*"; +fn list_dir(path: &str) -> [str] { + let path = path + "*"; ret rustrt::rust_list_files(path); } -fn path_is_absolute(p: &istr) -> bool { +fn path_is_absolute(p: &str) -> bool { ret str::char_at(p, 0u) == '/' || str::char_at(p, 1u) == ':' && str::char_at(p, 2u) == '\\'; } diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs index 9dccbcc679d..bf94439099f 100644 --- a/src/lib/win32_os.rs +++ b/src/lib/win32_os.rs @@ -40,16 +40,16 @@ mod libc_constants { } native "x86stdcall" mod kernel32 { - fn GetEnvironmentVariableA(n: str::sbuf, v: str::sbuf, - nsize: uint) -> uint; + fn GetEnvironmentVariableA(n: str::sbuf, v: str::sbuf, nsize: uint) -> + uint; fn SetEnvironmentVariableA(n: str::sbuf, v: str::sbuf) -> int; } -fn exec_suffix() -> istr { ret ~".exe"; } +fn exec_suffix() -> str { ret ".exe"; } -fn target_os() -> istr { ret ~"win32"; } +fn target_os() -> str { ret "win32"; } -fn dylib_filename(base: &istr) -> istr { ret base + ~".dll"; } +fn dylib_filename(base: &str) -> str { ret base + ".dll"; } fn pipe() -> {in: int, out: int} { // Windows pipes work subtly differently than unix pipes, and their @@ -69,21 +69,17 @@ fn pipe() -> {in: int, out: int} { } fn fd_FILE(fd: int) -> libc::FILE { - ret str::as_buf(~"r", { |modebuf| - libc::_fdopen(fd, modebuf) - }); + ret str::as_buf("r", {|modebuf| libc::_fdopen(fd, modebuf) }); } native "rust" mod rustrt { fn rust_process_wait(handle: int) -> int; - fn rust_getcwd() -> istr; + fn rust_getcwd() -> str; } fn waitpid(pid: int) -> int { ret rustrt::rust_process_wait(pid); } -fn getcwd() -> istr { - ret rustrt::rust_getcwd(); -} +fn getcwd() -> str { ret rustrt::rust_getcwd(); } // Local Variables: // mode: rust; diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs index fea1420f8bb..a1a3e1b984a 100644 --- a/src/test/bench/99bob-iter.rs +++ b/src/test/bench/99bob-iter.rs @@ -8,28 +8,28 @@ use std; import std::int; import std::str; -fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; } +fn b1() -> str { ret "# of beer on the wall, # of beer."; } -fn b2() -> istr { - ret ~"Take one down and pass it around, # of beer on the wall."; +fn b2() -> str { + ret "Take one down and pass it around, # of beer on the wall."; } -fn b7() -> istr { - ret ~"No more bottles of beer on the wall, no more bottles of beer."; +fn b7() -> str { + ret "No more bottles of beer on the wall, no more bottles of beer."; } -fn b8() -> istr { - ret ~"Go to the store and buy some more, # of beer on the wall."; +fn b8() -> str { + ret "Go to the store and buy some more, # of beer on the wall."; } -fn sub(t: &istr, n: int) -> istr { - let b: istr = ~""; +fn sub(t: &str, n: int) -> str { + let b: str = ""; let i: uint = 0u; - let ns: istr; + let ns: str; alt n { - 0 { ns = ~"no more bottles"; } - 1 { ns = ~"1 bottle"; } - _ { ns = int::to_str(n, 10u) + ~" bottles"; } + 0 { ns = "no more bottles"; } + 1 { ns = "1 bottle"; } + _ { ns = int::to_str(n, 10u) + " bottles"; } } while i < str::byte_len(t) { if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); } diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs index a13015fb4f7..fdfce9dfae5 100644 --- a/src/test/bench/99bob-pattern.rs +++ b/src/test/bench/99bob-pattern.rs @@ -29,12 +29,11 @@ fn show(b: bottle) { "1 bottle of beer on the wall."; } multiple(n) { - let nb: istr = int::to_str(n, 10u); - let mb: istr = int::to_str(n - 1, 10u); - log nb + ~" bottles of beer on the wall, " + nb + - ~" bottles of beer,"; - log ~"Take one down and pass it around, " + mb + - ~" bottles of beer on the wall."; + let nb: str = int::to_str(n, 10u); + let mb: str = int::to_str(n - 1, 10u); + log nb + " bottles of beer on the wall, " + nb + " bottles of beer,"; + log "Take one down and pass it around, " + mb + + " bottles of beer on the wall."; } } } diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs index 30518c63e2d..ae1c30fb9ec 100644 --- a/src/test/bench/99bob-simple.rs +++ b/src/test/bench/99bob-simple.rs @@ -8,28 +8,28 @@ use std; import std::int; import std::str; -fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; } +fn b1() -> str { ret "# of beer on the wall, # of beer."; } -fn b2() -> istr { - ret ~"Take one down and pass it around, # of beer on the wall."; +fn b2() -> str { + ret "Take one down and pass it around, # of beer on the wall."; } -fn b7() -> istr { - ret ~"No more bottles of beer on the wall, no more bottles of beer."; +fn b7() -> str { + ret "No more bottles of beer on the wall, no more bottles of beer."; } -fn b8() -> istr { - ret ~"Go to the store and buy some more, # of beer on the wall."; +fn b8() -> str { + ret "Go to the store and buy some more, # of beer on the wall."; } -fn sub(t: &istr, n: int) -> istr { - let b: istr = ~""; +fn sub(t: &str, n: int) -> str { + let b: str = ""; let i: uint = 0u; - let ns: istr; + let ns: str; alt n { - 0 { ns = ~"no more bottles"; } - 1 { ns = ~"1 bottle"; } - _ { ns = int::to_str(n, 10u) + ~" bottles"; } + 0 { ns = "no more bottles"; } + 1 { ns = "1 bottle"; } + _ { ns = int::to_str(n, 10u) + " bottles"; } } while i < str::byte_len(t) { if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); } diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs index 9ab8973cbce..af5e22f48ea 100644 --- a/src/test/bench/99bob-tail.rs +++ b/src/test/bench/99bob-tail.rs @@ -8,12 +8,11 @@ import std::str; fn main() { fn multiple(n: int) { - let nb: istr = int::to_str(n, 10u); - let mb: istr = int::to_str(n - 1, 10u); - log nb + ~" bottles of beer on the wall, " + nb + - ~" bottles of beer,"; - log ~"Take one down and pass it around, " + mb + - ~" bottles of beer on the wall."; + let nb: str = int::to_str(n, 10u); + let mb: str = int::to_str(n - 1, 10u); + log nb + " bottles of beer on the wall, " + nb + " bottles of beer,"; + log "Take one down and pass it around, " + mb + + " bottles of beer on the wall."; log ""; if n > 3 { be multiple(n - 1); } else { be dual(); } } diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs index fa4a17180ae..8e7b2cbe269 100644 --- a/src/test/bench/shootout-fannkuchredux.rs +++ b/src/test/bench/shootout-fannkuchredux.rs @@ -56,7 +56,7 @@ fn fannkuch(n: int) -> int { ret flips; } -fn main(args: [istr]) { +fn main(args: [str]) { let n = 7; log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)]; } diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs index cd29838b378..99b06a98416 100644 --- a/src/test/bench/shootout-fasta.rs +++ b/src/test/bench/shootout-fasta.rs @@ -43,32 +43,31 @@ fn select_random(r: u32, genelist: &[aminoacids]) -> char { ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r); } -fn make_random_fasta(id: &istr, desc: &istr, - genelist: &[aminoacids], n: int) { - log ~">" + id + ~" " + desc; +fn make_random_fasta(id: &str, desc: &str, genelist: &[aminoacids], n: int) { + log ">" + id + " " + desc; let rng = myrandom(std::rand::mk_rng().next()); - let op: istr = ~""; + let op: str = ""; for each i: uint in uint::range(0u, n as uint) { str::push_byte(op, select_random(rng.next(100u32), genelist) as u8); - if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; } + if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; } } if str::byte_len(op) > 0u { log op; } } -fn make_repeat_fasta(id: &istr, desc: &istr, s: &istr, n: int) { - log ~">" + id + ~" " + desc; - let op: istr = ~""; +fn make_repeat_fasta(id: &str, desc: &str, s: &str, n: int) { + log ">" + id + " " + desc; + let op: str = ""; let sl: uint = str::byte_len(s); for each i: uint in uint::range(0u, n as uint) { str::push_byte(op, s[i % sl]); - if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; } + if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; } } if str::byte_len(op) > 0u { log op; } } fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; } -fn main(args: [istr]) { +fn main(args: [str]) { let iub: [aminoacids] = make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), @@ -78,17 +77,16 @@ fn main(args: [istr]) { let homosapiens: [aminoacids] = make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), acid('t', 30u32)]); - let alu: istr = - ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + - ~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + - ~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + - ~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + - ~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + - ~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + - ~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + let alu: str = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; let n: int = 512; - make_repeat_fasta(~"ONE", ~"Homo sapiens alu", alu, n * 2); - make_random_fasta(~"TWO", ~"IUB ambiguity codes", iub, n * 3); - make_random_fasta(~"THREE", ~"Homo sapiens frequency", - homosapiens, n * 5); + make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2); + make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3); + make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5); } diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs index 6a9a5348c2e..9551aa6b982 100644 --- a/src/test/bench/shootout-pfib.rs +++ b/src/test/bench/shootout-pfib.rs @@ -49,14 +49,14 @@ fn fib(n: int) -> int { type config = {stress: bool}; -fn parse_opts(argv: &[istr]) -> config { - let opts = [getopts::optflag(~"stress")]; +fn parse_opts(argv: &[str]) -> config { + let opts = [getopts::optflag("stress")]; let opt_args = vec::slice(argv, 1u, vec::len(argv)); alt getopts::getopts(opt_args, opts) { - getopts::success(m) { ret {stress: getopts::opt_present(m, ~"stress")} } + getopts::success(m) { ret {stress: getopts::opt_present(m, "stress")} } getopts::failure(_) { fail; } } } @@ -79,7 +79,7 @@ fn stress(num_tasks: int) { for t in tasks { task::join(t); } } -fn main(argv: [istr]) { +fn main(argv: [str]) { if vec::len(argv) == 1u { assert (fib(8) == 21); log fib(8); @@ -105,9 +105,8 @@ fn main(argv: [istr]) { let elapsed = stop - start; - out.write_line( - #fmt["%d\t%d\t%s", n, fibn, - u64::str(elapsed)]); + out.write_line(#fmt["%d\t%d\t%s", n, fibn, + u64::str(elapsed)]); } } } diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs index 941f0183031..ebe1abc493b 100644 --- a/src/test/bench/task-perf-spawnalot.rs +++ b/src/test/bench/task-perf-spawnalot.rs @@ -8,12 +8,14 @@ fn f(n: uint) { let i = 0u; while i < n { let thunk = g; - task::join(task::spawn_joinable(thunk)); i += 1u; } + task::join(task::spawn_joinable(thunk)); + i += 1u; + } } fn g() { } -fn main(args: [istr]) { +fn main(args: [str]) { let n = if vec::len(args) < 2u { 10u diff --git a/src/test/bench/task-perf-vector-party.rs b/src/test/bench/task-perf-vector-party.rs index fd650df660b..b70bd24828a 100644 --- a/src/test/bench/task-perf-vector-party.rs +++ b/src/test/bench/task-perf-vector-party.rs @@ -16,13 +16,10 @@ fn f(n: uint) { } } -fn main(args: [istr]) { - let n = if vec::len(args) < 2u { - 100u - } else { - uint::parse_buf(str::bytes(args[1]), 10u) - }; - for each i in uint::range(0u, 100u) { - task::spawn(bind f(n)); - } -} \ No newline at end of file +fn main(args: [str]) { + let n = + if vec::len(args) < 2u { + 100u + } else { uint::parse_buf(str::bytes(args[1]), 10u) }; + for each i in uint::range(0u, 100u) { task::spawn(bind f(n)); } +} diff --git a/src/test/bench/task-perf-word-count-generic.rs b/src/test/bench/task-perf-word-count-generic.rs index 3a8f643bc37..adb5040fa25 100644 --- a/src/test/bench/task-perf-word-count-generic.rs +++ b/src/test/bench/task-perf-word-count-generic.rs @@ -70,9 +70,10 @@ mod map_reduce { tag reduce_proto<~V> { emit_val(V); done; ref; release; } - fn start_mappers<~K1, ~K2, ~V>(map : mapper<K1, K2, V>, - ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1]) - -> [joinable_task] { + fn start_mappers<~K1, ~K2, + ~V>(map: mapper<K1, K2, V>, + ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1]) -> + [joinable_task] { let tasks = []; for i in inputs { let m = map, c = ctrl, ii = i; @@ -81,18 +82,18 @@ mod map_reduce { ret tasks; } - fn map_task<~K1, ~K2, ~V>(map : -mapper<K1,K2,V>, - ctrl: -chan<ctrl_proto<K2,V>>, input: -K1) { + fn map_task<~K1, ~K2, + ~V>(map: -mapper<K1, K2, V>, ctrl: -chan<ctrl_proto<K2, V>>, + input: -K1) { // log_err "map_task " + input; let intermediates = treemap::init(); - fn emit<~K2, ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>, - ctrl: &chan<ctrl_proto<K2,V>>, key: &K2, val: &V) { + fn emit<~K2, + ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>, + ctrl: &chan<ctrl_proto<K2, V>>, key: &K2, val: &V) { let c; alt treemap::find(im, key) { - some(_c) { - c = _c - } + some(_c) { c = _c } none. { let p = port(); send(ctrl, find_reducer(key, chan(p))); @@ -106,15 +107,16 @@ mod map_reduce { map(input, bind emit(intermediates, ctrl, _, _)); - fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) { + fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) { send(v, release); } treemap::traverse(intermediates, finish); send(ctrl, mapper_done); } - fn reduce_task<~K, ~V>(reduce : -reducer<K,V>, - key: -K, out: -chan<chan<reduce_proto<V>>>) { + fn reduce_task<~K, + ~V>(reduce: -reducer<K, V>, key: -K, + out: -chan<chan<reduce_proto<V>>>) { let p = port(); send(out, chan(p)); @@ -123,7 +125,7 @@ mod map_reduce { let is_done = false; fn get<~V>(p: &port<reduce_proto<V>>, ref_count: &mutable int, - is_done: &mutable bool) -> option<V> { + is_done: &mutable bool) -> option<V> { while !is_done || ref_count > 0 { alt recv(p) { emit_val(v) { @@ -144,9 +146,9 @@ mod map_reduce { reduce(key, bind get(p, ref_count, is_done)); } - fn map_reduce<~K1, ~K2, ~V>(map : mapper<K1,K2,V>, - reduce : reducer<K2, V>, - inputs: &[K1]) { + fn map_reduce<~K1, ~K2, + ~V>(map: mapper<K1, K2, V>, reduce: reducer<K2, V>, + inputs: &[K1]) { let ctrl = port(); // This task becomes the master control task. It task::_spawns @@ -177,8 +179,8 @@ mod map_reduce { let p = port(); let r = reduce, kk = k; tasks += - [task::spawn_joinable(bind reduce_task(r, - kk, chan(p)))]; + [task::spawn_joinable(bind reduce_task(r, kk, + chan(p)))]; c = recv(p); treemap::insert(reducers, k, c); } @@ -188,21 +190,18 @@ mod map_reduce { } } - fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) { - send(v, done); - } + fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) { send(v, done); } treemap::traverse(reducers, finish); for t in tasks { task::join(t); } } } -fn main(argv: [istr]) { +fn main(argv: [str]) { if vec::len(argv) < 2u { let out = io::stdout(); - out.write_line( - #fmt["Usage: %s <filename> ...", argv[0]]); + out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]); // TODO: run something just to make sure the code hasn't // broken yet. This is the unit test mode of this program. @@ -227,12 +226,11 @@ fn main(argv: [istr]) { let elapsed = stop - start; elapsed /= 1000000u64; - log_err ~"MapReduce completed in " + - u64::str(elapsed) + ~"ms"; + log_err "MapReduce completed in " + u64::str(elapsed) + "ms"; } -fn read_word(r: io::reader) -> option<istr> { - let w = ~""; +fn read_word(r: io::reader) -> option<str> { + let w = ""; while !r.eof() { let c = r.read_char(); @@ -240,7 +238,7 @@ fn read_word(r: io::reader) -> option<istr> { if is_word_char(c) { w += str::from_char(c); - } else { if w != ~"" { ret some(w); } } + } else { if w != "" { ret some(w); } } } ret none; } diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs index c62ebc73b5d..a90abd9e526 100644 --- a/src/test/bench/task-perf-word-count.rs +++ b/src/test/bench/task-perf-word-count.rs @@ -29,7 +29,7 @@ import std::comm::port; import std::comm::recv; import std::comm::send; -fn map(filename: &istr, emit: map_reduce::putter) { +fn map(filename: &str, emit: map_reduce::putter) { let f = io::file_reader(filename); @@ -38,7 +38,7 @@ fn map(filename: &istr, emit: map_reduce::putter) { } } -fn reduce(word: &istr, get: map_reduce::getter) { +fn reduce(word: &str, get: map_reduce::getter) { let count = 0; @@ -52,36 +52,36 @@ mod map_reduce { export reducer; export map_reduce; - type putter = fn(&istr, int); + type putter = fn(&str, int); - type mapper = fn(&istr, putter); + type mapper = fn(&str, putter); type getter = fn() -> option<int>; - type reducer = fn(&istr, getter); + type reducer = fn(&str, getter); tag ctrl_proto { - find_reducer(istr, chan<chan<reduce_proto>>); + find_reducer(str, chan<chan<reduce_proto>>); mapper_done; } tag reduce_proto { emit_val(int); done; ref; release; } - fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[istr]) - -> [joinable_task] { + fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[str]) -> + [joinable_task] { let tasks = []; - for i: istr in inputs { + for i: str in inputs { tasks += [task::spawn_joinable(bind map_task(ctrl, i))]; } ret tasks; } - fn map_task(ctrl: chan<ctrl_proto>, input: &istr) { + fn map_task(ctrl: chan<ctrl_proto>, input: &str) { // log_err "map_task " + input; let intermediates = map::new_str_hash(); - fn emit(im: &map::hashmap<istr, chan<reduce_proto>>, - ctrl: chan<ctrl_proto>, key: &istr, val: int) { + fn emit(im: &map::hashmap<str, chan<reduce_proto>>, + ctrl: chan<ctrl_proto>, key: &str, val: int) { let c; alt im.find(key) { some(_c) { @@ -101,7 +101,7 @@ mod map_reduce { map(input, bind emit(intermediates, ctrl, _, _)); - for each kv: @{key: istr, val: chan<reduce_proto>} in + for each kv: @{key: str, val: chan<reduce_proto>} in intermediates.items() { send(kv.val, release); } @@ -109,7 +109,7 @@ mod map_reduce { send(ctrl, mapper_done); } - fn reduce_task(key: &istr, out: chan<chan<reduce_proto>>) { + fn reduce_task(key: &str, out: chan<chan<reduce_proto>>) { let p = port(); send(out, chan(p)); @@ -139,13 +139,13 @@ mod map_reduce { reduce(key, bind get(p, ref_count, is_done)); } - fn map_reduce(inputs: &[istr]) { + fn map_reduce(inputs: &[str]) { let ctrl = port::<ctrl_proto>(); // This task becomes the master control task. It task::_spawns // to do the rest. - let reducers: map::hashmap<istr, chan<reduce_proto>>; + let reducers: map::hashmap<str, chan<reduce_proto>>; reducers = map::new_str_hash(); @@ -171,8 +171,7 @@ mod map_reduce { // log_err "creating new reducer for " + k; let p = port(); tasks += - [task::spawn_joinable( - bind reduce_task(k, chan(p)))]; + [task::spawn_joinable(bind reduce_task(k, chan(p)))]; c = recv(p); reducers.insert(k, c); } @@ -182,7 +181,7 @@ mod map_reduce { } } - for each kv: @{key: istr, val: chan<reduce_proto>} in reducers.items() + for each kv: @{key: str, val: chan<reduce_proto>} in reducers.items() { send(kv.val, done); } @@ -191,12 +190,11 @@ mod map_reduce { } } -fn main(argv: [istr]) { +fn main(argv: [str]) { if vec::len(argv) < 2u { let out = io::stdout(); - out.write_line( - #fmt["Usage: %s <filename> ...", argv[0]]); + out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]); // TODO: run something just to make sure the code hasn't // broken yet. This is the unit test mode of this program. @@ -216,11 +214,11 @@ fn main(argv: [istr]) { let elapsed = stop - start; elapsed /= 1000000u64; - log_err ~"MapReduce completed in " + u64::str(elapsed) + ~"ms"; + log_err "MapReduce completed in " + u64::str(elapsed) + "ms"; } -fn read_word(r: io::reader) -> option<istr> { - let w = ~""; +fn read_word(r: io::reader) -> option<str> { + let w = ""; while !r.eof() { let c = r.read_char(); @@ -228,7 +226,7 @@ fn read_word(r: io::reader) -> option<istr> { if is_word_char(c) { w += str::from_char(c); - } else { if w != ~"" { ret some(w); } } + } else { if w != "" { ret some(w); } } } ret none; } diff --git a/src/test/compile-fail/bad-expr-path.rs b/src/test/compile-fail/bad-expr-path.rs index e3cb4873ebc..7c97308c538 100644 --- a/src/test/compile-fail/bad-expr-path.rs +++ b/src/test/compile-fail/bad-expr-path.rs @@ -2,4 +2,4 @@ mod m1 { } -fn main(args: [istr]) { log m1::a; } +fn main(args: [str]) { log m1::a; } diff --git a/src/test/compile-fail/bad-expr-path2.rs b/src/test/compile-fail/bad-expr-path2.rs index b779b459bf1..e6596f17b6e 100644 --- a/src/test/compile-fail/bad-expr-path2.rs +++ b/src/test/compile-fail/bad-expr-path2.rs @@ -4,4 +4,4 @@ mod m1 { mod a { } } -fn main(args: [istr]) { log m1::a; } +fn main(args: [str]) { log m1::a; } diff --git a/src/test/compile-fail/block-require-return.rs b/src/test/compile-fail/block-require-return.rs index 6a64bd44daa..f2796296da4 100644 --- a/src/test/compile-fail/block-require-return.rs +++ b/src/test/compile-fail/block-require-return.rs @@ -1,5 +1,3 @@ // error-pattern: not all control paths return fn force(f: &block() -> int) -> int { f() } -fn main() { - log_err force({| | }); -} +fn main() { log_err force({ | | }); } diff --git a/src/test/compile-fail/extenv-too-many-args.rs b/src/test/compile-fail/extenv-too-many-args.rs index f6fb13cbc33..945546fd6cb 100644 --- a/src/test/compile-fail/extenv-too-many-args.rs +++ b/src/test/compile-fail/extenv-too-many-args.rs @@ -1,3 +1,3 @@ // error-pattern:malformed #env call -fn main() { #env[~"one", ~"two"]; } +fn main() { #env["one", "two"]; } diff --git a/src/test/compile-fail/fn-constraint.rs b/src/test/compile-fail/fn-constraint.rs index dec1df5d458..bd6cd7b8ff1 100644 --- a/src/test/compile-fail/fn-constraint.rs +++ b/src/test/compile-fail/fn-constraint.rs @@ -5,5 +5,5 @@ import std::str::*; fn main() { let a: uint = 4u; let b: uint = 1u; - log_err safe_slice(~"kitties", a, b); + log_err safe_slice("kitties", a, b); } diff --git a/src/test/compile-fail/import.rs b/src/test/compile-fail/import.rs index 68147568cd9..f4375eaade3 100644 --- a/src/test/compile-fail/import.rs +++ b/src/test/compile-fail/import.rs @@ -4,4 +4,4 @@ import zed::baz; mod zed { fn bar() { log "bar"; } } -fn main(args: [istr]) { bar(); } +fn main(args: [str]) { bar(); } diff --git a/src/test/compile-fail/import2.rs b/src/test/compile-fail/import2.rs index 4d1043af563..89532f61fb1 100644 --- a/src/test/compile-fail/import2.rs +++ b/src/test/compile-fail/import2.rs @@ -4,4 +4,4 @@ mod baz { } mod zed { fn bar() { log "bar3"; } } -fn main(args: [istr]) { bar(); } +fn main(args: [str]) { bar(); } diff --git a/src/test/compile-fail/import3.rs b/src/test/compile-fail/import3.rs index 13b193162a3..680804c97b0 100644 --- a/src/test/compile-fail/import3.rs +++ b/src/test/compile-fail/import3.rs @@ -1,4 +1,4 @@ // error-pattern: unresolved modulename import main::bar; -fn main(args: [istr]) { log "foo"; } +fn main(args: [str]) { log "foo"; } diff --git a/src/test/compile-fail/import4.rs b/src/test/compile-fail/import4.rs index 80a540e165f..6daed215ddb 100644 --- a/src/test/compile-fail/import4.rs +++ b/src/test/compile-fail/import4.rs @@ -3,4 +3,4 @@ import zed::bar; import bar::zed; -fn main(args: [istr]) { log "loop"; } +fn main(args: [str]) { log "loop"; } diff --git a/src/test/compile-fail/no-constraint-prop.rs b/src/test/compile-fail/no-constraint-prop.rs index c01b20042fa..65e21baf78b 100644 --- a/src/test/compile-fail/no-constraint-prop.rs +++ b/src/test/compile-fail/no-constraint-prop.rs @@ -16,5 +16,5 @@ fn main() { // the next statement, since it's not true in the // prestate. let d <- a; - log safe_slice(~"kitties", b, d); + log safe_slice("kitties", b, d); } diff --git a/src/test/compile-fail/nonsense-constraints.rs b/src/test/compile-fail/nonsense-constraints.rs index 9ed12810ab5..47809cdcaf2 100644 --- a/src/test/compile-fail/nonsense-constraints.rs +++ b/src/test/compile-fail/nonsense-constraints.rs @@ -3,16 +3,11 @@ use std; import std::uint; -fn enum_chars(start:u8, end:u8) : uint::le(start, end) -> [char] { +fn enum_chars(start: u8, end: u8) : uint::le(start, end) -> [char] { let i = start; let r = []; - while (i <= end) { - r += [i as char]; - i += (1u as u8); - } + while i <= end { r += [i as char]; i += 1u as u8; } ret r; } -fn main() { - log (enum_chars('a' as u8, 'z' as u8)); -} \ No newline at end of file +fn main() { log enum_chars('a' as u8, 'z' as u8); } diff --git a/src/test/compile-fail/not-a-pred-2.rs b/src/test/compile-fail/not-a-pred-2.rs index 852db46e9df..2226c5cbf32 100644 --- a/src/test/compile-fail/not-a-pred-2.rs +++ b/src/test/compile-fail/not-a-pred-2.rs @@ -8,4 +8,5 @@ fn main() { // is not a manifest call + } diff --git a/src/test/compile-fail/zip-missing-check.rs b/src/test/compile-fail/zip-missing-check.rs index 554a670fab4..51028a03623 100644 --- a/src/test/compile-fail/zip-missing-check.rs +++ b/src/test/compile-fail/zip-missing-check.rs @@ -7,11 +7,11 @@ import std::vec::*; fn main() { let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 10u; // Silly, but necessary - check u8::le(a, j); - check uint::le(k, l); + check (u8::le(a, j)); + check (uint::le(k, l)); let chars = enum_chars(a, j); - let ints = enum_uints(k, l); + let ints = enum_uints(k, l); let ps = zip(chars, ints); fail "the impossible happened"; -} \ No newline at end of file +} diff --git a/src/test/compiletest/common.rs b/src/test/compiletest/common.rs index c43db38247d..ab0415fd7c1 100644 --- a/src/test/compiletest/common.rs +++ b/src/test/compiletest/common.rs @@ -16,17 +16,17 @@ type config = // for running under valgrind // Flags to pass to the compiler // Explain what's going on - {compile_lib_path: istr, - run_lib_path: istr, - rustc_path: istr, - src_base: istr, - build_base: istr, - stage_id: istr, + {compile_lib_path: str, + run_lib_path: str, + rustc_path: str, + src_base: str, + build_base: str, + stage_id: str, mode: mode, run_ignored: bool, - filter: option::t<istr>, - runtool: option::t<istr>, - rustcflags: option::t<istr>, + filter: option::t<str>, + runtool: option::t<str>, + rustcflags: option::t<str>, verbose: bool}; type cx = {config: config, procsrv: procsrv::handle}; diff --git a/src/test/compiletest/compiletest.rs b/src/test/compiletest/compiletest.rs index 5f3fd1944dd..c931369cfc7 100644 --- a/src/test/compiletest/compiletest.rs +++ b/src/test/compiletest/compiletest.rs @@ -21,58 +21,50 @@ import common::mode_pretty; import common::mode; import util::logv; -fn main(args: [istr]) { +fn main(args: [str]) { let config = parse_config(args); log_config(config); run_tests(config); } -fn parse_config(args: &[istr]) -> config { +fn parse_config(args: &[str]) -> config { let opts = - [getopts::reqopt(~"compile-lib-path"), - getopts::reqopt(~"run-lib-path"), - getopts::reqopt(~"rustc-path"), - getopts::reqopt(~"src-base"), - getopts::reqopt(~"build-base"), - getopts::reqopt(~"stage-id"), - getopts::reqopt(~"mode"), - getopts::optflag(~"ignored"), - getopts::optopt(~"runtool"), - getopts::optopt(~"rustcflags"), - getopts::optflag(~"verbose")]; + [getopts::reqopt("compile-lib-path"), getopts::reqopt("run-lib-path"), + getopts::reqopt("rustc-path"), getopts::reqopt("src-base"), + getopts::reqopt("build-base"), getopts::reqopt("stage-id"), + getopts::reqopt("mode"), getopts::optflag("ignored"), + getopts::optopt("runtool"), getopts::optopt("rustcflags"), + getopts::optflag("verbose")]; check (vec::is_not_empty(args)); let args_ = vec::tail(args); let match = alt getopts::getopts(args_, opts) { getopts::success(m) { m } - getopts::failure(f) { - fail getopts::fail_str(f) - } + getopts::failure(f) { fail getopts::fail_str(f) } }; - ret {compile_lib_path: getopts::opt_str(match, ~"compile-lib-path"), - run_lib_path: getopts::opt_str(match, ~"run-lib-path"), - rustc_path: getopts::opt_str(match, ~"rustc-path"), - src_base: getopts::opt_str(match, ~"src-base"), - build_base: getopts::opt_str(match, ~"build-base"), - stage_id: getopts::opt_str(match, ~"stage-id"), - mode: str_mode(getopts::opt_str(match, ~"mode")), - run_ignored: getopts::opt_present(match, ~"ignored"), + ret {compile_lib_path: getopts::opt_str(match, "compile-lib-path"), + run_lib_path: getopts::opt_str(match, "run-lib-path"), + rustc_path: getopts::opt_str(match, "rustc-path"), + src_base: getopts::opt_str(match, "src-base"), + build_base: getopts::opt_str(match, "build-base"), + stage_id: getopts::opt_str(match, "stage-id"), + mode: str_mode(getopts::opt_str(match, "mode")), + run_ignored: getopts::opt_present(match, "ignored"), filter: if vec::len(match.free) > 0u { option::some(match.free[0]) } else { option::none }, - runtool: getopts::opt_maybe_str(match, ~"runtool"), - rustcflags: getopts::opt_maybe_str(match, ~"rustcflags"), - verbose: getopts::opt_present(match, ~"verbose")}; + runtool: getopts::opt_maybe_str(match, "runtool"), + rustcflags: getopts::opt_maybe_str(match, "rustcflags"), + verbose: getopts::opt_present(match, "verbose")}; } fn log_config(config: &config) { let c = config; logv(c, #fmt["configuration:"]); - logv(c, #fmt["compile_lib_path: %s", - config.compile_lib_path]); + logv(c, #fmt["compile_lib_path: %s", config.compile_lib_path]); logv(c, #fmt["run_lib_path: %s", config.run_lib_path]); logv(c, #fmt["rustc_path: %s", config.rustc_path]); logv(c, #fmt["src_base: %s", config.src_base]); @@ -87,33 +79,30 @@ fn log_config(config: &config) { logv(c, #fmt["\n"]); } -fn opt_str(maybestr: option::t<istr>) -> istr { - alt maybestr { - option::some(s) { s } - option::none. { ~"(none)" } - } +fn opt_str(maybestr: option::t<str>) -> str { + alt maybestr { option::some(s) { s } option::none. { "(none)" } } } -fn str_opt(maybestr: &istr) -> option::t<istr> { - if maybestr != ~"(none)" { option::some(maybestr) } else { option::none } +fn str_opt(maybestr: &str) -> option::t<str> { + if maybestr != "(none)" { option::some(maybestr) } else { option::none } } -fn str_mode(s: &istr) -> mode { +fn str_mode(s: &str) -> mode { alt s { - ~"compile-fail" { mode_compile_fail } - ~"run-fail" { mode_run_fail } - ~"run-pass" { mode_run_pass } - ~"pretty" { mode_pretty } + "compile-fail" { mode_compile_fail } + "run-fail" { mode_run_fail } + "run-pass" { mode_run_pass } + "pretty" { mode_pretty } _ { fail "invalid mode" } } } -fn mode_str(mode: mode) -> istr { +fn mode_str(mode: mode) -> str { alt mode { - mode_compile_fail. { ~"compile-fail" } - mode_run_fail. { ~"run-fail" } - mode_run_pass. { ~"run-pass" } - mode_pretty. { ~"pretty" } + mode_compile_fail. { "compile-fail" } + mode_run_fail. { "run-fail" } + mode_run_pass. { "run-pass" } + mode_pretty. { "pretty" } } } @@ -126,13 +115,12 @@ fn run_tests(config: &config) { } fn test_opts(config: &config) -> test::test_opts { - { - filter: alt config.filter { - option::some(s) { option::some(s) } - option::none. { option::none } - }, - run_ignored: config.run_ignored - } + {filter: + alt config.filter { + option::some(s) { option::some(s) } + option::none. { option::none } + }, + run_ignored: config.run_ignored} } type tests_and_conv_fn = @@ -142,7 +130,7 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn { log #fmt["making tests from %s", cx.config.src_base]; let configport = port::<[u8]>(); let tests = []; - for file: istr in fs::list_dir(cx.config.src_base) { + for file: str in fs::list_dir(cx.config.src_base) { let file = file; log #fmt["inspecting file %s", file]; if is_test(cx.config, file) { @@ -152,13 +140,11 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn { ret {tests: tests, to_task: bind closure_to_task(cx, configport, _)}; } -fn is_test(config: &config, testfile: &istr) -> bool { +fn is_test(config: &config, testfile: &str) -> bool { // Pretty-printer does not work with .rc files yet - let valid_extensions = alt config.mode { - mode_pretty. { [~".rs"] } - _ { [~".rc", ~".rs"] } - }; - let invalid_prefixes = [~".", ~"#", ~"~"]; + let valid_extensions = + alt config.mode { mode_pretty. { [".rs"] } _ { [".rc", ".rs"] } }; + let invalid_prefixes = [".", "#", "~"]; let name = fs::basename(testfile); let valid = false; @@ -174,14 +160,14 @@ fn is_test(config: &config, testfile: &istr) -> bool { ret valid; } -fn make_test(cx: &cx, testfile: &istr, configport: &port<[u8]>) -> +fn make_test(cx: &cx, testfile: &str, configport: &port<[u8]>) -> test::test_desc { {name: make_test_name(cx.config, testfile), fn: make_test_closure(testfile, chan(configport)), ignore: header::is_test_ignored(cx.config, testfile)} } -fn make_test_name(config: &config, testfile: &istr) -> istr { +fn make_test_name(config: &config, testfile: &str) -> str { #fmt["[%s] %s", mode_str(config.mode), testfile] } @@ -204,12 +190,12 @@ up. Then we'll spawn that data into another task and return the task. Really convoluted. Need to think up of a better definition for tests. */ -fn make_test_closure(testfile: &istr, configchan: chan<[u8]>) -> +fn make_test_closure(testfile: &str, configchan: chan<[u8]>) -> test::test_fn { bind send_config(testfile, configchan) } -fn send_config(testfile: istr, configchan: chan<[u8]>) { +fn send_config(testfile: str, configchan: chan<[u8]>) { send(configchan, str::bytes(testfile)); } @@ -243,26 +229,17 @@ fn closure_to_task(cx: cx, configport: port<[u8]>, testfn: &fn()) -> let chan = cx.procsrv.chan; let testthunk = - bind run_test_task(compile_lib_path, run_lib_path, - rustc_path, src_base, - build_base, stage_id, - mode, - run_ignored, - filter, - runtool, - rustcflags, - verbose, - chan, + bind run_test_task(compile_lib_path, run_lib_path, rustc_path, + src_base, build_base, stage_id, mode, run_ignored, + filter, runtool, rustcflags, verbose, chan, testfile); ret task::spawn_joinable(testthunk); } -fn run_test_task(compile_lib_path: -istr, run_lib_path: -istr, - rustc_path: -istr, - src_base: -istr, build_base: -istr, stage_id: -istr, - mode: -istr, - run_ignored: -bool, opt_filter: -istr, opt_runtool: -istr, - opt_rustcflags: -istr, verbose: -bool, +fn run_test_task(compile_lib_path: -str, run_lib_path: -str, rustc_path: -str, + src_base: -str, build_base: -str, stage_id: -str, mode: -str, + run_ignored: -bool, opt_filter: -str, opt_runtool: -str, + opt_rustcflags: -str, verbose: -bool, procsrv_chan: -procsrv::reqchan, testfile: -[u8]) { test::configure_test_task(); diff --git a/src/test/compiletest/header.rs b/src/test/compiletest/header.rs index d891e87f5dd..8a03378742b 100644 --- a/src/test/compiletest/header.rs +++ b/src/test/compiletest/header.rs @@ -11,24 +11,24 @@ export is_test_ignored; type test_props = { // Lines that should be expected, in order, on standard out - error_patterns: [istr], + error_patterns: [str], // Extra flags to pass to the compiler - compile_flags: option::t<istr>, + compile_flags: option::t<str>, // If present, the name of a file that this test should match when // pretty-printed - pp_exact: option::t<istr>, + pp_exact: option::t<str>, // FIXME: no-valgrind is a temporary directive until all of run-fail // is valgrind-clean no_valgrind: bool }; // Load any test directives embedded in the file -fn load_props(testfile: &istr) -> test_props { +fn load_props(testfile: &str) -> test_props { let error_patterns = []; let compile_flags = option::none; let pp_exact = option::none; let no_valgrind = false; - for each ln: istr in iter_header(testfile) { + for each ln: str in iter_header(testfile) { alt parse_error_pattern(ln) { option::some(ep) { error_patterns += [ep]; } option::none. { } @@ -43,7 +43,7 @@ fn load_props(testfile: &istr) -> test_props { } if no_valgrind == false { - no_valgrind = parse_name_directive(ln, ~"no-valgrind"); + no_valgrind = parse_name_directive(ln, "no-valgrind"); } } ret { @@ -54,19 +54,19 @@ fn load_props(testfile: &istr) -> test_props { }; } -fn is_test_ignored(config: &config, testfile: &istr) -> bool { +fn is_test_ignored(config: &config, testfile: &str) -> bool { let found = false; - for each ln: istr in iter_header(testfile) { + for each ln: str in iter_header(testfile) { // FIXME: Can't return or break from iterator - found = found || parse_name_directive(ln, ~"xfail-test"); + found = found || parse_name_directive(ln, "xfail-test"); if (config.mode == common::mode_pretty) { - found = found || parse_name_directive(ln, ~"xfail-pretty"); + found = found || parse_name_directive(ln, "xfail-pretty"); } } ret found; } -iter iter_header(testfile: &istr) -> istr { +iter iter_header(testfile: &str) -> str { let rdr = io::file_reader(testfile); while !rdr.eof() { let ln = rdr.read_line(); @@ -74,26 +74,26 @@ iter iter_header(testfile: &istr) -> istr { // Assume that any directives will be found before the first // module or function. This doesn't seem to be an optimization // with a warm page cache. Maybe with a cold one. - if str::starts_with(ln, ~"fn") - || str::starts_with(ln, ~"mod") { + if str::starts_with(ln, "fn") + || str::starts_with(ln, "mod") { break; } else { put ln; } } } -fn parse_error_pattern(line: &istr) -> option::t<istr> { - parse_name_value_directive(line, ~"error-pattern") +fn parse_error_pattern(line: &str) -> option::t<str> { + parse_name_value_directive(line, "error-pattern") } -fn parse_compile_flags(line: &istr) -> option::t<istr> { - parse_name_value_directive(line, ~"compile-flags") +fn parse_compile_flags(line: &str) -> option::t<str> { + parse_name_value_directive(line, "compile-flags") } -fn parse_pp_exact(line: &istr, testfile: &istr) -> option::t<istr> { - alt parse_name_value_directive(line, ~"pp-exact") { +fn parse_pp_exact(line: &str, testfile: &str) -> option::t<str> { + alt parse_name_value_directive(line, "pp-exact") { option::some(s) { option::some(s) } option::none. { - if parse_name_directive(line, ~"pp-exact") { + if parse_name_directive(line, "pp-exact") { option::some(fs::basename(testfile)) } else { option::none @@ -102,13 +102,13 @@ fn parse_pp_exact(line: &istr, testfile: &istr) -> option::t<istr> { } } -fn parse_name_directive(line: &istr, directive: &istr) -> bool { +fn parse_name_directive(line: &str, directive: &str) -> bool { str::find(line, directive) >= 0 } -fn parse_name_value_directive(line: &istr, - directive: &istr) -> option::t<istr> { - let keycolon = directive + ~":"; +fn parse_name_value_directive(line: &str, + directive: &str) -> option::t<str> { + let keycolon = directive + ":"; if str::find(line, keycolon) >= 0 { let colon = str::find(line, keycolon) as uint; let value = diff --git a/src/test/compiletest/procsrv.rs b/src/test/compiletest/procsrv.rs index eb6d4676711..63a3807f6a5 100644 --- a/src/test/compiletest/procsrv.rs +++ b/src/test/compiletest/procsrv.rs @@ -27,8 +27,9 @@ export reqchan; type reqchan = chan<request>; -type handle = {task: option::t<(task::task, port<task::task_notification>)>, - chan: reqchan}; +type handle = + {task: option::t<(task::task, port<task::task_notification>)>, + chan: reqchan}; tag request { exec([u8], [u8], [[u8]], chan<response>); stop; } @@ -38,11 +39,11 @@ fn mk() -> handle { let setupport = port(); let task = task::spawn_joinable(bind fn (setupchan: chan<chan<request>>) { - let reqport = port(); - let reqchan = chan(reqport); - send(setupchan, reqchan); - worker(reqport); - }(chan(setupport))); + let reqport = port(); + let reqchan = chan(reqport); + send(setupchan, reqchan); + worker(reqport); + }(chan(setupport))); ret {task: option::some(task), chan: recv(setupport)}; } @@ -53,8 +54,8 @@ fn close(handle: &handle) { task::join(option::get(handle.task)); } -fn run(handle: &handle, lib_path: &istr, prog: &istr, args: &[istr], - input: &option::t<istr>) -> {status: int, out: istr, err: istr} { +fn run(handle: &handle, lib_path: &str, prog: &str, args: &[str], + input: &option::t<str>) -> {status: int, out: str, err: str} { let p = port(); let ch = chan(p); send(handle.chan, @@ -69,7 +70,7 @@ fn run(handle: &handle, lib_path: &istr, prog: &istr, args: &[istr], ret {status: status, out: output, err: errput}; } -fn writeclose(fd: int, s: &option::t<istr>) { +fn writeclose(fd: int, s: &option::t<str>) { if option::is_some(s) { let writer = io::new_writer(io::fd_buf_writer(fd, option::none)); writer.write_str(option::get(s)); @@ -78,11 +79,11 @@ fn writeclose(fd: int, s: &option::t<istr>) { os::libc::close(fd); } -fn readclose(fd: int) -> istr { +fn readclose(fd: int) -> str { // Copied from run::program_output let file = os::fd_FILE(fd); let reader = io::new_reader(io::FILE_buf_reader(file, option::none)); - let buf = ~""; + let buf = ""; while !reader.eof() { let bytes = reader.read_bytes(4096u); buf += str::unsafe_from_bytes(bytes); @@ -128,8 +129,7 @@ fn worker(p: port<request>) { let pipe_out = os::pipe(); let pipe_err = os::pipe(); let spawnproc = - bind run::spawn_process(execparms.prog, - execparms.args, + bind run::spawn_process(execparms.prog, execparms.args, pipe_in.in, pipe_out.out, pipe_err.out); let pid = with_lib_path(execparms.lib_path, spawnproc); @@ -151,7 +151,7 @@ fn worker(p: port<request>) { } } -fn with_lib_path<@T>(path: &istr, f: fn() -> T) -> T { +fn with_lib_path<@T>(path: &str, f: fn() -> T) -> T { let maybe_oldpath = getenv(util::lib_path_env_var()); append_lib_path(path); let res = f(); @@ -159,26 +159,22 @@ fn with_lib_path<@T>(path: &istr, f: fn() -> T) -> T { export_lib_path(option::get(maybe_oldpath)); } else { // FIXME: This should really be unset but we don't have that yet - export_lib_path(~""); + export_lib_path(""); } ret res; } -fn append_lib_path(path: &istr) { - export_lib_path(util::make_new_path(path)); -} +fn append_lib_path(path: &str) { export_lib_path(util::make_new_path(path)); } -fn export_lib_path(path: &istr) { - setenv(util::lib_path_env_var(), path); -} +fn export_lib_path(path: &str) { setenv(util::lib_path_env_var(), path); } -fn clone_vecstr(v: &[istr]) -> [[u8]] { +fn clone_vecstr(v: &[str]) -> [[u8]] { let r = []; - for t: istr in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; } + for t: str in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; } ret r; } -fn clone_vecu8str(v: &[[u8]]) -> [istr] { +fn clone_vecu8str(v: &[[u8]]) -> [str] { let r = []; for t in vec::slice(v, 0u, vec::len(v)) { r += [str::unsafe_from_bytes(t)]; diff --git a/src/test/compiletest/runtest.rs b/src/test/compiletest/runtest.rs index 9128160855b..87ae7750e03 100644 --- a/src/test/compiletest/runtest.rs +++ b/src/test/compiletest/runtest.rs @@ -22,7 +22,7 @@ fn run(cx: &cx, _testfile: -[u8]) { let testfile = str::unsafe_from_bytes(_testfile); if cx.config.verbose { // We're going to be dumping a lot of info. Start on a new line. - io::stdout().write_str(~"\n\n"); + io::stdout().write_str("\n\n"); } log #fmt["running %s", testfile]; let props = load_props(testfile); @@ -34,25 +34,25 @@ fn run(cx: &cx, _testfile: -[u8]) { } } -fn run_cfail_test(cx: &cx, props: &test_props, testfile: &istr) { +fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); if procres.status == 0 { - fatal_procres(~"compile-fail test compiled successfully!", procres); + fatal_procres("compile-fail test compiled successfully!", procres); } check_error_patterns(props, testfile, procres); } -fn run_rfail_test(cx: &cx, props: &test_props, testfile: &istr) { +fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); - if procres.status != 0 { fatal_procres(~"compilation failed!", procres); } + if procres.status != 0 { fatal_procres("compilation failed!", procres); } procres = exec_compiled_test(cx, props, testfile); if procres.status == 0 { - fatal_procres(~"run-fail test didn't produce an error!", procres); + fatal_procres("run-fail test didn't produce an error!", procres); } // This is the value valgrind returns on failure @@ -61,27 +61,27 @@ fn run_rfail_test(cx: &cx, props: &test_props, testfile: &istr) { // exit code on the command-line (137)? const valgrind_err: int = 9; if procres.status == valgrind_err { - fatal_procres(~"run-fail test isn't valgrind-clean!", procres); + fatal_procres("run-fail test isn't valgrind-clean!", procres); } check_error_patterns(props, testfile, procres); } -fn run_rpass_test(cx: &cx, props: &test_props, testfile: &istr) { +fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); - if procres.status != 0 { fatal_procres(~"compilation failed!", procres); } + if procres.status != 0 { fatal_procres("compilation failed!", procres); } procres = exec_compiled_test(cx, props, testfile); - if procres.status != 0 { fatal_procres(~"test run failed!", procres); } + if procres.status != 0 { fatal_procres("test run failed!", procres); } } -fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) { +fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) { if option::is_some(props.pp_exact) { - logv(cx.config, ~"testing for exact pretty-printing"); - } else { logv(cx.config, ~"testing for converging pretty-printing"); } + logv(cx.config, "testing for exact pretty-printing"); + } else { logv(cx.config, "testing for converging pretty-printing"); } let rounds = alt props.pp_exact { option::some(_) { 1 } option::none. { 2 } }; @@ -94,9 +94,8 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) { let procres = print_source(cx, testfile, srcs[round]); if procres.status != 0 { - fatal_procres( - #fmt["pretty-printing failed in round %d", round], - procres); + fatal_procres(#fmt["pretty-printing failed in round %d", round], + procres); } srcs += [procres.stdout]; @@ -115,10 +114,10 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) { if option::is_some(props.pp_exact) { // Now we have to care about line endings - let cr = ~"\r"; + let cr = "\r"; check (str::is_not_empty(cr)); - actual = str::replace(actual, cr, ~""); - expected = str::replace(expected, cr, ~""); + actual = str::replace(actual, cr, ""); + expected = str::replace(expected, cr, ""); } compare_source(expected, actual); @@ -127,25 +126,25 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) { let procres = typecheck_source(cx, testfile, actual); if procres.status != 0 { - fatal_procres(~"pretty-printed source does not typecheck", procres); + fatal_procres("pretty-printed source does not typecheck", procres); } ret; - fn print_source(cx: &cx, testfile: &istr, src: &istr) -> procres { + fn print_source(cx: &cx, testfile: &str, src: &str) -> procres { compose_and_run(cx, testfile, make_pp_args, cx.config.compile_lib_path, option::some(src)) } - fn make_pp_args(config: &config, _testfile: &istr) -> procargs { + fn make_pp_args(config: &config, _testfile: &str) -> procargs { let prog = config.rustc_path; - let args = [~"-", ~"--pretty", ~"normal"]; + let args = ["-", "--pretty", "normal"]; ret {prog: prog, args: args}; } - fn compare_source(expected: &istr, actual: &istr) { + fn compare_source(expected: &str, actual: &str) { if expected != actual { - error(~"pretty-printed source does match expected source"); + error("pretty-printed source does match expected source"); let msg = #fmt["\n\ expected:\n\ @@ -157,41 +156,39 @@ actual:\n\ %s\n\ ------------------------------------------\n\ \n", - expected, - actual]; + expected, actual]; io::stdout().write_str(msg); fail; } } - fn typecheck_source(cx: &cx, testfile: &istr, src: &istr) -> procres { + fn typecheck_source(cx: &cx, testfile: &str, src: &str) -> procres { compose_and_run(cx, testfile, make_typecheck_args, cx.config.compile_lib_path, option::some(src)) } - fn make_typecheck_args(config: &config, _testfile: &istr) -> procargs { + fn make_typecheck_args(config: &config, _testfile: &str) -> procargs { let prog = config.rustc_path; - let args = [~"-", ~"--no-trans", ~"--lib"]; + let args = ["-", "--no-trans", "--lib"]; ret {prog: prog, args: args}; } } -fn check_error_patterns(props: &test_props, testfile: &istr, +fn check_error_patterns(props: &test_props, testfile: &str, procres: &procres) { if vec::is_empty(props.error_patterns) { - fatal(~"no error pattern specified in " + testfile); + fatal("no error pattern specified in " + testfile); } if procres.status == 0 { - fatal(~"process did not return an error status"); + fatal("process did not return an error status"); } let next_err_idx = 0u; let next_err_pat = props.error_patterns[next_err_idx]; - for line: istr in str::split(procres.stdout, '\n' as u8) { + for line: str in str::split(procres.stdout, '\n' as u8) { if str::find(line, next_err_pat) > 0 { - log #fmt["found error pattern %s", - next_err_pat]; + log #fmt["found error pattern %s", next_err_pat]; next_err_idx += 1u; if next_err_idx == vec::len(props.error_patterns) { log "found all error patterns"; @@ -205,83 +202,83 @@ fn check_error_patterns(props: &test_props, testfile: &istr, vec::slice(props.error_patterns, next_err_idx, vec::len(props.error_patterns)); if vec::len(missing_patterns) == 1u { - fatal_procres( - #fmt["error pattern '%s' not found!", - missing_patterns[0]], procres); + fatal_procres(#fmt["error pattern '%s' not found!", + missing_patterns[0]], procres); } else { - for pattern: istr in missing_patterns { - error(#fmt["error pattern '%s' not found!", - pattern]); + for pattern: str in missing_patterns { + error(#fmt["error pattern '%s' not found!", pattern]); } - fatal_procres(~"multiple error patterns not found", procres); + fatal_procres("multiple error patterns not found", procres); } } -type procargs = {prog: istr, args: [istr]}; +type procargs = {prog: str, args: [str]}; -type procres = {status: int, stdout: istr, stderr: istr, cmdline: istr}; +type procres = {status: int, stdout: str, stderr: str, cmdline: str}; -fn compile_test(cx: &cx, props: &test_props, testfile: &istr) -> procres { +fn compile_test(cx: &cx, props: &test_props, testfile: &str) -> procres { compose_and_run(cx, testfile, bind make_compile_args(_, props, _), cx.config.compile_lib_path, option::none) } -fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &istr) -> +fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &str) -> procres { compose_and_run(cx, testfile, bind make_run_args(_, props, _), cx.config.run_lib_path, option::none) } -fn compose_and_run(cx: &cx, testfile: &istr, - make_args: fn(&config, &istr) -> procargs, - lib_path: &istr, - input: option::t<istr>) -> procres { +fn compose_and_run(cx: &cx, testfile: &str, + make_args: fn(&config, &str) -> procargs, lib_path: &str, + input: option::t<str>) -> procres { let procargs = make_args(cx.config, testfile); ret program_output(cx, testfile, lib_path, procargs.prog, procargs.args, input); } -fn make_compile_args(config: &config, props: &test_props, testfile: &istr) -> +fn make_compile_args(config: &config, props: &test_props, testfile: &str) -> procargs { let prog = config.rustc_path; - let args = [testfile, ~"-o", make_exe_name(config, testfile)]; - let rustcflags = alt config.rustcflags { - option::some(s) { option::some(s) } - option::none. { option::none } - }; + let args = [testfile, "-o", make_exe_name(config, testfile)]; + let rustcflags = + alt config.rustcflags { + option::some(s) { option::some(s) } + option::none. { option::none } + }; args += split_maybe_args(rustcflags); args += split_maybe_args(props.compile_flags); ret {prog: prog, args: args}; } -fn make_exe_name(config: &config, testfile: &istr) -> istr { +fn make_exe_name(config: &config, testfile: &str) -> str { output_base_name(config, testfile) + os::exec_suffix() } -fn make_run_args(config: &config, props: &test_props, testfile: &istr) -> +fn make_run_args(config: &config, props: &test_props, testfile: &str) -> procargs { - let toolargs = if !props.no_valgrind { - // If we've got another tool to run under (valgrind), - // then split apart its command - let runtool = alt config.runtool { - option::some(s) { option::some(s) } - option::none. { option::none } - }; - split_maybe_args(runtool) - } else { [] }; + let toolargs = + if !props.no_valgrind { + // If we've got another tool to run under (valgrind), + // then split apart its command + let runtool = + alt config.runtool { + option::some(s) { option::some(s) } + option::none. { option::none } + }; + split_maybe_args(runtool) + } else { [] }; let args = toolargs + [make_exe_name(config, testfile)]; ret {prog: args[0], args: vec::slice(args, 1u, vec::len(args))}; } -fn split_maybe_args(argstr: &option::t<istr>) -> [istr] { - fn rm_whitespace(v: &[istr]) -> [istr] { - fn flt(s: &istr) -> option::t<istr> { +fn split_maybe_args(argstr: &option::t<str>) -> [str] { + fn rm_whitespace(v: &[str]) -> [str] { + fn flt(s: &str) -> option::t<str> { if !is_whitespace(s) { option::some(s) } else { option::none } } // FIXME: This should be in std - fn is_whitespace(s: &istr) -> bool { + fn is_whitespace(s: &str) -> bool { for c: u8 in s { if c != ' ' as u8 { ret false; } } ret true; } @@ -294,13 +291,12 @@ fn split_maybe_args(argstr: &option::t<istr>) -> [istr] { } } -fn program_output(cx: &cx, testfile: &istr, lib_path: &istr, prog: &istr, - args: &[istr], input: option::t<istr>) -> procres { +fn program_output(cx: &cx, testfile: &str, lib_path: &str, prog: &str, + args: &[str], input: option::t<str>) -> procres { let cmdline = { let cmdline = make_cmdline(lib_path, prog, args); - logv(cx.config, #fmt["executing %s", - cmdline]); + logv(cx.config, #fmt["executing %s", cmdline]); cmdline }; let res = procsrv::run(cx.procsrv, lib_path, prog, args, input); @@ -311,66 +307,58 @@ fn program_output(cx: &cx, testfile: &istr, lib_path: &istr, prog: &istr, cmdline: cmdline}; } -fn make_cmdline(libpath: &istr, prog: &istr, args: &[istr]) -> istr { - #fmt["%s %s %s", - lib_path_cmd_prefix(libpath), - prog, - str::connect(args, ~" ")] +fn make_cmdline(libpath: &str, prog: &str, args: &[str]) -> str { + #fmt["%s %s %s", lib_path_cmd_prefix(libpath), prog, + str::connect(args, " ")] } // Build the LD_LIBRARY_PATH variable as it would be seen on the command line // for diagnostic purposes -fn lib_path_cmd_prefix(path: &istr) -> istr { - #fmt["%s=\"%s\"", - util::lib_path_env_var(), - util::make_new_path(path)] +fn lib_path_cmd_prefix(path: &str) -> str { + #fmt["%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)] } -fn dump_output(config: &config, testfile: &istr, out: &istr, err: &istr) { - dump_output_file(config, testfile, out, ~"out"); - dump_output_file(config, testfile, err, ~"err"); +fn dump_output(config: &config, testfile: &str, out: &str, err: &str) { + dump_output_file(config, testfile, out, "out"); + dump_output_file(config, testfile, err, "err"); maybe_dump_to_stdout(config, out, err); } #[cfg(target_os = "win32")] #[cfg(target_os = "linux")] -fn dump_output_file(config: &config, testfile: &istr, out: &istr, - extension: &istr) { +fn dump_output_file(config: &config, testfile: &str, out: &str, + extension: &str) { let outfile = make_out_name(config, testfile, extension); - let writer = io::file_writer(outfile, - [io::create, io::truncate]); + let writer = io::file_writer(outfile, [io::create, io::truncate]); writer.write_str(out); } // FIXME (726): Can't use file_writer on mac #[cfg(target_os = "macos")] -fn dump_output_file(config: &config, testfile: &istr, out: &istr, - extension: &istr) { +fn dump_output_file(config: &config, testfile: &str, out: &str, + extension: &str) { } -fn make_out_name(config: &config, testfile: &istr, - extension: &istr) -> istr { - output_base_name(config, testfile) + ~"." + extension +fn make_out_name(config: &config, testfile: &str, extension: &str) -> str { + output_base_name(config, testfile) + "." + extension } -fn output_base_name(config: &config, testfile: &istr) -> istr { +fn output_base_name(config: &config, testfile: &str) -> str { let base = config.build_base; let filename = { - let parts = str::split(fs::basename(testfile), - '.' as u8); + let parts = str::split(fs::basename(testfile), '.' as u8); parts = vec::slice(parts, 0u, vec::len(parts) - 1u); - str::connect(parts, ~".") + str::connect(parts, ".") }; - #fmt["%s%s.%s", base, filename, - config.stage_id] + #fmt["%s%s.%s", base, filename, config.stage_id] } -fn maybe_dump_to_stdout(config: &config, out: &istr, err: &istr) { +fn maybe_dump_to_stdout(config: &config, out: &str, err: &str) { if config.verbose { - let sep1 = #fmt["------%s------------------------------", ~"stdout"]; - let sep2 = #fmt["------%s------------------------------", ~"stderr"]; - let sep3 = ~"------------------------------------------"; + let sep1 = #fmt["------%s------------------------------", "stdout"]; + let sep2 = #fmt["------%s------------------------------", "stderr"]; + let sep3 = "------------------------------------------"; io::stdout().write_line(sep1); io::stdout().write_line(out); io::stdout().write_line(sep2); @@ -379,13 +367,11 @@ fn maybe_dump_to_stdout(config: &config, out: &istr, err: &istr) { } } -fn error(err: &istr) { - io::stdout().write_line(#fmt["\nerror: %s", err]); -} +fn error(err: &str) { io::stdout().write_line(#fmt["\nerror: %s", err]); } -fn fatal(err: &istr) -> ! { error(err); fail; } +fn fatal(err: &str) -> ! { error(err); fail; } -fn fatal_procres(err: &istr, procres: procres) -> ! { +fn fatal_procres(err: &str, procres: procres) -> ! { let msg = #fmt["\n\ error: %s\n\ @@ -399,10 +385,7 @@ stderr:\n\ %s\n\ ------------------------------------------\n\ \n", - err, - procres.cmdline, - procres.stdout, - procres.stderr]; + err, procres.cmdline, procres.stdout, procres.stderr]; io::stdout().write_str(msg); fail; } diff --git a/src/test/compiletest/util.rs b/src/test/compiletest/util.rs index b15e16b5d4d..769b409ea43 100644 --- a/src/test/compiletest/util.rs +++ b/src/test/compiletest/util.rs @@ -5,29 +5,26 @@ import std::str; import common::config; -fn make_new_path(path: &istr) -> istr { +fn make_new_path(path: &str) -> str { // Windows just uses PATH as the library search path, so we have to // maintain the current value while adding our own alt getenv(lib_path_env_var()) { - option::some(curr) { - #fmt["%s:%s", path, curr] } + option::some(curr) { #fmt["%s:%s", path, curr] } option::none. { path } } } #[cfg(target_os = "linux")] -fn lib_path_env_var() -> istr { ~"LD_LIBRARY_PATH" } +fn lib_path_env_var() -> str { "LD_LIBRARY_PATH" } #[cfg(target_os = "macos")] -fn lib_path_env_var() -> istr { ~"DYLD_LIBRARY_PATH" } +fn lib_path_env_var() -> str { "DYLD_LIBRARY_PATH" } #[cfg(target_os = "win32")] -fn lib_path_env_var() -> istr { ~"PATH" } +fn lib_path_env_var() -> str { "PATH" } -fn logv(config: &config, s: &istr) { +fn logv(config: &config, s: &str) { log s; - if config.verbose { - io::stdout().write_line(s); - } + if config.verbose { io::stdout().write_line(s); } } diff --git a/src/test/run-fail/explicit-fail-msg.rs b/src/test/run-fail/explicit-fail-msg.rs index 56937260b54..b45e443759c 100644 --- a/src/test/run-fail/explicit-fail-msg.rs +++ b/src/test/run-fail/explicit-fail-msg.rs @@ -1,3 +1,3 @@ // error-pattern:wooooo // no-valgrind -fn main() { let a = 1; if 1 == 1 { a = 2; } fail ~"woooo" + ~"o"; } +fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; } diff --git a/src/test/run-fail/fmt-fail.rs b/src/test/run-fail/fmt-fail.rs index 2791db07446..90256271fd2 100644 --- a/src/test/run-fail/fmt-fail.rs +++ b/src/test/run-fail/fmt-fail.rs @@ -2,4 +2,4 @@ // no-valgrind use std; -fn main() { let str_var: istr = ~"meh"; fail #fmt["%s", str_var]; } +fn main() { let str_var: str = "meh"; fail #fmt["%s", str_var]; } diff --git a/src/test/run-fail/fn-constraint.rs b/src/test/run-fail/fn-constraint.rs index f55772d2def..3499d44ceff 100644 --- a/src/test/run-fail/fn-constraint.rs +++ b/src/test/run-fail/fn-constraint.rs @@ -7,5 +7,5 @@ fn main() { let a: uint = 4u; let b: uint = 1u; check (le(a, b)); - log_err safe_slice(~"kitties", a, b); + log_err safe_slice("kitties", a, b); } diff --git a/src/test/run-fail/zip-different-lengths.rs b/src/test/run-fail/zip-different-lengths.rs index 95991e31243..dcc86fdd3c9 100644 --- a/src/test/run-fail/zip-different-lengths.rs +++ b/src/test/run-fail/zip-different-lengths.rs @@ -9,12 +9,12 @@ import std::vec::*; fn main() { let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 9u; // Silly, but necessary - check u8::le(a, j); - check uint::le(k, l); + check (u8::le(a, j)); + check (uint::le(k, l)); let chars = enum_chars(a, j); - let ints = enum_uints(k, l); + let ints = enum_uints(k, l); - check same_length(chars, ints); + check (same_length(chars, ints)); let ps = zip(chars, ints); fail "the impossible happened"; -} \ No newline at end of file +} diff --git a/src/test/run-pass/alt-str.rs b/src/test/run-pass/alt-str.rs index 57e68552e80..e51263db804 100644 --- a/src/test/run-pass/alt-str.rs +++ b/src/test/run-pass/alt-str.rs @@ -1,31 +1,21 @@ // Issue #53 fn main() { - alt ~"test" { - ~"not-test" { fail; } - ~"test" { } - _ { fail; } - } + alt "test" { "not-test" { fail; } "test" { } _ { fail; } } - tag t { tag1(istr); tag2; } + tag t { tag1(str); tag2; } - alt tag1(~"test") { + alt tag1("test") { tag2. { fail; } - tag1(~"not-test") { fail; } - tag1(~"test") { } + tag1("not-test") { fail; } + tag1("test") { } _ { fail; } } - let x = alt ~"a" { - ~"a" { 1 } - ~"b" { 2 } - }; - assert x == 1; + let x = alt "a" { "a" { 1 } "b" { 2 } }; + assert (x == 1); - alt ~"a" { - ~"a" { } - ~"b" { } - } + alt "a" { "a" { } "b" { } } } diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs index 4ed753c8333..0bb536086ba 100644 --- a/src/test/run-pass/argv.rs +++ b/src/test/run-pass/argv.rs @@ -1,5 +1,5 @@ -fn main(args: [istr]) { - let vs: [istr] = [~"hi", ~"there", ~"this", ~"is", ~"a", ~"vec"]; - let vvs: [[istr]] = [args, vs]; - for vs: [istr] in vvs { for s: istr in vs { log s; } } +fn main(args: [str]) { + let vs: [str] = ["hi", "there", "this", "is", "a", "vec"]; + let vvs: [[str]] = [args, vs]; + for vs: [str] in vvs { for s: str in vs { log s; } } } diff --git a/src/test/run-pass/bug-862.rs b/src/test/run-pass/bug-862.rs index e3cddda3f8a..0c4c49a0a3d 100644 --- a/src/test/run-pass/bug-862.rs +++ b/src/test/run-pass/bug-862.rs @@ -4,8 +4,4 @@ fn f(i: int, j: int) : p(j) -> int { j } fn g(i: int, j: int) : p(j) -> int { f(i, j) } -fn main() { - let x = 1; - check p(x); - log g(x, x); -} \ No newline at end of file +fn main() { let x = 1; check (p(x)); log g(x, x); } diff --git a/src/test/run-pass/check-pattern-bound.rs b/src/test/run-pass/check-pattern-bound.rs index 0ebaf84b96d..32c6ac2475b 100644 --- a/src/test/run-pass/check-pattern-bound.rs +++ b/src/test/run-pass/check-pattern-bound.rs @@ -1,16 +1,10 @@ use std; import std::option::*; -pure fn p(x:int) -> bool { true } +pure fn p(x: int) -> bool { true } -fn f(x:int) : p(x) { } +fn f(x: int) : p(x) { } fn main() { - alt some(5) { - some(y) { - check p(y); - f(y); - } - _ { fail "yuck"; } - } + alt some(5) { some(y) { check (p(y)); f(y); } _ { fail "yuck"; } } } diff --git a/src/test/run-pass/child-outlives-parent.rs b/src/test/run-pass/child-outlives-parent.rs index c902809e447..9a54dbd5c90 100644 --- a/src/test/run-pass/child-outlives-parent.rs +++ b/src/test/run-pass/child-outlives-parent.rs @@ -3,6 +3,6 @@ use std; import std::task; -fn child2(s: -istr) { } +fn child2(s: -str) { } -fn main() { let x = task::spawn(bind child2(~"hi")); } +fn main() { let x = task::spawn(bind child2("hi")); } diff --git a/src/test/run-pass/command-line-args.rs b/src/test/run-pass/command-line-args.rs index b044af7d839..efd5d2bb04c 100644 --- a/src/test/run-pass/command-line-args.rs +++ b/src/test/run-pass/command-line-args.rs @@ -1,3 +1,3 @@ -fn main(args: [istr]) { log args[0]; } +fn main(args: [str]) { log args[0]; } diff --git a/src/test/run-pass/constraint-prop-expr-move.rs b/src/test/run-pass/constraint-prop-expr-move.rs index a8f4f976872..56ebc914b93 100644 --- a/src/test/run-pass/constraint-prop-expr-move.rs +++ b/src/test/run-pass/constraint-prop-expr-move.rs @@ -8,5 +8,5 @@ fn main() { let c: uint = 17u; check (le(a, b)); c <- a; - log safe_slice(~"kitties", c, b); + log safe_slice("kitties", c, b); } diff --git a/src/test/run-pass/constraint-prop-move.rs b/src/test/run-pass/constraint-prop-move.rs index b691fb75dbd..97285adae0c 100644 --- a/src/test/run-pass/constraint-prop-move.rs +++ b/src/test/run-pass/constraint-prop-move.rs @@ -7,5 +7,5 @@ fn main() { let b: uint = 4u; check (le(a, b)); let c <- a; - log safe_slice(~"kitties", c, b); + log safe_slice("kitties", c, b); } diff --git a/src/test/run-pass/constraint-prop-swap.rs b/src/test/run-pass/constraint-prop-swap.rs index 5814f095f66..7b96a89bb16 100644 --- a/src/test/run-pass/constraint-prop-swap.rs +++ b/src/test/run-pass/constraint-prop-swap.rs @@ -7,5 +7,5 @@ fn main() { let b: uint = 1u; check (le(b, a)); b <-> a; - log safe_slice(~"kitties", a, b); + log safe_slice("kitties", a, b); } diff --git a/src/test/run-pass/constraint-prop.rs b/src/test/run-pass/constraint-prop.rs index c0a5903f69c..71f151f5260 100644 --- a/src/test/run-pass/constraint-prop.rs +++ b/src/test/run-pass/constraint-prop.rs @@ -7,5 +7,5 @@ fn main() { let b: uint = 4u; check (le(a, b)); let c = b; - log safe_slice(~"kitties", a, c); + log safe_slice("kitties", a, c); } diff --git a/src/test/run-pass/fn-constraint.rs b/src/test/run-pass/fn-constraint.rs index 5e2dac48eab..f9ea572a735 100644 --- a/src/test/run-pass/fn-constraint.rs +++ b/src/test/run-pass/fn-constraint.rs @@ -6,5 +6,5 @@ fn main() { let a: uint = 1u; let b: uint = 4u; check (le(a, b)); - log safe_slice(~"kitties", a, b); + log safe_slice("kitties", a, b); } diff --git a/src/test/run-pass/guards.rs b/src/test/run-pass/guards.rs index 49e7fd3b7fe..2da4a0296fd 100644 --- a/src/test/run-pass/guards.rs +++ b/src/test/run-pass/guards.rs @@ -1,16 +1,13 @@ fn main() { - let a = alt 10 { - x when x < 7 { 1 } - x when x < 11 { 2 } - 10 { 3 } - _ { 4 } - }; - assert a == 2; + let a = + alt 10 { x when x < 7 { 1 } x when x < 11 { 2 } 10 { 3 } _ { 4 } }; + assert (a == 2); - let b = alt {x: 10, y: 20} { - x when x.x < 5 && x.y < 5 { 1 } - {x, y} when x == 10 && y == 20 { 2 } - {x, y} { 3 } - }; - assert b == 2; + let b = + alt {x: 10, y: 20} { + x when x.x < 5 && x.y < 5 { 1 } + {x: x, y: y} when x == 10 && y == 20 { 2 } + {x: x, y: y} { 3 } + }; + assert (b == 2); } diff --git a/src/test/run-pass/hashmap-memory.rs b/src/test/run-pass/hashmap-memory.rs index 81c827bfb22..6d5203f4884 100644 --- a/src/test/run-pass/hashmap-memory.rs +++ b/src/test/run-pass/hashmap-memory.rs @@ -19,31 +19,29 @@ import std::comm::send; import std::comm::recv; import std::comm; -fn map(filename: &istr, emit: map_reduce::putter) { emit(filename, ~"1"); } +fn map(filename: &str, emit: map_reduce::putter) { emit(filename, "1"); } mod map_reduce { export putter; export mapper; export map_reduce; - type putter = fn(&istr, &istr); + type putter = fn(&str, &str); - type mapper = fn(&istr, putter); + type mapper = fn(&str, putter); tag ctrl_proto { find_reducer([u8], chan<int>); mapper_done; } - fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[istr]) { - for i: istr in inputs { - task::spawn(bind map_task(ctrl, i)); - } + fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[str]) { + for i: str in inputs { task::spawn(bind map_task(ctrl, i)); } } - fn map_task(ctrl: chan<ctrl_proto>, input: -istr) { + fn map_task(ctrl: chan<ctrl_proto>, input: -str) { let intermediates = map::new_str_hash(); - fn emit(im: &map::hashmap<istr, int>, ctrl: chan<ctrl_proto>, - key: &istr, val: &istr) { + fn emit(im: &map::hashmap<str, int>, ctrl: chan<ctrl_proto>, + key: &str, val: &str) { let c; alt im.find(key) { some(_c) { c = _c } @@ -63,13 +61,13 @@ mod map_reduce { send(ctrl, mapper_done); } - fn map_reduce(inputs: &[istr]) { + fn map_reduce(inputs: &[str]) { let ctrl = port(); // This task becomes the master control task. It spawns others // to do the rest. - let reducers: map::hashmap<istr, int>; + let reducers: map::hashmap<str, int>; reducers = map::new_str_hash(); @@ -94,5 +92,5 @@ mod map_reduce { } fn main() { - map_reduce::map_reduce([~"../src/test/run-pass/hashmap-memory.rs"]); + map_reduce::map_reduce(["../src/test/run-pass/hashmap-memory.rs"]); } diff --git a/src/test/run-pass/import4.rs b/src/test/run-pass/import4.rs index 20b60a41e24..9e263b73413 100644 --- a/src/test/run-pass/import4.rs +++ b/src/test/run-pass/import4.rs @@ -5,4 +5,4 @@ mod zed { fn bar() { log "bar"; } } -fn main(args: [istr]) { let zed = 42; bar(); } +fn main(args: [str]) { let zed = 42; bar(); } diff --git a/src/test/run-pass/import5.rs b/src/test/run-pass/import5.rs index 14dbd577361..9f3ec6d2b45 100644 --- a/src/test/run-pass/import5.rs +++ b/src/test/run-pass/import5.rs @@ -7,4 +7,4 @@ mod foo { } } -fn main(args: [istr]) { bar(); } +fn main(args: [str]) { bar(); } diff --git a/src/test/run-pass/import7.rs b/src/test/run-pass/import7.rs index a50dcff79d1..40c3d2357bf 100644 --- a/src/test/run-pass/import7.rs +++ b/src/test/run-pass/import7.rs @@ -12,4 +12,4 @@ mod bar { mod zed { } } } -fn main(args: [istr]) { baz(); } +fn main(args: [str]) { baz(); } diff --git a/src/test/run-pass/issue-687.rs b/src/test/run-pass/issue-687.rs index 65cdfd899a8..0306326e824 100644 --- a/src/test/run-pass/issue-687.rs +++ b/src/test/run-pass/issue-687.rs @@ -36,8 +36,7 @@ fn packager(cb: chan<chan<[u8]>>, msg: chan<msg>) { fn main() { let p: port<msg> = port(); let recv_reader: port<chan<[u8]>> = port(); - let pack = - task::spawn(bind packager(chan(recv_reader), chan(p))); + let pack = task::spawn(bind packager(chan(recv_reader), chan(p))); let source_chan: chan<[u8]> = recv(recv_reader); let prod = task::spawn(bind producer(source_chan)); diff --git a/src/test/run-pass/istr.rs b/src/test/run-pass/istr.rs index 8b0eb0ddc05..affdbd06f17 100644 --- a/src/test/run-pass/istr.rs +++ b/src/test/run-pass/istr.rs @@ -1,60 +1,53 @@ fn test_stack_assign() { - let s: istr = ~"a"; + let s: str = "a"; log s; - let t: istr = ~"a"; - assert s == t; - let u: istr = ~"b"; - assert s != u; + let t: str = "a"; + assert (s == t); + let u: str = "b"; + assert (s != u); } -fn test_heap_lit() { - ~"a big string"; -} +fn test_heap_lit() { "a big string"; } fn test_heap_assign() { - let s: istr = ~"a big ol' string"; - let t: istr = ~"a big ol' string"; - assert s == t; - let u: istr = ~"a bad ol' string"; - assert s != u; + let s: str = "a big ol' string"; + let t: str = "a big ol' string"; + assert (s == t); + let u: str = "a bad ol' string"; + assert (s != u); } -fn test_heap_log() { - let s = ~"a big ol' string"; - log s; -} +fn test_heap_log() { let s = "a big ol' string"; log s; } fn test_stack_add() { - assert ~"a" + ~"b" == ~"ab"; - let s: istr = ~"a"; - assert s + s == ~"aa"; - assert ~"" + ~"" == ~""; + assert ("a" + "b" == "ab"); + let s: str = "a"; + assert (s + s == "aa"); + assert ("" + "" == ""); } -fn test_stack_heap_add() { - assert ~"a" + ~"bracadabra" == ~"abracadabra"; -} +fn test_stack_heap_add() { assert ("a" + "bracadabra" == "abracadabra"); } fn test_heap_add() { - assert ~"this should" + ~" totally work" == ~"this should totally work"; + assert ("this should" + " totally work" == "this should totally work"); } fn test_append() { - let s = ~""; - s += ~"a"; - assert s == ~"a"; + let s = ""; + s += "a"; + assert (s == "a"); - let s = ~"a"; - s += ~"b"; + let s = "a"; + s += "b"; log s; - assert s == ~"ab"; + assert (s == "ab"); - let s = ~"c"; - s += ~"offee"; - assert s == ~"coffee"; + let s = "c"; + s += "offee"; + assert (s == "coffee"); - s += ~"&tea"; - assert s == ~"coffee&tea"; + s += "&tea"; + assert (s == "coffee&tea"); } fn main() { @@ -66,4 +59,4 @@ fn main() { test_stack_heap_add(); test_heap_add(); test_append(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/item-attributes.rs b/src/test/run-pass/item-attributes.rs index dd5fb0b18b3..3701d229059 100644 --- a/src/test/run-pass/item-attributes.rs +++ b/src/test/run-pass/item-attributes.rs @@ -167,7 +167,7 @@ mod test_distinguish_syntax_ext { use std; fn f() { - #fmt["test%s", ~"s"]; + #fmt["test%s", "s"]; #[attr = "val"] fn g() { } } diff --git a/src/test/run-pass/iter-ret.rs b/src/test/run-pass/iter-ret.rs index 25f350680ba..b450a34c411 100644 --- a/src/test/run-pass/iter-ret.rs +++ b/src/test/run-pass/iter-ret.rs @@ -4,4 +4,4 @@ iter x() -> int { } fn f() -> bool { for each i: int in x() { ret true; } ret false; } -fn main(args: [istr]) { f(); } +fn main(args: [str]) { f(); } diff --git a/src/test/run-pass/main-ivec.rs b/src/test/run-pass/main-ivec.rs index 376374f68eb..ec2403a9151 100644 --- a/src/test/run-pass/main-ivec.rs +++ b/src/test/run-pass/main-ivec.rs @@ -1,3 +1 @@ -fn main(args: [istr]) { - for s in args { log s } -} +fn main(args: [str]) { for s in args { log s } } diff --git a/src/test/run-pass/native2.rs b/src/test/run-pass/native2.rs index 2840c6a3a78..c0340387cfe 100644 --- a/src/test/run-pass/native2.rs +++ b/src/test/run-pass/native2.rs @@ -14,4 +14,4 @@ native "cdecl" mod libc = "" { native "cdecl" mod baz = "" { } -fn main(args: [istr]) { } +fn main(args: [str]) { } diff --git a/src/test/run-pass/non-boolean-pure-fns.rs b/src/test/run-pass/non-boolean-pure-fns.rs index 61477258bb4..9478735d932 100644 --- a/src/test/run-pass/non-boolean-pure-fns.rs +++ b/src/test/run-pass/non-boolean-pure-fns.rs @@ -3,30 +3,23 @@ use std; import std::list::*; pure fn pure_length_go<@T>(ls: &list<T>, acc: uint) -> uint { - alt ls { - nil. { acc } - cons(_, tl) { pure_length_go(*tl, acc + 1u) } - } + alt ls { nil. { acc } cons(_, tl) { pure_length_go(*tl, acc + 1u) } } } -pure fn pure_length<@T>(ls: &list<T>) -> uint { - pure_length_go(ls, 0u) -} +pure fn pure_length<@T>(ls: &list<T>) -> uint { pure_length_go(ls, 0u) } -pure fn nonempty_list<@T>(ls: &list<T>) -> bool { - pure_length(ls) > 0u -} +pure fn nonempty_list<@T>(ls: &list<T>) -> bool { pure_length(ls) > 0u } - // Of course, the compiler can't take advantage of the - // knowledge that ls is a cons node. Future work. - // Also, this is pretty contrived since nonempty_list - // could be a "tag refinement", if we implement those. +// Of course, the compiler can't take advantage of the +// knowledge that ls is a cons node. Future work. +// Also, this is pretty contrived since nonempty_list +// could be a "tag refinement", if we implement those. fn safe_head<@T>(ls: &list<T>) : nonempty_list(ls) -> T { car(ls) } fn main() { let mylist = cons(@1u, @nil); // Again, a way to eliminate such "obvious" checks seems // desirable. (Tags could have postconditions.) - check(nonempty_list(mylist)); - assert (*(safe_head(mylist)) == 1u); -} \ No newline at end of file + check (nonempty_list(mylist)); + assert (*safe_head(mylist) == 1u); +} diff --git a/src/test/run-pass/path.rs b/src/test/run-pass/path.rs index 0cac07f3c99..4fe43d18121 100644 --- a/src/test/run-pass/path.rs +++ b/src/test/run-pass/path.rs @@ -4,4 +4,4 @@ mod foo { fn bar(offset: uint) { } } -fn main(args: [istr]) { foo::bar(0u); } +fn main(args: [str]) { foo::bar(0u); } diff --git a/src/test/run-pass/sio-client.rs b/src/test/run-pass/sio-client.rs index f3eefbcaef9..14e5e2e44cf 100644 --- a/src/test/run-pass/sio-client.rs +++ b/src/test/run-pass/sio-client.rs @@ -13,9 +13,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) { fn main() { let cx: sio::ctx = sio::new(); let srv: sio::server = sio::create_server( - cx, net::parse_addr(~"0.0.0.0"), 9090); + cx, net::parse_addr("0.0.0.0"), 9090); let child = task::_spawn(bind connectTask(cx, - net::parse_addr(~"127.0.0.1"), + net::parse_addr("127.0.0.1"), 9090)); let client: sio::client = sio::accept_from(srv); task::join_id(child); diff --git a/src/test/run-pass/sio-read.rs b/src/test/run-pass/sio-read.rs index 9f7272e6d92..0085f4983f2 100644 --- a/src/test/run-pass/sio-read.rs +++ b/src/test/run-pass/sio-read.rs @@ -15,9 +15,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) { fn main() { let cx: sio::ctx = sio::new(); let srv: sio::server = sio::create_server( - cx, net::parse_addr(~"0.0.0.0"), 9090); + cx, net::parse_addr("0.0.0.0"), 9090); let child = task::_spawn(bind connectTask(cx, - net::parse_addr(~"127.0.0.1"), + net::parse_addr("127.0.0.1"), 9090)); let client: sio::client = sio::accept_from(srv); sio::write_data(client, str::bytes("hello, world\n")); diff --git a/src/test/run-pass/sio-srv.rs b/src/test/run-pass/sio-srv.rs index c51a2c0d9d4..1171971427e 100644 --- a/src/test/run-pass/sio-srv.rs +++ b/src/test/run-pass/sio-srv.rs @@ -6,7 +6,7 @@ import std::net; fn main() { let cx: sio::ctx = sio::new(); let srv: sio::server = sio::create_server(cx, - net::parse_addr(~"127.0.0.1"), + net::parse_addr("127.0.0.1"), 9090); sio::close_server(srv); sio::destroy(cx); diff --git a/src/test/run-pass/sio-write.rs b/src/test/run-pass/sio-write.rs index 63e1cf4f3b1..cc372bc916d 100644 --- a/src/test/run-pass/sio-write.rs +++ b/src/test/run-pass/sio-write.rs @@ -13,9 +13,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) { fn main() { let cx: sio::ctx = sio::new(); - let srv: sio::server = sio::create_server(cx, net::parse_addr(~"0.0.0.0"), + let srv: sio::server = sio::create_server(cx, net::parse_addr("0.0.0.0"), 9090); - let child = task::_spawn(bind connectTask(cx, net::parse_addr(~"127.0.0.1"), + let child = task::_spawn(bind connectTask(cx, net::parse_addr("127.0.0.1"), 9090)); let client: sio::client = sio::accept_from(srv); sio::write_data(client, str::bytes("hello, world\n")); diff --git a/src/test/run-pass/spawn-fn.rs b/src/test/run-pass/spawn-fn.rs index bfaba60bcd1..612fdecb4ab 100644 --- a/src/test/run-pass/spawn-fn.rs +++ b/src/test/run-pass/spawn-fn.rs @@ -4,12 +4,12 @@ use std; import std::task::yield; import std::task; -fn x(s: -istr, n: int) { log s; log n; } +fn x(s: -str, n: int) { log s; log n; } fn main() { - task::spawn(bind x(~"hello from first spawned fn", 65)); - task::spawn(bind x(~"hello from second spawned fn", 66)); - task::spawn(bind x(~"hello from third spawned fn", 67)); + task::spawn(bind x("hello from first spawned fn", 65)); + task::spawn(bind x("hello from second spawned fn", 66)); + task::spawn(bind x("hello from third spawned fn", 67)); let i: int = 30; while i > 0 { i = i - 1; log "parent sleeping"; yield(); } } diff --git a/src/test/run-pass/spawn-module-qualified.rs b/src/test/run-pass/spawn-module-qualified.rs index e5775550c44..38bf6afe1e5 100644 --- a/src/test/run-pass/spawn-module-qualified.rs +++ b/src/test/run-pass/spawn-module-qualified.rs @@ -2,10 +2,7 @@ use std; import std::task::join; import std::task::spawn_joinable; -fn main() { - let x = spawn_joinable(bind m::child(10)); - join(x); -} +fn main() { let x = spawn_joinable(bind m::child(10)); join(x); } mod m { fn child(i: int) { log i; } diff --git a/src/test/run-pass/spawn-types.rs b/src/test/run-pass/spawn-types.rs index 33ac76300a7..3a4ce18f3a2 100644 --- a/src/test/run-pass/spawn-types.rs +++ b/src/test/run-pass/spawn-types.rs @@ -12,9 +12,9 @@ import std::task; type ctx = comm::chan<int>; -fn iotask(cx: ctx, ip: -istr) { assert (str::eq(ip, ~"localhost")); } +fn iotask(cx: ctx, ip: -str) { assert (str::eq(ip, "localhost")); } fn main() { let p = comm::port::<int>(); - task::spawn(bind iotask(comm::chan(p), ~"localhost")); + task::spawn(bind iotask(comm::chan(p), "localhost")); } diff --git a/src/test/run-pass/spawn.rs b/src/test/run-pass/spawn.rs index 9086b7d0e37..50c599f42af 100644 --- a/src/test/run-pass/spawn.rs +++ b/src/test/run-pass/spawn.rs @@ -4,10 +4,7 @@ use std; import std::task; -fn main() { - let t = task::spawn_joinable(bind child(10)); - task::join(t); -} +fn main() { let t = task::spawn_joinable(bind child(10)); task::join(t); } fn child(i: int) { log_err i; assert (i == 10); } diff --git a/src/test/run-pass/str-append.rs b/src/test/run-pass/str-append.rs index 5677f562a2f..e1fa92738cb 100644 --- a/src/test/run-pass/str-append.rs +++ b/src/test/run-pass/str-append.rs @@ -5,8 +5,8 @@ use std; import std::str; fn test1() { - let s: istr = ~"hello"; - s += ~"world"; + let s: str = "hello"; + s += "world"; log s; assert (s[9] == 'd' as u8); } @@ -14,13 +14,13 @@ fn test1() { fn test2() { // This tests for issue #163 - let ff: istr = ~"abc"; - let a: istr = ff + ~"ABC" + ff; - let b: istr = ~"ABC" + ff + ~"ABC"; + let ff: str = "abc"; + let a: str = ff + "ABC" + ff; + let b: str = "ABC" + ff + "ABC"; log a; log b; - assert (str::eq(a, ~"abcABCabc")); - assert (str::eq(b, ~"ABCabcABC")); + assert (str::eq(a, "abcABCabc")); + assert (str::eq(b, "ABCabcABC")); } fn main() { test1(); test2(); } diff --git a/src/test/run-pass/str-multiline.rs b/src/test/run-pass/str-multiline.rs index 3df1a7d926f..15a13083321 100644 --- a/src/test/run-pass/str-multiline.rs +++ b/src/test/run-pass/str-multiline.rs @@ -5,13 +5,13 @@ use std; import std::str; fn main() { - let a: istr = ~"this \ + let a: str = "this \ is a test"; - let b: istr = - ~"this \ + let b: str = + "this \ is \ another \ test"; - assert (str::eq(a, ~"this is a test")); - assert (str::eq(b, ~"this is another test")); + assert (str::eq(a, "this is a test")); + assert (str::eq(b, "this is another test")); } diff --git a/src/test/run-pass/string-self-append.rs b/src/test/run-pass/string-self-append.rs index 29bef1379bb..94a9696adf0 100644 --- a/src/test/run-pass/string-self-append.rs +++ b/src/test/run-pass/string-self-append.rs @@ -3,7 +3,7 @@ import std::str; fn main() { // Make sure we properly handle repeated self-appends. - let a: istr = ~"A"; + let a: str = "A"; let i = 20; let expected_len = 1u; while i > 0 { diff --git a/src/test/run-pass/syntax-extension-fmt.rs b/src/test/run-pass/syntax-extension-fmt.rs index 77ae154085f..88204cfffeb 100644 --- a/src/test/run-pass/syntax-extension-fmt.rs +++ b/src/test/run-pass/syntax-extension-fmt.rs @@ -1,17 +1,17 @@ use std; import std::str; -fn test(actual: &istr, expected: &istr) { +fn test(actual: &str, expected: &str) { log actual; log expected; assert (str::eq(actual, expected)); } fn main() { - test(#fmt[~"hello %d friends and %s things", 10, ~"formatted"], - ~"hello 10 friends and formatted things"); + test(#fmt["hello %d friends and %s things", 10, "formatted"], + "hello 10 friends and formatted things"); - test(#fmt[~"test"], ~"test"); + test(#fmt["test"], "test"); // a quadratic optimization in LLVM (jump-threading) makes this test a // bit slow to compile unless we break it up @@ -26,192 +26,192 @@ fn main() { fn part1() { // Simple tests for types - test(#fmt[~"%d", 1], ~"1"); - test(#fmt[~"%i", 2], ~"2"); - test(#fmt[~"%i", -1], ~"-1"); - test(#fmt[~"%u", 10u], ~"10"); - test(#fmt[~"%s", ~"test"], ~"test"); - test(#fmt[~"%b", true], ~"true"); - test(#fmt[~"%b", false], ~"false"); - test(#fmt[~"%c", 'A'], ~"A"); - test(#fmt[~"%x", 0xff_u], ~"ff"); - test(#fmt[~"%X", 0x12ab_u], ~"12AB"); - test(#fmt[~"%o", 10u], ~"12"); - test(#fmt[~"%t", 0b11010101_u], ~"11010101"); + test(#fmt["%d", 1], "1"); + test(#fmt["%i", 2], "2"); + test(#fmt["%i", -1], "-1"); + test(#fmt["%u", 10u], "10"); + test(#fmt["%s", "test"], "test"); + test(#fmt["%b", true], "true"); + test(#fmt["%b", false], "false"); + test(#fmt["%c", 'A'], "A"); + test(#fmt["%x", 0xff_u], "ff"); + test(#fmt["%X", 0x12ab_u], "12AB"); + test(#fmt["%o", 10u], "12"); + test(#fmt["%t", 0b11010101_u], "11010101"); // 32-bit limits - test(#fmt[~"%i", -2147483648], ~"-2147483648"); - test(#fmt[~"%i", 2147483647], ~"2147483647"); - test(#fmt[~"%u", 4294967295u], ~"4294967295"); - test(#fmt[~"%x", 0xffffffff_u], ~"ffffffff"); - test(#fmt[~"%o", 0xffffffff_u], ~"37777777777"); - test(#fmt[~"%t", 0xffffffff_u], ~"11111111111111111111111111111111"); + test(#fmt["%i", -2147483648], "-2147483648"); + test(#fmt["%i", 2147483647], "2147483647"); + test(#fmt["%u", 4294967295u], "4294967295"); + test(#fmt["%x", 0xffffffff_u], "ffffffff"); + test(#fmt["%o", 0xffffffff_u], "37777777777"); + test(#fmt["%t", 0xffffffff_u], "11111111111111111111111111111111"); } fn part2() { // Widths - test(#fmt[~"%1d", 500], ~"500"); - test(#fmt[~"%10d", 500], ~" 500"); - test(#fmt[~"%10d", -500], ~" -500"); - test(#fmt[~"%10u", 500u], ~" 500"); - test(#fmt[~"%10s", ~"test"], ~" test"); - test(#fmt[~"%10b", true], ~" true"); - test(#fmt[~"%10x", 0xff_u], ~" ff"); - test(#fmt[~"%10X", 0xff_u], ~" FF"); - test(#fmt[~"%10o", 10u], ~" 12"); - test(#fmt[~"%10t", 0xff_u], ~" 11111111"); - test(#fmt[~"%10c", 'A'], ~" A"); + test(#fmt["%1d", 500], "500"); + test(#fmt["%10d", 500], " 500"); + test(#fmt["%10d", -500], " -500"); + test(#fmt["%10u", 500u], " 500"); + test(#fmt["%10s", "test"], " test"); + test(#fmt["%10b", true], " true"); + test(#fmt["%10x", 0xff_u], " ff"); + test(#fmt["%10X", 0xff_u], " FF"); + test(#fmt["%10o", 10u], " 12"); + test(#fmt["%10t", 0xff_u], " 11111111"); + test(#fmt["%10c", 'A'], " A"); // Left justify - test(#fmt[~"%-10d", 500], ~"500 "); - test(#fmt[~"%-10d", -500], ~"-500 "); - test(#fmt[~"%-10u", 500u], ~"500 "); - test(#fmt[~"%-10s", ~"test"], ~"test "); - test(#fmt[~"%-10b", true], ~"true "); - test(#fmt[~"%-10x", 0xff_u], ~"ff "); - test(#fmt[~"%-10X", 0xff_u], ~"FF "); - test(#fmt[~"%-10o", 10u], ~"12 "); - test(#fmt[~"%-10t", 0xff_u], ~"11111111 "); - test(#fmt[~"%-10c", 'A'], ~"A "); + test(#fmt["%-10d", 500], "500 "); + test(#fmt["%-10d", -500], "-500 "); + test(#fmt["%-10u", 500u], "500 "); + test(#fmt["%-10s", "test"], "test "); + test(#fmt["%-10b", true], "true "); + test(#fmt["%-10x", 0xff_u], "ff "); + test(#fmt["%-10X", 0xff_u], "FF "); + test(#fmt["%-10o", 10u], "12 "); + test(#fmt["%-10t", 0xff_u], "11111111 "); + test(#fmt["%-10c", 'A'], "A "); } fn part3() { // Precision - test(#fmt[~"%.d", 0], ~""); - test(#fmt[~"%.u", 0u], ~""); - test(#fmt[~"%.x", 0u], ~""); - test(#fmt[~"%.t", 0u], ~""); - test(#fmt[~"%.d", 10], ~"10"); - test(#fmt[~"%.d", -10], ~"-10"); - test(#fmt[~"%.u", 10u], ~"10"); - test(#fmt[~"%.s", ~"test"], ~""); - test(#fmt[~"%.x", 127u], ~"7f"); - test(#fmt[~"%.o", 10u], ~"12"); - test(#fmt[~"%.t", 3u], ~"11"); - test(#fmt[~"%.c", 'A'], ~"A"); - test(#fmt[~"%.0d", 0], ~""); - test(#fmt[~"%.0u", 0u], ~""); - test(#fmt[~"%.0x", 0u], ~""); - test(#fmt[~"%.0t", 0u], ~""); - test(#fmt[~"%.0d", 10], ~"10"); - test(#fmt[~"%.0d", -10], ~"-10"); - test(#fmt[~"%.0u", 10u], ~"10"); - test(#fmt[~"%.0s", ~"test"], ~""); - test(#fmt[~"%.0x", 127u], ~"7f"); - test(#fmt[~"%.0o", 10u], ~"12"); - test(#fmt[~"%.0t", 3u], ~"11"); - test(#fmt[~"%.0c", 'A'], ~"A"); - test(#fmt[~"%.1d", 0], ~"0"); - test(#fmt[~"%.1u", 0u], ~"0"); - test(#fmt[~"%.1x", 0u], ~"0"); - test(#fmt[~"%.1t", 0u], ~"0"); - test(#fmt[~"%.1d", 10], ~"10"); - test(#fmt[~"%.1d", -10], ~"-10"); - test(#fmt[~"%.1u", 10u], ~"10"); - test(#fmt[~"%.1s", ~"test"], ~"t"); - test(#fmt[~"%.1x", 127u], ~"7f"); - test(#fmt[~"%.1o", 10u], ~"12"); - test(#fmt[~"%.1t", 3u], ~"11"); - test(#fmt[~"%.1c", 'A'], ~"A"); + test(#fmt["%.d", 0], ""); + test(#fmt["%.u", 0u], ""); + test(#fmt["%.x", 0u], ""); + test(#fmt["%.t", 0u], ""); + test(#fmt["%.d", 10], "10"); + test(#fmt["%.d", -10], "-10"); + test(#fmt["%.u", 10u], "10"); + test(#fmt["%.s", "test"], ""); + test(#fmt["%.x", 127u], "7f"); + test(#fmt["%.o", 10u], "12"); + test(#fmt["%.t", 3u], "11"); + test(#fmt["%.c", 'A'], "A"); + test(#fmt["%.0d", 0], ""); + test(#fmt["%.0u", 0u], ""); + test(#fmt["%.0x", 0u], ""); + test(#fmt["%.0t", 0u], ""); + test(#fmt["%.0d", 10], "10"); + test(#fmt["%.0d", -10], "-10"); + test(#fmt["%.0u", 10u], "10"); + test(#fmt["%.0s", "test"], ""); + test(#fmt["%.0x", 127u], "7f"); + test(#fmt["%.0o", 10u], "12"); + test(#fmt["%.0t", 3u], "11"); + test(#fmt["%.0c", 'A'], "A"); + test(#fmt["%.1d", 0], "0"); + test(#fmt["%.1u", 0u], "0"); + test(#fmt["%.1x", 0u], "0"); + test(#fmt["%.1t", 0u], "0"); + test(#fmt["%.1d", 10], "10"); + test(#fmt["%.1d", -10], "-10"); + test(#fmt["%.1u", 10u], "10"); + test(#fmt["%.1s", "test"], "t"); + test(#fmt["%.1x", 127u], "7f"); + test(#fmt["%.1o", 10u], "12"); + test(#fmt["%.1t", 3u], "11"); + test(#fmt["%.1c", 'A'], "A"); } fn part4() { - test(#fmt[~"%.5d", 0], ~"00000"); - test(#fmt[~"%.5u", 0u], ~"00000"); - test(#fmt[~"%.5x", 0u], ~"00000"); - test(#fmt[~"%.5t", 0u], ~"00000"); - test(#fmt[~"%.5d", 10], ~"00010"); - test(#fmt[~"%.5d", -10], ~"-00010"); - test(#fmt[~"%.5u", 10u], ~"00010"); - test(#fmt[~"%.5s", ~"test"], ~"test"); - test(#fmt[~"%.5x", 127u], ~"0007f"); - test(#fmt[~"%.5o", 10u], ~"00012"); - test(#fmt[~"%.5t", 3u], ~"00011"); - test(#fmt[~"%.5c", 'A'], ~"A"); + test(#fmt["%.5d", 0], "00000"); + test(#fmt["%.5u", 0u], "00000"); + test(#fmt["%.5x", 0u], "00000"); + test(#fmt["%.5t", 0u], "00000"); + test(#fmt["%.5d", 10], "00010"); + test(#fmt["%.5d", -10], "-00010"); + test(#fmt["%.5u", 10u], "00010"); + test(#fmt["%.5s", "test"], "test"); + test(#fmt["%.5x", 127u], "0007f"); + test(#fmt["%.5o", 10u], "00012"); + test(#fmt["%.5t", 3u], "00011"); + test(#fmt["%.5c", 'A'], "A"); // Bool precision. I'm not sure if it's good or bad to have bool // conversions support precision - it's not standard printf so we // can do whatever. For now I'm making it behave the same as string // conversions. - test(#fmt[~"%.b", true], ~""); - test(#fmt[~"%.0b", true], ~""); - test(#fmt[~"%.1b", true], ~"t"); + test(#fmt["%.b", true], ""); + test(#fmt["%.0b", true], ""); + test(#fmt["%.1b", true], "t"); } fn part5() { // Explicit + sign. Only for signed conversions - test(#fmt[~"%+d", 0], ~"+0"); - test(#fmt[~"%+d", 1], ~"+1"); - test(#fmt[~"%+d", -1], ~"-1"); + test(#fmt["%+d", 0], "+0"); + test(#fmt["%+d", 1], "+1"); + test(#fmt["%+d", -1], "-1"); // Leave space for sign - test(#fmt[~"% d", 0], ~" 0"); - test(#fmt[~"% d", 1], ~" 1"); - test(#fmt[~"% d", -1], ~"-1"); + test(#fmt["% d", 0], " 0"); + test(#fmt["% d", 1], " 1"); + test(#fmt["% d", -1], "-1"); // Plus overrides space - test(#fmt[~"% +d", 0], ~"+0"); - test(#fmt[~"%+ d", 0], ~"+0"); + test(#fmt["% +d", 0], "+0"); + test(#fmt["%+ d", 0], "+0"); // 0-padding - test(#fmt[~"%05d", 0], ~"00000"); - test(#fmt[~"%05d", 1], ~"00001"); - test(#fmt[~"%05d", -1], ~"-0001"); - test(#fmt[~"%05u", 1u], ~"00001"); - test(#fmt[~"%05x", 127u], ~"0007f"); - test(#fmt[~"%05X", 127u], ~"0007F"); - test(#fmt[~"%05o", 10u], ~"00012"); - test(#fmt[~"%05t", 3u], ~"00011"); + test(#fmt["%05d", 0], "00000"); + test(#fmt["%05d", 1], "00001"); + test(#fmt["%05d", -1], "-0001"); + test(#fmt["%05u", 1u], "00001"); + test(#fmt["%05x", 127u], "0007f"); + test(#fmt["%05X", 127u], "0007F"); + test(#fmt["%05o", 10u], "00012"); + test(#fmt["%05t", 3u], "00011"); // 0-padding a string is undefined but glibc does this: - test(#fmt[~"%05s", ~"test"], ~" test"); - test(#fmt[~"%05c", 'A'], ~" A"); - test(#fmt[~"%05b", true], ~" true"); + test(#fmt["%05s", "test"], " test"); + test(#fmt["%05c", 'A'], " A"); + test(#fmt["%05b", true], " true"); // Left-justify overrides 0-padding - test(#fmt[~"%-05d", 0], ~"0 "); - test(#fmt[~"%-05d", 1], ~"1 "); - test(#fmt[~"%-05d", -1], ~"-1 "); - test(#fmt[~"%-05u", 1u], ~"1 "); - test(#fmt[~"%-05x", 127u], ~"7f "); - test(#fmt[~"%-05X", 127u], ~"7F "); - test(#fmt[~"%-05o", 10u], ~"12 "); - test(#fmt[~"%-05t", 3u], ~"11 "); - test(#fmt[~"%-05s", ~"test"], ~"test "); - test(#fmt[~"%-05c", 'A'], ~"A "); - test(#fmt[~"%-05b", true], ~"true "); + test(#fmt["%-05d", 0], "0 "); + test(#fmt["%-05d", 1], "1 "); + test(#fmt["%-05d", -1], "-1 "); + test(#fmt["%-05u", 1u], "1 "); + test(#fmt["%-05x", 127u], "7f "); + test(#fmt["%-05X", 127u], "7F "); + test(#fmt["%-05o", 10u], "12 "); + test(#fmt["%-05t", 3u], "11 "); + test(#fmt["%-05s", "test"], "test "); + test(#fmt["%-05c", 'A'], "A "); + test(#fmt["%-05b", true], "true "); } fn part6() { // Precision overrides 0-padding - test(#fmt[~"%06.5d", 0], ~" 00000"); - test(#fmt[~"%06.5u", 0u], ~" 00000"); - test(#fmt[~"%06.5x", 0u], ~" 00000"); - test(#fmt[~"%06.5d", 10], ~" 00010"); - test(#fmt[~"%06.5d", -10], ~"-00010"); - test(#fmt[~"%06.5u", 10u], ~" 00010"); - test(#fmt[~"%06.5s", ~"test"], ~" test"); - test(#fmt[~"%06.5c", 'A'], ~" A"); - test(#fmt[~"%06.5x", 127u], ~" 0007f"); - test(#fmt[~"%06.5X", 127u], ~" 0007F"); - test(#fmt[~"%06.5o", 10u], ~" 00012"); + test(#fmt["%06.5d", 0], " 00000"); + test(#fmt["%06.5u", 0u], " 00000"); + test(#fmt["%06.5x", 0u], " 00000"); + test(#fmt["%06.5d", 10], " 00010"); + test(#fmt["%06.5d", -10], "-00010"); + test(#fmt["%06.5u", 10u], " 00010"); + test(#fmt["%06.5s", "test"], " test"); + test(#fmt["%06.5c", 'A'], " A"); + test(#fmt["%06.5x", 127u], " 0007f"); + test(#fmt["%06.5X", 127u], " 0007F"); + test(#fmt["%06.5o", 10u], " 00012"); // Signed combinations - test(#fmt[~"% 5d", 1], ~" 1"); - test(#fmt[~"% 5d", -1], ~" -1"); - test(#fmt[~"%+5d", 1], ~" +1"); - test(#fmt[~"%+5d", -1], ~" -1"); - test(#fmt[~"% 05d", 1], ~" 0001"); - test(#fmt[~"% 05d", -1], ~"-0001"); - test(#fmt[~"%+05d", 1], ~"+0001"); - test(#fmt[~"%+05d", -1], ~"-0001"); - test(#fmt[~"%- 5d", 1], ~" 1 "); - test(#fmt[~"%- 5d", -1], ~"-1 "); - test(#fmt[~"%-+5d", 1], ~"+1 "); - test(#fmt[~"%-+5d", -1], ~"-1 "); - test(#fmt[~"%- 05d", 1], ~" 1 "); - test(#fmt[~"%- 05d", -1], ~"-1 "); - test(#fmt[~"%-+05d", 1], ~"+1 "); - test(#fmt[~"%-+05d", -1], ~"-1 "); + test(#fmt["% 5d", 1], " 1"); + test(#fmt["% 5d", -1], " -1"); + test(#fmt["%+5d", 1], " +1"); + test(#fmt["%+5d", -1], " -1"); + test(#fmt["% 05d", 1], " 0001"); + test(#fmt["% 05d", -1], "-0001"); + test(#fmt["%+05d", 1], "+0001"); + test(#fmt["%+05d", -1], "-0001"); + test(#fmt["%- 5d", 1], " 1 "); + test(#fmt["%- 5d", -1], "-1 "); + test(#fmt["%-+5d", 1], "+1 "); + test(#fmt["%-+5d", -1], "-1 "); + test(#fmt["%- 05d", 1], " 1 "); + test(#fmt["%- 05d", -1], "-1 "); + test(#fmt["%-+05d", 1], "+1 "); + test(#fmt["%-+05d", -1], "-1 "); } diff --git a/src/test/run-pass/tag-in-block.rs b/src/test/run-pass/tag-in-block.rs index c84bfeacee5..d76ee9ed12a 100644 --- a/src/test/run-pass/tag-in-block.rs +++ b/src/test/run-pass/tag-in-block.rs @@ -6,4 +6,4 @@ fn foo() { fn baz() { zed(nil); } } -fn main(args: [istr]) { } +fn main(args: [str]) { } diff --git a/src/test/run-pass/tag.rs b/src/test/run-pass/tag.rs index 12ac2614efe..d0022341f8d 100644 --- a/src/test/run-pass/tag.rs +++ b/src/test/run-pass/tag.rs @@ -4,10 +4,6 @@ // -*- rust -*- tag colour { red(int, int); green; } -fn f() { - let x = red(1, 2); - let y = green; - assert (x != y); -} +fn f() { let x = red(1, 2); let y = green; assert (x != y); } fn main() { f(); } diff --git a/src/test/run-pass/task-life-0.rs b/src/test/run-pass/task-life-0.rs index b8c78ecd12b..d272410be80 100644 --- a/src/test/run-pass/task-life-0.rs +++ b/src/test/run-pass/task-life-0.rs @@ -1,6 +1,6 @@ use std; import std::task; -fn main() { task::spawn(bind child(~"Hello")); } +fn main() { task::spawn(bind child("Hello")); } fn child(s: -str) { diff --git a/src/test/run-pass/terminate-in-initializer.rs b/src/test/run-pass/terminate-in-initializer.rs index 4e6bda36845..8e032197085 100644 --- a/src/test/run-pass/terminate-in-initializer.rs +++ b/src/test/run-pass/terminate-in-initializer.rs @@ -3,41 +3,21 @@ use std; -fn test_break() { - while true { - let x: @int = break; - } -} +fn test_break() { while true { let x: @int = break; } } -fn test_cont() { - let i = 0; - while i < 1 { - i += 1; - let x: @int = cont; - } -} +fn test_cont() { let i = 0; while i < 1 { i += 1; let x: @int = cont; } } -fn test_ret() { - let x: @int = ret; -} +fn test_ret() { let x: @int = ret; } fn test_fail() { - fn f() { - std::task::unsupervise(); - let x: @int = fail; - } + fn f() { std::task::unsupervise(); let x: @int = fail; } let g = f; std::task::spawn(g); } fn test_fail_indirect() { - fn f() -> ! { - fail; - } - fn g() { - std::task::unsupervise(); - let x: @int = f(); - } + fn f() -> ! { fail; } + fn g() { std::task::unsupervise(); let x: @int = f(); } let h = g; std::task::spawn(h); } @@ -48,4 +28,4 @@ fn main() { test_ret(); test_fail(); test_fail_indirect(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/type-param.rs b/src/test/run-pass/type-param.rs index 1ad437ed67f..be55ba86cac 100644 --- a/src/test/run-pass/type-param.rs +++ b/src/test/run-pass/type-param.rs @@ -2,4 +2,4 @@ type lteq<T> = fn(&T) -> bool; -fn main(args: [istr]) { } +fn main(args: [str]) { } diff --git a/src/test/run-pass/type-ptr.rs b/src/test/run-pass/type-ptr.rs index 000fb1a1558..e608a9f9836 100644 --- a/src/test/run-pass/type-ptr.rs +++ b/src/test/run-pass/type-ptr.rs @@ -2,4 +2,4 @@ fn f(a: *int) -> *int { ret a; } fn g(a: *int) -> *int { let b = f(a); ret b; } -fn main(args: [istr]) { ret; } +fn main(args: [str]) { ret; } diff --git a/src/test/run-pass/unchecked-predicates.rs b/src/test/run-pass/unchecked-predicates.rs index 56b7dcc7837..d456f1f2e90 100644 --- a/src/test/run-pass/unchecked-predicates.rs +++ b/src/test/run-pass/unchecked-predicates.rs @@ -6,35 +6,28 @@ import std::list::*; // Can't easily be written as a "pure fn" because there's // no syntax for specifying that f is pure. fn pure_foldl<@T, @U>(ls: &list<T>, u: &U, f: &block(&T, &U) -> U) -> U { - alt ls { - nil. { u } - cons(hd, tl) { f(hd, pure_foldl(*tl, f(hd, u), f)) } - } + alt ls { nil. { u } cons(hd, tl) { f(hd, pure_foldl(*tl, f(hd, u), f)) } } } // Shows how to use an "unchecked" block to call a general // fn from a pure fn pure fn pure_length<@T>(ls: &list<T>) -> uint { fn count<T>(_t: &T, u: &uint) -> uint { u + 1u } - unchecked { - pure_foldl(ls, 0u, count) - } + unchecked{ pure_foldl(ls, 0u, count) } } -pure fn nonempty_list<@T>(ls: &list<T>) -> bool { - pure_length(ls) > 0u -} +pure fn nonempty_list<@T>(ls: &list<T>) -> bool { pure_length(ls) > 0u } - // Of course, the compiler can't take advantage of the - // knowledge that ls is a cons node. Future work. - // Also, this is pretty contrived since nonempty_list - // could be a "tag refinement", if we implement those. +// Of course, the compiler can't take advantage of the +// knowledge that ls is a cons node. Future work. +// Also, this is pretty contrived since nonempty_list +// could be a "tag refinement", if we implement those. fn safe_head<@T>(ls: &list<T>) : nonempty_list(ls) -> T { car(ls) } fn main() { let mylist = cons(@1u, @nil); // Again, a way to eliminate such "obvious" checks seems // desirable. (Tags could have postconditions.) - check(nonempty_list(mylist)); - assert (*(safe_head(mylist)) == 1u); -} \ No newline at end of file + check (nonempty_list(mylist)); + assert (*safe_head(mylist) == 1u); +} diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs index 4b292d1ba86..e7f7f9a1524 100644 --- a/src/test/run-pass/utf8_chars.rs +++ b/src/test/run-pass/utf8_chars.rs @@ -5,7 +5,7 @@ import std::vec; fn main() { // Chars of 1, 2, 3, and 4 bytes let chs: [char] = ['e', 'é', '€', 0x10000 as char]; - let s: istr = str::from_chars(chs); + let s: str = str::from_chars(chs); assert (str::byte_len(s) == 10u); assert (str::char_len(s) == 4u); @@ -19,13 +19,13 @@ fn main() { assert (!str::is_utf8([0xc0_u8])); assert (!str::is_utf8([0xc0_u8, 0x10_u8])); - let stack = ~"a×c€"; + let stack = "a×c€"; assert (str::pop_char(stack) == '€'); assert (str::pop_char(stack) == 'c'); str::push_char(stack, 'u'); - assert (str::eq(stack, ~"a×u")); + assert (str::eq(stack, "a×u")); assert (str::shift_char(stack) == 'a'); assert (str::shift_char(stack) == '×'); str::unshift_char(stack, 'ß'); - assert (str::eq(stack, ~"ßu")); + assert (str::eq(stack, "ßu")); } diff --git a/src/test/run-pass/vec-self-append.rs b/src/test/run-pass/vec-self-append.rs index 47e9f27686b..8e023cf03da 100644 --- a/src/test/run-pass/vec-self-append.rs +++ b/src/test/run-pass/vec-self-append.rs @@ -5,17 +5,17 @@ fn test_heap_to_heap() { // a spills onto the heap let a = [0, 1, 2, 3, 4]; a += a; - assert vec::len(a) == 10u; - assert a[0] == 0; - assert a[1] == 1; - assert a[2] == 2; - assert a[3] == 3; - assert a[4] == 4; - assert a[5] == 0; - assert a[6] == 1; - assert a[7] == 2; - assert a[8] == 3; - assert a[9] == 4; + assert (vec::len(a) == 10u); + assert (a[0] == 0); + assert (a[1] == 1); + assert (a[2] == 2); + assert (a[3] == 3); + assert (a[4] == 4); + assert (a[5] == 0); + assert (a[6] == 1); + assert (a[7] == 2); + assert (a[8] == 3); + assert (a[9] == 4); } fn test_stack_to_heap() { @@ -23,13 +23,13 @@ fn test_stack_to_heap() { let a = [0, 1, 2]; // a spills to the heap a += a; - assert vec::len(a) == 6u; - assert a[0] == 0; - assert a[1] == 1; - assert a[2] == 2; - assert a[3] == 0; - assert a[4] == 1; - assert a[5] == 2; + assert (vec::len(a) == 6u); + assert (a[0] == 0); + assert (a[1] == 1); + assert (a[2] == 2); + assert (a[3] == 0); + assert (a[4] == 1); + assert (a[5] == 2); } fn test_loop() { @@ -46,8 +46,4 @@ fn test_loop() { } } -fn main() { - test_heap_to_heap(); - test_stack_to_heap(); - test_loop(); -} +fn main() { test_heap_to_heap(); test_stack_to_heap(); test_loop(); } diff --git a/src/test/run-pass/while-cont.rs b/src/test/run-pass/while-cont.rs index 78c4163c3bd..6a2e9acfda3 100644 --- a/src/test/run-pass/while-cont.rs +++ b/src/test/run-pass/while-cont.rs @@ -1,10 +1,2 @@ // Issue #825: Should recheck the loop contition after continuing -fn main() { - let i = 1; - while i > 0 { - assert i > 0; - log i; - i -= 1; - cont; - } -} \ No newline at end of file +fn main() { let i = 1; while i > 0 { assert (i > 0); log i; i -= 1; cont; } } diff --git a/src/test/run-pass/zip-same-length.rs b/src/test/run-pass/zip-same-length.rs index 5427f548d35..b2ccf093883 100644 --- a/src/test/run-pass/zip-same-length.rs +++ b/src/test/run-pass/zip-same-length.rs @@ -9,15 +9,15 @@ import std::vec::*; fn main() { let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 10u; // Silly, but necessary - check u8::le(a, j); - check uint::le(k, l); + check (u8::le(a, j)); + check (uint::le(k, l)); let chars = enum_chars(a, j); - let ints = enum_uints(k, l); + let ints = enum_uints(k, l); - check same_length(chars, ints); + check (same_length(chars, ints)); let ps = zip(chars, ints); - check is_not_empty(ps); + check (is_not_empty(ps)); assert (head(ps) == ('a', 1u)); assert (last_total(ps) == (j as char, 10u)); } diff --git a/src/test/stdtest/comm.rs b/src/test/stdtest/comm.rs index 1fafd1a0375..9c31c5e6f72 100644 --- a/src/test/stdtest/comm.rs +++ b/src/test/stdtest/comm.rs @@ -2,10 +2,7 @@ use std; import std::comm; #[test] -fn create_port_and_chan() { - let p = comm::port::<int>(); - comm::chan(p); -} +fn create_port_and_chan() { let p = comm::port::<int>(); comm::chan(p); } #[test] fn send_recv_fn() { diff --git a/src/test/stdtest/fs.rs b/src/test/stdtest/fs.rs index f2e49232800..36e8ae23c5d 100644 --- a/src/test/stdtest/fs.rs +++ b/src/test/stdtest/fs.rs @@ -5,28 +5,26 @@ import std::fs; #[test] fn test_connect() { let slash = fs::path_sep(); - log_err fs::connect(~"a", ~"b"); - assert (fs::connect(~"a", ~"b") == ~"a" + slash + ~"b"); - assert (fs::connect(~"a" + slash, ~"b") == ~"a" + slash + ~"b"); + log_err fs::connect("a", "b"); + assert (fs::connect("a", "b") == "a" + slash + "b"); + assert (fs::connect("a" + slash, "b") == "a" + slash + "b"); } // Issue #712 #[test] -fn test_list_dir_no_invalid_memory_access() { fs::list_dir(~"."); } +fn test_list_dir_no_invalid_memory_access() { fs::list_dir("."); } #[test] fn list_dir() { - let dirs = fs::list_dir(~"."); + let dirs = fs::list_dir("."); // Just assuming that we've got some contents in the current directory - assert std::vec::len(dirs) > 0u; + assert (std::vec::len(dirs) > 0u); - for dir in dirs { - log dir; - } + for dir in dirs { log dir; } } #[test] fn file_is_dir() { - assert fs::file_is_dir(~"."); - assert !fs::file_is_dir(~"test/stdtest/fs.rs"); -} \ No newline at end of file + assert (fs::file_is_dir(".")); + assert (!fs::file_is_dir("test/stdtest/fs.rs")); +} diff --git a/src/test/stdtest/getopts.rs b/src/test/stdtest/getopts.rs index 332ec484c95..55d67729129 100644 --- a/src/test/stdtest/getopts.rs +++ b/src/test/stdtest/getopts.rs @@ -27,13 +27,13 @@ fn check_fail_type(f: opt::fail_, ft: fail_type) { // Tests for reqopt #[test] fn test_reqopt_long() { - let args = [~"--test=20"]; - let opts = [opt::reqopt(~"test")]; + let args = ["--test=20"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"test")); - assert (opt::opt_str(m, ~"test") == ~"20"); + assert (opt::opt_present(m, "test")); + assert (opt::opt_str(m, "test") == "20"); } _ { fail; } } @@ -41,8 +41,8 @@ fn test_reqopt_long() { #[test] fn test_reqopt_long_missing() { - let args = [~"blah"]; - let opts = [opt::reqopt(~"test")]; + let args = ["blah"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_missing); } @@ -52,8 +52,8 @@ fn test_reqopt_long_missing() { #[test] fn test_reqopt_long_no_arg() { - let args = [~"--test"]; - let opts = [opt::reqopt(~"test")]; + let args = ["--test"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -63,8 +63,8 @@ fn test_reqopt_long_no_arg() { #[test] fn test_reqopt_long_multi() { - let args = [~"--test=20", ~"--test=30"]; - let opts = [opt::reqopt(~"test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -74,13 +74,13 @@ fn test_reqopt_long_multi() { #[test] fn test_reqopt_short() { - let args = [~"-t", ~"20"]; - let opts = [opt::reqopt(~"t")]; + let args = ["-t", "20"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"t")); - assert (opt::opt_str(m, ~"t") == ~"20"); + assert (opt::opt_present(m, "t")); + assert (opt::opt_str(m, "t") == "20"); } _ { fail; } } @@ -88,8 +88,8 @@ fn test_reqopt_short() { #[test] fn test_reqopt_short_missing() { - let args = [~"blah"]; - let opts = [opt::reqopt(~"t")]; + let args = ["blah"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_missing); } @@ -99,8 +99,8 @@ fn test_reqopt_short_missing() { #[test] fn test_reqopt_short_no_arg() { - let args = [~"-t"]; - let opts = [opt::reqopt(~"t")]; + let args = ["-t"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -110,8 +110,8 @@ fn test_reqopt_short_no_arg() { #[test] fn test_reqopt_short_multi() { - let args = [~"-t", ~"20", ~"-t", ~"30"]; - let opts = [opt::reqopt(~"t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -123,13 +123,13 @@ fn test_reqopt_short_multi() { // Tests for optopt #[test] fn test_optopt_long() { - let args = [~"--test=20"]; - let opts = [opt::optopt(~"test")]; + let args = ["--test=20"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"test")); - assert (opt::opt_str(m, ~"test") == ~"20"); + assert (opt::opt_present(m, "test")); + assert (opt::opt_str(m, "test") == "20"); } _ { fail; } } @@ -137,19 +137,19 @@ fn test_optopt_long() { #[test] fn test_optopt_long_missing() { - let args = [~"blah"]; - let opts = [opt::optopt(~"test")]; + let args = ["blah"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"test")); } + opt::success(m) { assert (!opt::opt_present(m, "test")); } _ { fail; } } } #[test] fn test_optopt_long_no_arg() { - let args = [~"--test"]; - let opts = [opt::optopt(~"test")]; + let args = ["--test"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -159,8 +159,8 @@ fn test_optopt_long_no_arg() { #[test] fn test_optopt_long_multi() { - let args = [~"--test=20", ~"--test=30"]; - let opts = [opt::optopt(~"test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -170,13 +170,13 @@ fn test_optopt_long_multi() { #[test] fn test_optopt_short() { - let args = [~"-t", ~"20"]; - let opts = [opt::optopt(~"t")]; + let args = ["-t", "20"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"t")); - assert (opt::opt_str(m, ~"t") == ~"20"); + assert (opt::opt_present(m, "t")); + assert (opt::opt_str(m, "t") == "20"); } _ { fail; } } @@ -184,19 +184,19 @@ fn test_optopt_short() { #[test] fn test_optopt_short_missing() { - let args = [~"blah"]; - let opts = [opt::optopt(~"t")]; + let args = ["blah"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"t")); } + opt::success(m) { assert (!opt::opt_present(m, "t")); } _ { fail; } } } #[test] fn test_optopt_short_no_arg() { - let args = [~"-t"]; - let opts = [opt::optopt(~"t")]; + let args = ["-t"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -206,8 +206,8 @@ fn test_optopt_short_no_arg() { #[test] fn test_optopt_short_multi() { - let args = [~"-t", ~"20", ~"-t", ~"30"]; - let opts = [opt::optopt(~"t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -219,30 +219,30 @@ fn test_optopt_short_multi() { // Tests for optflag #[test] fn test_optflag_long() { - let args = [~"--test"]; - let opts = [opt::optflag(~"test")]; + let args = ["--test"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (opt::opt_present(m, ~"test")); } + opt::success(m) { assert (opt::opt_present(m, "test")); } _ { fail; } } } #[test] fn test_optflag_long_missing() { - let args = [~"blah"]; - let opts = [opt::optflag(~"test")]; + let args = ["blah"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"test")); } + opt::success(m) { assert (!opt::opt_present(m, "test")); } _ { fail; } } } #[test] fn test_optflag_long_arg() { - let args = [~"--test=20"]; - let opts = [opt::optflag(~"test")]; + let args = ["--test=20"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { @@ -255,8 +255,8 @@ fn test_optflag_long_arg() { #[test] fn test_optflag_long_multi() { - let args = [~"--test", ~"--test"]; - let opts = [opt::optflag(~"test")]; + let args = ["--test", "--test"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -266,36 +266,36 @@ fn test_optflag_long_multi() { #[test] fn test_optflag_short() { - let args = [~"-t"]; - let opts = [opt::optflag(~"t")]; + let args = ["-t"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (opt::opt_present(m, ~"t")); } + opt::success(m) { assert (opt::opt_present(m, "t")); } _ { fail; } } } #[test] fn test_optflag_short_missing() { - let args = [~"blah"]; - let opts = [opt::optflag(~"t")]; + let args = ["blah"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"t")); } + opt::success(m) { assert (!opt::opt_present(m, "t")); } _ { fail; } } } #[test] fn test_optflag_short_arg() { - let args = [~"-t", ~"20"]; - let opts = [opt::optflag(~"t")]; + let args = ["-t", "20"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { // The next variable after the flag is just a free argument - assert (m.free[0] == ~"20"); + assert (m.free[0] == "20"); } _ { fail; } } @@ -303,8 +303,8 @@ fn test_optflag_short_arg() { #[test] fn test_optflag_short_multi() { - let args = [~"-t", ~"-t"]; - let opts = [opt::optflag(~"t")]; + let args = ["-t", "-t"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -316,13 +316,13 @@ fn test_optflag_short_multi() { // Tests for optmulti #[test] fn test_optmulti_long() { - let args = [~"--test=20"]; - let opts = [opt::optmulti(~"test")]; + let args = ["--test=20"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"test")); - assert (opt::opt_str(m, ~"test") == ~"20"); + assert (opt::opt_present(m, "test")); + assert (opt::opt_str(m, "test") == "20"); } _ { fail; } } @@ -330,19 +330,19 @@ fn test_optmulti_long() { #[test] fn test_optmulti_long_missing() { - let args = [~"blah"]; - let opts = [opt::optmulti(~"test")]; + let args = ["blah"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"test")); } + opt::success(m) { assert (!opt::opt_present(m, "test")); } _ { fail; } } } #[test] fn test_optmulti_long_no_arg() { - let args = [~"--test"]; - let opts = [opt::optmulti(~"test")]; + let args = ["--test"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -352,15 +352,15 @@ fn test_optmulti_long_no_arg() { #[test] fn test_optmulti_long_multi() { - let args = [~"--test=20", ~"--test=30"]; - let opts = [opt::optmulti(~"test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"test")); - assert (opt::opt_str(m, ~"test") == ~"20"); - assert (opt::opt_strs(m, ~"test")[0] == ~"20"); - assert (opt::opt_strs(m, ~"test")[1] == ~"30"); + assert (opt::opt_present(m, "test")); + assert (opt::opt_str(m, "test") == "20"); + assert (opt::opt_strs(m, "test")[0] == "20"); + assert (opt::opt_strs(m, "test")[1] == "30"); } _ { fail; } } @@ -368,13 +368,13 @@ fn test_optmulti_long_multi() { #[test] fn test_optmulti_short() { - let args = [~"-t", ~"20"]; - let opts = [opt::optmulti(~"t")]; + let args = ["-t", "20"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"t")); - assert (opt::opt_str(m, ~"t") == ~"20"); + assert (opt::opt_present(m, "t")); + assert (opt::opt_str(m, "t") == "20"); } _ { fail; } } @@ -382,19 +382,19 @@ fn test_optmulti_short() { #[test] fn test_optmulti_short_missing() { - let args = [~"blah"]; - let opts = [opt::optmulti(~"t")]; + let args = ["blah"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { - opt::success(m) { assert (!opt::opt_present(m, ~"t")); } + opt::success(m) { assert (!opt::opt_present(m, "t")); } _ { fail; } } } #[test] fn test_optmulti_short_no_arg() { - let args = [~"-t"]; - let opts = [opt::optmulti(~"t")]; + let args = ["-t"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -404,15 +404,15 @@ fn test_optmulti_short_no_arg() { #[test] fn test_optmulti_short_multi() { - let args = [~"-t", ~"20", ~"-t", ~"30"]; - let opts = [opt::optmulti(~"t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (opt::opt_present(m, ~"t")); - assert (opt::opt_str(m, ~"t") == ~"20"); - assert (opt::opt_strs(m, ~"t")[0] == ~"20"); - assert (opt::opt_strs(m, ~"t")[1] == ~"30"); + assert (opt::opt_present(m, "t")); + assert (opt::opt_str(m, "t") == "20"); + assert (opt::opt_strs(m, "t")[0] == "20"); + assert (opt::opt_strs(m, "t")[1] == "30"); } _ { fail; } } @@ -420,8 +420,8 @@ fn test_optmulti_short_multi() { #[test] fn test_unrecognized_option_long() { - let args = [~"--untest"]; - let opts = [opt::optmulti(~"t")]; + let args = ["--untest"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, unrecognized_option); } @@ -431,8 +431,8 @@ fn test_unrecognized_option_long() { #[test] fn test_unrecognized_option_short() { - let args = [~"-t"]; - let opts = [opt::optmulti(~"test")]; + let args = ["-t"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, unrecognized_option); } @@ -443,25 +443,24 @@ fn test_unrecognized_option_short() { #[test] fn test_combined() { let args = - [~"prog", ~"free1", ~"-s", ~"20", ~"free2", ~"--flag", - ~"--long=30", ~"-f", ~"-m", ~"40", ~"-m", ~"50"]; + ["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f", + "-m", "40", "-m", "50"]; let opts = - [opt::optopt(~"s"), opt::optflag(~"flag"), opt::reqopt(~"long"), - opt::optflag(~"f"), opt::optmulti(~"m"), - opt::optopt(~"notpresent")]; + [opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"), + opt::optflag("f"), opt::optmulti("m"), opt::optopt("notpresent")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (m.free[0] == ~"prog"); - assert (m.free[1] == ~"free1"); - assert (opt::opt_str(m, ~"s") == ~"20"); - assert (m.free[2] == ~"free2"); - assert (opt::opt_present(m, ~"flag")); - assert (opt::opt_str(m, ~"long") == ~"30"); - assert (opt::opt_present(m, ~"f")); - assert (opt::opt_strs(m, ~"m")[0] == ~"40"); - assert (opt::opt_strs(m, ~"m")[1] == ~"50"); - assert (!opt::opt_present(m, ~"notpresent")); + assert (m.free[0] == "prog"); + assert (m.free[1] == "free1"); + assert (opt::opt_str(m, "s") == "20"); + assert (m.free[2] == "free2"); + assert (opt::opt_present(m, "flag")); + assert (opt::opt_str(m, "long") == "30"); + assert (opt::opt_present(m, "f")); + assert (opt::opt_strs(m, "m")[0] == "40"); + assert (opt::opt_strs(m, "m")[1] == "50"); + assert (!opt::opt_present(m, "notpresent")); } _ { fail; } } diff --git a/src/test/stdtest/int.rs b/src/test/stdtest/int.rs index bc13e248d0b..61d3448a175 100644 --- a/src/test/stdtest/int.rs +++ b/src/test/stdtest/int.rs @@ -5,11 +5,11 @@ import std::str::eq; #[test] fn test_to_str() { - assert (eq(int::to_str(0, 10u), ~"0")); - assert (eq(int::to_str(1, 10u), ~"1")); - assert (eq(int::to_str(-1, 10u), ~"-1")); - assert (eq(int::to_str(255, 16u), ~"ff")); - assert (eq(int::to_str(100, 10u), ~"100")); + assert (eq(int::to_str(0, 10u), "0")); + assert (eq(int::to_str(1, 10u), "1")); + assert (eq(int::to_str(-1, 10u), "-1")); + assert (eq(int::to_str(255, 16u), "ff")); + assert (eq(int::to_str(100, 10u), "100")); } #[test] diff --git a/src/test/stdtest/io.rs b/src/test/stdtest/io.rs index a66b3bab464..08330c619fc 100644 --- a/src/test/stdtest/io.rs +++ b/src/test/stdtest/io.rs @@ -7,9 +7,9 @@ import std::str; #[cfg(target_os = "win32")] #[test] fn test_simple() { - let tmpfile: istr = ~"test/run-pass/lib-io-test-simple.tmp"; + let tmpfile: str = "test/run-pass/lib-io-test-simple.tmp"; log tmpfile; - let frood: istr = ~"A hoopy frood who really knows where his towel is."; + let frood: str = "A hoopy frood who really knows where his towel is."; log frood; { let out: io::writer = @@ -17,7 +17,7 @@ fn test_simple() { out.write_str(frood); } let inp: io::reader = io::file_reader(tmpfile); - let frood2: istr = inp.read_c_str(); + let frood2: str = inp.read_c_str(); log frood2; assert (str::eq(frood, frood2)); } diff --git a/src/test/stdtest/map.rs b/src/test/stdtest/map.rs index 585bae03cc9..67240a7c69b 100644 --- a/src/test/stdtest/map.rs +++ b/src/test/stdtest/map.rs @@ -14,8 +14,8 @@ fn test_simple() { fn eq_uint(x: &uint, y: &uint) -> bool { ret x == y; } let hasher_uint: map::hashfn<uint> = util::id; let eqer_uint: map::eqfn<uint> = eq_uint; - let hasher_str: map::hashfn<istr> = str::hash; - let eqer_str: map::eqfn<istr> = str::eq; + let hasher_str: map::hashfn<str> = str::hash; + let eqer_str: map::eqfn<str> = str::eq; log "uint -> uint"; let hm_uu: map::hashmap<uint, uint> = map::mk_hashmap::<uint, uint>(hasher_uint, eqer_uint); @@ -29,49 +29,49 @@ fn test_simple() { assert (hm_uu.get(12u) == 14u); assert (!hm_uu.insert(12u, 12u)); assert (hm_uu.get(12u) == 12u); - let ten: istr = ~"ten"; - let eleven: istr = ~"eleven"; - let twelve: istr = ~"twelve"; + let ten: str = "ten"; + let eleven: str = "eleven"; + let twelve: str = "twelve"; log "str -> uint"; - let hm_su: map::hashmap<istr, uint> = - map::mk_hashmap::<istr, uint>(hasher_str, eqer_str); - assert (hm_su.insert(~"ten", 12u)); + let hm_su: map::hashmap<str, uint> = + map::mk_hashmap::<str, uint>(hasher_str, eqer_str); + assert (hm_su.insert("ten", 12u)); assert (hm_su.insert(eleven, 13u)); - assert (hm_su.insert(~"twelve", 14u)); + assert (hm_su.insert("twelve", 14u)); assert (hm_su.get(eleven) == 13u); - assert (hm_su.get(~"eleven") == 13u); - assert (hm_su.get(~"twelve") == 14u); - assert (hm_su.get(~"ten") == 12u); - assert (!hm_su.insert(~"twelve", 14u)); - assert (hm_su.get(~"twelve") == 14u); - assert (!hm_su.insert(~"twelve", 12u)); - assert (hm_su.get(~"twelve") == 12u); + assert (hm_su.get("eleven") == 13u); + assert (hm_su.get("twelve") == 14u); + assert (hm_su.get("ten") == 12u); + assert (!hm_su.insert("twelve", 14u)); + assert (hm_su.get("twelve") == 14u); + assert (!hm_su.insert("twelve", 12u)); + assert (hm_su.get("twelve") == 12u); log "uint -> str"; - let hm_us: map::hashmap<uint, istr> = - map::mk_hashmap::<uint, istr>(hasher_uint, eqer_uint); - assert (hm_us.insert(10u, ~"twelve")); - assert (hm_us.insert(11u, ~"thirteen")); - assert (hm_us.insert(12u, ~"fourteen")); - assert (str::eq(hm_us.get(11u), ~"thirteen")); - assert (str::eq(hm_us.get(12u), ~"fourteen")); - assert (str::eq(hm_us.get(10u), ~"twelve")); - assert (!hm_us.insert(12u, ~"fourteen")); - assert (str::eq(hm_us.get(12u), ~"fourteen")); - assert (!hm_us.insert(12u, ~"twelve")); - assert (str::eq(hm_us.get(12u), ~"twelve")); + let hm_us: map::hashmap<uint, str> = + map::mk_hashmap::<uint, str>(hasher_uint, eqer_uint); + assert (hm_us.insert(10u, "twelve")); + assert (hm_us.insert(11u, "thirteen")); + assert (hm_us.insert(12u, "fourteen")); + assert (str::eq(hm_us.get(11u), "thirteen")); + assert (str::eq(hm_us.get(12u), "fourteen")); + assert (str::eq(hm_us.get(10u), "twelve")); + assert (!hm_us.insert(12u, "fourteen")); + assert (str::eq(hm_us.get(12u), "fourteen")); + assert (!hm_us.insert(12u, "twelve")); + assert (str::eq(hm_us.get(12u), "twelve")); log "str -> str"; - let hm_ss: map::hashmap<istr, istr> = - map::mk_hashmap::<istr, istr>(hasher_str, eqer_str); - assert (hm_ss.insert(ten, ~"twelve")); - assert (hm_ss.insert(eleven, ~"thirteen")); - assert (hm_ss.insert(twelve, ~"fourteen")); - assert (str::eq(hm_ss.get(~"eleven"), ~"thirteen")); - assert (str::eq(hm_ss.get(~"twelve"), ~"fourteen")); - assert (str::eq(hm_ss.get(~"ten"), ~"twelve")); - assert (!hm_ss.insert(~"twelve", ~"fourteen")); - assert (str::eq(hm_ss.get(~"twelve"), ~"fourteen")); - assert (!hm_ss.insert(~"twelve", ~"twelve")); - assert (str::eq(hm_ss.get(~"twelve"), ~"twelve")); + let hm_ss: map::hashmap<str, str> = + map::mk_hashmap::<str, str>(hasher_str, eqer_str); + assert (hm_ss.insert(ten, "twelve")); + assert (hm_ss.insert(eleven, "thirteen")); + assert (hm_ss.insert(twelve, "fourteen")); + assert (str::eq(hm_ss.get("eleven"), "thirteen")); + assert (str::eq(hm_ss.get("twelve"), "fourteen")); + assert (str::eq(hm_ss.get("ten"), "twelve")); + assert (!hm_ss.insert("twelve", "fourteen")); + assert (str::eq(hm_ss.get("twelve"), "fourteen")); + assert (!hm_ss.insert("twelve", "twelve")); + assert (str::eq(hm_ss.get("twelve"), "twelve")); log "*** finished test_simple"; } @@ -92,14 +92,14 @@ fn test_growth() { let i: uint = 0u; while i < num_to_insert { assert (hm_uu.insert(i, i * i)); - log ~"inserting " + uint::to_str(i, 10u) + ~" -> " + + log "inserting " + uint::to_str(i, 10u) + " -> " + uint::to_str(i * i, 10u); i += 1u; } log "-----"; i = 0u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm_uu.get(i), 10u); assert (hm_uu.get(i) == i * i); i += 1u; @@ -110,44 +110,42 @@ fn test_growth() { hm_uu.rehash(); i = 0u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm_uu.get(i), 10u); assert (hm_uu.get(i) == i * i); i += 1u; } log "str -> str"; - let hasher_str: map::hashfn<istr> = str::hash; - let eqer_str: map::eqfn<istr> = str::eq; - let hm_ss: map::hashmap<istr, istr> = - map::mk_hashmap::<istr, istr>(hasher_str, eqer_str); + let hasher_str: map::hashfn<str> = str::hash; + let eqer_str: map::eqfn<str> = str::eq; + let hm_ss: map::hashmap<str, str> = + map::mk_hashmap::<str, str>(hasher_str, eqer_str); i = 0u; while i < num_to_insert { - assert (hm_ss.insert(uint::to_str(i, 2u), - uint::to_str(i * i, 2u))); - log ~"inserting \"" + uint::to_str(i, 2u) + ~"\" -> \"" + - uint::to_str(i * i, 2u) + ~"\""; + assert (hm_ss.insert(uint::to_str(i, 2u), uint::to_str(i * i, 2u))); + log "inserting \"" + uint::to_str(i, 2u) + "\" -> \"" + + uint::to_str(i * i, 2u) + "\""; i += 1u; } log "-----"; i = 0u; while i < num_to_insert { - log ~"get(\"" + uint::to_str(i, 2u) + ~"\") = \"" + - hm_ss.get(uint::to_str(i, 2u)) + ~"\""; + log "get(\"" + uint::to_str(i, 2u) + "\") = \"" + + hm_ss.get(uint::to_str(i, 2u)) + "\""; assert (str::eq(hm_ss.get(uint::to_str(i, 2u)), uint::to_str(i * i, 2u))); i += 1u; } assert (hm_ss.insert(uint::to_str(num_to_insert, 2u), uint::to_str(17u, 2u))); - assert (str::eq(hm_ss.get( - uint::to_str(num_to_insert, 2u)), + assert (str::eq(hm_ss.get(uint::to_str(num_to_insert, 2u)), uint::to_str(17u, 2u))); log "-----"; hm_ss.rehash(); i = 0u; while i < num_to_insert { - log ~"get(\"" + uint::to_str(i, 2u) + ~"\") = \"" + - hm_ss.get(uint::to_str(i, 2u)) + ~"\""; + log "get(\"" + uint::to_str(i, 2u) + "\") = \"" + + hm_ss.get(uint::to_str(i, 2u)) + "\""; assert (str::eq(hm_ss.get(uint::to_str(i, 2u)), uint::to_str(i * i, 2u))); i += 1u; @@ -176,7 +174,7 @@ fn test_removal() { let i: uint = 0u; while i < num_to_insert { assert (hm.insert(i, i * i)); - log ~"inserting " + uint::to_str(i, 10u) + ~" -> " + + log "inserting " + uint::to_str(i, 10u) + " -> " + uint::to_str(i * i, 10u); i += 1u; } @@ -186,10 +184,8 @@ fn test_removal() { i = 0u; while i < num_to_insert { let v = hm.remove(i); - alt (v) { - option::some(u) { - assert (u == (i * i)); - } + alt v { + option::some(u) { assert (u == i * i); } option::none. { fail; } } i += 2u; @@ -198,7 +194,7 @@ fn test_removal() { log "-----"; i = 1u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm.get(i), 10u); assert (hm.get(i) == i * i); i += 2u; @@ -209,7 +205,7 @@ fn test_removal() { log "-----"; i = 1u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm.get(i), 10u); assert (hm.get(i) == i * i); i += 2u; @@ -218,7 +214,7 @@ fn test_removal() { i = 0u; while i < num_to_insert { assert (hm.insert(i, i * i)); - log ~"inserting " + uint::to_str(i, 10u) + ~" -> " + + log "inserting " + uint::to_str(i, 10u) + " -> " + uint::to_str(i * i, 10u); i += 2u; } @@ -226,7 +222,7 @@ fn test_removal() { log "-----"; i = 0u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm.get(i), 10u); assert (hm.get(i) == i * i); i += 1u; @@ -238,7 +234,7 @@ fn test_removal() { assert (hm.size() == num_to_insert); i = 0u; while i < num_to_insert { - log ~"get(" + uint::to_str(i, 10u) + ~") = " + + log "get(" + uint::to_str(i, 10u) + ") = " + uint::to_str(hm.get(i), 10u); assert (hm.get(i) == i * i); i += 1u; @@ -248,18 +244,18 @@ fn test_removal() { #[test] fn test_contains_key() { - let key = ~"k"; - let map = map::mk_hashmap::<istr, istr>(str::hash, str::eq); + let key = "k"; + let map = map::mk_hashmap::<str, str>(str::hash, str::eq); assert (!map.contains_key(key)); - map.insert(key, ~"val"); + map.insert(key, "val"); assert (map.contains_key(key)); } #[test] fn test_find() { - let key = ~"k"; - let map = map::mk_hashmap::<istr, istr>(str::hash, str::eq); + let key = "k"; + let map = map::mk_hashmap::<str, str>(str::hash, str::eq); assert (std::option::is_none(map.find(key))); - map.insert(key, ~"val"); - assert (std::option::get(map.find(key)) == ~"val"); + map.insert(key, "val"); + assert (std::option::get(map.find(key)) == "val"); } diff --git a/src/test/stdtest/net.rs b/src/test/stdtest/net.rs index d2f185a4fde..9da7a12a060 100644 --- a/src/test/stdtest/net.rs +++ b/src/test/stdtest/net.rs @@ -3,12 +3,10 @@ import std::net; #[test] fn test_format_ip() { - assert (net::format_addr(net::ipv4( - 127u8, 0u8, 0u8, 1u8)) == ~"127.0.0.1") + assert (net::format_addr(net::ipv4(127u8, 0u8, 0u8, 1u8)) == "127.0.0.1") } #[test] fn test_parse_ip() { - assert (net::parse_addr(~"127.0.0.1") - == net::ipv4(127u8, 0u8, 0u8, 1u8)); + assert (net::parse_addr("127.0.0.1") == net::ipv4(127u8, 0u8, 0u8, 1u8)); } diff --git a/src/test/stdtest/os.rs b/src/test/stdtest/os.rs index fc508595329..49ebb217dbf 100644 --- a/src/test/stdtest/os.rs +++ b/src/test/stdtest/os.rs @@ -6,26 +6,26 @@ import std::option; fn test_setenv() { // NB: Each test of setenv needs to use different variable names or the // tests will not be threadsafe - setenv(~"NAME1", ~"VALUE"); - assert (getenv(~"NAME1") == option::some(~"VALUE")); + setenv("NAME1", "VALUE"); + assert (getenv("NAME1") == option::some("VALUE")); } #[test] fn test_setenv_overwrite() { - setenv(~"NAME2", ~"1"); - setenv(~"NAME2", ~"2"); - assert (getenv(~"NAME2") == option::some(~"2")); + setenv("NAME2", "1"); + setenv("NAME2", "2"); + assert (getenv("NAME2") == option::some("2")); } // Windows GetEnvironmentVariable requires some extra work to make sure // the buffer the variable is copied into is the right size #[test] fn test_getenv_big() { - let s = ~""; + let s = ""; let i = 0; - while i < 100 { s += ~"aaaaaaaaaa"; i += 1; } - setenv(~"NAME3", s); - assert (getenv(~"NAME3") == option::some(s)); + while i < 100 { s += "aaaaaaaaaa"; i += 1; } + setenv("NAME3", s); + assert (getenv("NAME3") == option::some(s)); } // Local Variables: diff --git a/src/test/stdtest/path.rs b/src/test/stdtest/path.rs index 82fe54413d9..911bc6b0dd9 100644 --- a/src/test/stdtest/path.rs +++ b/src/test/stdtest/path.rs @@ -8,10 +8,10 @@ import std::os; #[test] fn test() { - assert (!fs::path_is_absolute(~"test-path")); + assert (!fs::path_is_absolute("test-path")); - log ~"Current working directory: " + os::getcwd(); + log "Current working directory: " + os::getcwd(); - log fs::make_absolute(~"test-path"); - log fs::make_absolute(~"/usr/bin"); + log fs::make_absolute("test-path"); + log fs::make_absolute("/usr/bin"); } diff --git a/src/test/stdtest/qsort.rs b/src/test/stdtest/qsort.rs index 32109dc1caa..609adf3afe4 100644 --- a/src/test/stdtest/qsort.rs +++ b/src/test/stdtest/qsort.rs @@ -51,8 +51,8 @@ fn test_simple() { let immut_names = vec::from_mut(names); - // Silly, but what else can we do? - check vec::same_length(expected, immut_names); + // Silly, but what else can we do? + check (vec::same_length(expected, immut_names)); let pairs = vec::zip(expected, immut_names); for (a, b) in pairs { log #fmt["%d %d", a, b]; assert (a == b); } } diff --git a/src/test/stdtest/run.rs b/src/test/stdtest/run.rs index 5c62ed3eb0e..b60a3935500 100644 --- a/src/test/stdtest/run.rs +++ b/src/test/stdtest/run.rs @@ -11,9 +11,9 @@ import std::vec; #[cfg(target_os = "macos")] #[test] fn test_leaks() { - run::run_program(~"echo", []); - run::start_program(~"echo", []); - run::program_output(~"echo", []); + run::run_program("echo", []); + run::start_program("echo", []); + run::program_output("echo", []); } // FIXME @@ -29,14 +29,13 @@ fn test_pipes() { let pipe_err = os::pipe(); let pid = - run::spawn_process(~"cat", [], - pipe_in.in, pipe_out.out, pipe_err.out); + run::spawn_process("cat", [], pipe_in.in, pipe_out.out, pipe_err.out); os::libc::close(pipe_in.in); os::libc::close(pipe_out.out); os::libc::close(pipe_err.out); if pid == -1 { fail; } - let expected = ~"test"; + let expected = "test"; writeclose(pipe_in.out, expected); let actual = readclose(pipe_out.in); readclose(pipe_err.in); @@ -46,18 +45,18 @@ fn test_pipes() { log actual; assert (expected == actual); - fn writeclose(fd: int, s: &istr) { + fn writeclose(fd: int, s: &str) { let writer = io::new_writer(io::fd_buf_writer(fd, option::none)); writer.write_str(s); os::libc::close(fd); } - fn readclose(fd: int) -> istr { + fn readclose(fd: int) -> str { // Copied from run::program_output let file = os::fd_FILE(fd); let reader = io::new_reader(io::FILE_buf_reader(file, option::none)); - let buf = ~""; + let buf = ""; while !reader.eof() { let bytes = reader.read_bytes(4096u); buf += str::unsafe_from_bytes(bytes); diff --git a/src/test/stdtest/sha1.rs b/src/test/stdtest/sha1.rs index a66b898ddfa..6b72be20dd5 100644 --- a/src/test/stdtest/sha1.rs +++ b/src/test/stdtest/sha1.rs @@ -9,24 +9,24 @@ import std::str; #[test] fn test() { - type test = {input: istr, output: [u8]}; + type test = {input: str, output: [u8]}; - fn a_million_letter_a() -> istr { + fn a_million_letter_a() -> str { let i = 0; - let rs = ~""; - while i < 100000 { rs += ~"aaaaaaaaaa"; i += 1; } + let rs = ""; + while i < 100000 { rs += "aaaaaaaaaa"; i += 1; } ret rs; } // Test messages from FIPS 180-1 let fips_180_1_tests: [test] = - [{input: ~"abc", + [{input: "abc", output: [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8, 0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8, 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]}, - {input: ~"abcdbcdecdefdefgefghfghighij" - + ~"hijkijkljklmklmnlmnomnopnopq", + {input: + "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq", output: [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8, 0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, 0xE5u8, @@ -39,12 +39,12 @@ fn test() { // Examples from wikipedia let wikipedia_tests: [test] = - [{input: ~"The quick brown fox jumps over the lazy dog", + [{input: "The quick brown fox jumps over the lazy dog", output: [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8, 0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, 0x39u8, 0x1bu8, 0x93u8, 0xebu8, 0x12u8]}, - {input: ~"The quick brown fox jumps over the lazy cog", + {input: "The quick brown fox jumps over the lazy cog", output: [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8, 0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8, diff --git a/src/test/stdtest/str.rs b/src/test/stdtest/str.rs index a559b61d3f2..2852822f8d4 100644 --- a/src/test/stdtest/str.rs +++ b/src/test/stdtest/str.rs @@ -3,105 +3,103 @@ import std::vec; #[test] fn test_eq() { - assert str::eq(~"", ~""); - assert str::eq(~"foo", ~"foo"); - assert !str::eq(~"foo", ~"bar"); + assert (str::eq("", "")); + assert (str::eq("foo", "foo")); + assert (!str::eq("foo", "bar")); } #[test] fn test_lteq() { - assert str::lteq(~"", ~""); - assert str::lteq(~"", ~"foo"); - assert str::lteq(~"foo", ~"foo"); - assert !str::eq(~"foo", ~"bar"); + assert (str::lteq("", "")); + assert (str::lteq("", "foo")); + assert (str::lteq("foo", "foo")); + assert (!str::eq("foo", "bar")); } #[test] fn test_bytes_len() { - assert (str::byte_len(~"") == 0u); - assert (str::byte_len(~"hello world") == 11u); - assert (str::byte_len(~"\x63") == 1u); - assert (str::byte_len(~"\xa2") == 2u); - assert (str::byte_len(~"\u03c0") == 2u); - assert (str::byte_len(~"\u2620") == 3u); - assert (str::byte_len(~"\U0001d11e") == 4u); + assert (str::byte_len("") == 0u); + assert (str::byte_len("hello world") == 11u); + assert (str::byte_len("\x63") == 1u); + assert (str::byte_len("\xa2") == 2u); + assert (str::byte_len("\u03c0") == 2u); + assert (str::byte_len("\u2620") == 3u); + assert (str::byte_len("\U0001d11e") == 4u); } #[test] fn test_index_and_rindex() { - assert (str::index(~"hello", 'e' as u8) == 1); - assert (str::index(~"hello", 'o' as u8) == 4); - assert (str::index(~"hello", 'z' as u8) == -1); - assert (str::rindex(~"hello", 'l' as u8) == 3); - assert (str::rindex(~"hello", 'h' as u8) == 0); - assert (str::rindex(~"hello", 'z' as u8) == -1); + assert (str::index("hello", 'e' as u8) == 1); + assert (str::index("hello", 'o' as u8) == 4); + assert (str::index("hello", 'z' as u8) == -1); + assert (str::rindex("hello", 'l' as u8) == 3); + assert (str::rindex("hello", 'h' as u8) == 0); + assert (str::rindex("hello", 'z' as u8) == -1); } #[test] fn test_split() { - fn t(s: &istr, c: char, i: int, k: &istr) { - log ~"splitting: " + s; + fn t(s: &str, c: char, i: int, k: &str) { + log "splitting: " + s; log i; let v = str::split(s, c as u8); - log ~"split to: "; - for z: istr in v { log z; } - log ~"comparing: " + v[i] + ~" vs. " + k; + log "split to: "; + for z: str in v { log z; } + log "comparing: " + v[i] + " vs. " + k; assert (str::eq(v[i], k)); } - t(~"abc.hello.there", '.', 0, ~"abc"); - t(~"abc.hello.there", '.', 1, ~"hello"); - t(~"abc.hello.there", '.', 2, ~"there"); - t(~".hello.there", '.', 0, ~""); - t(~".hello.there", '.', 1, ~"hello"); - t(~"...hello.there.", '.', 3, ~"hello"); - t(~"...hello.there.", '.', 5, ~""); + t("abc.hello.there", '.', 0, "abc"); + t("abc.hello.there", '.', 1, "hello"); + t("abc.hello.there", '.', 2, "there"); + t(".hello.there", '.', 0, ""); + t(".hello.there", '.', 1, "hello"); + t("...hello.there.", '.', 3, "hello"); + t("...hello.there.", '.', 5, ""); } #[test] fn test_find() { - fn t(haystack: &istr, needle: &istr, i: int) { + fn t(haystack: &str, needle: &str, i: int) { let j: int = str::find(haystack, needle); - log ~"searched for " + needle; + log "searched for " + needle; log j; assert (i == j); } - t(~"this is a simple", ~"is a", 5); - t(~"this is a simple", ~"is z", -1); - t(~"this is a simple", ~"", 0); - t(~"this is a simple", ~"simple", 10); - t(~"this", ~"simple", -1); + t("this is a simple", "is a", 5); + t("this is a simple", "is z", -1); + t("this is a simple", "", 0); + t("this is a simple", "simple", 10); + t("this", "simple", -1); } #[test] fn test_substr() { - fn t(a: &istr, b: &istr, start: int) { - assert (str::eq(str::substr(a, start as uint, - str::byte_len(b)), b)); + fn t(a: &str, b: &str, start: int) { + assert (str::eq(str::substr(a, start as uint, str::byte_len(b)), b)); } - t(~"hello", ~"llo", 2); - t(~"hello", ~"el", 1); - t(~"substr should not be a challenge", ~"not", 14); + t("hello", "llo", 2); + t("hello", "el", 1); + t("substr should not be a challenge", "not", 14); } #[test] fn test_concat() { - fn t(v: &[istr], s: &istr) { assert (str::eq(str::concat(v), s)); } - t([~"you", ~"know", ~"I'm", ~"no", ~"good"], ~"youknowI'mnogood"); - let v: [istr] = []; - t(v, ~""); - t([~"hi"], ~"hi"); + fn t(v: &[str], s: &str) { assert (str::eq(str::concat(v), s)); } + t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood"); + let v: [str] = []; + t(v, ""); + t(["hi"], "hi"); } #[test] fn test_connect() { - fn t(v: &[istr], sep: &istr, s: &istr) { + fn t(v: &[str], sep: &str, s: &str) { assert (str::eq(str::connect(v, sep), s)); } - t([~"you", ~"know", ~"I'm", ~"no", ~"good"], ~" ", - ~"you know I'm no good"); - let v: [istr] = []; - t(v, ~" ", ~""); - t([~"hi"], ~" ", ~"hi"); + t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good"); + let v: [str] = []; + t(v, " ", ""); + t(["hi"], " ", "hi"); } #[test] @@ -109,28 +107,28 @@ fn test_to_upper() { // to_upper doesn't understand unicode yet, // but we need to at least preserve it - let unicode = ~"\u65e5\u672c"; - let input = ~"abcDEF" + unicode + ~"xyz:.;"; - let expected = ~"ABCDEF" + unicode + ~"XYZ:.;"; + let unicode = "\u65e5\u672c"; + let input = "abcDEF" + unicode + "xyz:.;"; + let expected = "ABCDEF" + unicode + "XYZ:.;"; let actual = str::to_upper(input); assert (str::eq(expected, actual)); } #[test] fn test_slice() { - assert (str::eq(~"ab", str::slice(~"abc", 0u, 2u))); - assert (str::eq(~"bc", str::slice(~"abc", 1u, 3u))); - assert (str::eq(~"", str::slice(~"abc", 1u, 1u))); - fn a_million_letter_a() -> istr { + assert (str::eq("ab", str::slice("abc", 0u, 2u))); + assert (str::eq("bc", str::slice("abc", 1u, 3u))); + assert (str::eq("", str::slice("abc", 1u, 1u))); + fn a_million_letter_a() -> str { let i = 0; - let rs = ~""; - while i < 100000 { rs += ~"aaaaaaaaaa"; i += 1; } + let rs = ""; + while i < 100000 { rs += "aaaaaaaaaa"; i += 1; } ret rs; } - fn half_a_million_letter_a() -> istr { + fn half_a_million_letter_a() -> str { let i = 0; - let rs = ~""; - while i < 100000 { rs += ~"aaaaa"; i += 1; } + let rs = ""; + while i < 100000 { rs += "aaaaa"; i += 1; } ret rs; } assert (str::eq(half_a_million_letter_a(), @@ -139,123 +137,122 @@ fn test_slice() { #[test] fn test_starts_with() { - assert (str::starts_with(~"", ~"")); - assert (str::starts_with(~"abc", ~"")); - assert (str::starts_with(~"abc", ~"a")); - assert (!str::starts_with(~"a", ~"abc")); - assert (!str::starts_with(~"", ~"abc")); + assert (str::starts_with("", "")); + assert (str::starts_with("abc", "")); + assert (str::starts_with("abc", "a")); + assert (!str::starts_with("a", "abc")); + assert (!str::starts_with("", "abc")); } #[test] fn test_ends_with() { - assert (str::ends_with(~"", ~"")); - assert (str::ends_with(~"abc", ~"")); - assert (str::ends_with(~"abc", ~"c")); - assert (!str::ends_with(~"a", ~"abc")); - assert (!str::ends_with(~"", ~"abc")); + assert (str::ends_with("", "")); + assert (str::ends_with("abc", "")); + assert (str::ends_with("abc", "c")); + assert (!str::ends_with("a", "abc")); + assert (!str::ends_with("", "abc")); } #[test] fn test_is_empty() { - assert (str::is_empty(~"")); - assert (!str::is_empty(~"a")); + assert (str::is_empty("")); + assert (!str::is_empty("a")); } #[test] fn test_is_not_empty() { - assert (str::is_not_empty(~"a")); - assert (!str::is_not_empty(~"")); + assert (str::is_not_empty("a")); + assert (!str::is_not_empty("")); } #[test] fn test_replace() { - let a = ~"a"; + let a = "a"; check (str::is_not_empty(a)); - assert (str::replace(~"", a, ~"b") == ~""); - assert (str::replace(~"a", a, ~"b") == ~"b"); - assert (str::replace(~"ab", a, ~"b") == ~"bb"); - let test = ~"test"; + assert (str::replace("", a, "b") == ""); + assert (str::replace("a", a, "b") == "b"); + assert (str::replace("ab", a, "b") == "bb"); + let test = "test"; check (str::is_not_empty(test)); - assert (str::replace(~" test test ", test, ~"toast") - == ~" toast toast "); - assert (str::replace(~" test test ", test, ~"") == ~" "); + assert (str::replace(" test test ", test, "toast") == " toast toast "); + assert (str::replace(" test test ", test, "") == " "); } #[test] fn test_char_slice() { - assert (str::eq(~"ab", str::char_slice(~"abc", 0u, 2u))); - assert (str::eq(~"bc", str::char_slice(~"abc", 1u, 3u))); - assert (str::eq(~"", str::char_slice(~"abc", 1u, 1u))); - assert (str::eq(~"\u65e5", str::char_slice(~"\u65e5\u672c", 0u, 1u))); + assert (str::eq("ab", str::char_slice("abc", 0u, 2u))); + assert (str::eq("bc", str::char_slice("abc", 1u, 3u))); + assert (str::eq("", str::char_slice("abc", 1u, 1u))); + assert (str::eq("\u65e5", str::char_slice("\u65e5\u672c", 0u, 1u))); } #[test] fn trim_left() { - assert (str::trim_left(~"") == ~""); - assert (str::trim_left(~"a") == ~"a"); - assert (str::trim_left(~" ") == ~""); - assert (str::trim_left(~" blah") == ~"blah"); - assert (str::trim_left(~" \u3000 wut") == ~"wut"); - assert (str::trim_left(~"hey ") == ~"hey "); + assert (str::trim_left("") == ""); + assert (str::trim_left("a") == "a"); + assert (str::trim_left(" ") == ""); + assert (str::trim_left(" blah") == "blah"); + assert (str::trim_left(" \u3000 wut") == "wut"); + assert (str::trim_left("hey ") == "hey "); } #[test] fn trim_right() { - assert (str::trim_right(~"") == ~""); - assert (str::trim_right(~"a") == ~"a"); - assert (str::trim_right(~" ") == ~""); - assert (str::trim_right(~"blah ") == ~"blah"); - assert (str::trim_right(~"wut \u3000 ") == ~"wut"); - assert (str::trim_right(~" hey") == ~" hey"); + assert (str::trim_right("") == ""); + assert (str::trim_right("a") == "a"); + assert (str::trim_right(" ") == ""); + assert (str::trim_right("blah ") == "blah"); + assert (str::trim_right("wut \u3000 ") == "wut"); + assert (str::trim_right(" hey") == " hey"); } #[test] fn trim() { - assert (str::trim(~"") == ~""); - assert (str::trim(~"a") == ~"a"); - assert (str::trim(~" ") == ~""); - assert (str::trim(~" blah ") == ~"blah"); - assert (str::trim(~"\nwut \u3000 ") == ~"wut"); - assert (str::trim(~" hey dude ") == ~"hey dude"); + assert (str::trim("") == ""); + assert (str::trim("a") == "a"); + assert (str::trim(" ") == ""); + assert (str::trim(" blah ") == "blah"); + assert (str::trim("\nwut \u3000 ") == "wut"); + assert (str::trim(" hey dude ") == "hey dude"); } #[test] fn is_whitespace() { - assert (str::is_whitespace(~"")); - assert (str::is_whitespace(~" ")); - assert (str::is_whitespace(~"\u2009")); // Thin space - assert (str::is_whitespace(~" \n\t ")); - assert (!str::is_whitespace(~" _ ")); + assert (str::is_whitespace("")); + assert (str::is_whitespace(" ")); + assert (str::is_whitespace("\u2009")); // Thin space + assert (str::is_whitespace(" \n\t ")); + assert (!str::is_whitespace(" _ ")); } #[test] fn is_ascii() { - assert str::is_ascii(~""); - assert str::is_ascii(~"a"); - assert !str::is_ascii(~"\u2009"); + assert (str::is_ascii("")); + assert (str::is_ascii("a")); + assert (!str::is_ascii("\u2009")); } #[test] fn shift_byte() { - let s = ~"ABC"; + let s = "ABC"; let b = str::shift_byte(s); - assert s == ~"BC"; - assert b == 65u8; + assert (s == "BC"); + assert (b == 65u8); } #[test] fn pop_byte() { - let s = ~"ABC"; + let s = "ABC"; let b = str::pop_byte(s); - assert s == ~"AB"; - assert b == 67u8; + assert (s == "AB"); + assert (b == 67u8); } #[test] fn unsafe_from_bytes() { let a = [65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 65u8]; let b = str::unsafe_from_bytes(a); - assert b == ~"AAAAAAA"; + assert (b == "AAAAAAA"); } #[test] @@ -263,43 +260,37 @@ fn str_from_cstr() { let a = [65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 0u8]; let b = vec::to_ptr(a); let c = str::str_from_cstr(b); - assert c == ~"AAAAAAA"; + assert (c == "AAAAAAA"); } #[test] fn as_buf() { - let a = ~"Abcdefg"; - let b = str::as_buf(a, { |buf| - assert *buf == 65u8; - 100 - }); - assert b == 100; + let a = "Abcdefg"; + let b = str::as_buf(a, {|buf| assert (*buf == 65u8); 100 }); + assert (b == 100); } #[test] fn as_buf_small() { - let a = ~"A"; - let b = str::as_buf(a, { |buf| - assert *buf == 65u8; - 100 - }); - assert b == 100; + let a = "A"; + let b = str::as_buf(a, {|buf| assert (*buf == 65u8); 100 }); + assert (b == 100); } #[test] fn as_buf2() { - let s = ~"hello"; - let sb = str::as_buf(s, { |b| b }); + let s = "hello"; + let sb = str::as_buf(s, {|b| b }); let s_cstr = str::str_from_cstr(sb); assert (str::eq(s_cstr, s)); } #[test] fn vec_str_conversions() { - let s1: istr = ~"All mimsy were the borogoves"; + let s1: str = "All mimsy were the borogoves"; let v: [u8] = str::bytes(s1); - let s2: istr = str::unsafe_from_bytes(v); + let s2: str = str::unsafe_from_bytes(v); let i: uint = 0u; let n1: uint = str::byte_len(s1); let n2: uint = vec::len::<u8>(v); diff --git a/src/test/stdtest/sys.rs b/src/test/stdtest/sys.rs index 006aaaa8f5e..56cafe9217a 100644 --- a/src/test/stdtest/sys.rs +++ b/src/test/stdtest/sys.rs @@ -1,6 +1,4 @@ import std::sys; #[test] -fn last_os_error() { - log sys::rustrt::last_os_error(); -} \ No newline at end of file +fn last_os_error() { log sys::rustrt::last_os_error(); } diff --git a/src/test/stdtest/task.rs b/src/test/stdtest/task.rs index 1984202fd93..8c1776aa36f 100644 --- a/src/test/stdtest/task.rs +++ b/src/test/stdtest/task.rs @@ -67,12 +67,10 @@ fn test_join_convenient() { #[test] fn spawn_polymorphic() { - fn foo<~T>(x : -T) { - log_err x; - } + fn foo<~T>(x: -T) { log_err x; } let fb = bind foo(true); task::spawn(fb); task::spawn(bind foo(42)); -} \ No newline at end of file +} diff --git a/src/test/stdtest/test.rs b/src/test/stdtest/test.rs index cb4b9313029..eaecb80ba6b 100644 --- a/src/test/stdtest/test.rs +++ b/src/test/stdtest/test.rs @@ -9,7 +9,7 @@ fn do_not_run_ignored_tests() { let ran = @mutable false; let f = bind fn (ran: @mutable bool) { *ran = true; }(ran); - let desc = {name: ~"whatever", fn: f, ignore: true}; + let desc = {name: "whatever", fn: f, ignore: true}; test::run_test(desc, test::default_test_to_task); @@ -19,22 +19,22 @@ fn do_not_run_ignored_tests() { #[test] fn ignored_tests_result_in_ignored() { fn f() { } - let desc = {name: ~"whatever", fn: f, ignore: true}; + let desc = {name: "whatever", fn: f, ignore: true}; let res = test::run_test(desc, test::default_test_to_task).wait(); assert (res == test::tr_ignored); } #[test] fn first_free_arg_should_be_a_filter() { - let args = [~"progname", ~"filter"]; + let args = ["progname", "filter"]; check (vec::is_not_empty(args)); let opts = alt test::parse_opts(args) { either::left(o) { o } }; - assert (str::eq(~"filter", option::get(opts.filter))); + assert (str::eq("filter", option::get(opts.filter))); } #[test] fn parse_ignored_flag() { - let args = [~"progname", ~"filter", ~"--ignored"]; + let args = ["progname", "filter", "--ignored"]; check (vec::is_not_empty(args)); let opts = alt test::parse_opts(args) { either::left(o) { o } }; assert (opts.run_ignored); @@ -47,12 +47,12 @@ fn filter_for_ignored_option() { let opts = {filter: option::none, run_ignored: true}; let tests = - [{name: ~"1", fn: fn () { }, ignore: true}, - {name: ~"2", fn: fn () { }, ignore: false}]; + [{name: "1", fn: fn () { }, ignore: true}, + {name: "2", fn: fn () { }, ignore: false}]; let filtered = test::filter_tests(opts, tests); assert (vec::len(filtered) == 1u); - assert (filtered[0].name == ~"1"); + assert (filtered[0].name == "1"); assert (filtered[0].ignore == false); } @@ -61,17 +61,17 @@ fn sort_tests() { let opts = {filter: option::none, run_ignored: false}; let names = - [~"sha1::test", ~"int::test_to_str", ~"int::test_pow", - ~"test::do_not_run_ignored_tests", - ~"test::ignored_tests_result_in_ignored", - ~"test::first_free_arg_should_be_a_filter", - ~"test::parse_ignored_flag", ~"test::filter_for_ignored_option", - ~"test::sort_tests"]; + ["sha1::test", "int::test_to_str", "int::test_pow", + "test::do_not_run_ignored_tests", + "test::ignored_tests_result_in_ignored", + "test::first_free_arg_should_be_a_filter", + "test::parse_ignored_flag", "test::filter_for_ignored_option", + "test::sort_tests"]; let tests = { let testfn = fn () { }; let tests = []; - for name: istr in names { + for name: str in names { let test = {name: name, fn: testfn, ignore: false}; tests += [test]; } @@ -80,15 +80,13 @@ fn sort_tests() { let filtered = test::filter_tests(opts, tests); let expected = - [~"int::test_pow", ~"int::test_to_str", ~"sha1::test", - ~"test::do_not_run_ignored_tests", - ~"test::filter_for_ignored_option", - ~"test::first_free_arg_should_be_a_filter", - ~"test::ignored_tests_result_in_ignored", - ~"test::parse_ignored_flag", - ~"test::sort_tests"]; - - check vec::same_length(expected, filtered); + ["int::test_pow", "int::test_to_str", "sha1::test", + "test::do_not_run_ignored_tests", "test::filter_for_ignored_option", + "test::first_free_arg_should_be_a_filter", + "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag", + "test::sort_tests"]; + + check (vec::same_length(expected, filtered)); let pairs = vec::zip(expected, filtered); diff --git a/src/test/stdtest/treemap.rs b/src/test/stdtest/treemap.rs index 9a2ef1e8e68..0f4119c6c3d 100644 --- a/src/test/stdtest/treemap.rs +++ b/src/test/stdtest/treemap.rs @@ -5,41 +5,29 @@ import std::option::none; import std::str; #[test] -fn init_treemap() { - let m = init::<int, int>(); -} +fn init_treemap() { let m = init::<int, int>(); } #[test] -fn insert_one() { - let m = init(); - insert(m, 1, 2); -} +fn insert_one() { let m = init(); insert(m, 1, 2); } #[test] -fn insert_two() { - let m = init(); - insert(m, 1, 2); - insert(m, 3, 4); -} +fn insert_two() { let m = init(); insert(m, 1, 2); insert(m, 3, 4); } #[test] fn insert_find() { let m = init(); insert(m, 1, 2); - assert(find(m, 1) == some(2)); + assert (find(m, 1) == some(2)); } #[test] -fn find_empty() { - let m = init::<int, int>(); - assert(find(m, 1) == none); -} +fn find_empty() { let m = init::<int, int>(); assert (find(m, 1) == none); } #[test] fn find_not_found() { let m = init(); insert(m, 1, 2); - assert(find(m, 2) == none); + assert (find(m, 2) == none); } #[test] @@ -52,10 +40,7 @@ fn traverse_in_order() { insert(m, 1, ()); let n = 0; - fn t(n : &mutable int, k : &int, v : &()) { - assert(n == k); - n += 1; - } + fn t(n: &mutable int, k: &int, v: &()) { assert (n == k); n += 1; } traverse(m, bind t(n, _, _)); } @@ -63,12 +48,12 @@ fn traverse_in_order() { fn u8_map() { let m = init(); - let k1 = str::bytes(~"foo"); - let k2 = str::bytes(~"bar"); + let k1 = str::bytes("foo"); + let k2 = str::bytes("bar"); - insert(m, k1, ~"foo"); - insert(m, k2, ~"bar"); + insert(m, k1, "foo"); + insert(m, k2, "bar"); - assert(find(m, k2) == some(~"bar")); - assert(find(m, k1) == some(~"foo")); + assert (find(m, k2) == some("bar")); + assert (find(m, k1) == some("foo")); } diff --git a/src/test/stdtest/vec.rs b/src/test/stdtest/vec.rs index 3d1df459067..6194c461c15 100644 --- a/src/test/stdtest/vec.rs +++ b/src/test/stdtest/vec.rs @@ -303,7 +303,7 @@ fn test_zip_unzip() { let v1 = [1, 2, 3]; let v2 = [4, 5, 6]; - check same_length(v1, v2); // Silly, but what else can we do? + check (same_length(v1, v2)); // Silly, but what else can we do? let z1 = vec::zip(v1, v2); assert ((1, 4) == z1[0]); @@ -351,7 +351,7 @@ fn reverse_and_reversed() { // Make sure they work with 0-length vectors too. let v4 = vec::reversed::<int>([]); - assert v4 == []; + assert (v4 == []); let v3: [mutable int] = [mutable]; vec::reverse::<int>(v3); } |
