auto merge of #6829 : dotdash/rust/allocs, r=sanxiyn

27 files changed, 83 insertions, 91 deletions

diff --git a/src/compiletest/header.rs b/src/compiletest/header.rs
index 2bfc92bc704..b147dc806e2 100644
--- a/src/compiletest/header.rs
+++ b/src/compiletest/header.rs
@@ -99,7 +99,7 @@ pub fn is_test_ignored(config: &config, testfile: &Path) -> bool {
     return false;
 
     fn xfail_target() -> ~str {
-        ~"xfail-" + str::to_owned(os::SYSNAME)
+        ~"xfail-" + os::SYSNAME
     }
 }
 
@@ -173,7 +173,7 @@ fn parse_name_directive(line: &str, directive: &str) -> bool {
 
 fn parse_name_value_directive(line: &str,
                               directive: ~str) -> Option<~str> {
-    let keycolon = directive + ~":";
+    let keycolon = directive + ":";
     match str::find_str(line, keycolon) {
         Some(colon) => {
             let value = str::slice(line, colon + str::len(keycolon),
diff --git a/src/compiletest/procsrv.rs b/src/compiletest/procsrv.rs
index 57a6dc8037e..8285986d67e 100644
--- a/src/compiletest/procsrv.rs
+++ b/src/compiletest/procsrv.rs
@@ -24,12 +24,12 @@ fn target_env(lib_path: &str, prog: &str) -> ~[(~str,~str)] {
     let mut env = os::env();
 
     // Make sure we include the aux directory in the path
-    assert!(prog.ends_with(~".exe"));
-    let aux_path = prog.slice(0u, prog.len() - 4u).to_owned() + ~".libaux";
+    assert!(prog.ends_with(".exe"));
+    let aux_path = prog.slice(0u, prog.len() - 4u).to_owned() + ".libaux";
 
     env = do vec::map(env) |pair| {
         let (k,v) = *pair;
-        if k == ~"PATH" { (~"PATH", v + ~";" + lib_path + ~";" + aux_path) }
+        if k == ~"PATH" { (~"PATH", v + ";" + lib_path + ";" + aux_path) }
         else { (k,v) }
     };
     if str::ends_with(prog, "rustc.exe") {
diff --git a/src/compiletest/runtest.rs b/src/compiletest/runtest.rs
index 4db1fa6d0a0..f0f6469e923 100644
--- a/src/compiletest/runtest.rs
+++ b/src/compiletest/runtest.rs
@@ -378,7 +378,7 @@ fn check_expected_errors(expected_errors: ~[errors::ExpectedError],
             was_expected = true;
         }
 
-        if !was_expected && is_compiler_error_or_warning(str::to_owned(line)) {
+        if !was_expected && is_compiler_error_or_warning(line) {
             fatal_ProcRes(fmt!("unexpected compiler error or warning: '%s'",
                                line),
                           ProcRes);
@@ -596,8 +596,7 @@ fn make_lib_name(config: &config, auxfile: &Path, testfile: &Path) -> Path {
 }
 
 fn make_exe_name(config: &config, testfile: &Path) -> Path {
-    Path(output_base_name(config, testfile).to_str() +
-            str::to_owned(os::EXE_SUFFIX))
+    Path(output_base_name(config, testfile).to_str() + os::EXE_SUFFIX)
 }
 
 fn make_run_args(config: &config, _props: &TestProps, testfile: &Path) ->
@@ -606,7 +605,7 @@ fn make_run_args(config: &config, _props: &TestProps, testfile: &Path) ->
     // then split apart its command
     let toolargs = split_maybe_args(&config.runtool);
 
-    let mut args = toolargs + ~[make_exe_name(config, testfile).to_str()];
+    let mut args = toolargs + [make_exe_name(config, testfile).to_str()];
     let prog = args.shift();
     return ProcArgs {prog: prog, args: args};
 }
@@ -655,7 +654,7 @@ fn make_cmdline(_libpath: &str, prog: &str, args: &[~str]) -> ~str {
 #[cfg(target_os = "win32")]
 fn make_cmdline(libpath: &str, prog: &str, args: &[~str]) -> ~str {
     fmt!("%s %s %s", lib_path_cmd_prefix(libpath), prog,
-         str::connect(args, ~" "))
+         str::connect(args, " "))
 }
 
 // Build the LD_LIBRARY_PATH variable as it would be seen on the command line
@@ -776,8 +775,8 @@ fn _arm_exec_compiled_test(config: &config, props: &TestProps,
     for args.args.each |tv| {
         newcmd_out.push_str(" ");
         newcmd_err.push_str(" ");
-        newcmd_out.push_str(tv.to_owned());
-        newcmd_err.push_str(tv.to_owned());
+        newcmd_out.push_str(*tv);
+        newcmd_err.push_str(*tv);
     }
 
     newcmd_out.push_str(" 2>/dev/null");
diff --git a/src/libextra/getopts.rs b/src/libextra/getopts.rs
index 294b8fec042..678d795d8f8 100644
--- a/src/libextra/getopts.rs
+++ b/src/libextra/getopts.rs
@@ -110,10 +110,11 @@ pub struct Opt {
 }
 
 fn mkname(nm: &str) -> Name {
-    let unm = str::to_owned(nm);
-    return if nm.len() == 1u {
-            Short(str::char_at(unm, 0u))
-        } else { Long(unm) };
+  if nm.len() == 1u {
+      Short(str::char_at(nm, 0u))
+  } else {
+      Long(nm.to_owned())
+  }
 }
 
 /// Create an option that is required and takes an argument
@@ -195,19 +196,19 @@ pub enum Fail_ {
 pub fn fail_str(f: Fail_) -> ~str {
     return match f {
         ArgumentMissing(ref nm) => {
-            ~"Argument to option '" + *nm + "' missing."
+            fmt!("Argument to option '%s' missing.", *nm)
         }
         UnrecognizedOption(ref nm) => {
-            ~"Unrecognized option: '" + *nm + "'."
+            fmt!("Unrecognized option: '%s'.", *nm)
         }
         OptionMissing(ref nm) => {
-            ~"Required option '" + *nm + "' missing."
+            fmt!("Required option '%s' missing.", *nm)
         }
         OptionDuplicated(ref nm) => {
-            ~"Option '" + *nm + "' given more than once."
+            fmt!("Option '%s' given more than once.", *nm)
         }
         UnexpectedArgument(ref nm) => {
-            ~"Option " + *nm + " does not take an argument."
+            fmt!("Option '%s' does not take an argument.", *nm)
         }
     };
 }
@@ -245,11 +246,11 @@ pub fn getopts(args: &[~str], opts: &[Opt]) -> Result {
             let mut names;
             let mut i_arg = None;
             if cur[1] == '-' as u8 {
-                let tail = str::slice(cur, 2, curlen).to_owned();
+                let tail = str::slice(cur, 2, curlen);
                 let mut tail_eq = ~[];
                 for str::each_splitn_char(tail, '=', 1) |s| { tail_eq.push(s.to_owned()) }
                 if tail_eq.len() <= 1 {
-                    names = ~[Long(tail)];
+                    names = ~[Long(tail.to_owned())];
                 } else {
                     names =
                         ~[Long(copy tail_eq[0])];
diff --git a/src/libextra/net_ip.rs b/src/libextra/net_ip.rs
index e92523726df..160d06ec20d 100644
--- a/src/libextra/net_ip.rs
+++ b/src/libextra/net_ip.rs
@@ -230,7 +230,7 @@ pub mod v4 {
             let input_is_inaddr_none =
                 result::get(&ip_rep_result).as_u32() == INADDR_NONE;
 
-            let new_addr = uv_ip4_addr(str::to_owned(ip), 22);
+            let new_addr = uv_ip4_addr(ip, 22);
             let reformatted_name = uv_ip4_name(&new_addr);
             debug!("try_parse_addr: input ip: %s reparsed ip: %s",
                             ip, reformatted_name);
@@ -259,7 +259,6 @@ pub mod v6 {
     use uv_ip6_name = uv::ll::ip6_name;
 
     use core::result;
-    use core::str;
 
     /**
      * Convert a str to `ip_addr`
@@ -285,7 +284,7 @@ pub mod v6 {
     pub fn try_parse_addr(ip: &str) -> result::Result<IpAddr,ParseAddrErr> {
         unsafe {
             // need to figure out how to establish a parse failure..
-            let new_addr = uv_ip6_addr(str::to_owned(ip), 22);
+            let new_addr = uv_ip6_addr(ip, 22);
             let reparsed_name = uv_ip6_name(&new_addr);
             debug!("v6::try_parse_addr ip: '%s' reparsed '%s'",
                             ip, reparsed_name);
diff --git a/src/libextra/net_url.rs b/src/libextra/net_url.rs
index fa7295923a0..80957a8c8ef 100644
--- a/src/libextra/net_url.rs
+++ b/src/libextra/net_url.rs
@@ -585,7 +585,7 @@ fn get_path(rawurl: &str, authority: bool) ->
         }
     }
 
-    return Ok((decode_component(str::slice(rawurl, 0, end).to_owned()),
+    return Ok((decode_component(str::slice(rawurl, 0, end)),
                     str::slice(rawurl, end, len).to_owned()));
 }
 
@@ -596,14 +596,13 @@ fn get_query_fragment(rawurl: &str) ->
         if str::starts_with(rawurl, "#") {
             let f = decode_component(str::slice(rawurl,
                                                 1,
-                                                str::len(rawurl)).to_owned());
+                                                str::len(rawurl)));
             return Ok((~[], Some(f)));
         } else {
             return Ok((~[], None));
         }
     }
-    let (q, r) = split_char_first(str::slice(rawurl, 1,
-                                             str::len(rawurl)).to_owned(), '#');
+    let (q, r) = split_char_first(str::slice(rawurl, 1, rawurl.len()), '#');
     let f = if str::len(r) != 0 {
         Some(decode_component(r)) } else { None };
     return Ok((query_from_str(q), f));
diff --git a/src/libextra/sha1.rs b/src/libextra/sha1.rs
index e970d34ff91..80b4ab02e5f 100644
--- a/src/libextra/sha1.rs
+++ b/src/libextra/sha1.rs
@@ -399,8 +399,7 @@ mod tests {
             let mut left = len;
             while left > 0u {
                 let take = (left + 1u) / 2u;
-                sh.input_str(str::slice(t.input, len - left,
-                             take + len - left).to_owned());
+                sh.input_str(t.input.slice(len - left, take + len - left));
                 left = left - take;
             }
             let out = sh.result();
diff --git a/src/libextra/time.rs b/src/libextra/time.rs
index 8603d0f814a..e3289d01750 100644
--- a/src/libextra/time.rs
+++ b/src/libextra/time.rs
@@ -293,7 +293,7 @@ priv fn do_strptime(s: &str, format: &str) -> Result<Tm, ~str> {
 
         let mut i = 0u;
         while i < digits {
-            let range = str::char_range_at(str::to_owned(ss), pos);
+            let range = str::char_range_at(ss, pos);
             pos = range.next;
 
             match range.ch {
@@ -632,7 +632,7 @@ priv fn do_strptime(s: &str, format: &str) -> Result<Tm, ~str> {
         }
     }
 
-    do io::with_str_reader(str::to_owned(format)) |rdr| {
+    do io::with_str_reader(format) |rdr| {
         let mut tm = Tm {
             tm_sec: 0_i32,
             tm_min: 0_i32,
@@ -844,7 +844,7 @@ priv fn do_strftime(format: &str, tm: &Tm) -> ~str {
 
     let mut buf = ~"";
 
-    do io::with_str_reader(str::to_owned(format)) |rdr| {
+    do io::with_str_reader(format) |rdr| {
         while !rdr.eof() {
             match rdr.read_char() {
                 '%' => buf += parse_type(rdr.read_char(), tm),
diff --git a/src/libextra/workcache.rs b/src/libextra/workcache.rs
index 19913fb92f4..47a717a56a5 100644
--- a/src/libextra/workcache.rs
+++ b/src/libextra/workcache.rs
@@ -201,7 +201,7 @@ struct Logger {
 
 pub impl Logger {
     fn info(&self, i: &str) {
-        io::println(~"workcache: " + i.to_owned());
+        io::println(~"workcache: " + i);
     }
 }
 
diff --git a/src/librustc/back/link.rs b/src/librustc/back/link.rs
index 785b79f66b9..02c0b19e565 100644
--- a/src/librustc/back/link.rs
+++ b/src/librustc/back/link.rs
@@ -741,7 +741,6 @@ pub fn mangle_internal_name_by_seq(ccx: @CrateContext, flav: &str) -> ~str {
 
 
 pub fn output_dll_filename(os: session::os, lm: LinkMeta) -> ~str {
-    let libname = fmt!("%s-%s-%s", lm.name, lm.extras_hash, lm.vers);
     let (dll_prefix, dll_suffix) = match os {
         session::os_win32 => (win32::DLL_PREFIX, win32::DLL_SUFFIX),
         session::os_macos => (macos::DLL_PREFIX, macos::DLL_SUFFIX),
@@ -749,8 +748,7 @@ pub fn output_dll_filename(os: session::os, lm: LinkMeta) -> ~str {
         session::os_android => (android::DLL_PREFIX, android::DLL_SUFFIX),
         session::os_freebsd => (freebsd::DLL_PREFIX, freebsd::DLL_SUFFIX),
     };
-    return str::to_owned(dll_prefix) + libname +
-           str::to_owned(dll_suffix);
+    fmt!("%s%s-%s-%s%s", dll_prefix, lm.name, lm.extras_hash, lm.vers, dll_suffix)
 }
 
 // If the user wants an exe generated we need to invoke
diff --git a/src/librustc/lib/llvm.rs b/src/librustc/lib/llvm.rs
index 49a682e68f1..b664abef343 100644
--- a/src/librustc/lib/llvm.rs
+++ b/src/librustc/lib/llvm.rs
@@ -2014,7 +2014,7 @@ pub fn type_to_str_inner(names: @TypeNames, outer0: &[TypeRef], ty: TypeRef)
             let mut first: bool = true;
             for tys.each |t| {
                 if first { first = false; } else { s += ", "; }
-                s += type_to_str_inner(names, outer, *t).to_owned();
+                s += type_to_str_inner(names, outer, *t);
             }
             // [Note at-str] FIXME #2543: Could rewrite this without the copy,
             // but need better @str support.
diff --git a/src/librustc/metadata/loader.rs b/src/librustc/metadata/loader.rs
index 5c64bd43943..182f1e9078c 100644
--- a/src/librustc/metadata/loader.rs
+++ b/src/librustc/metadata/loader.rs
@@ -268,8 +268,7 @@ pub fn list_file_metadata(intr: @ident_interner,
     match get_metadata_section(os, path) {
       option::Some(bytes) => decoder::list_crate_metadata(intr, bytes, out),
       option::None => {
-        out.write_str(~"could not find metadata in "
-                      + path.to_str() + ".\n");
+        out.write_str(fmt!("could not find metadata in %s.\n", path.to_str()))
       }
     }
 }
diff --git a/src/librustc/metadata/tyencode.rs b/src/librustc/metadata/tyencode.rs
index 42423b4df29..eb76b15dd28 100644
--- a/src/librustc/metadata/tyencode.rs
+++ b/src/librustc/metadata/tyencode.rs
@@ -89,8 +89,7 @@ pub fn enc_ty(w: @io::Writer, cx: @ctxt, t: ty::t) {
           let abbrev_len = 3u + estimate_sz(pos) + estimate_sz(len);
           if abbrev_len < len {
               // I.e. it's actually an abbreviation.
-              let s = ~"#" + uint::to_str_radix(pos, 16u) + ":" +
-                  uint::to_str_radix(len, 16u) + "#";
+              let s = fmt!("#%x:%x#", pos, len);
               let a = ty_abbrev { pos: pos, len: len, s: @s };
               abbrevs.insert(t, a);
           }
diff --git a/src/librustc/middle/trans/asm.rs b/src/librustc/middle/trans/asm.rs
index bfcd6b16857..ac92ea75963 100644
--- a/src/librustc/middle/trans/asm.rs
+++ b/src/librustc/middle/trans/asm.rs
@@ -98,7 +98,8 @@ pub fn trans_inline_asm(bcx: block, ia: &ast::inline_asm) -> block {
 
     // Add the clobbers to our constraints list
     if clobbers != ~"" && constraints != ~"" {
-        constraints += ~"," + clobbers;
+        constraints += ",";
+        constraints += clobbers;
     } else {
         constraints += clobbers;
     }
diff --git a/src/librustc/middle/trans/base.rs b/src/librustc/middle/trans/base.rs
index a36eb39c049..6a49ae4cbc6 100644
--- a/src/librustc/middle/trans/base.rs
+++ b/src/librustc/middle/trans/base.rs
@@ -2906,8 +2906,7 @@ pub fn decl_crate_map(sess: session::Session, mapmeta: LinkMeta,
     let cstore = sess.cstore;
     while cstore::have_crate_data(cstore, n_subcrates) { n_subcrates += 1; }
     let mapname = if *sess.building_library {
-        mapmeta.name.to_owned() + "_" + mapmeta.vers.to_owned() + "_"
-            + mapmeta.extras_hash.to_owned()
+        fmt!("%s_%s_%s", mapmeta.name, mapmeta.vers, mapmeta.extras_hash)
     } else {
         ~"toplevel"
     };
diff --git a/src/librustc/middle/trans/cabi.rs b/src/librustc/middle/trans/cabi.rs
index c6f4d230419..629d9ca629b 100644
--- a/src/librustc/middle/trans/cabi.rs
+++ b/src/librustc/middle/trans/cabi.rs
@@ -60,8 +60,8 @@ pub impl FnType {
     fn build_shim_args(&self, bcx: block,
                        arg_tys: &[TypeRef],
                        llargbundle: ValueRef) -> ~[ValueRef] {
-        let mut atys = /*bad*/copy self.arg_tys;
-        let mut attrs = /*bad*/copy self.attrs;
+        let mut atys: &[LLVMType] = self.arg_tys;
+        let mut attrs: &[option::Option<Attribute>] = self.attrs;
 
         let mut llargvals = ~[];
         let mut i = 0u;
@@ -71,8 +71,8 @@ pub impl FnType {
             let llretptr = GEPi(bcx, llargbundle, [0u, n]);
             let llretloc = Load(bcx, llretptr);
                 llargvals = ~[llretloc];
-                atys = vec::to_owned(atys.tail());
-                attrs = vec::to_owned(attrs.tail());
+                atys = atys.tail();
+                attrs = attrs.tail();
         }
 
         while i < n {
@@ -133,12 +133,12 @@ pub impl FnType {
                        ret_ty: TypeRef,
                        llwrapfn: ValueRef,
                        llargbundle: ValueRef) {
-        let mut atys = /*bad*/copy self.arg_tys;
-        let mut attrs = /*bad*/copy self.attrs;
+        let mut atys: &[LLVMType] = self.arg_tys;
+        let mut attrs: &[option::Option<Attribute>] = self.attrs;
         let mut j = 0u;
         let llretptr = if self.sret {
-            atys = vec::to_owned(atys.tail());
-            attrs = vec::to_owned(attrs.tail());
+            atys = atys.tail();
+            attrs = attrs.tail();
             j = 1u;
             get_param(llwrapfn, 0u)
         } else if self.ret_ty.cast {
diff --git a/src/librustc/middle/typeck/check/mod.rs b/src/librustc/middle/typeck/check/mod.rs
index 7ba759e63ee..61da263e843 100644
--- a/src/librustc/middle/typeck/check/mod.rs
+++ b/src/librustc/middle/typeck/check/mod.rs
@@ -3661,8 +3661,8 @@ pub fn check_intrinsic_type(ccx: @mut CrateCtxt, it: @ast::foreign_item) {
         ~"bswap64"  => (0, ~[ ty::mk_i64() ], ty::mk_i64()),
         ref other => {
             tcx.sess.span_err(it.span,
-                              ~"unrecognized intrinsic function: `" +
-                              (*other) + "`");
+                              fmt!("unrecognized intrinsic function: `%s`",
+                                   *other));
             return;
         }
     };
diff --git a/src/librustc/middle/typeck/mod.rs b/src/librustc/middle/typeck/mod.rs
index 5cb4928d514..5aa19ed5875 100644
--- a/src/librustc/middle/typeck/mod.rs
+++ b/src/librustc/middle/typeck/mod.rs
@@ -323,8 +323,8 @@ fn check_main_fn_ty(ccx: @mut CrateCtxt,
         }
         _ => {
             tcx.sess.span_bug(main_span,
-                              ~"main has a non-function type: found `" +
-                              ppaux::ty_to_str(tcx, main_t) + "`");
+                              fmt!("main has a non-function type: found `%s`",
+                                   ppaux::ty_to_str(tcx, main_t)));
         }
     }
 }
@@ -372,8 +372,8 @@ fn check_start_fn_ty(ccx: @mut CrateCtxt,
         }
         _ => {
             tcx.sess.span_bug(start_span,
-                              ~"start has a non-function type: found `" +
-                              ppaux::ty_to_str(tcx, start_t) + "`");
+                              fmt!("start has a non-function type: found `%s`",
+                                   ppaux::ty_to_str(tcx, start_t)));
         }
     }
 }
diff --git a/src/librustc/util/ppaux.rs b/src/librustc/util/ppaux.rs
index dcf631f0f7b..69e0f85522a 100644
--- a/src/librustc/util/ppaux.rs
+++ b/src/librustc/util/ppaux.rs
@@ -416,7 +416,7 @@ pub fn ty_to_str(cx: ctxt, typ: t) -> ~str {
       ty_rptr(r, ref tm) => {
         region_to_str_space(cx, "&", r) + mt_to_str(cx, tm)
       }
-      ty_unboxed_vec(ref tm) => { ~"unboxed_vec<" + mt_to_str(cx, tm) + ">" }
+      ty_unboxed_vec(ref tm) => { fmt!("unboxed_vec<%s>", mt_to_str(cx, tm)) }
       ty_type => ~"type",
       ty_tup(ref elems) => {
         let strs = elems.map(|elem| ty_to_str(cx, *elem));
diff --git a/src/librusti/rusti.rc b/src/librusti/rusti.rc
index d17379a2193..ff8b4092fab 100644
--- a/src/librusti/rusti.rc
+++ b/src/librusti/rusti.rc
@@ -272,12 +272,11 @@ fn run_cmd(repl: &mut Repl, _in: @io::Reader, _out: @io::Writer,
         }
         ~"help" => {
             println(
-                ~":{\\n ..lines.. \\n:}\\n - execute multiline command\n" +
-                ":load <crate> ... - \
-                  loads given crates as dynamic libraries\n" +
-                ":clear - clear the bindings\n" +
-                ":exit - exit from the repl\n" +
-                ":help - show this message");
+                ":{\\n ..lines.. \\n:}\\n - execute multiline command\n\
+                 :load <crate> ... - loads given crates as dynamic libraries\n\
+                 :clear - clear the bindings\n\
+                 :exit - exit from the repl\n\
+                 :help - show this message");
         }
         ~"load" => {
             let mut loaded_crates: ~[~str] = ~[];
diff --git a/src/libstd/os.rs b/src/libstd/os.rs
index cc36dcb92a2..446804f7b30 100644
--- a/src/libstd/os.rs
+++ b/src/libstd/os.rs
@@ -145,7 +145,7 @@ pub mod win32 {
     pub fn as_utf16_p<T>(s: &str, f: &fn(*u16) -> T) -> T {
         let mut t = str::to_utf16(s);
         // Null terminate before passing on.
-        t += ~[0u16];
+        t += [0u16];
         vec::as_imm_buf(t, |buf, _len| f(buf))
     }
 }
@@ -437,8 +437,7 @@ fn dup2(src: c_int, dst: c_int) -> c_int {
 
 /// Returns the proper dll filename for the given basename of a file.
 pub fn dll_filename(base: &str) -> ~str {
-    return str::to_owned(DLL_PREFIX) + str::to_owned(base) +
-           str::to_owned(DLL_SUFFIX)
+    fmt!("%s%s%s", DLL_PREFIX, base, DLL_SUFFIX)
 }
 
 /// Optionally returns the filesystem path to the current executable which is
diff --git a/src/libsyntax/parse/lexer.rs b/src/libsyntax/parse/lexer.rs
index 4a9ef2faa54..0e04e719020 100644
--- a/src/libsyntax/parse/lexer.rs
+++ b/src/libsyntax/parse/lexer.rs
@@ -448,7 +448,8 @@ fn scan_number(c: char, rdr: @mut StringReader) -> token::Token {
         is_float = true;
         bump(rdr);
         let dec_part = scan_digits(rdr, 10u);
-        num_str += ~"." + dec_part;
+        num_str += ".";
+        num_str += dec_part;
     }
     if is_float {
         match base {
diff --git a/src/test/bench/shootout-chameneos-redux.rs b/src/test/bench/shootout-chameneos-redux.rs
index 58b8a9cd47b..dcde474ace3 100644
--- a/src/test/bench/shootout-chameneos-redux.rs
+++ b/src/test/bench/shootout-chameneos-redux.rs
@@ -26,8 +26,8 @@ fn print_complements() {
     let all = ~[Blue, Red, Yellow];
     for vec::each(all) |aa| {
         for vec::each(all) |bb| {
-            io::println(show_color(*aa) + ~" + " + show_color(*bb) +
-                ~" -> " + show_color(transform(*aa, *bb)));
+            io::println(show_color(*aa) + " + " + show_color(*bb) +
+                " -> " + show_color(transform(*aa, *bb)));
         }
     }
 }
@@ -50,7 +50,7 @@ fn show_color(cc: color) -> ~str {
 fn show_color_list(set: ~[color]) -> ~str {
     let mut out = ~"";
     for vec::eachi(set) |_ii, col| {
-        out += ~" ";
+        out += " ";
         out += show_color(*col);
     }
     return out;
@@ -82,7 +82,7 @@ fn show_number(nn: uint) -> ~str {
     while num != 0 {
         dig = num % 10;
         num = num / 10;
-        out = show_digit(dig) + ~" " + out;
+        out = show_digit(dig) + " " + out;
     }
 
     return out;
@@ -131,8 +131,8 @@ fn creature(
             }
             option::None => {
                 // log creatures met and evil clones of self
-                let report = fmt!("%u", creatures_met) + ~" " +
-                             show_number(evil_clones_met);
+                let report = fmt!("%u %s",
+                                  creatures_met, show_number(evil_clones_met));
                 to_rendezvous_log.send(report);
                 break;
             }
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index 78a37f06bb9..3cff8baa829 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -49,7 +49,7 @@ fn make_cumulative(aa: ~[AminoAcids]) -> ~[AminoAcids] {
     let mut ans: ~[AminoAcids] = ~[];
     for aa.each |a| {
         cp += a.prob;
-        ans += ~[AminoAcids {ch: a.ch, prob: cp}];
+        ans += [AminoAcids {ch: a.ch, prob: cp}];
     }
     return ans;
 }
@@ -72,7 +72,7 @@ fn make_random_fasta(wr: @io::Writer,
                      desc: ~str,
                      genelist: ~[AminoAcids],
                      n: int) {
-    wr.write_line(~">" + id + ~" " + desc);
+    wr.write_line(~">" + id + " " + desc);
     let mut rng = rand::rng();
     let rng = @mut MyRandom {
         last: rng.next()
@@ -91,7 +91,7 @@ fn make_random_fasta(wr: @io::Writer,
 
 fn make_repeat_fasta(wr: @io::Writer, id: ~str, desc: ~str, s: ~str, n: int) {
     unsafe {
-        wr.write_line(~">" + id + ~" " + desc);
+        wr.write_line(~">" + id + " " + desc);
         let mut op: ~str = ~"";
         let sl: uint = str::len(s);
         for uint::range(0u, n as uint) |i| {
@@ -139,13 +139,13 @@ fn main() {
         make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
                          acid('t', 30u32)]);
     let alu: ~str =
-        ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
-            ~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
-            ~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
-            ~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
-            ~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
-            ~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
-            ~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+        ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
+          GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
+          CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
+          ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
+          GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
+          AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
+          AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
     make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2);
     make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3);
     make_random_fasta(writer, ~"THREE",
diff --git a/src/test/bench/sudoku.rs b/src/test/bench/sudoku.rs
index dbce9d60af7..8f12f2bd58e 100644
--- a/src/test/bench/sudoku.rs
+++ b/src/test/bench/sudoku.rs
@@ -103,7 +103,7 @@ pub impl Sudoku {
         for u8::range(0u8, 9u8) |row| {
             for u8::range(0u8, 9u8) |col| {
                 let color = self.grid[row][col];
-                if color == 0u8 { work += ~[(row, col)]; }
+                if color == 0u8 { work += [(row, col)]; }
             }
         }
 
diff --git a/src/test/bench/task-perf-alloc-unwind.rs b/src/test/bench/task-perf-alloc-unwind.rs
index a0363bd568a..7a04a06d6a6 100644
--- a/src/test/bench/task-perf-alloc-unwind.rs
+++ b/src/test/bench/task-perf-alloc-unwind.rs
@@ -96,7 +96,7 @@ fn recurse_or_fail(depth: int, st: Option<State>) {
                 fn_box: || @Cons((), fn_box()),
                 tuple: (@Cons((), st.tuple.first()),
                         ~Cons((), @*st.tuple.second())),
-                vec: st.vec + ~[@Cons((), *st.vec.last())],
+                vec: st.vec + [@Cons((), *st.vec.last())],
                 res: r(@Cons((), st.res._l))
             }
           }
diff --git a/src/test/run-pass/trait-to-str.rs b/src/test/run-pass/trait-to-str.rs
index ff01efc027e..9b94b785125 100644
--- a/src/test/run-pass/trait-to-str.rs
+++ b/src/test/run-pass/trait-to-str.rs
@@ -26,7 +26,7 @@ impl to_str for int {
 
 impl<T:to_str> to_str for ~[T] {
     fn to_str(&self) -> ~str {
-        ~"[" + str::connect(vec::map(*self, |e| e.to_str() ), ~", ") + ~"]"
+        ~"[" + str::connect(vec::map(*self, |e| e.to_str() ), ", ") + "]"
     }
 }