about summary refs log tree commit diff
diff options
context:
space:
mode:
authorAndre Bogus <bogusandre@gmail.com>2015-09-24 11:29:15 +0200
committerAndre Bogus <bogusandre@gmail.com>2015-09-24 11:29:15 +0200
commit960e85c8ea5e03df2836bb53f6d62979d67a1aab (patch)
tree7cf5ba9a135f1bf8468d83207c6e97af171e23c3
parent8fe79bdfdacb2f5914971bd1a0b63b9577afbf6a (diff)
downloadrust-960e85c8ea5e03df2836bb53f6d62979d67a1aab.tar.gz
rust-960e85c8ea5e03df2836bb53f6d62979d67a1aab.zip
change fasta benchmark to Veedrac's implementation
-rw-r--r--src/test/bench/shootout-fasta.rs392
1 files changed, 305 insertions, 87 deletions
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index accf525b4e6..a5731f150c6 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -39,114 +39,332 @@
 // OF THE POSSIBILITY OF SUCH DAMAGE.
 
 use std::cmp::min;
-use std::env;
-use std::fs::File;
-use std::io::{self, BufWriter};
-use std::io::prelude::*;
+use std::io::{self, Write};
+use std::sync::{Arc, Mutex};
+use std::thread;
 
-const LINE_LENGTH: usize = 60;
-const IM: u32 = 139968;
 
-struct MyRandom {
+const LINE_LEN: usize = 60;
+
+const BLOCK_LINES: usize = 512;
+const BLOCK_THOROUGHPUT: usize = LINE_LEN * BLOCK_LINES;
+const BLOCK_LEN: usize = BLOCK_THOROUGHPUT + BLOCK_LINES;
+
+const STDIN_BUF: usize = (LINE_LEN + 1) * 1024;
+
+
+const ALU: &'static [u8] =
+    b"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
+      GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
+      CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
+      ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
+      GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
+      AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
+      AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+const IUB: &'static [(u8, f32)] =
+    &[(b'a', 0.27), (b'c', 0.12), (b'g', 0.12),
+      (b't', 0.27), (b'B', 0.02), (b'D', 0.02),
+      (b'H', 0.02), (b'K', 0.02), (b'M', 0.02),
+      (b'N', 0.02), (b'R', 0.02), (b'S', 0.02),
+      (b'V', 0.02), (b'W', 0.02), (b'Y', 0.02)];
+
+const HOMOSAPIENS: &'static [(u8, f32)] =
+    &[(b'a', 0.3029549426680),
+      (b'c', 0.1979883004921),
+      (b'g', 0.1975473066391),
+      (b't', 0.3015094502008)];
+
+
+// We need a specific Rng,
+// so implement this manually
+const MODULUS: u32 = 139968;
+const MULTIPLIER: u32 = 3877;
+const ADDITIVE: u32 = 29573;
+
+// Why doesn't rust already have this?
+// Algorithm directly taken from Wikipedia
+fn powmod(mut base: u64, mut exponent: u32, modulus: u64) -> u64 {
+    let mut ret = 1;
+    base %= modulus;
+
+    while exponent > 0 {
+        if exponent & 1 == 1 {
+           ret *= base;
+           ret %= modulus;
+        }
+        exponent >>= 1;
+        base *= base;
+        base %= modulus;
+    }
+
+    ret
+}
+
+// Just a typical LCRNG
+pub struct Rng {
     last: u32
 }
-impl MyRandom {
-    fn new() -> MyRandom { MyRandom { last: 42 } }
-    fn normalize(p: f32) -> u32 {(p * IM as f32).floor() as u32}
-    fn gen(&mut self) -> u32 {
-        self.last = (self.last * 3877 + 29573) % IM;
+
+impl Rng {
+    pub fn new() -> Rng {
+        Rng { last: 42 }
+    }
+
+    pub fn max_value() -> u32 {
+        MODULUS - 1
+    }
+
+    pub fn normalize(p: f32) -> u32 {
+        (p * MODULUS as f32).floor() as u32
+    }
+
+    pub fn gen(&mut self) -> u32 {
+        self.last = (self.last * MULTIPLIER + ADDITIVE) % MODULUS;
         self.last
     }
+
+    // This allows us to fast-forward the RNG,
+    // allowing us to run it in parallel.
+    pub fn future(&self, n: u32) -> Rng {
+        let a = MULTIPLIER as u64;
+        let b = ADDITIVE as u64;
+        let m = MODULUS as u64;
+
+        //                          (a^n - 1) mod (a-1) m
+        // x_k = ((a^n x_0 mod m) + --------------------- b) mod m
+        //                                   a - 1
+        //
+        // Since (a - 1) divides (a^n - 1) mod (a-1) m,
+        // the subtraction does not overflow and thus can be non-modular.
+        //
+        let new_seed =
+            (powmod(a, n, m) * self.last as u64) % m +
+            (powmod(a, n, (a-1) * m) - 1) / (a-1) * b;
+
+        Rng { last: (new_seed % m) as u32 }
+    }
 }
 
-struct AAGen<'a> {
-    rng: &'a mut MyRandom,
-    data: Vec<(u32, u8)>
+
+// This will end up keeping track of threads, like
+// in the other multithreaded Rust version, in
+// order to keep writes in order.
+//
+// This is stolen from another multithreaded Rust
+// implementation, although that implementation
+// was not able to parallelize the RNG itself.
+struct BlockSubmitter<W: io::Write> {
+    writer: W,
+    pub waiting_on: usize,
 }
-impl<'a> AAGen<'a> {
-    fn new<'b>(rng: &'b mut MyRandom, aa: &[(char, f32)]) -> AAGen<'b> {
-        let mut cum = 0.;
-        let data = aa.iter()
-            .map(|&(ch, p)| { cum += p; (MyRandom::normalize(cum), ch as u8) })
-            .collect();
-        AAGen { rng: rng, data: data }
+
+impl<W: io::Write> BlockSubmitter<W> {
+    fn submit(&mut self, data: &[u8], block_num: usize) -> Option<io::Result<()>> {
+        if block_num == self.waiting_on {
+            self.waiting_on += 1;
+            Some(self.submit_async(data))
+        }
+        else {
+            None
+        }
     }
-}
-impl<'a> Iterator for AAGen<'a> {
-    type Item = u8;
-
-    fn next(&mut self) -> Option<u8> {
-        let r = self.rng.gen();
-        self.data.iter()
-            .skip_while(|pc| pc.0 < r)
-            .map(|&(_, c)| c)
-            .next()
+
+    fn submit_async(&mut self, data: &[u8]) -> io::Result<()> {
+        self.writer.write_all(data)
     }
 }
 
-fn make_fasta<W: Write, I: Iterator<Item=u8>>(
-    wr: &mut W, header: &str, mut it: I, mut n: usize)
-    -> io::Result<()>
+
+// For repeating strings as output
+fn fasta_static<W: io::Write>(
+    writer: &mut W,
+    header: &[u8],
+    data: &[u8],
+    mut n: usize
+) -> io::Result<()>
 {
-    try!(wr.write(header.as_bytes()));
-    let mut line = [0; LINE_LENGTH + 1];
+    // The aim here is to print a short(ish) string cyclically
+    // with line breaks as appropriate.
+    //
+    // The secret technique is to repeat the string such that
+    // any wanted line is a single offset in the string.
+    //
+    // This technique is stolen from the Haskell version.
+
+    try!(writer.write_all(header));
+
+    // Maximum offset is data.len(),
+    // Maximum read len is LINE_LEN
+    let stream = data.iter().cloned().cycle();
+    let mut extended: Vec<u8> = stream.take(data.len() + LINE_LEN + 1).collect();
+
+    let mut offset = 0;
     while n > 0 {
-        let nb = min(LINE_LENGTH, n);
-        for i in 0..nb {
-            line[i] = it.next().unwrap();
+        let write_len = min(LINE_LEN, n);
+        let end = offset + write_len;
+        n -= write_len;
+
+        let tmp = extended[end];
+        extended[end] = b'\n';
+        try!(writer.write_all(&extended[offset..end + 1]));
+        extended[end] = tmp;
+
+        offset = end;
+        offset %= data.len();
+    }
+
+    Ok(())
+}
+
+
+// For RNG streams as output
+fn fasta<W: io::Write + Send + 'static>(
+    submitter: &Arc<Mutex<BlockSubmitter<W>>>,
+    header: &[u8],
+    table: &[(u8, f32)],
+    rng: &mut Rng,
+    n: usize
+) -> io::Result<()>
+{
+    // There's another secret technique in use here:
+    // we generate a lookup table to cache search of the
+    // aa buffer.
+    //
+    // The secret technique used is stolen from Haskell's
+    // implementation, and is the main secret to the Haskell
+    // implementation's  speed.
+    fn gen_lookup_table(aa: &[(u8, f32)]) -> Vec<u8> {
+        let mut table = Vec::with_capacity(Rng::max_value() as usize + 1);
+
+        let mut cumulative_prob = 0.0;
+        let mut cumulative_norm = 0;
+
+        for &(byte, prob) in aa {
+            let last_norm = cumulative_norm;
+            cumulative_prob += prob;
+            cumulative_norm = min(Rng::max_value(), Rng::normalize(cumulative_prob)) + 1;
+
+            table.extend((0..cumulative_norm - last_norm).map(|_| byte));
         }
-        n -= nb;
-        line[nb] = '\n' as u8;
-        try!(wr.write(&line[..nb+1]));
+
+        table
+    }
+
+    {
+        try!(submitter.lock().unwrap().submit_async(header));
     }
+
+    let lookup_table = Arc::new(gen_lookup_table(table));
+
+    let thread_count = 4; // avoid external dependency
+    let mut threads = Vec::new();
+    for block_num in (0..thread_count) {
+        let offset = BLOCK_THOROUGHPUT * block_num;
+
+        let local_submitter = submitter.clone();
+        let local_lookup_table = lookup_table.clone();
+        let local_rng = rng.future(offset as u32);
+
+        threads.push(thread::spawn(move || {
+            gen_block(
+                local_submitter,
+                local_lookup_table,
+                local_rng,
+                n.saturating_sub(offset),
+                block_num,
+                thread_count
+            )
+        }));
+    }
+
+    for thread in threads {
+        try!(thread.join().unwrap());
+    }
+
+    *rng = rng.future(n as u32);
+
     Ok(())
 }
 
-fn run<W: Write>(writer: &mut W) -> io::Result<()> {
-    let mut args = env::args();
-    let n = if env::var_os("RUST_BENCH").is_some() {
-        25000000
-    } else if args.len() <= 1 {
-        1000
-    } else {
-        args.nth(1).unwrap().parse().unwrap()
-    };
-
-    let rng = &mut MyRandom::new();
-    let alu =
-        "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
-        GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
-        CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
-        ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
-        GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
-        AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
-        AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-    let iub = &[('a', 0.27), ('c', 0.12), ('g', 0.12),
-                ('t', 0.27), ('B', 0.02), ('D', 0.02),
-                ('H', 0.02), ('K', 0.02), ('M', 0.02),
-                ('N', 0.02), ('R', 0.02), ('S', 0.02),
-                ('V', 0.02), ('W', 0.02), ('Y', 0.02)];
-    let homosapiens = &[('a', 0.3029549426680),
-                        ('c', 0.1979883004921),
-                        ('g', 0.1975473066391),
-                        ('t', 0.3015094502008)];
-
-    try!(make_fasta(writer, ">ONE Homo sapiens alu\n",
-                    alu.as_bytes().iter().cycle().cloned(), n * 2));
-    try!(make_fasta(writer, ">TWO IUB ambiguity codes\n",
-                    AAGen::new(rng, iub), n * 3));
-    try!(make_fasta(writer, ">THREE Homo sapiens frequency\n",
-                    AAGen::new(rng, homosapiens), n * 5));
-
-    writer.flush()
+// A very optimized writer.
+// I have a feeling a simpler version wouldn't slow
+// things down too much, though, since the RNG
+// is the really heavy hitter.
+fn gen_block<W: io::Write>(
+    submitter: Arc<Mutex<BlockSubmitter<W>>>,
+    lookup_table: Arc<Vec<u8>>,
+    mut rng: Rng,
+    mut length: usize,
+    mut block_num: usize,
+    block_stride: usize,
+) -> io::Result<()>
+{
+    // Include newlines in block
+    length += length / LINE_LEN;
+    let block: &mut [u8] = &mut [b'\n'; BLOCK_LEN];
+
+    while length > 0 {
+        {
+            let gen_into = &mut block[..min(length, BLOCK_LEN)];
+
+            // Write random numbers, skipping newlines
+            for (i, byte) in gen_into.iter_mut().enumerate() {
+                if (i + 1) % (LINE_LEN + 1) != 0 {
+                    *byte = lookup_table[rng.gen() as usize];
+                }
+            }
+        }
+
+        let write_out = {
+            if length >= BLOCK_LEN               { &mut *block }
+            else if length % (LINE_LEN + 1) == 0 { &mut block[..length] }
+            else                                 { &mut block[..length + 1] }
+        };
+
+        *write_out.last_mut().unwrap() = b'\n';
+        loop {
+            match submitter.lock().unwrap().submit(write_out, block_num) {
+                Some(result) => { try!(result); break; }
+                None => std::thread::yield_now()
+            }
+        }
+        block_num += block_stride;
+        rng = rng.future((BLOCK_THOROUGHPUT * (block_stride - 1)) as u32);
+        length = length.saturating_sub(BLOCK_LEN * (block_stride - 1));
+
+        length = length.saturating_sub(BLOCK_LEN);
+    }
+
+    Ok(())
 }
 
+
+fn run<W: io::Write + Send + 'static>(writer: W) -> io::Result<()> {
+    let n = std::env::args_os().nth(1)
+        .and_then(|s| s.into_string().ok())
+        .and_then(|n| n.parse().ok())
+        .unwrap_or(1000);
+
+    let rng = &mut Rng::new();
+
+    // Use automatic buffering for the static version...
+    let mut writer = io::BufWriter::with_capacity(STDIN_BUF, writer);
+    try!(fasta_static(&mut writer, b">ONE Homo sapiens alu\n", ALU, n * 2));
+
+    // ...but the dynamic version does its own buffering already
+    let writer = try!(writer.into_inner());
+    let submitter = Arc::new(Mutex::new(BlockSubmitter { writer: writer, waiting_on: 0 }));
+
+    { submitter.lock().unwrap().waiting_on = 0; }
+    try!(fasta(&submitter, b">TWO IUB ambiguity codes\n", &IUB, rng, n * 3));
+    { submitter.lock().unwrap().waiting_on = 0; }
+    try!(fasta(&submitter, b">THREE Homo sapiens frequency\n", &HOMOSAPIENS, rng, n * 5));
+
+    Ok(())
+}
+
+
 fn main() {
-    let res = if env::var_os("RUST_BENCH").is_some() {
-        let mut file = BufWriter::new(File::create("./shootout-fasta.data").unwrap());
-        run(&mut file)
-    } else {
-        run(&mut io::stdout())
-    };
-    res.unwrap()
+    run(io::stdout()).unwrap()
 }