diff options
| author | Nick Cameron <ncameron@mozilla.com> | 2014-12-20 15:20:51 +1300 |
|---|---|---|
| committer | Nick Cameron <ncameron@mozilla.com> | 2014-12-20 15:23:29 +1300 |
| commit | 2e86929a4a5a36f3993e577b4582ba70d84bbb40 (patch) | |
| tree | 7b3e8049edae74dde7a870a7173afed6f9fc744e /src/test | |
| parent | cbe9fb45bc705a89f23b434c686544d490923596 (diff) | |
| download | rust-2e86929a4a5a36f3993e577b4582ba70d84bbb40.tar.gz rust-2e86929a4a5a36f3993e577b4582ba70d84bbb40.zip | |
Allow use of `[_ ; n]` syntax for fixed length and repeating arrays.
This does NOT break any existing programs because the `[_, ..n]` syntax is also supported.
Diffstat (limited to 'src/test')
118 files changed, 245 insertions, 259 deletions
diff --git a/src/test/auxiliary/nested_item.rs b/src/test/auxiliary/nested_item.rs index 96bae656390..d97a2e3cda1 100644 --- a/src/test/auxiliary/nested_item.rs +++ b/src/test/auxiliary/nested_item.rs @@ -28,7 +28,7 @@ impl<T> Foo { pub struct Parser<T>; impl<T: std::iter::Iterator<char>> Parser<T> { fn in_doctype(&mut self) { - static DOCTYPEPattern: [char, ..6] = ['O', 'C', 'T', 'Y', 'P', 'E']; + static DOCTYPEPattern: [char; 6] = ['O', 'C', 'T', 'Y', 'P', 'E']; } } diff --git a/src/test/bench/noise.rs b/src/test/bench/noise.rs index 025f8467d20..75cf864ce49 100644 --- a/src/test/bench/noise.rs +++ b/src/test/bench/noise.rs @@ -37,20 +37,20 @@ fn gradient(orig: Vec2, grad: Vec2, p: Vec2) -> f32 { } struct Noise2DContext { - rgradients: [Vec2, ..256], - permutations: [i32, ..256], + rgradients: [Vec2; 256], + permutations: [i32; 256], } impl Noise2DContext { fn new() -> Noise2DContext { let mut rng = StdRng::new().unwrap(); - let mut rgradients = [Vec2 { x: 0.0, y: 0.0 }, ..256]; + let mut rgradients = [Vec2 { x: 0.0, y: 0.0 }; 256]; for x in rgradients.iter_mut() { *x = random_gradient(&mut rng); } - let mut permutations = [0i32, ..256]; + let mut permutations = [0i32; 256]; for (i, x) in permutations.iter_mut().enumerate() { *x = i as i32; } @@ -65,7 +65,7 @@ impl Noise2DContext { self.rgradients[(idx & 255) as uint] } - fn get_gradients(&self, x: f32, y: f32) -> ([Vec2, ..4], [Vec2, ..4]) { + fn get_gradients(&self, x: f32, y: f32) -> ([Vec2; 4], [Vec2; 4]) { let x0f = x.floor(); let y0f = y.floor(); let x1f = x0f + 1.0; @@ -102,7 +102,7 @@ impl Noise2DContext { fn main() { let symbols = [' ', '░', '▒', '▓', '█', '█']; - let mut pixels = [0f32, ..256*256]; + let mut pixels = [0f32; 256*256]; let n2d = Noise2DContext::new(); for _ in range(0u, 100) { diff --git a/src/test/bench/shootout-fannkuch-redux.rs b/src/test/bench/shootout-fannkuch-redux.rs index 4849421a3f0..723b2b722d7 100644 --- a/src/test/bench/shootout-fannkuch-redux.rs +++ b/src/test/bench/shootout-fannkuch-redux.rs @@ -64,14 +64,14 @@ fn next_permutation(perm: &mut [i32], count: &mut [i32]) { } struct P { - p: [i32, .. 16], + p: [i32; 16], } impl Copy for P {} struct Perm { - cnt: [i32, .. 16], - fact: [u32, .. 16], + cnt: [i32; 16], + fact: [u32; 16], n: u32, permcount: u32, perm: P, @@ -81,21 +81,21 @@ impl Copy for Perm {} impl Perm { fn new(n: u32) -> Perm { - let mut fact = [1, .. 16]; + let mut fact = [1; 16]; for i in range(1, n as uint + 1) { fact[i] = fact[i - 1] * i as u32; } Perm { - cnt: [0, .. 16], + cnt: [0; 16], fact: fact, n: n, permcount: 0, - perm: P { p: [0, .. 16 ] } + perm: P { p: [0; 16 ] } } } fn get(&mut self, mut idx: i32) -> P { - let mut pp = [0u8, .. 16]; + let mut pp = [0u8; 16]; self.permcount = idx as u32; for (i, place) in self.perm.p.iter_mut().enumerate() { *place = i as i32 + 1; diff --git a/src/test/bench/shootout-fasta-redux.rs b/src/test/bench/shootout-fasta-redux.rs index afffbe5bed4..eb18cfdaed3 100644 --- a/src/test/bench/shootout-fasta-redux.rs +++ b/src/test/bench/shootout-fasta-redux.rs @@ -64,7 +64,7 @@ const ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\ const NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 }; -static IUB: [AminoAcid, ..15] = [ +static IUB: [AminoAcid;15] = [ AminoAcid { c: 'a' as u8, p: 0.27 }, AminoAcid { c: 'c' as u8, p: 0.12 }, AminoAcid { c: 'g' as u8, p: 0.12 }, @@ -82,7 +82,7 @@ static IUB: [AminoAcid, ..15] = [ AminoAcid { c: 'Y' as u8, p: 0.02 }, ]; -static HOMO_SAPIENS: [AminoAcid, ..4] = [ +static HOMO_SAPIENS: [AminoAcid;4] = [ AminoAcid { c: 'a' as u8, p: 0.3029549426680 }, AminoAcid { c: 'c' as u8, p: 0.1979883004921 }, AminoAcid { c: 'g' as u8, p: 0.1975473066391 }, @@ -148,8 +148,8 @@ impl<'a, W: Writer> RepeatFasta<'a, W> { } } -fn make_lookup(a: &[AminoAcid]) -> [AminoAcid, ..LOOKUP_SIZE] { - let mut lookup = [ NULL_AMINO_ACID, ..LOOKUP_SIZE ]; +fn make_lookup(a: &[AminoAcid]) -> [AminoAcid;LOOKUP_SIZE] { + let mut lookup = [ NULL_AMINO_ACID;LOOKUP_SIZE ]; let mut j = 0; for (i, slot) in lookup.iter_mut().enumerate() { while a[j].p < (i as f32) { @@ -162,7 +162,7 @@ fn make_lookup(a: &[AminoAcid]) -> [AminoAcid, ..LOOKUP_SIZE] { struct RandomFasta<'a, W:'a> { seed: u32, - lookup: [AminoAcid, ..LOOKUP_SIZE], + lookup: [AminoAcid;LOOKUP_SIZE], out: &'a mut W, } @@ -193,7 +193,7 @@ impl<'a, W: Writer> RandomFasta<'a, W> { fn make(&mut self, n: uint) -> IoResult<()> { let lines = n / LINE_LEN; let chars_left = n % LINE_LEN; - let mut buf = [0, ..LINE_LEN + 1]; + let mut buf = [0;LINE_LEN + 1]; for _ in range(0, lines) { for i in range(0u, LINE_LEN) { diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs index 1f0bed05521..2de61cf3572 100644 --- a/src/test/bench/shootout-fasta.rs +++ b/src/test/bench/shootout-fasta.rs @@ -89,7 +89,7 @@ fn make_fasta<W: Writer, I: Iterator<u8>>( -> std::io::IoResult<()> { try!(wr.write(header.as_bytes())); - let mut line = [0u8, .. LINE_LENGTH + 1]; + let mut line = [0u8; LINE_LENGTH + 1]; while n > 0 { let nb = min(LINE_LENGTH, n); for i in range(0, nb) { diff --git a/src/test/bench/shootout-k-nucleotide.rs b/src/test/bench/shootout-k-nucleotide.rs index d112fe60674..8521e2216e9 100644 --- a/src/test/bench/shootout-k-nucleotide.rs +++ b/src/test/bench/shootout-k-nucleotide.rs @@ -46,10 +46,10 @@ use std::string::String; use std::slice; use std::sync::{Arc, Future}; -static TABLE: [u8, ..4] = [ 'A' as u8, 'C' as u8, 'G' as u8, 'T' as u8 ]; +static TABLE: [u8;4] = [ 'A' as u8, 'C' as u8, 'G' as u8, 'T' as u8 ]; static TABLE_SIZE: uint = 2 << 16; -static OCCURRENCES: [&'static str, ..5] = [ +static OCCURRENCES: [&'static str;5] = [ "GGT", "GGTA", "GGTATT", diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs index 3f36c16aff6..dab67331120 100644 --- a/src/test/bench/shootout-nbody.rs +++ b/src/test/bench/shootout-nbody.rs @@ -45,7 +45,7 @@ const SOLAR_MASS: f64 = 4.0 * PI * PI; const YEAR: f64 = 365.24; const N_BODIES: uint = 5; -static BODIES: [Planet, ..N_BODIES] = [ +static BODIES: [Planet;N_BODIES] = [ // Sun Planet { x: 0.0, y: 0.0, z: 0.0, @@ -102,7 +102,7 @@ struct Planet { impl Copy for Planet {} -fn advance(bodies: &mut [Planet, ..N_BODIES], dt: f64, steps: int) { +fn advance(bodies: &mut [Planet;N_BODIES], dt: f64, steps: int) { for _ in range(0, steps) { let mut b_slice = bodies.as_mut_slice(); loop { @@ -135,7 +135,7 @@ fn advance(bodies: &mut [Planet, ..N_BODIES], dt: f64, steps: int) { } } -fn energy(bodies: &[Planet, ..N_BODIES]) -> f64 { +fn energy(bodies: &[Planet;N_BODIES]) -> f64 { let mut e = 0.0; let mut bodies = bodies.iter(); loop { @@ -155,7 +155,7 @@ fn energy(bodies: &[Planet, ..N_BODIES]) -> f64 { e } -fn offset_momentum(bodies: &mut [Planet, ..N_BODIES]) { +fn offset_momentum(bodies: &mut [Planet;N_BODIES]) { let mut px = 0.0; let mut py = 0.0; let mut pz = 0.0; diff --git a/src/test/bench/shootout-reverse-complement.rs b/src/test/bench/shootout-reverse-complement.rs index 312ee2dd27e..d746ec1dbab 100644 --- a/src/test/bench/shootout-reverse-complement.rs +++ b/src/test/bench/shootout-reverse-complement.rs @@ -50,17 +50,17 @@ use std::ptr::{copy_memory}; use std::io::{IoResult, EndOfFile}; struct Tables { - table8: [u8, ..1 << 8], - table16: [u16, ..1 << 16] + table8: [u8;1 << 8], + table16: [u16;1 << 16] } impl Tables { fn new() -> Tables { - let mut table8 = [0, ..1 << 8]; + let mut table8 = [0;1 << 8]; for (i, v) in table8.iter_mut().enumerate() { *v = Tables::computed_cpl8(i as u8); } - let mut table16 = [0, ..1 << 16]; + let mut table16 = [0;1 << 16]; for (i, v) in table16.iter_mut().enumerate() { *v = table8[i & 255] as u16 << 8 | table8[i >> 8] as u16; diff --git a/src/test/bench/sudoku.rs b/src/test/bench/sudoku.rs index c55f85f40e8..5fb7e2c3a84 100644 --- a/src/test/bench/sudoku.rs +++ b/src/test/bench/sudoku.rs @@ -46,7 +46,7 @@ impl Sudoku { return Sudoku { grid: g } } - pub fn from_vec(vec: &[[u8, ..9], ..9]) -> Sudoku { + pub fn from_vec(vec: &[[u8;9];9]) -> Sudoku { let g = Vec::from_fn(9u, |i| { Vec::from_fn(9u, |j| { vec[i][j] }) }); @@ -198,7 +198,7 @@ impl Colors { } } -static DEFAULT_SUDOKU: [[u8, ..9], ..9] = [ +static DEFAULT_SUDOKU: [[u8;9];9] = [ /* 0 1 2 3 4 5 6 7 8 */ /* 0 */ [0u8, 4u8, 0u8, 6u8, 0u8, 0u8, 0u8, 3u8, 2u8], /* 1 */ [0u8, 0u8, 8u8, 0u8, 2u8, 0u8, 0u8, 0u8, 0u8], @@ -212,7 +212,7 @@ static DEFAULT_SUDOKU: [[u8, ..9], ..9] = [ ]; #[cfg(test)] -static DEFAULT_SOLUTION: [[u8, ..9], ..9] = [ +static DEFAULT_SOLUTION: [[u8;9];9] = [ /* 0 1 2 3 4 5 6 7 8 */ /* 0 */ [1u8, 4u8, 9u8, 6u8, 7u8, 5u8, 8u8, 3u8, 2u8], /* 1 */ [5u8, 3u8, 8u8, 1u8, 2u8, 9u8, 7u8, 4u8, 6u8], diff --git a/src/test/compile-fail/better-expected.rs b/src/test/compile-fail/better-expected.rs index 489f892726a..2e0f2a174c6 100644 --- a/src/test/compile-fail/better-expected.rs +++ b/src/test/compile-fail/better-expected.rs @@ -9,5 +9,5 @@ // except according to those terms. fn main() { - let x: [int ..3]; //~ ERROR expected one of `(`, `+`, `,`, `::`, or `]`, found `..` + let x: [int 3]; //~ ERROR expected one of `(`, `+`, `,`, `::`, `;`, or `]`, found `3` } diff --git a/src/test/compile-fail/borrowck-for-loop-correct-cmt-for-pattern.rs b/src/test/compile-fail/borrowck-for-loop-correct-cmt-for-pattern.rs index 93a4383b4f5..f0d42bb9ac1 100644 --- a/src/test/compile-fail/borrowck-for-loop-correct-cmt-for-pattern.rs +++ b/src/test/compile-fail/borrowck-for-loop-correct-cmt-for-pattern.rs @@ -11,7 +11,7 @@ // Issue #16205. struct Foo { - a: [Box<int>, ..3], + a: [Box<int>; 3], } fn main() { diff --git a/src/test/compile-fail/coercion-slice.rs b/src/test/compile-fail/coercion-slice.rs index bb020688f58..b6b46fadb13 100644 --- a/src/test/compile-fail/coercion-slice.rs +++ b/src/test/compile-fail/coercion-slice.rs @@ -8,8 +8,8 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -// Tests that we forbid coercion from `[T, ..n]` to `&[T]` +// Tests that we forbid coercion from `[T; n]` to `&[T]` fn main() { - let _: &[int] = [0i]; //~ERROR: mismatched types: expected `&[int]`, found `[int, ..1]` + let _: &[int] = [0i]; //~ERROR: mismatched types: expected `&[int]`, found `[int; 1]` } diff --git a/src/test/compile-fail/const-cast-wrong-type.rs b/src/test/compile-fail/const-cast-wrong-type.rs index 223426dc7c6..b3597441834 100644 --- a/src/test/compile-fail/const-cast-wrong-type.rs +++ b/src/test/compile-fail/const-cast-wrong-type.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static a: [u8, ..3] = ['h' as u8, 'i' as u8, 0 as u8]; +static a: [u8; 3] = ['h' as u8, 'i' as u8, 0 as u8]; static b: *const i8 = &a as *const i8; //~ ERROR mismatched types fn main() { diff --git a/src/test/compile-fail/dst-bad-coerce1.rs b/src/test/compile-fail/dst-bad-coerce1.rs index 59499ac070d..c77ae25e0cf 100644 --- a/src/test/compile-fail/dst-bad-coerce1.rs +++ b/src/test/compile-fail/dst-bad-coerce1.rs @@ -20,9 +20,9 @@ trait Bar {} pub fn main() { // With a vec of ints. let f1 = Fat { ptr: [1, 2, 3] }; - let f2: &Fat<[int, ..3]> = &f1; + let f2: &Fat<[int; 3]> = &f1; let f3: &Fat<[uint]> = f2; - //~^ ERROR mismatched types: expected `&Fat<[uint]>`, found `&Fat<[int, ..3]>` + //~^ ERROR mismatched types: expected `&Fat<[uint]>`, found `&Fat<[int; 3]>` // With a trait. let f1 = Fat { ptr: Foo }; diff --git a/src/test/compile-fail/dst-bad-coerce2.rs b/src/test/compile-fail/dst-bad-coerce2.rs index e1a754b6332..6eb650e9781 100644 --- a/src/test/compile-fail/dst-bad-coerce2.rs +++ b/src/test/compile-fail/dst-bad-coerce2.rs @@ -21,7 +21,7 @@ impl Bar for Foo {} pub fn main() { // With a vec of ints. let f1 = Fat { ptr: [1, 2, 3] }; - let f2: &Fat<[int, ..3]> = &f1; + let f2: &Fat<[int; 3]> = &f1; let f3: &mut Fat<[int]> = f2; //~ ERROR mismatched types // With a trait. diff --git a/src/test/compile-fail/dst-bad-coerce3.rs b/src/test/compile-fail/dst-bad-coerce3.rs index 7cf647a26d7..b0bd5176374 100644 --- a/src/test/compile-fail/dst-bad-coerce3.rs +++ b/src/test/compile-fail/dst-bad-coerce3.rs @@ -21,7 +21,7 @@ impl Bar for Foo {} fn baz<'a>() { // With a vec of ints. let f1 = Fat { ptr: [1, 2, 3] }; - let f2: &Fat<[int, ..3]> = &f1; //~ ERROR `f1` does not live long enough + let f2: &Fat<[int; 3]> = &f1; //~ ERROR `f1` does not live long enough let f3: &'a Fat<[int]> = f2; // With a trait. diff --git a/src/test/compile-fail/dst-bad-coerce4.rs b/src/test/compile-fail/dst-bad-coerce4.rs index 9010185f76b..783a32d6302 100644 --- a/src/test/compile-fail/dst-bad-coerce4.rs +++ b/src/test/compile-fail/dst-bad-coerce4.rs @@ -17,6 +17,6 @@ struct Fat<Sized? T> { pub fn main() { // With a vec of ints. let f1: &Fat<[int]> = &Fat { ptr: [1, 2, 3] }; - let f2: &Fat<[int, ..3]> = f1; - //~^ ERROR mismatched types: expected `&Fat<[int, ..3]>`, found `&Fat<[int]>` + let f2: &Fat<[int; 3]> = f1; + //~^ ERROR mismatched types: expected `&Fat<[int; 3]>`, found `&Fat<[int]>` } diff --git a/src/test/compile-fail/dst-bad-deep.rs b/src/test/compile-fail/dst-bad-deep.rs index 506322d41f5..0833a74f1da 100644 --- a/src/test/compile-fail/dst-bad-deep.rs +++ b/src/test/compile-fail/dst-bad-deep.rs @@ -18,7 +18,7 @@ struct Fat<Sized? T> { } pub fn main() { - let f: Fat<[int, ..3]> = Fat { ptr: [5i, 6, 7] }; + let f: Fat<[int; 3]> = Fat { ptr: [5i, 6, 7] }; let g: &Fat<[int]> = &f; let h: &Fat<Fat<[int]>> = &Fat { ptr: *g }; //~^ ERROR the trait `core::kinds::Sized` is not implemented diff --git a/src/test/compile-fail/huge-array-simple.rs b/src/test/compile-fail/huge-array-simple.rs index 17f85c7bd2b..a9dda771b7f 100644 --- a/src/test/compile-fail/huge-array-simple.rs +++ b/src/test/compile-fail/huge-array-simple.rs @@ -11,5 +11,5 @@ // error-pattern: too big for the current fn main() { - let fat : [u8, ..(1<<61)+(1<<31)] = [0, ..(1u64<<61) as uint +(1u64<<31) as uint]; + let fat : [u8; (1<<61)+(1<<31)] = [0; (1u64<<61) as uint +(1u64<<31) as uint]; } diff --git a/src/test/compile-fail/huge-array.rs b/src/test/compile-fail/huge-array.rs index 4b91564154b..029e9651cb3 100644 --- a/src/test/compile-fail/huge-array.rs +++ b/src/test/compile-fail/huge-array.rs @@ -8,13 +8,13 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -// error-pattern: ..1518599999 +// error-pattern:; 1518599999 fn generic<T: Copy>(t: T) { - let s: [T, ..1518600000] = [t, ..1518600000]; + let s: [T; 1518600000] = [t; 1518600000]; } fn main() { - let x: [u8, ..1518599999] = [0, ..1518599999]; - generic::<[u8, ..1518599999]>(x); + let x: [u8; 1518599999] = [0; 1518599999]; + generic::<[u8; 1518599999]>(x); } diff --git a/src/test/compile-fail/huge-enum.rs b/src/test/compile-fail/huge-enum.rs index 4a85cb5753b..7c7a75abf3f 100644 --- a/src/test/compile-fail/huge-enum.rs +++ b/src/test/compile-fail/huge-enum.rs @@ -14,10 +14,10 @@ #[cfg(target_word_size = "32")] fn main() { - let big: Option<[u32, ..(1<<29)-1]> = None; + let big: Option<[u32; (1<<29)-1]> = None; } #[cfg(target_word_size = "64")] fn main() { - let big: Option<[u32, ..(1<<45)-1]> = None; + let big: Option<[u32; (1<<45)-1]> = None; } diff --git a/src/test/compile-fail/issue-13446.rs b/src/test/compile-fail/issue-13446.rs index 162324b7c59..a0a7660428d 100644 --- a/src/test/compile-fail/issue-13446.rs +++ b/src/test/compile-fail/issue-13446.rs @@ -13,7 +13,7 @@ // error-pattern: mismatched types -static VEC: [u32, ..256] = vec!(); +static VEC: [u32; 256] = vec!(); fn main() {} diff --git a/src/test/compile-fail/issue-13482-2.rs b/src/test/compile-fail/issue-13482-2.rs index 4ec8c2b1b7e..ef7d3d4d158 100644 --- a/src/test/compile-fail/issue-13482-2.rs +++ b/src/test/compile-fail/issue-13482-2.rs @@ -14,7 +14,7 @@ fn main() { let x = [1,2]; let y = match x { [] => None, - //~^ ERROR types: expected `[_#0i, ..2]`, found `[_#7t, ..0]` + //~^ ERROR types: expected `[_#0i; 2]`, found `[_#7t; 0]` // (expected array of 2 elements, found array of 0 elements) [a,_] => Some(a) }; diff --git a/src/test/compile-fail/issue-13482.rs b/src/test/compile-fail/issue-13482.rs index 18070ed53b0..157280b1719 100644 --- a/src/test/compile-fail/issue-13482.rs +++ b/src/test/compile-fail/issue-13482.rs @@ -12,7 +12,7 @@ fn main() { let x = [1,2]; let y = match x { [] => None, -//~^ ERROR types: expected `[_, ..2]`, found `[_, ..0]` +//~^ ERROR types: expected `[_; 2]`, found `[_; 0]` // (expected array of 2 elements, found array of 0 elements) [a,_] => Some(a) }; diff --git a/src/test/compile-fail/issue-14845.rs b/src/test/compile-fail/issue-14845.rs index bc606d8139f..5166d84a025 100644 --- a/src/test/compile-fail/issue-14845.rs +++ b/src/test/compile-fail/issue-14845.rs @@ -10,15 +10,15 @@ struct X { - a: [u8, ..1] + a: [u8; 1] } fn main() { let x = X { a: [0] }; let _f = &x.a as *mut u8; - //~^ ERROR mismatched types: expected `*mut u8`, found `&[u8, ..1]` + //~^ ERROR mismatched types: expected `*mut u8`, found `&[u8; 1]` let local = [0u8]; let _v = &local as *mut u8; - //~^ ERROR mismatched types: expected `*mut u8`, found `&[u8, ..1]` + //~^ ERROR mismatched types: expected `*mut u8`, found `&[u8; 1]` } diff --git a/src/test/compile-fail/issue-17252.rs b/src/test/compile-fail/issue-17252.rs index 4a6b80d765b..4adb3f041a3 100644 --- a/src/test/compile-fail/issue-17252.rs +++ b/src/test/compile-fail/issue-17252.rs @@ -11,10 +11,10 @@ static FOO: uint = FOO; //~ ERROR recursive constant fn main() { - let _x: [u8, ..FOO]; // caused stack overflow prior to fix + let _x: [u8; FOO]; // caused stack overflow prior to fix let _y: uint = 1 + { static BAR: uint = BAR; //~ ERROR recursive constant - let _z: [u8, ..BAR]; // caused stack overflow prior to fix + let _z: [u8; BAR]; // caused stack overflow prior to fix 1 }; } diff --git a/src/test/compile-fail/issue-17441.rs b/src/test/compile-fail/issue-17441.rs index 11c815da1c7..e5da5c5504e 100644 --- a/src/test/compile-fail/issue-17441.rs +++ b/src/test/compile-fail/issue-17441.rs @@ -10,7 +10,7 @@ fn main() { let _foo = &[1u, 2] as [uint]; - //~^ ERROR cast to unsized type: `&[uint, ..2]` as `[uint]` + //~^ ERROR cast to unsized type: `&[uint; 2]` as `[uint]` //~^^ HELP consider using an implicit coercion to `&[uint]` instead let _bar = box 1u as std::fmt::Show; //~^ ERROR cast to unsized type: `Box<uint>` as `core::fmt::Show` @@ -19,6 +19,6 @@ fn main() { //~^ ERROR cast to unsized type: `uint` as `core::fmt::Show` //~^^ HELP consider using a box or reference as appropriate let _quux = [1u, 2] as [uint]; - //~^ ERROR cast to unsized type: `[uint, ..2]` as `[uint]` + //~^ ERROR cast to unsized type: `[uint; 2]` as `[uint]` //~^^ HELP consider using a box or reference as appropriate } diff --git a/src/test/compile-fail/issue-17718-borrow-interior.rs b/src/test/compile-fail/issue-17718-borrow-interior.rs index 1f763dbdc9f..8aa5fdf1c4d 100644 --- a/src/test/compile-fail/issue-17718-borrow-interior.rs +++ b/src/test/compile-fail/issue-17718-borrow-interior.rs @@ -15,7 +15,7 @@ static B: &'static uint = &A.a; static C: &'static uint = &(A.a); //~^ ERROR: cannot refer to the interior of another static -static D: [uint, ..1] = [1]; +static D: [uint; 1] = [1]; static E: uint = D[0]; //~^ ERROR: cannot refer to other statics by value static F: &'static uint = &D[0]; diff --git a/src/test/compile-fail/issue-19244-1.rs b/src/test/compile-fail/issue-19244-1.rs index 7ca83f21305..fafe6377397 100644 --- a/src/test/compile-fail/issue-19244-1.rs +++ b/src/test/compile-fail/issue-19244-1.rs @@ -11,6 +11,6 @@ const TUP: (uint,) = (42,); fn main() { - let a: [int, ..TUP.1]; + let a: [int; TUP.1]; //~^ ERROR expected constant expr for array length: tuple index out of bounds } diff --git a/src/test/compile-fail/issue-19244-2.rs b/src/test/compile-fail/issue-19244-2.rs index d9aeecc0222..95965ca35f9 100644 --- a/src/test/compile-fail/issue-19244-2.rs +++ b/src/test/compile-fail/issue-19244-2.rs @@ -12,6 +12,6 @@ struct MyStruct { field: uint } const STRUCT: MyStruct = MyStruct { field: 42 }; fn main() { - let a: [int, ..STRUCT.nonexistent_field]; + let a: [int; STRUCT.nonexistent_field]; //~^ ERROR expected constant expr for array length: nonexistent struct field } diff --git a/src/test/compile-fail/issue-2149.rs b/src/test/compile-fail/issue-2149.rs index 1150f40db76..3343e92252f 100644 --- a/src/test/compile-fail/issue-2149.rs +++ b/src/test/compile-fail/issue-2149.rs @@ -22,5 +22,5 @@ impl<A> vec_monad<A> for Vec<A> { } fn main() { ["hi"].bind(|x| [x] ); - //~^ ERROR type `[&str, ..1]` does not implement any method in scope named `bind` + //~^ ERROR type `[&str; 1]` does not implement any method in scope named `bind` } diff --git a/src/test/compile-fail/issue-4517.rs b/src/test/compile-fail/issue-4517.rs index f61ed35fca3..1c5fd9be1bd 100644 --- a/src/test/compile-fail/issue-4517.rs +++ b/src/test/compile-fail/issue-4517.rs @@ -11,8 +11,8 @@ fn bar(int_param: int) {} fn main() { - let foo: [u8, ..4] = [1u8, ..4u]; + let foo: [u8; 4] = [1u8; 4u]; bar(foo); - //~^ ERROR mismatched types: expected `int`, found `[u8, ..4]` + //~^ ERROR mismatched types: expected `int`, found `[u8; 4]` // (expected int, found vector) } diff --git a/src/test/compile-fail/lint-uppercase-variables.rs b/src/test/compile-fail/lint-uppercase-variables.rs index eb5c475e7ef..19373c806f1 100644 --- a/src/test/compile-fail/lint-uppercase-variables.rs +++ b/src/test/compile-fail/lint-uppercase-variables.rs @@ -29,7 +29,7 @@ fn main() { println!("{}", Test); let mut f = File::open(&Path::new("something.txt")); - let mut buff = [0u8, ..16]; + let mut buff = [0u8; 16]; match f.read(&mut buff) { Ok(cnt) => println!("read this many bytes: {}", cnt), Err(IoError{ kind: EndOfFile, .. }) => println!("Got end of file: {}", EndOfFile.to_string()), diff --git a/src/test/compile-fail/move-fragments-9.rs b/src/test/compile-fail/move-fragments-9.rs index ce05087f659..0b095ff6f82 100644 --- a/src/test/compile-fail/move-fragments-9.rs +++ b/src/test/compile-fail/move-fragments-9.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -// Test moving array structures, e.g. `[T, ..3]` as well as moving +// Test moving array structures, e.g. `[T; 3]` as well as moving // elements in and out of such arrays. // // Note also that the `test_move_array_then_overwrite` tests represent @@ -18,14 +18,14 @@ pub struct D { d: int } impl Drop for D { fn drop(&mut self) { } } #[rustc_move_fragments] -pub fn test_move_array_via_return(a: [D, ..3]) -> [D, ..3] { +pub fn test_move_array_via_return(a: [D; 3]) -> [D; 3] { //~^ ERROR assigned_leaf_path: `$(local a)` //~| ERROR moved_leaf_path: `$(local a)` return a; } #[rustc_move_fragments] -pub fn test_move_array_into_recv(a: [D, ..3], recv: &mut [D, ..3]) { +pub fn test_move_array_into_recv(a: [D; 3], recv: &mut [D; 3]) { //~^ ERROR parent_of_fragments: `$(local recv)` //~| ERROR assigned_leaf_path: `$(local a)` //~| ERROR moved_leaf_path: `$(local a)` @@ -34,7 +34,7 @@ pub fn test_move_array_into_recv(a: [D, ..3], recv: &mut [D, ..3]) { } #[rustc_move_fragments] -pub fn test_extract_array_elem(a: [D, ..3], i: uint) -> D { +pub fn test_extract_array_elem(a: [D; 3], i: uint) -> D { //~^ ERROR parent_of_fragments: `$(local a)` //~| ERROR assigned_leaf_path: `$(local i)` //~| ERROR moved_leaf_path: `$(local a).[]` @@ -43,7 +43,7 @@ pub fn test_extract_array_elem(a: [D, ..3], i: uint) -> D { } #[rustc_move_fragments] -pub fn test_overwrite_array_elem(mut a: [D, ..3], i: uint, d: D) { +pub fn test_overwrite_array_elem(mut a: [D; 3], i: uint, d: D) { //~^ ERROR parent_of_fragments: `$(local mut a)` //~| ERROR assigned_leaf_path: `$(local i)` //~| ERROR assigned_leaf_path: `$(local d)` @@ -59,7 +59,7 @@ pub fn test_overwrite_array_elem(mut a: [D, ..3], i: uint, d: D) { // See RFC PR 320 for more discussion. #[rustc_move_fragments] -pub fn test_move_array_then_overwrite_elem1(mut a: [D, ..3], i: uint, recv: &mut [D, ..3], d: D) { +pub fn test_move_array_then_overwrite_elem1(mut a: [D; 3], i: uint, recv: &mut [D; 3], d: D) { //~^ ERROR parent_of_fragments: `$(local mut a)` //~| ERROR parent_of_fragments: `$(local recv)` //~| ERROR assigned_leaf_path: `$(local recv).*` @@ -76,8 +76,8 @@ pub fn test_move_array_then_overwrite_elem1(mut a: [D, ..3], i: uint, recv: &mut } #[rustc_move_fragments] -pub fn test_move_array_then_overwrite_elem2(mut a: [D, ..3], i: uint, j: uint, - recv: &mut [D, ..3], d1: D, d2: D) { +pub fn test_move_array_then_overwrite_elem2(mut a: [D; 3], i: uint, j: uint, + recv: &mut [D; 3], d1: D, d2: D) { //~^^ ERROR parent_of_fragments: `$(local mut a)` //~| ERROR parent_of_fragments: `$(local recv)` //~| ERROR assigned_leaf_path: `$(local recv).*` diff --git a/src/test/compile-fail/moves-based-on-type-exprs.rs b/src/test/compile-fail/moves-based-on-type-exprs.rs index 678808f166c..d8d84e558a9 100644 --- a/src/test/compile-fail/moves-based-on-type-exprs.rs +++ b/src/test/compile-fail/moves-based-on-type-exprs.rs @@ -89,7 +89,7 @@ fn f100() { fn f110() { let x = vec!("hi".to_string()); - let _y = [x.into_iter().next().unwrap(), ..1]; + let _y = [x.into_iter().next().unwrap(); 1]; touch(&x); //~ ERROR use of moved value: `x` } diff --git a/src/test/compile-fail/non-constant-enum-for-vec-repeat.rs b/src/test/compile-fail/non-constant-enum-for-vec-repeat.rs index 3ccce591ee7..a1dc2ab2041 100644 --- a/src/test/compile-fail/non-constant-enum-for-vec-repeat.rs +++ b/src/test/compile-fail/non-constant-enum-for-vec-repeat.rs @@ -11,6 +11,6 @@ enum State { ST_NULL, ST_WHITESPACE } fn main() { - [State::ST_NULL, ..(State::ST_WHITESPACE as uint)]; + [State::ST_NULL; (State::ST_WHITESPACE as uint)]; //~^ ERROR expected constant integer for repeat count, found non-constant expression } diff --git a/src/test/compile-fail/non-constant-expr-for-fixed-len-vec.rs b/src/test/compile-fail/non-constant-expr-for-fixed-len-vec.rs index 91551941c06..85d734ddaf2 100644 --- a/src/test/compile-fail/non-constant-expr-for-fixed-len-vec.rs +++ b/src/test/compile-fail/non-constant-expr-for-fixed-len-vec.rs @@ -12,7 +12,7 @@ fn main() { fn bar(n: int) { - let _x: [int, ..n]; + let _x: [int; n]; //~^ ERROR expected constant expr for array length: non-constant path in constant expr } } diff --git a/src/test/compile-fail/non-constant-expr-for-vec-repeat.rs b/src/test/compile-fail/non-constant-expr-for-vec-repeat.rs index 299e9d3dced..2e063e5237c 100644 --- a/src/test/compile-fail/non-constant-expr-for-vec-repeat.rs +++ b/src/test/compile-fail/non-constant-expr-for-vec-repeat.rs @@ -12,6 +12,6 @@ fn main() { fn bar(n: uint) { - let _x = [0, ..n]; //~ ERROR expected constant integer for repeat count, found variable + let _x = [0; n]; //~ ERROR expected constant integer for repeat count, found variable } } diff --git a/src/test/compile-fail/non-exhaustive-pattern-witness.rs b/src/test/compile-fail/non-exhaustive-pattern-witness.rs index 6e1c3db1014..d35e3ad3c55 100644 --- a/src/test/compile-fail/non-exhaustive-pattern-witness.rs +++ b/src/test/compile-fail/non-exhaustive-pattern-witness.rs @@ -12,7 +12,7 @@ struct Foo { first: bool, - second: Option<[uint, ..4]> + second: Option<[uint; 4]> } enum Color { diff --git a/src/test/compile-fail/packed-struct-generic-transmute.rs b/src/test/compile-fail/packed-struct-generic-transmute.rs index d699f69864e..5c0aba42b96 100644 --- a/src/test/compile-fail/packed-struct-generic-transmute.rs +++ b/src/test/compile-fail/packed-struct-generic-transmute.rs @@ -33,7 +33,7 @@ struct Oof<T, S> { fn main() { let foo = Foo { bar: [1u8, 2, 3, 4, 5], baz: 10i32 }; unsafe { - let oof: Oof<[u8, .. 5], i32> = mem::transmute(foo); + let oof: Oof<[u8; 5], i32> = mem::transmute(foo); println!("{} {}", oof.rab[], oof.zab); } } diff --git a/src/test/compile-fail/removed-syntax-fixed-vec.rs b/src/test/compile-fail/removed-syntax-fixed-vec.rs index fe49d1f4a8d..0a8420c19c3 100644 --- a/src/test/compile-fail/removed-syntax-fixed-vec.rs +++ b/src/test/compile-fail/removed-syntax-fixed-vec.rs @@ -8,4 +8,4 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -type v = [int * 3]; //~ ERROR expected one of `(`, `+`, `,`, `::`, or `]`, found `*` +type v = [int * 3]; //~ ERROR expected one of `(`, `+`, `,`, `::`, `;`, or `]`, found `*` diff --git a/src/test/compile-fail/removed-syntax-mut-vec-expr.rs b/src/test/compile-fail/removed-syntax-mut-vec-expr.rs index 437f871f8ea..30302bbd16e 100644 --- a/src/test/compile-fail/removed-syntax-mut-vec-expr.rs +++ b/src/test/compile-fail/removed-syntax-mut-vec-expr.rs @@ -11,5 +11,5 @@ fn f() { let v = [mut 1, 2, 3, 4]; //~^ ERROR expected identifier, found keyword `mut` - //~^^ ERROR expected one of `!`, `,`, `.`, `::`, `]`, `{`, or an operator, found `1` + //~^^ ERROR expected one of `!`, `,`, `.`, `::`, `;`, `]`, `{`, or an operator, found `1` } diff --git a/src/test/compile-fail/removed-syntax-mut-vec-ty.rs b/src/test/compile-fail/removed-syntax-mut-vec-ty.rs index af469fadf98..9c6056bd72a 100644 --- a/src/test/compile-fail/removed-syntax-mut-vec-ty.rs +++ b/src/test/compile-fail/removed-syntax-mut-vec-ty.rs @@ -10,4 +10,4 @@ type v = [mut int]; //~^ ERROR expected identifier, found keyword `mut` - //~^^ ERROR expected one of `(`, `+`, `,`, `::`, or `]`, found `int` + //~^^ ERROR expected one of `(`, `+`, `,`, `::`, `;`, or `]`, found `int` diff --git a/src/test/compile-fail/repeat-to-run-dtor-twice.rs b/src/test/compile-fail/repeat-to-run-dtor-twice.rs index 8fdf586b3d1..d3126cf44d1 100644 --- a/src/test/compile-fail/repeat-to-run-dtor-twice.rs +++ b/src/test/compile-fail/repeat-to-run-dtor-twice.rs @@ -24,6 +24,6 @@ impl Drop for Foo { fn main() { let a = Foo { x: 3 }; - let _ = [ a, ..5 ]; + let _ = [ a; 5 ]; //~^ ERROR the trait `core::kinds::Copy` is not implemented for the type `Foo` } diff --git a/src/test/compile-fail/repeat_count.rs b/src/test/compile-fail/repeat_count.rs index 38fbb426fb1..3b0ef0c293a 100644 --- a/src/test/compile-fail/repeat_count.rs +++ b/src/test/compile-fail/repeat_count.rs @@ -12,18 +12,18 @@ fn main() { let n = 1; - let a = [0, ..n]; //~ ERROR expected constant integer for repeat count, found variable - let b = [0, ..()]; + let a = [0; n]; //~ ERROR expected constant integer for repeat count, found variable + let b = [0; ()]; //~^ ERROR expected constant integer for repeat count, found non-constant expression //~^^ ERROR: expected `uint`, found `()` - let c = [0, ..true]; //~ ERROR expected positive integer for repeat count, found boolean + let c = [0; true]; //~ ERROR expected positive integer for repeat count, found boolean //~^ ERROR: expected `uint`, found `bool` - let d = [0, ..0.5]; //~ ERROR expected positive integer for repeat count, found float + let d = [0; 0.5]; //~ ERROR expected positive integer for repeat count, found float //~^ ERROR: expected `uint`, found `_` - let e = [0, .."foo"]; //~ ERROR expected positive integer for repeat count, found string + let e = [0; "foo"]; //~ ERROR expected positive integer for repeat count, found string //~^ ERROR: expected `uint`, found `&'static str` - let f = [0, ..-4]; + let f = [0; -4]; //~^ ERROR expected positive integer for repeat count, found negative integer - let f = [0u, ..-1]; + let f = [0u; -1]; //~^ ERROR expected positive integer for repeat count, found negative integer } diff --git a/src/test/compile-fail/static-vec-repeat-not-constant.rs b/src/test/compile-fail/static-vec-repeat-not-constant.rs index 03be2cc8f0f..ff84ed5bf0c 100644 --- a/src/test/compile-fail/static-vec-repeat-not-constant.rs +++ b/src/test/compile-fail/static-vec-repeat-not-constant.rs @@ -10,7 +10,7 @@ fn foo() -> int { 23 } -static a: [int, ..2] = [foo(), ..2]; +static a: [int; 2] = [foo(); 2]; //~^ ERROR: function calls in constants are limited to struct and enum constructors fn main() {} diff --git a/src/test/compile-fail/trailing-comma-array-repeat.rs b/src/test/compile-fail/trailing-comma-array-repeat.rs deleted file mode 100644 index dadd6571583..00000000000 --- a/src/test/compile-fail/trailing-comma-array-repeat.rs +++ /dev/null @@ -1,13 +0,0 @@ -// Copyright 2014 The Rust Project Developers. See the COPYRIGHT -// file at the top-level directory of this distribution and at -// http://rust-lang.org/COPYRIGHT. -// -// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or -// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license -// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your -// option. This file may not be copied, modified, or distributed -// except according to those terms. - -fn main() { - let [_, ..,] = [(), ()]; //~ ERROR unexpected token: `]` -} diff --git a/src/test/compile-fail/transmute-type-parameters.rs b/src/test/compile-fail/transmute-type-parameters.rs index 53391a0e894..2286c0e75bd 100644 --- a/src/test/compile-fail/transmute-type-parameters.rs +++ b/src/test/compile-fail/transmute-type-parameters.rs @@ -20,7 +20,7 @@ unsafe fn g<T>(x: (T, int)) { let _: int = transmute(x); //~ ERROR cannot transmute } -unsafe fn h<T>(x: [T, ..10]) { +unsafe fn h<T>(x: [T; 10]) { let _: int = transmute(x); //~ ERROR cannot transmute } diff --git a/src/test/compile-fail/vector-cast-weirdness.rs b/src/test/compile-fail/vector-cast-weirdness.rs index e096e5eb436..c5109ce473e 100644 --- a/src/test/compile-fail/vector-cast-weirdness.rs +++ b/src/test/compile-fail/vector-cast-weirdness.rs @@ -12,20 +12,20 @@ // presence of the `_` type shorthand notation. struct X { - y: [u8, ..2], + y: [u8; 2], } fn main() { let x1 = X { y: [0, 0] }; let p1: *const u8 = &x1.y as *const _; //~ ERROR mismatched types - let t1: *const [u8, ..2] = &x1.y as *const _; - let h1: *const [u8, ..2] = &x1.y as *const [u8, ..2]; + let t1: *const [u8; 2] = &x1.y as *const _; + let h1: *const [u8; 2] = &x1.y as *const [u8; 2]; let mut x1 = X { y: [0, 0] }; let p1: *mut u8 = &mut x1.y as *mut _; //~ ERROR mismatched types - let t1: *mut [u8, ..2] = &mut x1.y as *mut _; - let h1: *mut [u8, ..2] = &mut x1.y as *mut [u8, ..2]; + let t1: *mut [u8; 2] = &mut x1.y as *mut _; + let h1: *mut [u8; 2] = &mut x1.y as *mut [u8; 2]; } diff --git a/src/test/debuginfo/evec-in-struct.rs b/src/test/debuginfo/evec-in-struct.rs index aab9c446a9e..786868f6b89 100644 --- a/src/test/debuginfo/evec-in-struct.rs +++ b/src/test/debuginfo/evec-in-struct.rs @@ -53,28 +53,28 @@ #![allow(unused_variables)] struct NoPadding1 { - x: [u32, ..3], + x: [u32; 3], y: i32, - z: [f32, ..2] + z: [f32; 2] } struct NoPadding2 { - x: [u32, ..3], - y: [[u32, ..2], ..2] + x: [u32; 3], + y: [[u32; 2]; 2] } struct StructInternalPadding { - x: [i16, ..2], - y: [i64, ..2] + x: [i16; 2], + y: [i64; 2] } struct SingleVec { - x: [i16, ..5] + x: [i16; 5] } struct StructPaddedAtEnd { - x: [i64, ..2], - y: [i16, ..2] + x: [i64; 2], + y: [i16; 2] } fn main() { diff --git a/src/test/debuginfo/lexical-scopes-in-block-expression.rs b/src/test/debuginfo/lexical-scopes-in-block-expression.rs index a1f34aea0f2..41dee642fea 100644 --- a/src/test/debuginfo/lexical-scopes-in-block-expression.rs +++ b/src/test/debuginfo/lexical-scopes-in-block-expression.rs @@ -450,7 +450,7 @@ fn main() { sentinel(); val - }, ..10]; + }; 10]; zzz(); // #break sentinel(); @@ -491,7 +491,7 @@ fn main() { sentinel(); // index expression - let a_vector = [10i, ..20]; + let a_vector = [10i; 20]; let _ = a_vector[{ zzz(); // #break sentinel(); diff --git a/src/test/debuginfo/recursive-struct.rs b/src/test/debuginfo/recursive-struct.rs index 032b8b1fa26..8cc0fdabfc2 100644 --- a/src/test/debuginfo/recursive-struct.rs +++ b/src/test/debuginfo/recursive-struct.rs @@ -143,7 +143,7 @@ fn main() { value: 2, }; - let vec_unique: [UniqueNode<f32>, ..1] = [UniqueNode { + let vec_unique: [UniqueNode<f32>; 1] = [UniqueNode { next: Val { val: box UniqueNode { next: Empty, diff --git a/src/test/debuginfo/type-names.rs b/src/test/debuginfo/type-names.rs index d72b080409e..286c44667c5 100644 --- a/src/test/debuginfo/type-names.rs +++ b/src/test/debuginfo/type-names.rs @@ -99,10 +99,10 @@ // VECTORS // gdb-command:whatis fixed_size_vec1 -// gdb-check:type = struct ([type-names::Struct1, ..3], i16) +// gdb-check:type = struct ([type-names::Struct1; 3], i16) // gdb-command:whatis fixed_size_vec2 -// gdb-check:type = struct ([uint, ..3], i16) +// gdb-check:type = struct ([uint; 3], i16) // gdb-command:whatis slice1 // gdb-check:type = struct &[uint] diff --git a/src/test/debuginfo/vec.rs b/src/test/debuginfo/vec.rs index fd422a90e63..00c93653cf4 100644 --- a/src/test/debuginfo/vec.rs +++ b/src/test/debuginfo/vec.rs @@ -30,7 +30,7 @@ #![allow(unused_variables)] -static mut VECT: [i32, ..3] = [1, 2, 3]; +static mut VECT: [i32; 3] = [1, 2, 3]; fn main() { let a = [1i, 2, 3]; diff --git a/src/test/pretty/blank-lines.rs b/src/test/pretty/blank-lines.rs index 24eb5337d25..1774edd3f76 100644 --- a/src/test/pretty/blank-lines.rs +++ b/src/test/pretty/blank-lines.rs @@ -9,7 +9,7 @@ // except according to those terms. // pp-exact -fn f() -> [int, ..3] { +fn f() -> [int; 3] { let picard = 0; let data = 1; diff --git a/src/test/pretty/issue-4264.pp b/src/test/pretty/issue-4264.pp index b5ea9bd4b89..974af1e6f3e 100644 --- a/src/test/pretty/issue-4264.pp +++ b/src/test/pretty/issue-4264.pp @@ -21,26 +21,26 @@ use std::prelude::*; // #4264 fixed-length vector types -pub fn foo(_: [int, ..(3 as uint)]) { } +pub fn foo(_: [int; (3 as uint)]) { } pub fn bar() { const FOO: uint = ((5u as uint) - (4u as uint) as uint); - let _: [(), ..(FOO as uint)] = ([(() as ())] as [(), ..1]); + let _: [(); (FOO as uint)] = ([(() as ())] as [(); 1]); - let _: [(), ..(1u as uint)] = ([(() as ())] as [(), ..1]); + let _: [(); (1u as uint)] = ([(() as ())] as [(); 1]); let _ = - (((&((([(1i as int), (2 as int), (3 as int)] as [int, ..3])) as - [int, ..3]) as &[int, ..3]) as *const _ as *const [int, ..3]) - as *const [int, ..(3u as uint)] as *const [int, ..3]); + (((&((([(1i as int), (2 as int), (3 as int)] as [int; 3])) as + [int; 3]) as &[int; 3]) as *const _ as *const [int; 3]) as + *const [int; (3u as uint)] as *const [int; 3]); (match (() as ()) { () => { #[inline] #[allow(dead_code)] static __STATIC_FMTSTR: &'static [&'static str] = - (&([("test" as &'static str)] as [&'static str, ..1]) as - &'static [&'static str, ..1]); + (&([("test" as &'static str)] as [&'static str; 1]) as + &'static [&'static str; 1]); @@ -57,9 +57,9 @@ pub fn bar() { &'static [&'static str]), (&([] as - [core::fmt::Argument<'_>, ..0]) + [core::fmt::Argument<'_>; 0]) as - &[core::fmt::Argument<'_>, ..0])) + &[core::fmt::Argument<'_>; 0])) as core::fmt::Arguments<'_>) as @@ -68,18 +68,17 @@ pub fn bar() { } } as collections::string::String); } -pub type Foo = [int, ..(3u as uint)]; +pub type Foo = [int; (3u as uint)]; pub struct Bar { - pub x: [int, ..(3u as uint)], + pub x: [int; (3u as uint)], } -pub struct TupleBar([int, ..(4u as uint)]); -pub enum Baz { BazVariant([int, ..(5u as uint)]), } +pub struct TupleBar([int; (4u as uint)]); +pub enum Baz { BazVariant([int; (5u as uint)]), } pub fn id<T>(x: T) -> T { (x as T) } pub fn use_id() { let _ = - ((id::<[int, ..(3u as uint)]> as - fn([int, ..3]) -> [int, ..3])(([(1 as int), (2 as int), - (3 as int)] as [int, ..3])) as - [int, ..3]); + ((id::<[int; (3u as uint)]> as + fn([int; 3]) -> [int; 3])(([(1 as int), (2 as int), (3 as int)] + as [int; 3])) as [int; 3]); } fn main() { } diff --git a/src/test/run-make/no-stack-check/attr.rs b/src/test/run-make/no-stack-check/attr.rs index ef2db932b41..7d0fc2d7fe5 100644 --- a/src/test/run-make/no-stack-check/attr.rs +++ b/src/test/run-make/no-stack-check/attr.rs @@ -20,6 +20,6 @@ extern { #[no_stack_check] pub unsafe fn foo() { // Make sure we use the stack - let x: [u8, ..50] = [0, ..50]; + let x: [u8; 50] = [0; 50]; black_box(x.as_ptr()); } diff --git a/src/test/run-make/no-stack-check/flag.rs b/src/test/run-make/no-stack-check/flag.rs index ee0364001e1..2b6e7240d6f 100644 --- a/src/test/run-make/no-stack-check/flag.rs +++ b/src/test/run-make/no-stack-check/flag.rs @@ -19,6 +19,6 @@ extern { pub unsafe fn foo() { // Make sure we use the stack - let x: [u8, ..50] = [0, ..50]; + let x: [u8; 50] = [0; 50]; black_box(x.as_ptr()); } diff --git a/src/test/run-make/target-specs/foo.rs b/src/test/run-make/target-specs/foo.rs index cab98204b17..fd112034f40 100644 --- a/src/test/run-make/target-specs/foo.rs +++ b/src/test/run-make/target-specs/foo.rs @@ -21,7 +21,7 @@ trait Sized { } fn start(_main: *const u8, _argc: int, _argv: *const *const u8) -> int { 0 } extern { - fn _foo() -> [u8, ..16]; + fn _foo() -> [u8; 16]; } fn _main() { diff --git a/src/test/run-pass/cast-in-array-size.rs b/src/test/run-pass/cast-in-array-size.rs index aaffb013ad8..717ca3ff9fe 100644 --- a/src/test/run-pass/cast-in-array-size.rs +++ b/src/test/run-pass/cast-in-array-size.rs @@ -13,8 +13,8 @@ const SIZE: int = 25; fn main() { - let _a: [bool, ..1 as uint]; - let _b: [int, ..SIZE as uint] = [1, ..SIZE as uint]; - let _c: [bool, ..'\n' as uint] = [true, ..'\n' as uint]; - let _d: [bool, ..true as uint] = [true, ..true as uint]; + let _a: [bool; 1 as uint]; + let _b: [int; SIZE as uint] = [1; SIZE as uint]; + let _c: [bool; '\n' as uint] = [true; '\n' as uint]; + let _d: [bool; true as uint] = [true; true as uint]; } diff --git a/src/test/run-pass/check-static-slice.rs b/src/test/run-pass/check-static-slice.rs index 60daedec4c7..6e2cfedf9ec 100644 --- a/src/test/run-pass/check-static-slice.rs +++ b/src/test/run-pass/check-static-slice.rs @@ -11,11 +11,11 @@ // Check that the various ways of getting to a reference to a vec (both sized // and unsized) work properly. -const aa: [int, ..3] = [1, 2, 3]; -const ab: &'static [int, ..3] = &aa; +const aa: [int; 3] = [1, 2, 3]; +const ab: &'static [int; 3] = &aa; const ac: &'static [int] = ab; const ad: &'static [int] = &aa; -const ae: &'static [int, ..3] = &[1, 2, 3]; +const ae: &'static [int; 3] = &[1, 2, 3]; const af: &'static [int] = &[1, 2, 3]; static ca: int = aa[0]; diff --git a/src/test/run-pass/const-autoderef.rs b/src/test/run-pass/const-autoderef.rs index e80ed7c984b..71312fb3878 100644 --- a/src/test/run-pass/const-autoderef.rs +++ b/src/test/run-pass/const-autoderef.rs @@ -8,9 +8,9 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static A: [u8, ..1] = ['h' as u8]; +static A: [u8; 1] = ['h' as u8]; static B: u8 = (&A)[0]; -static C: &'static &'static &'static &'static [u8, ..1] = & & & &A; +static C: &'static &'static &'static &'static [u8; 1] = & & & &A; static D: u8 = (&C)[0]; pub fn main() { diff --git a/src/test/run-pass/const-enum-vec-index.rs b/src/test/run-pass/const-enum-vec-index.rs index fef6c8624cf..4c8124d28a2 100644 --- a/src/test/run-pass/const-enum-vec-index.rs +++ b/src/test/run-pass/const-enum-vec-index.rs @@ -12,7 +12,7 @@ enum E { V1(int), V0 } const C: &'static [E] = &[E::V0, E::V1(0xDEADBEE)]; static C0: E = C[0]; static C1: E = C[1]; -const D: &'static [E, ..2] = &[E::V0, E::V1(0xDEADBEE)]; +const D: &'static [E; 2] = &[E::V0, E::V1(0xDEADBEE)]; static D0: E = C[0]; static D1: E = C[1]; diff --git a/src/test/run-pass/const-enum-vector.rs b/src/test/run-pass/const-enum-vector.rs index 83687f8775b..6eb5c2dab38 100644 --- a/src/test/run-pass/const-enum-vector.rs +++ b/src/test/run-pass/const-enum-vector.rs @@ -9,7 +9,7 @@ // except according to those terms. enum E { V1(int), V0 } -static C: [E, ..3] = [E::V0, E::V1(0xDEADBEE), E::V0]; +static C: [E; 3] = [E::V0, E::V1(0xDEADBEE), E::V0]; pub fn main() { match C[1] { diff --git a/src/test/run-pass/const-expr-in-fixed-length-vec.rs b/src/test/run-pass/const-expr-in-fixed-length-vec.rs index 317a54e927f..6317c2eec18 100644 --- a/src/test/run-pass/const-expr-in-fixed-length-vec.rs +++ b/src/test/run-pass/const-expr-in-fixed-length-vec.rs @@ -14,6 +14,6 @@ pub fn main() { const FOO: uint = 2; - let _v: [int, ..FOO*3]; + let _v: [int; FOO*3]; } diff --git a/src/test/run-pass/const-expr-in-vec-repeat.rs b/src/test/run-pass/const-expr-in-vec-repeat.rs index 54386b33dd9..d692f3a87e4 100644 --- a/src/test/run-pass/const-expr-in-vec-repeat.rs +++ b/src/test/run-pass/const-expr-in-vec-repeat.rs @@ -13,6 +13,6 @@ pub fn main() { const FOO: uint = 2; - let _v = [0i, ..FOO*3*2/2]; + let _v = [0i; FOO*3*2/2]; } diff --git a/src/test/run-pass/const-fields-and-indexing.rs b/src/test/run-pass/const-fields-and-indexing.rs index 49b244a162b..0819e0becbf 100644 --- a/src/test/run-pass/const-fields-and-indexing.rs +++ b/src/test/run-pass/const-fields-and-indexing.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -const x : [int, ..4] = [1,2,3,4]; +const x : [int; 4] = [1,2,3,4]; static p : int = x[2]; const y : &'static [int] = &[1,2,3,4]; static q : int = y[2]; diff --git a/src/test/run-pass/const-region-ptrs-noncopy.rs b/src/test/run-pass/const-region-ptrs-noncopy.rs index 5e417efb4b5..e8081005d4a 100644 --- a/src/test/run-pass/const-region-ptrs-noncopy.rs +++ b/src/test/run-pass/const-region-ptrs-noncopy.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -type Big = [u64, ..8]; +type Big = [u64; 8]; struct Pair<'a> { a: int, b: &'a Big } const x: &'static Big = &([13, 14, 10, 13, 11, 14, 14, 15]); const y: &'static Pair<'static> = &Pair {a: 15, b: x}; diff --git a/src/test/run-pass/const-str-ptr.rs b/src/test/run-pass/const-str-ptr.rs index 47d59eca263..d6f0296619a 100644 --- a/src/test/run-pass/const-str-ptr.rs +++ b/src/test/run-pass/const-str-ptr.rs @@ -10,8 +10,8 @@ use std::{str, string}; -const A: [u8, ..2] = ['h' as u8, 'i' as u8]; -const B: &'static [u8, ..2] = &A; +const A: [u8; 2] = ['h' as u8, 'i' as u8]; +const B: &'static [u8; 2] = &A; const C: *const u8 = B as *const u8; pub fn main() { diff --git a/src/test/run-pass/const-vecs-and-slices.rs b/src/test/run-pass/const-vecs-and-slices.rs index 1a2a3e36e87..26874b9f9d5 100644 --- a/src/test/run-pass/const-vecs-and-slices.rs +++ b/src/test/run-pass/const-vecs-and-slices.rs @@ -8,9 +8,9 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static x : [int, ..4] = [1,2,3,4]; +static x : [int; 4] = [1,2,3,4]; static y : &'static [int] = &[1,2,3,4]; -static z : &'static [int, ..4] = &[1,2,3,4]; +static z : &'static [int; 4] = &[1,2,3,4]; static zz : &'static [int] = &[1,2,3,4]; pub fn main() { diff --git a/src/test/run-pass/dst-struct.rs b/src/test/run-pass/dst-struct.rs index bf5b300f7cf..3644ca81d56 100644 --- a/src/test/run-pass/dst-struct.rs +++ b/src/test/run-pass/dst-struct.rs @@ -120,7 +120,7 @@ pub fn main() { assert!((*f2)[1] == 2); // Nested Box. - let f1 : Box<Fat<[int, ..3]>> = box Fat { f1: 5, f2: "some str", ptr: [1, 2, 3] }; + let f1 : Box<Fat<[int; 3]>> = box Fat { f1: 5, f2: "some str", ptr: [1, 2, 3] }; foo(&*f1); let f2 : Box<Fat<[int]>> = f1; foo(&*f2); diff --git a/src/test/run-pass/enum-vec-initializer.rs b/src/test/run-pass/enum-vec-initializer.rs index 0256420ac4c..d436916c279 100644 --- a/src/test/run-pass/enum-vec-initializer.rs +++ b/src/test/run-pass/enum-vec-initializer.rs @@ -16,9 +16,9 @@ const BAR:uint = Flopsy::Bunny as uint; const BAR2:uint = BAR; pub fn main() { - let _v = [0i, .. Flopsy::Bunny as uint]; - let _v = [0i, .. BAR]; - let _v = [0i, .. BAR2]; + let _v = [0i; Flopsy::Bunny as uint]; + let _v = [0i; BAR]; + let _v = [0i; BAR2]; const BAR3:uint = BAR2; - let _v = [0i, .. BAR3]; + let _v = [0i; BAR3]; } diff --git a/src/test/run-pass/evec-internal.rs b/src/test/run-pass/evec-internal.rs index 36b5f86aeda..28b5f781b5c 100644 --- a/src/test/run-pass/evec-internal.rs +++ b/src/test/run-pass/evec-internal.rs @@ -13,16 +13,16 @@ // Doesn't work; needs a design decision. pub fn main() { - let x : [int, ..5] = [1,2,3,4,5]; - let _y : [int, ..5] = [1,2,3,4,5]; + let x : [int; 5] = [1,2,3,4,5]; + let _y : [int; 5] = [1,2,3,4,5]; let mut z = [1,2,3,4,5]; z = x; assert_eq!(z[0], 1); assert_eq!(z[4], 5); - let a : [int, ..5] = [1,1,1,1,1]; - let b : [int, ..5] = [2,2,2,2,2]; - let c : [int, ..5] = [2,2,2,2,3]; + let a : [int; 5] = [1,1,1,1,1]; + let b : [int; 5] = [2,2,2,2,2]; + let c : [int; 5] = [2,2,2,2,3]; log(debug, a); diff --git a/src/test/run-pass/huge-largest-array.rs b/src/test/run-pass/huge-largest-array.rs index d494e0bf40d..e24731546ed 100644 --- a/src/test/run-pass/huge-largest-array.rs +++ b/src/test/run-pass/huge-largest-array.rs @@ -12,10 +12,10 @@ use std::mem::size_of; #[cfg(target_word_size = "32")] pub fn main() { - assert_eq!(size_of::<[u8, ..(1 << 31) - 1]>(), (1 << 31) - 1); + assert_eq!(size_of::<[u8; (1 << 31) - 1]>(), (1 << 31) - 1); } #[cfg(target_word_size = "64")] pub fn main() { - assert_eq!(size_of::<[u8, ..(1 << 47) - 1]>(), (1 << 47) - 1); + assert_eq!(size_of::<[u8; (1 << 47) - 1]>(), (1 << 47) - 1); } diff --git a/src/test/run-pass/issue-11205.rs b/src/test/run-pass/issue-11205.rs index ea138311f19..549a70f19e3 100644 --- a/src/test/run-pass/issue-11205.rs +++ b/src/test/run-pass/issue-11205.rs @@ -12,22 +12,22 @@ trait Foo {} impl Foo for int {} -fn foo(_: [&Foo, ..2]) {} +fn foo(_: [&Foo; 2]) {} fn foos(_: &[&Foo]) {} fn foog<T>(_: &[T], _: &[T]) {} -fn bar(_: [Box<Foo>, ..2]) {} +fn bar(_: [Box<Foo>; 2]) {} fn bars(_: &[Box<Foo>]) {} fn main() { - let x: [&Foo, ..2] = [&1i, &2i]; + let x: [&Foo; 2] = [&1i, &2i]; foo(x); foo([&1i, &2i]); let r = &1i; - let x: [&Foo, ..2] = [r, ..2]; + let x: [&Foo; 2] = [r; 2]; foo(x); - foo([&1i, ..2]); + foo([&1i; 2]); let x: &[&Foo] = &[&1i, &2i]; foos(x); @@ -37,7 +37,7 @@ fn main() { let r = &1i; foog(x, &[r]); - let x: [Box<Foo>, ..2] = [box 1i, box 2i]; + let x: [Box<Foo>; 2] = [box 1i, box 2i]; bar(x); bar([box 1i, box 2i]); @@ -49,16 +49,16 @@ fn main() { foog(x, &[box 1i]); struct T<'a> { - t: [&'a (Foo+'a), ..2] + t: [&'a (Foo+'a); 2] } let _n = T { t: [&1i, &2i] }; let r = &1i; let _n = T { - t: [r, ..2] + t: [r; 2] }; - let x: [&Foo, ..2] = [&1i, &2i]; + let x: [&Foo; 2] = [&1i, &2i]; let _n = T { t: x }; @@ -70,11 +70,11 @@ fn main() { t: &[&1i, &2i] }; let r = &1i; - let r: [&Foo, ..2] = [r, ..2]; + let r: [&Foo; 2] = [r; 2]; let _n = F { t: &r }; - let x: [&Foo, ..2] = [&1i, &2i]; + let x: [&Foo; 2] = [&1i, &2i]; let _n = F { t: &x }; @@ -85,7 +85,7 @@ fn main() { let _n = M { t: &[box 1i, box 2i] }; - let x: [Box<Foo>, ..2] = [box 1i, box 2i]; + let x: [Box<Foo>; 2] = [box 1i, box 2i]; let _n = M { t: &x }; diff --git a/src/test/run-pass/issue-13259-windows-tcb-trash.rs b/src/test/run-pass/issue-13259-windows-tcb-trash.rs index 0e42bdbd6ad..329ab7c921d 100644 --- a/src/test/run-pass/issue-13259-windows-tcb-trash.rs +++ b/src/test/run-pass/issue-13259-windows-tcb-trash.rs @@ -27,7 +27,7 @@ mod imp { } pub fn test() { - let mut buf: [u16, ..50] = [0, ..50]; + let mut buf: [u16; 50] = [0; 50]; let ret = unsafe { FormatMessageW(0x1000, 0 as *mut c_void, 1, 0x400, buf.as_mut_ptr(), buf.len() as u32, 0 as *const c_void) diff --git a/src/test/run-pass/issue-13763.rs b/src/test/run-pass/issue-13763.rs index 8b2b732415e..81b6892b0f9 100644 --- a/src/test/run-pass/issue-13763.rs +++ b/src/test/run-pass/issue-13763.rs @@ -12,9 +12,9 @@ use std::u8; const NUM: uint = u8::BITS as uint; -struct MyStruct { nums: [uint, ..8] } +struct MyStruct { nums: [uint; 8] } fn main() { - let _s = MyStruct { nums: [0, ..NUM] }; + let _s = MyStruct { nums: [0; NUM] }; } diff --git a/src/test/run-pass/issue-13837.rs b/src/test/run-pass/issue-13837.rs index 221115a0869..f62a45277b2 100644 --- a/src/test/run-pass/issue-13837.rs +++ b/src/test/run-pass/issue-13837.rs @@ -8,6 +8,6 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static TEST_VALUE : *const [int, ..2] = 0x1234 as *const [int, ..2]; +static TEST_VALUE : *const [int; 2] = 0x1234 as *const [int; 2]; fn main() {} diff --git a/src/test/run-pass/issue-14940.rs b/src/test/run-pass/issue-14940.rs index cef09af1fcf..d815620c969 100644 --- a/src/test/run-pass/issue-14940.rs +++ b/src/test/run-pass/issue-14940.rs @@ -15,7 +15,7 @@ fn main() { let args = os::args(); if args.len() > 1 { let mut out = stdio::stdout(); - out.write(&['a' as u8, ..128 * 1024]).unwrap(); + out.write(&['a' as u8; 128 * 1024]).unwrap(); } else { let out = Command::new(args[0].as_slice()).arg("child").output(); let out = out.unwrap(); diff --git a/src/test/run-pass/issue-15673.rs b/src/test/run-pass/issue-15673.rs index 051d98aa1d8..e66788a2c00 100644 --- a/src/test/run-pass/issue-15673.rs +++ b/src/test/run-pass/issue-15673.rs @@ -10,6 +10,6 @@ use std::iter::AdditiveIterator; fn main() { - let x: [u64, ..3] = [1, 2, 3]; + let x: [u64; 3] = [1, 2, 3]; assert_eq!(6, range(0, 3).map(|i| x[i]).sum()); } diff --git a/src/test/run-pass/issue-17302.rs b/src/test/run-pass/issue-17302.rs index 50583c7d127..b2abf2d2b1a 100644 --- a/src/test/run-pass/issue-17302.rs +++ b/src/test/run-pass/issue-17302.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static mut DROPPED: [bool, ..2] = [false, false]; +static mut DROPPED: [bool; 2] = [false, false]; struct A(uint); struct Foo { _a: A, _b: int } diff --git a/src/test/run-pass/issue-17877.rs b/src/test/run-pass/issue-17877.rs index 51db2f05959..827e6a10abd 100644 --- a/src/test/run-pass/issue-17877.rs +++ b/src/test/run-pass/issue-17877.rs @@ -9,11 +9,11 @@ // except according to those terms. fn main() { - assert_eq!(match [0u8, ..1024] { + assert_eq!(match [0u8; 1024] { _ => 42u, }, 42u); - assert_eq!(match [0u8, ..1024] { + assert_eq!(match [0u8; 1024] { [1, _..] => 0u, [0, _..] => 1u, _ => 2u diff --git a/src/test/run-pass/issue-18425.rs b/src/test/run-pass/issue-18425.rs index 6bb244bf88f..f61530c7418 100644 --- a/src/test/run-pass/issue-18425.rs +++ b/src/test/run-pass/issue-18425.rs @@ -12,5 +12,5 @@ // expression with a count of 1 and a non-Copy element type. fn main() { - let _ = [box 1u, ..1]; + let _ = [box 1u; 1]; } diff --git a/src/test/run-pass/issue-19244.rs b/src/test/run-pass/issue-19244.rs index d42bda6cd5d..3ee5ce9bff9 100644 --- a/src/test/run-pass/issue-19244.rs +++ b/src/test/run-pass/issue-19244.rs @@ -13,8 +13,8 @@ const STRUCT: MyStruct = MyStruct { field: 42 }; const TUP: (uint,) = (43,); fn main() { - let a = [0i, ..STRUCT.field]; - let b = [0i, ..TUP.0]; + let a = [0i; STRUCT.field]; + let b = [0i; TUP.0]; assert!(a.len() == 42); assert!(b.len() == 43); diff --git a/src/test/run-pass/issue-2904.rs b/src/test/run-pass/issue-2904.rs index 1dc1587ff2f..f87eb46d553 100644 --- a/src/test/run-pass/issue-2904.rs +++ b/src/test/run-pass/issue-2904.rs @@ -63,7 +63,7 @@ fn read_board_grid<rdr:'static + io::Reader>(mut input: rdr) -> Vec<Vec<square>> { let mut input: &mut io::Reader = &mut input; let mut grid = Vec::new(); - let mut line = [0, ..10]; + let mut line = [0; 10]; input.read(&mut line); let mut row = Vec::new(); for c in line.iter() { diff --git a/src/test/run-pass/issue-3656.rs b/src/test/run-pass/issue-3656.rs index 53157ce7546..8a39676ca17 100644 --- a/src/test/run-pass/issue-3656.rs +++ b/src/test/run-pass/issue-3656.rs @@ -16,7 +16,7 @@ extern crate libc; use libc::{c_uint, uint32_t, c_void}; pub struct KEYGEN { - hash_algorithm: [c_uint, ..2], + hash_algorithm: [c_uint; 2], count: uint32_t, salt: *const c_void, salt_size: uint32_t, diff --git a/src/test/run-pass/issue-4387.rs b/src/test/run-pass/issue-4387.rs index 447bf3b4b26..43948ef4a45 100644 --- a/src/test/run-pass/issue-4387.rs +++ b/src/test/run-pass/issue-4387.rs @@ -9,5 +9,5 @@ // except according to those terms. pub fn main() { - let _foo = [0i, ..2*4]; + let _foo = [0i; 2*4]; } diff --git a/src/test/run-pass/issue-5688.rs b/src/test/run-pass/issue-5688.rs index 0a13e001fab..7c8940aafbf 100644 --- a/src/test/run-pass/issue-5688.rs +++ b/src/test/run-pass/issue-5688.rs @@ -13,7 +13,7 @@ ...should print &[1, 2, 3] but instead prints something like &[4492532864, 24]. It is pretty evident that the compiler messed up -with the representation of [int, ..n] and [int] somehow, or at least +with the representation of [int; n] and [int] somehow, or at least failed to typecheck correctly. */ diff --git a/src/test/run-pass/issue-7784.rs b/src/test/run-pass/issue-7784.rs index 666847517ef..b936eb322fc 100644 --- a/src/test/run-pass/issue-7784.rs +++ b/src/test/run-pass/issue-7784.rs @@ -10,10 +10,10 @@ #![feature(advanced_slice_patterns)] -fn foo<T: Add<T, T> + Clone>([x, y, z]: [T, ..3]) -> (T, T, T) { +fn foo<T: Add<T, T> + Clone>([x, y, z]: [T; 3]) -> (T, T, T) { (x.clone(), x.clone() + y.clone(), x + y + z) } -fn bar(a: &'static str, b: &'static str) -> [&'static str, ..4] { +fn bar(a: &'static str, b: &'static str) -> [&'static str; 4] { [a, b, b, a] } diff --git a/src/test/run-pass/issue-9942.rs b/src/test/run-pass/issue-9942.rs index b9410ffdb43..321e22cd19c 100644 --- a/src/test/run-pass/issue-9942.rs +++ b/src/test/run-pass/issue-9942.rs @@ -9,5 +9,5 @@ // except according to those terms. pub fn main() { - const S: uint = 23 as uint; [0i, ..S]; () + const S: uint = 23 as uint; [0i; S]; () } diff --git a/src/test/run-pass/macro-invocation-in-count-expr-fixed-array-type.rs b/src/test/run-pass/macro-invocation-in-count-expr-fixed-array-type.rs index 4c124d85eee..ecd7c0458f7 100644 --- a/src/test/run-pass/macro-invocation-in-count-expr-fixed-array-type.rs +++ b/src/test/run-pass/macro-invocation-in-count-expr-fixed-array-type.rs @@ -15,5 +15,5 @@ macro_rules! four ( ); fn main() { - let _x: [u16, ..four!()]; + let _x: [u16; four!()]; } diff --git a/src/test/run-pass/match-arm-statics.rs b/src/test/run-pass/match-arm-statics.rs index 400aab64b4c..db512adc011 100644 --- a/src/test/run-pass/match-arm-statics.rs +++ b/src/test/run-pass/match-arm-statics.rs @@ -64,7 +64,7 @@ fn issue_6533() { } fn issue_13626() { - const VAL: [u8, ..1] = [0]; + const VAL: [u8; 1] = [0]; match [1] { VAL => unreachable!(), _ => () diff --git a/src/test/run-pass/method-mut-self-modifies-mut-slice-lvalue.rs b/src/test/run-pass/method-mut-self-modifies-mut-slice-lvalue.rs index 00319d57f8d..9ae7f49c75a 100644 --- a/src/test/run-pass/method-mut-self-modifies-mut-slice-lvalue.rs +++ b/src/test/run-pass/method-mut-self-modifies-mut-slice-lvalue.rs @@ -38,7 +38,7 @@ impl<'a> MyWriter for &'a mut [u8] { } fn main() { - let mut buf = [0_u8, .. 6]; + let mut buf = [0_u8; 6]; { let mut writer = buf.as_mut_slice(); diff --git a/src/test/run-pass/method-two-traits-distinguished-via-where-clause.rs b/src/test/run-pass/method-two-traits-distinguished-via-where-clause.rs index 986236fb6f9..fbecb6851b6 100644 --- a/src/test/run-pass/method-two-traits-distinguished-via-where-clause.rs +++ b/src/test/run-pass/method-two-traits-distinguished-via-where-clause.rs @@ -28,7 +28,7 @@ impl<T> B for *const [T] { } fn main() { - let x: [int, ..4] = [1,2,3,4]; + let x: [int; 4] = [1,2,3,4]; let xptr = x.as_slice() as *const _; xptr.foo(); } diff --git a/src/test/run-pass/mutability-inherits-through-fixed-length-vec.rs b/src/test/run-pass/mutability-inherits-through-fixed-length-vec.rs index ef0bc75c326..bf926a6c48a 100644 --- a/src/test/run-pass/mutability-inherits-through-fixed-length-vec.rs +++ b/src/test/run-pass/mutability-inherits-through-fixed-length-vec.rs @@ -9,13 +9,13 @@ // except according to those terms. fn test1() { - let mut ints = [0i, ..32]; + let mut ints = [0i; 32]; ints[0] += 1; assert_eq!(ints[0], 1); } fn test2() { - let mut ints = [0i, ..32]; + let mut ints = [0i; 32]; for i in ints.iter_mut() { *i += 22; } for i in ints.iter() { assert!(*i == 22); } } diff --git a/src/test/run-pass/new-style-fixed-length-vec.rs b/src/test/run-pass/new-style-fixed-length-vec.rs index a689fb0cf7c..e06461daed0 100644 --- a/src/test/run-pass/new-style-fixed-length-vec.rs +++ b/src/test/run-pass/new-style-fixed-length-vec.rs @@ -8,7 +8,7 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static FOO: [int, ..3] = [1, 2, 3]; +static FOO: [int; 3] = [1, 2, 3]; pub fn main() { println!("{} {} {}", FOO[0], FOO[1], FOO[2]); diff --git a/src/test/run-pass/nullable-pointer-iotareduction.rs b/src/test/run-pass/nullable-pointer-iotareduction.rs index da1ad094df6..2660de619e9 100644 --- a/src/test/run-pass/nullable-pointer-iotareduction.rs +++ b/src/test/run-pass/nullable-pointer-iotareduction.rs @@ -20,7 +20,7 @@ use std::{option, mem}; // trying to get assert failure messages that at least identify which case // failed. -enum E<T> { Thing(int, T), Nothing((), ((), ()), [i8, ..0]) } +enum E<T> { Thing(int, T), Nothing((), ((), ()), [i8; 0]) } impl<T> E<T> { fn is_none(&self) -> bool { match *self { @@ -54,7 +54,7 @@ macro_rules! check_fancy { check_fancy!($e: $T, |ptr| assert!(*ptr == $e)); }}; ($e:expr: $T:ty, |$v:ident| $chk:expr) => {{ - assert!(E::Nothing::<$T>((), ((), ()), [23i8, ..0]).is_none()); + assert!(E::Nothing::<$T>((), ((), ()), [23i8; 0]).is_none()); let e = $e; let t_ = E::Thing::<$T>(23, e); match t_.get_ref() { diff --git a/src/test/run-pass/nullable-pointer-size.rs b/src/test/run-pass/nullable-pointer-size.rs index 5708310abad..afc22be38b8 100644 --- a/src/test/run-pass/nullable-pointer-size.rs +++ b/src/test/run-pass/nullable-pointer-size.rs @@ -12,7 +12,7 @@ use std::mem; -enum E<T> { Thing(int, T), Nothing((), ((), ()), [i8, ..0]) } +enum E<T> { Thing(int, T), Nothing((), ((), ()), [i8; 0]) } struct S<T>(int, T); // These are macros so we get useful assert messages. diff --git a/src/test/run-pass/order-drop-with-match.rs b/src/test/run-pass/order-drop-with-match.rs index 9a76beac9e5..a866be43a05 100644 --- a/src/test/run-pass/order-drop-with-match.rs +++ b/src/test/run-pass/order-drop-with-match.rs @@ -14,7 +14,7 @@ // in ORDER matching up to when it ran. // Correct order is: matched, inner, outer -static mut ORDER: [uint, ..3] = [0, 0, 0]; +static mut ORDER: [uint; 3] = [0, 0, 0]; static mut INDEX: uint = 0; struct A; diff --git a/src/test/run-pass/out-of-stack-new-thread-no-split.rs b/src/test/run-pass/out-of-stack-new-thread-no-split.rs index 419d9b5d824..674d0dc86da 100644 --- a/src/test/run-pass/out-of-stack-new-thread-no-split.rs +++ b/src/test/run-pass/out-of-stack-new-thread-no-split.rs @@ -27,7 +27,7 @@ pub fn black_box<T>(dummy: T) { unsafe { asm!("" : : "r"(&dummy)) } } #[no_stack_check] fn recurse() { - let buf = [0i, ..10]; + let buf = [0i; 10]; black_box(buf); recurse(); } diff --git a/src/test/run-pass/out-of-stack-no-split.rs b/src/test/run-pass/out-of-stack-no-split.rs index ecb93cc6f8c..79926776abf 100644 --- a/src/test/run-pass/out-of-stack-no-split.rs +++ b/src/test/run-pass/out-of-stack-no-split.rs @@ -28,7 +28,7 @@ pub fn black_box<T>(dummy: T) { unsafe { asm!("" : : "r"(&dummy)) } } #[no_stack_check] fn recurse() { - let buf = [0i, ..10]; + let buf = [0i; 10]; black_box(buf); recurse(); } diff --git a/src/test/run-pass/out-of-stack.rs b/src/test/run-pass/out-of-stack.rs index 81e75ba2cd5..1594cca89e5 100644 --- a/src/test/run-pass/out-of-stack.rs +++ b/src/test/run-pass/out-of-stack.rs @@ -22,7 +22,7 @@ use std::os; pub fn black_box<T>(dummy: T) { unsafe { asm!("" : : "r"(&dummy)) } } fn silent_recurse() { - let buf = [0i, ..1000]; + let buf = [0i; 1000]; black_box(buf); silent_recurse(); } diff --git a/src/test/run-pass/packed-struct-generic-layout.rs b/src/test/run-pass/packed-struct-generic-layout.rs index 999e4aeeb59..004a3022018 100644 --- a/src/test/run-pass/packed-struct-generic-layout.rs +++ b/src/test/run-pass/packed-struct-generic-layout.rs @@ -20,7 +20,7 @@ struct S<T, S> { pub fn main() { unsafe { let s = S { a: 0xff_ff_ff_ffu32, b: 1, c: 0xaa_aa_aa_aa as i32 }; - let transd : [u8, .. 9] = mem::transmute(s); + let transd : [u8; 9] = mem::transmute(s); // Don't worry about endianness, the numbers are palindromic. assert!(transd == [0xff, 0xff, 0xff, 0xff, @@ -29,7 +29,7 @@ pub fn main() { let s = S { a: 1u8, b: 2u8, c: 0b10000001_10000001 as i16}; - let transd : [u8, .. 4] = mem::transmute(s); + let transd : [u8; 4] = mem::transmute(s); // Again, no endianness problems. assert!(transd == [1, 2, 0b10000001, 0b10000001]); diff --git a/src/test/run-pass/packed-struct-layout.rs b/src/test/run-pass/packed-struct-layout.rs index b4fbf0820cd..9e94502a92a 100644 --- a/src/test/run-pass/packed-struct-layout.rs +++ b/src/test/run-pass/packed-struct-layout.rs @@ -13,7 +13,7 @@ use std::mem; #[repr(packed)] struct S4 { a: u8, - b: [u8, .. 3], + b: [u8; 3], } #[repr(packed)] @@ -25,11 +25,11 @@ struct S5 { pub fn main() { unsafe { let s4 = S4 { a: 1, b: [2,3,4] }; - let transd : [u8, .. 4] = mem::transmute(s4); + let transd : [u8; 4] = mem::transmute(s4); assert!(transd == [1, 2, 3, 4]); let s5 = S5 { a: 1, b: 0xff_00_00_ff }; - let transd : [u8, .. 5] = mem::transmute(s5); + let transd : [u8; 5] = mem::transmute(s5); // Don't worry about endianness, the u32 is palindromic. assert!(transd == [1, 0xff, 0, 0, 0xff]); } diff --git a/src/test/run-pass/packed-struct-size.rs b/src/test/run-pass/packed-struct-size.rs index 9472fd4ce38..846d51e2e7e 100644 --- a/src/test/run-pass/packed-struct-size.rs +++ b/src/test/run-pass/packed-struct-size.rs @@ -14,7 +14,7 @@ use std::mem; #[repr(packed)] struct S4 { a: u8, - b: [u8, .. 3], + b: [u8; 3], } #[repr(packed)] diff --git a/src/test/run-pass/packed-struct-vec.rs b/src/test/run-pass/packed-struct-vec.rs index 59bb5678b69..d2121aa7752 100644 --- a/src/test/run-pass/packed-struct-vec.rs +++ b/src/test/run-pass/packed-struct-vec.rs @@ -22,9 +22,9 @@ struct Foo { impl Copy for Foo {} pub fn main() { - let foos = [Foo { bar: 1, baz: 2 }, .. 10]; + let foos = [Foo { bar: 1, baz: 2 }; 10]; - assert_eq!(mem::size_of::<[Foo, .. 10]>(), 90); + assert_eq!(mem::size_of::<[Foo; 10]>(), 90); for i in range(0u, 10) { assert_eq!(foos[i], Foo { bar: 1, baz: 2}); diff --git a/src/test/run-pass/packed-tuple-struct-layout.rs b/src/test/run-pass/packed-tuple-struct-layout.rs index 5fb43503ccb..c41d678b0f5 100644 --- a/src/test/run-pass/packed-tuple-struct-layout.rs +++ b/src/test/run-pass/packed-tuple-struct-layout.rs @@ -11,7 +11,7 @@ use std::mem; #[repr(packed)] -struct S4(u8,[u8, .. 3]); +struct S4(u8,[u8; 3]); #[repr(packed)] struct S5(u8,u32); @@ -19,11 +19,11 @@ struct S5(u8,u32); pub fn main() { unsafe { let s4 = S4(1, [2,3,4]); - let transd : [u8, .. 4] = mem::transmute(s4); + let transd : [u8; 4] = mem::transmute(s4); assert!(transd == [1, 2, 3, 4]); let s5 = S5(1, 0xff_00_00_ff); - let transd : [u8, .. 5] = mem::transmute(s5); + let transd : [u8; 5] = mem::transmute(s5); // Don't worry about endianness, the u32 is palindromic. assert!(transd == [1, 0xff, 0, 0, 0xff]); } diff --git a/src/test/run-pass/packed-tuple-struct-size.rs b/src/test/run-pass/packed-tuple-struct-size.rs index 8967b07ca88..a0b88ea53c5 100644 --- a/src/test/run-pass/packed-tuple-struct-size.rs +++ b/src/test/run-pass/packed-tuple-struct-size.rs @@ -12,7 +12,7 @@ use std::mem; #[repr(packed)] -struct S4(u8,[u8, .. 3]); +struct S4(u8,[u8; 3]); #[repr(packed)] struct S5(u8, u32); diff --git a/src/test/run-pass/regions-dependent-addr-of.rs b/src/test/run-pass/regions-dependent-addr-of.rs index 79f8ca48882..41396ef01be 100644 --- a/src/test/run-pass/regions-dependent-addr-of.rs +++ b/src/test/run-pass/regions-dependent-addr-of.rs @@ -18,7 +18,7 @@ struct A { struct B { v1: int, - v2: [int, ..3], + v2: [int; 3], v3: Vec<int> , v4: C, v5: Box<C>, diff --git a/src/test/run-pass/repeat-expr-in-static.rs b/src/test/run-pass/repeat-expr-in-static.rs index 9955673bb0b..a53f1da4ce6 100644 --- a/src/test/run-pass/repeat-expr-in-static.rs +++ b/src/test/run-pass/repeat-expr-in-static.rs @@ -8,8 +8,8 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -static FOO: [int, ..4] = [32, ..4]; -static BAR: [int, ..4] = [32, 32, 32, 32]; +static FOO: [int; 4] = [32; 4]; +static BAR: [int; 4] = [32, 32, 32, 32]; pub fn main() { assert!(FOO == BAR); diff --git a/src/test/run-pass/repeated-vector-syntax.rs b/src/test/run-pass/repeated-vector-syntax.rs index 9c369c0d770..0781822cb74 100644 --- a/src/test/run-pass/repeated-vector-syntax.rs +++ b/src/test/run-pass/repeated-vector-syntax.rs @@ -11,8 +11,8 @@ #![feature(slicing_syntax)] pub fn main() { - let x = [ [true], ..512 ]; - let y = [ 0i, ..1 ]; + let x = [ [true]; 512 ]; + let y = [ 0i; 1 ]; print!("["); for xi in x.iter() { diff --git a/src/test/run-pass/uninit-empty-types.rs b/src/test/run-pass/uninit-empty-types.rs index 005205353fc..c2bd738b8a4 100644 --- a/src/test/run-pass/uninit-empty-types.rs +++ b/src/test/run-pass/uninit-empty-types.rs @@ -18,6 +18,6 @@ struct Foo; pub fn main() { unsafe { let _x: Foo = mem::uninitialized(); - let _x: [Foo, ..2] = mem::uninitialized(); + let _x: [Foo; 2] = mem::uninitialized(); } } diff --git a/src/test/run-pass/unsized3.rs b/src/test/run-pass/unsized3.rs index e5e6ce6e76b..271f5817c9e 100644 --- a/src/test/run-pass/unsized3.rs +++ b/src/test/run-pass/unsized3.rs @@ -60,7 +60,7 @@ pub fn main() { unsafe { struct Foo_<T> { - f: [T, ..3] + f: [T; 3] } let data = box Foo_{f: [1i32, 2, 3] }; @@ -72,7 +72,7 @@ pub fn main() { struct Baz_ { f1: uint, - f2: [u8, ..5], + f2: [u8; 5], } let data = box Baz_{ f1: 42, f2: ['a' as u8, 'b' as u8, 'c' as u8, 'd' as u8, 'e' as u8] }; diff --git a/src/test/run-pass/variadic-ffi.rs b/src/test/run-pass/variadic-ffi.rs index aa71de2123c..f8eef988561 100644 --- a/src/test/run-pass/variadic-ffi.rs +++ b/src/test/run-pass/variadic-ffi.rs @@ -19,7 +19,7 @@ extern { } unsafe fn check<T>(expected: &str, f: |*mut c_char| -> T) { - let mut x = [0 as c_char, ..50]; + let mut x = [0 as c_char; 50]; f(&mut x[0] as *mut c_char); let res = CString::new(&x[0], false); assert_eq!(expected, res.as_str().unwrap()); diff --git a/src/test/run-pass/vec-dst.rs b/src/test/run-pass/vec-dst.rs index d8bf0a5c627..4a36231e72b 100644 --- a/src/test/run-pass/vec-dst.rs +++ b/src/test/run-pass/vec-dst.rs @@ -9,9 +9,9 @@ // except according to those terms. pub fn main() { - // Tests for indexing into box/& [T, ..n] - let x: [int, ..3] = [1, 2, 3]; - let mut x: Box<[int, ..3]> = box x; + // Tests for indexing into box/& [T; n] + let x: [int; 3] = [1, 2, 3]; + let mut x: Box<[int; 3]> = box x; assert!(x[0] == 1); assert!(x[1] == 2); assert!(x[2] == 3); @@ -20,8 +20,8 @@ pub fn main() { assert!(x[1] == 45); assert!(x[2] == 3); - let mut x: [int, ..3] = [1, 2, 3]; - let x: &mut [int, ..3] = &mut x; + let mut x: [int; 3] = [1, 2, 3]; + let x: &mut [int; 3] = &mut x; assert!(x[0] == 1); assert!(x[1] == 2); assert!(x[2] == 3); diff --git a/src/test/run-pass/vec-fixed-length.rs b/src/test/run-pass/vec-fixed-length.rs index 05a7388b5e2..20e1becd008 100644 --- a/src/test/run-pass/vec-fixed-length.rs +++ b/src/test/run-pass/vec-fixed-length.rs @@ -11,17 +11,17 @@ use std::mem::size_of; pub fn main() { - let x: [int, ..4] = [1, 2, 3, 4]; + let x: [int; 4] = [1, 2, 3, 4]; assert_eq!(x[0], 1); assert_eq!(x[1], 2); assert_eq!(x[2], 3); assert_eq!(x[3], 4); - assert_eq!(size_of::<[u8, ..4]>(), 4u); + assert_eq!(size_of::<[u8; 4]>(), 4u); // FIXME #10183 // FIXME #18069 //if cfg!(target_word_size = "64") { - // assert_eq!(size_of::<[u8, ..(1 << 32)]>(), (1u << 32)); + // assert_eq!(size_of::<[u8; (1 << 32)]>(), (1u << 32)); //} } diff --git a/src/test/run-pass/vec-repeat-with-cast.rs b/src/test/run-pass/vec-repeat-with-cast.rs index 18ccd8c96ab..97a443cb3b8 100644 --- a/src/test/run-pass/vec-repeat-with-cast.rs +++ b/src/test/run-pass/vec-repeat-with-cast.rs @@ -8,4 +8,4 @@ // option. This file may not be copied, modified, or distributed // except according to those terms. -pub fn main() { let _a = [0i, ..1 as uint]; } +pub fn main() { let _a = [0i; 1 as uint]; } diff --git a/src/test/run-pass/vector-sort-panic-safe.rs b/src/test/run-pass/vector-sort-panic-safe.rs index c969e66957c..fe89c7532ee 100644 --- a/src/test/run-pass/vector-sort-panic-safe.rs +++ b/src/test/run-pass/vector-sort-panic-safe.rs @@ -14,7 +14,7 @@ use std::rand::{task_rng, Rng, Rand}; const REPEATS: uint = 5; const MAX_LEN: uint = 32; -static drop_counts: [AtomicUint, .. MAX_LEN] = +static drop_counts: [AtomicUint; MAX_LEN] = // FIXME #5244: AtomicUint is not Copy. [ INIT_ATOMIC_UINT, INIT_ATOMIC_UINT, INIT_ATOMIC_UINT, INIT_ATOMIC_UINT, |
