Rewrite everything to use [] instead of vec() in value position.

87 files changed, 1137 insertions, 1134 deletions

diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs
index c4abeec176e..b1b533c84d6 100644
--- a/src/comp/back/upcall.rs
+++ b/src/comp/back/upcall.rs
@@ -63,8 +63,8 @@ type upcalls = rec(
 fn declare_upcalls(type_names tn, ModuleRef llmod) -> @upcalls {
     fn decl(type_names tn, ModuleRef llmod, str name, vec[TypeRef] tys,
             TypeRef rv) -> ValueRef {
-        let vec[TypeRef] arg_tys = vec(T_taskptr(tn));
-        for (TypeRef t in tys) { arg_tys += vec(t); }
+        let vec[TypeRef] arg_tys = [T_taskptr(tn)];
+        for (TypeRef t in tys) { arg_tys += [t]; }
         auto fn_ty = T_fn(arg_tys, rv);
         ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty);
     }
@@ -74,61 +74,61 @@ fn declare_upcalls(type_names tn, ModuleRef llmod) -> @upcalls {
 
     // FIXME: Sigh:.. remove this when I fix the typechecker pushdown.
     // --pcwalton
-    let vec[TypeRef] empty_vec = vec();
+    let vec[TypeRef] empty_vec = [];
 
     ret @rec(
-        grow_task=dv("grow_task", vec(T_size_t())),
-        log_int=dv("log_int", vec(T_i32(), T_i32())),
-        log_float=dv("log_float", vec(T_i32(), T_f32())),
-        log_double=dv("log_double", vec(T_i32(), T_ptr(T_f64()))),
-        log_str=dv("log_str", vec(T_i32(), T_ptr(T_str()))),
-        trace_word=dv("trace_word", vec(T_int())),
-        trace_str=dv("trace_str", vec(T_ptr(T_i8()))),
-        new_port=d("new_port", vec(T_size_t()), T_opaque_port_ptr()),
-        del_port=dv("del_port", vec(T_opaque_port_ptr())),
-        new_chan=d("new_chan", vec(T_opaque_port_ptr()), T_opaque_chan_ptr()),
-        flush_chan=dv("flush_chan", vec(T_opaque_chan_ptr())),
-        del_chan=dv("del_chan", vec(T_opaque_chan_ptr())),
-        clone_chan=d("clone_chan", vec(T_taskptr(tn), T_opaque_chan_ptr()),
+        grow_task=dv("grow_task", [T_size_t()]),
+        log_int=dv("log_int", [T_i32(), T_i32()]),
+        log_float=dv("log_float", [T_i32(), T_f32()]),
+        log_double=dv("log_double", [T_i32(), T_ptr(T_f64())]),
+        log_str=dv("log_str", [T_i32(), T_ptr(T_str())]),
+        trace_word=dv("trace_word", [T_int()]),
+        trace_str=dv("trace_str", [T_ptr(T_i8())]),
+        new_port=d("new_port", [T_size_t()], T_opaque_port_ptr()),
+        del_port=dv("del_port", [T_opaque_port_ptr()]),
+        new_chan=d("new_chan", [T_opaque_port_ptr()], T_opaque_chan_ptr()),
+        flush_chan=dv("flush_chan", [T_opaque_chan_ptr()]),
+        del_chan=dv("del_chan", [T_opaque_chan_ptr()]),
+        clone_chan=d("clone_chan", [T_taskptr(tn), T_opaque_chan_ptr()],
                      T_opaque_chan_ptr()),
         _yield=dv("yield", empty_vec),
-        sleep=dv("sleep", vec(T_size_t())),
-        _join=dv("join", vec(T_taskptr(tn))),
-        send=dv("send", vec(T_opaque_chan_ptr(), T_ptr(T_i8()))),
-        recv=dv("recv", vec(T_ptr(T_ptr(T_i8())), T_opaque_port_ptr())),
-        _fail=dv("fail", vec(T_ptr(T_i8()), T_ptr(T_i8()), T_size_t())),
-        kill=dv("kill", vec(T_taskptr(tn))),
+        sleep=dv("sleep", [T_size_t()]),
+        _join=dv("join", [T_taskptr(tn)]),
+        send=dv("send", [T_opaque_chan_ptr(), T_ptr(T_i8())]),
+        recv=dv("recv", [T_ptr(T_ptr(T_i8())), T_opaque_port_ptr()]),
+        _fail=dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]),
+        kill=dv("kill", [T_taskptr(tn)]),
         exit=dv("exit", empty_vec),
-        malloc=d("malloc", vec(T_size_t(), T_ptr(T_tydesc(tn))),
+        malloc=d("malloc", [T_size_t(), T_ptr(T_tydesc(tn))],
                                T_ptr(T_i8())),
-        free=dv("free", vec(T_ptr(T_i8()), T_int())),
-        mark=d("mark", vec(T_ptr(T_i8())), T_int()),
-        new_str=d("new_str", vec(T_ptr(T_i8()), T_size_t()), T_ptr(T_str())),
-        new_vec=d("new_vec", vec(T_size_t(), T_ptr(T_tydesc(tn))),
+        free=dv("free", [T_ptr(T_i8()), T_int()]),
+        mark=d("mark", [T_ptr(T_i8())], T_int()),
+        new_str=d("new_str", [T_ptr(T_i8()), T_size_t()], T_ptr(T_str())),
+        new_vec=d("new_vec", [T_size_t(), T_ptr(T_tydesc(tn))],
                                  T_opaque_vec_ptr()),
-        vec_grow=d("vec_grow", vec(T_opaque_vec_ptr(), T_size_t(),
-                                   T_ptr(T_int()), T_ptr(T_tydesc(tn))),
+        vec_grow=d("vec_grow", [T_opaque_vec_ptr(), T_size_t(),
+                                   T_ptr(T_int()), T_ptr(T_tydesc(tn))],
                    T_opaque_vec_ptr()),
         require_rust_sym=d("require_rust_sym",
-                           vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
+                           [T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
                                T_size_t(), T_ptr(T_i8()),
-                               T_ptr(T_ptr(T_i8()))),
+                               T_ptr(T_ptr(T_i8()))],
                            T_int()),
         require_c_sym=d("require_c_sym",
-                        vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
-                            T_ptr(T_i8()), T_ptr(T_i8())),
+                        [T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
+                            T_ptr(T_i8()), T_ptr(T_i8())],
                         T_int()),
         get_type_desc=d("get_type_desc",
-                        vec(T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
-                            T_size_t(), T_ptr(T_ptr(T_tydesc(tn)))),
+                        [T_ptr(T_crate(tn)), T_size_t(), T_size_t(),
+                            T_size_t(), T_ptr(T_ptr(T_tydesc(tn)))],
                         T_ptr(T_tydesc(tn))),
-        new_task=d("new_task", vec(T_ptr(T_i8())), T_taskptr(tn)),
-        start_task=d("start_task", vec(T_taskptr(tn), T_int(), T_int(),
-                                       T_int(), T_size_t()),
+        new_task=d("new_task", [T_ptr(T_i8())], T_taskptr(tn)),
+        start_task=d("start_task", [T_taskptr(tn), T_int(), T_int(),
+                                       T_int(), T_size_t()],
                      T_taskptr(tn)),
-        new_thread=d("new_thread", vec(T_ptr(T_i8())), T_taskptr(tn)),
-        start_thread=d("start_thread", vec(T_taskptr(tn), T_int(), T_int(),
-                                           T_int(), T_size_t()),
+        new_thread=d("new_thread", [T_ptr(T_i8())], T_taskptr(tn)),
+        start_thread=d("start_thread", [T_taskptr(tn), T_int(), T_int(),
+                                           T_int(), T_size_t()],
                        T_taskptr(tn))
     );
 }
diff --git a/src/comp/back/x86.rs b/src/comp/back/x86.rs
index 7d578c2f8d5..fffb82053f6 100644
--- a/src/comp/back/x86.rs
+++ b/src/comp/back/x86.rs
@@ -12,78 +12,78 @@ fn wstr(int i) -> str {
 }
 
 fn start() -> vec[str] {
-    ret vec(".cfi_startproc");
+    ret [".cfi_startproc"];
 }
 
 fn end() -> vec[str] {
-    ret vec(".cfi_endproc");
+    ret [".cfi_endproc"];
 }
 
 fn save_callee_saves() -> vec[str] {
-    ret vec("pushl %ebp",
+    ret ["pushl %ebp",
             "pushl %edi",
             "pushl %esi",
-            "pushl %ebx");
+            "pushl %ebx"];
 }
 
 fn save_callee_saves_with_cfi() -> vec[str] {
     auto offset = 8;
     auto t;
-    t  = vec("pushl %ebp");
-    t += vec(".cfi_def_cfa_offset " + istr(offset));
-    t += vec(".cfi_offset %ebp, -" + istr(offset));
+    t  = ["pushl %ebp"];
+    t += [".cfi_def_cfa_offset " + istr(offset)];
+    t += [".cfi_offset %ebp, -" + istr(offset)];
 
-    t += vec("pushl %edi");
+    t += ["pushl %edi"];
     offset += 4;
-    t += vec(".cfi_def_cfa_offset " + istr(offset));
+    t += [".cfi_def_cfa_offset " + istr(offset)];
 
-    t += vec("pushl %esi");
+    t += ["pushl %esi"];
     offset += 4;
-    t += vec(".cfi_def_cfa_offset " + istr(offset));
+    t += [".cfi_def_cfa_offset " + istr(offset)];
 
-    t += vec("pushl %ebx");
+    t += ["pushl %ebx"];
     offset += 4;
-    t += vec(".cfi_def_cfa_offset " + istr(offset));
+    t += [".cfi_def_cfa_offset " + istr(offset)];
     ret t;
 }
 
 fn restore_callee_saves() -> vec[str] {
-    ret vec("popl  %ebx",
+    ret ["popl  %ebx",
             "popl  %esi",
             "popl  %edi",
-            "popl  %ebp");
+            "popl  %ebp"];
 }
 
 fn load_esp_from_rust_sp_first_arg() -> vec[str] {
-    ret vec("movl  " + wstr(abi::task_field_rust_sp) + "(%ecx), %esp");
+    ret ["movl  " + wstr(abi::task_field_rust_sp) + "(%ecx), %esp"];
 }
 
 fn load_esp_from_runtime_sp_first_arg() -> vec[str] {
-    ret vec("movl  " + wstr(abi::task_field_runtime_sp) + "(%ecx), %esp");
+    ret ["movl  " + wstr(abi::task_field_runtime_sp) + "(%ecx), %esp"];
 }
 
 fn store_esp_to_rust_sp_first_arg() -> vec[str] {
-    ret vec("movl  %esp, " + wstr(abi::task_field_rust_sp) + "(%ecx)");
+    ret ["movl  %esp, " + wstr(abi::task_field_rust_sp) + "(%ecx)"];
 }
 
 fn store_esp_to_runtime_sp_first_arg() -> vec[str] {
-    ret vec("movl  %esp, " + wstr(abi::task_field_runtime_sp) + "(%ecx)");
+    ret ["movl  %esp, " + wstr(abi::task_field_runtime_sp) + "(%ecx)"];
 }
 
 fn load_esp_from_rust_sp_second_arg() -> vec[str] {
-    ret vec("movl  " + wstr(abi::task_field_rust_sp) + "(%edx), %esp");
+    ret ["movl  " + wstr(abi::task_field_rust_sp) + "(%edx), %esp"];
 }
 
 fn load_esp_from_runtime_sp_second_arg() -> vec[str] {
-    ret vec("movl  " + wstr(abi::task_field_runtime_sp) + "(%edx), %esp");
+    ret ["movl  " + wstr(abi::task_field_runtime_sp) + "(%edx), %esp"];
 }
 
 fn store_esp_to_rust_sp_second_arg() -> vec[str] {
-    ret vec("movl  %esp, " + wstr(abi::task_field_rust_sp) + "(%edx)");
+    ret ["movl  %esp, " + wstr(abi::task_field_rust_sp) + "(%edx)"];
 }
 
 fn store_esp_to_runtime_sp_second_arg() -> vec[str] {
-    ret vec("movl  %esp, " + wstr(abi::task_field_runtime_sp) + "(%edx)");
+    ret ["movl  %esp, " + wstr(abi::task_field_runtime_sp) + "(%edx)"];
 }
 
 
@@ -105,7 +105,7 @@ fn store_esp_to_runtime_sp_second_arg() -> vec[str] {
  */
 
 fn rust_activate_glue() -> vec[str] {
-    ret vec("movl  4(%esp), %ecx    # ecx = rust_task")
+    ret ["movl  4(%esp), %ecx    # ecx = rust_task"]
         + save_callee_saves()
         + store_esp_to_runtime_sp_first_arg()
         + load_esp_from_rust_sp_first_arg()
@@ -157,7 +157,7 @@ fn rust_activate_glue() -> vec[str] {
          *      will be a no-op. Esp won't move, and the task's stack won't
          *      grow.
          */
-        + vec("addl  $20, " + wstr(abi::task_field_rust_sp) + "(%ecx)")
+        + ["addl  $20, " + wstr(abi::task_field_rust_sp) + "(%ecx)"]
 
 
         /*
@@ -167,10 +167,10 @@ fn rust_activate_glue() -> vec[str] {
          * activating, the task needs to be in the fastcall 2nd parameter
          * expected by the rust main function. That's edx.
          */
-        + vec("mov  %ecx, %edx")
+        + ["mov  %ecx, %edx"]
 
         + restore_callee_saves()
-        + vec("ret");
+        + ["ret"];
 }
 
 /* More glue code, this time the 'bottom half' of yielding.
@@ -200,13 +200,13 @@ fn rust_activate_glue() -> vec[str] {
  */
 
 fn rust_yield_glue() -> vec[str] {
-    ret vec("movl  0(%esp), %ecx    # ecx = rust_task")
+    ret ["movl  0(%esp), %ecx    # ecx = rust_task"]
         + load_esp_from_rust_sp_first_arg()
         + save_callee_saves()
         + store_esp_to_rust_sp_first_arg()
         + load_esp_from_runtime_sp_first_arg()
         + restore_callee_saves()
-        + vec("ret");
+        + ["ret"];
 }
 
 fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] {
@@ -239,8 +239,8 @@ fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] {
         } else {
             src_off = wstr(5 + (i as int));
         }
-        auto m = vec("movl  " + src_off + "(%ebp),%eax",
-                     "movl  %eax," + dst_off + "(%esp)");
+        auto m = ["movl  " + src_off + "(%ebp),%eax",
+                     "movl  %eax," + dst_off + "(%esp)"];
         ret _str::connect(m, "\n\t");
     }
 
@@ -250,24 +250,24 @@ fn native_glue(int n_args, abi::native_glue_type ngt) -> vec[str] {
         start()
         + save_callee_saves_with_cfi()
 
-        + vec("movl  %esp, %ebp     # ebp = rust_sp")
-        + vec(".cfi_def_cfa_register %ebp")
+        + ["movl  %esp, %ebp     # ebp = rust_sp"]
+        + [".cfi_def_cfa_register %ebp"]
 
         + store_esp_to_rust_sp_second_arg()
         + load_esp_from_runtime_sp_second_arg()
 
-        + vec("subl  $" + wstr(n_args) + ", %esp   # esp -= args",
-              "andl  $~0xf, %esp    # align esp down")
+        + ["subl  $" + wstr(n_args) + ", %esp   # esp -= args",
+              "andl  $~0xf, %esp    # align esp down"]
 
         + _vec::init_fn[str](carg, (n_args) as uint)
 
-        +  vec("movl  %edx, %edi     # save task from edx to edi",
+        +  ["movl  %edx, %edi     # save task from edx to edi",
                "call  *%ecx          # call *%ecx",
-               "movl  %edi, %edx     # restore edi-saved task to edx")
+               "movl  %edi, %edx     # restore edi-saved task to edx"]
 
         + load_esp_from_rust_sp_second_arg()
         + restore_callee_saves()
-        + vec("ret")
+        + ["ret"]
         + end();
 
 }
@@ -305,13 +305,13 @@ fn get_module_asm() -> str {
     auto prefix = get_symbol_prefix();
 
     auto glues =
-        vec(decl_glue(align, prefix,
+        [decl_glue(align, prefix,
                       abi::activate_glue_name(),
                       rust_activate_glue()),
 
             decl_glue(align, prefix,
                       abi::yield_glue_name(),
-                      rust_yield_glue()))
+                      rust_yield_glue())]
 
         + _vec::init_fn[str](bind decl_native_glue(align, prefix,
             abi::ngt_rust, _), (abi::n_native_glues + 1) as uint)
diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs
index d538e1711a6..f2f082323fa 100644
--- a/src/comp/driver/rustc.rs
+++ b/src/comp/driver/rustc.rs
@@ -44,7 +44,7 @@ fn default_environment(session::session sess,
     }
 
     ret
-        vec(
+        [
             // Target bindings.
             tup("target_os", eval::val_str(std::os::target_os())),
             tup("target_arch", eval::val_str("x86")),
@@ -53,7 +53,7 @@ fn default_environment(session::session sess,
             // Build bindings.
             tup("build_compiler", eval::val_str(argv0)),
             tup("build_input", eval::val_str(input))
-            );
+            ];
 }
 
 fn parse_input(session::session sess,
@@ -205,7 +205,7 @@ fn main(vec[str] args) {
              uint_type = common::ty_u32,
              float_type = common::ty_f64);
 
-    auto opts = vec(optflag("h"), optflag("help"),
+    auto opts = [optflag("h"), optflag("help"),
                     optflag("v"), optflag("version"),
                     optflag("glue"), optflag("emit-llvm"),
                     optflag("pretty"), optflag("ls"), optflag("parse-only"),
@@ -214,7 +214,7 @@ fn main(vec[str] args) {
                     optflag("save-temps"), optopt("sysroot"),
                     optflag("stats"),
                     optflag("time-passes"), optflag("time-llvm-passes"),
-                    optflag("no-typestate"), optflag("noverify"));
+                    optflag("no-typestate"), optflag("noverify")];
     auto binary = _vec::shift[str](args);
     auto match;
     alt (getopts::getopts(args, opts)) {
@@ -287,7 +287,7 @@ fn main(vec[str] args) {
 
     auto crate_cache = common::new_int_hash[session::crate_metadata]();
     auto target_crate_num = 0;
-    let vec[@ast::meta_item] md = vec();
+    let vec[@ast::meta_item] md = [];
     auto sess =
         session::session(target_crate_num, target_cfg, sopts,
                         crate_cache, md, front::codemap::new_codemap());
@@ -323,13 +323,13 @@ fn main(vec[str] args) {
                 _vec::pop[str](parts);
                 saved_out_filename = parts.(0);
                 alt (output_type) {
-                    case (link::output_type_none) { parts += vec("pp"); }
-                    case (link::output_type_bitcode) { parts += vec("bc"); }
-                    case (link::output_type_assembly) { parts += vec("s"); }
+                    case (link::output_type_none) { parts += ["pp"]; }
+                    case (link::output_type_bitcode) { parts += ["bc"]; }
+                    case (link::output_type_assembly) { parts += ["s"]; }
 
                     // Object and exe output both use the '.o' extension here
-                    case (link::output_type_object) { parts += vec("o"); }
-                    case (link::output_type_exe) { parts += vec("o"); }
+                    case (link::output_type_object) { parts += ["o"]; }
+                    case (link::output_type_exe) { parts += ["o"]; }
                 }
                 auto ofile = _str::connect(parts, ".");
                 compile_input(sess, env, ifile, ofile);
@@ -353,33 +353,33 @@ fn main(vec[str] args) {
         let str exe_suffix = "";
 
         // The invocations of gcc share some flags across platforms
-        let vec[str] common_cflags = vec("-fno-strict-aliasing", "-fPIC",
-                           "-Wall", "-fno-rtti", "-fno-exceptions", "-g");
-        let vec[str] common_libs = vec(stage, "-Lrustllvm", "-Lrt",
-                           "-lrustrt", "-lrustllvm", "-lstd", "-lm");
+        let vec[str] common_cflags = ["-fno-strict-aliasing", "-fPIC",
+                           "-Wall", "-fno-rtti", "-fno-exceptions", "-g"];
+        let vec[str] common_libs = [stage, "-Lrustllvm", "-Lrt",
+                           "-lrustrt", "-lrustllvm", "-lstd", "-lm"];
 
         alt (sess.get_targ_cfg().os) {
             case (session::os_win32) {
                 exe_suffix = ".exe";
-                gcc_args = common_cflags + vec(
+                gcc_args = common_cflags + [
                             "-march=i686", "-O2",
                             glu, "-o",
                             saved_out_filename + exe_suffix,
-                            saved_out_filename + ".o") + common_libs;
+                            saved_out_filename + ".o"] + common_libs;
             }
             case (session::os_macos) {
-                gcc_args = common_cflags + vec(
+                gcc_args = common_cflags + [
                            "-arch i386", "-O0", "-m32",
                            glu, "-o",
                            saved_out_filename + exe_suffix,
-                           saved_out_filename + ".o") + common_libs;
+                           saved_out_filename + ".o"] + common_libs;
             }
             case (session::os_linux) {
-                gcc_args = common_cflags + vec(
+                gcc_args = common_cflags + [
                            "-march=i686", "-O2", "-m32",
                            glu, "-o",
                            saved_out_filename + exe_suffix,
-                           saved_out_filename + ".o") + common_libs;
+                           saved_out_filename + ".o"] + common_libs;
             }
         }
 
@@ -388,12 +388,12 @@ fn main(vec[str] args) {
 
         // Clean up on Darwin
         if (sess.get_targ_cfg().os == session::os_macos) {
-            run::run_program("dsymutil", vec(saved_out_filename));
+            run::run_program("dsymutil", [saved_out_filename]);
         }
 
         // Remove the temporary object file if we aren't saving temps
         if (!save_temps) {
-            run::run_program("rm", vec(saved_out_filename + ".o"));
+            run::run_program("rm", [saved_out_filename + ".o"]);
         }
     }
 }
diff --git a/src/comp/front/codemap.rs b/src/comp/front/codemap.rs
index c474fa07fb6..cd959d9d88d 100644
--- a/src/comp/front/codemap.rs
+++ b/src/comp/front/codemap.rs
@@ -13,14 +13,14 @@ type codemap = @rec(mutable vec[filemap] files);
 type loc = rec(str filename, uint line, uint col);
 
 fn new_codemap() -> codemap {
-    let vec[filemap] files = vec();
+    let vec[filemap] files = [];
     ret @rec(mutable files=files);
 }
 
 fn new_filemap(str filename, uint start_pos) -> filemap {
     ret @rec(name=filename,
              start_pos=start_pos,
-             mutable lines=vec(0u));
+             mutable lines=[0u]);
 }
 
 fn next_line(filemap file, uint pos) {
diff --git a/src/comp/front/creader.rs b/src/comp/front/creader.rs
index 023ede50865..3ac7b3638e1 100644
--- a/src/comp/front/creader.rs
+++ b/src/comp/front/creader.rs
@@ -90,9 +90,9 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t {
         case ('t') {
             assert (next(st) as char == '[');
             auto def = parse_def(st, sd);
-            let vec[ty::t] params = vec();
+            let vec[ty::t] params = [];
             while (peek(st) as char != ']') {
-                params += vec(parse_ty(st, sd));
+                params += [parse_ty(st, sd)];
             }
             st.pos = st.pos + 1u;
             ret ty::mk_tag(st.tcx, def, params);
@@ -104,23 +104,23 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t {
         case ('C') { ret ty::mk_chan(st.tcx, parse_ty(st, sd)); }
         case ('T') {
             assert (next(st) as char == '[');
-            let vec[ty::mt] params = vec();
+            let vec[ty::mt] params = [];
             while (peek(st) as char != ']') {
-                params += vec(parse_mt(st, sd));
+                params += [parse_mt(st, sd)];
             }
             st.pos = st.pos + 1u;
             ret ty::mk_tup(st.tcx, params);
         }
         case ('R') {
             assert (next(st) as char == '[');
-            let vec[ty::field] fields = vec();
+            let vec[ty::field] fields = [];
             while (peek(st) as char != ']') {
                 auto name = "";
                 while (peek(st) as char != '=') {
                     name += _str::unsafe_from_byte(next(st));
                 }
                 st.pos = st.pos + 1u;
-                fields += vec(rec(ident=name, mt=parse_mt(st, sd)));
+                fields += [rec(ident=name, mt=parse_mt(st, sd))];
             }
             st.pos = st.pos + 1u;
             ret ty::mk_rec(st.tcx, fields);
@@ -146,7 +146,7 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t {
         }
         case ('O') {
             assert (next(st) as char == '[');
-            let vec[ty::method] methods = vec();
+            let vec[ty::method] methods = [];
             while (peek(st) as char != ']') {
                 auto proto;
                 alt (next(st) as char) {
@@ -158,10 +158,10 @@ fn parse_ty(@pstate st, str_def sd) -> ty::t {
                     name += _str::unsafe_from_byte(next(st));
                 }
                 auto func = parse_ty_fn(st, sd);
-                methods += vec(rec(proto=proto,
+                methods += [rec(proto=proto,
                                    ident=name,
                                    inputs=func._0,
-                                   output=func._1));
+                                   output=func._1)];
             }
             st.pos += 1u;
             ret ty::mk_obj(st.tcx, methods);
@@ -242,14 +242,14 @@ fn parse_hex(@pstate st) -> uint {
 
 fn parse_ty_fn(@pstate st, str_def sd) -> tup(vec[ty::arg], ty::t) {
     assert (next(st) as char == '[');
-    let vec[ty::arg] inputs = vec();
+    let vec[ty::arg] inputs = [];
     while (peek(st) as char != ']') {
         auto mode = ty::mo_val;
         if (peek(st) as char == '&') {
             mode = ty::mo_alias;
             st.pos = st.pos + 1u;
         }
-        inputs += vec(rec(mode=mode, ty=parse_ty(st, sd)));
+        inputs += [rec(mode=mode, ty=parse_ty(st, sd))];
     }
     st.pos = st.pos + 1u;
     ret tup(inputs, parse_ty(st, sd));
@@ -285,7 +285,7 @@ fn lookup_hash(&ebml::doc d, fn(vec[u8]) -> bool eq_fn, uint hash)
     auto pos = ebml::be_uint_from_bytes(d.data, hash_pos, 4u);
     auto bucket = ebml::doc_at(d.data, pos);
     // Awkward logic because we can't ret from foreach yet
-    let vec[ebml::doc] result = vec();
+    let vec[ebml::doc] result = [];
     auto belt = metadata::tag_index_buckets_bucket_elt;
     for each (ebml::doc elt in ebml::tagged_docs(bucket, belt)) {
         auto pos = ebml::be_uint_from_bytes(elt.data, elt.start, 4u);
@@ -306,7 +306,7 @@ fn resolve_path(vec[ast::ident] path, vec[u8] data) -> vec[ast::def_id] {
     auto md = ebml::new_doc(data);
     auto paths = ebml::get_doc(md, metadata::tag_paths);
     auto eqer = bind eq_item(_, s);
-    let vec[ast::def_id] result = vec();
+    let vec[ast::def_id] result = [];
     for (ebml::doc doc in lookup_hash(paths, eqer, metadata::hash_path(s))) {
         auto did_doc = ebml::get_doc(doc, metadata::tag_def_id);
         _vec::push(result, parse_def_id(ebml::doc_data(did_doc)));
@@ -380,7 +380,7 @@ fn item_ty_param_count(&ebml::doc item, int this_cnum) -> uint {
 }
 
 fn tag_variant_ids(&ebml::doc item, int this_cnum) -> vec[ast::def_id] {
-    let vec[ast::def_id] ids = vec();
+    let vec[ast::def_id] ids = [];
     auto v = metadata::tag_items_data_item_variant;
     for each (ebml::doc p in ebml::tagged_docs(item, v)) {
         auto ext = parse_def_id(ebml::doc_data(p));
@@ -544,23 +544,23 @@ fn get_tag_variants(session::session sess, ty::ctxt tcx, ast::def_id def)
     auto items = ebml::get_doc(ebml::new_doc(data), metadata::tag_items);
     auto item = find_item(def._1, items);
 
-    let vec[trans::variant_info] infos = vec();
+    let vec[trans::variant_info] infos = [];
     auto variant_ids = tag_variant_ids(item, external_crate_id);
     for (ast::def_id did in variant_ids) {
         auto item = find_item(did._1, items);
         auto ctor_ty = item_type(item, external_crate_id, tcx);
-        let vec[ty::t] arg_tys = vec();
+        let vec[ty::t] arg_tys = [];
         alt (ty::struct(tcx, ctor_ty)) {
             case (ty::ty_fn(_, ?args, _)) {
                 for (ty::arg a in args) {
-                    arg_tys += vec(a.ty);
+                    arg_tys += [a.ty];
                 }
             }
             case (_) {
                 // Nullary tag variant.
             }
         }
-        infos += vec(rec(args=arg_tys, ctor_ty=ctor_ty, id=did));
+        infos += [rec(args=arg_tys, ctor_ty=ctor_ty, id=did)];
     }
 
     ret infos;
diff --git a/src/comp/front/eval.rs b/src/comp/front/eval.rs
index 0416611c8f3..c44af3d0926 100644
--- a/src/comp/front/eval.rs
+++ b/src/comp/front/eval.rs
@@ -38,7 +38,7 @@ type ctx = @rec(parser p,
                 mutable uint next_ann);
 
 fn mk_env() -> env {
-    let env e = vec();
+    let env e = [];
     ret e;
 }
 
@@ -249,8 +249,8 @@ fn eval_crate_directives(ctx cx,
 fn eval_crate_directives_to_mod(ctx cx, env e,
                                        vec[@ast::crate_directive] cdirs,
                                        str prefix) -> ast::_mod {
-    let vec[@ast::view_item] view_items = vec();
-    let vec[@ast::item] items = vec();
+    let vec[@ast::view_item] view_items = [];
+    let vec[@ast::item] items = [];
 
     eval_crate_directives(cx, e, cdirs, prefix,
                           view_items, items);
@@ -356,7 +356,7 @@ fn eval_crate_directive(ctx cx,
 
         case (ast::cdir_let(?id, ?x, ?cdirs)) {
             auto v = eval_expr(cx, e, x);
-            auto e0 = vec(tup(id, v)) + e;
+            auto e0 = [tup(id, v)] + e;
             eval_crate_directives(cx, e0, cdirs, prefix,
                                   view_items, items);
         }
@@ -379,7 +379,7 @@ fn eval_crate_directive(ctx cx,
             auto full_path = prefix + std::fs::path_sep() + file_path;
 
             if (cx.mode == mode_depend) {
-                cx.deps += vec(full_path);
+                cx.deps += [full_path];
                 ret;
             }
 
diff --git a/src/comp/front/extfmt.rs b/src/comp/front/extfmt.rs
index df1b5e67f0a..9c15d11e4c4 100644
--- a/src/comp/front/extfmt.rs
+++ b/src/comp/front/extfmt.rs
@@ -118,7 +118,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
 
     fn make_path_expr(parser p, common::span sp, vec[ast::ident] idents)
             -> @ast::expr {
-        let vec[@ast::ty] types = vec();
+        let vec[@ast::ty] types = [];
         auto path = rec(idents=idents, types=types);
         auto sp_path = rec(node=path, span=sp);
         auto pathexpr = ast::expr_path(sp_path, p.get_ann());
@@ -143,14 +143,14 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
 
     fn make_rec_expr(parser p, common::span sp,
                      vec[tup(ast::ident, @ast::expr)] fields) -> @ast::expr {
-        let vec[ast::field] astfields = vec();
+        let vec[ast::field] astfields = [];
         for (tup(ast::ident, @ast::expr) field in fields) {
             auto ident = field._0;
             auto val = field._1;
             auto astfield = rec(mut = ast::imm,
                                 ident = ident,
                                 expr = val);
-            astfields += vec(astfield);
+            astfields += [astfield];
         }
 
         auto recexpr = ast::expr_rec(astfields,
@@ -163,7 +163,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
     fn make_path_vec(str ident) -> vec[str] {
         // FIXME: #fmt can't currently be used from within std
         // because we're explicitly referencing the 'std' crate here
-        ret vec("std", "extfmt", "rt", ident);
+        ret ["std", "extfmt", "rt", ident];
     }
 
     fn make_rt_path_expr(parser p, common::span sp, str ident) -> @ast::expr {
@@ -177,7 +177,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
 
         fn make_flags(parser p, common::span sp, vec[flag] flags)
                 -> @ast::expr {
-            let vec[@ast::expr] flagexprs = vec();
+            let vec[@ast::expr] flagexprs = [];
             for (flag f in flags) {
                 auto fstr;
                 alt (f) {
@@ -197,14 +197,14 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
                         fstr = "flag_alternate";
                     }
                 }
-                flagexprs += vec(make_rt_path_expr(p, sp, fstr));
+                flagexprs += [make_rt_path_expr(p, sp, fstr)];
             }
 
             // FIXME: 0-length vectors can't have their type inferred
             // through the rec that these flags are a member of, so
             // this is a hack placeholder flag
             if (_vec::len[@ast::expr](flagexprs) == 0u) {
-                flagexprs += vec(make_rt_path_expr(p, sp, "flag_none"));
+                flagexprs += [make_rt_path_expr(p, sp, "flag_none")];
             }
 
             ret make_vec_expr(p, sp, flagexprs);
@@ -218,7 +218,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
                 case (count_is(?c)) {
                     auto count_lit = make_new_int(p, sp, c);
                     auto count_is_path = make_path_vec("count_is");
-                    auto count_is_args = vec(count_lit);
+                    auto count_is_args = [count_lit];
                     ret make_call(p, sp, count_is_path, count_is_args);
                 }
                 case (_) {
@@ -261,10 +261,10 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
                          @ast::expr width_expr,
                          @ast::expr precision_expr,
                          @ast::expr ty_expr) -> @ast::expr {
-            ret make_rec_expr(p, sp, vec(tup("flags", flags_expr),
+            ret make_rec_expr(p, sp, [tup("flags", flags_expr),
                                          tup("width", width_expr),
                                          tup("precision", precision_expr),
-                                         tup("ty", ty_expr)));
+                                         tup("ty", ty_expr)]);
         }
 
         auto rt_conv_flags = make_flags(p, sp, cnv.flags);
@@ -284,7 +284,7 @@ fn pieces_to_expr(parser p, vec[piece] pieces, vec[@ast::expr] args)
         auto fname = "conv_" + conv_type;
         auto path = make_path_vec(fname);
         auto cnv_expr = make_rt_conv_expr(p, sp, cnv);
-        auto args = vec(cnv_expr, arg);
+        auto args = [cnv_expr, arg];
         ret make_call(p, arg.span, path, args);
     }
 
diff --git a/src/comp/front/lexer.rs b/src/comp/front/lexer.rs
index 16f75b4ab05..c151dc2f7be 100644
--- a/src/comp/front/lexer.rs
+++ b/src/comp/front/lexer.rs
@@ -91,7 +91,7 @@ fn new_reader(session sess, io::reader rdr,
         }
     }
     auto file = _str::unsafe_from_bytes(rdr.read_whole_stream());
-    let vec[str] strs = vec();
+    let vec[str] strs = [];
     auto rd = reader(sess, file, _str::byte_len(file), 0u, -1 as char,
                      filemap.start_pos, filemap.start_pos,
                      strs, filemap, itr);
@@ -228,11 +228,11 @@ fn scan_exponent(reader rdr) -> option::t[str] {
     auto res = "";
 
     if (c == 'e' || c == 'E') {
-        res += _str::from_bytes(vec(c as u8));
+        res += _str::from_bytes([c as u8]);
         rdr.bump();
         c = rdr.curr();
         if (c == '-' || c == '+') {
-            res += _str::from_bytes(vec(c as u8));
+            res += _str::from_bytes([c as u8]);
             rdr.bump();
         }
         auto exponent = scan_dec_digits(rdr);
@@ -256,7 +256,7 @@ fn scan_dec_digits(reader rdr) -> str {
 
     while (is_dec_digit (c) || c == '_') {
         if (c != '_') {
-            res += _str::from_bytes(vec(c as u8));
+            res += _str::from_bytes([c as u8]);
         }
         rdr.bump();
         c = rdr.curr();
@@ -766,7 +766,7 @@ fn read_block_comment(reader rdr) -> cmnt {
     auto p = rdr.get_chpos();
     rdr.bump(); rdr.bump();
     while (rdr.curr() == ' ') {rdr.bump();}
-    let vec[str] lines = vec();
+    let vec[str] lines = [];
     auto val = "";
     auto level = 1;
     while (true) {
@@ -802,7 +802,7 @@ fn gather_comments(session sess, str path) -> vec[cmnt] {
     auto srdr = io::file_reader(path);
     auto itr = @interner::mk_interner[str](_str::hash, _str::eq);
     auto rdr = new_reader(sess, srdr, codemap::new_filemap(path, 0u), itr);
-    let vec[cmnt] comments = vec();
+    let vec[cmnt] comments = [];
     while (!rdr.is_eof()) {
         while (true) {
             consume_whitespace(rdr);
diff --git a/src/comp/front/parser.rs b/src/comp/front/parser.rs
index 8649dc6fc42..3fa25857d3f 100644
--- a/src/comp/front/parser.rs
+++ b/src/comp/front/parser.rs
@@ -422,7 +422,7 @@ fn parse_ty_constr(parser p) -> @ast::constr {
 fn parse_constrs(parser p) -> common::spanned[vec[@ast::constr]] {
     auto lo = p.get_lo_pos();
     auto hi = p.get_hi_pos();
-    let vec[@ast::constr] constrs = vec();
+    let vec[@ast::constr] constrs = [];
     if (p.peek() == token::COLON) {
         p.bump();
         while (true) {
@@ -580,7 +580,7 @@ fn parse_seq_to_end[T](token::token ket,
                               uint hi,
                               parser p) -> vec[T] {
     let bool first = true;
-    let vec[T] v = vec();
+    let vec[T] v = [];
     while (p.peek() != ket) {
         alt(sep) {
             case (some[token::token](?t)) {
@@ -595,7 +595,7 @@ fn parse_seq_to_end[T](token::token ket,
         }
         // FIXME: v += f(p) doesn't work at the moment.
         let T t = f(p);
-        v += vec(t);
+        v += [t];
     }
     hi = p.get_hi_pos();
     expect(p, ket);
@@ -677,7 +677,7 @@ fn parse_ty_args(parser p, uint hi) ->
                                some(token::COMMA),
                                pf, p);
     }
-    let vec[@ast::ty] v = vec();
+    let vec[@ast::ty] v = [];
     auto pos = p.get_lo_pos();
     ret spanned(hi, hi, v);
 }
@@ -687,12 +687,12 @@ fn parse_path(parser p) -> ast::path {
     auto lo = p.get_lo_pos();
     auto hi = lo;
 
-    let vec[ast::ident] ids = vec();
+    let vec[ast::ident] ids = [];
     while (true) {
         alt (p.peek()) {
             case (token::IDENT(?i, _)) {
                 hi = p.get_hi_pos();
-                ids += vec(p.get_str(i));
+                ids += [p.get_str(i)];
                 p.bump();
                 if (p.peek() == token::MOD_SEP) {
                     p.bump();
@@ -797,7 +797,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr {
                   pf, hi, p));
         }
 
-        let vec[@ast::method] meths = vec();
+        let vec[@ast::method] meths = [];
         let option::t[ast::ident] with_obj = none[ast::ident];
 
         expect(p, token::LBRACE);
@@ -830,7 +830,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr {
 
     } else if (eat_word(p, "rec")) {
         expect(p, token::LPAREN);
-        auto fields = vec(parse_field(p));
+        auto fields = [parse_field(p)];
 
         auto more = true;
         auto base = none[@ast::expr];
@@ -846,7 +846,7 @@ fn parse_bottom_expr(parser p) -> @ast::expr {
                 more = false;
             } else if (p.peek() == token::COMMA) {
                 p.bump();
-                fields += vec(parse_field(p));
+                fields += [parse_field(p)];
             } else {
                 unexpected(p, p.peek());
             }
@@ -1151,7 +1151,7 @@ type op_spec = rec(token::token tok, ast::binop op, int prec);
 
 // FIXME make this a const, don't store it in parser state
 fn prec_table() -> vec[op_spec] {
-    ret vec(rec(tok=token::BINOP(token::STAR), op=ast::mul, prec=11),
+    ret [rec(tok=token::BINOP(token::STAR), op=ast::mul, prec=11),
             rec(tok=token::BINOP(token::SLASH), op=ast::div, prec=11),
             rec(tok=token::BINOP(token::PERCENT), op=ast::rem, prec=11),
             rec(tok=token::BINOP(token::PLUS), op=ast::add, prec=10),
@@ -1170,7 +1170,7 @@ fn prec_table() -> vec[op_spec] {
             rec(tok=token::EQEQ, op=ast::eq, prec=3),
             rec(tok=token::NE, op=ast::ne, prec=3),
             rec(tok=token::ANDAND, op=ast::and, prec=2),
-            rec(tok=token::OROR, op=ast::or, prec=1));
+            rec(tok=token::OROR, op=ast::or, prec=1)];
 }
 
 fn parse_binops(parser p) -> @ast::expr {
@@ -1342,14 +1342,14 @@ fn parse_alt_expr(parser p) -> @ast::expr {
     expect(p, token::RPAREN);
     expect(p, token::LBRACE);
 
-    let vec[ast::arm] arms = vec();
+    let vec[ast::arm] arms = [];
     while (p.peek() != token::RBRACE) {
         if (eat_word(p, "case")) {
             expect(p, token::LPAREN);
             auto pat = parse_pat(p);
             expect(p, token::RPAREN);
             auto block = parse_block(p);
-            arms += vec(rec(pat=pat, block=block));
+            arms += [rec(pat=pat, block=block)];
         } else if (p.peek() == token::RBRACE) {
             /* empty */
         } else {
@@ -1480,7 +1480,7 @@ fn parse_pat(parser p) -> @ast::pat {
                         args = a.node;
                         hi = a.span.hi;
                     }
-                    case (_) { args = vec(); }
+                    case (_) { args = []; }
                 }
 
                 pat = ast::pat_tag(tag_path, args, p.get_ann());
@@ -1630,7 +1630,7 @@ fn stmt_ends_with_semi(@ast::stmt stmt) -> bool {
 fn parse_block(parser p) -> ast::block {
     auto lo = p.get_lo_pos();
 
-    let vec[@ast::stmt] stmts = vec();
+    let vec[@ast::stmt] stmts = [];
     let option::t[@ast::expr] expr = none[@ast::expr];
 
     expect(p, token::LBRACE);
@@ -1650,7 +1650,7 @@ fn parse_block(parser p) -> ast::block {
                         alt (p.peek()) {
                             case (token::SEMI) {
                                 p.bump();
-                                stmts += vec(stmt);
+                                stmts += [stmt];
                             }
                             case (token::RBRACE) { expr = some(e); }
                             case (?t) {
@@ -1660,13 +1660,13 @@ fn parse_block(parser p) -> ast::block {
                                           token::to_str(p.get_reader(), t));
                                     fail;
                                 }
-                                stmts += vec(stmt);
+                                stmts += [stmt];
                             }
                         }
                     }
                     case (none[@ast::expr]) {
                         // Not an expression statement.
-                        stmts += vec(stmt);
+                        stmts += [stmt];
                         // FIXME: crazy differentiation between conditions
                         // used in branches and binary expressions in rustboot
                         // means we cannot use && here. I know, right?
@@ -1693,7 +1693,7 @@ fn parse_ty_param(parser p) -> ast::ty_param {
 }
 
 fn parse_ty_params(parser p) -> vec[ast::ty_param] {
-    let vec[ast::ty_param] ty_params = vec();
+    let vec[ast::ty_param] ty_params = [];
     if (p.peek() == token::LBRACKET) {
         auto f = parse_ty_param;   // FIXME: pass as lval directly
         ty_params = parse_seq[ast::ty_param](token::LBRACKET, token::RBRACKET,
@@ -1775,7 +1775,7 @@ fn parse_method(parser p) -> @ast::method {
 fn parse_dtor(parser p) -> @ast::method {
     auto lo = p.get_last_lo_pos();
     let ast::block b = parse_block(p);
-    let vec[ast::arg] inputs = vec();
+    let vec[ast::arg] inputs = [];
     let @ast::ty output = @spanned(lo, lo, ast::ty_nil);
     let ast::fn_decl d = rec(inputs=inputs,
                             output=output,
@@ -1802,7 +1802,7 @@ fn parse_item_obj(parser p, ast::layer lyr) -> @ast::item {
          some(token::COMMA),
          pf, p);
 
-    let vec[@ast::method] meths = vec();
+    let vec[@ast::method] meths = [];
     let option::t[@ast::method] dtor = none[@ast::method];
 
     expect(p, token::LBRACE);
@@ -1829,9 +1829,9 @@ fn parse_item_obj(parser p, ast::layer lyr) -> @ast::item {
 
 fn parse_mod_items(parser p, token::token term) -> ast::_mod {
     auto view_items = parse_view(p);
-    let vec[@ast::item] items = vec();
+    let vec[@ast::item] items = [];
     while (p.peek() != term) {
-        items += vec(parse_item(p));
+        items += [parse_item(p)];
     }
     ret rec(view_items=view_items, items=items);
 }
@@ -1899,12 +1899,12 @@ fn parse_native_item(parser p) -> @ast::native_item {
 fn parse_native_mod_items(parser p,
                                  str native_name,
                                  ast::native_abi abi) -> ast::native_mod {
-    let vec[@ast::native_item] items = vec();
+    let vec[@ast::native_item] items = [];
 
     auto view_items = parse_native_view(p);
 
     while (p.peek() != token::RBRACE) {
-        items += vec(parse_native_item(p));
+        items += [parse_native_item(p)];
     }
     ret rec(native_name=native_name, abi=abi,
             view_items=view_items,
@@ -1982,7 +1982,7 @@ fn parse_item_tag(parser p) -> @ast::item {
     auto id = parse_ident(p);
     auto ty_params = parse_ty_params(p);
 
-    let vec[ast::variant] variants = vec();
+    let vec[ast::variant] variants = [];
     expect(p, token::LBRACE);
     while (p.peek() != token::RBRACE) {
         auto tok = p.peek();
@@ -1992,7 +1992,7 @@ fn parse_item_tag(parser p) -> @ast::item {
                 auto vlo = p.get_lo_pos();
                 p.bump();
 
-                let vec[ast::variant_arg] args = vec();
+                let vec[ast::variant_arg] args = [];
                 alt (p.peek()) {
                     case (token::LPAREN) {
                         auto f = parse_ty;
@@ -2001,7 +2001,7 @@ fn parse_item_tag(parser p) -> @ast::item {
                                                           some(token::COMMA),
                                                           f, p);
                         for (@ast::ty ty in arg_tys.node) {
-                            args += vec(rec(ty=ty, id=p.next_def_id()));
+                            args += [rec(ty=ty, id=p.next_def_id())];
                         }
                     }
                     case (_) { /* empty */ }
@@ -2013,7 +2013,7 @@ fn parse_item_tag(parser p) -> @ast::item {
                 auto id = p.next_def_id();
                 auto vr = rec(name=p.get_str(name), args=args,
                               id=id, ann=p.get_ann());
-                variants += vec(spanned[ast::variant_](vlo, vhi, vr));
+                variants += [spanned[ast::variant_](vlo, vhi, vr)];
             }
             case (token::RBRACE) { /* empty */ }
             case (_) {
@@ -2135,7 +2135,7 @@ fn parse_optional_meta(parser p) -> vec[@ast::meta_item] {
             ret parse_meta(p);
         }
         case (_) {
-            let vec[@ast::meta_item] v = vec();
+            let vec[@ast::meta_item] v = [];
             ret v;
         }
     }
@@ -2156,11 +2156,11 @@ fn parse_rest_import_name(parser p, ast::ident first,
                                  option::t[ast::ident] def_ident)
         -> @ast::view_item {
     auto lo = p.get_lo_pos();
-    let vec[ast::ident] identifiers = vec(first);
+    let vec[ast::ident] identifiers = [first];
     while (p.peek() != token::SEMI) {
         expect(p, token::MOD_SEP);
         auto i = parse_ident(p);
-        identifiers += vec(i);
+        identifiers += [i];
     }
     auto hi = p.get_hi_pos();
     p.bump();
@@ -2248,17 +2248,17 @@ fn is_view_item(&parser p) -> bool {
 }
 
 fn parse_view(parser p) -> vec[@ast::view_item] {
-    let vec[@ast::view_item] items = vec();
+    let vec[@ast::view_item] items = [];
     while (is_view_item(p)) {
-        items += vec(parse_view_item(p));
+        items += [parse_view_item(p)];
     }
     ret items;
 }
 
 fn parse_native_view(parser p) -> vec[@ast::view_item] {
-    let vec[@ast::view_item] items = vec();
+    let vec[@ast::view_item] items = [];
     while (is_view_item(p)) {
-        items += vec(parse_view_item(p));
+        items += [parse_view_item(p)];
     }
     ret items;
 }
@@ -2267,7 +2267,7 @@ fn parse_native_view(parser p) -> vec[@ast::view_item] {
 fn parse_crate_from_source_file(parser p) -> @ast::crate {
     auto lo = p.get_lo_pos();
     auto m = parse_mod_items(p, token::EOF);
-    let vec[@ast::crate_directive] cdirs = vec();
+    let vec[@ast::crate_directive] cdirs = [];
     ret @spanned(lo, p.get_lo_pos(), rec(directives=cdirs,
                                          module=m));
 }
@@ -2362,7 +2362,7 @@ fn parse_crate_directive(parser p) -> ast::crate_directive
 fn parse_crate_directives(parser p, token::token term)
     -> vec[@ast::crate_directive] {
 
-    let vec[@ast::crate_directive] cdirs = vec();
+    let vec[@ast::crate_directive] cdirs = [];
 
     while (p.peek() != term) {
         auto cdir = @parse_crate_directive(p);
@@ -2376,7 +2376,7 @@ fn parse_crate_from_crate_file(parser p) -> @ast::crate {
     auto lo = p.get_lo_pos();
     auto prefix = std::fs::dirname(p.get_filemap().name);
     auto cdirs = parse_crate_directives(p, token::EOF);
-    let vec[str] deps = vec();
+    let vec[str] deps = [];
     auto cx = @rec(p=p,
                    mode=eval::mode_parse,
                    mutable deps = deps,
diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs
index ba607d3e046..4a8e42a42d0 100644
--- a/src/comp/lib/llvm.rs
+++ b/src/comp/lib/llvm.rs
@@ -1395,7 +1395,7 @@ obj builder(BuilderRef B, @mutable bool terminated) {
         let ValueRef T = llvm::LLVMGetNamedFunction(M,
                                                     _str::buf("llvm.trap"));
         assert (T as int != 0);
-        let vec[ValueRef] Args = vec();
+        let vec[ValueRef] Args = [];
         ret llvm::LLVMBuildCall(B, T,
                                _vec::buf[ValueRef](Args),
                                _vec::len[ValueRef](Args),
@@ -1467,7 +1467,7 @@ fn mk_type_names() -> type_names {
 }
 
 fn type_to_str(type_names names, TypeRef ty) -> str {
-    let vec[TypeRef] v = vec();
+    let vec[TypeRef] v = [];
     ret type_to_str_inner(names, v, ty);
 }
 
@@ -1478,7 +1478,7 @@ fn type_to_str_inner(type_names names,
         ret names.get_name(ty);
     }
 
-    auto outer = outer0 + vec(ty);
+    auto outer = outer0 + [ty];
 
     let int kind = llvm::LLVMGetTypeKind(ty);
 
diff --git a/src/comp/middle/fold.rs b/src/comp/middle/fold.rs
index 7a9a67ddfca..606b37e49fc 100644
--- a/src/comp/middle/fold.rs
+++ b/src/comp/middle/fold.rs
@@ -358,7 +358,7 @@ type ast_fold[ENV] =
 //// Fold drivers.
 
 fn fold_path[ENV](&ENV env, &ast_fold[ENV] fld, &path p) -> path {
-    let vec[@ast::ty] tys_ = vec();
+    let vec[@ast::ty] tys_ = [];
     for (@ast::ty t in p.node.types) {
         _vec::push[@ast::ty](tys_, fold_ty(env, fld, t));
     }
@@ -398,7 +398,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty {
         }
 
         case (ast::ty_tup(?elts)) {
-            let vec[mt] elts_ = vec();
+            let vec[mt] elts_ = [];
             for (mt elt in elts) {
                 auto ty_ = fold_ty(env, fld, elt.ty);
                 _vec::push[mt](elts_, rec(ty=ty_, mut=elt.mut));
@@ -407,7 +407,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty {
         }
 
         case (ast::ty_rec(?flds)) {
-            let vec[ast::ty_field] flds_ = vec();
+            let vec[ast::ty_field] flds_ = [];
             for (ast::ty_field f in flds) {
                 auto ty_ = fold_ty(env, fld, f.mt.ty);
                 _vec::push[ast::ty_field]
@@ -417,7 +417,7 @@ fn fold_ty[ENV](&ENV env, &ast_fold[ENV] fld, &@ty t) -> @ty {
         }
 
         case (ast::ty_obj(?meths)) {
-            let vec[ast::ty_method] meths_ = vec();
+            let vec[ast::ty_method] meths_ = [];
             for (ast::ty_method m in meths) {
                 auto tfn = fold_ty_fn(env_, fld, t.span, m.proto,
                                       m.inputs, m.output);
@@ -458,11 +458,11 @@ fn fold_ty_fn[ENV](&ENV env, &ast_fold[ENV] fld, &span sp,
                    &vec[rec(ast::mode mode, @ty ty)] inputs,
                    &@ty output) -> @ty {
     auto output_ = fold_ty(env, fld, output);
-    let vec[rec(ast::mode mode, @ty ty)] inputs_ = vec();
+    let vec[rec(ast::mode mode, @ty ty)] inputs_ = [];
     for (rec(ast::mode mode, @ty ty) input in inputs) {
         auto ty_ = fold_ty(env, fld, input.ty);
         auto input_ = rec(ty=ty_ with input);
-        inputs_ += vec(input_);
+        inputs_ += [input_];
     }
     ret fld.fold_ty_fn(env, sp, proto, inputs_, output_);
 }
@@ -524,9 +524,9 @@ fn fold_pat[ENV](&ENV env, &ast_fold[ENV] fld, &@ast::pat p) -> @ast::pat {
         case (ast::pat_tag(?path, ?pats, ?t)) {
             auto ppath = fold_path(env, fld, path);
 
-            let vec[@ast::pat] ppats = vec();
+            let vec[@ast::pat] ppats = [];
             for (@ast::pat pat in pats) {
-                ppats += vec(fold_pat(env_, fld, pat));
+                ppats += [fold_pat(env_, fld, pat)];
             }
 
             ret fld.fold_pat_tag(env_, p.span, ppath, ppats, t);
@@ -536,7 +536,7 @@ fn fold_pat[ENV](&ENV env, &ast_fold[ENV] fld, &@ast::pat p) -> @ast::pat {
 
 fn fold_exprs[ENV](&ENV env, &ast_fold[ENV] fld,
                    &vec[@expr] es) -> vec[@expr] {
-    let vec[@expr] exprs = vec();
+    let vec[@expr] exprs = [];
     for (@expr e in es) {
         _vec::push[@expr](exprs, fold_expr(env, fld, e));
     }
@@ -568,19 +568,19 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr {
         }
 
         case (ast::expr_tup(?es, ?t)) {
-            let vec[ast::elt] elts = vec();
+            let vec[ast::elt] elts = [];
             for (ast::elt e in es) {
-                elts += vec(fold_tup_elt[ENV](env, fld, e));
+                elts += [fold_tup_elt[ENV](env, fld, e)];
             }
             auto t2 = fld.fold_ann(env_, t);
             ret fld.fold_expr_tup(env_, e.span, elts, t2);
         }
 
         case (ast::expr_rec(?fs, ?base, ?t)) {
-            let vec[ast::field] fields = vec();
+            let vec[ast::field] fields = [];
             let option::t[@expr] b = none[@expr];
             for (ast::field f in fs) {
-                fields += vec(fold_rec_field(env, fld, f));
+                fields += [fold_rec_field(env, fld, f)];
             }
             alt (base) {
                 case (none[@ast::expr]) { }
@@ -606,14 +606,14 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr {
 
         case (ast::expr_bind(?f, ?args_opt, ?t)) {
             auto ff = fold_expr(env_, fld, f);
-            let vec[option::t[@ast::expr]] aargs_opt = vec();
+            let vec[option::t[@ast::expr]] aargs_opt = [];
             for (option::t[@ast::expr] t_opt in args_opt) {
                 alt (t_opt) {
                     case (none[@ast::expr]) {
-                        aargs_opt += vec(none[@ast::expr]);
+                        aargs_opt += [none[@ast::expr]];
                     }
                     case (some[@ast::expr](?e)) {
-                        aargs_opt += vec(some(fold_expr(env_, fld, e)));
+                        aargs_opt += [some(fold_expr(env_, fld, e))];
                     }
                     case (none[@ast::expr]) { /* empty */ }
                 }
@@ -700,9 +700,9 @@ fn fold_expr[ENV](&ENV env, &ast_fold[ENV] fld, &@expr e) -> @expr {
 
         case (ast::expr_alt(?expr, ?arms, ?t)) {
             auto eexpr = fold_expr(env_, fld, expr);
-            let vec[ast::arm] aarms = vec();
+            let vec[ast::arm] aarms = [];
             for (ast::arm a in arms) {
-                aarms += vec(fold_arm(env_, fld, a));
+                aarms += [fold_arm(env_, fld, a)];
             }
             auto t2 = fld.fold_ann(env_, t);
             ret fld.fold_expr_alt(env_, e.span, eexpr, aarms, t2);
@@ -887,7 +887,7 @@ fn fold_block[ENV](&ENV env, &ast_fold[ENV] fld, &block blk) -> block {
         ret blk;
     }
 
-    let vec[@ast::stmt] stmts = vec();
+    let vec[@ast::stmt] stmts = [];
     for (@ast::stmt s in blk.node.stmts) {
         auto new_stmt = fold_stmt[ENV](env_, fld, s);
         _vec::push[@ast::stmt](stmts, new_stmt);
@@ -921,9 +921,9 @@ fn fold_arg[ENV](&ENV env, &ast_fold[ENV] fld, &arg a) -> arg {
 
 fn fold_fn_decl[ENV](&ENV env, &ast_fold[ENV] fld,
                      &ast::fn_decl decl) -> ast::fn_decl {
-    let vec[ast::arg] inputs = vec();
+    let vec[ast::arg] inputs = [];
     for (ast::arg a in decl.inputs) {
-        inputs += vec(fold_arg(env, fld, a));
+        inputs += [fold_arg(env, fld, a)];
     }
     auto output = fold_ty[ENV](env, fld, decl.output);
     ret fld.fold_fn_decl(env, inputs, output, decl.purity);
@@ -953,10 +953,10 @@ fn fold_method[ENV](&ENV env, &ast_fold[ENV] fld,
 
 fn fold_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::_obj ob) -> ast::_obj {
 
-    let vec[ast::obj_field] fields = vec();
-    let vec[@ast::method] meths = vec();
+    let vec[ast::obj_field] fields = [];
+    let vec[@ast::method] meths = [];
     for (ast::obj_field f in ob.fields) {
-        fields += vec(fold_obj_field(env, fld, f));
+        fields += [fold_obj_field(env, fld, f)];
     }
     let option::t[@ast::method] dtor = none[@ast::method];
     alt (ob.dtor) {
@@ -965,7 +965,7 @@ fn fold_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::_obj ob) -> ast::_obj {
             dtor = some[@ast::method](fold_method[ENV](env, fld, m));
         }
     }
-    let vec[ast::ty_param] tp = vec();
+    let vec[ast::ty_param] tp = [];
     for (@ast::method m in ob.methods) {
         // Fake-up an ast::item for this method.
         // FIXME: this is kinda awful. Maybe we should reformulate
@@ -990,9 +990,9 @@ fn fold_anon_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::anon_obj ob)
     alt (ob.fields) {
         case (none[vec[ast::obj_field]]) { }
         case (some[vec[ast::obj_field]](?v)) {
-            let vec[ast::obj_field] fields = vec();
+            let vec[ast::obj_field] fields = [];
             for (ast::obj_field f in v) {
-                fields += vec(fold_obj_field(env, fld, f));
+                fields += [fold_obj_field(env, fld, f)];
             }
         }
     }
@@ -1007,8 +1007,8 @@ fn fold_anon_obj[ENV](&ENV env, &ast_fold[ENV] fld, &ast::anon_obj ob)
     }
 
     // Methods
-    let vec[@ast::method] meths = vec();
-    let vec[ast::ty_param] tp = vec();
+    let vec[@ast::method] meths = [];
+    let vec[ast::ty_param] tp = [];
     for (@ast::method m in ob.methods) {
         // Fake-up an ast::item for this method.
         // FIXME: this is kinda awful. Maybe we should reformulate
@@ -1089,16 +1089,16 @@ fn fold_item[ENV](&ENV env, &ast_fold[ENV] fld, &@item i) -> @item {
         }
 
         case (ast::item_tag(?ident, ?variants, ?ty_params, ?id, ?ann)) {
-            let vec[ast::variant] new_variants = vec();
+            let vec[ast::variant] new_variants = [];
             for (ast::variant v in variants) {
-                let vec[ast::variant_arg] new_args = vec();
+                let vec[ast::variant_arg] new_args = [];
                 for (ast::variant_arg va in v.node.args) {
                     auto new_ty = fold_ty[ENV](env_, fld, va.ty);
-                    new_args += vec(rec(ty=new_ty, id=va.id));
+                    new_args += [rec(ty=new_ty, id=va.id)];
                 }
                 auto new_v = rec(name=v.node.name, args=new_args,
                                  id=v.node.id, ann=v.node.ann);
-                new_variants += vec(respan[ast::variant_](v.span, new_v));
+                new_variants += [respan[ast::variant_](v.span, new_v)];
             }
             ret fld.fold_item_tag(env_, i.span, ident, new_variants,
                                   ty_params, id, ann);
@@ -1116,8 +1116,8 @@ fn fold_item[ENV](&ENV env, &ast_fold[ENV] fld, &@item i) -> @item {
 
 fn fold_mod[ENV](&ENV e, &ast_fold[ENV] fld, &ast::_mod m) -> ast::_mod {
 
-    let vec[@view_item] view_items = vec();
-    let vec[@item] items = vec();
+    let vec[@view_item] view_items = [];
+    let vec[@item] items = [];
 
     for (@view_item vi in m.view_items) {
         auto new_vi = fold_view_item[ENV](e, fld, vi);
@@ -1154,8 +1154,8 @@ fn fold_native_item[ENV](&ENV env, &ast_fold[ENV] fld,
 
 fn fold_native_mod[ENV](&ENV e, &ast_fold[ENV] fld,
                         &ast::native_mod m) -> ast::native_mod {
-    let vec[@view_item] view_items = vec();
-    let vec[@native_item] items = vec();
+    let vec[@view_item] view_items = [];
+    let vec[@native_item] items = [];
 
     for (@view_item vi in m.view_items) {
         auto new_vi = fold_view_item[ENV](e, fld, vi);
diff --git a/src/comp/middle/metadata.rs b/src/comp/middle/metadata.rs
index b307842412d..daf52f7fbde 100644
--- a/src/comp/middle/metadata.rs
+++ b/src/comp/middle/metadata.rs
@@ -299,8 +299,8 @@ fn add_to_index(&ebml::writer ebml_w,
                 &vec[str] path,
                 &mutable vec[tup(str, uint)] index,
                 &str name) {
-    auto full_path = path + vec(name);
-    index += vec(tup(_str::connect(full_path, "::"), ebml_w.writer.tell()));
+    auto full_path = path + [name];
+    index += [tup(_str::connect(full_path, "::"), ebml_w.writer.tell())];
 }
 
 fn encode_native_module_item_paths(&ebml::writer ebml_w,
@@ -353,7 +353,7 @@ fn encode_module_item_paths(&ebml::writer ebml_w,
                 ebml::start_tag(ebml_w, tag_paths_data_mod);
                 encode_name(ebml_w, id);
                 encode_def_id(ebml_w, did);
-                encode_module_item_paths(ebml_w, _mod, path + vec(id), index);
+                encode_module_item_paths(ebml_w, _mod, path + [id], index);
                 ebml::end_tag(ebml_w);
             }
             case (ast::item_native_mod(?id, ?nmod, ?did)) {
@@ -361,7 +361,7 @@ fn encode_module_item_paths(&ebml::writer ebml_w,
                 ebml::start_tag(ebml_w, tag_paths_data_mod);
                 encode_name(ebml_w, id);
                 encode_def_id(ebml_w, did);
-                encode_native_module_item_paths(ebml_w, nmod, path + vec(id),
+                encode_native_module_item_paths(ebml_w, nmod, path + [id],
                                                 index);
                 ebml::end_tag(ebml_w);
             }
@@ -400,8 +400,8 @@ fn encode_module_item_paths(&ebml::writer ebml_w,
 
 fn encode_item_paths(&ebml::writer ebml_w, &@ast::crate crate)
         -> vec[tup(str, uint)] {
-    let vec[tup(str, uint)] index = vec();
-    let vec[str] path = vec();
+    let vec[tup(str, uint)] index = [];
+    let vec[str] path = [];
     ebml::start_tag(ebml_w, tag_paths);
     encode_module_item_paths(ebml_w, crate.node.module, path, index);
     ebml::end_tag(ebml_w);
@@ -413,7 +413,7 @@ fn encode_item_paths(&ebml::writer ebml_w, &@ast::crate crate)
 
 fn encode_kind(&ebml::writer ebml_w, u8 c) {
     ebml::start_tag(ebml_w, tag_items_data_item_kind);
-    ebml_w.writer.write(vec(c));
+    ebml_w.writer.write([c]);
     ebml::end_tag(ebml_w);
 }
 
@@ -470,7 +470,7 @@ fn encode_tag_variant_info(&@trans::crate_ctxt cx, &ebml::writer ebml_w,
                            &mutable vec[tup(int, uint)] index,
                            &vec[ast::ty_param] ty_params) {
     for (ast::variant variant in variants) {
-        index += vec(tup(variant.node.id._1, ebml_w.writer.tell()));
+        index += [tup(variant.node.id._1, ebml_w.writer.tell())];
 
         ebml::start_tag(ebml_w, tag_items_data_item);
         encode_def_id(ebml_w, variant.node.id);
@@ -549,7 +549,7 @@ fn encode_info_for_item(@trans::crate_ctxt cx, &ebml::writer ebml_w,
             encode_symbol(cx, ebml_w, odid.ctor);
             ebml::end_tag(ebml_w);
 
-            index += vec(tup(odid.ty._1, ebml_w.writer.tell()));
+            index += [tup(odid.ty._1, ebml_w.writer.tell())];
             ebml::start_tag(ebml_w, tag_items_data_item);
             encode_def_id(ebml_w, odid.ty);
             encode_kind(ebml_w, 'y' as u8);
@@ -582,16 +582,16 @@ fn encode_info_for_native_item(&@trans::crate_ctxt cx, &ebml::writer ebml_w,
 
 fn encode_info_for_items(&@trans::crate_ctxt cx, &ebml::writer ebml_w)
         -> vec[tup(int, uint)] {
-    let vec[tup(int, uint)] index = vec();
+    let vec[tup(int, uint)] index = [];
 
     ebml::start_tag(ebml_w, tag_items_data);
     for each (@tup(ast::def_id, @ast::item) kvp in cx.items.items()) {
-        index += vec(tup(kvp._0._1, ebml_w.writer.tell()));
+        index += [tup(kvp._0._1, ebml_w.writer.tell())];
         encode_info_for_item(cx, ebml_w, kvp._1, index);
     }
     for each (@tup(ast::def_id, @ast::native_item) kvp in
             cx.native_items.items()) {
-        index += vec(tup(kvp._0._1, ebml_w.writer.tell()));
+        index += [tup(kvp._0._1, ebml_w.writer.tell())];
         encode_info_for_native_item(cx, ebml_w, kvp._1);
     }
     ebml::end_tag(ebml_w);
@@ -618,15 +618,15 @@ fn hash_path(&str s) -> uint {
 
 fn create_index[T](&vec[tup(T, uint)] index, fn(&T) -> uint hash_fn)
         -> vec[vec[tup(T, uint)]] {
-    let vec[vec[tup(T, uint)]] buckets = vec();
+    let vec[vec[tup(T, uint)]] buckets = [];
     for each (uint i in _uint::range(0u, 256u)) {
-        let vec[tup(T, uint)] bucket = vec();
-        buckets += vec(bucket);
+        let vec[tup(T, uint)] bucket = [];
+        buckets += [bucket];
     }
 
     for (tup(T, uint) elt in index) {
         auto h = hash_fn(elt._0);
-        buckets.(h % 256u) += vec(elt);
+        buckets.(h % 256u) += [elt];
     }
 
     ret buckets;
@@ -638,10 +638,10 @@ fn encode_index[T](&ebml::writer ebml_w, &vec[vec[tup(T, uint)]] buckets,
 
     ebml::start_tag(ebml_w, tag_index);
 
-    let vec[uint] bucket_locs = vec();
+    let vec[uint] bucket_locs = [];
     ebml::start_tag(ebml_w, tag_index_buckets);
     for (vec[tup(T, uint)] bucket in buckets) {
-        bucket_locs += vec(ebml_w.writer.tell());
+        bucket_locs += [ebml_w.writer.tell()];
 
         ebml::start_tag(ebml_w, tag_index_buckets_bucket);
         for (tup(T, uint) elt in bucket) {
@@ -698,7 +698,7 @@ fn encode_metadata(&@trans::crate_ctxt cx, &@ast::crate crate)
 
     // Pad this, since something (LLVM, presumably) is cutting off the
     // remaining % 4 bytes.
-    buf_w.write(vec(0u8, 0u8, 0u8, 0u8));
+    buf_w.write([0u8, 0u8, 0u8, 0u8]);
 
     ret C_postr(string_w.get_str());
 }
@@ -709,7 +709,7 @@ fn write_metadata(&@trans::crate_ctxt cx, &@ast::crate crate) {
         llmeta = encode_metadata(cx, crate);
     }
 
-    auto llconst = trans::C_struct(vec(llmeta));
+    auto llconst = trans::C_struct([llmeta]);
     auto llglobal = llvm::LLVMAddGlobal(cx.llmod, trans::val_ty(llconst),
                                        _str::buf("rust_metadata"));
     llvm::LLVMSetInitializer(llglobal, llconst);
diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs
index f530d3f412f..07667e114fa 100644
--- a/src/comp/middle/resolve.rs
+++ b/src/comp/middle/resolve.rs
@@ -253,7 +253,7 @@ fn pop_env_for_item(@mutable list[scope] sc, &@ast::item i) {
 }
 
 fn push_env_for_method(@mutable list[scope] sc, &@ast::method m) {
-    let vec[ast::ty_param] tp = vec();
+    let vec[ast::ty_param] tp = [];
     let @ast::item i = @rec(node=ast::item_fn(m.node.ident,
                                               m.node.meth,
                                               tp,
@@ -686,7 +686,7 @@ fn lookup_in_mod(&env e, def m, &ident id, namespace ns, dir dr)
     if (defid._0 != ast::local_crate) { // Not in this crate
         auto cached = e.ext_cache.find(tup(defid,id,ns));
         if (!option::is_none(cached)) { ret cached; }
-        auto path = vec(id);
+        auto path = [id];
         if (defid._1 != -1) {
             path = e.ext_map.get(defid) + path;
         }
diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs
index 3fa7c8012c2..4c9f170ecd4 100644
--- a/src/comp/middle/trans.rs
+++ b/src/comp/middle/trans.rs
@@ -193,7 +193,7 @@ fn sep() -> str {
 }
 
 fn extend_path(@local_ctxt cx, &str name) -> @local_ctxt {
-  ret @rec(path = cx.path + vec(name) with *cx);
+  ret @rec(path = cx.path + [name] with *cx);
 }
 
 fn path_name(&vec[str] path) -> str {
@@ -341,8 +341,8 @@ fn T_fn(vec[TypeRef] inputs, TypeRef output) -> TypeRef {
 }
 
 fn T_fn_pair(&type_names tn, TypeRef tfn) -> TypeRef {
-    ret T_struct(vec(T_ptr(tfn),
-                     T_opaque_closure_ptr(tn)));
+    ret T_struct([T_ptr(tfn),
+                     T_opaque_closure_ptr(tn)]);
 }
 
 fn T_ptr(TypeRef t) -> TypeRef {
@@ -365,7 +365,7 @@ fn T_task(&type_names tn) -> TypeRef {
         ret tn.get_type(s);
     }
 
-    auto t = T_struct(vec(T_int(),      // Refcount
+    auto t = T_struct([T_int(),      // Refcount
                           T_int(),      // Delegate pointer
                           T_int(),      // Stack segment pointer
                           T_int(),      // Runtime SP
@@ -373,7 +373,7 @@ fn T_task(&type_names tn) -> TypeRef {
                           T_int(),      // GC chain
                           T_int(),      // Domain pointer
                           T_int()       // Crate cache pointer
-                          ));
+                          ]);
     tn.associate(s, t);
     ret t;
 }
@@ -426,19 +426,19 @@ fn T_tydesc(&type_names tn) -> TypeRef {
     auto abs_tydesc = llvm::LLVMResolveTypeHandle(th.llth);
     auto tydescpp = T_ptr(T_ptr(abs_tydesc));
     auto pvoid = T_ptr(T_i8());
-    auto glue_fn_ty = T_ptr(T_fn(vec(T_ptr(T_nil()),
+    auto glue_fn_ty = T_ptr(T_fn([T_ptr(T_nil()),
                                      T_taskptr(tn),
                                      T_ptr(T_nil()),
                                      tydescpp,
-                                     pvoid), T_void()));
-    auto cmp_glue_fn_ty = T_ptr(T_fn(vec(T_ptr(T_i1()),
+                                     pvoid], T_void()));
+    auto cmp_glue_fn_ty = T_ptr(T_fn([T_ptr(T_i1()),
                                          T_taskptr(tn),
                                          T_ptr(T_nil()),
                                          tydescpp,
                                          pvoid,
                                          pvoid,
-                                         T_i8()), T_void()));
-    auto tydesc = T_struct(vec(tydescpp,          // first_param
+                                         T_i8()], T_void()));
+    auto tydesc = T_struct([tydescpp,          // first_param
                                T_int(),           // size
                                T_int(),           // align
                                glue_fn_ty,        // take_glue
@@ -448,7 +448,7 @@ fn T_tydesc(&type_names tn) -> TypeRef {
                                glue_fn_ty,        // mark_glue
                                glue_fn_ty,        // obj_drop_glue
                                glue_fn_ty,        // is_stateful
-                               cmp_glue_fn_ty));  // cmp_glue
+                               cmp_glue_fn_ty]);  // cmp_glue
 
     llvm::LLVMRefineType(abs_tydesc, tydesc);
     auto t = llvm::LLVMResolveTypeHandle(th.llth);
@@ -462,12 +462,12 @@ fn T_array(TypeRef t, uint n) -> TypeRef {
 }
 
 fn T_vec(TypeRef t) -> TypeRef {
-    ret T_struct(vec(T_int(),       // Refcount
+    ret T_struct([T_int(),       // Refcount
                      T_int(),       // Alloc
                      T_int(),       // Fill
                      T_int(),       // Pad
                      T_array(t, 1u) // Body elements
-                     ));
+                     ]);
 }
 
 fn T_opaque_vec_ptr() -> TypeRef {
@@ -479,15 +479,15 @@ fn T_str() -> TypeRef {
 }
 
 fn T_box(TypeRef t) -> TypeRef {
-    ret T_struct(vec(T_int(), t));
+    ret T_struct([T_int(), t]);
 }
 
 fn T_port(TypeRef t) -> TypeRef {
-    ret T_struct(vec(T_int())); // Refcount
+    ret T_struct([T_int()]); // Refcount
 }
 
 fn T_chan(TypeRef t) -> TypeRef {
-    ret T_struct(vec(T_int())); // Refcount
+    ret T_struct([T_int()]); // Refcount
 }
 
 fn T_crate(&type_names tn) -> TypeRef {
@@ -496,7 +496,7 @@ fn T_crate(&type_names tn) -> TypeRef {
         ret tn.get_type(s);
     }
 
-    auto t = T_struct(vec(T_int(),      // ptrdiff_t image_base_off
+    auto t = T_struct([T_int(),      // ptrdiff_t image_base_off
                           T_int(),      // uintptr_t self_addr
                           T_int(),      // ptrdiff_t debug_abbrev_off
                           T_int(),      // size_t debug_abbrev_sz
@@ -511,7 +511,7 @@ fn T_crate(&type_names tn) -> TypeRef {
                           T_int(),      // int n_c_syms
                           T_int(),      // int n_libs
                           T_int()       // uintptr_t abi_tag
-                          ));
+                          ]);
     tn.associate(s, t);
     ret t;
 }
@@ -544,10 +544,10 @@ fn T_closure_ptr(&type_names tn,
     // NB: keep this in sync with code in trans_bind; we're making
     // an LLVM typeref structure that has the same "shape" as the ty::t
     // it constructs.
-    ret T_ptr(T_box(T_struct(vec(T_ptr(T_tydesc(tn)),
+    ret T_ptr(T_box(T_struct([T_ptr(T_tydesc(tn)),
                                  lltarget_ty,
                                  llbindings_ty,
-                                 T_captured_tydescs(tn, n_ty_params))
+                                 T_captured_tydescs(tn, n_ty_params)]
                              )));
 }
 
@@ -556,8 +556,8 @@ fn T_opaque_closure_ptr(&type_names tn) -> TypeRef {
     if (tn.name_has_type(s)) {
         ret tn.get_type(s);
     }
-    auto t = T_closure_ptr(tn, T_struct(vec(T_ptr(T_nil()),
-                                            T_ptr(T_nil()))),
+    auto t = T_closure_ptr(tn, T_struct([T_ptr(T_nil()),
+                                            T_ptr(T_nil())]),
                            T_nil(),
                            0u);
     tn.associate(s, t);
@@ -572,9 +572,9 @@ fn T_tag(&type_names tn, uint size) -> TypeRef {
 
     auto t;
     if (size == 0u) {
-        t = T_struct(vec(T_int()));
+        t = T_struct([T_int()]);
     } else {
-        t = T_struct(vec(T_int(), T_array(T_i8(), size)));
+        t = T_struct([T_int(), T_array(T_i8(), size)]);
     }
 
     tn.associate(s, t);
@@ -586,7 +586,7 @@ fn T_opaque_tag(&type_names tn) -> TypeRef {
     if (tn.name_has_type(s)) {
         ret tn.get_type(s);
     }
-    auto t = T_struct(vec(T_int(), T_i8()));
+    auto t = T_struct([T_int(), T_i8()]);
     tn.associate(s, t);
     ret t;
 }
@@ -603,8 +603,8 @@ fn T_obj_ptr(&type_names tn, uint n_captured_tydescs) -> TypeRef {
     // This function is not publicly exposed because it returns an incomplete
     // type. The dynamically-sized fields follow the captured tydescs.
     fn T_obj(type_names tn, uint n_captured_tydescs) -> TypeRef {
-        ret T_struct(vec(T_ptr(T_tydesc(tn)),
-                         T_captured_tydescs(tn, n_captured_tydescs)));
+        ret T_struct([T_ptr(T_tydesc(tn)),
+                         T_captured_tydescs(tn, n_captured_tydescs)]);
     }
 
     ret T_ptr(T_box(T_obj(tn, n_captured_tydescs)));
@@ -635,11 +635,11 @@ fn type_of(&@crate_ctxt cx, &ty::t t) -> TypeRef {
 
 fn type_of_explicit_args(&@crate_ctxt cx,
                          &vec[ty::arg] inputs) -> vec[TypeRef] {
-    let vec[TypeRef] atys = vec();
+    let vec[TypeRef] atys = [];
     for (ty::arg arg in inputs) {
         if (ty::type_has_dynamic_size(cx.tcx, arg.ty)) {
             assert (arg.mode == ty::mo_alias);
-            atys += vec(T_typaram_ptr(cx.tn));
+            atys += [T_typaram_ptr(cx.tn)];
         } else {
             let TypeRef t;
             alt (arg.mode) {
@@ -650,7 +650,7 @@ fn type_of_explicit_args(&@crate_ctxt cx,
                     t = type_of_inner(cx, arg.ty);
                 }
             }
-            atys += vec(t);
+            atys += [t];
         }
     }
     ret atys;
@@ -669,26 +669,26 @@ fn type_of_fn_full(&@crate_ctxt cx,
                    &vec[ty::arg] inputs,
                    &ty::t output,
                    uint ty_param_count) -> TypeRef {
-    let vec[TypeRef] atys = vec();
+    let vec[TypeRef] atys = [];
 
     // Arg 0: Output pointer.
     if (ty::type_has_dynamic_size(cx.tcx, output)) {
-        atys += vec(T_typaram_ptr(cx.tn));
+        atys += [T_typaram_ptr(cx.tn)];
     } else {
-        atys += vec(T_ptr(type_of_inner(cx, output)));
+        atys += [T_ptr(type_of_inner(cx, output))];
     }
 
     // Arg 1: task pointer.
-    atys += vec(T_taskptr(cx.tn));
+    atys += [T_taskptr(cx.tn)];
 
     // Arg 2: Env (closure-bindings / self-obj)
     alt (obj_self) {
         case (some[TypeRef](?t)) {
             assert (t as int != 0);
-            atys += vec(t);
+            atys += [t];
         }
         case (_) {
-            atys += vec(T_opaque_closure_ptr(cx.tn));
+            atys += [T_opaque_closure_ptr(cx.tn)];
         }
     }
 
@@ -696,7 +696,7 @@ fn type_of_fn_full(&@crate_ctxt cx,
     if (obj_self == none[TypeRef]) {
         auto i = 0u;
         while (i < ty_param_count) {
-            atys += vec(T_ptr(T_tydesc(cx.tn)));
+            atys += [T_ptr(T_tydesc(cx.tn))];
             i += 1u;
         }
     }
@@ -706,11 +706,11 @@ fn type_of_fn_full(&@crate_ctxt cx,
         // *input* type of the function we're given as our iter-block
         // argument.
         atys +=
-            vec(T_fn_pair(cx.tn,
+            [T_fn_pair(cx.tn,
                           type_of_fn_full(cx, ast::proto_fn, none[TypeRef],
-                                          vec(rec(mode=ty::mo_alias,
-                                                  ty=output)),
-                                          ty::mk_nil(cx.tcx), 0u)));
+                                          [rec(mode=ty::mo_alias,
+                                                  ty=output)],
+                                          ty::mk_nil(cx.tcx), 0u))];
     }
 
     // ... then explicit args.
@@ -732,13 +732,13 @@ fn type_of_native_fn(&@crate_ctxt cx, ast::native_abi abi,
                      &vec[ty::arg] inputs,
                      &ty::t output,
                      uint ty_param_count) -> TypeRef {
-    let vec[TypeRef] atys = vec();
+    let vec[TypeRef] atys = [];
     if (abi == ast::native_abi_rust) {
-        atys += vec(T_taskptr(cx.tn));
+        atys += [T_taskptr(cx.tn)];
         auto t = ty::ty_native_fn(abi, inputs, output);
         auto i = 0u;
         while (i < ty_param_count) {
-            atys += vec(T_ptr(T_tydesc(cx.tn)));
+            atys += [T_ptr(T_tydesc(cx.tn))];
             i += 1u;
         }
     }
@@ -798,16 +798,16 @@ fn type_of_inner(&@crate_ctxt cx, &ty::t t) -> TypeRef {
             llty = T_ptr(T_chan(type_of_inner(cx, t)));
         }
         case (ty::ty_tup(?elts)) {
-            let vec[TypeRef] tys = vec();
+            let vec[TypeRef] tys = [];
             for (ty::mt elt in elts) {
-                tys += vec(type_of_inner(cx, elt.ty));
+                tys += [type_of_inner(cx, elt.ty)];
             }
             llty = T_struct(tys);
         }
         case (ty::ty_rec(?fields)) {
-            let vec[TypeRef] tys = vec();
+            let vec[TypeRef] tys = [];
             for (ty::field f in fields) {
-                tys += vec(type_of_inner(cx, f.mt.ty));
+                tys += [type_of_inner(cx, f.mt.ty)];
             }
             llty = T_struct(tys);
         }
@@ -822,17 +822,17 @@ fn type_of_inner(&@crate_ctxt cx, &ty::t t) -> TypeRef {
             auto th = mk_type_handle();
             auto self_ty = llvm::LLVMResolveTypeHandle(th.llth);
 
-            let vec[TypeRef] mtys = vec(T_ptr(T_i8()));
+            let vec[TypeRef] mtys = [T_ptr(T_i8())];
             for (ty::method m in meths) {
                 let TypeRef mty =
                     type_of_fn_full(cx, m.proto,
                                     some[TypeRef](self_ty),
                                     m.inputs, m.output, 0u);
-                mtys += vec(T_ptr(mty));
+                mtys += [T_ptr(mty)];
             }
             let TypeRef vtbl = T_struct(mtys);
-            let TypeRef pair = T_struct(vec(T_ptr(vtbl),
-                                            T_opaque_obj_ptr(cx.tn)));
+            let TypeRef pair = T_struct([T_ptr(vtbl),
+                                            T_opaque_obj_ptr(cx.tn)]);
 
             auto abs_pair = llvm::LLVMResolveTypeHandle(th.llth);
             llvm::LLVMRefineType(abs_pair, pair);
@@ -917,7 +917,7 @@ fn sanitize(&str s) -> str {
                     if (c != 10u8 && c != ('}' as u8) && c != (')' as u8) &&
                         c != (' ' as u8) && c != ('\t' as u8) &&
                         c != (';' as u8)) {
-                        auto v = vec(c);
+                        auto v = [c];
                         result += _str::from_bytes(v);
                     }
                 }
@@ -987,12 +987,12 @@ fn C_cstr(&@crate_ctxt cx, &str s) -> ValueRef {
 // A rust boxed-and-length-annotated string.
 fn C_str(&@crate_ctxt cx, &str s) -> ValueRef {
     auto len = _str::byte_len(s);
-    auto box = C_struct(vec(C_int(abi::const_refcount as int),
+    auto box = C_struct([C_int(abi::const_refcount as int),
                             C_int(len + 1u as int), // 'alloc'
                             C_int(len + 1u as int), // 'fill'
                             C_int(0),               // 'pad'
                             llvm::LLVMConstString(_str::buf(s),
-                                                 len, False)));
+                                                 len, False)]);
     auto g = llvm::LLVMAddGlobal(cx.llmod, val_ty(box),
                                 _str::buf(cx.names.next("str")));
     llvm::LLVMSetInitializer(g, box);
@@ -1004,9 +1004,9 @@ fn C_str(&@crate_ctxt cx, &str s) -> ValueRef {
 
 fn C_zero_byte_arr(uint size) -> ValueRef {
     auto i = 0u;
-    let vec[ValueRef] elts = vec();
+    let vec[ValueRef] elts = [];
     while (i < size) {
-        elts += vec(C_u8(0u));
+        elts += [C_u8(0u)];
         i += 1u;
     }
     ret llvm::LLVMConstArray(T_i8(), _vec::buf[ValueRef](elts),
@@ -1050,7 +1050,7 @@ fn decl_internal_fastcall_fn(ModuleRef llmod,
 }
 
 fn decl_glue(ModuleRef llmod, type_names tn, &str s) -> ValueRef {
-    ret decl_cdecl_fn(llmod, s, T_fn(vec(T_taskptr(tn)), T_void()));
+    ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(tn)], T_void()));
 }
 
 fn decl_native_glue(ModuleRef llmod, &type_names tn,
@@ -1068,10 +1068,10 @@ fn decl_native_glue(ModuleRef llmod, &type_names tn,
     // to call them directly, once we have a calling convention worked out.
     let int n = _n as int;
     let str s = abi::native_glue_name(n, ngt);
-    let vec[TypeRef] args = vec(T_int()); // callee
+    let vec[TypeRef] args = [T_int()]; // callee
 
     if (!pass_task) {
-        args += vec(T_int()); // taskptr, will not be passed
+        args += [T_int()]; // taskptr, will not be passed
     }
 
     args += _vec::init_elt[TypeRef](T_int(), n as uint);
@@ -1123,14 +1123,14 @@ fn trans_native_call(&builder b, @glue_fns glues, ValueRef lltaskptr,
     } else {
         llglue = glues.native_glues_cdecl.(n);
     }
-    let vec[ValueRef] call_args = vec(llnative);
+    let vec[ValueRef] call_args = [llnative];
 
     if (!pass_task) {
-        call_args += vec(lltaskptr);
+        call_args += [lltaskptr];
     }
 
     for (ValueRef a in args) {
-        call_args += vec(b.ZExtOrBitCast(a, T_int()));
+        call_args += [b.ZExtOrBitCast(a, T_int())];
     }
 
     ret b.FastCall(llglue, call_args);
@@ -1138,8 +1138,8 @@ fn trans_native_call(&builder b, @glue_fns glues, ValueRef lltaskptr,
 
 fn trans_non_gc_free(&@block_ctxt cx, ValueRef v) -> result {
     cx.build.Call(cx.fcx.lcx.ccx.upcalls.free,
-                  vec(cx.fcx.lltaskptr,
-                      cx.build.PointerCast(v, T_ptr(T_i8())), C_int(0)));
+                  [cx.fcx.lltaskptr,
+                      cx.build.PointerCast(v, T_ptr(T_i8())), C_int(0)]);
     ret res(cx, C_int(0));
 }
 
@@ -1322,16 +1322,16 @@ fn dynamic_size_of(&@block_ctxt cx, ty::t t) -> result {
             ret res(szptr.bcx, szptr.bcx.build.Load(szptr.val));
         }
         case (ty::ty_tup(?elts)) {
-            let vec[ty::t] tys = vec();
+            let vec[ty::t] tys = [];
             for (ty::mt mt in elts) {
-                tys += vec(mt.ty);
+                tys += [mt.ty];
             }
             ret align_elements(cx, tys);
         }
         case (ty::ty_rec(?flds)) {
-            let vec[ty::t] tys = vec();
+            let vec[ty::t] tys = [];
             for (ty::field f in flds) {
-                tys += vec(f.mt.ty);
+                tys += [f.mt.ty];
             }
             ret align_elements(cx, tys);
         }
@@ -1346,13 +1346,13 @@ fn dynamic_size_of(&@block_ctxt cx, ty::t t) -> result {
             for (variant_info variant in variants) {
                 // Perform type substitution on the raw argument types.
                 let vec[ty::t] raw_tys = variant.args;
-                let vec[ty::t] tys = vec();
+                let vec[ty::t] tys = [];
                 for (ty::t raw_ty in raw_tys) {
                     auto t = ty::bind_params_in_type(cx.fcx.lcx.ccx.tcx,
                                                     raw_ty);
                     t = ty::substitute_type_params(cx.fcx.lcx.ccx.tcx, tps,
                                                    t);
-                    tys += vec(t);
+                    tys += [t];
                 }
 
                 auto rslt = align_elements(bcx, tys);
@@ -1417,9 +1417,9 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t,
     // It might be a static-known type. Handle this.
 
     if (! ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, t)) {
-        let vec[ValueRef] v = vec();
+        let vec[ValueRef] v = [];
         for (int i in ixs) {
-            v += vec(C_int(i));
+            v += [C_int(i)];
         }
         ret res(cx, cx.build.GEP(base, v));
     }
@@ -1463,7 +1463,7 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t,
         assert (n < len);
 
         let int ix = ixs.(n);
-        let vec[ty::t] prefix = vec();
+        let vec[ty::t] prefix = [];
         let int i = 0;
         while (i < ix) {
             _vec::push[ty::t](prefix,
@@ -1497,7 +1497,7 @@ fn GEP_tup_like(&@block_ctxt cx, &ty::t t,
     auto sz = size_of(bcx, prefix_ty);
     bcx = sz.bcx;
     auto raw = bcx.build.PointerCast(base, T_ptr(T_i8()));
-    auto bumped = bcx.build.GEP(raw, vec(sz.val));
+    auto bumped = bcx.build.GEP(raw, [sz.val]);
 
     if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, s.target)) {
         ret res(bcx, bumped);
@@ -1525,12 +1525,12 @@ fn GEP_tag(@block_ctxt cx,
     auto arg_tys = variant.args;
     auto elem_ty = ty::mk_nil(cx.fcx.lcx.ccx.tcx); // typestate infelicity
     auto i = 0;
-    let vec[ty::t] true_arg_tys = vec();
+    let vec[ty::t] true_arg_tys = [];
     for (ty::t aty in arg_tys) {
         auto arg_ty = ty::bind_params_in_type(cx.fcx.lcx.ccx.tcx, aty);
         arg_ty = ty::substitute_type_params(cx.fcx.lcx.ccx.tcx, ty_substs,
                                            arg_ty);
-        true_arg_tys += vec(arg_ty);
+        true_arg_tys += [arg_ty];
         if (i == ix) {
             elem_ty = arg_ty;
         }
@@ -1551,7 +1551,7 @@ fn GEP_tag(@block_ctxt cx,
     }
 
     // Do the GEP_tup_like().
-    auto rslt = GEP_tup_like(cx, tup_ty, llunionptr, vec(0, ix));
+    auto rslt = GEP_tup_like(cx, tup_ty, llunionptr, [0, ix]);
 
     // Cast the result to the appropriate type, if necessary.
     auto val;
@@ -1571,7 +1571,7 @@ fn trans_raw_malloc(&@block_ctxt cx, TypeRef llptr_ty, ValueRef llsize)
     // FIXME: need a table to collect tydesc globals.
     auto tydesc = C_null(T_ptr(T_tydesc(cx.fcx.lcx.ccx.tn)));
     auto rval = cx.build.Call(cx.fcx.lcx.ccx.upcalls.malloc,
-                              vec(cx.fcx.lltaskptr, llsize, tydesc));
+                              [cx.fcx.lltaskptr, llsize, tydesc]);
     ret res(cx, cx.build.PointerCast(rval, llptr_ty));
 }
 
@@ -1579,7 +1579,7 @@ fn trans_malloc_boxed(&@block_ctxt cx, ty::t t) -> result {
     // Synthesize a fake box type structurally so we have something
     // to measure the size of.
     auto boxed_body = ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx,
-                                    vec(ty::mk_int(cx.fcx.lcx.ccx.tcx), t));
+                                    [ty::mk_int(cx.fcx.lcx.ccx.tcx), t]);
     auto box_ptr = ty::mk_imm_box(cx.fcx.lcx.ccx.tcx, t);
     auto sz = size_of(cx, boxed_body);
     auto llty = type_of(cx.fcx.lcx.ccx, box_ptr);
@@ -1597,7 +1597,7 @@ fn field_of_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, int field)
     auto ti = none[@tydesc_info];
     auto tydesc = get_tydesc(cx, t, escapes, ti);
     ret res(tydesc.bcx,
-            tydesc.bcx.build.GEP(tydesc.val, vec(C_int(0), C_int(field))));
+            tydesc.bcx.build.GEP(tydesc.val, [C_int(0), C_int(field)]));
 }
 
 // Given a type containing ty params, build a vector containing a ValueRef for
@@ -1606,8 +1606,8 @@ fn field_of_tydesc(&@block_ctxt cx, &ty::t t, bool escapes, int field)
 // constructing derived tydescs.
 fn linearize_ty_params(&@block_ctxt cx, &ty::t t) ->
         tup(vec[uint], vec[ValueRef]) {
-    let vec[ValueRef] param_vals = vec();
-    let vec[uint] param_defs = vec();
+    let vec[ValueRef] param_vals = [];
+    let vec[uint] param_defs = [];
     type rr = rec(@block_ctxt cx,
                   mutable vec[ValueRef] vals,
                   mutable vec[uint] defs);
@@ -1622,8 +1622,8 @@ fn linearize_ty_params(&@block_ctxt cx, &ty::t t) ->
                     }
                 }
                 if (!seen) {
-                    r.vals += vec(r.cx.fcx.lltydescs.(pid));
-                    r.defs += vec(pid);
+                    r.vals += [r.cx.fcx.lltydescs.(pid)];
+                    r.defs += [pid];
                 }
             }
             case (_) { }
@@ -1654,7 +1654,7 @@ fn trans_stack_local_derived_tydesc(&@block_ctxt cx, ValueRef llsz,
 
     // Store a pointer to the rest of the descriptors.
     auto llrootfirstparam = cx.build.GEP(llmyroottydesc,
-                                         vec(C_int(0), C_int(0)));
+                                         [C_int(0), C_int(0)]);
 
     auto llfirstparam;
     alt (llparamtydescs) {
@@ -1663,16 +1663,16 @@ fn trans_stack_local_derived_tydesc(&@block_ctxt cx, ValueRef llsz,
         }
         case (some[ValueRef](?llparamtydescs)) {
             llfirstparam = cx.build.GEP(llparamtydescs,
-                                        vec(C_int(0), C_int(0)));
+                                        [C_int(0), C_int(0)]);
         }
     }
     cx.build.Store(llfirstparam,
-                   cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(0))));
+                   cx.build.GEP(llmyroottydesc, [C_int(0), C_int(0)]));
 
     cx.build.Store(llsz,
-                   cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(1))));
+                   cx.build.GEP(llmyroottydesc, [C_int(0), C_int(1)]));
     cx.build.Store(llalign,
-                   cx.build.GEP(llmyroottydesc, vec(C_int(0), C_int(2))));
+                   cx.build.GEP(llmyroottydesc, [C_int(0), C_int(2)]));
 
     ret llmyroottydesc;
 }
@@ -1715,11 +1715,11 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes,
                                       1u /* for root*/ + n_params));
 
         auto i = 0;
-        auto tdp = bcx.build.GEP(tydescs, vec(C_int(0), C_int(i)));
+        auto tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]);
         bcx.build.Store(root, tdp);
         i += 1;
         for (ValueRef td in tys._1) {
-            auto tdp = bcx.build.GEP(tydescs, vec(C_int(0), C_int(i)));
+            auto tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]);
             bcx.build.Store(td, tdp);
             i += 1;
         }
@@ -1727,12 +1727,12 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes,
         auto lltydescsptr = bcx.build.PointerCast(tydescs,
             T_ptr(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn))));
         auto td_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.get_type_desc,
-            vec(bcx.fcx.lltaskptr,
+            [bcx.fcx.lltaskptr,
                 bcx.fcx.lcx.ccx.crate_ptr,
                 sz.val,
                 align.val,
                 C_int((1u + n_params) as int),
-                lltydescsptr));
+                lltydescsptr]);
         v = td_val;
     } else {
         auto llparamtydescs_opt;
@@ -1745,7 +1745,7 @@ fn get_derived_tydesc(&@block_ctxt cx, &ty::t t, bool escapes,
             auto i = 0;
             for (ValueRef td in tys._1) {
                 auto tdp = bcx.build.GEP(llparamtydescs,
-                                        vec(C_int(0), C_int(i)));
+                                        [C_int(0), C_int(i)]);
                 bcx.build.Store(td, tdp);
                 i += 1;
             }
@@ -1777,7 +1777,7 @@ fn get_tydesc(&@block_ctxt cx, &ty::t t, bool escapes,
     }
 
     // Otherwise, generate a tydesc if necessary, and return it.
-    let vec[uint] tps = vec();
+    let vec[uint] tps = [];
     auto info = get_static_tydesc(cx, t, tps);
     static_ti = some[@tydesc_info](info);
     ret res(cx, info.tydesc);
@@ -1901,7 +1901,7 @@ fn make_generic_glue(&@local_ctxt cx,
     auto p = 0u;
     while (p < ty_param_count) {
         auto llparam = copy_args_bcx.build.GEP(lltyparams,
-                                               vec(C_int(p as int)));
+                                               [C_int(p as int)]);
         llparam = copy_args_bcx.build.Load(llparam);
         _vec::grow_set[ValueRef](lltydescs, ty_params.(p), 0 as ValueRef,
                                 llparam);
@@ -1977,7 +1977,7 @@ fn emit_tydescs(&@crate_ctxt ccx) {
         };
 
 
-        auto tydesc = C_struct(vec(C_null(T_ptr(T_ptr(T_tydesc(ccx.tn)))),
+        auto tydesc = C_struct([C_null(T_ptr(T_ptr(T_tydesc(ccx.tn)))),
                                    ti.size,
                                    ti.align,
                                    take_glue,             // take_glue
@@ -1987,7 +1987,7 @@ fn emit_tydescs(&@crate_ctxt ccx) {
                                    C_null(glue_fn_ty),    // mark_glue
                                    C_null(glue_fn_ty),    // obj_drop_glue
                                    C_null(glue_fn_ty),    // is_stateful
-                                   cmp_glue));            // cmp_glue
+                                   cmp_glue]);            // cmp_glue
 
         auto gvar = ti.tydesc;
         llvm::LLVMSetInitializer(gvar, tydesc);
@@ -2014,8 +2014,8 @@ fn make_take_glue(&@block_ctxt cx, ValueRef v, &ty::t t) {
 }
 
 fn incr_refcnt_of_boxed(&@block_ctxt cx, ValueRef box_ptr) -> result {
-    auto rc_ptr = cx.build.GEP(box_ptr, vec(C_int(0),
-                                            C_int(abi::box_rc_field_refcnt)));
+    auto rc_ptr = cx.build.GEP(box_ptr, [C_int(0),
+                                            C_int(abi::box_rc_field_refcnt)]);
     auto rc = cx.build.Load(rc_ptr);
 
     auto rc_adj_cx = new_sub_block_ctxt(cx, "rc++");
@@ -2063,8 +2063,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
             fn hit_zero(&@block_ctxt cx, ValueRef v,
                         ty::t body_ty) -> result {
                 auto body = cx.build.GEP(v,
-                                         vec(C_int(0),
-                                             C_int(abi::box_rc_field_body)));
+                                         [C_int(0),
+                                             C_int(abi::box_rc_field_body)]);
 
                 auto body_val = load_if_immediate(cx, body, body_ty);
                 auto res = drop_ty(cx, body_val, body_ty);
@@ -2081,8 +2081,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
         case (ty::ty_port(_)) {
             fn hit_zero(&@block_ctxt cx, ValueRef v) -> result {
                 cx.build.Call(cx.fcx.lcx.ccx.upcalls.del_port,
-                    vec(cx.fcx.lltaskptr,
-                        cx.build.PointerCast(v, T_opaque_port_ptr())));
+                    [cx.fcx.lltaskptr,
+                        cx.build.PointerCast(v, T_opaque_port_ptr())]);
                 ret res(cx, C_int(0));
             }
             auto v = cx.build.Load(v0);
@@ -2095,8 +2095,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
         case (ty::ty_chan(_)) {
             fn hit_zero(&@block_ctxt cx, ValueRef v) -> result {
                 cx.build.Call(cx.fcx.lcx.ccx.upcalls.del_chan,
-                    vec(cx.fcx.lltaskptr,
-                        cx.build.PointerCast(v, T_opaque_chan_ptr())));
+                    [cx.fcx.lltaskptr,
+                        cx.build.PointerCast(v, T_opaque_chan_ptr())]);
                 ret res(cx, C_int(0));
             }
             auto v = cx.build.Load(v0);
@@ -2110,12 +2110,12 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
             fn hit_zero(&@block_ctxt cx, ValueRef b, ValueRef o) -> result {
                 auto body =
                     cx.build.GEP(b,
-                                 vec(C_int(0),
-                                     C_int(abi::box_rc_field_body)));
+                                 [C_int(0),
+                                     C_int(abi::box_rc_field_body)]);
                 auto tydescptr =
                     cx.build.GEP(body,
-                                 vec(C_int(0),
-                                     C_int(abi::obj_body_elt_tydesc)));
+                                 [C_int(0),
+                                     C_int(abi::obj_body_elt_tydesc)]);
                 auto tydesc = cx.build.Load(tydescptr);
 
                 auto cx_ = maybe_call_dtor(cx, o);
@@ -2131,8 +2131,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
             }
             auto box_cell =
                 cx.build.GEP(v0,
-                             vec(C_int(0),
-                                 C_int(abi::obj_field_box)));
+                             [C_int(0),
+                                 C_int(abi::obj_field_box)]);
 
             auto boxptr = cx.build.Load(box_cell);
 
@@ -2148,17 +2148,17 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
                 // Call through the closure's own fields-drop glue first.
                 auto body =
                     cx.build.GEP(v,
-                                 vec(C_int(0),
-                                     C_int(abi::box_rc_field_body)));
+                                 [C_int(0),
+                                     C_int(abi::box_rc_field_body)]);
                 auto bindings =
                     cx.build.GEP(body,
-                                 vec(C_int(0),
-                                     C_int(abi::closure_elt_bindings)));
+                                 [C_int(0),
+                                     C_int(abi::closure_elt_bindings)]);
 
                 auto tydescptr =
                     cx.build.GEP(body,
-                                 vec(C_int(0),
-                                     C_int(abi::closure_elt_tydesc)));
+                                 [C_int(0),
+                                     C_int(abi::closure_elt_tydesc)]);
 
                 auto ti = none[@tydesc_info];
                 call_tydesc_glue_full(cx, bindings, cx.build.Load(tydescptr),
@@ -2171,8 +2171,8 @@ fn make_drop_glue(&@block_ctxt cx, ValueRef v0, &ty::t t) {
             }
             auto box_cell =
                 cx.build.GEP(v0,
-                             vec(C_int(0),
-                                 C_int(abi::fn_field_box)));
+                             [C_int(0),
+                                 C_int(abi::fn_field_box)]);
 
             auto boxptr = cx.build.Load(box_cell);
 
@@ -2216,8 +2216,8 @@ fn decr_refcnt_and_if_zero(&@block_ctxt cx,
 
 
     auto rc_ptr = load_rc_cx.build.GEP(box_ptr,
-                                       vec(C_int(0),
-                                           C_int(abi::box_rc_field_refcnt)));
+                                       [C_int(0),
+                                           C_int(abi::box_rc_field_refcnt)]);
 
     auto rc = load_rc_cx.build.Load(rc_ptr);
     auto const_test =
@@ -2234,11 +2234,11 @@ fn decr_refcnt_and_if_zero(&@block_ctxt cx,
     inner_res.bcx.build.Br(next_cx.llbb);
 
     auto phi = next_cx.build.Phi(t_else,
-                                 vec(v_else, v_else, v_else, inner_res.val),
-                                 vec(cx.llbb,
+                                 [v_else, v_else, v_else, inner_res.val],
+                                 [cx.llbb,
                                      load_rc_cx.llbb,
                                      rc_adj_cx.llbb,
-                                     inner_res.bcx.llbb));
+                                     inner_res.bcx.llbb]);
 
     ret res(next_cx, phi);
 }
@@ -2263,8 +2263,8 @@ fn make_cmp_glue(&@block_ctxt cx,
         make_scalar_cmp_glue(cx, lhs, rhs, t, llop);
 
     } else if (ty::type_is_box(cx.fcx.lcx.ccx.tcx, t)) {
-        lhs = cx.build.GEP(lhs, vec(C_int(0), C_int(abi::box_rc_field_body)));
-        rhs = cx.build.GEP(rhs, vec(C_int(0), C_int(abi::box_rc_field_body)));
+        lhs = cx.build.GEP(lhs, [C_int(0), C_int(abi::box_rc_field_body)]);
+        rhs = cx.build.GEP(rhs, [C_int(0), C_int(abi::box_rc_field_body)]);
         auto t_inner = alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) {
             case (ty::ty_box(?ti)) { ti.ty }
         };
@@ -2378,7 +2378,7 @@ fn make_cmp_glue(&@block_ctxt cx,
             auto rhs_p0 = vec_p0(r.bcx, rhs);
             auto min_len = umin(r.bcx, vec_fill(r.bcx, lhs),
                                 vec_fill(r.bcx, rhs));
-            auto rhs_lim = r.bcx.build.GEP(rhs_p0, vec(min_len));
+            auto rhs_lim = r.bcx.build.GEP(rhs_p0, [min_len]);
             auto elt_ty = ty::sequence_element_type(cx.fcx.lcx.ccx.tcx, t);
             r = size_of(r.bcx, elt_ty);
             r = iter_sequence_raw(r.bcx, lhs_p0, rhs_p0, rhs_lim, r.val,
@@ -2452,8 +2452,8 @@ fn make_fp_cmp_glue(&@block_ctxt cx, ValueRef lhs, ValueRef rhs,
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb);
 
     auto last_result =
-        last_cx.build.Phi(T_i1(), vec(eq_result, lt_result, le_result),
-                          vec(eq_cx.llbb, lt_cx.llbb, le_cx.llbb));
+        last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result],
+                          [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
     last_cx.build.Store(last_result, cx.fcx.llretptr);
     last_cx.build.RetVoid();
 }
@@ -2494,8 +2494,8 @@ fn compare_integral_values(&@block_ctxt cx, ValueRef lhs, ValueRef rhs,
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb);
 
     auto last_result =
-        last_cx.build.Phi(T_i1(), vec(eq_result, lt_result, le_result),
-                          vec(eq_cx.llbb, lt_cx.llbb, le_cx.llbb));
+        last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result],
+                          [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
     ret res(last_cx, last_result);
 }
 
@@ -2522,17 +2522,17 @@ fn tag_variants(&@crate_ctxt cx, &ast::def_id id) -> vec[variant_info] {
     assert (cx.items.contains_key(id));
     alt (cx.items.get(id).node) {
         case (ast::item_tag(_, ?variants, _, _, _)) {
-            let vec[variant_info] result = vec();
+            let vec[variant_info] result = [];
             for (ast::variant variant in variants) {
                 auto ctor_ty = node_ann_type(cx, variant.node.ann);
-                let vec[ty::t] arg_tys = vec();
+                let vec[ty::t] arg_tys = [];
                 if (_vec::len[ast::variant_arg](variant.node.args) > 0u) {
                     for (ty::arg a in ty::ty_fn_args(cx.tcx, ctor_ty)) {
-                        arg_tys += vec(a.ty);
+                        arg_tys += [a.ty];
                     }
                 }
                 auto did = variant.node.id;
-                result += vec(rec(args=arg_tys, ctor_ty=ctor_ty, id=did));
+                result += [rec(args=arg_tys, ctor_ty=ctor_ty, id=did)];
             }
             ret result;
         }
@@ -2616,9 +2616,9 @@ fn iter_structural_ty_full(&@block_ctxt cx,
         case (ty::ty_tup(?args)) {
             let int i = 0;
             for (ty::mt arg in args) {
-                r = GEP_tup_like(r.bcx, t, av, vec(0, i));
+                r = GEP_tup_like(r.bcx, t, av, [0, i]);
                 auto elt_a = r.val;
-                r = GEP_tup_like(r.bcx, t, bv, vec(0, i));
+                r = GEP_tup_like(r.bcx, t, bv, [0, i]);
                 auto elt_b = r.val;
                 r = f(r.bcx,
                       load_if_immediate(r.bcx, elt_a, arg.ty),
@@ -2630,9 +2630,9 @@ fn iter_structural_ty_full(&@block_ctxt cx,
         case (ty::ty_rec(?fields)) {
             let int i = 0;
             for (ty::field fld in fields) {
-                r = GEP_tup_like(r.bcx, t, av, vec(0, i));
+                r = GEP_tup_like(r.bcx, t, av, [0, i]);
                 auto llfld_a = r.val;
-                r = GEP_tup_like(r.bcx, t, bv, vec(0, i));
+                r = GEP_tup_like(r.bcx, t, bv, [0, i]);
                 auto llfld_b = r.val;
                 r = f(r.bcx,
                       load_if_immediate(r.bcx, llfld_a, fld.mt.ty),
@@ -2651,15 +2651,15 @@ fn iter_structural_ty_full(&@block_ctxt cx,
             auto bv_tag = cx.build.PointerCast(bv, lltagty);
 
             auto lldiscrim_a_ptr = cx.build.GEP(av_tag,
-                                                vec(C_int(0), C_int(0)));
+                                                [C_int(0), C_int(0)]);
             auto llunion_a_ptr = cx.build.GEP(av_tag,
-                                              vec(C_int(0), C_int(1)));
+                                              [C_int(0), C_int(1)]);
             auto lldiscrim_a = cx.build.Load(lldiscrim_a_ptr);
 
             auto lldiscrim_b_ptr = cx.build.GEP(bv_tag,
-                                                vec(C_int(0), C_int(0)));
+                                                [C_int(0), C_int(0)]);
             auto llunion_b_ptr = cx.build.GEP(bv_tag,
-                                              vec(C_int(0), C_int(1)));
+                                              [C_int(0), C_int(1)]);
             auto lldiscrim_b = cx.build.Load(lldiscrim_b_ptr);
 
             // NB: we must hit the discriminant first so that structural
@@ -2690,7 +2690,7 @@ fn iter_structural_ty_full(&@block_ctxt cx,
                         case (ty::ty_fn(_, ?args, _)) {
                             auto j = 0;
                             for (ty::arg a in args) {
-                                auto v = vec(C_int(0), C_int(j as int));
+                                auto v = [C_int(0), C_int(j as int)];
 
                                 auto rslt = GEP_tag(variant_cx, llunion_a_ptr,
                                     tid, variant.id, tps, j);
@@ -2740,23 +2740,23 @@ fn iter_structural_ty_full(&@block_ctxt cx,
         case (ty::ty_fn(_,_,_)) {
             auto box_cell_a =
                 cx.build.GEP(av,
-                             vec(C_int(0),
-                                 C_int(abi::fn_field_box)));
+                             [C_int(0),
+                                 C_int(abi::fn_field_box)]);
             auto box_cell_b =
                 cx.build.GEP(bv,
-                             vec(C_int(0),
-                                 C_int(abi::fn_field_box)));
+                             [C_int(0),
+                                 C_int(abi::fn_field_box)]);
             ret iter_boxpp(cx, box_cell_a, box_cell_b, f);
         }
         case (ty::ty_obj(_)) {
             auto box_cell_a =
                 cx.build.GEP(av,
-                             vec(C_int(0),
-                                 C_int(abi::obj_field_box)));
+                             [C_int(0),
+                                 C_int(abi::obj_field_box)]);
             auto box_cell_b =
                 cx.build.GEP(bv,
-                             vec(C_int(0),
-                                 C_int(abi::obj_field_box)));
+                             [C_int(0),
+                                 C_int(abi::obj_field_box)]);
             ret iter_boxpp(cx, box_cell_a, box_cell_b, f);
         }
         case (_) {
@@ -2787,9 +2787,9 @@ fn iter_sequence_raw(@block_ctxt cx,
     bcx.build.Br(cond_cx.llbb);
 
     let ValueRef dst_curr = cond_cx.build.Phi(T_int(),
-                                              vec(dst_int), vec(bcx.llbb));
+                                              [dst_int], [bcx.llbb]);
     let ValueRef src_curr = cond_cx.build.Phi(T_int(),
-                                              vec(src_int), vec(bcx.llbb));
+                                              [src_int], [bcx.llbb]);
 
     auto end_test = cond_cx.build.ICmp(lib::llvm::LLVMIntULT,
                                        src_curr, src_lim_int);
@@ -2806,10 +2806,10 @@ fn iter_sequence_raw(@block_ctxt cx,
     auto src_next = body_cx.build.Add(src_curr, elt_sz);
     body_cx.build.Br(cond_cx.llbb);
 
-    cond_cx.build.AddIncomingToPhi(dst_curr, vec(dst_next),
-                                   vec(body_cx.llbb));
-    cond_cx.build.AddIncomingToPhi(src_curr, vec(src_next),
-                                   vec(body_cx.llbb));
+    cond_cx.build.AddIncomingToPhi(dst_curr, [dst_next],
+                                   [body_cx.llbb]);
+    cond_cx.build.AddIncomingToPhi(src_curr, [src_next],
+                                   [body_cx.llbb]);
 
     ret res(next_cx, C_nil());
 }
@@ -2855,10 +2855,10 @@ fn iter_sequence(@block_ctxt cx,
                           &val_and_ty_fn f,
                           bool trailing_null) -> result {
 
-        auto p0 = cx.build.GEP(v, vec(C_int(0),
-                                      C_int(abi::vec_elt_data)));
-        auto lenptr = cx.build.GEP(v, vec(C_int(0),
-                                          C_int(abi::vec_elt_fill)));
+        auto p0 = cx.build.GEP(v, [C_int(0),
+                                      C_int(abi::vec_elt_data)]);
+        auto lenptr = cx.build.GEP(v, [C_int(0),
+                                          C_int(abi::vec_elt_fill)]);
 
         auto llunit_ty;
         if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, elt_ty)) {
@@ -2993,17 +2993,17 @@ fn call_tydesc_glue_full(&@block_ctxt cx, ValueRef v,
 
     auto llrawptr = cx.build.BitCast(v, T_ptr(T_i8()));
     auto lltydescs = cx.build.GEP(tydesc,
-                                  vec(C_int(0),
-                                      C_int(abi::tydesc_field_first_param)));
+                                  [C_int(0),
+                                      C_int(abi::tydesc_field_first_param)]);
     lltydescs = cx.build.Load(lltydescs);
-    auto llfnptr = cx.build.GEP(tydesc, vec(C_int(0), C_int(field)));
+    auto llfnptr = cx.build.GEP(tydesc, [C_int(0), C_int(field)]);
     auto llfn = cx.build.Load(llfnptr);
 
-    cx.build.FastCall(llfn, vec(C_null(T_ptr(T_nil())),
+    cx.build.FastCall(llfn, [C_null(T_ptr(T_nil())),
                                 cx.fcx.lltaskptr,
                                 C_null(T_ptr(T_nil())),
                                 lltydescs,
-                                llrawptr));
+                                llrawptr]);
 }
 
 fn call_tydesc_glue(&@block_ctxt cx, ValueRef v,
@@ -3019,9 +3019,9 @@ fn call_tydesc_glue(&@block_ctxt cx, ValueRef v,
 }
 
 fn maybe_call_dtor(&@block_ctxt cx, ValueRef v) -> @block_ctxt {
-    auto vtbl = cx.build.GEP(v, vec(C_int(0), C_int(abi::obj_field_vtbl)));
+    auto vtbl = cx.build.GEP(v, [C_int(0), C_int(abi::obj_field_vtbl)]);
     vtbl = cx.build.Load(vtbl);
-    auto dtor_ptr = cx.build.GEP(vtbl, vec(C_int(0), C_int(0)));
+    auto dtor_ptr = cx.build.GEP(vtbl, [C_int(0), C_int(0)]);
     dtor_ptr = cx.build.Load(dtor_ptr);
     auto self_t = llvm::LLVMGetElementType(val_ty(v));
     dtor_ptr = cx.build.BitCast(dtor_ptr,
@@ -3034,8 +3034,8 @@ fn maybe_call_dtor(&@block_ctxt cx, ValueRef v) -> @block_ctxt {
     cx.build.CondBr(test, dtor_cx.llbb, after_cx.llbb);
 
     auto me = dtor_cx.build.Load(v);
-    dtor_cx.build.FastCall(dtor_ptr, vec(C_null(T_ptr(T_nil())),
-                                         cx.fcx.lltaskptr, me));
+    dtor_cx.build.FastCall(dtor_ptr, [C_null(T_ptr(T_nil())),
+                                         cx.fcx.lltaskptr, me]);
     dtor_cx.build.Br(after_cx.llbb);
     ret after_cx;
 }
@@ -3060,23 +3060,23 @@ fn call_cmp_glue(&@block_ctxt cx,
     lazily_emit_tydesc_glue(cx, abi::tydesc_field_cmp_glue, ti);
 
     auto lltydescs =
-        r.bcx.build.GEP(r.val, vec(C_int(0),
-                                   C_int(abi::tydesc_field_first_param)));
+        r.bcx.build.GEP(r.val, [C_int(0),
+                                   C_int(abi::tydesc_field_first_param)]);
     lltydescs = r.bcx.build.Load(lltydescs);
     auto llfnptr =
-        r.bcx.build.GEP(r.val, vec(C_int(0),
-                                   C_int(abi::tydesc_field_cmp_glue)));
+        r.bcx.build.GEP(r.val, [C_int(0),
+                                   C_int(abi::tydesc_field_cmp_glue)]);
     auto llfn = r.bcx.build.Load(llfnptr);
 
     auto llcmpresultptr = r.bcx.build.Alloca(T_i1());
 
-    let vec[ValueRef] llargs = vec(llcmpresultptr,
+    let vec[ValueRef] llargs = [llcmpresultptr,
                                    r.bcx.fcx.lltaskptr,
                                    C_null(T_ptr(T_nil())),
                                    lltydescs,
                                    llrawlhsptr,
                                    llrawrhsptr,
-                                   llop);
+                                   llop];
 
     r.bcx.build.FastCall(llfn, llargs);
 
@@ -3132,8 +3132,8 @@ fn call_memmove(&@block_ctxt cx,
 
     auto volatile = C_bool(false);
     ret res(cx, cx.build.Call(memmove,
-                              vec(dst_ptr, src_ptr,
-                                  size, align, volatile)));
+                              [dst_ptr, src_ptr,
+                                  size, align, volatile]));
 }
 
 fn call_bzero(&@block_ctxt cx,
@@ -3155,8 +3155,8 @@ fn call_bzero(&@block_ctxt cx,
 
     auto volatile = C_bool(false);
     ret res(cx, cx.build.Call(memset,
-                              vec(dst_ptr, C_u8(0u),
-                                  size, align, volatile)));
+                              [dst_ptr, C_u8(0u),
+                                  size, align, volatile]));
 }
 
 fn memmove_ty(&@block_ctxt cx,
@@ -3328,15 +3328,15 @@ fn trans_unary(&@block_ctxt cx, ast::unop op,
             auto box_ty = node_ann_type(sub.bcx.fcx.lcx.ccx, a);
             sub = trans_malloc_boxed(sub.bcx, e_ty);
             find_scope_cx(cx).cleanups +=
-                vec(clean(bind drop_ty(_, sub.val, box_ty)));
+                [clean(bind drop_ty(_, sub.val, box_ty))];
 
             auto box = sub.val;
             auto rc = sub.bcx.build.GEP(box,
-                                        vec(C_int(0),
-                                            C_int(abi::box_rc_field_refcnt)));
+                                        [C_int(0),
+                                            C_int(abi::box_rc_field_refcnt)]);
             auto body = sub.bcx.build.GEP(box,
-                                          vec(C_int(0),
-                                              C_int(abi::box_rc_field_body)));
+                                          [C_int(0),
+                                              C_int(abi::box_rc_field_body)]);
             sub.bcx.build.Store(C_int(1), rc);
 
             // Cast the body type to the type of the value. This is needed to
@@ -3426,10 +3426,10 @@ fn trans_vec_append(&@block_ctxt cx, &ty::t t,
     auto src = bcx.build.PointerCast(rhs, T_opaque_vec_ptr());
 
     ret res(bcx, bcx.build.FastCall(cx.fcx.lcx.ccx.glues.vec_append_glue,
-                                    vec(cx.fcx.lltaskptr,
+                                    [cx.fcx.lltaskptr,
                                         llvec_tydesc.val,
                                         llelt_tydesc.val,
-                                        dst, src, skip_null)));
+                                        dst, src, skip_null]));
 }
 
 fn trans_vec_add(&@block_ctxt cx, &ty::t t,
@@ -3440,7 +3440,7 @@ fn trans_vec_add(&@block_ctxt cx, &ty::t t,
     auto bcx = trans_vec_append(r.bcx, t, tmp, rhs).bcx;
     tmp = load_if_immediate(bcx, tmp, t);
     find_scope_cx(cx).cleanups +=
-        vec(clean(bind drop_ty(_, tmp, t)));
+        [clean(bind drop_ty(_, tmp, t))];
     ret res(bcx, tmp);
 }
 
@@ -3530,8 +3530,8 @@ fn autoderef(&@block_ctxt cx, ValueRef v, &ty::t t) -> result {
         alt (ty::struct(cx.fcx.lcx.ccx.tcx, t1)) {
             case (ty::ty_box(?mt)) {
                 auto body = cx.build.GEP(v1,
-                                         vec(C_int(0),
-                                             C_int(abi::box_rc_field_body)));
+                                         [C_int(0),
+                                             C_int(abi::box_rc_field_body)]);
                 t1 = mt.ty;
 
                 // Since we're changing levels of box indirection, we may have
@@ -3596,7 +3596,7 @@ fn trans_binary(&@block_ctxt cx, ast::binop op,
                                      lhs_false_cx.llbb);
 
             ret join_results(cx, T_bool(),
-                             vec(lhs_false_res, rhs_res));
+                             [lhs_false_res, rhs_res]);
         }
 
         case (ast::or) {
@@ -3620,7 +3620,7 @@ fn trans_binary(&@block_ctxt cx, ast::binop op,
                                      rhs_cx.llbb);
 
             ret join_results(cx, T_bool(),
-                             vec(lhs_true_res, rhs_res));
+                             [lhs_true_res, rhs_res]);
         }
 
         case (_) {
@@ -3645,15 +3645,15 @@ fn join_results(&@block_ctxt parent_cx,
                 &vec[result] ins)
     -> result {
 
-    let vec[result] live = vec();
-    let vec[ValueRef] vals = vec();
-    let vec[BasicBlockRef] bbs = vec();
+    let vec[result] live = [];
+    let vec[ValueRef] vals = [];
+    let vec[BasicBlockRef] bbs = [];
 
     for (result r in ins) {
         if (! is_terminated(r.bcx)) {
-            live += vec(r);
-            vals += vec(r.val);
-            bbs += vec(r.bcx.llbb);
+            live += [r];
+            vals += [r.val];
+            bbs += [r.bcx.llbb];
         }
     }
 
@@ -3730,7 +3730,7 @@ fn trans_if(&@block_ctxt cx, &@ast::expr cond,
                               else_cx.llbb);
 
     ret join_results(cx, expr_llty,
-                     vec(then_res, else_res));
+                     [then_res, else_res]);
 }
 
 fn trans_for(&@block_ctxt cx,
@@ -3751,7 +3751,7 @@ fn trans_for(&@block_ctxt cx,
         auto local_res = alloc_local(scope_cx, local);
         auto bcx = copy_ty(local_res.bcx, INIT, local_res.val, curr, t).bcx;
         scope_cx.cleanups +=
-            vec(clean(bind drop_slot(_, local_res.val, t)));
+            [clean(bind drop_slot(_, local_res.val, t))];
         bcx = trans_block(bcx, body).bcx;
         bcx.build.Br(next_cx.llbb);
         ret res(next_cx, C_nil());
@@ -3814,7 +3814,7 @@ fn collect_upvars(&@block_ctxt cx, &ast::block bloc,
         }
     }
 
-    let vec[ast::def_id] refs = vec();
+    let vec[ast::def_id] refs = [];
     let hashmap[ast::def_id,()] decls = new_def_hash[()]();
     decls.insert(initial_decl, ());
     let env e = @rec(mutable refs=refs,
@@ -3827,10 +3827,10 @@ fn collect_upvars(&@block_ctxt cx, &ast::block bloc,
     walk::walk_block(*visitor, bloc);
 
     // Calculate (refs - decls). This is the set of captured upvars.
-    let vec[ast::def_id] result = vec();
+    let vec[ast::def_id] result = [];
     for (ast::def_id ref_id in e.refs) {
         if (!decls.contains_key(ref_id)) {
-            result += vec(ref_id);
+            result += [ref_id];
         }
     }
 
@@ -3884,8 +3884,8 @@ fn trans_for_each(&@block_ctxt cx,
     auto llbindingsptr;
     if (upvar_count > 0u) {
         // Gather up the upvars.
-        let vec[ValueRef] llbindings = vec();
-        let vec[TypeRef] llbindingtys = vec();
+        let vec[ValueRef] llbindings = [];
+        let vec[TypeRef] llbindingtys = [];
         for (ast::def_id did in upvars) {
             auto llbinding;
             alt (cx.fcx.lllocals.find(did)) {
@@ -3899,8 +3899,8 @@ fn trans_for_each(&@block_ctxt cx,
                 }
                 case (some[ValueRef](?llval)) { llbinding = llval; }
             }
-            llbindings += vec(llbinding);
-            llbindingtys += vec(val_ty(llbinding));
+            llbindings += [llbinding];
+            llbindingtys += [val_ty(llbinding)];
         }
 
         // Create an array of bindings and copy in aliases to the upvars.
@@ -3908,7 +3908,7 @@ fn trans_for_each(&@block_ctxt cx,
         auto i = 0u;
         while (i < upvar_count) {
             auto llbindingptr = cx.build.GEP(llbindingsptr,
-                                             vec(C_int(0), C_int(i as int)));
+                                             [C_int(0), C_int(i as int)]);
             cx.build.Store(llbindings.(i), llbindingptr);
             i += 1u;
         }
@@ -3924,21 +3924,21 @@ fn trans_for_each(&@block_ctxt cx,
     auto llenvptr = alloca(cx, llvm::LLVMGetElementType(llenvptrty));
 
     auto llbindingsptrptr = cx.build.GEP(llenvptr,
-                                         vec(C_int(0),
+                                         [C_int(0),
                                              C_int(abi::box_rc_field_body),
-                                             C_int(2)));
+                                             C_int(2)]);
     cx.build.Store(llbindingsptr, llbindingsptrptr);
 
     // Copy in our type descriptors, in case the iterator body needs to refer
     // to them.
     auto lltydescsptr = cx.build.GEP(llenvptr,
-                                     vec(C_int(0),
+                                     [C_int(0),
                                          C_int(abi::box_rc_field_body),
-                                         C_int(abi::closure_elt_ty_params)));
+                                         C_int(abi::closure_elt_ty_params)]);
     auto i = 0u;
     while (i < tydesc_count) {
         auto lltydescptr = cx.build.GEP(lltydescsptr,
-                                        vec(C_int(0), C_int(i as int)));
+                                        [C_int(0), C_int(i as int)]);
         cx.build.Store(cx.fcx.lltydescs.(i), lltydescptr);
         i += 1u;
     }
@@ -3956,7 +3956,7 @@ fn trans_for_each(&@block_ctxt cx,
     auto iter_body_llty =
         type_of_fn_full(lcx.ccx, ast::proto_fn,
                         none[TypeRef],
-                        vec(rec(mode=ty::mo_alias, ty=decl_ty)),
+                        [rec(mode=ty::mo_alias, ty=decl_ty)],
                         ty::mk_nil(lcx.ccx.tcx), 0u);
 
     let ValueRef lliterbody = decl_internal_fastcall_fn(lcx.ccx.llmod,
@@ -3971,9 +3971,9 @@ fn trans_for_each(&@block_ctxt cx,
                                                           llenvptrty);
     auto llremotebindingsptrptr =
         copy_args_bcx.build.GEP(llremoteenvptr,
-                                vec(C_int(0),
+                                [C_int(0),
                                     C_int(abi::box_rc_field_body),
-                                    C_int(abi::closure_elt_bindings)));
+                                    C_int(abi::closure_elt_bindings)]);
     auto llremotebindingsptr =
         copy_args_bcx.build.Load(llremotebindingsptrptr);
 
@@ -3982,7 +3982,7 @@ fn trans_for_each(&@block_ctxt cx,
         auto upvar_id = upvars.(i);
         auto llupvarptrptr =
             copy_args_bcx.build.GEP(llremotebindingsptr,
-                                    vec(C_int(0), C_int(i as int)));
+                                    [C_int(0), C_int(i as int)]);
         auto llupvarptr = copy_args_bcx.build.Load(llupvarptrptr);
         fcx.llupvars.insert(upvar_id, llupvarptr);
 
@@ -3992,17 +3992,17 @@ fn trans_for_each(&@block_ctxt cx,
     // Populate the type parameters from the environment.
     auto llremotetydescsptr =
         copy_args_bcx.build.GEP(llremoteenvptr,
-                                vec(C_int(0),
+                                [C_int(0),
                                     C_int(abi::box_rc_field_body),
-                                    C_int(abi::closure_elt_ty_params)));
+                                    C_int(abi::closure_elt_ty_params)]);
 
     i = 0u;
     while (i < tydesc_count) {
         auto llremotetydescptr =
-            copy_args_bcx.build.GEP(llremotetydescsptr, vec(C_int(0),
-                                                            C_int(i as int)));
+            copy_args_bcx.build.GEP(llremotetydescsptr, [C_int(0),
+                                                            C_int(i as int)]);
         auto llremotetydesc = copy_args_bcx.build.Load(llremotetydescptr);
-        fcx.lltydescs += vec(llremotetydesc);
+        fcx.lltydescs += [llremotetydesc];
         i += 1u;
     }
 
@@ -4027,12 +4027,12 @@ fn trans_for_each(&@block_ctxt cx,
             auto pair = alloca(cx, T_fn_pair(lcx.ccx.tn,
                                              iter_body_llty));
             auto code_cell = cx.build.GEP(pair,
-                                          vec(C_int(0),
-                                              C_int(abi::fn_field_code)));
+                                          [C_int(0),
+                                              C_int(abi::fn_field_code)]);
             cx.build.Store(lliterbody, code_cell);
 
-            auto env_cell = cx.build.GEP(pair, vec(C_int(0),
-                                                   C_int(abi::fn_field_box)));
+            auto env_cell = cx.build.GEP(pair, [C_int(0),
+                                                   C_int(abi::fn_field_box)]);
             auto llenvblobptr = cx.build.PointerCast(llenvptr,
                 T_opaque_closure_ptr(lcx.ccx.tn));
             cx.build.Store(llenvblobptr, env_cell);
@@ -4109,7 +4109,7 @@ fn trans_pat_match(&@block_ctxt cx, &@ast::pat pat, ValueRef llval,
                 T_opaque_tag_ptr(cx.fcx.lcx.ccx.tn));
 
             auto lldiscrimptr = cx.build.GEP(lltagptr,
-                                             vec(C_int(0), C_int(0)));
+                                             [C_int(0), C_int(0)]);
             auto lldiscrim = cx.build.Load(lldiscrimptr);
 
             auto vdef = ast::variant_def_ids
@@ -4138,7 +4138,7 @@ fn trans_pat_match(&@block_ctxt cx, &@ast::pat pat, ValueRef llval,
 
             if (_vec::len[@ast::pat](subpats) > 0u) {
                 auto llblobptr = matched_cx.build.GEP(lltagptr,
-                    vec(C_int(0), C_int(1)));
+                    [C_int(0), C_int(1)]);
                 auto i = 0;
                 for (@ast::pat subpat in subpats) {
                     auto rslt = GEP_tag(matched_cx, llblobptr, vdef._0,
@@ -4183,7 +4183,7 @@ fn trans_pat_binding(&@block_ctxt cx, &@ast::pat pat,
                 maybe_name_value(cx.fcx.lcx.ccx, dst, id);
                 bcx.fcx.lllocals.insert(def_id, dst);
                 bcx.cleanups +=
-                    vec(clean(bind drop_slot(_, dst, t)));
+                    [clean(bind drop_slot(_, dst, t))];
                 ret copy_ty(bcx, INIT, dst, llval, t);
             }
         }
@@ -4196,7 +4196,7 @@ fn trans_pat_binding(&@block_ctxt cx, &@ast::pat pat,
 
             auto lltagptr = cx.build.PointerCast(llval,
                 T_opaque_tag_ptr(cx.fcx.lcx.ccx.tn));
-            auto llblobptr = cx.build.GEP(lltagptr, vec(C_int(0), C_int(1)));
+            auto llblobptr = cx.build.GEP(lltagptr, [C_int(0), C_int(1)]);
 
             auto ty_param_substs =
                 ty::ann_to_type_params(cx.fcx.lcx.ccx.node_types, ann);
@@ -4223,7 +4223,7 @@ fn trans_alt(&@block_ctxt cx, &@ast::expr expr,
     auto expr_res = trans_expr(cx, expr);
 
     auto this_cx = expr_res.bcx;
-    let vec[result] arm_results = vec();
+    let vec[result] arm_results = [];
     for (ast::arm arm in arms) {
         auto next_cx = new_sub_block_ctxt(expr_res.bcx, "next");
         auto match_res = trans_pat_match(this_cx, arm.pat, expr_res.val,
@@ -4236,7 +4236,7 @@ fn trans_alt(&@block_ctxt cx, &@ast::expr expr,
                                              expr_res.val, false);
 
         auto block_res = trans_block(binding_res.bcx, arm.block);
-        arm_results += vec(block_res);
+        arm_results += [block_res];
 
         this_cx = next_cx;
     }
@@ -4325,13 +4325,13 @@ fn lval_generic_fn(&@block_ctxt cx,
 
     if (_vec::len[ty::t](tys) != 0u) {
         auto bcx = lv.res.bcx;
-        let vec[ValueRef] tydescs = vec();
-        let vec[option::t[@tydesc_info]] tis = vec();
+        let vec[ValueRef] tydescs = [];
+        let vec[option::t[@tydesc_info]] tis = [];
         for (ty::t t in tys) {
             // TODO: Doesn't always escape.
             auto ti = none[@tydesc_info];
             auto td = get_tydesc(bcx, t, true, ti);
-            tis += vec(ti);
+            tis += [ti];
             bcx = td.bcx;
             _vec::push[ValueRef](tydescs, td.val);
         }
@@ -4438,7 +4438,7 @@ fn trans_path(&@block_ctxt cx, &ast::path p, &ast::ann ann) -> lval_result {
                         PointerCast(lltagblob, T_ptr(lltagty));
 
                     auto lldiscrimptr = alloc_result.bcx.build.GEP
-                        (lltagptr, vec(C_int(0), C_int(0)));
+                        (lltagptr, [C_int(0), C_int(0)]);
                     alloc_result.bcx.build.Store(lldiscrim,
                                                  lldiscrimptr);
 
@@ -4472,25 +4472,25 @@ fn trans_field(&@block_ctxt cx, &ast::span sp, ValueRef v, &ty::t t0,
     alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) {
         case (ty::ty_tup(_)) {
             let uint ix = ty::field_num(cx.fcx.lcx.ccx.sess, sp, field);
-            auto v = GEP_tup_like(r.bcx, t, r.val, vec(0, ix as int));
+            auto v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]);
             ret lval_mem(v.bcx, v.val);
         }
         case (ty::ty_rec(?fields)) {
             let uint ix = ty::field_idx(cx.fcx.lcx.ccx.sess, sp, field,
                                        fields);
-            auto v = GEP_tup_like(r.bcx, t, r.val, vec(0, ix as int));
+            auto v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]);
             ret lval_mem(v.bcx, v.val);
         }
         case (ty::ty_obj(?methods)) {
             let uint ix = ty::method_idx(cx.fcx.lcx.ccx.sess, sp, field,
                                         methods);
             auto vtbl = r.bcx.build.GEP(r.val,
-                                        vec(C_int(0),
-                                            C_int(abi::obj_field_vtbl)));
+                                        [C_int(0),
+                                            C_int(abi::obj_field_vtbl)]);
             vtbl = r.bcx.build.Load(vtbl);
             // +1 because slot #0 contains the destructor
-            auto v =  r.bcx.build.GEP(vtbl, vec(C_int(0),
-                                                C_int((ix + 1u) as int)));
+            auto v =  r.bcx.build.GEP(vtbl, [C_int(0),
+                                                C_int((ix + 1u) as int)]);
 
             auto lvo = lval_mem(r.bcx, v);
             let ty::t fn_ty = ty::method_ty_to_fn_ty(cx.fcx.lcx.ccx.tcx,
@@ -4535,7 +4535,7 @@ fn trans_index(&@block_ctxt cx, &ast::span sp, &@ast::expr base,
     auto scaled_ix = bcx.build.Mul(ix_val, unit_sz.val);
     maybe_name_value(cx.fcx.lcx.ccx, scaled_ix, "scaled_ix");
 
-    auto lim = bcx.build.GEP(v, vec(C_int(0), C_int(abi::vec_elt_fill)));
+    auto lim = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]);
     lim = bcx.build.Load(lim);
 
     auto bounds_check = bcx.build.ICmp(lib::llvm::LLVMIntULT,
@@ -4549,13 +4549,13 @@ fn trans_index(&@block_ctxt cx, &ast::span sp, &@ast::expr base,
     auto fail_res = trans_fail(fail_cx, some[common::span](sp),
                                "bounds check");
 
-    auto body = next_cx.build.GEP(v, vec(C_int(0), C_int(abi::vec_elt_data)));
+    auto body = next_cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]);
     auto elt;
     if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, unit_ty)) {
         body = next_cx.build.PointerCast(body, T_ptr(T_array(T_i8(), 1u)));
-        elt = next_cx.build.GEP(body, vec(C_int(0), scaled_ix));
+        elt = next_cx.build.GEP(body, [C_int(0), scaled_ix]);
     } else {
-        elt = next_cx.build.GEP(body, vec(C_int(0), ix_val));
+        elt = next_cx.build.GEP(body, [C_int(0), ix_val]);
 
         // We're crossing a box boundary here, so we may need to pointer cast.
         auto llunitty = type_of(next_cx.fcx.lcx.ccx, unit_ty);
@@ -4588,8 +4588,8 @@ fn trans_lval(&@block_ctxt cx, &@ast::expr e) -> lval_result {
 
             auto sub = trans_expr(cx, base);
             auto val = sub.bcx.build.GEP(sub.val,
-                                         vec(C_int(0),
-                                             C_int(abi::box_rc_field_body)));
+                                         [C_int(0),
+                                             C_int(abi::box_rc_field_body)]);
             ret lval_mem(sub.bcx, val);
         }
         case (ast::expr_self_method(?ident, ?ann)) {
@@ -4677,13 +4677,13 @@ fn trans_bind_thunk(&@local_ctxt cx,
     auto llclosure = bcx.build.PointerCast(fcx.llenv, llclosure_ptr_ty);
 
     auto lltarget = GEP_tup_like(bcx, closure_ty, llclosure,
-                                 vec(0,
+                                 [0,
                                      abi::box_rc_field_body,
-                                     abi::closure_elt_target));
+                                     abi::closure_elt_target]);
     bcx = lltarget.bcx;
     auto lltargetclosure = bcx.build.GEP(lltarget.val,
-                                         vec(C_int(0),
-                                             C_int(abi::fn_field_box)));
+                                         [C_int(0),
+                                             C_int(abi::fn_field_box)]);
     lltargetclosure = bcx.build.Load(lltargetclosure);
 
     auto outgoing_ret_ty = ty::ty_fn_ret(cx.ccx.tcx, outgoing_fty);
@@ -4694,23 +4694,23 @@ fn trans_bind_thunk(&@local_ctxt cx,
         llretptr = bcx.build.PointerCast(llretptr, T_typaram_ptr(cx.ccx.tn));
     }
 
-    let vec[ValueRef] llargs = vec(llretptr,
+    let vec[ValueRef] llargs = [llretptr,
                                    fcx.lltaskptr,
-                                   lltargetclosure);
+                                   lltargetclosure];
 
     // Copy in the type parameters.
     let uint i = 0u;
     while (i < ty_param_count) {
         auto lltyparam_ptr =
             GEP_tup_like(bcx, closure_ty, llclosure,
-                         vec(0,
+                         [0,
                              abi::box_rc_field_body,
                              abi::closure_elt_ty_params,
-                             (i as int)));
+                             (i as int)]);
         bcx = lltyparam_ptr.bcx;
         auto td = bcx.build.Load(lltyparam_ptr.val);
-        llargs += vec(td);
-        fcx.lltydescs += vec(td);
+        llargs += [td];
+        fcx.lltydescs += [td];
         i += 1u;
     }
 
@@ -4732,10 +4732,10 @@ fn trans_bind_thunk(&@local_ctxt cx,
                 auto e_ty = ty::expr_ty(cx.ccx.tcx, cx.ccx.node_types, e);
                 auto bound_arg =
                     GEP_tup_like(bcx, closure_ty, llclosure,
-                                 vec(0,
+                                 [0,
                                      abi::box_rc_field_body,
                                      abi::closure_elt_bindings,
-                                     b));
+                                     b]);
 
                 bcx = bound_arg.bcx;
                 auto val = bound_arg.val;
@@ -4754,7 +4754,7 @@ fn trans_bind_thunk(&@local_ctxt cx,
                     val = bcx.build.PointerCast(val, llout_arg_ty);
                 }
 
-                llargs += vec(val);
+                llargs += [val];
                 b += 1;
             }
 
@@ -4768,7 +4768,7 @@ fn trans_bind_thunk(&@local_ctxt cx,
                                                        llout_arg_ty);
                 }
 
-                llargs += vec(passed_arg);
+                llargs += [passed_arg];
                 a += 1u;
             }
         }
@@ -4778,8 +4778,8 @@ fn trans_bind_thunk(&@local_ctxt cx,
 
     // FIXME: turn this call + ret into a tail call.
     auto lltargetfn = bcx.build.GEP(lltarget.val,
-                                    vec(C_int(0),
-                                        C_int(abi::fn_field_code)));
+                                    [C_int(0),
+                                        C_int(abi::fn_field_code)]);
 
     // Cast the outgoing function to the appropriate type (see the comments in
     // trans_bind below for why this is necessary).
@@ -4808,7 +4808,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
     if (f_res.is_mem) {
         cx.fcx.lcx.ccx.sess.unimpl("re-binding existing function");
     } else {
-        let vec[@ast::expr] bound = vec();
+        let vec[@ast::expr] bound = [];
 
         for (option::t[@ast::expr] argopt in args) {
             alt (argopt) {
@@ -4827,7 +4827,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
             case (none[generic_info]) {
                 outgoing_fty = ty::expr_ty(cx.fcx.lcx.ccx.tcx,
                                            cx.fcx.lcx.ccx.node_types, f);
-                lltydescs = vec();
+                lltydescs = [];
             }
             case (some[generic_info](?ginfo)) {
                 lazily_emit_all_generic_info_tydesc_glues(cx, ginfo);
@@ -4846,8 +4846,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
             auto pair_v = alloca(bcx, pair_t);
 
             // Translate the bound expressions.
-            let vec[ty::t] bound_tys = vec();
-            let vec[ValueRef] bound_vals = vec();
+            let vec[ty::t] bound_tys = [];
+            let vec[ValueRef] bound_vals = [];
             auto i = 0u;
             for (@ast::expr e in bound) {
                 auto arg = trans_expr(bcx, e);
@@ -4874,10 +4874,10 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
                 _vec::init_elt[ty::t](tydesc_ty, ty_param_count);
 
             let vec[ty::t] closure_tys =
-                vec(tydesc_ty,
+                [tydesc_ty,
                     outgoing_fty,
                     bindings_ty,
-                    ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, captured_tys));
+                    ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx, captured_tys)];
 
             let ty::t closure_ty = ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx,
                                                  closure_tys);
@@ -4886,19 +4886,19 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
             auto box = r.val;
             bcx = r.bcx;
             auto rc = bcx.build.GEP(box,
-                                    vec(C_int(0),
-                                        C_int(abi::box_rc_field_refcnt)));
+                                    [C_int(0),
+                                        C_int(abi::box_rc_field_refcnt)]);
             auto closure =
                 bcx.build.GEP(box,
-                              vec(C_int(0),
-                                  C_int(abi::box_rc_field_body)));
+                              [C_int(0),
+                                  C_int(abi::box_rc_field_body)]);
             bcx.build.Store(C_int(1), rc);
 
             // Store bindings tydesc.
             auto bound_tydesc =
                 bcx.build.GEP(closure,
-                              vec(C_int(0),
-                                  C_int(abi::closure_elt_tydesc)));
+                              [C_int(0),
+                                  C_int(abi::closure_elt_tydesc)]);
             auto ti = none[@tydesc_info];
             auto bindings_tydesc = get_tydesc(bcx, bindings_ty, true, ti);
             lazily_emit_tydesc_glue(bcx, abi::tydesc_field_drop_glue, ti);
@@ -4921,8 +4921,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
             // Store thunk-target.
             auto bound_target =
                 bcx.build.GEP(closure,
-                              vec(C_int(0),
-                                  C_int(abi::closure_elt_target)));
+                              [C_int(0),
+                                  C_int(abi::closure_elt_target)]);
             auto src = bcx.build.Load(f_res.res.val);
             bound_target = bcx.build.PointerCast(bound_target, llclosurety);
             bcx.build.Store(src, bound_target);
@@ -4931,11 +4931,11 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
             i = 0u;
             auto bindings =
                 bcx.build.GEP(closure,
-                              vec(C_int(0),
-                                  C_int(abi::closure_elt_bindings)));
+                              [C_int(0),
+                                  C_int(abi::closure_elt_bindings)]);
             for (ValueRef v in bound_vals) {
                 auto bound = bcx.build.GEP(bindings,
-                                           vec(C_int(0), C_int(i as int)));
+                                           [C_int(0), C_int(i as int)]);
                 bcx = copy_ty(bcx, INIT, bound, v, bound_tys.(i)).bcx;
                 i += 1u;
             }
@@ -4949,13 +4949,13 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
                     lazily_emit_all_generic_info_tydesc_glues(cx, ginfo);
                     auto ty_params_slot =
                         bcx.build.GEP(closure,
-                                      vec(C_int(0),
-                                          C_int(abi::closure_elt_ty_params)));
+                                      [C_int(0),
+                                          C_int(abi::closure_elt_ty_params)]);
                     auto i = 0;
                     for (ValueRef td in ginfo.tydescs) {
                         auto ty_param_slot = bcx.build.GEP(ty_params_slot,
-                                                           vec(C_int(0),
-                                                               C_int(i)));
+                                                           [C_int(0),
+                                                               C_int(i)]);
                         bcx.build.Store(td, ty_param_slot);
                         i += 1;
                     }
@@ -4966,8 +4966,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
 
             // Make thunk and store thunk-ptr in outer pair's code slot.
             auto pair_code = bcx.build.GEP(pair_v,
-                                           vec(C_int(0),
-                                               C_int(abi::fn_field_code)));
+                                           [C_int(0),
+                                               C_int(abi::fn_field_code)]);
 
             let ty::t pair_ty = node_ann_type(cx.fcx.lcx.ccx, ann);
 
@@ -4980,8 +4980,8 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
 
             // Store box ptr in outer pair's box slot.
             auto pair_box = bcx.build.GEP(pair_v,
-                                          vec(C_int(0),
-                                              C_int(abi::fn_field_box)));
+                                          [C_int(0),
+                                              C_int(abi::fn_field_box)]);
             bcx.build.Store
                 (bcx.build.PointerCast
                  (box,
@@ -4989,7 +4989,7 @@ fn trans_bind(&@block_ctxt cx, &@ast::expr f,
                  pair_box);
 
             find_scope_cx(cx).cleanups +=
-                vec(clean(bind drop_slot(_, pair_v, pair_ty)));
+                [clean(bind drop_slot(_, pair_v, pair_ty))];
 
             ret res(bcx, pair_v);
         }
@@ -5079,8 +5079,8 @@ fn trans_args(&@block_ctxt cx,
     -> tup(@block_ctxt, vec[ValueRef], ValueRef) {
 
     let vec[ty::arg] args = ty::ty_fn_args(cx.fcx.lcx.ccx.tcx, fn_ty);
-    let vec[ValueRef] llargs = vec();
-    let vec[ValueRef] lltydescs = vec();
+    let vec[ValueRef] llargs = [];
+    let vec[ValueRef] lltydescs = [];
     let @block_ctxt bcx = cx;
 
 
@@ -5101,8 +5101,8 @@ fn trans_args(&@block_ctxt cx,
         }
     }
     if (ty::type_has_dynamic_size(cx.fcx.lcx.ccx.tcx, retty)) {
-        llargs += vec(bcx.build.PointerCast
-                      (llretslot, T_typaram_ptr(cx.fcx.lcx.ccx.tn)));
+        llargs += [bcx.build.PointerCast
+                      (llretslot, T_typaram_ptr(cx.fcx.lcx.ccx.tn))];
     } else if (ty::type_contains_params(cx.fcx.lcx.ccx.tcx, retty)) {
         // It's possible that the callee has some generic-ness somewhere in
         // its return value -- say a method signature within an obj or a fn
@@ -5110,15 +5110,15 @@ fn trans_args(&@block_ctxt cx,
         // of. If so, cast the caller's view of the restlot to the callee's
         // view, for the sake of making a type-compatible call.
         llargs +=
-            vec(cx.build.PointerCast(llretslot,
-                                     T_ptr(type_of(bcx.fcx.lcx.ccx, retty))));
+            [cx.build.PointerCast(llretslot,
+                                     T_ptr(type_of(bcx.fcx.lcx.ccx, retty)))];
     } else {
-        llargs += vec(llretslot);
+        llargs += [llretslot];
     }
 
 
     // Arg 1: task pointer.
-    llargs += vec(bcx.fcx.lltaskptr);
+    llargs += [bcx.fcx.lltaskptr];
 
     // Arg 2: Env (closure-bindings / self-obj)
     alt (llobj) {
@@ -5126,10 +5126,10 @@ fn trans_args(&@block_ctxt cx,
             // Every object is always found in memory,
             // and not-yet-loaded (as part of an lval x.y
             // doted method-call).
-            llargs += vec(bcx.build.Load(ob));
+            llargs += [bcx.build.Load(ob)];
         }
         case (_) {
-            llargs += vec(llenv);
+            llargs += [llenv];
         }
     }
 
@@ -5140,7 +5140,7 @@ fn trans_args(&@block_ctxt cx,
     alt (lliterbody) {
         case (none[ValueRef]) {}
         case (some[ValueRef](?lli)) {
-            llargs += vec(lli);
+            llargs += [lli];
         }
     }
 
@@ -5155,7 +5155,7 @@ fn trans_args(&@block_ctxt cx,
     for (@ast::expr e in es) {
         auto r = trans_arg_expr(bcx, args.(i), arg_tys.(i), e);
         bcx = r.bcx;
-        llargs += vec(r.val);
+        llargs += [r.val];
         i += 1u;
     }
 
@@ -5184,13 +5184,13 @@ fn trans_call(&@block_ctxt cx, &@ast::expr f,
             // It's a closure.
             auto bcx = f_res.res.bcx;
             auto pair = faddr;
-            faddr = bcx.build.GEP(pair, vec(C_int(0),
-                                            C_int(abi::fn_field_code)));
+            faddr = bcx.build.GEP(pair, [C_int(0),
+                                            C_int(abi::fn_field_code)]);
             faddr = bcx.build.Load(faddr);
 
             auto llclosure = bcx.build.GEP(pair,
-                                           vec(C_int(0),
-                                               C_int(abi::fn_field_box)));
+                                           [C_int(0),
+                                               C_int(abi::fn_field_box)]);
             llenv = bcx.build.Load(llclosure);
         }
     }
@@ -5239,7 +5239,7 @@ fn trans_call(&@block_ctxt cx, &@ast::expr f,
                 // the frame, but it's a ref all the same, so we put a note
                 // here to drop it when we're done in this scope.
                 find_scope_cx(cx).cleanups +=
-                    vec(clean(bind drop_ty(_, retval, ret_ty)));
+                    [clean(bind drop_ty(_, retval, ret_ty))];
             }
         }
         case (some[ValueRef](_)) {
@@ -5260,7 +5260,7 @@ fn trans_tup(&@block_ctxt cx, &vec[ast::elt] elts,
     bcx = tup_res.bcx;
 
     find_scope_cx(cx).cleanups +=
-        vec(clean(bind drop_ty(_, tup_val, t)));
+        [clean(bind drop_ty(_, tup_val, t))];
     let int i = 0;
 
     for (ast::elt e in elts) {
@@ -5268,7 +5268,7 @@ fn trans_tup(&@block_ctxt cx, &vec[ast::elt] elts,
                                 e.expr);
         auto src_res = trans_expr(bcx, e.expr);
         bcx = src_res.bcx;
-        auto dst_res = GEP_tup_like(bcx, t, tup_val, vec(0, i));
+        auto dst_res = GEP_tup_like(bcx, t, tup_val, [0, i]);
         bcx = dst_res.bcx;
         bcx = copy_ty(src_res.bcx, INIT, dst_res.val, src_res.val, e_ty).bcx;
         i += 1;
@@ -5297,16 +5297,16 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args,
 
     // FIXME: pass tydesc properly.
     auto vec_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_vec,
-        vec(bcx.fcx.lltaskptr, data_sz,
-            C_null(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn)))));
+        [bcx.fcx.lltaskptr, data_sz,
+            C_null(T_ptr(T_tydesc(bcx.fcx.lcx.ccx.tn)))]);
     auto llty = type_of(bcx.fcx.lcx.ccx, t);
     vec_val = bcx.build.PointerCast(vec_val, llty);
 
     find_scope_cx(bcx).cleanups +=
-        vec(clean(bind drop_ty(_, vec_val, t)));
+        [clean(bind drop_ty(_, vec_val, t))];
 
-    auto body = bcx.build.GEP(vec_val, vec(C_int(0),
-                                           C_int(abi::vec_elt_data)));
+    auto body = bcx.build.GEP(vec_val, [C_int(0),
+                                           C_int(abi::vec_elt_data)]);
 
     auto pseudo_tup_ty =
         ty::mk_imm_tup(cx.fcx.lcx.ccx.tcx,
@@ -5317,7 +5317,7 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args,
     for (@ast::expr e in args) {
         auto src_res = trans_expr(bcx, e);
         bcx = src_res.bcx;
-        auto dst_res = GEP_tup_like(bcx, pseudo_tup_ty, body, vec(0, i));
+        auto dst_res = GEP_tup_like(bcx, pseudo_tup_ty, body, [0, i]);
         bcx = dst_res.bcx;
 
         // Cast the destination type to the source type. This is needed to
@@ -5344,7 +5344,7 @@ fn trans_vec(&@block_ctxt cx, &vec[@ast::expr] args,
         i += 1;
     }
     auto fill = bcx.build.GEP(vec_val,
-                              vec(C_int(0), C_int(abi::vec_elt_fill)));
+                              [C_int(0), C_int(abi::vec_elt_fill)]);
     bcx.build.Store(data_sz, fill);
 
     ret res(bcx, vec_val);
@@ -5360,7 +5360,7 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields,
     bcx = rec_res.bcx;
 
     find_scope_cx(cx).cleanups +=
-        vec(clean(bind drop_ty(_, rec_val, t)));
+        [clean(bind drop_ty(_, rec_val, t))];
     let int i = 0;
 
     auto base_val = C_nil();
@@ -5374,14 +5374,14 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields,
         }
     }
 
-    let vec[ty::field] ty_fields = vec();
+    let vec[ty::field] ty_fields = [];
     alt (ty::struct(cx.fcx.lcx.ccx.tcx, t)) {
         case (ty::ty_rec(?flds)) { ty_fields = flds; }
     }
 
     for (ty::field tf in ty_fields) {
         auto e_ty = tf.mt.ty;
-        auto dst_res = GEP_tup_like(bcx, t, rec_val, vec(0, i));
+        auto dst_res = GEP_tup_like(bcx, t, rec_val, [0, i]);
         bcx = dst_res.bcx;
 
         auto expr_provided = false;
@@ -5394,7 +5394,7 @@ fn trans_rec(&@block_ctxt cx, &vec[ast::field] fields,
             }
         }
         if (!expr_provided) {
-            src_res = GEP_tup_like(bcx, t, base_val, vec(0, i));
+            src_res = GEP_tup_like(bcx, t, base_val, [0, i]);
             src_res = res(src_res.bcx,
                           load_if_immediate(bcx, src_res.val, e_ty));
         }
@@ -5662,29 +5662,29 @@ fn trans_log(int lvl, &@block_ctxt cx, &@ast::expr e) -> result {
         }
         if (is32bit) {
             log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_float,
-                               vec(log_bcx.fcx.lltaskptr, C_int(lvl),
-                                   sub.val));
+                               [log_bcx.fcx.lltaskptr, C_int(lvl),
+                                   sub.val]);
         } else {
             // FIXME: Eliminate this level of indirection.
             auto tmp = alloca(log_bcx, tr);
             sub.bcx.build.Store(sub.val, tmp);
             log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_double,
-                               vec(log_bcx.fcx.lltaskptr, C_int(lvl), tmp));
+                               [log_bcx.fcx.lltaskptr, C_int(lvl), tmp]);
         }
     } else {
         alt (ty::struct(cx.fcx.lcx.ccx.tcx, e_ty)) {
             case (ty::ty_str) {
                 log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_str,
-                                   vec(log_bcx.fcx.lltaskptr, C_int(lvl),
-                                       sub.val));
+                                   [log_bcx.fcx.lltaskptr, C_int(lvl),
+                                       sub.val]);
             }
             case (_) {
                 // FIXME: Handle signedness properly.
                 auto llintval = int_cast(log_bcx, T_int(), val_ty(sub.val),
                                          sub.val, false);
                 log_bcx.build.Call(log_bcx.fcx.lcx.ccx.upcalls.log_int,
-                                   vec(log_bcx.fcx.lltaskptr, C_int(lvl),
-                                       llintval));
+                                   [log_bcx.fcx.lltaskptr, C_int(lvl),
+                                       llintval]);
             }
         }
     }
@@ -5729,7 +5729,7 @@ fn trans_fail(&@block_ctxt cx, &option::t[common::span] sp_opt, &str fail_str)
     V_fail_str = cx.build.PointerCast(V_fail_str, T_ptr(T_i8()));
     V_filename = cx.build.PointerCast(V_filename, T_ptr(T_i8()));
 
-    auto args = vec(cx.fcx.lltaskptr, V_fail_str, V_filename, C_int(V_line));
+    auto args = [cx.fcx.lltaskptr, V_fail_str, V_filename, C_int(V_line)];
 
     cx.build.Call(cx.fcx.lcx.ccx.upcalls._fail, args);
     cx.build.Unreachable();
@@ -5745,28 +5745,28 @@ fn trans_put(&@block_ctxt cx, &option::t[@ast::expr] e) -> result {
             auto slot = alloca(cx, val_ty(lli));
             cx.build.Store(lli, slot);
 
-            llcallee = cx.build.GEP(slot, vec(C_int(0),
-                                              C_int(abi::fn_field_code)));
+            llcallee = cx.build.GEP(slot, [C_int(0),
+                                              C_int(abi::fn_field_code)]);
             llcallee = cx.build.Load(llcallee);
 
-            llenv = cx.build.GEP(slot, vec(C_int(0),
-                                           C_int(abi::fn_field_box)));
+            llenv = cx.build.GEP(slot, [C_int(0),
+                                           C_int(abi::fn_field_box)]);
             llenv = cx.build.Load(llenv);
         }
     }
     auto bcx = cx;
     auto dummy_retslot = alloca(bcx, T_nil());
-    let vec[ValueRef] llargs = vec(dummy_retslot, cx.fcx.lltaskptr, llenv);
+    let vec[ValueRef] llargs = [dummy_retslot, cx.fcx.lltaskptr, llenv];
     alt (e) {
         case (none[@ast::expr]) { }
         case (some[@ast::expr](?x)) {
             auto e_ty = ty::expr_ty(cx.fcx.lcx.ccx.tcx,
                                     cx.fcx.lcx.ccx.node_types, x);
             auto arg = rec(mode=ty::mo_alias, ty=e_ty);
-            auto arg_tys = type_of_explicit_args(cx.fcx.lcx.ccx, vec(arg));
+            auto arg_tys = type_of_explicit_args(cx.fcx.lcx.ccx, [arg]);
             auto r = trans_arg_expr(bcx, arg, arg_tys.(0), x);
             bcx = r.bcx;
-            llargs += vec(r.val);
+            llargs += [r.val];
         }
     }
 
@@ -5882,11 +5882,11 @@ fn trans_port(&@block_ctxt cx, &ast::ann ann) -> result {
     auto unit_sz = size_of(bcx, unit_ty);
     bcx = unit_sz.bcx;
     auto port_raw_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_port,
-                                       vec(bcx.fcx.lltaskptr, unit_sz.val));
+                                       [bcx.fcx.lltaskptr, unit_sz.val]);
     auto llty = type_of(cx.fcx.lcx.ccx, t);
     auto port_val = bcx.build.PointerCast(port_raw_val, llty);
     auto dropref = clean(bind drop_ty(_, port_val, t));
-    find_scope_cx(bcx).cleanups += vec(dropref);
+    find_scope_cx(bcx).cleanups += [dropref];
 
     ret res(bcx, port_val);
 }
@@ -5899,13 +5899,13 @@ fn trans_chan(&@block_ctxt cx, &@ast::expr e, &ast::ann ann) -> result {
 
     auto prt_val = bcx.build.PointerCast(prt.val, T_opaque_port_ptr());
     auto chan_raw_val = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.new_chan,
-                                       vec(bcx.fcx.lltaskptr, prt_val));
+                                       [bcx.fcx.lltaskptr, prt_val]);
 
     auto chan_ty = node_ann_type(bcx.fcx.lcx.ccx, ann);
     auto chan_llty = type_of(bcx.fcx.lcx.ccx, chan_ty);
     auto chan_val = bcx.build.PointerCast(chan_raw_val, chan_llty);
     auto dropref = clean(bind drop_ty(_, chan_val, chan_ty));
-    find_scope_cx(bcx).cleanups += vec(dropref);
+    find_scope_cx(bcx).cleanups += [dropref];
 
     ret res(bcx, chan_val);
 }
@@ -5937,12 +5937,12 @@ fn trans_send(&@block_ctxt cx, &@ast::expr lhs, &@ast::expr rhs,
     bcx = data_tmp.bcx;
 
     find_scope_cx(bcx).cleanups +=
-        vec(clean(bind drop_ty(_, data_alloc.val, unit_ty)));
+        [clean(bind drop_ty(_, data_alloc.val, unit_ty))];
 
     auto llchanval = bcx.build.PointerCast(chn.val, T_opaque_chan_ptr());
     auto lldataptr = bcx.build.PointerCast(data_alloc.val, T_ptr(T_i8()));
     bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.send,
-                   vec(bcx.fcx.lltaskptr, llchanval, lldataptr));
+                   [bcx.fcx.lltaskptr, llchanval, lldataptr]);
 
     ret res(bcx, chn.val);
 }
@@ -5970,7 +5970,7 @@ fn recv_val(&@block_ctxt cx, ValueRef lhs, &@ast::expr rhs,
     auto lldataptr = bcx.build.PointerCast(lhs, T_ptr(T_ptr(T_i8())));
     auto llportptr = bcx.build.PointerCast(prt.val, T_opaque_port_ptr());
     bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.recv,
-                   vec(bcx.fcx.lltaskptr, lldataptr, llportptr));
+                   [bcx.fcx.lltaskptr, lldataptr, llportptr]);
 
     auto data_load = load_if_immediate(bcx, lhs, unit_ty);
     auto cp = copy_ty(bcx, action, lhs, data_load, unit_ty);
@@ -5990,7 +5990,7 @@ fn init_local(&@block_ctxt cx, &@ast::local local) -> result {
     auto bcx = cx;
 
     find_scope_cx(cx).cleanups +=
-        vec(clean(bind drop_slot(_, llptr, ty)));
+        [clean(bind drop_slot(_, llptr, ty))];
 
     alt (local.init) {
         case (some[ast::initializer](?init)) {
@@ -6061,7 +6061,7 @@ fn new_builder(BasicBlockRef llbb) -> builder {
 fn new_block_ctxt(&@fn_ctxt cx, &block_parent parent,
                   block_kind kind,
                   &str name) -> @block_ctxt {
-    let vec[cleanup] cleanups = vec();
+    let vec[cleanup] cleanups = [];
     auto s = _str::buf("");
     if (cx.lcx.ccx.sess.get_opts().save_temps) {
         s = _str::buf(cx.lcx.ccx.names.next(name));
@@ -6098,7 +6098,7 @@ fn new_sub_block_ctxt(&@block_ctxt bcx, &str n) -> @block_ctxt {
 }
 
 fn new_raw_block_ctxt(&@fn_ctxt fcx, BasicBlockRef llbb) -> @block_ctxt {
-    let vec[cleanup] cleanups = vec();
+    let vec[cleanup] cleanups = [];
     ret @rec(llbb=llbb, build=new_builder(llbb), parent=parent_none,
              kind=NON_SCOPE_BLOCK, mutable cleanups=cleanups, fcx=fcx);
 }
@@ -6144,7 +6144,7 @@ iter block_locals(&ast::block b) -> @ast::local {
 }
 
 fn llallocas_block_ctxt(&@fn_ctxt fcx) -> @block_ctxt {
-    let vec[cleanup] cleanups = vec();
+    let vec[cleanup] cleanups = [];
     ret @rec(llbb=fcx.llallocas,
              build=new_builder(fcx.llallocas),
              parent=parent_none,
@@ -6246,7 +6246,7 @@ fn trans_block(&@block_ctxt cx, &ast::block b) -> result {
 
                     auto cleanup = bind drop_hoisted_ty(_, res_alloca.val,
                                                         r_ty);
-                    find_outer_scope_cx(bcx).cleanups += vec(clean(cleanup));
+                    find_outer_scope_cx(bcx).cleanups += [clean(cleanup)];
                 }
             }
         }
@@ -6260,11 +6260,11 @@ fn trans_block(&@block_ctxt cx, &ast::block b) -> result {
 }
 
 fn new_local_ctxt(&@crate_ctxt ccx) -> @local_ctxt {
-    let vec[str] pth = vec();
-    let vec[ast::ty_param] obj_typarams = vec();
-    let vec[ast::obj_field] obj_fields = vec();
+    let vec[str] pth = [];
+    let vec[ast::ty_param] obj_typarams = [];
+    let vec[ast::obj_field] obj_fields = [];
     ret @rec(path=pth,
-             module_path=vec(crate_name(ccx, "main")),
+             module_path=[crate_name(ccx, "main")],
              obj_typarams = obj_typarams,
              obj_fields = obj_fields,
              ccx = ccx);
@@ -6346,7 +6346,7 @@ fn create_llargs_for_fn_args(&@fn_ctxt cx,
             for (ast::ty_param tp in ty_params) {
                 auto llarg = llvm::LLVMGetParam(cx.llfn, arg_n);
                 assert (llarg as int != 0);
-                cx.lltydescs += vec(llarg);
+                cx.lltydescs += [llarg];
                 arg_n += 1u;
                 i += 1u;
             }
@@ -6422,7 +6422,7 @@ fn add_cleanups_for_args(&@block_ctxt bcx,
         if (aarg.mode != ast::alias) {
             auto argval = bcx.fcx.llargs.get(aarg.id);
             find_scope_cx(bcx).cleanups +=
-                vec(clean(bind drop_slot(_, argval, arg_tys.(arg_n).ty)));
+                [clean(bind drop_slot(_, argval, arg_tys.(arg_n).ty))];
         }
         arg_n += 1u;
     }
@@ -6460,10 +6460,10 @@ fn ret_ty_of_fn(&@crate_ctxt ccx, ast::ann ann) -> ty::t {
 fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) {
     auto bcx = llallocas_block_ctxt(fcx);
 
-    let vec[ty::t] field_tys = vec();
+    let vec[ty::t] field_tys = [];
 
     for (ast::obj_field f in bcx.fcx.lcx.obj_fields) {
-        field_tys += vec(node_ann_type(bcx.fcx.lcx.ccx, f.ann));
+        field_tys += [node_ann_type(bcx.fcx.lcx.ccx, f.ann)];
     }
 
     // Synthesize a tuple type for the fields so that GEP_tup_like() can work
@@ -6475,17 +6475,17 @@ fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) {
 
     auto box_cell =
         bcx.build.GEP(llself.v,
-                      vec(C_int(0),
-                          C_int(abi::obj_field_box)));
+                      [C_int(0),
+                          C_int(abi::obj_field_box)]);
 
     auto box_ptr = bcx.build.Load(box_cell);
 
     box_ptr = bcx.build.PointerCast(box_ptr, llobj_box_ty);
 
     auto obj_typarams = bcx.build.GEP(box_ptr,
-                                     vec(C_int(0),
+                                     [C_int(0),
                                          C_int(abi::box_rc_field_body),
-                                         C_int(abi::obj_body_elt_typarams)));
+                                         C_int(abi::obj_body_elt_typarams)]);
 
     // The object fields immediately follow the type parameters, so we skip
     // over them to get the pointer.
@@ -6507,16 +6507,16 @@ fn populate_fn_ctxt_from_llself(@fn_ctxt fcx, self_vt llself) {
 
     for (ast::ty_param p in fcx.lcx.obj_typarams) {
         let ValueRef lltyparam = bcx.build.GEP(obj_typarams,
-                                               vec(C_int(0),
-                                                   C_int(i)));
+                                               [C_int(0),
+                                                   C_int(i)]);
         lltyparam = bcx.build.Load(lltyparam);
-        fcx.lltydescs += vec(lltyparam);
+        fcx.lltydescs += [lltyparam];
         i += 1;
     }
 
     i = 0;
     for (ast::obj_field f in fcx.lcx.obj_fields) {
-        auto rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, vec(0, i));
+        auto rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, [0, i]);
         bcx = llallocas_block_ctxt(fcx);
         auto llfield = rslt.val;
         fcx.llobjfields.insert(f.id, llfield);
@@ -6584,7 +6584,7 @@ fn trans_vtbl(@local_ctxt cx,
         }
         case (none[@ast::method]) {}
     }
-    let vec[ValueRef] methods = vec(dtor);
+    let vec[ValueRef] methods = [dtor];
 
     fn meth_lteq(&@ast::method a, &@ast::method b) -> bool {
         ret _str::lteq(a.node.ident, b.node.ident);
@@ -6615,7 +6615,7 @@ fn trans_vtbl(@local_ctxt cx,
         trans_fn(mcx, m.node.meth, m.node.id,
                  some[tup(TypeRef, ty::t)](tup(llself_ty, self_ty)),
                  ty_params, m.node.ann);
-        methods += vec(llfn);
+        methods += [llfn];
     }
     auto vtbl = C_struct(methods);
     auto vtbl_name = mangle_name_by_seq(cx.ccx, cx.path, "vtbl");
@@ -6654,9 +6654,9 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
     auto llctor_decl = ccx.item_ids.get(oid);
 
     // Translate obj ctor args to function arguments.
-    let vec[ast::arg] fn_args = vec();
+    let vec[ast::arg] fn_args = [];
     for (ast::obj_field f in ob.fields) {
-        fn_args += vec(rec(mode=ast::alias, ty=f.ty, ident=f.ident, id=f.id));
+        fn_args += [rec(mode=ast::alias, ty=f.ty, ident=f.ident, id=f.id)];
     }
 
     auto fcx = new_fn_ctxt(cx, llctor_decl);
@@ -6677,11 +6677,11 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
 
     auto vtbl = trans_vtbl(cx, llself_ty, self_ty, ob, ty_params);
     auto pair_vtbl = bcx.build.GEP(pair,
-                                   vec(C_int(0),
-                                       C_int(abi::obj_field_vtbl)));
+                                   [C_int(0),
+                                       C_int(abi::obj_field_vtbl)]);
     auto pair_box = bcx.build.GEP(pair,
-                                  vec(C_int(0),
-                                      C_int(abi::obj_field_box)));
+                                  [C_int(0),
+                                      C_int(abi::obj_field_box)]);
     bcx.build.Store(vtbl, pair_vtbl);
 
     let TypeRef llbox_ty = T_opaque_obj_ptr(ccx.tn);
@@ -6694,14 +6694,14 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
         bcx.build.Store(C_null(llbox_ty), pair_box);
     } else {
         // Malloc a box for the body and copy args in.
-        let vec[ty::t] obj_fields = vec();
+        let vec[ty::t] obj_fields = [];
         for (ty::arg a in arg_tys) {
             _vec::push[ty::t](obj_fields, a.ty);
         }
 
         // Synthesize an obj body type.
         auto tydesc_ty = ty::mk_type(ccx.tcx);
-        let vec[ty::t] tps = vec();
+        let vec[ty::t] tps = [];
         for (ast::ty_param tp in ty_params) {
             _vec::push[ty::t](tps, tydesc_ty);
         }
@@ -6709,26 +6709,26 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
         let ty::t typarams_ty = ty::mk_imm_tup(ccx.tcx, tps);
         let ty::t fields_ty = ty::mk_imm_tup(ccx.tcx, obj_fields);
         let ty::t body_ty = ty::mk_imm_tup(ccx.tcx,
-                                          vec(tydesc_ty,
+                                          [tydesc_ty,
                                               typarams_ty,
-                                              fields_ty));
+                                              fields_ty]);
         let ty::t boxed_body_ty = ty::mk_imm_box(ccx.tcx, body_ty);
 
         // Malloc a box for the body.
         auto box = trans_malloc_boxed(bcx, body_ty);
         bcx = box.bcx;
         auto rc = GEP_tup_like(bcx, boxed_body_ty, box.val,
-                               vec(0, abi::box_rc_field_refcnt));
+                               [0, abi::box_rc_field_refcnt]);
         bcx = rc.bcx;
         auto body = GEP_tup_like(bcx, boxed_body_ty, box.val,
-                                 vec(0, abi::box_rc_field_body));
+                                 [0, abi::box_rc_field_body]);
         bcx = body.bcx;
         bcx.build.Store(C_int(1), rc.val);
 
         // Store body tydesc.
         auto body_tydesc =
             GEP_tup_like(bcx, body_ty, body.val,
-                         vec(0, abi::obj_body_elt_tydesc));
+                         [0, abi::obj_body_elt_tydesc]);
         bcx = body_tydesc.bcx;
 
         auto ti = none[@tydesc_info];
@@ -6749,13 +6749,13 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
         // Copy typarams into captured typarams.
         auto body_typarams =
             GEP_tup_like(bcx, body_ty, body.val,
-                         vec(0, abi::obj_body_elt_typarams));
+                         [0, abi::obj_body_elt_typarams]);
         bcx = body_typarams.bcx;
         let int i = 0;
         for (ast::ty_param tp in ty_params) {
             auto typaram = bcx.fcx.lltydescs.(i);
             auto capture = GEP_tup_like(bcx, typarams_ty, body_typarams.val,
-                                        vec(0, i));
+                                        [0, i]);
             bcx = capture.bcx;
             bcx = copy_ty(bcx, INIT, capture.val, typaram, tydesc_ty).bcx;
             i += 1;
@@ -6764,7 +6764,7 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
         // Copy args into body fields.
         auto body_fields =
             GEP_tup_like(bcx, body_ty, body.val,
-                         vec(0, abi::obj_body_elt_fields));
+                         [0, abi::obj_body_elt_fields]);
         bcx = body_fields.bcx;
 
         i = 0;
@@ -6772,7 +6772,7 @@ fn trans_obj(@local_ctxt cx, &ast::_obj ob, ast::def_id oid,
             auto arg = bcx.fcx.llargs.get(f.id);
             arg = load_if_immediate(bcx, arg, arg_tys.(i).ty);
             auto field = GEP_tup_like(bcx, fields_ty, body_fields.val,
-                                      vec(0, i));
+                                      [0, i]);
             bcx = field.bcx;
             bcx = copy_ty(bcx, INIT, field.val, arg, arg_tys.(i).ty).bcx;
             i += 1;
@@ -6794,13 +6794,13 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id,
     }
 
     // Translate variant arguments to function arguments.
-    let vec[ast::arg] fn_args = vec();
+    let vec[ast::arg] fn_args = [];
     auto i = 0u;
     for (ast::variant_arg varg in variant.node.args) {
-        fn_args += vec(rec(mode=ast::alias,
+        fn_args += [rec(mode=ast::alias,
                            ty=varg.ty,
                            ident="arg" + _uint::to_str(i, 10u),
-                           id=varg.id));
+                           id=varg.id)];
     }
 
     assert (cx.ccx.item_ids.contains_key(variant.node.id));
@@ -6813,10 +6813,10 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id,
                               ret_ty_of_fn(cx.ccx, variant.node.ann),
                               fn_args, ty_params);
 
-    let vec[ty::t] ty_param_substs = vec();
+    let vec[ty::t] ty_param_substs = [];
     i = 0u;
     for (ast::ty_param tp in ty_params) {
-        ty_param_substs += vec(ty::mk_param(cx.ccx.tcx, i));
+        ty_param_substs += [ty::mk_param(cx.ccx.tcx, i)];
         i += 1u;
     }
 
@@ -6831,11 +6831,11 @@ fn trans_tag_variant(@local_ctxt cx, ast::def_id tag_id,
                                           T_opaque_tag_ptr(fcx.lcx.ccx.tn));
 
     auto lldiscrimptr = bcx.build.GEP(lltagptr,
-                                      vec(C_int(0), C_int(0)));
+                                      [C_int(0), C_int(0)]);
     bcx.build.Store(C_int(index), lldiscrimptr);
 
     auto llblobptr = bcx.build.GEP(lltagptr,
-                                   vec(C_int(0), C_int(1)));
+                                   [C_int(0), C_int(1)]);
 
     i = 0u;
     for (ast::variant_arg va in variant.node.args) {
@@ -6911,8 +6911,8 @@ fn trans_item(@local_ctxt cx, &ast::item item) {
             trans_obj(sub_cx, ob, oid.ctor, tps, ann);
         }
         case (ast::item_mod(?name, ?m, _)) {
-            auto sub_cx = @rec(path = cx.path + vec(name),
-                               module_path = cx.module_path + vec(name)
+            auto sub_cx = @rec(path = cx.path + [name],
+                               module_path = cx.module_path + [name]
                                with *cx);
             trans_mod(sub_cx, m);
         }
@@ -6939,7 +6939,7 @@ fn trans_mod(@local_ctxt cx, &ast::_mod m) {
 
 fn get_pair_fn_ty(TypeRef llpairty) -> TypeRef {
     // Bit of a kludge: pick the fn typeref out of the pair.
-    let vec[TypeRef] pair_tys = vec(T_nil(), T_nil());
+    let vec[TypeRef] pair_tys = [T_nil(), T_nil()];
     llvm::LLVMGetStructElementTypes(llpairty,
                                    _vec::buf[TypeRef](pair_tys));
     ret llvm::LLVMGetElementType(pair_tys.(0));
@@ -6980,8 +6980,8 @@ fn register_fn_pair(&@crate_ctxt cx, str ps, TypeRef llpairty, ValueRef llfn,
                     ast::def_id id) {
     let ValueRef gvar = llvm::LLVMAddGlobal(cx.llmod, llpairty,
                                            _str::buf(ps));
-    auto pair = C_struct(vec(llfn,
-                             C_null(T_opaque_closure_ptr(cx.tn))));
+    auto pair = C_struct([llfn,
+                             C_null(T_opaque_closure_ptr(cx.tn))]);
 
     llvm::LLVMSetInitializer(gvar, pair);
     llvm::LLVMSetGlobalConstant(gvar, True);
@@ -7089,19 +7089,19 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx,
         lltaskptr = fcx.lltaskptr;
     }
 
-    let vec[ValueRef] call_args = vec();
-    if (pass_task) { call_args += vec(lltaskptr); }
+    let vec[ValueRef] call_args = [];
+    if (pass_task) { call_args += [lltaskptr]; }
 
     auto arg_n = 3u;
     for each (uint i in _uint::range(0u, num_ty_param)) {
         auto llarg = llvm::LLVMGetParam(fcx.llfn, arg_n);
-        fcx.lltydescs += vec(llarg);
+        fcx.lltydescs += [llarg];
         assert (llarg as int != 0);
 
         if (cast_to_i32) {
-            call_args += vec(vp2i(bcx, llarg));
+            call_args += [vp2i(bcx, llarg)];
         } else {
-            call_args += vec(llarg);
+            call_args += [llarg];
         }
 
         arg_n += 1u;
@@ -7134,9 +7134,9 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx,
                                &mutable vec[ValueRef] call_args,
                                ty::t fn_type,
                                uint first_arg_n) -> tup(ValueRef, ValueRef) {
-        let vec[TypeRef] call_arg_tys = vec();
+        let vec[TypeRef] call_arg_tys = [];
         for (ValueRef arg in call_args) {
-            call_arg_tys += vec(val_ty(arg));
+            call_arg_tys += [val_ty(arg)];
         }
 
         auto llnativefnty =
@@ -7158,7 +7158,7 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx,
     auto args = ty::ty_fn_args(ccx.tcx, fn_type);
 
     // Build up the list of arguments.
-    let vec[tup(ValueRef, ty::t)] drop_args = vec();
+    let vec[tup(ValueRef, ty::t)] drop_args = [];
     auto i = arg_n;
     for (ty::arg arg in args) {
         auto llarg = llvm::LLVMGetParam(fcx.llfn, i);
@@ -7166,13 +7166,13 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx,
 
         if (cast_to_i32) {
             auto llarg_i32 = convert_arg_to_i32(bcx, llarg, arg.ty, arg.mode);
-            call_args += vec(llarg_i32);
+            call_args += [llarg_i32];
         } else {
-            call_args += vec(llarg);
+            call_args += [llarg];
         }
 
         if (arg.mode == ty::mo_val) {
-            drop_args += vec(tup(llarg, arg.ty));
+            drop_args += [tup(llarg, arg.ty)];
         }
 
         i += 1u;
@@ -7217,7 +7217,7 @@ fn decl_native_fn_and_pair(&@crate_ctxt ccx,
 
 type walk_ctxt = rec(mutable vec[str] path);
 fn new_walk_ctxt() -> @walk_ctxt {
-    let vec[str] path = vec();
+    let vec[str] path = [];
     ret @rec(mutable path=path);
 }
 
@@ -7338,7 +7338,7 @@ fn collect_tag_ctor(&@crate_ctxt ccx, @walk_ctxt wcx, &@ast::item i) {
         case (ast::item_tag(_, ?variants, ?tps, _, _)) {
             for (ast::variant variant in variants) {
                 if (_vec::len[ast::variant_arg](variant.node.args) != 0u) {
-                    decl_fn_and_pair(ccx, wcx.path + vec(variant.node.name),
+                    decl_fn_and_pair(ccx, wcx.path + [variant.node.name],
                                      "tag", tps, variant.node.ann,
                                      variant.node.id);
                 }
@@ -7392,7 +7392,7 @@ fn trans_constant(&@crate_ctxt ccx, @walk_ctxt wcx, &@ast::item it) {
             // with consts.
             auto v = C_int(1);
             ccx.item_ids.insert(cid, v);
-            auto s = mangle_name_by_type(ccx, wcx.path + vec(name),
+            auto s = mangle_name_by_type(ccx, wcx.path + [name],
                                          node_ann_type(ccx, ann));
             ccx.item_symbols.insert(cid, s);
         }
@@ -7430,8 +7430,8 @@ fn i2p(ValueRef v, TypeRef t) -> ValueRef {
 fn trans_exit_task_glue(@glue_fns glues,
                         &hashmap[str, ValueRef] externs,
                         type_names tn, ModuleRef llmod) {
-    let vec[TypeRef] T_args = vec();
-    let vec[ValueRef] V_args = vec();
+    let vec[TypeRef] T_args = [];
+    let vec[ValueRef] V_args = [];
 
     auto llfn = glues.exit_task_glue;
 
@@ -7444,14 +7444,14 @@ fn trans_exit_task_glue(@glue_fns glues,
     let ValueRef arg4 = llvm::LLVMGetParam(llfn, 3u);
     let ValueRef arg5 = llvm::LLVMGetParam(llfn, 4u);
 
-    auto main_type = T_fn(vec(T_int(), T_int(), T_int(), T_int()), T_void());
+    auto main_type = T_fn([T_int(), T_int(), T_int(), T_int()], T_void());
 
     auto fun = build.IntToPtr(arg1, T_ptr(main_type));
-    auto call_args = vec(arg2, arg3, arg4, arg5);
+    auto call_args = [arg2, arg3, arg4, arg5];
     build.FastCall(fun, call_args);
 
     trans_native_call(build, glues, arg3,
-                      externs, tn, llmod, "upcall_exit", true, vec(arg3));
+                      externs, tn, llmod, "upcall_exit", true, [arg3]);
 
     build.RetVoid();
 }
@@ -7476,7 +7476,7 @@ fn create_crate_constant(ValueRef crate_ptr, @glue_fns glues) {
         llvm::LLVMConstSub(p2i(glues.exit_task_glue), crate_addr);
 
     let ValueRef crate_val =
-        C_struct(vec(C_null(T_int()),     // ptrdiff_t image_base_off
+        C_struct([C_null(T_int()),     // ptrdiff_t image_base_off
                      p2i(crate_ptr),      // uintptr_t self_addr
                      C_null(T_int()),     // ptrdiff_t debug_abbrev_off
                      C_null(T_int()),     // size_t debug_abbrev_sz
@@ -7491,7 +7491,7 @@ fn create_crate_constant(ValueRef crate_ptr, @glue_fns glues) {
                      C_null(T_int()),     // int n_c_syms
                      C_null(T_int()),     // int n_libs
                      C_int(abi::abi_x86_rustc_fastcall) // uintptr_t abi_tag
-                     ));
+                     ]);
 
     llvm::LLVMSetInitializer(crate_ptr, crate_val);
 }
@@ -7521,8 +7521,8 @@ fn find_main_fn(&@crate_ctxt cx) -> ValueRef {
 }
 
 fn trans_main_fn(@local_ctxt cx, ValueRef llcrate, ValueRef crate_map) {
-    auto T_main_args = vec(T_int(), T_int());
-    auto T_rust_start_args = vec(T_int(), T_int(), T_int(), T_int(), T_int());
+    auto T_main_args = [T_int(), T_int()];
+    auto T_rust_start_args = [T_int(), T_int(), T_int(), T_int(), T_int()];
 
     auto main_name;
     if (_str::eq(std::os::target_os(), "win32")) {
@@ -7553,25 +7553,25 @@ fn trans_main_fn(@local_ctxt cx, ValueRef llcrate, ValueRef crate_map) {
         llvm::LLVMAppendBasicBlock(llmain, _str::buf(""));
     auto b = new_builder(llbb);
 
-    auto start_args = vec(p2i(llrust_main), p2i(llcrate), llargc, llargv,
-                          p2i(crate_map));
+    auto start_args = [p2i(llrust_main), p2i(llcrate), llargc, llargv,
+                          p2i(crate_map)];
 
     b.Ret(b.Call(llrust_start, start_args));
 }
 
 fn declare_intrinsics(ModuleRef llmod) -> hashmap[str,ValueRef] {
 
-    let vec[TypeRef] T_memmove32_args = vec(T_ptr(T_i8()), T_ptr(T_i8()),
-                                           T_i32(), T_i32(), T_i1());
-    let vec[TypeRef] T_memmove64_args = vec(T_ptr(T_i8()), T_ptr(T_i8()),
-                                           T_i64(), T_i32(), T_i1());
+    let vec[TypeRef] T_memmove32_args = [T_ptr(T_i8()), T_ptr(T_i8()),
+                                           T_i32(), T_i32(), T_i1()];
+    let vec[TypeRef] T_memmove64_args = [T_ptr(T_i8()), T_ptr(T_i8()),
+                                           T_i64(), T_i32(), T_i1()];
 
-    let vec[TypeRef] T_memset32_args = vec(T_ptr(T_i8()), T_i8(),
-                                           T_i32(), T_i32(), T_i1());
-    let vec[TypeRef] T_memset64_args = vec(T_ptr(T_i8()), T_i8(),
-                                           T_i64(), T_i32(), T_i1());
+    let vec[TypeRef] T_memset32_args = [T_ptr(T_i8()), T_i8(),
+                                           T_i32(), T_i32(), T_i1()];
+    let vec[TypeRef] T_memset64_args = [T_ptr(T_i8()), T_i8(),
+                                           T_i64(), T_i32(), T_i1()];
 
-    let vec[TypeRef] T_trap_args = vec();
+    let vec[TypeRef] T_trap_args = [];
 
     auto memmove32 = decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32",
                                   T_fn(T_memmove32_args, T_void()));
@@ -7598,12 +7598,12 @@ fn declare_intrinsics(ModuleRef llmod) -> hashmap[str,ValueRef] {
 
 fn trace_str(&@block_ctxt cx, str s) {
     cx.build.Call(cx.fcx.lcx.ccx.upcalls.trace_str,
-                  vec(cx.fcx.lltaskptr, C_cstr(cx.fcx.lcx.ccx, s)));
+                  [cx.fcx.lltaskptr, C_cstr(cx.fcx.lcx.ccx, s)]);
 }
 
 fn trace_word(&@block_ctxt cx, ValueRef v) {
     cx.build.Call(cx.fcx.lcx.ccx.upcalls.trace_word,
-                  vec(cx.fcx.lltaskptr, v));
+                  [cx.fcx.lltaskptr, v]);
 }
 
 fn trace_ptr(&@block_ctxt cx, ValueRef v) {
@@ -7611,12 +7611,12 @@ fn trace_ptr(&@block_ctxt cx, ValueRef v) {
 }
 
 fn trap(&@block_ctxt bcx) {
-    let vec[ValueRef] v = vec();
+    let vec[ValueRef] v = [];
     bcx.build.Call(bcx.fcx.lcx.ccx.intrinsics.get("llvm.trap"), v);
 }
 
 fn decl_no_op_type_glue(ModuleRef llmod, type_names tn) -> ValueRef {
-    auto ty = T_fn(vec(T_taskptr(tn), T_ptr(T_i8())), T_void());
+    auto ty = T_fn([T_taskptr(tn), T_ptr(T_i8())], T_void());
     ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty);
 }
 
@@ -7647,11 +7647,11 @@ fn make_vec_append_glue(ModuleRef llmod, type_names tn) -> ValueRef {
      *
      */
 
-    auto ty = T_fn(vec(T_taskptr(tn),
+    auto ty = T_fn([T_taskptr(tn),
                        T_ptr(T_tydesc(tn)),
                        T_ptr(T_tydesc(tn)),
                        T_ptr(T_opaque_vec_ptr()),
-                       T_opaque_vec_ptr(), T_bool()),
+                       T_opaque_vec_ptr(), T_bool()],
                    T_void());
 
     auto llfn = decl_fastcall_fn(llmod, abi::vec_append_glue_name(), ty);
@@ -7660,41 +7660,41 @@ fn make_vec_append_glue(ModuleRef llmod, type_names tn) -> ValueRef {
 
 
 fn vec_fill(&@block_ctxt bcx, ValueRef v) -> ValueRef {
-    ret bcx.build.Load(bcx.build.GEP(v, vec(C_int(0),
-                                            C_int(abi::vec_elt_fill))));
+    ret bcx.build.Load(bcx.build.GEP(v, [C_int(0),
+                                            C_int(abi::vec_elt_fill)]));
 }
 
 fn put_vec_fill(&@block_ctxt bcx, ValueRef v, ValueRef fill) -> ValueRef {
     ret bcx.build.Store(fill,
                         bcx.build.GEP(v,
-                                      vec(C_int(0),
-                                          C_int(abi::vec_elt_fill))));
+                                      [C_int(0),
+                                          C_int(abi::vec_elt_fill)]));
 }
 
 fn vec_fill_adjusted(&@block_ctxt bcx, ValueRef v,
                      ValueRef skipnull) -> ValueRef {
     auto f = bcx.build.Load(bcx.build.GEP(v,
-                                          vec(C_int(0),
-                                              C_int(abi::vec_elt_fill))));
+                                          [C_int(0),
+                                              C_int(abi::vec_elt_fill)]));
     ret bcx.build.Select(skipnull, bcx.build.Sub(f, C_int(1)), f);
 }
 
 fn vec_p0(&@block_ctxt bcx, ValueRef v) -> ValueRef {
-    auto p = bcx.build.GEP(v, vec(C_int(0),
-                                  C_int(abi::vec_elt_data)));
+    auto p = bcx.build.GEP(v, [C_int(0),
+                                  C_int(abi::vec_elt_data)]);
     ret bcx.build.PointerCast(p, T_ptr(T_i8()));
 }
 
 
 fn vec_p1(&@block_ctxt bcx, ValueRef v) -> ValueRef {
     auto len = vec_fill(bcx, v);
-    ret bcx.build.GEP(vec_p0(bcx, v), vec(len));
+    ret bcx.build.GEP(vec_p0(bcx, v), [len]);
 }
 
 fn vec_p1_adjusted(&@block_ctxt bcx, ValueRef v,
                    ValueRef skipnull) -> ValueRef {
     auto len = vec_fill_adjusted(bcx, v, skipnull);
-    ret bcx.build.GEP(vec_p0(bcx, v), vec(len));
+    ret bcx.build.GEP(vec_p0(bcx, v), [len]);
 }
 
 fn trans_vec_append_glue(@local_ctxt cx) {
@@ -7739,9 +7739,9 @@ fn trans_vec_append_glue(@local_ctxt cx) {
 
     auto llcopy_dst_ptr = alloca(bcx, T_int());
     auto llnew_vec = bcx.build.Call(bcx.fcx.lcx.ccx.upcalls.vec_grow,
-        vec(bcx.fcx.lltaskptr, lldst_vec,
+        [bcx.fcx.lltaskptr, lldst_vec,
             vec_fill_adjusted(bcx, llsrc_vec, llskipnull),
-            llcopy_dst_ptr, llvec_tydesc));
+            llcopy_dst_ptr, llvec_tydesc]);
     maybe_name_value(bcx.fcx.lcx.ccx, llnew_vec, "llnew_vec");
 
     auto copy_dst_cx = new_sub_block_ctxt(bcx, "copy new <- dst");
@@ -7764,19 +7764,19 @@ fn trans_vec_append_glue(@local_ctxt cx) {
                  ValueRef src,
                  ValueRef n_bytes) -> result {
 
-        auto src_lim = cx.build.GEP(src, vec(n_bytes));
+        auto src_lim = cx.build.GEP(src, [n_bytes]);
         maybe_name_value(cx.fcx.lcx.ccx, src_lim, "src_lim");
 
         auto elt_llsz =
             cx.build.Load(cx.build.GEP(elt_tydesc,
-                                       vec(C_int(0),
-                                           C_int(abi::tydesc_field_size))));
+                                       [C_int(0),
+                                           C_int(abi::tydesc_field_size)]));
         maybe_name_value(cx.fcx.lcx.ccx, elt_llsz, "elt_llsz");
 
         auto elt_llalign =
             cx.build.Load(cx.build.GEP(elt_tydesc,
-                                       vec(C_int(0),
-                                           C_int(abi::tydesc_field_align))));
+                                       [C_int(0),
+                                           C_int(abi::tydesc_field_align)]));
         maybe_name_value(cx.fcx.lcx.ccx, elt_llsz, "elt_llalign");
 
 
@@ -7841,11 +7841,11 @@ fn make_glues(ModuleRef llmod, &type_names tn) -> @glue_fns {
     ret @rec(activate_glue = decl_glue(llmod, tn, abi::activate_glue_name()),
              yield_glue = decl_glue(llmod, tn, abi::yield_glue_name()),
              exit_task_glue = decl_cdecl_fn(llmod, abi::exit_task_glue_name(),
-                                            T_fn(vec(T_int(),
+                                            T_fn([T_int(),
                                                      T_int(),
                                                      T_int(),
                                                      T_int(),
-                                                     T_int()),
+                                                     T_int()],
                                                  T_void())),
 
              native_glues_rust =
@@ -7889,18 +7889,18 @@ fn make_common_glue(&session::session sess, &str output) {
 }
 
 fn create_module_map(&@crate_ctxt ccx) -> ValueRef {
-    auto elttype = T_struct(vec(T_int(), T_int()));
+    auto elttype = T_struct([T_int(), T_int()]);
     auto maptype = T_array(elttype, ccx.module_data.size() + 1u);
     auto map = llvm::LLVMAddGlobal(ccx.llmod, maptype,
                                   _str::buf("_rust_mod_map"));
     llvm::LLVMSetLinkage(map, lib::llvm::LLVMInternalLinkage
                          as llvm::Linkage);
-    let vec[ValueRef] elts = vec();
+    let vec[ValueRef] elts = [];
     for each (@tup(str, ValueRef) item in ccx.module_data.items()) {
-        auto elt = C_struct(vec(p2i(C_cstr(ccx, item._0)), p2i(item._1)));
+        auto elt = C_struct([p2i(C_cstr(ccx, item._0)), p2i(item._1)]);
         _vec::push[ValueRef](elts, elt);
     }
-    auto term = C_struct(vec(C_int(0), C_int(0)));
+    auto term = C_struct([C_int(0), C_int(0)]);
     _vec::push[ValueRef](elts, term);
     llvm::LLVMSetInitializer(map, C_array(elttype, elts));
     ret map;
@@ -7917,7 +7917,7 @@ fn crate_name(&@crate_ctxt ccx, &str deflt) -> str {
 
 // FIXME use hashed metadata instead of crate names once we have that
 fn create_crate_map(&@crate_ctxt ccx) -> ValueRef {
-    let vec[ValueRef] subcrates = vec();
+    let vec[ValueRef] subcrates = [];
     auto i = 1;
     while (ccx.sess.has_external_crate(i)) {
         auto name = ccx.sess.get_external_crate(i).name;
@@ -7929,12 +7929,12 @@ fn create_crate_map(&@crate_ctxt ccx) -> ValueRef {
     _vec::push[ValueRef](subcrates, C_int(0));
     auto sym_name = "_rust_crate_map_" + crate_name(ccx, "__none__");
     auto arrtype = T_array(T_int(), _vec::len[ValueRef](subcrates));
-    auto maptype = T_struct(vec(T_int(), arrtype));
+    auto maptype = T_struct([T_int(), arrtype]);
     auto map = llvm::LLVMAddGlobal(ccx.llmod, maptype, _str::buf(sym_name));
     llvm::LLVMSetLinkage(map, lib::llvm::LLVMExternalLinkage
                          as llvm::Linkage);
-    llvm::LLVMSetInitializer(map, C_struct(vec(p2i(create_module_map(ccx)),
-                                              C_array(T_int(), subcrates))));
+    llvm::LLVMSetInitializer(map, C_struct([p2i(create_module_map(ccx)),
+                                              C_array(T_int(), subcrates)]));
     ret map;
 }
 
diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs
index 1c947e693ef..ee02a21ace3 100644
--- a/src/comp/middle/ty.rs
+++ b/src/comp/middle/ty.rs
@@ -420,9 +420,9 @@ fn mk_tup(&ctxt cx, &vec[mt] tms) -> t { ret gen_ty(cx, ty_tup(tms)); }
 
 fn mk_imm_tup(&ctxt cx, &vec[t] tys) -> t {
     // TODO: map
-    let vec[ty::mt] mts = vec();
+    let vec[ty::mt] mts = [];
     for (t typ in tys) {
-        mts += vec(rec(ty=typ, mut=ast::imm));
+        mts += [rec(ty=typ, mut=ast::imm)];
     }
     ret mk_tup(cx, mts);
 }
@@ -625,12 +625,12 @@ fn ty_to_str(ctxt cx, &t typ) -> str {
         }
 
         case (ty_param(?id)) {
-            s += "'" + _str::unsafe_from_bytes(vec(('a' as u8) + (id as u8)));
+            s += "'" + _str::unsafe_from_bytes([('a' as u8) + (id as u8)]);
         }
 
         case (ty_bound_param(?id)) {
-            s += "''" + _str::unsafe_from_bytes(vec(('a' as u8) +
-                                                    (id as u8)));
+            s += "''" + _str::unsafe_from_bytes([('a' as u8) +
+                                                    (id as u8)]);
         }
     }
 
@@ -693,7 +693,7 @@ fn walk_ty(ctxt cx, ty_walk walker, t ty) {
             walk_ty(cx, walker, ret_ty);
         }
         case (ty_obj(?methods)) {
-            let vec[method] new_methods = vec();
+            let vec[method] new_methods = [];
             for (method m in methods) {
                 for (arg a in m.inputs) {
                     walk_ty(cx, walker, a.ty);
@@ -740,58 +740,58 @@ fn fold_ty(ctxt cx, ty_fold fld, t ty_0) -> t {
             ty = copy_cname(cx, mk_chan(cx, fold_ty(cx, fld, subty)), ty);
         }
         case (ty_tag(?tid, ?subtys)) {
-            let vec[t] new_subtys = vec();
+            let vec[t] new_subtys = [];
             for (t subty in subtys) {
-                new_subtys += vec(fold_ty(cx, fld, subty));
+                new_subtys += [fold_ty(cx, fld, subty)];
             }
             ty = copy_cname(cx, mk_tag(cx, tid, new_subtys), ty);
         }
         case (ty_tup(?mts)) {
-            let vec[mt] new_mts = vec();
+            let vec[mt] new_mts = [];
             for (mt tm in mts) {
                 auto new_subty = fold_ty(cx, fld, tm.ty);
-                new_mts += vec(rec(ty=new_subty, mut=tm.mut));
+                new_mts += [rec(ty=new_subty, mut=tm.mut)];
             }
             ty = copy_cname(cx, mk_tup(cx, new_mts), ty);
         }
         case (ty_rec(?fields)) {
-            let vec[field] new_fields = vec();
+            let vec[field] new_fields = [];
             for (field fl in fields) {
                 auto new_ty = fold_ty(cx, fld, fl.mt.ty);
                 auto new_mt = rec(ty=new_ty, mut=fl.mt.mut);
-                new_fields += vec(rec(ident=fl.ident, mt=new_mt));
+                new_fields += [rec(ident=fl.ident, mt=new_mt)];
             }
             ty = copy_cname(cx, mk_rec(cx, new_fields), ty);
         }
         case (ty_fn(?proto, ?args, ?ret_ty)) {
-            let vec[arg] new_args = vec();
+            let vec[arg] new_args = [];
             for (arg a in args) {
                 auto new_ty = fold_ty(cx, fld, a.ty);
-                new_args += vec(rec(mode=a.mode, ty=new_ty));
+                new_args += [rec(mode=a.mode, ty=new_ty)];
             }
             ty = copy_cname(cx, mk_fn(cx, proto, new_args,
                                       fold_ty(cx, fld, ret_ty)), ty);
         }
         case (ty_native_fn(?abi, ?args, ?ret_ty)) {
-            let vec[arg] new_args = vec();
+            let vec[arg] new_args = [];
             for (arg a in args) {
                 auto new_ty = fold_ty(cx, fld, a.ty);
-                new_args += vec(rec(mode=a.mode, ty=new_ty));
+                new_args += [rec(mode=a.mode, ty=new_ty)];
             }
             ty = copy_cname(cx, mk_native_fn(cx, abi, new_args,
                                              fold_ty(cx, fld, ret_ty)), ty);
         }
         case (ty_obj(?methods)) {
-            let vec[method] new_methods = vec();
+            let vec[method] new_methods = [];
             for (method m in methods) {
-                let vec[arg] new_args = vec();
+                let vec[arg] new_args = [];
                 for (arg a in m.inputs) {
-                    new_args += vec(rec(mode=a.mode,
-                                        ty=fold_ty(cx, fld, a.ty)));
+                    new_args += [rec(mode=a.mode,
+                                        ty=fold_ty(cx, fld, a.ty))];
                 }
-                new_methods += vec(rec(proto=m.proto, ident=m.ident,
+                new_methods += [rec(proto=m.proto, ident=m.ident,
                                        inputs=new_args,
-                                       output=fold_ty(cx, fld, m.output)));
+                                       output=fold_ty(cx, fld, m.output))];
             }
             ty = copy_cname(cx, mk_obj(cx, new_methods), ty);
         }
@@ -1443,7 +1443,7 @@ fn ann_to_type(&node_type_table ntt, &ast::ann ann) -> t {
 fn ann_to_type_params(&node_type_table ntt, &ast::ann ann) -> vec[t] {
     alt (ann_to_ty_param_substs_opt_and_ty(ntt, ann)._0) {
         case (none[vec[t]]) {
-            let vec[t] result = vec();
+            let vec[t] result = [];
             ret result;
         }
         case (some[vec[t]](?tps)) { ret tps; }
@@ -1492,14 +1492,14 @@ fn count_ty_params(ctxt cx, t ty) -> uint {
                     }
                 }
                 if (!seen) {
-                    *param_indices += vec(param_idx);
+                    *param_indices += [param_idx];
                 }
             }
             case (_) { /* fall through */ }
         }
     }
 
-    let vec[uint] v = vec();    // FIXME: typechecker botch
+    let vec[uint] v = [];    // FIXME: typechecker botch
     let @mutable vec[uint] param_indices = @mutable v;
     auto f = bind counter(cx, param_indices, _);
     walk_ty(cx, f, ty);
@@ -1873,7 +1873,7 @@ mod unify {
         }
 
         // TODO: as above, we should have an iter2 iterator.
-        let vec[arg] result_ins = vec();
+        let vec[arg] result_ins = [];
         auto i = 0u;
         while (i < expected_len) {
             auto expected_input = expected_inputs.(i);
@@ -1897,7 +1897,7 @@ mod unify {
 
             alt (result) {
                 case (ures_ok(?rty)) {
-                    result_ins += vec(rec(mode=result_mode, ty=rty));
+                    result_ins += [rec(mode=result_mode, ty=rty)];
                 }
 
                 case (_) {
@@ -1979,7 +1979,7 @@ mod unify {
                  &t actual,
                  &vec[method] expected_meths,
                  &vec[method] actual_meths) -> result {
-      let vec[method] result_meths = vec();
+      let vec[method] result_meths = [];
       let uint i = 0u;
       let uint expected_len = _vec::len[method](expected_meths);
       let uint actual_len = _vec::len[method](actual_meths);
@@ -2004,9 +2004,9 @@ mod unify {
             case (ures_ok(?tfn)) {
                 alt (struct(cx.tcx, tfn)) {
                     case (ty_fn(?proto, ?ins, ?out)) {
-                        result_meths += vec(rec(inputs = ins,
+                        result_meths += [rec(inputs = ins,
                                                 output = out
-                                                with e_meth));
+                                                with e_meth)];
                     }
                 }
             }
@@ -2057,10 +2057,10 @@ mod unify {
                         // Just bind the type variable to the expected type.
                         auto vlen = _vec::len[vec[t]](cx.types);
                         if (actual_n < vlen) {
-                            cx.types.(actual_n) += vec(expected);
+                            cx.types.(actual_n) += [expected];
                         } else {
                             assert (actual_n == vlen);
-                            cx.types += vec(mutable vec(expected));
+                            cx.types += [mutable [expected]];
                         }
                     }
                 }
@@ -2120,7 +2120,7 @@ mod unify {
 
                         // TODO: factor this cruft out, see the TODO in the
                         // ty::ty_tup case
-                        let vec[t] result_tps = vec();
+                        let vec[t] result_tps = [];
                         auto i = 0u;
                         auto expected_len = _vec::len[t](expected_tps);
                         while (i < expected_len) {
@@ -2272,7 +2272,7 @@ mod unify {
 
                         // TODO: implement an iterator that can iterate over
                         // two arrays simultaneously.
-                        let vec[ty::mt] result_elems = vec();
+                        let vec[ty::mt] result_elems = [];
                         auto i = 0u;
                         while (i < expected_len) {
                             auto expected_elem = expected_elems.(i);
@@ -2294,7 +2294,7 @@ mod unify {
                             alt (result) {
                                 case (ures_ok(?rty)) {
                                     auto mt = rec(ty=rty, mut=mut);
-                                    result_elems += vec(mt);
+                                    result_elems += [mt];
                                 }
                                 case (_) {
                                     ret result;
@@ -2326,7 +2326,7 @@ mod unify {
 
                         // TODO: implement an iterator that can iterate over
                         // two arrays simultaneously.
-                        let vec[field] result_fields = vec();
+                        let vec[field] result_fields = [];
                         auto i = 0u;
                         while (i < expected_len) {
                             auto expected_field = expected_fields.(i);
@@ -2425,10 +2425,10 @@ mod unify {
                 auto expected_n = get_or_create_set(cx, expected_id);
                 auto vlen = _vec::len[vec[t]](cx.types);
                 if (expected_n < vlen) {
-                    cx.types.(expected_n) += vec(actual);
+                    cx.types.(expected_n) += [actual];
                 } else {
                     assert (expected_n == vlen);
-                    cx.types += vec(mutable vec(actual));
+                    cx.types += [mutable [actual]];
                 }
                 ret ures_ok(expected);
             }
@@ -2485,13 +2485,13 @@ mod unify {
     }
 
     fn unify_sets(&@ctxt cx) -> vec[t] {
-        let vec[t] throwaway = vec();
-        let vec[mutable vec[t]] set_types = vec(mutable throwaway);
+        let vec[t] throwaway = [];
+        let vec[mutable vec[t]] set_types = [mutable throwaway];
         _vec::pop[vec[t]](set_types);   // FIXME: botch
 
         for (ufind::node node in cx.sets.nodes) {
-            let vec[t] v = vec();
-            set_types += vec(mutable v);
+            let vec[t] v = [];
+            set_types += [mutable v];
         }
 
         auto i = 0u;
@@ -2501,14 +2501,14 @@ mod unify {
             i += 1u;
         }
 
-        let vec[t] result = vec();
+        let vec[t] result = [];
         for (vec[t] types in set_types) {
             if (_vec::len[t](types) > 1u) {
                 log_err "unification of > 1 types in a type set is " +
                     "unimplemented";
                 fail;
             }
-            result += vec(types.(0));
+            result += [types.(0)];
         }
 
         ret result;
@@ -2518,8 +2518,8 @@ mod unify {
              &t actual,
              &unify_handler handler,
              &ty_ctxt tcx) -> result {
-        let vec[t] throwaway = vec();
-        let vec[mutable vec[t]] types = vec(mutable throwaway);
+        let vec[t] throwaway = [];
+        let vec[mutable vec[t]] types = [mutable throwaway];
         _vec::pop[vec[t]](types);   // FIXME: botch
 
         auto cx = @rec(sets=ufind::make(),
diff --git a/src/comp/middle/type_glue.rs b/src/comp/middle/type_glue.rs
index d9f16bb3bcd..d9c144f3fbf 100644
--- a/src/comp/middle/type_glue.rs
+++ b/src/comp/middle/type_glue.rs
@@ -37,17 +37,17 @@ fn rc_shape_of(&ty::ctxt tcx, variant_getter getter, ty::t t) -> rc_shape {
         case (ty::ty_char) { ret rs_none; }
         case (ty::ty_str) { ret rs_none; }
         case (ty::ty_tag(?did, ?params)) {
-            let vec[vec[@rc_shape]] result = vec();
+            let vec[vec[@rc_shape]] result = [];
 
             auto vinfos = getter(did);
             for (variant_info vinfo in vinfos) {
-                let vec[@rc_shape] variant_rcs = vec();
+                let vec[@rc_shape] variant_rcs = [];
                 for (ty::t typ in vinfo.args) {
                     auto ty_1 = ty::bind_params_in_type(tcx, typ);
                     ty_1 = ty::substitute_type_params(tcx, params, ty_1);
-                    variant_rcs += vec(@rc_shape_of(tcx, getter, ty_1));
+                    variant_rcs += [@rc_shape_of(tcx, getter, ty_1)];
                 }
-                result += vec(variant_rcs);
+                result += [variant_rcs];
             }
 
             ret rs_tag(result);
@@ -58,16 +58,16 @@ fn rc_shape_of(&ty::ctxt tcx, variant_getter getter, ty::t t) -> rc_shape {
         case (ty::ty_chan(_)) { ret rs_ref; }
         case (ty::ty_task) { ret rs_ref; }
         case (ty::ty_tup(?mts)) {
-            let vec[@rc_shape] result = vec();
+            let vec[@rc_shape] result = [];
             for (ty::mt tm in mts) {
-                result += vec(@rc_shape_of(tcx, getter, tm.ty));
+                result += [@rc_shape_of(tcx, getter, tm.ty)];
             }
             ret rs_tup(result);
         }
         case (ty::ty_rec(?fields)) {
-            let vec[@rc_shape] result = vec();
+            let vec[@rc_shape] result = [];
             for (ty::field fld in fields) {
-                result += vec(@rc_shape_of(tcx, getter, fld.mt.ty));
+                result += [@rc_shape_of(tcx, getter, fld.mt.ty)];
             }
             ret rs_tup(result);
         }
diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs
index 4b1eea9e2fd..42a06d398fd 100644
--- a/src/comp/middle/typeck.rs
+++ b/src/comp/middle/typeck.rs
@@ -188,10 +188,10 @@ fn instantiate_path(&@fn_ctxt fcx, &ast::path pth, &ty_param_count_and_ty tpt,
     auto ty_substs_opt;
     auto ty_substs_len = _vec::len[@ast::ty](pth.node.types);
     if (ty_substs_len > 0u) {
-        let vec[ty::t] ty_substs = vec();
+        let vec[ty::t] ty_substs = [];
         auto i = 0u;
         while (i < ty_substs_len) {
-            ty_substs += vec(ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i)));
+            ty_substs += [ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i))];
             i += 1u;
         }
         ty_substs_opt = some[vec[ty::t]](ty_substs);
@@ -203,10 +203,10 @@ fn instantiate_path(&@fn_ctxt fcx, &ast::path pth, &ty_param_count_and_ty tpt,
         }
     } else {
         // We will acquire the type parameters through unification.
-        let vec[ty::t] ty_substs = vec();
+        let vec[ty::t] ty_substs = [];
         auto i = 0u;
         while (i < ty_param_count) {
-            ty_substs += vec(next_ty_var(fcx.ccx));
+            ty_substs += [next_ty_var(fcx.ccx)];
             i += 1u;
         }
         ty_substs_opt = some[vec[ty::t]](ty_substs);
@@ -259,9 +259,9 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t {
         // TODO: Make sure the number of supplied bindings matches the number
         // of type parameters in the typedef. Emit a friendly error otherwise.
         auto bound_ty = bind_params_in_type(tcx, params_opt_and_ty._1);
-        let vec[ty::t] param_bindings = vec();
+        let vec[ty::t] param_bindings = [];
         for (@ast::ty ast_ty in args) {
-            param_bindings += vec(ast_ty_to_ty(tcx, getter, ast_ty));
+            param_bindings += [ast_ty_to_ty(tcx, getter, ast_ty)];
         }
         ret ty::substitute_type_params(tcx, param_bindings, bound_ty);
     }
@@ -294,14 +294,14 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t {
         }
 
         case (ast::ty_tup(?fields)) {
-            let vec[ty::mt] flds = vec();
+            let vec[ty::mt] flds = [];
             for (ast::mt field in fields) {
                 _vec::push[ty::mt](flds, ast_mt_to_mt(tcx, getter, field));
             }
             typ = ty::mk_tup(tcx, flds);
         }
         case (ast::ty_rec(?fields)) {
-            let vec[field] flds = vec();
+            let vec[field] flds = [];
             for (ast::ty_field f in fields) {
                 auto tm = ast_mt_to_mt(tcx, getter, f.mt);
                 _vec::push[field](flds, rec(ident=f.ident, mt=tm));
@@ -336,7 +336,7 @@ fn ast_ty_to_ty(&ty::ctxt tcx, &ty_getter getter, &@ast::ty ast_ty) -> ty::t {
         }
 
         case (ast::ty_obj(?meths)) {
-            let vec[ty::method] tmeths = vec();
+            let vec[ty::method] tmeths = [];
             auto f = bind ast_arg_to_arg(tcx, getter, _);
             for (ast::ty_method m in meths) {
                 auto ins = _vec::map[ast::ty_arg, arg](f, m.inputs);
@@ -502,7 +502,7 @@ mod collect {
             -> ty::ty_param_count_and_ty {
         auto t_obj = ty_of_obj(cx, id, obj_info, ty_params);
 
-        let vec[arg] t_inputs = vec();
+        let vec[arg] t_inputs = [];
         for (ast::obj_field f in obj_info.fields) {
             auto g = bind getter(cx, _);
             auto t_field = ast_ty_to_ty(cx.tcx, g, f.ty);
@@ -561,11 +561,11 @@ mod collect {
 
             case (ast::item_tag(_, _, ?tps, ?def_id, _)) {
                 // Create a new generic polytype.
-                let vec[ty::t] subtys = vec();
+                let vec[ty::t] subtys = [];
 
                 auto i = 0u;
                 for (ast::ty_param tp in tps) {
-                    subtys += vec(ty::mk_param(cx.tcx, i));
+                    subtys += [ty::mk_param(cx.tcx, i)];
                     i += 1u;
                 }
 
@@ -613,13 +613,13 @@ mod collect {
                              &vec[ast::variant] variants,
                              &vec[ast::ty_param] ty_params)
             -> vec[ast::variant] {
-        let vec[ast::variant] result = vec();
+        let vec[ast::variant] result = [];
 
         // Create a set of parameter types shared among all the variants.
-        let vec[ty::t] ty_param_tys = vec();
+        let vec[ty::t] ty_param_tys = [];
         auto i = 0u;
         for (ast::ty_param tp in ty_params) {
-            ty_param_tys += vec(ty::mk_param(cx.tcx, i));
+            ty_param_tys += [ty::mk_param(cx.tcx, i)];
             i += 1u;
         }
 
@@ -636,10 +636,10 @@ mod collect {
                 // should be called to resolve named types.
                 auto f = bind getter(cx, _);
 
-                let vec[arg] args = vec();
+                let vec[arg] args = [];
                 for (ast::variant_arg va in variant.node.args) {
                     auto arg_ty = ast_ty_to_ty(cx.tcx, f, va.ty);
-                    args += vec(rec(mode=ty::mo_alias, ty=arg_ty));
+                    args += [rec(mode=ty::mo_alias, ty=arg_ty)];
                 }
                 auto tag_t = ty::mk_tag(cx.tcx, tag_id, ty_param_tys);
                 result_ty = ty::mk_fn(cx.tcx, ast::proto_fn, args, tag_t);
@@ -653,7 +653,7 @@ mod collect {
             );
             write_type_only(cx.node_types, ast::ann_tag(variant.node.ann),
                             result_ty);
-            result += vec(fold::respan(variant.span, variant_t));
+            result += [fold::respan(variant.span, variant_t)];
         }
 
         ret result;
@@ -750,7 +750,7 @@ mod collect {
                     case (none[@ast::method]) { /* nothing to do */ }
                     case (some[@ast::method](?m)) {
                         // TODO: typechecker botch
-                        let vec[arg] no_args = vec();
+                        let vec[arg] no_args = [];
                         auto t = ty::mk_fn(cx.tcx, ast::proto_fn, no_args,
                                            ty::mk_nil(cx.tcx));
                         write_type_only(cx.node_types,
@@ -795,7 +795,7 @@ mod collect {
         auto id_to_ty_item = @common::new_def_hash[any_item]();
 
         let vec[mutable option::t[ty::ty_param_substs_opt_and_ty]] ntt_sub =
-            vec(mutable);
+            [mutable];
         let node_type_table ntt = @mutable ntt_sub;
 
         auto visit = rec(
@@ -837,7 +837,7 @@ mod unify {
               &ty::t actual) -> ty::unify::result {
         // FIXME: horrid botch
         let vec[mutable ty::t] param_substs =
-            vec(mutable ty::mk_nil(fcx.ccx.tcx));
+            [mutable ty::mk_nil(fcx.ccx.tcx)];
         _vec::pop(param_substs);
         ret with_params(fcx, expected, actual, param_substs);
     }
@@ -884,9 +884,9 @@ mod unify {
                 }
 
                 // TODO: "freeze"
-                let vec[ty::t] param_substs_1 = vec();
+                let vec[ty::t] param_substs_1 = [];
                 for (ty::t subst in param_substs) {
-                    param_substs_1 += vec(subst);
+                    param_substs_1 += [subst];
                 }
 
                 unified_type =
@@ -968,13 +968,13 @@ type ty_param_substs_and_ty = tup(vec[ty::t], ty::t);
 mod Demand {
     fn simple(&@fn_ctxt fcx, &span sp, &ty::t expected, &ty::t actual)
         -> ty::t {
-        let vec[ty::t] tps = vec();
+        let vec[ty::t] tps = [];
         ret full(fcx, sp, expected, actual, tps, NO_AUTODEREF)._1;
     }
 
     fn autoderef(&@fn_ctxt fcx, &span sp, &ty::t expected, &ty::t actual,
                  autoderef_kind adk) -> ty::t {
-        let vec[ty::t] tps = vec();
+        let vec[ty::t] tps = [];
         ret full(fcx, sp, expected, actual, tps, adk)._1;
     }
 
@@ -996,18 +996,18 @@ mod Demand {
         }
 
         let vec[mutable ty::t] ty_param_substs =
-            vec(mutable ty::mk_nil(fcx.ccx.tcx));
+            [mutable ty::mk_nil(fcx.ccx.tcx)];
         _vec::pop(ty_param_substs);   // FIXME: horrid botch
         for (ty::t ty_param_subst in ty_param_substs_0) {
-            ty_param_substs += vec(mutable ty_param_subst);
+            ty_param_substs += [mutable ty_param_subst];
         }
 
         alt (unify::with_params(fcx, expected_1, actual_1, ty_param_substs)) {
             case (ures_ok(?t)) {
                 // TODO: Use "freeze", when we have it.
-                let vec[ty::t] result_ty_param_substs = vec();
+                let vec[ty::t] result_ty_param_substs = [];
                 for (ty::t ty_param_subst in ty_param_substs) {
-                    result_ty_param_substs += vec(ty_param_subst);
+                    result_ty_param_substs += [ty_param_subst];
                 }
 
                 ret tup(result_ty_param_substs,
@@ -1042,7 +1042,7 @@ fn variant_arg_types(&@crate_ctxt ccx, &span sp, &ast::def_id vid,
                      &vec[ty::t] tag_ty_params) -> vec[ty::t] {
     auto ty_param_count = _vec::len[ty::t](tag_ty_params);
 
-    let vec[ty::t] result = vec();
+    let vec[ty::t] result = [];
 
     auto tpt = ty::lookup_item_type(ccx.sess, ccx.tcx, ccx.type_cache, vid);
     alt (struct(ccx.tcx, tpt._1)) {
@@ -1052,7 +1052,7 @@ fn variant_arg_types(&@crate_ctxt ccx, &span sp, &ast::def_id vid,
                 auto arg_ty = bind_params_in_type(ccx.tcx, arg.ty);
                 arg_ty = substitute_ty_params(ccx, arg_ty, ty_param_count,
                                               tag_ty_params, sp);
-                result += vec(arg_ty);
+                result += [arg_ty];
             }
         }
         case (_) {
@@ -1163,11 +1163,11 @@ mod Pushdown {
 
                 auto t = Demand::simple(fcx, e.span, expected,
                                        ann_to_type(fcx.ccx.node_types, ann));
-                let vec[@ast::expr] es_1 = vec();
+                let vec[@ast::expr] es_1 = [];
                 alt (struct(fcx.ccx.tcx, t)) {
                     case (ty::ty_vec(?mt)) {
                         for (@ast::expr e_0 in es_0) {
-                            es_1 += vec(pushdown_expr(fcx, mt.ty, e_0));
+                            es_1 += [pushdown_expr(fcx, mt.ty, e_0)];
                         }
                     }
                     case (_) {
@@ -1182,14 +1182,14 @@ mod Pushdown {
             case (ast::expr_tup(?es_0, ?ann)) {
                 auto t = Demand::simple(fcx, e.span, expected,
                                        ann_to_type(fcx.ccx.node_types, ann));
-                let vec[ast::elt] elts_1 = vec();
+                let vec[ast::elt] elts_1 = [];
                 alt (struct(fcx.ccx.tcx, t)) {
                     case (ty::ty_tup(?mts)) {
                         auto i = 0u;
                         for (ast::elt elt_0 in es_0) {
                             auto e_1 = pushdown_expr(fcx, mts.(i).ty,
                                                      elt_0.expr);
-                            elts_1 += vec(rec(mut=elt_0.mut, expr=e_1));
+                            elts_1 += [rec(mut=elt_0.mut, expr=e_1)];
                             i += 1u;
                         }
                     }
@@ -1207,7 +1207,7 @@ mod Pushdown {
 
                 auto t = Demand::simple(fcx, e.span, expected,
                                        ann_to_type(fcx.ccx.node_types, ann));
-                let vec[ast::field] fields_1 = vec();
+                let vec[ast::field] fields_1 = [];
                 alt (struct(fcx.ccx.tcx, t)) {
                     case (ty::ty_rec(?field_mts)) {
                         alt (base_0) {
@@ -1220,9 +1220,9 @@ mod Pushdown {
                                         pushdown_expr(fcx,
                                                       field_mts.(i).mt.ty,
                                                       field_0.expr);
-                                    fields_1 += vec(rec(mut=field_0.mut,
+                                    fields_1 += [rec(mut=field_0.mut,
                                                         ident=field_0.ident,
-                                                        expr=e_1));
+                                                        expr=e_1)];
                                     i += 1u;
                                 }
                             }
@@ -1231,7 +1231,7 @@ mod Pushdown {
                                 base_1 = some[@ast::expr]
                                     (pushdown_expr(fcx, t, bx));
 
-                                let vec[field] base_fields = vec();
+                                let vec[field] base_fields = [];
 
                                 for (ast::field field_0 in fields_0) {
 
@@ -1242,9 +1242,9 @@ mod Pushdown {
                                                 pushdown_expr(fcx, ft.mt.ty,
                                                               field_0.expr);
                                             fields_1 +=
-                                                vec(rec(mut=field_0.mut,
+                                                [rec(mut=field_0.mut,
                                                         ident=field_0.ident,
-                                                        expr=e_1));
+                                                        expr=e_1)];
                                         }
                                     }
                                 }
@@ -1479,13 +1479,13 @@ mod Pushdown {
 
             case (ast::expr_alt(?discrim, ?arms_0, ?ann)) {
                 auto t = expected;
-                let vec[ast::arm] arms_1 = vec();
+                let vec[ast::arm] arms_1 = [];
                 for (ast::arm arm_0 in arms_0) {
                     auto block_1 = pushdown_block(fcx, expected, arm_0.block);
                     t = Demand::simple(fcx, e.span, t,
                         block_ty(fcx.ccx.tcx, fcx.ccx.node_types, block_1));
                     auto arm_1 = rec(pat=arm_0.pat, block=block_1);
-                    arms_1 += vec(arm_1);
+                    arms_1 += [arm_1];
                 }
                 e_1 = ast::expr_alt(discrim, arms_1,
                                     triv_ann(ast::ann_tag(ann), t));
@@ -1848,13 +1848,13 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
         auto f_0 = check_expr(fcx, f);
 
         // Check the arguments and generate the argument signature.
-        let vec[option::t[@ast::expr]] args_0 = vec();
-        let vec[arg] arg_tys_0 = vec();
+        let vec[option::t[@ast::expr]] args_0 = [];
+        let vec[arg] arg_tys_0 = [];
         for (option::t[@ast::expr] a_opt in args) {
             alt (a_opt) {
                 case (some[@ast::expr](?a)) {
                     auto a_0 = check_expr(fcx, a);
-                    args_0 += vec(some[@ast::expr](a_0));
+                    args_0 += [some[@ast::expr](a_0)];
 
                     auto arg_ty = rec(mode=mo_either,
                                       ty=expr_ty(fcx.ccx.tcx,
@@ -1862,7 +1862,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
                     _vec::push[arg](arg_tys_0, arg_ty);
                 }
                 case (none[@ast::expr]) {
-                    args_0 += vec(none[@ast::expr]);
+                    args_0 += [none[@ast::expr]];
 
                     auto typ = next_ty_var(fcx.ccx);
                     _vec::push[arg](arg_tys_0, rec(mode=mo_either, ty=typ));
@@ -1920,18 +1920,18 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
     fn check_call(&@fn_ctxt fcx, &@ast::expr f, &vec[@ast::expr] args)
         -> tup(@ast::expr, vec[@ast::expr]) {
 
-        let vec[option::t[@ast::expr]] args_opt_0 = vec();
+        let vec[option::t[@ast::expr]] args_opt_0 = [];
         for (@ast::expr arg in args) {
-            args_opt_0 += vec(some[@ast::expr](arg));
+            args_opt_0 += [some[@ast::expr](arg)];
         }
 
         // Call the generic checker.
         auto result = check_call_or_bind(fcx, f, args_opt_0);
 
         // Pull out the arguments.
-        let vec[@ast::expr] args_1 = vec();
+        let vec[@ast::expr] args_1 = [];
         for (option::t[@ast::expr] arg in result._1) {
-            args_1 += vec(option::get[@ast::expr](arg));
+            args_1 += [option::get[@ast::expr](arg)];
         }
 
         ret tup(result._0, args_1);
@@ -2397,12 +2397,12 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
             auto pattern_ty = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types,
                                       expr_0);
 
-            let vec[@ast::pat] pats = vec();
+            let vec[@ast::pat] pats = [];
             for (ast::arm arm in arms) {
                 check_pat(fcx, arm.pat);
                 pattern_ty = Demand::simple(fcx, arm.pat.span, pattern_ty,
                     pat_ty(fcx.ccx.tcx, fcx.ccx.node_types, arm.pat));
-                pats += vec(arm.pat);
+                pats += [arm.pat];
             }
 
             for (@ast::pat pat in pats) {
@@ -2412,15 +2412,15 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
             // Now typecheck the blocks.
             auto result_ty = next_ty_var(fcx.ccx);
 
-            let vec[ast::block] blocks_0 = vec();
+            let vec[ast::block] blocks_0 = [];
             for (ast::arm arm in arms) {
                 auto block_0 = check_block(fcx, arm.block);
                 result_ty = Demand::simple(fcx, block_0.span, result_ty,
                     block_ty(fcx.ccx.tcx, fcx.ccx.node_types, block_0));
-                blocks_0 += vec(block_0);
+                blocks_0 += [block_0];
             }
 
-            let vec[ast::arm] arms_1 = vec();
+            let vec[ast::arm] arms_1 = [];
             auto i = 0u;
             for (ast::block block_0 in blocks_0) {
                 auto block_1 = Pushdown::pushdown_block(fcx, result_ty,
@@ -2428,7 +2428,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
                 auto pat = pats.(i);
                 auto arm = arms.(i);
                 auto arm_1 = rec(pat=pat, block=block_1);
-                arms_1 += vec(arm_1);
+                arms_1 += [arm_1];
                 i += 1u;
             }
 
@@ -2464,7 +2464,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
 
             // Pull the argument and return types out.
             auto proto_1;
-            let vec[ty::arg] arg_tys_1 = vec();
+            let vec[ty::arg] arg_tys_1 = [];
             auto rt_1;
             alt (struct(fcx.ccx.tcx, expr_ty(fcx.ccx.tcx, fcx.ccx.node_types,
                                              result._0))) {
@@ -2479,7 +2479,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
                         alt (args.(i)) {
                             case (some[@ast::expr](_)) { /* no-op */ }
                             case (none[@ast::expr]) {
-                                arg_tys_1 += vec(arg_tys.(i));
+                                arg_tys_1 += [arg_tys.(i)];
                             }
                         }
                         i += 1u;
@@ -2624,7 +2624,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
         }
 
         case (ast::expr_vec(?args, ?mut, ?a)) {
-            let vec[@ast::expr] args_1 = vec();
+            let vec[@ast::expr] args_1 = [];
 
             let ty::t t;
             if (_vec::len[@ast::expr](args) == 0u) {
@@ -2650,15 +2650,15 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
         }
 
         case (ast::expr_tup(?elts, ?a)) {
-            let vec[ast::elt] elts_1 = vec();
-            let vec[ty::mt] elts_mt = vec();
+            let vec[ast::elt] elts_1 = [];
+            let vec[ty::mt] elts_mt = [];
 
             for (ast::elt e in elts) {
                 auto expr_1 = check_expr(fcx, e.expr);
                 auto expr_t = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types,
                                       expr_1);
                 _vec::push[ast::elt](elts_1, rec(expr=expr_1 with e));
-                elts_mt += vec(rec(ty=expr_t, mut=e.mut));
+                elts_mt += [rec(ty=expr_t, mut=e.mut)];
             }
 
             auto typ = ty::mk_tup(fcx.ccx.tcx, elts_mt);
@@ -2678,8 +2678,8 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
                 }
             }
 
-            let vec[ast::field] fields_1 = vec();
-            let vec[field] fields_t = vec();
+            let vec[ast::field] fields_1 = [];
+            let vec[field] fields_t = [];
 
             for (ast::field f in fields) {
                 auto expr_1 = check_expr(fcx, f.expr);
@@ -2705,7 +2705,7 @@ fn check_expr(&@fn_ctxt fcx, &@ast::expr expr) -> @ast::expr {
                     auto bexpr_t = expr_ty(fcx.ccx.tcx, fcx.ccx.node_types,
                                            bexpr_1);
 
-                    let vec[field] base_fields = vec();
+                    let vec[field] base_fields = [];
 
                     alt (struct(fcx.ccx.tcx, bexpr_t)) {
                         case (ty::ty_rec(?flds)) {
@@ -3000,7 +3000,7 @@ fn check_stmt(&@fn_ctxt fcx, &@ast::stmt stmt) -> @ast::stmt {
 }
 
 fn check_block(&@fn_ctxt fcx, &ast::block block) -> ast::block {
-    let vec[@ast::stmt] stmts = vec();
+    let vec[@ast::stmt] stmts = [];
     for (@ast::stmt s in block.node.stmts) {
         _vec::push[@ast::stmt](stmts, check_stmt(fcx, s));
     }
@@ -3093,10 +3093,10 @@ fn check_item_fn(&@crate_ctxt ccx, &span sp, &ast::ident ident, &ast::_fn f,
     // and return type translated to typeck::ty values. We don't need do to it
     // again here, we can extract them.
 
-    let vec[arg] inputs = vec();
+    let vec[arg] inputs = [];
     for (ast::arg arg in f.decl.inputs) {
         auto input_ty = ast_ty_to_ty_crate(ccx, arg.ty);
-        inputs += vec(rec(mode=ast_mode_to_mode(arg.mode), ty=input_ty));
+        inputs += [rec(mode=ast_mode_to_mode(arg.mode), ty=input_ty)];
     }
 
     auto output_ty = ast_ty_to_ty_crate(ccx, f.decl.output);
@@ -3182,7 +3182,7 @@ fn check_crate(&ty::ctxt tcx, &@ast::crate crate) -> typecheck_result {
     auto sess = tcx.sess;
     auto result = collect::collect_item_types(sess, tcx, crate);
 
-    let vec[ast::obj_field] fields = vec();
+    let vec[ast::obj_field] fields = [];
 
     auto hasher = hash_unify_cache_entry;
     auto eqer = eq_unify_cache_entry;
diff --git a/src/comp/middle/typestate_check.rs b/src/comp/middle/typestate_check.rs
index c12d02737da..4e89863e43f 100644
--- a/src/comp/middle/typestate_check.rs
+++ b/src/comp/middle/typestate_check.rs
@@ -797,10 +797,10 @@ fn find_pre_post_loop(&def_map dm, &fn_info_map fm, &fn_info enclosing,
     find_pre_post_expr(dm, fm, enclosing, index);
     find_pre_post_block(dm, fm, enclosing, body);
     auto loop_precond = declare_var(enclosing, decl_lhs(d),
-           seq_preconds(enclosing, vec(expr_pp(index),
-                                       block_pp(body))));
+           seq_preconds(enclosing, [expr_pp(index),
+                                       block_pp(body)]));
     auto loop_postcond = intersect_postconds
-        (vec(expr_postcond(index), block_postcond(body)));
+        ([expr_postcond(index), block_postcond(body)]);
     set_pre_and_post(a, rec(precondition=loop_precond,
                             postcondition=loop_postcond));
 }
@@ -897,7 +897,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
             }
             // doesn't check that lhs is an lval, but
             // that's probably ok
-            find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a);
+            find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a);
         }
         case (expr_recv(?lhs, ?rhs, ?a)) {
             alt (lhs.node) {
@@ -918,12 +918,12 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
             }
             // doesn't check that lhs is an lval, but
             // that's probably ok
-            find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a);
+            find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a);
         }
         case (expr_assign_op(_, ?lhs, ?rhs, ?a)) {
             /* Different from expr_assign in that the lhs *must*
                already be initialized */
-            find_pre_post_exprs(dm, fm, enclosing, vec(lhs, rhs), a);
+            find_pre_post_exprs(dm, fm, enclosing, [lhs, rhs], a);
         }
         case (expr_lit(_,?a)) {
             set_pre_and_post(a, empty_pre_post(num_local_vars));
@@ -955,8 +955,8 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
             alt (maybe_alt) {
                 case (none[@expr]) {
                     auto precond_res = seq_preconds(enclosing,
-                                                    vec(expr_pp(antec),
-                                                        block_pp(conseq)));
+                                                    [expr_pp(antec),
+                                                        block_pp(conseq)]);
                     set_pre_and_post(a, rec(precondition=precond_res,
                                             postcondition=
                                             expr_poststate(antec)));
@@ -965,21 +965,21 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
                     find_pre_post_expr(dm, fm, enclosing, altern);
                     auto precond_true_case =
                         seq_preconds(enclosing,
-                                     vec(expr_pp(antec), block_pp(conseq)));
+                                     [expr_pp(antec), block_pp(conseq)]);
                     auto postcond_true_case = union_postconds
                         (num_local_vars,
-                         vec(expr_postcond(antec), block_postcond(conseq)));
+                         [expr_postcond(antec), block_postcond(conseq)]);
                     auto precond_false_case = seq_preconds
                         (enclosing,
-                         vec(expr_pp(antec), expr_pp(altern)));
+                         [expr_pp(antec), expr_pp(altern)]);
                     auto postcond_false_case = union_postconds
                         (num_local_vars,
-                         vec(expr_postcond(antec), expr_postcond(altern)));
+                         [expr_postcond(antec), expr_postcond(altern)]);
                     auto precond_res = union_postconds
                         (num_local_vars,
-                         vec(precond_true_case, precond_false_case));
+                         [precond_true_case, precond_false_case]);
                     auto postcond_res = intersect_postconds
-                        (vec(postcond_true_case, postcond_false_case));
+                        ([postcond_true_case, postcond_false_case]);
                     set_pre_and_post(a, rec(precondition=precond_res,
                                             postcondition=postcond_res));
                 }
@@ -988,10 +988,10 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
         case (expr_binary(?bop,?l,?r,?a)) {
             /* *unless* bop is lazy (e.g. and, or)? 
              FIXME */
-            find_pre_post_exprs(dm, fm, enclosing, vec(l, r), a);
+            find_pre_post_exprs(dm, fm, enclosing, [l, r], a);
         }
         case (expr_send(?l, ?r, ?a)) {
-            find_pre_post_exprs(dm, fm, enclosing, vec(l, r), a);
+            find_pre_post_exprs(dm, fm, enclosing, [l, r], a);
         }
         case (expr_unary(_,?operand,?a)) {
             find_pre_post_expr(dm, fm, enclosing, operand);
@@ -1007,18 +1007,18 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
             set_pre_and_post(a,
               rec(precondition=
                   seq_preconds(enclosing,
-                                 vec(expr_pp(test), 
-                                     block_pp(body))),
+                                 [expr_pp(test), 
+                                     block_pp(body)]),
                   postcondition=
-                  intersect_postconds(vec(expr_postcond(test),
-                                          block_postcond(body)))));
+                  intersect_postconds([expr_postcond(test),
+                                          block_postcond(body)])));
         }
         case (expr_do_while(?body, ?test, ?a)) {
             find_pre_post_block(dm, fm, enclosing, body);
             find_pre_post_expr(dm, fm, enclosing, test);
    
             auto loop_postcond = union_postconds(num_local_vars,
-                            vec(block_postcond(body), expr_postcond(test)));
+                            [block_postcond(body), expr_postcond(test)]);
             /* conservative approximination: if the body
                could break or cont, the test may never be executed */
             if (has_nonlocal_exits(body)) {
@@ -1027,8 +1027,8 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
 
             set_pre_and_post(a, 
                              rec(precondition=seq_preconds(enclosing,
-                                             vec(block_pp(body),
-                                                 expr_pp(test))),
+                                             [block_pp(body),
+                                                 expr_pp(test)]),
                    postcondition=loop_postcond));
         }
         case (expr_for(?d, ?index, ?body, ?a)) {
@@ -1038,7 +1038,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
             find_pre_post_loop(dm, fm, enclosing, d, index, body, a);
         }
         case (expr_index(?e, ?sub, ?a)) {
-            find_pre_post_exprs(dm, fm, enclosing, vec(e, sub), a);
+            find_pre_post_exprs(dm, fm, enclosing, [e, sub], a);
         }
         case (expr_alt(?e, ?alts, ?a)) {
             find_pre_post_expr(dm, fm, enclosing, e);
@@ -1053,7 +1053,7 @@ fn find_pre_post_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
                           fn_info enclosing, &pre_and_post pp,
                           &pre_and_post next) -> pre_and_post {
                 union(pp.precondition, seq_preconds(enclosing,
-                                         vec(antec, next)));
+                                         [antec, next]));
                 intersect(pp.postcondition, next.postcondition);
                 ret pp;
             }
@@ -1214,7 +1214,7 @@ fn find_pre_post_block(&def_map dm, &fn_info_map fm, &fn_info enclosing,
     auto do_inner = bind do_inner_(dm, fm, enclosing, _);
     option::map[@expr, ()](do_inner, b.node.expr);
 
-    let vec[pre_and_post] pps = vec();
+    let vec[pre_and_post] pps = [];
 
     fn get_pp_stmt(&@stmt s) -> pre_and_post {
         ret stmt_pp(*s);
@@ -1408,8 +1408,8 @@ fn find_pre_post_state_loop(&def_map dm, &fn_info_map fm, &fn_info enclosing,
        (poststate of index, poststate of body) */
     changed = find_pre_post_state_block(dm, fm, enclosing,
                 expr_poststate(index), body) || changed;
-    auto res_p = intersect_postconds(vec(expr_poststate(index),
-                                         block_poststate(body)));
+    auto res_p = intersect_postconds([expr_poststate(index),
+                                         block_poststate(body)]);
   
     changed = extend_poststate_ann(a, res_p) || changed;
     ret changed;
@@ -1603,7 +1603,7 @@ fn find_pre_post_state_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
                 changed = find_pre_post_state_expr(dm, fm, enclosing,
                    expr_poststate(antec), altern) || changed;
                 auto poststate_res = intersect_postconds
-                    (vec(block_poststate(conseq), expr_poststate(altern)));
+                    ([block_poststate(conseq), expr_poststate(altern)]);
                 changed = extend_poststate_ann(a, poststate_res) || changed;
             }
         }
@@ -1660,8 +1660,8 @@ fn find_pre_post_state_expr(&def_map dm, &fn_info_map fm, &fn_info enclosing,
         changed = find_pre_post_state_block(dm, fm, 
                    enclosing, expr_poststate(test), body) || changed; 
         changed = extend_poststate_ann(a,
-                    intersect_postconds(vec(expr_poststate(test),
-                                        block_poststate(body)))) || changed;
+                    intersect_postconds([expr_poststate(test),
+                                        block_poststate(body)])) || changed;
         ret changed;
     }
     case (expr_do_while(?body, ?test, ?a)) {
@@ -2335,7 +2335,7 @@ fn annotate_stmt(&fn_info_map fm, &@stmt s) -> @stmt {
     }
 }
 fn annotate_block(&fn_info_map fm, &block b) -> block {
-    let vec[@stmt] new_stmts = vec();
+    let vec[@stmt] new_stmts = [];
 
     for (@stmt s in b.node.stmts) {
         auto new_s = annotate_stmt(fm, s);
@@ -2357,7 +2357,7 @@ fn annotate_fn(&fn_info_map fm, &ast::_fn f) -> ast::_fn {
     ret rec(body=annotate_block(fm, f.body) with f);
 }
 fn annotate_mod(&fn_info_map fm, &ast::_mod m) -> ast::_mod {
-    let vec[@item] new_items = vec();
+    let vec[@item] new_items = [];
 
     for (@item i in m.items) {
         auto new_i = annotate_item(fm, i);
@@ -2470,7 +2470,7 @@ fn annotate_item(&fn_info_map fm, &@ast::item item) -> @ast::item {
 }
 
 fn annotate_module(&fn_info_map fm, &ast::_mod module) -> ast::_mod {
-    let vec[@item] new_items = vec();
+    let vec[@item] new_items = [];
 
     for (@item i in module.items) {
         auto new_item = annotate_item(fm, i);
diff --git a/src/comp/pretty/pp.rs b/src/comp/pretty/pp.rs
index aff0843d27d..45b555439cd 100644
--- a/src/comp/pretty/pp.rs
+++ b/src/comp/pretty/pp.rs
@@ -31,9 +31,9 @@ type ps = @rec(mutable vec[context] context,
                mutable bool potential_brk);
 
 fn mkstate(io::writer out, uint width) -> ps {
-  let vec[context] stack = vec(rec(tp=cx_v, indent=0u));
-  let vec[token] buff = vec();
-  let vec[boxtype] sd = vec();
+  let vec[context] stack = [rec(tp=cx_v, indent=0u)];
+  let vec[token] buff = [];
+  let vec[boxtype] sd = [];
   ret @rec(mutable context=stack,
            width=width,
            out=out,
@@ -81,7 +81,7 @@ fn direct_token(ps p, token tok) {
 }
 
 fn buffer_token(ps p, token tok) {
-  p.buffered += vec(tok);
+  p.buffered += [tok];
   auto col = p.scancol;
   p.scancol = col + token_size(tok);
   if (p.scancol > p.width) {
@@ -140,13 +140,13 @@ fn finish_scan(ps p, bool fits) {
       push_context(p, cx_h, base_indent(p) + ind);
     }
   }
-  p.scandepth = vec();
+  p.scandepth = [];
   p.scanning = scan_none;
   for (token t in buf) { add_token(p, t); }
 }
 
 fn start_scan(ps p, token tok, scantype tp) {
-  p.buffered = vec();
+  p.buffered = [];
   p.scancol = p.col;
   p.scanning = tp;
   buffer_token(p, tok);
diff --git a/src/comp/pretty/pprust.rs b/src/comp/pretty/pprust.rs
index c7c4fba36d3..a6ab26dc618 100644
--- a/src/comp/pretty/pprust.rs
+++ b/src/comp/pretty/pprust.rs
@@ -307,7 +307,7 @@ fn print_item(ps s, @ast::item item) {
             bopen(s);
             for (@ast::method meth in _obj.methods) {
                 hbox(s);
-                let vec[ast::ty_param] typarams = vec();
+                let vec[ast::ty_param] typarams = [];
                 maybe_print_comment(s, meth.span.lo);
                 print_fn(s, meth.node.meth.decl, meth.node.ident, typarams);
                 space(s.s);
@@ -360,7 +360,7 @@ fn print_literal(ps s, @ast::lit lit) {
     alt (lit.node) {
         case (ast::lit_str(?st)) {print_string(s, st);}
         case (ast::lit_char(?ch)) {
-            wrd(s.s, "'" + escape_str(_str::from_bytes(vec(ch as u8)), '\'')
+            wrd(s.s, "'" + escape_str(_str::from_bytes([ch as u8]), '\'')
                 + "'");
         }
         case (ast::lit_int(?val)) {
diff --git a/src/comp/util/interner.rs b/src/comp/util/interner.rs
index a9bf9bc4e33..59426664b4a 100644
--- a/src/comp/util/interner.rs
+++ b/src/comp/util/interner.rs
@@ -20,7 +20,7 @@ type interner[T] = rec(
 
 fn mk_interner[T](hashfn[T] hasher, eqfn[T] eqer) -> interner[T] {
     auto m = map::mk_hashmap[T,uint](hasher, eqer);
-    let vec[T] vect = vec();
+    let vec[T] vect = [];
     ret rec(map=m, mutable vect=vect, hasher=hasher, eqer=eqer);
 }
 
@@ -30,7 +30,7 @@ fn intern[T](&interner[T] itr, &T val) -> uint {
         case (none[uint]) {
             auto new_idx = _vec::len[T](itr.vect);
             itr.map.insert(val, new_idx);
-            itr.vect += vec(val);
+            itr.vect += [val];
             ret new_idx;
         }
     }
diff --git a/src/lib/_str.rs b/src/lib/_str.rs
index 36b2376d4db..1ab1b014410 100644
--- a/src/lib/_str.rs
+++ b/src/lib/_str.rs
@@ -141,7 +141,7 @@ fn unsafe_from_bytes(vec[mutable? u8] v) -> str {
 }
 
 fn unsafe_from_byte(u8 u) -> str {
-    ret rustrt::str_from_vec(vec(u));
+    ret rustrt::str_from_vec([u]);
 }
 
 fn str_from_cstr(sbuf cstr) -> str {
@@ -248,7 +248,7 @@ fn char_len(str s) -> uint {
 }
 
 fn to_chars(str s) -> vec[char] {
-    let vec[char] buf = vec();
+    let vec[char] buf = [];
     auto i = 0u;
     auto len = byte_len(s);
     while (i < len) {
@@ -419,12 +419,12 @@ fn unshift_byte(&mutable str s, u8 b) {
 }
 
 fn split(str s, u8 sep) -> vec[str] {
-    let vec[str] v = vec();
+    let vec[str] v = [];
     let str accum = "";
     let bool ends_with_sep = false;
     for (u8 c in s) {
         if (c == sep) {
-            v += vec(accum);
+            v += [accum];
             accum = "";
             ends_with_sep = true;
         } else {
@@ -434,7 +434,7 @@ fn split(str s, u8 sep) -> vec[str] {
     }
     if (_str::byte_len(accum) != 0u ||
         ends_with_sep) {
-        v += vec(accum);
+        v += [accum];
     }
     ret v;
 }
@@ -486,5 +486,5 @@ fn to_upper(str s) -> str {
 // indent-tabs-mode: nil
 // c-basic-offset: 4
 // buffer-file-coding-system: utf-8-unix
-// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
+// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
 // End:
diff --git a/src/lib/_vec.rs b/src/lib/_vec.rs
index 0988864a160..70446e0f39f 100644
--- a/src/lib/_vec.rs
+++ b/src/lib/_vec.rs
@@ -75,7 +75,7 @@ fn init_fn[T](&init_op[T] op, uint n_elts) -> vec[T] {
     let vec[T] v = alloc[T](n_elts);
     let uint i = 0u;
     while (i < n_elts) {
-        v += vec(op(i));
+        v += [op(i)];
         i += 1u;
     }
     ret v;
@@ -85,7 +85,7 @@ fn init_fn_mut[T](&init_op[T] op, uint n_elts) -> vec[mutable T] {
     let vec[mutable T] v = alloc_mut[T](n_elts);
     let uint i = 0u;
     while (i < n_elts) {
-        v += vec(mutable op(i));
+        v += [mutable op(i)];
         i += 1u;
     }
     ret v;
@@ -103,7 +103,7 @@ fn init_elt[T](&T t, uint n_elts) -> vec[T] {
     let uint i = n_elts;
     while (i > 0u) {
         i -= 1u;
-        v += vec(t);
+        v += [t];
     }
     ret v;
 }
@@ -113,7 +113,7 @@ fn init_elt_mut[T](&T t, uint n_elts) -> vec[mutable T] {
     let uint i = n_elts;
     while (i > 0u) {
         i -= 1u;
-        v += vec(mutable t);
+        v += [mutable t];
     }
     ret v;
 }
@@ -156,7 +156,7 @@ fn slice[T](array[T] v, uint start, uint end) -> vec[T] {
     auto result = alloc[T](end - start);
     let uint i = start;
     while (i < end) {
-        result += vec(v.(i));
+        result += [v.(i)];
         i += 1u;
     }
     ret result;
@@ -180,12 +180,12 @@ fn pop[T](&mutable array[T] v) -> T {
 }
 
 fn push[T](&mutable array[T] v, &T t) {
-    v += vec(t);
+    v += [t];
 }
 
 fn unshift[T](&mutable array[T] v, &T t) {
     auto res = alloc[T](len[T](v) + 1u);
-    res += vec(t);
+    res += [t];
     res += v;
     v = res;
 }
@@ -194,7 +194,7 @@ fn grow[T](&array[T] v, uint n, &T initval) {
     let uint i = n;
     while (i > 0u) {
         i -= 1u;
-        v += vec(initval);
+        v += [initval];
     }
 }
 
@@ -209,7 +209,7 @@ fn grow_set[T](&vec[mutable T] v, uint index, &T initval, &T val) {
 fn map[T, U](&option::operator[T,U] f, &array[T] v) -> vec[U] {
     let vec[U] u = alloc[U](len[T](v));
     for (T ve in v) {
-        u += vec(f(ve));
+        u += [f(ve)];
     }
     ret u;
 }
@@ -223,7 +223,7 @@ fn map2[T,U,V](&operator2[T,U,V] f, &array[T] v0, &array[U] v1) -> vec[V] {
     let vec[V] u = alloc[V](v0_len);
     auto i = 0u;
     while (i < v0_len) {
-        u += vec(f(v0.(i), v1.(i)));
+        u += [f(v0.(i), v1.(i))];
         i += 1u;
     }
 
@@ -262,8 +262,8 @@ fn unzip[T, U](&vec[tup(T, U)] v) -> tup(vec[T], vec[U]) {
     else {
         auto rest = slice[tup(T, U)](v, 1u, sz);
         auto tl   = unzip[T, U](rest);
-        auto a    = vec(v.(0)._0);
-        auto b    = vec(v.(0)._1);
+        auto a    = [v.(0)._0];
+        auto b    = [v.(0)._1];
         ret tup(a + tl._0, b + tl._1);
     }
 }
@@ -280,18 +280,18 @@ fn clone[T](&vec[T] v) -> vec[T] {
 fn plus_option[T](&vec[T] v, &option::t[T] o) -> () {
     alt (o) {
         case (none[T]) {}
-        case (some[T](?x)) { v += vec(x); }
+        case (some[T](?x)) { v += [x]; }
     }
 }
 
 fn cat_options[T](&vec[option::t[T]] v) -> vec[T] {
-    let vec[T] res = vec();
+    let vec[T] res = [];
 
     for (option::t[T] o in v) {
         alt (o) {
             case (none[T]) { }
             case (some[T](?t)) {
-                res += vec(t);
+                res += [t];
             }
         }
     }
@@ -301,9 +301,9 @@ fn cat_options[T](&vec[option::t[T]] v) -> vec[T] {
 
 // TODO: Remove in favor of built-in "freeze" operation when it's implemented.
 fn freeze[T](vec[mutable T] v) -> vec[T] {
-    let vec[T] result = vec();
+    let vec[T] result = [];
     for (T elem in v) {
-        result += vec(elem);
+        result += [elem];
     }
     ret result;
 }
diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs
index 1b4528a44a9..f34ce56524e 100644
--- a/src/lib/bitv.rs
+++ b/src/lib/bitv.rs
@@ -217,6 +217,6 @@ fn eq_vec(&t v0, &vec[uint] v1) -> bool {
 // indent-tabs-mode: nil
 // c-basic-offset: 4
 // buffer-file-coding-system: utf-8-unix
-// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
+// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
 // End:
 //
diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs
index 0efb05b83c3..0a5831d7333 100644
--- a/src/lib/ebml.rs
+++ b/src/lib/ebml.rs
@@ -122,22 +122,22 @@ fn write_sized_vint(&io::buf_writer w, uint n, uint size) {
     let vec[u8] buf;
     alt (size) {
         case (1u) {
-            buf = vec(0x80u8 | (n as u8));
+            buf = [0x80u8 | (n as u8)];
         }
         case (2u) {
-            buf = vec(0x40u8 | ((n >> 8u) as u8),
-                      (n & 0xffu) as u8);
+            buf = [0x40u8 | ((n >> 8u) as u8),
+                      (n & 0xffu) as u8];
         }
         case (3u) {
-            buf = vec(0x20u8 | ((n >> 16u) as u8),
+            buf = [0x20u8 | ((n >> 16u) as u8),
                       ((n >> 8u) & 0xffu) as u8,
-                      (n & 0xffu) as u8);
+                      (n & 0xffu) as u8];
         }
         case (4u) {
-            buf = vec(0x10u8 | ((n >> 24u) as u8),
+            buf = [0x10u8 | ((n >> 24u) as u8),
                       ((n >> 16u) & 0xffu) as u8,
                       ((n >> 8u) & 0xffu) as u8,
-                      (n & 0xffu) as u8);
+                      (n & 0xffu) as u8];
         }
         case (_) {
             log_err "vint to write too big";
@@ -158,7 +158,7 @@ fn write_vint(&io::buf_writer w, uint n) {
 }
 
 fn create_writer(&io::buf_writer w) -> writer {
-    let vec[uint] size_positions = vec();
+    let vec[uint] size_positions = [];
     ret rec(writer=w, mutable size_positions=size_positions);
 }
 
@@ -169,8 +169,8 @@ fn start_tag(&writer w, uint tag_id) {
     write_vint(w.writer, tag_id);
 
     // Write a placeholder four-byte size.
-    w.size_positions += vec(w.writer.tell());
-    let vec[u8] zeroes = vec(0u8, 0u8, 0u8, 0u8);
+    w.size_positions += [w.writer.tell()];
+    let vec[u8] zeroes = [0u8, 0u8, 0u8, 0u8];
     w.writer.write(zeroes);
 }
 
diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs
index 93d4d7de8d0..04c823c7cf1 100644
--- a/src/lib/extfmt.rs
+++ b/src/lib/extfmt.rs
@@ -79,14 +79,14 @@ mod ct {
     }
 
     fn parse_fmt_string(str s) -> vec[piece] {
-        let vec[piece] pieces = vec();
+        let vec[piece] pieces = [];
         auto lim = _str::byte_len(s);
         auto buf = "";
 
         fn flush_buf(str buf, &vec[piece] pieces) -> str {
             if (_str::byte_len(buf) > 0u) {
                 auto piece = piece_string(buf);
-                pieces += vec(piece);
+                pieces += [piece];
             }
             ret "";
         }
@@ -106,7 +106,7 @@ mod ct {
                 } else {
                     buf = flush_buf(buf, pieces);
                     auto res = parse_conversion(s, i, lim);
-                    pieces += vec(res._0);
+                    pieces += [res._0];
                     i = res._1;
                 }
             } else {
@@ -180,7 +180,7 @@ mod ct {
     }
 
     fn parse_flags(str s, uint i, uint lim) -> tup(vec[flag], uint) {
-        let vec[flag] noflags = vec();
+        let vec[flag] noflags = [];
 
         if (i >= lim) {
             ret tup(noflags, i);
@@ -190,7 +190,7 @@ mod ct {
             auto next = parse_flags(s, i + 1u, lim);
             auto rest = next._0;
             auto j = next._1;
-            let vec[flag] curr = vec(f);
+            let vec[flag] curr = [f];
             ret tup(curr + rest, j);
         }
 
@@ -539,7 +539,7 @@ mod rt {
                 || head == '-' as u8
                 || head == ' ' as u8) {
 
-                auto headstr = _str::unsafe_from_bytes(vec(head));
+                auto headstr = _str::unsafe_from_bytes([head]);
                 auto bytelen = _str::byte_len(s);
                 auto numpart = _str::substr(s, 1u, bytelen - 1u);
                 ret headstr + padstr + numpart;
@@ -793,7 +793,7 @@ mod RT {
                 || head == '-' as u8
                 || head == ' ' as u8) {
 
-                auto headstr = _str::unsafe_from_bytes(vec(head));
+                auto headstr = _str::unsafe_from_bytes([head]);
                 auto bytelen = _str::byte_len(s);
                 auto numpart = _str::substr(s, 1u, bytelen - 1u);
                 ret headstr + padstr + numpart;
diff --git a/src/lib/fs.rs b/src/lib/fs.rs
index a897576944b..c726fc0985c 100644
--- a/src/lib/fs.rs
+++ b/src/lib/fs.rs
@@ -36,7 +36,7 @@ fn list_dir(path p) -> vec[str] {
   if (pl == 0u || p.(pl - 1u) as char != os_fs::path_sep) {
     p += path_sep();
   }
-  let vec[str] full_paths = vec();
+  let vec[str] full_paths = [];
   for (str filename in os_fs::list_dir(p)) {
     if (!_str::eq(filename, ".")) {if (!_str::eq(filename, "..")) {
       _vec::push[str](full_paths, p + filename);
diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs
index c1bcaae30c5..a553b7e4128 100644
--- a/src/lib/getopts.rs
+++ b/src/lib/getopts.rs
@@ -106,7 +106,7 @@ fn getopts(vec[str] args, vec[opt] opts) -> result {
     fn empty_(uint x) -> vec[optval]{ret _vec::empty[optval]();}
     auto f = empty_;
     auto vals = _vec::init_fn_mut[vec[optval]](f, n_opts);
-    let vec[str] free = vec();
+    let vec[str] free = [];
 
     auto l = _vec::len[str](args);
     auto i = 0u;
@@ -125,15 +125,15 @@ fn getopts(vec[str] args, vec[opt] opts) -> result {
                 auto tail = _str::slice(cur, 2u, curlen);
                 auto eq = _str::index(tail, '=' as u8);
                 if (eq == -1) {
-                    names = vec(long(tail));
+                    names = [long(tail)];
                 } else {
-                    names = vec(long(_str::slice(tail, 0u, eq as uint)));
+                    names = [long(_str::slice(tail, 0u, eq as uint))];
                     i_arg = option::some[str]
                         (_str::slice(tail, (eq as uint) + 1u, curlen - 2u));
                 }
             } else {
                 auto j = 1u;
-                names = vec();
+                names = [];
                 while (j < curlen) {
                     auto range = _str::char_range_at(cur, j);
                     _vec::push[name](names, short(range._0));
@@ -221,7 +221,7 @@ fn opt_str(match m, str nm) -> str {
     }
 }
 fn opt_strs(match m, str nm) -> vec[str] {
-    let vec[str] acc = vec();
+    let vec[str] acc = [];
     for (optval v in opt_vals(m, nm)) {
         alt (v) {
             case (val(?s)) { _vec::push[str](acc, s); }
diff --git a/src/lib/io.rs b/src/lib/io.rs
index c996584f8f0..57675916f46 100644
--- a/src/lib/io.rs
+++ b/src/lib/io.rs
@@ -120,7 +120,7 @@ state obj new_reader(buf_reader rdr) {
         ret rdr.eof();
     }
     fn read_line() -> str {
-        let vec[u8] buf = vec();
+        let vec[u8] buf = [];
         // No break yet in rustc
         auto go_on = true;
         while (go_on) {
@@ -131,7 +131,7 @@ state obj new_reader(buf_reader rdr) {
         ret _str::unsafe_from_bytes(buf);
     }
     fn read_c_str() -> str {
-        let vec[u8] buf = vec();
+        let vec[u8] buf = [];
         auto go_on = true;
         while (go_on) {
             auto ch = rdr.read_byte();
@@ -172,7 +172,7 @@ state obj new_reader(buf_reader rdr) {
         ret val;
     }
     fn read_whole_stream() -> vec[u8] {
-        let vec[u8] buf = vec();
+        let vec[u8] buf = [];
         while (!rdr.eof()) {
             buf += rdr.read(2048u);
         }
@@ -366,9 +366,9 @@ type writer =
     };
 
 fn uint_to_le_bytes(uint n, uint size) -> vec[u8] {
-    let vec[u8] bytes = vec();
+    let vec[u8] bytes = [];
     while (size > 0u) {
-        bytes += vec((n & 255u) as u8);
+        bytes += [(n & 255u) as u8];
         n >>= 8u;
         size -= 1u;
     }
@@ -376,10 +376,10 @@ fn uint_to_le_bytes(uint n, uint size) -> vec[u8] {
 }
 
 fn uint_to_be_bytes(uint n, uint size) -> vec[u8] {
-    let vec[u8] bytes = vec();
+    let vec[u8] bytes = [];
     auto i = (size - 1u) as int;
     while (i >= 0) {
-        bytes += vec(((n >> ((i * 8) as uint)) & 255u) as u8);
+        bytes += [((n >> ((i * 8) as uint)) & 255u) as u8];
         i -= 1;
     }
     ret bytes;
@@ -466,7 +466,7 @@ state obj byte_buf_writer(mutable_byte_buf buf) {
         while (vpos < vlen) {
             auto b = v.(vpos);
             if (buf.pos == _vec::len(buf.buf)) {
-                buf.buf += vec(mutable b);
+                buf.buf += [mutable b];
             } else {
                 buf.buf.(buf.pos) = b;
             }
@@ -486,7 +486,7 @@ state obj byte_buf_writer(mutable_byte_buf buf) {
 
 fn string_writer() -> str_writer {
     // FIXME: yikes, this is bad. Needs fixing of mutable syntax.
-    let vec[mutable u8] b = vec(mutable 0u8);
+    let vec[mutable u8] b = [mutable 0u8];
     _vec::pop(b);
 
     let mutable_byte_buf buf = @rec(mutable buf = b, mutable pos = 0u);
diff --git a/src/lib/linux_os.rs b/src/lib/linux_os.rs
index 2a8921e3cbe..f014c9c0df2 100644
--- a/src/lib/linux_os.rs
+++ b/src/lib/linux_os.rs
@@ -65,7 +65,7 @@ fn dylib_filename(str base) -> str {
 }
 
 fn pipe() -> tup(int, int) {
-    let vec[mutable int] fds = vec(mutable 0, 0);
+    let vec[mutable int] fds = [mutable 0, 0];
     assert (os::libc::pipe(_vec::buf(fds)) == 0);
     ret tup(fds.(0), fds.(1));
 }
@@ -75,7 +75,7 @@ fn fd_FILE(int fd) -> libc::FILE {
 }
 
 fn waitpid(int pid) -> int {
-    let vec[mutable int] status = vec(mutable 0);
+    let vec[mutable int] status = [mutable 0];
     assert (os::libc::waitpid(pid, _vec::buf(status), 0) != -1);
     ret status.(0);
 }
diff --git a/src/lib/macos_os.rs b/src/lib/macos_os.rs
index 04a143b8ea2..0e37051278b 100644
--- a/src/lib/macos_os.rs
+++ b/src/lib/macos_os.rs
@@ -62,7 +62,7 @@ fn dylib_filename(str base) -> str {
 }
 
 fn pipe() -> tup(int, int) {
-    let vec[mutable int] fds = vec(mutable 0, 0);
+    let vec[mutable int] fds = [mutable 0, 0];
     assert (os::libc::pipe(_vec::buf(fds)) == 0);
     ret tup(fds.(0), fds.(1));
 }
@@ -72,7 +72,7 @@ fn fd_FILE(int fd) -> libc::FILE {
 }
 
 fn waitpid(int pid) -> int {
-    let vec[mutable int] status = vec(mutable 0);
+    let vec[mutable int] status = [mutable 0];
     assert (os::libc::waitpid(pid, _vec::buf(status), 0) != -1);
     ret status.(0);
 }
diff --git a/src/lib/posix_fs.rs b/src/lib/posix_fs.rs
index 1244dd1bd98..7a0606ec891 100644
--- a/src/lib/posix_fs.rs
+++ b/src/lib/posix_fs.rs
@@ -6,7 +6,7 @@ fn list_dir(str path) -> vec[str] {
   // TODO ensure this is always closed
   auto dir = os::libc::opendir(_str::buf(path));
   assert (dir as uint != 0u);
-  let vec[str] result = vec();
+  let vec[str] result = [];
   while (true) {
     auto ent = os::libc::readdir(dir);
     if (ent as int == 0) {
diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs
index abcf1472067..06fe23596c0 100644
--- a/src/lib/run_program.rs
+++ b/src/lib/run_program.rs
@@ -5,8 +5,8 @@ native "rust" mod rustrt {
     fn rust_run_program(vbuf argv, int in_fd, int out_fd, int err_fd) -> int;
 }
 
-fn argvec(str prog, vec[str] args) -> vec[sbuf] {
-    auto argptrs = vec(_str::buf(prog));
+fn arg_vec(str prog, vec[str] args) -> vec[sbuf] {
+    auto argptrs = [_str::buf(prog)];
     for (str arg in args) {
         _vec::push[sbuf](argptrs, _str::buf(arg));
     }
@@ -15,7 +15,7 @@ fn argvec(str prog, vec[str] args) -> vec[sbuf] {
 }
 
 fn run_program(str prog, vec[str] args) -> int {
-    auto pid = rustrt::rust_run_program(_vec::buf[sbuf](argvec(prog, args)),
+    auto pid = rustrt::rust_run_program(_vec::buf[sbuf](arg_vec(prog, args)),
                                        0, 0, 0);
     ret os::waitpid(pid);
 }
@@ -33,7 +33,7 @@ fn start_program(str prog, vec[str] args) -> @program {
     auto pipe_input = os::pipe();
     auto pipe_output = os::pipe();
     auto pid = rustrt::rust_run_program
-        (_vec::buf[sbuf](argvec(prog, args)),
+        (_vec::buf[sbuf](arg_vec(prog, args)),
          pipe_input._0, pipe_output._1, 0);
     if (pid == -1) {fail;}
     os::libc::close(pipe_input._0);
@@ -92,5 +92,5 @@ fn program_output(str prog, vec[str] args)
 // indent-tabs-mode: nil
 // c-basic-offset: 4
 // buffer-file-coding-system: utf-8-unix
-// compile-command: "make -k -C .. 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
+// compile-command: "make -k -C $RBUILD 2>&1 | sed -e 's/\\/x\\//x:\\//g'";
 // End:
diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs
index 96535d121f9..4ae004079c3 100644
--- a/src/lib/sha1.rs
+++ b/src/lib/sha1.rs
@@ -174,13 +174,13 @@ fn mk_sha1() -> sha1 {
             st.computed = true;
         }
 
-        let vec[u8] res = vec();
+        let vec[u8] res = [];
         for (u32 hpart in st.h) {
             auto a = (hpart >> 24u32) & 0xFFu32 as u8;
             auto b = (hpart >> 16u32) & 0xFFu32 as u8;
             auto c = (hpart >> 8u32) & 0xFFu32 as u8;
             auto d = (hpart & 0xFFu32 as u8);
-            res += vec(a,b,c,d);
+            res += [a,b,c,d];
         }
         ret res;
     }
diff --git a/src/lib/sort.rs b/src/lib/sort.rs
index 3b3c64036be..f74a7d7df71 100644
--- a/src/lib/sort.rs
+++ b/src/lib/sort.rs
@@ -6,17 +6,17 @@ type lteq[T] = fn(&T a, &T b) -> bool;
 fn merge_sort[T](lteq[T] le, vec[T] v) -> vec[T] {
 
     fn merge[T](lteq[T] le, vec[T] a, vec[T] b) -> vec[T] {
-        let vec[T] res = vec();
+        let vec[T] res = [];
         let uint a_len = len[T](a);
         let uint a_ix = 0u;
         let uint b_len = len[T](b);
         let uint b_ix = 0u;
         while (a_ix < a_len && b_ix < b_len) {
             if (le(a.(a_ix), b.(b_ix))) {
-                res += vec(a.(a_ix));
+                res += [a.(a_ix)];
                 a_ix += 1u;
             } else {
-                res += vec(b.(b_ix));
+                res += [b.(b_ix)];
                 b_ix += 1u;
             }
         }
diff --git a/src/lib/term.rs b/src/lib/term.rs
index 6fd54a2d4e6..46525e47bda 100644
--- a/src/lib/term.rs
+++ b/src/lib/term.rs
@@ -22,12 +22,12 @@ const u8 color_bright_cyan = 14u8;
 const u8 color_bright_white = 15u8;
 
 fn esc(io::buf_writer writer) {
-    writer.write(vec(0x1bu8, '[' as u8));
+    writer.write([0x1bu8, '[' as u8]);
 }
 
 fn reset(io::buf_writer writer) {
     esc(writer);
-    writer.write(vec('0' as u8, 'm' as u8));
+    writer.write(['0' as u8, 'm' as u8]);
 }
 
 fn color_supported() -> bool {
@@ -39,10 +39,10 @@ fn set_color(io::buf_writer writer, u8 first_char, u8 color) {
 
     esc(writer);
     if (color >= 8u8) {
-        writer.write(vec('1' as u8, ';' as u8));
+        writer.write(['1' as u8, ';' as u8]);
         color -= 8u8;
     }
-    writer.write(vec(first_char, ('0' as u8) + color, 'm' as u8));
+    writer.write([first_char, ('0' as u8) + color, 'm' as u8]);
 }
 
 fn fg(io::buf_writer writer, u8 color) {
diff --git a/src/lib/ufind.rs b/src/lib/ufind.rs
index faa77305b9e..c7790049be2 100644
--- a/src/lib/ufind.rs
+++ b/src/lib/ufind.rs
@@ -7,14 +7,14 @@ type node = option::t[uint];
 type ufind = rec(mutable vec[mutable node] nodes);
 
 fn make() -> ufind {
-    let vec[mutable node] v = vec(mutable none[uint]);
+    let vec[mutable node] v = [mutable none[uint]];
     _vec::pop(v);  // FIXME: botch
     ret rec(mutable nodes=v);
 }
 
 fn make_set(&ufind ufnd) -> uint {
     auto idx = _vec::len(ufnd.nodes);
-    ufnd.nodes += vec(mutable none[uint]);
+    ufnd.nodes += [mutable none[uint]];
     ret idx;
 }
 
diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs
index e9555249ed4..2baed39cac1 100644
--- a/src/lib/win32_os.rs
+++ b/src/lib/win32_os.rs
@@ -52,7 +52,7 @@ fn dylib_filename(str base) -> str {
 }
 
 fn pipe() -> tup(int, int) {
-    let vec[mutable int] fds = vec(mutable 0, 0);
+    let vec[mutable int] fds = [mutable 0, 0];
     assert (os::libc::_pipe(_vec::buf(fds), 1024u,
                         libc_constants::O_BINARY()) == 0);
     ret tup(fds.(0), fds.(1));
diff --git a/src/snapshots.txt b/src/snapshots.txt
index 56e1df2c2e6..21c73a81d71 100644
--- a/src/snapshots.txt
+++ b/src/snapshots.txt
@@ -1,4 +1,7 @@
-T
+T 2011-05-16 ae030c5
+  linux-i386 83a6f52df4029b61ebd628795b0a400265c98179
+  macos-i386 1167e8b782165be738cbd08eeab104ede0d61df6
+  winnt-i386 456bc38c2bc7ebb27fd008e3ccd05f16f6a31fe6
 
 S 2011-05-12 b1d3364
   linux-i386 7671ac0de19d9ea981616b3c58c1d48f1b43820a
diff --git a/src/test/bench/shootout/fasta.rs b/src/test/bench/shootout/fasta.rs
index ec962e38a48..b7a890971e3 100644
--- a/src/test/bench/shootout/fasta.rs
+++ b/src/test/bench/shootout/fasta.rs
@@ -28,10 +28,10 @@ type aminoacids = tup(char, u32);
 
 fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
   let u32 cp = 0u32;
-  let vec[aminoacids] ans = vec();
+  let vec[aminoacids] ans = [];
   for (aminoacids a in aa) {
     cp += a._1;
-    ans += vec(tup(a._0, cp));
+    ans += [tup(a._0, cp)];
   }
   ret ans;
 }
@@ -91,7 +91,7 @@ fn make_repeat_fasta(str id, str desc, str s, int n) {
 }
 
 fn main(vec[str] args) {
-  let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ),
+  let vec[aminoacids] iub = make_cumulative([tup( 'a', 27u32 ),
                                                 tup( 'c', 12u32 ),
                                                 tup( 'g', 12u32 ),
                                                 tup( 't', 27u32 ),
@@ -106,12 +106,12 @@ fn main(vec[str] args) {
                                                 tup( 'S', 2u32 ),
                                                 tup( 'V', 2u32 ),
                                                 tup( 'W', 2u32 ),
-                                                tup( 'Y', 2u32 )));
+                                                tup( 'Y', 2u32 )]);
 
-  let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ),
+  let vec[aminoacids] homosapiens = make_cumulative([tup( 'a', 30u32 ),
                                                         tup( 'c', 20u32 ),
                                                         tup( 'g', 20u32 ),
-                                                        tup( 't', 30u32 )));
+                                                        tup( 't', 30u32 )]);
 
   let str alu =
     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
diff --git a/src/test/bench/shootout/nbody.rs b/src/test/bench/shootout/nbody.rs
index 4b3e9044d92..152291c7145 100644
--- a/src/test/bench/shootout/nbody.rs
+++ b/src/test/bench/shootout/nbody.rs
@@ -7,7 +7,7 @@ native "llvm" mod llvm {
 
 fn main() {
 
-    let vec[int] inputs = vec(
+    let vec[int] inputs = [
                               50000,
                               500000
                               //
@@ -16,7 +16,7 @@ fn main() {
                               // during 'make check' under valgrind
                               // 5000000
                               // 50000000
-        );
+        ];
 
     let vec[Body::props] bodies = NBodySystem::MakeNBodySystem();
 
@@ -38,13 +38,13 @@ fn main() {
 mod NBodySystem {
 
     fn MakeNBodySystem() -> vec[Body::props] {
-        let vec[Body::props] bodies = vec(
+        let vec[Body::props] bodies = [
             // these each return a Body::props
             Body::sun(), 
             Body::jupiter(), 
             Body::saturn(), 
             Body::uranus(), 
-            Body::neptune());
+            Body::neptune()];
 
         let float px = 0.0;
         let float py = 0.0;
diff --git a/src/test/compile-fail/infinite-vec-type-recursion.rs b/src/test/compile-fail/infinite-vec-type-recursion.rs
index 5e26c855ed6..9a2cd3237ba 100644
--- a/src/test/compile-fail/infinite-vec-type-recursion.rs
+++ b/src/test/compile-fail/infinite-vec-type-recursion.rs
@@ -8,5 +8,5 @@
 type x = vec[x];
 
 fn main() {
-  let x b = vec();
+  let x b = [];
 }
diff --git a/src/test/compile-fail/writing-to-immutable-vec.rs b/src/test/compile-fail/writing-to-immutable-vec.rs
index cb4030eaed7..2872d11fc80 100644
--- a/src/test/compile-fail/writing-to-immutable-vec.rs
+++ b/src/test/compile-fail/writing-to-immutable-vec.rs
@@ -3,6 +3,6 @@
 // xfail-stage2
 // error-pattern: writing to immutable type
 fn main() {
-  let vec[int] v = vec(1, 2, 3);
+  let vec[int] v = [1, 2, 3];
   v.(1) = 4;
 }
\ No newline at end of file
diff --git a/src/test/run-fail/vec-overrun.rs b/src/test/run-fail/vec-overrun.rs
index 1eaedff9b4c..a6d782809c7 100644
--- a/src/test/run-fail/vec-overrun.rs
+++ b/src/test/run-fail/vec-overrun.rs
@@ -6,7 +6,7 @@
 // error-pattern:bounds check
 
 fn main() {
-  let vec[int] v = vec(10);
+  let vec[int] v = [10];
   let int x = 0;
   assert (v.(x) == 10);
   // Bounds-check failure.
diff --git a/src/test/run-fail/vec-underrun.rs b/src/test/run-fail/vec-underrun.rs
index fab59869d8c..ac691bb85ae 100644
--- a/src/test/run-fail/vec-underrun.rs
+++ b/src/test/run-fail/vec-underrun.rs
@@ -6,7 +6,7 @@
 // error-pattern:bounds check
 
 fn main() {
-  let vec[int] v = vec(10, 20);
+  let vec[int] v = [10, 20];
   let int x = 0;
   assert (v.(x) == 10);
   // Bounds-check failure.
diff --git a/src/test/run-pass/alt-join.rs b/src/test/run-pass/alt-join.rs
index a785f91d3b4..3d6d6313085 100644
--- a/src/test/run-pass/alt-join.rs
+++ b/src/test/run-pass/alt-join.rs
@@ -7,7 +7,7 @@ import std::option::some;
 fn foo[T](&option::t[T] y) {
   let int x;
   
-  let vec[int] res = vec();
+  let vec[int] res = [];
   
   /* tests that x doesn't get put in the precondition for the 
      entire if expression */
@@ -22,7 +22,7 @@ fn foo[T](&option::t[T] y) {
         x = 42;
       }
     }
-    res += vec(x);
+    res += [x];
   }
 
   ret;
diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs
index 92d5fcc6e66..a84d3192f7b 100644
--- a/src/test/run-pass/argv.rs
+++ b/src/test/run-pass/argv.rs
@@ -1,6 +1,6 @@
 fn main(vec[str] args) {
-  let vec[str] vs = vec("hi", "there", "this", "is", "a", "vec");
-  let vec[vec[str]] vvs = vec(args, vs);
+  let vec[str] vs = ["hi", "there", "this", "is", "a", "vec"];
+  let vec[vec[str]] vvs = [args, vs];
   for (vec[str] vs in vvs) {
     for (str s in vs) {
       log s;
diff --git a/src/test/run-pass/break.rs b/src/test/run-pass/break.rs
index 3485977e132..65f0f57a14a 100644
--- a/src/test/run-pass/break.rs
+++ b/src/test/run-pass/break.rs
@@ -13,7 +13,7 @@ fn main() {
   } while (i < 30);
   assert (i == 20);
 
-  for (int x in vec(1, 2, 3, 4, 5, 6)) {
+  for (int x in [1, 2, 3, 4, 5, 6]) {
     if (x == 3) { break; }
     assert (x <= 3);
   }
@@ -32,7 +32,7 @@ fn main() {
     assert (i % 2 != 0);
   } while (i < 10);
 
-  for (int x in vec(1, 2, 3, 4, 5, 6)) {
+  for (int x in [1, 2, 3, 4, 5, 6]) {
     if (x % 2 == 0) { cont; }
     assert (x % 2 != 0);
   }
diff --git a/src/test/run-pass/empty-mutable-vec.rs b/src/test/run-pass/empty-mutable-vec.rs
index a972fda4e53..7faf162b889 100644
--- a/src/test/run-pass/empty-mutable-vec.rs
+++ b/src/test/run-pass/empty-mutable-vec.rs
@@ -1,4 +1,4 @@
 fn main() {
-    let vec[mutable int] v = vec(mutable);
+    let vec[mutable int] v = [mutable];
 }
 
diff --git a/src/test/run-pass/expr-alt-generic-box2.rs b/src/test/run-pass/expr-alt-generic-box2.rs
index 7398d0b030c..3b6cadc7202 100644
--- a/src/test/run-pass/expr-alt-generic-box2.rs
+++ b/src/test/run-pass/expr-alt-generic-box2.rs
@@ -16,7 +16,7 @@ fn test_vec() {
     ret v1 == v2;
   }
   auto eq = bind compare_vec(_, _);
-  test_generic[vec[int]](vec(1, 2, 3), eq);
+  test_generic[vec[int]]([1, 2, 3], eq);
 }
 
 fn main() {
diff --git a/src/test/run-pass/expr-block-generic-box2.rs b/src/test/run-pass/expr-block-generic-box2.rs
index d0e272a26cc..2c9d85d5d96 100644
--- a/src/test/run-pass/expr-block-generic-box2.rs
+++ b/src/test/run-pass/expr-block-generic-box2.rs
@@ -12,7 +12,7 @@ fn test_vec() {
     ret v1 == v2;
   }
   auto eq = bind compare_vec(_, _);
-  test_generic[vec[int]](vec(1, 2), eq);
+  test_generic[vec[int]]([1, 2], eq);
 }
 
 fn main() {
diff --git a/src/test/run-pass/expr-if-generic-box2.rs b/src/test/run-pass/expr-if-generic-box2.rs
index 572662431f6..c0224fffcd2 100644
--- a/src/test/run-pass/expr-if-generic-box2.rs
+++ b/src/test/run-pass/expr-if-generic-box2.rs
@@ -12,7 +12,7 @@ fn test_vec() {
     ret v1 == v2;
   }
   auto eq = bind compare_vec(_, _);
-  test_generic[vec[int]](vec(1, 2), vec(2, 3), eq);
+  test_generic[vec[int]]([1, 2], [2, 3], eq);
 }
 
 fn main() {
diff --git a/src/test/run-pass/foreach-nested-2.rs b/src/test/run-pass/foreach-nested-2.rs
index 33a376d529e..423821ab16c 100644
--- a/src/test/run-pass/foreach-nested-2.rs
+++ b/src/test/run-pass/foreach-nested-2.rs
@@ -15,7 +15,7 @@ iter range(int start, int stop) -> int {
 
 fn main() {
     let vec[mutable int] a =
-      vec(mutable -1, -1, -1, -1, -1, -1, -1, -1);
+      [mutable -1, -1, -1, -1, -1, -1, -1, -1];
     let int p = 0;
 
     for each (int i in two()) {
diff --git a/src/test/run-pass/foreach-nested.rs b/src/test/run-pass/foreach-nested.rs
index 9ba304c1463..dd431a80890 100644
--- a/src/test/run-pass/foreach-nested.rs
+++ b/src/test/run-pass/foreach-nested.rs
@@ -6,7 +6,7 @@ iter two() -> int {
 }
 
 fn main() {
-    let vec[mutable int] a = vec(mutable -1, -1, -1, -1);
+    let vec[mutable int] a = [mutable -1, -1, -1, -1];
     let int p = 0;
 
     for each (int i in two()) {
diff --git a/src/test/run-pass/integral-indexing.rs b/src/test/run-pass/integral-indexing.rs
index ee80786c18a..f7207295685 100644
--- a/src/test/run-pass/integral-indexing.rs
+++ b/src/test/run-pass/integral-indexing.rs
@@ -2,7 +2,7 @@
 
 fn main() {
 
-  let vec[int] v = vec(0, 1, 2, 3, 4, 5);
+  let vec[int] v = [0, 1, 2, 3, 4, 5];
   let str s = "abcdef";
   assert (v.(3u) == 3);
   assert (v.(3u8) == 3);
diff --git a/src/test/run-pass/lib-bitv.rs b/src/test/run-pass/lib-bitv.rs
index 506d5b2ad1d..706f3c22cd5 100644
--- a/src/test/run-pass/lib-bitv.rs
+++ b/src/test/run-pass/lib-bitv.rs
@@ -16,10 +16,10 @@ fn test_1_element() {
   auto act;
 
   act = bitv::create(1u, false);
-  assert (bitv::eq_vec(act, vec(0u)));
+  assert (bitv::eq_vec(act, [0u]));
 
   act = bitv::create(1u, true);
-  assert (bitv::eq_vec(act, vec(1u)));
+  assert (bitv::eq_vec(act, [1u]));
 }
 
 fn test_10_elements() {
@@ -27,11 +27,11 @@ fn test_10_elements() {
 
   // all 0
   act = bitv::create(10u, false);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // all 1
   act = bitv::create(10u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u)));
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(10u, false);
@@ -40,7 +40,7 @@ fn test_10_elements() {
   bitv::set(act, 2u, true);
   bitv::set(act, 3u, true);
   bitv::set(act, 4u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u)));
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u]));
 
   // mixed
   act = bitv::create(10u, false);
@@ -49,7 +49,7 @@ fn test_10_elements() {
   bitv::set(act, 7u, true);
   bitv::set(act, 8u, true);
   bitv::set(act, 9u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u)));
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(10u, false);
@@ -57,7 +57,7 @@ fn test_10_elements() {
   bitv::set(act, 3u, true);
   bitv::set(act, 6u, true);
   bitv::set(act, 9u, true);
-  assert (bitv::eq_vec(act, vec(1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u)));
+  assert (bitv::eq_vec(act, [1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u]));
 }
 
 fn test_31_elements() {
@@ -65,17 +65,17 @@ fn test_31_elements() {
 
   // all 0
   act = bitv::create(31u, false);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // all 1
   act = bitv::create(31u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              1u, 1u, 1u, 1u, 1u, 1u, 1u)));
+                             1u, 1u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(31u, false);
@@ -87,10 +87,10 @@ fn test_31_elements() {
   bitv::set(act, 5u, true);
   bitv::set(act, 6u, true);
   bitv::set(act, 7u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // mixed
   act = bitv::create(31u, false);
@@ -102,10 +102,10 @@ fn test_31_elements() {
   bitv::set(act, 21u, true);
   bitv::set(act, 22u, true);
   bitv::set(act, 23u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // mixed
   act = bitv::create(31u, false);
@@ -116,20 +116,20 @@ fn test_31_elements() {
   bitv::set(act, 28u, true);
   bitv::set(act, 29u, true);
   bitv::set(act, 30u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              1u, 1u, 1u, 1u, 1u, 1u, 1u)));
+                             1u, 1u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(31u, false);
   bitv::set(act, 3u, true);
   bitv::set(act, 17u, true);
   bitv::set(act, 30u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 1u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 1u]));
 }
 
 fn test_32_elements() {
@@ -137,17 +137,17 @@ fn test_32_elements() {
 
   // all 0
   act = bitv::create(32u, false);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // all 1
   act = bitv::create(32u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u)));
+                             1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(32u, false);
@@ -159,10 +159,10 @@ fn test_32_elements() {
   bitv::set(act, 5u, true);
   bitv::set(act, 6u, true);
   bitv::set(act, 7u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // mixed
   act = bitv::create(32u, false);
@@ -174,10 +174,10 @@ fn test_32_elements() {
   bitv::set(act, 21u, true);
   bitv::set(act, 22u, true);
   bitv::set(act, 23u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
 
   // mixed
   act = bitv::create(32u, false);
@@ -189,10 +189,10 @@ fn test_32_elements() {
   bitv::set(act, 29u, true);
   bitv::set(act, 30u, true);
   bitv::set(act, 31u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u)));
+                             1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
 
   // mixed
   act = bitv::create(32u, false);
@@ -200,10 +200,10 @@ fn test_32_elements() {
   bitv::set(act, 17u, true);
   bitv::set(act, 30u, true);
   bitv::set(act, 31u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u)));
+                             0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u]));
 }
 
 fn test_33_elements() {
@@ -211,19 +211,19 @@ fn test_33_elements() {
 
   // all 0
   act = bitv::create(33u, false);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u)));
+                             0u]));
 
   // all 1
   act = bitv::create(33u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              1u)));
+                             1u]));
 
   // mixed
   act = bitv::create(33u, false);
@@ -235,11 +235,11 @@ fn test_33_elements() {
   bitv::set(act, 5u, true);
   bitv::set(act, 6u, true);
   bitv::set(act, 7u, true);
-  assert (bitv::eq_vec(act, vec(1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+  assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u)));
+                             0u]));
 
   // mixed
   act = bitv::create(33u, false);
@@ -251,11 +251,11 @@ fn test_33_elements() {
   bitv::set(act, 21u, true);
   bitv::set(act, 22u, true);
   bitv::set(act, 23u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                              0u)));
+                              0u]));
 
   // mixed
   act = bitv::create(33u, false);
@@ -267,11 +267,11 @@ fn test_33_elements() {
   bitv::set(act, 29u, true);
   bitv::set(act, 30u, true);
   bitv::set(act, 31u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                              0u)));
+                             0u]));
 
   // mixed
   act = bitv::create(33u, false);
@@ -280,11 +280,11 @@ fn test_33_elements() {
   bitv::set(act, 30u, true);
   bitv::set(act, 31u, true);
   bitv::set(act, 32u, true);
-  assert (bitv::eq_vec(act, vec(0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
+  assert (bitv::eq_vec(act, [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u,
                               0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                              1u)));
+                             1u]));
 }
 
 fn main() {
diff --git a/src/test/run-pass/lib-io.rs b/src/test/run-pass/lib-io.rs
index d9a33a6b120..3462e93f7c5 100644
--- a/src/test/run-pass/lib-io.rs
+++ b/src/test/run-pass/lib-io.rs
@@ -14,7 +14,7 @@ fn test_simple(str tmpfilebase) {
   log frood;
 
   {
-    let io::writer out = io::file_writer(tmpfile, vec(io::create));
+    let io::writer out = io::file_writer(tmpfile, [io::create]);
     out.write_str(frood);
   }
 
diff --git a/src/test/run-pass/lib-qsort.rs b/src/test/run-pass/lib-qsort.rs
index 2f086667686..473950cd864 100644
--- a/src/test/run-pass/lib-qsort.rs
+++ b/src/test/run-pass/lib-qsort.rs
@@ -19,32 +19,32 @@ fn check_sort(vec[mutable int] v1, vec[mutable int] v2) {
 
 fn main() {
   {
-    auto v1 = vec(mutable 3,7,4,5,2,9,5,8);
-    auto v2 = vec(mutable 2,3,4,5,5,7,8,9);
+    auto v1 = [mutable 3,7,4,5,2,9,5,8];
+    auto v2 = [mutable 2,3,4,5,5,7,8,9];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(mutable 1,1,1);
-    auto v2 = vec(mutable 1,1,1);
+    auto v1 = [mutable 1,1,1];
+    auto v2 = [mutable 1,1,1];
     check_sort(v1, v2);
   }
 
   {
-    let vec[mutable int] v1 = vec(mutable);
-    let vec[mutable int] v2 = vec(mutable);
+    let vec[mutable int] v1 = [mutable];
+    let vec[mutable int] v2 = [mutable];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(mutable 9);
-    auto v2 = vec(mutable 9);
+    auto v1 = [mutable 9];
+    auto v2 = [mutable 9];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(mutable 9,3,3,3,9);
-    auto v2 = vec(mutable 3,3,3,9,9);
+    auto v1 = [mutable 9,3,3,3,9];
+    auto v2 = [mutable 3,3,3,9,9];
     check_sort(v1, v2);
   }
 
diff --git a/src/test/run-pass/lib-sha1.rs b/src/test/run-pass/lib-sha1.rs
index 882784796d5..7f137cb871c 100644
--- a/src/test/run-pass/lib-sha1.rs
+++ b/src/test/run-pass/lib-sha1.rs
@@ -24,44 +24,44 @@ fn main() {
 
     // Test messages from FIPS 180-1
     let vec[test] fips_180_1_tests =
-        vec(
+        [
             rec(input = "abc",
-                output = vec(0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8,
+                output = [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8,
                              0x06u8, 0x81u8, 0x6Au8, 0xBAu8, 0x3Eu8,
                              0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8,
-                             0x6Cu8, 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8)
+                             0x6Cu8, 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]
                 ),
             rec(input = "abcdbcdecdefdefgefghfghighij"
                       + "hijkijkljklmklmnlmnomnopnopq",
-                output = vec(0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8,
+                output = [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8,
                              0x3Bu8, 0xD2u8, 0x6Eu8, 0xBAu8, 0xAEu8,
                              0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8,
-                             0xE5u8, 0xE5u8, 0x46u8, 0x70u8, 0xF1u8)
+                             0xE5u8, 0xE5u8, 0x46u8, 0x70u8, 0xF1u8]
                 ),
             rec(input = a_million_letter_a(),
-                output = vec(0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8,
+                output = [0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8,
                              0xC4u8, 0xDAu8, 0xA4u8, 0xF6u8, 0x1Eu8,
                              0xEBu8, 0x2Bu8, 0xDBu8, 0xADu8, 0x27u8,
-                             0x31u8, 0x65u8, 0x34u8, 0x01u8, 0x6Fu8)
+                             0x31u8, 0x65u8, 0x34u8, 0x01u8, 0x6Fu8]
                 )
-            );
+            ];
 
     // Examples from wikipedia
     let vec[test] wikipedia_tests =
-        vec(
+        [
             rec(input = "The quick brown fox jumps over the lazy dog",
-                output = vec(0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8,
+                output = [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8,
                              0x2du8, 0x28u8, 0xfcu8, 0xedu8, 0x84u8,
                              0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8,
-                             0x39u8, 0x1bu8, 0x93u8, 0xebu8, 0x12u8)
+                             0x39u8, 0x1bu8, 0x93u8, 0xebu8, 0x12u8]
                 ),
             rec(input = "The quick brown fox jumps over the lazy cog",
-                output = vec(0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8,
+                output = [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8,
                              0x5eu8, 0x1bu8, 0x3au8, 0xfau8, 0xd3u8,
                              0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8,
-                             0x9bu8, 0x10u8, 0x0du8, 0xb4u8, 0xb3u8)
+                             0x9bu8, 0x10u8, 0x0du8, 0xb4u8, 0xb3u8]
                 )
-            );
+            ];
 
     auto tests = fips_180_1_tests + wikipedia_tests;
 
diff --git a/src/test/run-pass/lib-sort.rs b/src/test/run-pass/lib-sort.rs
index 6ec266fa210..fe0c9e9473f 100644
--- a/src/test/run-pass/lib-sort.rs
+++ b/src/test/run-pass/lib-sort.rs
@@ -17,32 +17,32 @@ fn check_sort(vec[int] v1, vec[int] v2) {
 
 fn main() {
   {
-    auto v1 = vec(3,7,4,5,2,9,5,8);
-    auto v2 = vec(2,3,4,5,5,7,8,9);
+    auto v1 = [3,7,4,5,2,9,5,8];
+    auto v2 = [2,3,4,5,5,7,8,9];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(1,1,1);
-    auto v2 = vec(1,1,1);
+    auto v1 = [1,1,1];
+    auto v2 = [1,1,1];
     check_sort(v1, v2);
   }
 
   {
-    let vec[int] v1 = vec();
-    let vec[int] v2 = vec();
+    let vec[int] v1 = [];
+    let vec[int] v2 = [];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(9);
-    auto v2 = vec(9);
+    auto v1 = [9];
+    auto v2 = [9];
     check_sort(v1, v2);
   }
 
   {
-    auto v1 = vec(9,3,3,3,9);
-    auto v2 = vec(3,3,3,9,9);
+    auto v1 = [9,3,3,3,9];
+    auto v2 = [3,3,3,9,9];
     check_sort(v1, v2);
   }
 
diff --git a/src/test/run-pass/lib-str.rs b/src/test/run-pass/lib-str.rs
index eaa31012b11..185694a25a1 100644
--- a/src/test/run-pass/lib-str.rs
+++ b/src/test/run-pass/lib-str.rs
@@ -73,10 +73,10 @@ fn test_concat() {
     assert (_str::eq(_str::concat(v), s));
   }
 
-  t(vec("you", "know", "I'm", "no", "good"), "youknowI'mnogood");
-  let vec[str] v = vec();
+  t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
+  let vec[str] v = [];
   t(v, "");
-  t(vec("hi"), "hi");
+  t(["hi"], "hi");
 }
 
 fn test_connect() {
@@ -84,10 +84,10 @@ fn test_connect() {
     assert (_str::eq(_str::connect(v, sep), s));
   }
 
-  t(vec("you", "know", "I'm", "no", "good"), " ", "you know I'm no good");
-  let vec[str] v = vec();
+  t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
+  let vec[str] v = [];
   t(v, " ", "");
-  t(vec("hi"), " ", "hi");
+  t(["hi"], " ", "hi");
 }
 
 fn test_to_upper() {
diff --git a/src/test/run-pass/lib-vec.rs b/src/test/run-pass/lib-vec.rs
index f7e6157a14d..63e903d2d8e 100644
--- a/src/test/run-pass/lib-vec.rs
+++ b/src/test/run-pass/lib-vec.rs
@@ -23,7 +23,7 @@ fn test_init_fn() {
 }
 
 fn test_slice() {
-  let vec[int] v = vec(1,2,3,4,5);
+  let vec[int] v = [1,2,3,4,5];
   auto v2 = std::_vec::slice[int](v, 2u, 4u);
   assert (std::_vec::len[int](v2) == 2u);
   assert (v2.(0) == 3);
@@ -33,7 +33,7 @@ fn test_slice() {
 fn test_map() {
   fn square(&int x) -> int { ret x * x; }
   let std::option::operator[int, int] op = square;
-  let vec[int] v = vec(1, 2, 3, 4, 5);
+  let vec[int] v = [1, 2, 3, 4, 5];
   let vec[int] s = std::_vec::map[int, int](op, v);
   let int i = 0;
   while (i < 5) {
@@ -45,8 +45,8 @@ fn test_map() {
 fn test_map2() {
   fn times(&int x, &int y) -> int { ret x * y; }
   auto f = times;
-  auto v0 = vec(1, 2, 3, 4, 5);
-  auto v1 = vec(5, 4, 3, 2, 1);
+  auto v0 = [1, 2, 3, 4, 5];
+  auto v1 = [5, 4, 3, 2, 1];
   auto u = std::_vec::map2[int,int,int](f, v0, v1);
 
   auto i = 0;
diff --git a/src/test/run-pass/linear-for-loop.rs b/src/test/run-pass/linear-for-loop.rs
index c816f817225..6345e43acf5 100644
--- a/src/test/run-pass/linear-for-loop.rs
+++ b/src/test/run-pass/linear-for-loop.rs
@@ -1,5 +1,5 @@
 fn main() {
-  auto x = vec(1,2,3);
+  auto x = [1,2,3];
   auto y = 0;
   for (int i in x) {
     log i;
diff --git a/src/test/run-pass/maybe-mutable.rs b/src/test/run-pass/maybe-mutable.rs
index c0af0867faa..7b8781d2f81 100644
--- a/src/test/run-pass/maybe-mutable.rs
+++ b/src/test/run-pass/maybe-mutable.rs
@@ -9,9 +9,9 @@ fn len(vec[mutable? int] v) -> uint {
 }
 
 fn main() {
-    auto v0 = vec(1, 2, 3, 4, 5);
+    auto v0 = [1, 2, 3, 4, 5];
     log len(v0);
-    auto v1 = vec(mutable 1, 2, 3, 4, 5);
+    auto v1 = [mutable 1, 2, 3, 4, 5];
     log len(v1);
 }
 
diff --git a/src/test/run-pass/mutable-alias-vec.rs b/src/test/run-pass/mutable-alias-vec.rs
index c63220dfbfa..a09d8dc4ab8 100644
--- a/src/test/run-pass/mutable-alias-vec.rs
+++ b/src/test/run-pass/mutable-alias-vec.rs
@@ -3,11 +3,11 @@
 use std;
 
 fn grow(&mutable vec[int] v) {
-  v += vec(1);
+  v += [1];
 }
 
 fn main() {
-  let vec[int] v = vec();
+  let vec[int] v = [];
   grow(v);
   grow(v);
   grow(v);
diff --git a/src/test/run-pass/mutable-vec-drop.rs b/src/test/run-pass/mutable-vec-drop.rs
index ebfb8c6c53f..15c36f46b68 100644
--- a/src/test/run-pass/mutable-vec-drop.rs
+++ b/src/test/run-pass/mutable-vec-drop.rs
@@ -2,5 +2,5 @@ fn main() {
   // This just tests whether the vec leaks its members.
 
   let vec[mutable @tup(int,int)] pvec =
-    vec(mutable @tup(1,2), @tup(3,4), @tup(5,6));
+    [mutable @tup(1,2), @tup(3,4), @tup(5,6)];
 }
diff --git a/src/test/run-pass/obj-with-vec.rs b/src/test/run-pass/obj-with-vec.rs
index b298f75f969..7b807b9a76f 100644
--- a/src/test/run-pass/obj-with-vec.rs
+++ b/src/test/run-pass/obj-with-vec.rs
@@ -5,7 +5,7 @@ fn main() {
       ret data.(i);
     }
   }
-  auto b = buf(vec(1 as u8, 2 as u8, 3 as u8));
+  auto b = buf([1 as u8, 2 as u8, 3 as u8]);
   log b.get(1);
   assert (b.get(1) == (2 as u8));
 }
diff --git a/src/test/run-pass/seq-compare.rs b/src/test/run-pass/seq-compare.rs
index ba7e623908d..9a8eca74af4 100644
--- a/src/test/run-pass/seq-compare.rs
+++ b/src/test/run-pass/seq-compare.rs
@@ -3,13 +3,13 @@ fn main() {
   assert ("hello " > "hello");
   assert ("hello" != "there");
 
-  assert (vec(1,2,3,4) > vec(1,2,3));
-  assert (vec(1,2,3) < vec(1,2,3,4));
-  assert (vec(1,2,4,4) > vec(1,2,3,4));
-  assert (vec(1,2,3,4) < vec(1,2,4,4));
-  assert (vec(1,2,3) <= vec(1,2,3));
-  assert (vec(1,2,3) <= vec(1,2,3,3));
-  assert (vec(1,2,3,4) > vec(1,2,3));
-  assert (vec(1,2,3) == vec(1,2,3));
-  assert (vec(1,2,3) != vec(1,1,3));
+  assert ([1,2,3,4] > [1,2,3]);
+  assert ([1,2,3] < [1,2,3,4]);
+  assert ([1,2,4,4] > [1,2,3,4]);
+  assert ([1,2,3,4] < [1,2,4,4]);
+  assert ([1,2,3] <= [1,2,3]);
+  assert ([1,2,3] <= [1,2,3,3]);
+  assert ([1,2,3,4] > [1,2,3]);
+  assert ([1,2,3] == [1,2,3]);
+  assert ([1,2,3] != [1,1,3]);
 }
diff --git a/src/test/run-pass/size-and-align.rs b/src/test/run-pass/size-and-align.rs
index 58d529e8374..8412d51d8c7 100644
--- a/src/test/run-pass/size-and-align.rs
+++ b/src/test/run-pass/size-and-align.rs
@@ -13,6 +13,6 @@ fn uhoh[T](vec[clam[T]] v) {
 }
 
 fn main() {
-  let vec[clam[int]] v = vec(b[int], b[int], a[int](42, 17));
+  let vec[clam[int]] v = [b[int], b[int], a[int](42, 17)];
   uhoh[int](v);
 }
diff --git a/src/test/run-pass/task-comm-16.rs b/src/test/run-pass/task-comm-16.rs
index 9438f50ef4d..9a533bca036 100644
--- a/src/test/run-pass/task-comm-16.rs
+++ b/src/test/run-pass/task-comm-16.rs
@@ -22,7 +22,7 @@ fn test_rec() {
 fn test_vec() {
   let port[vec[int]] po = port();
   let chan[vec[int]] ch = chan(po);
-  let vec[int] v0 = vec(0, 1, 2);
+  let vec[int] v0 = [0, 1, 2];
 
   ch <| v0;
 
diff --git a/src/test/run-pass/task-comm-2.rs b/src/test/run-pass/task-comm-2.rs
index f2aa250c881..e856f0bbef2 100644
--- a/src/test/run-pass/task-comm-2.rs
+++ b/src/test/run-pass/task-comm-2.rs
@@ -21,13 +21,13 @@ fn test00(bool create_threads) {
     let int number_of_tasks = 8;
     
     let int i = 0;
-    let vec[task] tasks = vec();
+    let vec[task] tasks = [];
     while (i < number_of_tasks) {
         i = i + 1;
         if (create_threads) {
-            tasks += vec(spawn thread start(i));
+            tasks += [spawn thread start(i)];
         } else {
-            tasks += vec(spawn start(i));
+            tasks += [spawn start(i)];
         }
     }
     
diff --git a/src/test/run-pass/task-comm-3.rs b/src/test/run-pass/task-comm-3.rs
index 0cdbe5ac0ba..907a7f28035 100644
--- a/src/test/run-pass/task-comm-3.rs
+++ b/src/test/run-pass/task-comm-3.rs
@@ -31,13 +31,13 @@ fn test00(bool is_multithreaded) {
     let int i = 0;
     
     // Create and spawn tasks...
-    let vec[task] tasks = vec();
+    let vec[task] tasks = [];
     while (i < number_of_tasks) {
         if (is_multithreaded) {
-            tasks += vec(
-                spawn thread test00_start(ch, i, number_of_messages));
+            tasks += [
+                spawn thread test00_start(ch, i, number_of_messages)];
         } else {
-            tasks += vec(spawn test00_start(ch, i, number_of_messages));
+            tasks += [spawn test00_start(ch, i, number_of_messages)];
         }
         i = i + 1;
     }
diff --git a/src/test/run-pass/task-comm.rs b/src/test/run-pass/task-comm.rs
index 16fc6452382..826743d0937 100644
--- a/src/test/run-pass/task-comm.rs
+++ b/src/test/run-pass/task-comm.rs
@@ -33,14 +33,14 @@ fn test00(bool is_multithreaded) {
     
     let int i = 0;
     
-    let vec[task] tasks = vec();
+    let vec[task] tasks = [];
     while (i < number_of_tasks) {
         i = i + 1;
         if (is_multithreaded) {
-            tasks += vec(
-                spawn thread test00_start(ch, i, number_of_messages));
+            tasks += [
+                spawn thread test00_start(ch, i, number_of_messages)];
         } else {
-            tasks += vec(spawn test00_start(ch, i, number_of_messages));
+            tasks += [spawn test00_start(ch, i, number_of_messages)];
         }
     }
     
@@ -147,11 +147,11 @@ fn test06() {
     
     let int i = 0;
     
-    let vec[task] tasks = vec();
+    let vec[task] tasks = [];
     while (i < number_of_tasks) {
         i = i + 1;
-        tasks += vec(spawn thread test06_start(i));
-        // tasks += vec(spawn test06_start(i));
+        tasks += [spawn thread test06_start(i)];
+        // tasks += [spawn test06_start(i)];
     }
     
     for (task t in tasks) {
diff --git a/src/test/run-pass/type-params-in-for-each.rs b/src/test/run-pass/type-params-in-for-each.rs
index 49fe099b625..1394643929e 100644
--- a/src/test/run-pass/type-params-in-for-each.rs
+++ b/src/test/run-pass/type-params-in-for-each.rs
@@ -9,7 +9,7 @@ iter range(uint lo, uint hi) -> uint {
 
 fn create_index[T](vec[tup(T, uint)] index, fn(&T) -> uint hash_fn) {
     for each (uint i in range(0u, 256u)) {
-        let vec[T] bucket = vec();
+        let vec[T] bucket = [];
     }
 }
 
diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs
index a79294ec572..22a97ed7002 100644
--- a/src/test/run-pass/utf8_chars.rs
+++ b/src/test/run-pass/utf8_chars.rs
@@ -8,7 +8,7 @@ import std::io;
 
 fn main() {
   // Chars of 1, 2, 3, and 4 bytes
-  let vec[char] chs = vec('e', 'é', '€', 0x10000 as char);
+  let vec[char] chs = ['e', 'é', '€', 0x10000 as char];
   let str s = _str::from_chars(chs);
 
   assert (_str::byte_len(s) == 10u);
@@ -19,9 +19,9 @@ fn main() {
   assert (_str::char_at(s, 1u) == 'é');
 
   assert (_str::is_utf8(_str::bytes(s)));
-  assert (!_str::is_utf8(vec(0x80_u8)));
-  assert (!_str::is_utf8(vec(0xc0_u8)));
-  assert (!_str::is_utf8(vec(0xc0_u8, 0x10_u8)));
+  assert (!_str::is_utf8([0x80_u8]));
+  assert (!_str::is_utf8([0xc0_u8]));
+  assert (!_str::is_utf8([0xc0_u8, 0x10_u8]));
 
   auto stack = "a×c€";
   assert (_str::pop_char(stack) == '€');
diff --git a/src/test/run-pass/vec-alloc-append.rs b/src/test/run-pass/vec-alloc-append.rs
index d0ca6ab9c8c..c61d4cc967b 100644
--- a/src/test/run-pass/vec-alloc-append.rs
+++ b/src/test/run-pass/vec-alloc-append.rs
@@ -13,5 +13,5 @@ fn slice[T](vec[T] e) {
 }
 
 fn main() {
-  slice[str](vec("a"));
+  slice[str](["a"]);
 }
diff --git a/src/test/run-pass/vec-append.rs b/src/test/run-pass/vec-append.rs
index dc36799bce4..1d0d2509570 100644
--- a/src/test/run-pass/vec-append.rs
+++ b/src/test/run-pass/vec-append.rs
@@ -13,8 +13,8 @@ import std::_vec;
 const uint const_refcount = 0x7bad_face_u;
 
 fn fast_growth() {
-  let vec[int] v = vec(1,2,3,4,5);
-  v += vec(6,7,8,9,0);
+  let vec[int] v = [1,2,3,4,5];
+  v += [6,7,8,9,0];
 
   log v.(9);
   assert (v.(0) == 1);
@@ -23,9 +23,9 @@ fn fast_growth() {
 }
 
 fn slow_growth() {
-  let vec[int] v = vec();
+  let vec[int] v = [];
   let vec[int] u = v;
-  v += vec(17);
+  v += [17];
 
   log v.(0);
   assert (v.(0) == 17);
@@ -34,7 +34,7 @@ fn slow_growth() {
 fn slow_growth2_helper(str s) {   // ref up: s
 
   obj acc(vec[str] v) {
-    fn add(&str s) { v += vec(s); }
+    fn add(&str s) { v += [s]; }
   }
 
   let str ss = s;                 // ref up: s
@@ -50,7 +50,7 @@ fn slow_growth2_helper(str s) {   // ref up: s
      * copy of existing elements should increment the ref count of
      * mumble, the existing str in the originally- shared vec.
      */
-    let vec[str] v = vec(mumble); // ref up: v, mumble
+    let vec[str] v = [mumble]; // ref up: v, mumble
     let acc a = acc(v);           // ref up: a, v
 
     log _vec::refcount[str](v);
diff --git a/src/test/run-pass/vec-concat.rs b/src/test/run-pass/vec-concat.rs
index 09a95402e65..3ef6b1dec56 100644
--- a/src/test/run-pass/vec-concat.rs
+++ b/src/test/run-pass/vec-concat.rs
@@ -1,8 +1,8 @@
 // -*- rust -*-
 
 fn main() {
-  let vec[int] a = vec(1,2,3,4,5);
-  let vec[int] b = vec(6,7,8,9,0);
+  let vec[int] a = [1,2,3,4,5];
+  let vec[int] b = [6,7,8,9,0];
   let vec[int] v = a + b;
   log v.(9);
   assert (v.(0) == 1);
diff --git a/src/test/run-pass/vec-drop.rs b/src/test/run-pass/vec-drop.rs
index fff9a1ee64b..6b46102faf4 100644
--- a/src/test/run-pass/vec-drop.rs
+++ b/src/test/run-pass/vec-drop.rs
@@ -1,4 +1,4 @@
 fn main() {
   // This just tests whether the vec leaks its members.
-  let vec[@tup(int,int)] pvec = vec(@tup(1,2),@tup(3,4),@tup(5,6));
+  let vec[@tup(int,int)] pvec = [@tup(1,2),@tup(3,4),@tup(5,6)];
 }
diff --git a/src/test/run-pass/vec-growth.rs b/src/test/run-pass/vec-growth.rs
index b6976abd3a9..3c010e19e91 100644
--- a/src/test/run-pass/vec-growth.rs
+++ b/src/test/run-pass/vec-growth.rs
@@ -1,9 +1,9 @@
 fn main() {
-    auto v = vec(1);
-    v += vec(2);
-    v += vec(3);
-    v += vec(4);
-    v += vec(5);
+    auto v = [1];
+    v += [2];
+    v += [3];
+    v += [4];
+    v += [5];
     assert (v.(0) == 1);
     assert (v.(1) == 2);
     assert (v.(2) == 3);
diff --git a/src/test/run-pass/vec-in-tup.rs b/src/test/run-pass/vec-in-tup.rs
index 415554dd374..e1c0a78bd9a 100644
--- a/src/test/run-pass/vec-in-tup.rs
+++ b/src/test/run-pass/vec-in-tup.rs
@@ -1,4 +1,4 @@
 fn main() {
-  let tup(mutable vec[int]) i = tup(mutable vec(1,2,3));
-  i._0 = vec(4,5,6);
+  let tup(mutable vec[int]) i = tup(mutable [1,2,3]);
+  i._0 = [4,5,6];
 }
diff --git a/src/test/run-pass/vec-late-init.rs b/src/test/run-pass/vec-late-init.rs
index 39a0b6e89bc..48e91dcd213 100644
--- a/src/test/run-pass/vec-late-init.rs
+++ b/src/test/run-pass/vec-late-init.rs
@@ -1,9 +1,9 @@
 fn main() {
   let vec[int] later;
   if (true) {
-    later = vec(1);
+    later = [1];
   } else {
-    later = vec(2);
+    later = [2];
   }
   log later.(0);
 }
\ No newline at end of file
diff --git a/src/test/run-pass/vec-push.rs b/src/test/run-pass/vec-push.rs
index fc4f19eae33..09416d67fef 100644
--- a/src/test/run-pass/vec-push.rs
+++ b/src/test/run-pass/vec-push.rs
@@ -1,9 +1,9 @@
 fn push[T](&mutable vec[mutable? T] v, &T t) {
-    v += vec(t);
+    v += [t];
 }
 
 fn main() {
-    auto v = @vec(1, 2, 3);
+    auto v = @[1, 2, 3];
     push[int](*v, 1);
 }
 
diff --git a/src/test/run-pass/vec-ref-count.rs b/src/test/run-pass/vec-ref-count.rs
index 86ba642b61f..cb26e4845d5 100644
--- a/src/test/run-pass/vec-ref-count.rs
+++ b/src/test/run-pass/vec-ref-count.rs
@@ -2,7 +2,7 @@ use std;
 import std::_vec;
 
 fn main() {
-    auto v = vec(1, 2, 3);
+    auto v = [1, 2, 3];
     log_err _vec::refcount[int](v);
     log_err _vec::refcount[int](v);
     log_err _vec::refcount[int](v);
diff --git a/src/test/run-pass/vec-slice.rs b/src/test/run-pass/vec-slice.rs
index dc15060bafe..fb60210fbfc 100644
--- a/src/test/run-pass/vec-slice.rs
+++ b/src/test/run-pass/vec-slice.rs
@@ -2,7 +2,7 @@
 // xfail-stage1
 // xfail-stage2
 fn main() {
-  let vec[int] v = vec(1,2,3,4,5);
+  let vec[int] v = [1,2,3,4,5];
   auto v2 = v.(1,2);
   assert (v2.(0) == 2);
   assert (v2.(1) == 3);
diff --git a/src/test/run-pass/vec.rs b/src/test/run-pass/vec.rs
index 138d0ff2880..5e97fa81465 100644
--- a/src/test/run-pass/vec.rs
+++ b/src/test/run-pass/vec.rs
@@ -1,7 +1,7 @@
 // -*- rust -*-
 
 fn main() {
-  let vec[int] v = vec(10, 20);
+  let vec[int] v = [10, 20];
   assert (v.(0) == 10);
   assert (v.(1) == 20);
   let int x = 0;
diff --git a/src/test/run-pass/while-with-break.rs b/src/test/run-pass/while-with-break.rs
index 2adaf24bbc3..64dc59af3d6 100644
--- a/src/test/run-pass/while-with-break.rs
+++ b/src/test/run-pass/while-with-break.rs
@@ -6,7 +6,7 @@ fn main() {
     log i;
     i = i + 1;
     if (i == 95) { 
-      let vec[int] v = vec(1,2,3,4,5); // we check that it is freed by break
+      let vec[int] v = [1,2,3,4,5]; // we check that it is freed by break
       log "breaking"; 
       break; 
     }