diff options
Diffstat (limited to 'src')
642 files changed, 6788 insertions, 7387 deletions
diff --git a/src/comp/back/link.rs b/src/comp/back/link.rs index 11df59a7f43..d8fd682387b 100644 --- a/src/comp/back/link.rs +++ b/src/comp/back/link.rs @@ -137,10 +137,9 @@ mod write { False); if threshold != 0u { - llvm::LLVMPassManagerBuilderUseInlinerWithThreshold(MPMB, - threshold); + llvm::LLVMPassManagerBuilderUseInlinerWithThreshold( + MPMB, threshold); } - llvm::LLVMPassManagerBuilderPopulateModulePassManager(MPMB, pm.llpm); @@ -293,21 +292,21 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str, provided_metas { let name: option::t<str> = none; let vers: option::t<str> = none; - let cmh_items: [@ast::meta_item] = ~[]; + let cmh_items: [@ast::meta_item] = []; let linkage_metas = attr::find_linkage_metas(c.node.attrs); attr::require_unique_names(sess, linkage_metas); for meta: @ast::meta_item in linkage_metas { if attr::get_meta_item_name(meta) == "name" { alt attr::get_meta_item_value_str(meta) { some(v) { name = some(v); } - none. { cmh_items += ~[meta]; } + none. { cmh_items += [meta]; } } - } else if (attr::get_meta_item_name(meta) == "vers") { + } else if attr::get_meta_item_name(meta) == "vers" { alt attr::get_meta_item_value_str(meta) { some(v) { vers = some(v); } - none. { cmh_items += ~[meta]; } + none. { cmh_items += [meta]; } } - } else { cmh_items += ~[meta]; } + } else { cmh_items += [meta]; } } ret {name: name, vers: vers, cmh_items: cmh_items}; } @@ -316,7 +315,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str, fn crate_meta_extras_hash(sha: sha1, _crate: &ast::crate, metas: &provided_metas) -> str { fn len_and_str(s: &str) -> str { - ret #fmt("%u_%s", str::byte_len(s), s); + ret #fmt["%u_%s", str::byte_len(s), s]; } fn len_and_str_lit(l: &ast::lit) -> str { @@ -345,8 +344,8 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str, fn warn_missing(sess: &session::session, name: str, default: str) { if !sess.get_opts().library { ret; } - sess.warn(#fmt("missing crate link meta '%s', using '%s' as default", - name, default)); + sess.warn(#fmt["missing crate link meta '%s', using '%s' as default", + name, default]); } fn crate_meta_name(sess: &session::session, _crate: &ast::crate, @@ -356,8 +355,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str, none. { let name = { - let os = - str::split(fs::basename(output), '.' as u8); + let os = str::split(fs::basename(output), '.' as u8); assert (vec::len(os) >= 2u); vec::pop(os); str::connect(os, ".") @@ -429,7 +427,7 @@ fn mangle(ss: &[str]) -> str { let n = "_ZN"; // Begin name-sequence. - for s: str in ss { n += #fmt("%u%s", str::byte_len(s), s); } + for s: str in ss { n += #fmt["%u%s", str::byte_len(s), s]; } n += "E"; // End name-sequence. ret n; @@ -438,7 +436,7 @@ fn mangle(ss: &[str]) -> str { fn exported_name(path: &[str], hash: &str, _vers: &str) -> str { // FIXME: versioning isn't working yet - ret mangle(path + ~[hash]); // + "@" + vers; + ret mangle(path + [hash]); // + "@" + vers; } @@ -451,12 +449,12 @@ fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: &ty::t, name: &str) -> str { let s = util::ppaux::ty_to_short_str(ccx.tcx, t); let hash = get_symbol_hash(ccx, t); - ret mangle(~[name, s, hash]); + ret mangle([name, s, hash]); } fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[str], flav: &str) -> str { - ret mangle(path + ~[ccx.names.next(flav)]); + ret mangle(path + [ccx.names.next(flav)]); } fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[str]) -> str { diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs index 40e365612d6..eb1741767ad 100644 --- a/src/comp/back/upcall.rs +++ b/src/comp/back/upcall.rs @@ -51,72 +51,68 @@ type upcalls = fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef, taskptr_type: TypeRef, llmod: ModuleRef) -> @upcalls { - fn decl(llmod: ModuleRef, name: str, tys: [TypeRef], - rv: TypeRef) -> ValueRef { - let arg_tys: [TypeRef] = ~[]; - for t: TypeRef in tys { arg_tys += ~[t]; } + fn decl(llmod: ModuleRef, name: str, tys: [TypeRef], rv: TypeRef) -> + ValueRef { + let arg_tys: [TypeRef] = []; + for t: TypeRef in tys { arg_tys += [t]; } let fn_ty = T_fn(arg_tys, rv); ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty); } - fn decl_with_taskptr(taskptr_type: TypeRef, - llmod: ModuleRef, name: str, tys: [TypeRef], - rv: TypeRef) -> ValueRef { - ret decl(llmod, name, ~[taskptr_type] + tys, rv); + fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef, name: str, + tys: [TypeRef], rv: TypeRef) -> ValueRef { + ret decl(llmod, name, [taskptr_type] + tys, rv); } let dv = bind decl_with_taskptr(taskptr_type, llmod, _, _, T_void()); let d = bind decl_with_taskptr(taskptr_type, llmod, _, _, _); let dr = bind decl(llmod, _, _, _); - let empty_vec: [TypeRef] = ~[]; - ret @{grow_task: dv("grow_task", ~[T_size_t()]), + let empty_vec: [TypeRef] = []; + ret @{grow_task: dv("grow_task", [T_size_t()]), _yield: dv("yield", empty_vec), - sleep: dv("sleep", ~[T_size_t()]), - _fail: dv("fail", ~[T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]), - kill: dv("kill", ~[taskptr_type]), + sleep: dv("sleep", [T_size_t()]), + _fail: dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]), + kill: dv("kill", [taskptr_type]), exit: dv("exit", empty_vec), malloc: - d("malloc", ~[T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), - free: dv("free", ~[T_ptr(T_i8()), T_int()]), + d("malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), + free: dv("free", [T_ptr(T_i8()), T_int()]), shared_malloc: - d("shared_malloc", ~[T_size_t(), T_ptr(tydesc_type)], + d("shared_malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())), - shared_free: dv("shared_free", ~[T_ptr(T_i8())]), - mark: d("mark", ~[T_ptr(T_i8())], T_int()), - new_str: d("new_str", ~[T_ptr(T_i8()), T_size_t()], T_ptr(T_str())), + shared_free: dv("shared_free", [T_ptr(T_i8())]), + mark: d("mark", [T_ptr(T_i8())], T_int()), + new_str: d("new_str", [T_ptr(T_i8()), T_size_t()], T_ptr(T_str())), evec_append: d("evec_append", - ~[T_ptr(tydesc_type), T_ptr(tydesc_type), - T_ptr(T_opaque_vec_ptr()), T_opaque_vec_ptr(), T_bool()], + [T_ptr(tydesc_type), T_ptr(tydesc_type), + T_ptr(T_opaque_vec_ptr()), T_opaque_vec_ptr(), T_bool()], T_void()), get_type_desc: d("get_type_desc", - ~[T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(), - T_ptr(T_ptr(tydesc_type))], T_ptr(tydesc_type)), + [T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(), + T_ptr(T_ptr(tydesc_type))], T_ptr(tydesc_type)), ivec_resize: - d("ivec_resize", ~[T_ptr(T_opaque_ivec()), T_int()], T_void()), + d("ivec_resize", [T_ptr(T_opaque_ivec()), T_int()], T_void()), ivec_spill: - d("ivec_spill", ~[T_ptr(T_opaque_ivec()), T_int()], T_void()), + d("ivec_spill", [T_ptr(T_opaque_ivec()), T_int()], T_void()), ivec_resize_shared: - d("ivec_resize_shared", ~[T_ptr(T_opaque_ivec()), T_int()], + d("ivec_resize_shared", [T_ptr(T_opaque_ivec()), T_int()], T_void()), ivec_spill_shared: - d("ivec_spill_shared", ~[T_ptr(T_opaque_ivec()), T_int()], + d("ivec_spill_shared", [T_ptr(T_opaque_ivec()), T_int()], T_void()), cmp_type: - dr("cmp_type", ~[T_ptr(T_i1()), taskptr_type, - T_ptr(tydesc_type), T_ptr(T_ptr(tydesc_type)), - T_ptr(T_i8()), T_ptr(T_i8()), T_i8()], - T_void()), + dr("cmp_type", + [T_ptr(T_i1()), taskptr_type, T_ptr(tydesc_type), + T_ptr(T_ptr(tydesc_type)), T_ptr(T_i8()), T_ptr(T_i8()), + T_i8()], T_void()), log_type: - dr("log_type", ~[taskptr_type, T_ptr(tydesc_type), - T_ptr(T_i8()), T_i32()], + dr("log_type", + [taskptr_type, T_ptr(tydesc_type), T_ptr(T_i8()), T_i32()], T_void()), - dynastack_mark: - d("dynastack_mark", ~[], T_ptr(T_i8())), - dynastack_alloc: - d("dynastack_alloc", ~[T_size_t()], T_ptr(T_i8())), - dynastack_free: - d("dynastack_free", ~[T_ptr(T_i8())], T_void())}; + dynastack_mark: d("dynastack_mark", [], T_ptr(T_i8())), + dynastack_alloc: d("dynastack_alloc", [T_size_t()], T_ptr(T_i8())), + dynastack_free: d("dynastack_free", [T_ptr(T_i8())], T_void())}; } // // Local Variables: diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs index 6c125f0e176..a75a46e64c7 100644 --- a/src/comp/driver/rustc.rs +++ b/src/comp/driver/rustc.rs @@ -53,11 +53,11 @@ fn default_configuration(sess: session::session, argv0: str, input: str) -> let mk = attr::mk_name_value_item_str; - ret ~[ // Target bindings. - mk("target_os", std::os::target_os()), mk("target_arch", "x86"), - mk("target_libc", libc), - // Build bindings. - mk("build_compiler", argv0), mk("build_input", input)]; + ret [ // Target bindings. + mk("target_os", std::os::target_os()), mk("target_arch", "x86"), + mk("target_libc", libc), + // Build bindings. + mk("build_compiler", argv0), mk("build_input", input)]; } fn build_configuration(sess: session::session, argv0: str, input: str) -> @@ -71,8 +71,8 @@ fn build_configuration(sess: session::session, argv0: str, input: str) -> { if sess.get_opts().test && !attr::contains_name(user_cfg, "test") { - ~[attr::mk_word_item("test")] - } else { ~[] } + [attr::mk_word_item("test")] + } else { [] } }; ret user_cfg + gen_cfg + default_cfg; } @@ -81,8 +81,8 @@ fn build_configuration(sess: session::session, argv0: str, input: str) -> fn parse_cfgspecs(cfgspecs: &[str]) -> ast::crate_cfg { // FIXME: It would be nice to use the parser to parse all varieties of // meta_item here. At the moment we just support the meta_word variant. - let words = ~[]; - for s: str in cfgspecs { words += ~[attr::mk_word_item(s)]; } + let words = []; + for s: str in cfgspecs { words += [attr::mk_word_item(s)]; } ret words; } @@ -92,31 +92,29 @@ fn parse_input(sess: session::session, cfg: &ast::crate_cfg, input: str) -> @ast::crate { if !input_is_stdin(input) { parser::parse_crate_from_file(input, cfg, sess.get_parse_sess()) - } else { - parse_input_src(sess, cfg, input).crate - } + } else { parse_input_src(sess, cfg, input).crate } } -fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, - infile: str) -> {crate: @ast::crate, src: str} { - let srcbytes = if infile != "-" { - io::file_reader(infile) - } else { - io::stdin() - }.read_whole_stream(); +fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, infile: str) + -> {crate: @ast::crate, src: str} { + let srcbytes = + if infile != "-" { + io::file_reader(infile) + } else { io::stdin() }.read_whole_stream(); let src = str::unsafe_from_bytes(srcbytes); - let crate = parser::parse_crate_from_source_str(infile, src, cfg, - sess.get_parse_sess()); + let crate = + parser::parse_crate_from_source_str(infile, src, cfg, + sess.get_parse_sess()); ret {crate: crate, src: src}; } -fn time<T>(do_it: bool, what: str, thunk: fn() -> T ) -> T { +fn time<T>(do_it: bool, what: str, thunk: fn() -> T) -> T { if !do_it { ret thunk(); } let start = std::time::precise_time_s(); let rv = thunk(); let end = std::time::precise_time_s(); - log_err #fmt("time: %s took %s s", what, - common::float_to_str(end - start, 3u)); + log_err #fmt["time: %s took %s s", what, + common::float_to_str(end - start, 3u)]; ret rv; } @@ -143,7 +141,7 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str, bind middle::ast_map::map_crate(*crate)); time(time_passes, "external crate/lib resolution", bind creader::read_crates(sess, *crate)); - let {def_map, ext_map} = + let {def_map: def_map, ext_map: ext_map} = time(time_passes, "resolution", bind resolve::resolve_crate(sess, ast_map, crate)); let freevars = @@ -151,9 +149,9 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str, bind freevars::annotate_freevars(sess, def_map, crate)); let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, ast_map, freevars); time::<()>(time_passes, "typechecking", - bind typeck::check_crate(ty_cx, crate)); + bind typeck::check_crate(ty_cx, crate)); time::<()>(time_passes, "alt checking", - bind middle::check_alt::check_crate(ty_cx, crate)); + bind middle::check_alt::check_crate(ty_cx, crate)); if sess.get_opts().run_typestate { time(time_passes, "typestate checking", bind middle::tstate::ck::check_crate(ty_cx, crate)); @@ -161,15 +159,15 @@ fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: str, time(time_passes, "alias checking", bind middle::alias::check_crate(ty_cx, crate)); time::<()>(time_passes, "kind checking", - bind kind::check_crate(ty_cx, crate)); + bind kind::check_crate(ty_cx, crate)); if sess.get_opts().no_trans { ret; } let llmod = time::<llvm::llvm::ModuleRef>(time_passes, "translation", - bind trans::trans_crate(sess, crate, - ty_cx, output, - ast_map)); + bind trans::trans_crate(sess, crate, + ty_cx, output, + ast_map)); time::<()>(time_passes, "LLVM passes", - bind link::write::run_passes(sess, llmod, output)); + bind link::write::run_passes(sess, llmod, output)); } fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str, @@ -222,7 +220,8 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str, alt ppm { ppm_typed. { let amap = middle::ast_map::map_crate(*crate); - let {def_map, ext_map} = resolve::resolve_crate(sess, amap, crate); + let {def_map: def_map, ext_map: ext_map} = + resolve::resolve_crate(sess, amap, crate); let freevars = freevars::annotate_freevars(sess, def_map, crate); let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, amap, freevars); typeck::check_crate(ty_cx, crate); @@ -239,14 +238,14 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg, input: str, fn version(argv0: str) { let vers = "unknown version"; - let env_vers = #env("CFG_VERSION"); + let env_vers = #env["CFG_VERSION"]; if str::byte_len(env_vers) != 0u { vers = env_vers; } - io::stdout().write_str(#fmt("%s %s\n", argv0, vers)); + io::stdout().write_str(#fmt["%s %s\n", argv0, vers]); } fn usage(argv0: str) { - io::stdout().write_str(#fmt("usage: %s [options] <input>\n", argv0) + - " + io::stdout().write_str(#fmt["usage: %s [options] <input>\n", argv0] + + " options: -h --help display this message @@ -287,9 +286,9 @@ fn get_os(triple: str) -> session::os { ret if str::find(triple, "win32") >= 0 || str::find(triple, "mingw32") >= 0 { session::os_win32 - } else if (str::find(triple, "darwin") >= 0) { + } else if str::find(triple, "darwin") >= 0 { session::os_macos - } else if (str::find(triple, "linux") >= 0) { + } else if str::find(triple, "linux") >= 0 { session::os_linux } else { log_err "Unknown operating system!"; fail }; } @@ -300,10 +299,10 @@ fn get_arch(triple: str) -> session::arch { str::find(triple, "i686") >= 0 || str::find(triple, "i786") >= 0 { session::arch_x86 - } else if (str::find(triple, "x86_64") >= 0) { + } else if str::find(triple, "x86_64") >= 0 { session::arch_x64 - } else if (str::find(triple, "arm") >= 0 || - str::find(triple, "xscale") >= 0) { + } else if str::find(triple, "arm") >= 0 || + str::find(triple, "xscale") >= 0 { session::arch_arm } else { log_err "Unknown architecture! " + triple; fail }; } @@ -331,9 +330,9 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str) let library = opt_present(match, "lib"); let static = opt_present(match, "static"); - let library_search_paths = ~[binary_dir + "/lib"]; + let library_search_paths = [binary_dir + "/lib"]; let lsp_vec = getopts::opt_strs(match, "L"); - for lsp: str in lsp_vec { library_search_paths += ~[lsp]; } + for lsp: str in lsp_vec { library_search_paths += [lsp]; } let parse_only = opt_present(match, "parse-only"); let no_trans = opt_present(match, "no-trans"); @@ -341,11 +340,11 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str) let output_type = if parse_only || no_trans { link::output_type_none - } else if (opt_present(match, "S")) { + } else if opt_present(match, "S") { link::output_type_assembly - } else if (opt_present(match, "c")) { + } else if opt_present(match, "c") { link::output_type_object - } else if (opt_present(match, "emit-llvm")) { + } else if opt_present(match, "emit-llvm") { link::output_type_bitcode } else { link::output_type_exe }; let verify = !opt_present(match, "noverify"); @@ -363,7 +362,7 @@ fn build_session_options(binary: str, match: getopts::match, binary_dir: str) fail; } 2u - } else if (opt_present(match, "OptLevel")) { + } else if opt_present(match, "OptLevel") { alt getopts::opt_str(match, "OptLevel") { "0" { 0u } "1" { 1u } @@ -417,24 +416,23 @@ fn build_session(sopts: @session::options) -> session::session { fn parse_pretty(sess: session::session, name: &str) -> pp_mode { if str::eq(name, "normal") { ret ppm_normal; - } else if (str::eq(name, "typed")) { + } else if str::eq(name, "typed") { ret ppm_typed; - } else if (str::eq(name, "identified")) { ret ppm_identified; } + } else if str::eq(name, "identified") { ret ppm_identified; } sess.fatal("argument to `pretty` or `expand` must be one of `normal`, " + "`typed`, or `identified`"); } fn opts() -> [getopts::opt] { - ret ~[optflag("h"), optflag("help"), optflag("v"), optflag("version"), - optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"), - optflagopt("expand"), optflag("ls"), optflag("parse-only"), - optflag("no-trans"), - optflag("O"), optopt("OptLevel"), optmulti("L"), optflag("S"), - optflag("c"), optopt("o"), optflag("g"), optflag("save-temps"), - optopt("sysroot"), optflag("stats"), optflag("time-passes"), - optflag("time-llvm-passes"), optflag("no-typestate"), - optflag("noverify"), optmulti("cfg"), optflag("test"), - optflag("lib"), optflag("static"), optflag("gc")]; + ret [optflag("h"), optflag("help"), optflag("v"), optflag("version"), + optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"), + optflagopt("expand"), optflag("ls"), optflag("parse-only"), + optflag("no-trans"), optflag("O"), optopt("OptLevel"), optmulti("L"), + optflag("S"), optflag("c"), optopt("o"), optflag("g"), + optflag("save-temps"), optopt("sysroot"), optflag("stats"), + optflag("time-passes"), optflag("time-llvm-passes"), + optflag("no-typestate"), optflag("noverify"), optmulti("cfg"), + optflag("test"), optflag("lib"), optflag("static"), optflag("gc")]; } fn main(args: [str]) { @@ -444,7 +442,7 @@ fn main(args: [str]) { alt getopts::getopts(args, opts()) { getopts::success(m) { m } getopts::failure(f) { - log_err #fmt("error: %s", getopts::fail_str(f)); + log_err #fmt["error: %s", getopts::fail_str(f)]; fail } }; @@ -471,10 +469,10 @@ fn main(args: [str]) { } if n_inputs == 0u { sess.fatal("No input filename given."); - } else if (n_inputs > 1u) { + } else if n_inputs > 1u { sess.fatal("Multiple input filenames provided."); } - let ifile = match.free.(0); + let ifile = match.free[0]; let saved_out_filename: str = ""; let cfg = build_configuration(sess, binary, ifile); let expand = @@ -502,10 +500,7 @@ fn main(args: [str]) { none::<pp_mode>. {/* continue */ } } let ls = opt_present(match, "ls"); - if ls { - metadata::creader::list_file_metadata(ifile, io::stdout()); - ret; - } + if ls { metadata::creader::list_file_metadata(ifile, io::stdout()); ret; } let stop_after_codegen = sopts.output_type != link::output_type_exe || @@ -516,29 +511,31 @@ fn main(args: [str]) { // "-" as input file will cause the parser to read from stdin so we // have to make up a name // We want to toss everything after the final '.' - let parts = if !input_is_stdin(ifile) { - str::split(ifile, '.' as u8) - } else { - ~["default", "rs"] - }; + let parts = + if !input_is_stdin(ifile) { + str::split(ifile, '.' as u8) + } else { ["default", "rs"] }; vec::pop(parts); saved_out_filename = str::connect(parts, "."); - let suffix = alt sopts.output_type { - link::output_type_none. { "none" } - link::output_type_bitcode. { "bc" } - link::output_type_assembly. { "s" } - // Object and exe output both use the '.o' extension here - link::output_type_object. | link::output_type_exe. { "o" } - }; + let suffix = + alt sopts.output_type { + link::output_type_none. { "none" } + link::output_type_bitcode. { "bc" } + link::output_type_assembly. { "s" } + + // Object and exe output both use the '.o' extension here + link::output_type_object. | link::output_type_exe. { + "o" + } + }; let ofile = saved_out_filename + "." + suffix; compile_input(sess, cfg, ifile, ofile); } some(ofile) { // FIXME: what about windows? This will create a foo.exe.o. saved_out_filename = ofile; - let temp_filename = if !stop_after_codegen { - ofile + ".o" - } else { ofile }; + let temp_filename = + if !stop_after_codegen { ofile + ".o" } else { ofile }; compile_input(sess, cfg, ifile, temp_filename); } } @@ -556,8 +553,8 @@ fn main(args: [str]) { // The invocations of gcc share some flags across platforms let gcc_args = - ~[stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename, - saved_out_filename + ".o"]; + [stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename, + saved_out_filename + ".o"]; let lib_cmd; let os = sess.get_targ_cfg().os; @@ -591,46 +588,45 @@ fn main(args: [str]) { let cstore = sess.get_cstore(); for cratepath: str in cstore::get_used_crate_files(cstore) { if str::ends_with(cratepath, ".rlib") { - gcc_args += ~[cratepath]; + gcc_args += [cratepath]; cont; } let dir = fs::dirname(cratepath); - if dir != "" { gcc_args += ~["-L" + dir]; } + if dir != "" { gcc_args += ["-L" + dir]; } let libarg = unlib(sess.get_targ_cfg(), fs::basename(cratepath)); - gcc_args += ~["-l" + libarg]; + gcc_args += ["-l" + libarg]; } let ula = cstore::get_used_link_args(cstore); - for arg: str in ula { gcc_args += ~[arg]; } + for arg: str in ula { gcc_args += [arg]; } let used_libs = cstore::get_used_libraries(cstore); - for l: str in used_libs { gcc_args += ~["-l" + l]; } + for l: str in used_libs { gcc_args += ["-l" + l]; } if sopts.library { - gcc_args += ~[lib_cmd]; + gcc_args += [lib_cmd]; } else { // FIXME: why do we hardcode -lm? - gcc_args += ~["-lm", main]; + gcc_args += ["-lm", main]; } // We run 'gcc' here let err_code = run::run_program(prog, gcc_args); if 0 != err_code { - sess.err(#fmt("linking with gcc failed with code %d", err_code)); - sess.note(#fmt("gcc arguments: %s", - str::connect(gcc_args, " "))); + sess.err(#fmt["linking with gcc failed with code %d", err_code]); + sess.note(#fmt["gcc arguments: %s", str::connect(gcc_args, " ")]); sess.abort_if_errors(); } // Clean up on Darwin if sess.get_targ_cfg().os == session::os_macos { - run::run_program("dsymutil", ~[saved_out_filename]); + run::run_program("dsymutil", [saved_out_filename]); } // Remove the temporary object file if we aren't saving temps if !sopts.save_temps { - run::run_program("rm", ~[saved_out_filename + ".o"]); + run::run_program("rm", [saved_out_filename + ".o"]); } } @@ -641,7 +637,7 @@ mod test { #[test] fn test_switch_implies_cfg_test() { let match = - alt getopts::getopts(~["--test"], opts()) { + alt getopts::getopts(["--test"], opts()) { getopts::success(m) { m } }; let sessopts = build_session_options("whatever", match, "whatever"); @@ -655,7 +651,7 @@ mod test { #[test] fn test_switch_implies_cfg_test_unless_cfg_test() { let match = - alt getopts::getopts(~["--test", "--cfg=test"], opts()) { + alt getopts::getopts(["--test", "--cfg=test"], opts()) { getopts::success(m) { m } }; let sessopts = build_session_options("whatever", match, "whatever"); diff --git a/src/comp/driver/session.rs b/src/comp/driver/session.rs index ea3eae60767..5a2b26739aa 100644 --- a/src/comp/driver/session.rs +++ b/src/comp/driver/session.rs @@ -43,8 +43,7 @@ type options = test: bool, parse_only: bool, no_trans: bool, - do_gc: bool - }; + do_gc: bool}; type crate_metadata = {name: str, data: [u8]}; @@ -90,10 +89,10 @@ obj session(targ_cfg: @config, } fn note(msg: str) { codemap::emit_note(none, msg, parse_sess.cm); } fn span_bug(sp: span, msg: str) -> ! { - self.span_fatal(sp, #fmt("internal compiler error %s", msg)); + self.span_fatal(sp, #fmt["internal compiler error %s", msg]); } fn bug(msg: str) -> ! { - self.fatal(#fmt("internal compiler error %s", msg)); + self.fatal(#fmt["internal compiler error %s", msg]); } fn span_unimpl(sp: span, msg: str) -> ! { self.span_bug(sp, "unimplemented " + msg); diff --git a/src/comp/front/attr.rs b/src/comp/front/attr.rs index c06e1810497..0f3eb354d9e 100644 --- a/src/comp/front/attr.rs +++ b/src/comp/front/attr.rs @@ -30,7 +30,7 @@ export mk_attr; // From a list of crate attributes get only the meta_items that impact crate // linkage fn find_linkage_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] { - let metas: [@ast::meta_item] = ~[]; + let metas: [@ast::meta_item] = []; for attr: ast::attribute in find_attrs_by_name(attrs, "link") { alt attr.node.value.node { ast::meta_list(_, items) { metas += items; } @@ -95,8 +95,8 @@ fn attr_meta(attr: &ast::attribute) -> @ast::meta_item { @attr.node.value } // Get the meta_items from inside a vector of attributes fn attr_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] { - let mitems = ~[]; - for a: ast::attribute in attrs { mitems += ~[attr_meta(a)]; } + let mitems = []; + for a: ast::attribute in attrs { mitems += [attr_meta(a)]; } ret mitems; } @@ -122,11 +122,11 @@ fn eq(a: @ast::meta_item, b: @ast::meta_item) -> bool { } fn contains(haystack: &[@ast::meta_item], needle: @ast::meta_item) -> bool { - log #fmt("looking for %s", - syntax::print::pprust::meta_item_to_str(*needle)); + log #fmt["looking for %s", + syntax::print::pprust::meta_item_to_str(*needle)]; for item: @ast::meta_item in haystack { - log #fmt("looking in %s", - syntax::print::pprust::meta_item_to_str(*item)); + log #fmt["looking in %s", + syntax::print::pprust::meta_item_to_str(*item)]; if eq(item, needle) { log "found it!"; ret true; } } log "found it not :("; @@ -152,13 +152,13 @@ fn sort_meta_items(items: &[@ast::meta_item]) -> [@ast::meta_item] { } // This is sort of stupid here, converting to a vec of mutables and back - let v: [mutable @ast::meta_item] = ~[mutable]; - for mi: @ast::meta_item in items { v += ~[mutable mi]; } + let v: [mutable @ast::meta_item] = [mutable]; + for mi: @ast::meta_item in items { v += [mutable mi]; } std::sort::quick_sort(lteq, v); - let v2: [@ast::meta_item] = ~[]; - for mi: @ast::meta_item in v { v2 += ~[mi]; } + let v2: [@ast::meta_item] = []; + for mi: @ast::meta_item in v { v2 += [mi]; } ret v2; } @@ -176,14 +176,13 @@ fn remove_meta_items_by_name(items: &[@ast::meta_item], name: str) -> ret vec::filter_map(filter, items); } -fn require_unique_names(sess: &session::session, - metas: &[@ast::meta_item]) { +fn require_unique_names(sess: &session::session, metas: &[@ast::meta_item]) { let map = map::mk_hashmap::<str, ()>(str::hash, str::eq); for meta: @ast::meta_item in metas { let name = get_meta_item_name(meta); if map.contains_key(name) { sess.span_fatal(meta.span, - #fmt("duplicate meta item `%s`", name)); + #fmt["duplicate meta item `%s`", name]); } map.insert(name, ()); } diff --git a/src/comp/front/config.rs b/src/comp/front/config.rs index 4a9eeac0d22..4aa1c07be57 100644 --- a/src/comp/front/config.rs +++ b/src/comp/front/config.rs @@ -115,7 +115,7 @@ fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool { } } let cfg_metas = attr::attr_metas(item_cfg_attrs); - vec::foldl(extract_metas, ~[], cfg_metas) + vec::foldl(extract_metas, [], cfg_metas) }; for cfg_mi: @ast::meta_item in item_cfg_metas { diff --git a/src/comp/front/test.rs b/src/comp/front/test.rs index 5bb5912630f..93ddaa54559 100644 --- a/src/comp/front/test.rs +++ b/src/comp/front/test.rs @@ -9,7 +9,7 @@ import front::attr; export modify_for_testing; -type node_id_gen = @fn() -> ast::node_id ; +type node_id_gen = @fn() -> ast::node_id; type test = {path: [ast::ident], ignore: bool}; @@ -36,8 +36,8 @@ fn modify_for_testing(crate: @ast::crate) -> @ast::crate { let cx: test_ctxt = @{next_node_id: next_node_id_fn, - mutable path: ~[], - mutable testfns: ~[]}; + mutable path: [], + mutable testfns: []}; let precursor = {fold_crate: bind fold_crate(cx, _, _), @@ -51,8 +51,8 @@ fn modify_for_testing(crate: @ast::crate) -> @ast::crate { ret res; } -fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold) - -> ast::_mod { +fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold) -> + ast::_mod { // Remove any defined main function from the AST so it doesn't clash with // the one we're going to add. FIXME: This is sloppy. Instead we should @@ -87,14 +87,14 @@ fn fold_crate(cx: &test_ctxt, c: &ast::crate_, fld: fold::ast_fold) -> fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) -> @ast::item { - cx.path += ~[i.ident]; - log #fmt("current path: %s", ast::path_name_i(cx.path)); + cx.path += [i.ident]; + log #fmt["current path: %s", ast::path_name_i(cx.path)]; if is_test_fn(i) { log "this is a test function"; let test = {path: cx.path, ignore: is_ignored(i)}; - cx.testfns += ~[test]; - log #fmt("have %u test functions", vec::len(cx.testfns)); + cx.testfns += [test]; + log #fmt["have %u test functions", vec::len(cx.testfns)]; } let res = fold::noop_fold_item(i, fld); @@ -127,7 +127,7 @@ fn is_ignored(i: &@ast::item) -> bool { fn add_test_module(cx: &test_ctxt, m: &ast::_mod) -> ast::_mod { let testmod = mk_test_module(cx); - ret {items: m.items + ~[testmod] with m}; + ret {items: m.items + [testmod] with m}; } /* @@ -154,16 +154,16 @@ fn mk_test_module(cx: &test_ctxt) -> @ast::item { // The synthesized main function which will call the console test runner // with our list of tests let mainfn = mk_main(cx); - let testmod: ast::_mod = {view_items: ~[], items: ~[mainfn, testsfn]}; + let testmod: ast::_mod = {view_items: [], items: [mainfn, testsfn]}; let item_ = ast::item_mod(testmod); let item: ast::item = {ident: "__test", - attrs: ~[], + attrs: [], id: cx.next_node_id(), node: item_, span: ast::dummy_sp()}; - log #fmt("Synthetic test module:\n%s\n", pprust::item_to_str(@item)); + log #fmt["Synthetic test module:\n%s\n", pprust::item_to_str(@item)]; ret @item; } @@ -176,27 +176,27 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item { let ret_ty = mk_test_desc_vec_ty(cx); let decl: ast::fn_decl = - {inputs: ~[], + {inputs: [], output: ret_ty, purity: ast::impure_fn, il: ast::il_normal, cf: ast::return, - constraints: ~[]}; + constraints: []}; let proto = ast::proto_fn; // The vector of test_descs for this crate let test_descs = mk_test_desc_vec(cx); let body_: ast::blk_ = - {stmts: ~[], expr: option::some(test_descs), id: cx.next_node_id()}; + {stmts: [], expr: option::some(test_descs), id: cx.next_node_id()}; let body = nospan(body_); let fn_ = {decl: decl, proto: proto, body: body}; - let item_ = ast::item_fn(fn_, ~[]); + let item_ = ast::item_fn(fn_, []); let item: ast::item = {ident: "tests", - attrs: ~[], + attrs: [], id: cx.next_node_id(), node: item_, span: ast::dummy_sp()}; @@ -205,10 +205,10 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item { fn empty_fn_ty() -> ast::ty { let proto = ast::proto_fn; - let input_ty = ~[]; + let input_ty = []; let ret_ty = @nospan(ast::ty_nil); let cf = ast::return; - let constrs = ~[]; + let constrs = []; ret nospan(ast::ty_fn(proto, input_ty, ret_ty, cf, constrs)); } @@ -216,8 +216,8 @@ fn empty_fn_ty() -> ast::ty { fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty { let test_desc_ty_path: ast::path = nospan({global: false, - idents: ~["std", "test", "test_desc"], - types: ~[]}); + idents: ["std", "test", "test_desc"], + types: []}); let test_desc_ty: ast::ty = nospan(ast::ty_path(test_desc_ty_path, cx.next_node_id())); @@ -228,11 +228,11 @@ fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty { } fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr { - log #fmt("building test vector from %u tests", vec::len(cx.testfns)); - let descs = ~[]; + log #fmt["building test vector from %u tests", vec::len(cx.testfns)]; + let descs = []; for test: test in cx.testfns { let test_ = test; // Satisfy alias analysis - descs += ~[mk_test_desc_rec(cx, test_)]; + descs += [mk_test_desc_rec(cx, test_)]; } ret @{id: cx.next_node_id(), @@ -243,7 +243,7 @@ fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr { fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { let path = test.path; - log #fmt("encoding %s", ast::path_name_i(path)); + log #fmt["encoding %s", ast::path_name_i(path)]; let name_lit: ast::lit = nospan(ast::lit_str(ast::path_name_i(path), ast::sk_rc)); @@ -255,8 +255,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { let name_field: ast::field = nospan({mut: ast::imm, ident: "name", expr: @name_expr}); - let fn_path: ast::path = - nospan({global: false, idents: path, types: ~[]}); + let fn_path: ast::path = nospan({global: false, idents: path, types: []}); let fn_expr: ast::expr = {id: cx.next_node_id(), @@ -277,7 +276,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr { nospan({mut: ast::imm, ident: "ignore", expr: @ignore_expr}); let desc_rec_: ast::expr_ = - ast::expr_rec(~[name_field, fn_field, ignore_field], option::none); + ast::expr_rec([name_field, fn_field, ignore_field], option::none); let desc_rec: ast::expr = {id: cx.next_node_id(), node: desc_rec_, span: ast::dummy_sp()}; ret @desc_rec; @@ -294,28 +293,28 @@ fn mk_main(cx: &test_ctxt) -> @ast::item { let ret_ty = nospan(ast::ty_nil); let decl: ast::fn_decl = - {inputs: ~[args_arg], + {inputs: [args_arg], output: @ret_ty, purity: ast::impure_fn, il: ast::il_normal, cf: ast::return, - constraints: ~[]}; + constraints: []}; let proto = ast::proto_fn; let test_main_call_expr = mk_test_main_call(cx); let body_: ast::blk_ = - {stmts: ~[], + {stmts: [], expr: option::some(test_main_call_expr), id: cx.next_node_id()}; let body = {node: body_, span: ast::dummy_sp()}; let fn_ = {decl: decl, proto: proto, body: body}; - let item_ = ast::item_fn(fn_, ~[]); + let item_ = ast::item_fn(fn_, []); let item: ast::item = {ident: "main", - attrs: ~[], + attrs: [], id: cx.next_node_id(), node: item_, span: ast::dummy_sp()}; @@ -326,38 +325,32 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr { // Get the args passed to main so we can pass the to test_main let args_path: ast::path = - nospan({global: false, idents: ~["args"], types: ~[]}); + nospan({global: false, idents: ["args"], types: []}); let args_path_expr_: ast::expr_ = ast::expr_path(args_path); let args_path_expr: ast::expr = - {id: cx.next_node_id(), - node: args_path_expr_, - span: ast::dummy_sp()}; + {id: cx.next_node_id(), node: args_path_expr_, span: ast::dummy_sp()}; // Call __test::test to generate the vector of test_descs let test_path: ast::path = - nospan({global: false, idents: ~["tests"], types: ~[]}); + nospan({global: false, idents: ["tests"], types: []}); let test_path_expr_: ast::expr_ = ast::expr_path(test_path); let test_path_expr: ast::expr = - {id: cx.next_node_id(), - node: test_path_expr_, - span: ast::dummy_sp()}; + {id: cx.next_node_id(), node: test_path_expr_, span: ast::dummy_sp()}; - let test_call_expr_: ast::expr_ = ast::expr_call(@test_path_expr, ~[]); + let test_call_expr_: ast::expr_ = ast::expr_call(@test_path_expr, []); let test_call_expr: ast::expr = - {id: cx.next_node_id(), - node: test_call_expr_, - span: ast::dummy_sp()}; + {id: cx.next_node_id(), node: test_call_expr_, span: ast::dummy_sp()}; // Call std::test::test_main let test_main_path: ast::path = nospan({global: false, - idents: ~["std", "test", "test_main"], - types: ~[]}); + idents: ["std", "test", "test_main"], + types: []}); let test_main_path_expr_: ast::expr_ = ast::expr_path(test_main_path); @@ -368,7 +361,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr { let test_main_call_expr_: ast::expr_ = ast::expr_call(@test_main_path_expr, - ~[@args_path_expr, @test_call_expr]); + [@args_path_expr, @test_call_expr]); let test_main_call_expr: ast::expr = {id: cx.next_node_id(), diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs index 9d80972ffb5..5a4dcdc5e0d 100644 --- a/src/comp/lib/llvm.rs +++ b/src/comp/lib/llvm.rs @@ -81,20 +81,20 @@ const LLVMOptimizeForSizeAttribute: uint = 8192u; const LLVMStackProtectAttribute: uint = 16384u; const LLVMStackProtectReqAttribute: uint = 32768u; const LLVMAlignmentAttribute: uint = 2031616u; - // 31 << 16 +// 31 << 16 const LLVMNoCaptureAttribute: uint = 2097152u; const LLVMNoRedZoneAttribute: uint = 4194304u; const LLVMNoImplicitFloatAttribute: uint = 8388608u; const LLVMNakedAttribute: uint = 16777216u; const LLVMInlineHintAttribute: uint = 33554432u; const LLVMStackAttribute: uint = 469762048u; - // 7 << 26 +// 7 << 26 const LLVMUWTableAttribute: uint = 1073741824u; - // 1 << 30 +// 1 << 30 - // Consts for the LLVM IntPredicate type, pre-cast to uint. - // FIXME: as above. +// Consts for the LLVM IntPredicate type, pre-cast to uint. +// FIXME: as above. const LLVMIntEQ: uint = 32u; @@ -276,9 +276,9 @@ native "cdecl" mod llvm = "rustllvm" { /* Operations on constants of any type */ fn LLVMConstNull(Ty: TypeRef) -> ValueRef; - /* all zeroes */ + /* all zeroes */ fn LLVMConstAllOnes(Ty: TypeRef) -> ValueRef; - /* only for int/vector */ + /* only for int/vector */ fn LLVMGetUndef(Ty: TypeRef) -> ValueRef; fn LLVMIsConstant(Val: ValueRef) -> Bool; fn LLVMIsNull(Val: ValueRef) -> Bool; @@ -809,19 +809,19 @@ native "cdecl" mod llvm = "rustllvm" { Value: Bool); fn LLVMPassManagerBuilderSetDisableUnrollLoops(PMB: PassManagerBuilderRef, Value: Bool); - fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls(PMB: - PassManagerBuilderRef, - Value: Bool); - fn LLVMPassManagerBuilderUseInlinerWithThreshold(PMB: - PassManagerBuilderRef, - threshold: uint); - fn LLVMPassManagerBuilderPopulateModulePassManager(PMB: - PassManagerBuilderRef, - PM: PassManagerRef); - - fn LLVMPassManagerBuilderPopulateFunctionPassManager(PMB: - PassManagerBuilderRef, - PM: PassManagerRef); + fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls( + PMB: PassManagerBuilderRef, + Value: Bool); + fn LLVMPassManagerBuilderUseInlinerWithThreshold( + PMB: PassManagerBuilderRef, + threshold: uint); + fn LLVMPassManagerBuilderPopulateModulePassManager( + PMB: PassManagerBuilderRef, + PM: PassManagerRef); + + fn LLVMPassManagerBuilderPopulateFunctionPassManager( + PMB: PassManagerBuilderRef, + PM: PassManagerRef); /** Destroys a memory buffer. */ fn LLVMDisposeMemoryBuffer(MemBuf: MemoryBufferRef); @@ -905,68 +905,68 @@ native "cdecl" mod llvm = "rustllvm" { * it's attached to. */ -resource BuilderRef_res(B: BuilderRef) { - llvm::LLVMDisposeBuilder(B); -} +resource BuilderRef_res(B: BuilderRef) { llvm::LLVMDisposeBuilder(B); } + +obj builder(B: BuilderRef, + terminated: @mutable bool, -obj builder(B: BuilderRef, terminated: @mutable bool, // Stored twice so that we don't have to constantly deref res: @BuilderRef_res) { /* Terminators */ fn RetVoid() -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildRetVoid(B); } fn Ret(V: ValueRef) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildRet(B, V); } fn AggregateRet(RetVals: &[ValueRef]) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildAggregateRet(B, vec::to_ptr(RetVals), vec::len(RetVals)); } fn Br(Dest: BasicBlockRef) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildBr(B, Dest); } fn CondBr(If: ValueRef, Then: BasicBlockRef, Else: BasicBlockRef) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildCondBr(B, If, Then, Else); } fn Switch(V: ValueRef, Else: BasicBlockRef, NumCases: uint) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildSwitch(B, V, Else, NumCases); } fn IndirectBr(Addr: ValueRef, NumDests: uint) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildIndirectBr(B, Addr, NumDests); } fn Invoke(Fn: ValueRef, Args: &[ValueRef], Then: BasicBlockRef, Catch: BasicBlockRef) -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildInvoke(B, Fn, vec::to_ptr(Args), vec::len(Args), Then, Catch, str::buf("")); } fn Unreachable() -> ValueRef { - assert (!*terminated); + assert (!*terminated);; *terminated = true; ret llvm::LLVMBuildUnreachable(B); } @@ -1402,14 +1402,12 @@ obj builder(B: BuilderRef, terminated: @mutable bool, let T: ValueRef = llvm::LLVMGetNamedFunction(M, str::buf("llvm.trap")); assert (T as int != 0); - let Args: [ValueRef] = ~[]; + let Args: [ValueRef] = []; ret llvm::LLVMBuildCall(B, T, vec::to_ptr(Args), vec::len(Args), str::buf("")); } - fn is_terminated() -> bool { - ret *terminated; - } + fn is_terminated() -> bool { ret *terminated; } } fn new_builder(llbb: BasicBlockRef) -> builder { @@ -1454,7 +1452,7 @@ fn mk_type_names() -> type_names { } fn type_to_str(names: type_names, ty: TypeRef) -> str { - ret type_to_str_inner(names, ~[], ty); + ret type_to_str_inner(names, [], ty); } fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> @@ -1462,7 +1460,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> if names.type_has_name(ty) { ret names.get_name(ty); } - let outer = outer0 + ~[ty]; + let outer = outer0 + [ty]; let kind: int = llvm::LLVMGetTypeKind(ty); @@ -1480,6 +1478,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> alt kind { + // FIXME: more enum-as-int constants determined from Core::h; // horrible, horrible. Complete as needed. @@ -1494,11 +1493,13 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> 6 { ret "Label"; } + 7 { ret "i" + std::int::str(llvm::LLVMGetIntTypeWidth(ty) as int); } + 8 { let s = "fn("; let out_ty: TypeRef = llvm::LLVMGetReturnType(ty); @@ -1512,6 +1513,7 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> } + 9 { let s: str = "{"; let n_elts: uint = llvm::LLVMCountStructElementTypes(ty); @@ -1523,12 +1525,14 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> } + 10 { let el_ty = llvm::LLVMGetElementType(ty); ret "[" + type_to_str_inner(names, outer, el_ty) + "]"; } + 11 { let i: uint = 0u; for tout: TypeRef in outer0 { @@ -1543,12 +1547,13 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) -> } + 12 { ret "Opaque"; } 13 { ret "Vector"; } 14 { ret "Metadata"; } - _ { log_err #fmt("unknown TypeKind %d", kind as int); fail; } + _ { log_err #fmt["unknown TypeKind %d", kind as int]; fail; } } } diff --git a/src/comp/metadata/creader.rs b/src/comp/metadata/creader.rs index 4adceacdfde..fd233ad4443 100644 --- a/src/comp/metadata/creader.rs +++ b/src/comp/metadata/creader.rs @@ -67,7 +67,7 @@ fn visit_item(e: env, i: &@ast::item) { } let cstore = e.sess.get_cstore(); if !cstore::add_used_library(cstore, m.native_name) { ret; } - for a: ast::attribute in + for a: ast::attribute in attr::find_attrs_by_name(i.attrs, "link_args") { alt attr::get_meta_item_value_str(attr::attr_meta(a)) { some(linkarg) { cstore::add_used_link_args(cstore, linkarg); } @@ -93,12 +93,12 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool { let attrs = decoder::get_crate_attributes(crate_data); let linkage_metas = attr::find_linkage_metas(attrs); - log #fmt("matching %u metadata requirements against %u items", - vec::len(metas), vec::len(linkage_metas)); + log #fmt["matching %u metadata requirements against %u items", + vec::len(metas), vec::len(linkage_metas)]; for needed: @ast::meta_item in metas { if !attr::contains(linkage_metas, needed) { - log #fmt("missing %s", pprust::meta_item_to_str(*needed)); + log #fmt["missing %s", pprust::meta_item_to_str(*needed)]; ret false; } } @@ -116,26 +116,26 @@ fn default_native_lib_naming(sess: session::session, static: bool) -> } fn find_library_crate(sess: &session::session, ident: &ast::ident, - metas: &[@ast::meta_item], - library_search_paths: &[str]) -> - option::t<{ident: str, data: @[u8]}> { + metas: &[@ast::meta_item], library_search_paths: &[str]) + -> option::t<{ident: str, data: @[u8]}> { attr::require_unique_names(sess, metas); // FIXME: Probably want a warning here since the user // is using the wrong type of meta item - let crate_name = { - let name_items = attr::find_meta_items_by_name(metas, "name"); - alt vec::last(name_items) { - some(i) { - alt attr::get_meta_item_value_str(i) { - some(n) { n } - _ { ident } + let crate_name = + { + let name_items = attr::find_meta_items_by_name(metas, "name"); + alt vec::last(name_items) { + some(i) { + alt attr::get_meta_item_value_str(i) { + some(n) { n } + _ { ident } + } + } + none. { ident } } - } - none. { ident } - } - }; + }; let nn = default_native_lib_naming(sess, sess.get_opts().static); let x = @@ -157,23 +157,23 @@ fn find_library_crate_aux(nn: &{prefix: str, suffix: str}, crate_name: str, // manually filtering fs::list_dir here. for library_search_path: str in library_search_paths { - log #fmt("searching %s", library_search_path); + log #fmt["searching %s", library_search_path]; for path: str in fs::list_dir(library_search_path) { - log #fmt("searching %s", path); + log #fmt["searching %s", path]; let f: str = fs::basename(path); if !(str::starts_with(f, prefix) && str::ends_with(f, nn.suffix)) { - log #fmt("skipping %s, doesn't look like %s*%s", path, prefix, - nn.suffix); + log #fmt["skipping %s, doesn't look like %s*%s", path, prefix, + nn.suffix]; cont; } alt get_metadata_section(path) { option::some(cvec) { if !metadata_matches(cvec, metas) { - log #fmt("skipping %s, metadata doesn't match", path); + log #fmt["skipping %s, metadata doesn't match", path]; cont; } - log #fmt("found %s with matching metadata", path); + log #fmt["found %s with matching metadata", path]; ret some({ident: path, data: cvec}); } _ { } @@ -204,15 +204,14 @@ fn get_metadata_section(filename: str) -> option::t<@[u8]> { } fn load_library_crate(sess: &session::session, span: span, ident: &ast::ident, - metas: &[@ast::meta_item], - library_search_paths: &[str]) -> - {ident: str, data: @[u8]} { + metas: &[@ast::meta_item], library_search_paths: &[str]) + -> {ident: str, data: @[u8]} { alt find_library_crate(sess, ident, metas, library_search_paths) { some(t) { ret t; } none. { - sess.span_fatal(span, #fmt("can't find crate for '%s'", ident)); + sess.span_fatal(span, #fmt["can't find crate for '%s'", ident]); } } } @@ -253,7 +252,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map { for dep: decoder::crate_dep in decoder::get_crate_deps(cdata) { let extrn_cnum = dep.cnum; let cname = dep.ident; - log #fmt("resolving dep %s", cname); + log #fmt["resolving dep %s", cname]; if e.crate_cache.contains_key(cname) { log "already have it"; // We've already seen this crate @@ -264,7 +263,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map { // This is a new one so we've got to load it // FIXME: Need better error reporting than just a bogus span let fake_span = ast::dummy_sp(); - let local_cnum = resolve_crate(e, cname, ~[], fake_span); + let local_cnum = resolve_crate(e, cname, [], fake_span); cnum_map.insert(extrn_cnum, local_cnum); } } diff --git a/src/comp/metadata/cstore.rs b/src/comp/metadata/cstore.rs index 155597f94fa..ed737e046ec 100644 --- a/src/comp/metadata/cstore.rs +++ b/src/comp/metadata/cstore.rs @@ -56,9 +56,9 @@ fn mk_cstore() -> cstore { let crate_map = map::new_int_hash::<ast::crate_num>(); ret private(@{metas: meta_cache, use_crate_map: crate_map, - mutable used_crate_files: ~[], - mutable used_libraries: ~[], - mutable used_link_args: ~[]}); + mutable used_crate_files: [], + mutable used_libraries: [], + mutable used_link_args: []}); } fn get_crate_data(cstore: &cstore, cnum: ast::crate_num) -> crate_metadata { @@ -76,7 +76,7 @@ fn have_crate_data(cstore: &cstore, cnum: ast::crate_num) -> bool { iter iter_crate_data(cstore: &cstore) -> @{key: ast::crate_num, val: crate_metadata} { - for each kv: @{key: ast::crate_num, val: crate_metadata} in + for each kv: @{key: ast::crate_num, val: crate_metadata} in p(cstore).metas.items() { put kv; } @@ -84,7 +84,7 @@ iter iter_crate_data(cstore: &cstore) -> fn add_used_crate_file(cstore: &cstore, lib: &str) { if !vec::member(lib, p(cstore).used_crate_files) { - p(cstore).used_crate_files += ~[lib]; + p(cstore).used_crate_files += [lib]; } } @@ -97,7 +97,7 @@ fn add_used_library(cstore: &cstore, lib: &str) -> bool { if vec::member(lib, p(cstore).used_libraries) { ret false; } - p(cstore).used_libraries += ~[lib]; + p(cstore).used_libraries += [lib]; ret true; } diff --git a/src/comp/metadata/decoder.rs b/src/comp/metadata/decoder.rs index dcb5fa2488d..972334ddfc7 100644 --- a/src/comp/metadata/decoder.rs +++ b/src/comp/metadata/decoder.rs @@ -33,9 +33,9 @@ export external_resolver; // def_id for an item defined in another crate, somebody needs to figure out // what crate that's in and give us a def_id that makes sense for the current // build. -type external_resolver = fn(&ast::def_id) -> ast::def_id ; +type external_resolver = fn(&ast::def_id) -> ast::def_id; -fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool , hash: uint) -> +fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool, hash: uint) -> [ebml::doc] { let index = ebml::get_doc(d, tag_index); let table = ebml::get_doc(index, tag_index_table); @@ -44,19 +44,18 @@ fn lookup_hash(d: &ebml::doc, eq_fn: fn(&[u8]) -> bool , hash: uint) -> let bucket = ebml::doc_at(d.data, pos); // Awkward logic because we can't ret from foreach yet - let result: [ebml::doc] = ~[]; + let result: [ebml::doc] = []; let belt = tag_index_buckets_bucket_elt; for each elt: ebml::doc in ebml::tagged_docs(bucket, belt) { let pos = ebml::be_uint_from_bytes(elt.data, elt.start, 4u); if eq_fn(vec::slice::<u8>(*elt.data, elt.start + 4u, elt.end)) { - result += ~[ebml::doc_at(d.data, pos)]; + result += [ebml::doc_at(d.data, pos)]; } } ret result; } -fn maybe_find_item(item_id: int, items: &ebml::doc) -> - option::t<ebml::doc> { +fn maybe_find_item(item_id: int, items: &ebml::doc) -> option::t<ebml::doc> { fn eq_item(bytes: &[u8], item_id: int) -> bool { ret ebml::be_uint_from_bytes(@bytes, 0u, 4u) as int == item_id; } @@ -64,7 +63,7 @@ fn maybe_find_item(item_id: int, items: &ebml::doc) -> let found = lookup_hash(items, eqer, hash_node_id(item_id)); if vec::len(found) == 0u { ret option::none::<ebml::doc>; - } else { ret option::some::<ebml::doc>(found.(0)); } + } else { ret option::some::<ebml::doc>(found[0]); } } fn find_item(item_id: int, items: &ebml::doc) -> ebml::doc { @@ -115,19 +114,20 @@ fn item_type(item: &ebml::doc, this_cnum: ast::crate_num, tcx: ty::ctxt, } fn item_ty_param_kinds(item: &ebml::doc) -> [ast::kind] { - let ks: [ast::kind] = ~[]; + let ks: [ast::kind] = []; let tp = tag_items_data_item_ty_param_kinds; for each p: ebml::doc in ebml::tagged_docs(item, tp) { - let dat : [u8] = ebml::doc_data(p); + let dat: [u8] = ebml::doc_data(p); let vi = ebml::vint_at(dat, 0u); let i = 0u; while i < vi.val { - let k = alt dat.(vi.next + i) as char { - 'u' { ast::kind_unique } - 's' { ast::kind_shared } - 'p' { ast::kind_pinned } - }; - ks += ~[k]; + let k = + alt dat[vi.next + i] as char { + 'u' { ast::kind_unique } + 's' { ast::kind_shared } + 'p' { ast::kind_pinned } + }; + ks += [k]; i += 1u; } } @@ -136,11 +136,11 @@ fn item_ty_param_kinds(item: &ebml::doc) -> [ast::kind] { fn tag_variant_ids(item: &ebml::doc, this_cnum: ast::crate_num) -> [ast::def_id] { - let ids: [ast::def_id] = ~[]; + let ids: [ast::def_id] = []; let v = tag_items_data_item_variant; for each p: ebml::doc in ebml::tagged_docs(item, v) { let ext = parse_def_id(ebml::doc_data(p)); - ids += ~[{crate: this_cnum, node: ext.node}]; + ids += [{crate: this_cnum, node: ext.node}]; } ret ids; } @@ -155,10 +155,10 @@ fn resolve_path(path: &[ast::ident], data: @[u8]) -> [ast::def_id] { let md = ebml::new_doc(data); let paths = ebml::get_doc(md, tag_paths); let eqer = bind eq_item(_, s); - let result: [ast::def_id] = ~[]; + let result: [ast::def_id] = []; for doc: ebml::doc in lookup_hash(paths, eqer, hash_path(s)) { let did_doc = ebml::get_doc(doc, tag_def_id); - result += ~[parse_def_id(ebml::doc_data(did_doc))]; + result += [parse_def_id(ebml::doc_data(did_doc))]; } ret result; } @@ -203,12 +203,12 @@ fn get_type(data: @[u8], def: ast::def_id, tcx: &ty::ctxt, let node_id = def.node; let item = lookup_item(node_id, data); let t = item_type(item, this_cnum, tcx, extres); - let tp_kinds : [ast::kind]; + let tp_kinds: [ast::kind]; let fam_ch = item_family(item); let has_ty_params = family_has_type_params(fam_ch); if has_ty_params { tp_kinds = item_ty_param_kinds(item); - } else { tp_kinds = ~[]; } + } else { tp_kinds = []; } ret {kinds: tp_kinds, ty: t}; } @@ -231,22 +231,22 @@ fn get_tag_variants(_data: &@[u8], def: ast::def_id, tcx: &ty::ctxt, cstore::get_crate_data(tcx.sess.get_cstore(), external_crate_id).data; let items = ebml::get_doc(ebml::new_doc(data), tag_items); let item = find_item(def.node, items); - let infos: [ty::variant_info] = ~[]; + let infos: [ty::variant_info] = []; let variant_ids = tag_variant_ids(item, external_crate_id); for did: ast::def_id in variant_ids { let item = find_item(did.node, items); let ctor_ty = item_type(item, external_crate_id, tcx, extres); - let arg_tys: [ty::t] = ~[]; + let arg_tys: [ty::t] = []; alt ty::struct(tcx, ctor_ty) { ty::ty_fn(_, args, _, _, _) { - for a: ty::arg in args { arg_tys += ~[a.ty]; } + for a: ty::arg in args { arg_tys += [a.ty]; } } _ { // Nullary tag variant. } } - infos += ~[{args: arg_tys, ctor_ty: ctor_ty, id: did}]; + infos += [{args: arg_tys, ctor_ty: ctor_ty, id: did}]; } ret infos; } @@ -295,14 +295,14 @@ fn item_family_to_str(fam: u8) -> str { } fn get_meta_items(md: &ebml::doc) -> [@ast::meta_item] { - let items: [@ast::meta_item] = ~[]; - for each meta_item_doc: ebml::doc in + let items: [@ast::meta_item] = []; + for each meta_item_doc: ebml::doc in ebml::tagged_docs(md, tag_meta_item_word) { let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name); let n = str::unsafe_from_bytes(ebml::doc_data(nd)); - items += ~[attr::mk_word_item(n)]; + items += [attr::mk_word_item(n)]; } - for each meta_item_doc: ebml::doc in + for each meta_item_doc: ebml::doc in ebml::tagged_docs(md, tag_meta_item_name_value) { let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name); let vd = ebml::get_doc(meta_item_doc, tag_meta_item_value); @@ -310,32 +310,32 @@ fn get_meta_items(md: &ebml::doc) -> [@ast::meta_item] { let v = str::unsafe_from_bytes(ebml::doc_data(vd)); // FIXME (#611): Should be able to decode meta_name_value variants, // but currently they can't be encoded - items += ~[attr::mk_name_value_item_str(n, v)]; + items += [attr::mk_name_value_item_str(n, v)]; } - for each meta_item_doc: ebml::doc in + for each meta_item_doc: ebml::doc in ebml::tagged_docs(md, tag_meta_item_list) { let nd = ebml::get_doc(meta_item_doc, tag_meta_item_name); let n = str::unsafe_from_bytes(ebml::doc_data(nd)); let subitems = get_meta_items(meta_item_doc); - items += ~[attr::mk_list_item(n, subitems)]; + items += [attr::mk_list_item(n, subitems)]; } ret items; } fn get_attributes(md: &ebml::doc) -> [ast::attribute] { - let attrs: [ast::attribute] = ~[]; + let attrs: [ast::attribute] = []; alt ebml::maybe_get_doc(md, tag_attributes) { option::some(attrs_d) { - for each attr_doc: ebml::doc in + for each attr_doc: ebml::doc in ebml::tagged_docs(attrs_d, tag_attribute) { let meta_items = get_meta_items(attr_doc); // Currently it's only possible to have a single meta item on // an attribute assert (vec::len(meta_items) == 1u); - let meta_item = meta_items.(0); + let meta_item = meta_items[0]; attrs += - ~[{node: {style: ast::attr_outer, value: *meta_item}, - span: ast::dummy_sp()}]; + [{node: {style: ast::attr_outer, value: *meta_item}, + span: ast::dummy_sp()}]; } } option::none. { } @@ -345,7 +345,7 @@ fn get_attributes(md: &ebml::doc) -> [ast::attribute] { fn list_meta_items(meta_items: &ebml::doc, out: io::writer) { for mi: @ast::meta_item in get_meta_items(meta_items) { - out.write_str(#fmt("%s\n", pprust::meta_item_to_str(*mi))); + out.write_str(#fmt["%s\n", pprust::meta_item_to_str(*mi)]); } } @@ -353,7 +353,7 @@ fn list_crate_attributes(md: &ebml::doc, out: io::writer) { out.write_str("=Crate Attributes=\n"); for attr: ast::attribute in get_attributes(md) { - out.write_str(#fmt("%s\n", pprust::attribute_to_str(attr))); + out.write_str(#fmt["%s\n", pprust::attribute_to_str(attr)]); } out.write_str("\n\n"); @@ -366,14 +366,13 @@ fn get_crate_attributes(data: @[u8]) -> [ast::attribute] { type crate_dep = {cnum: ast::crate_num, ident: str}; fn get_crate_deps(data: @[u8]) -> [crate_dep] { - let deps: [crate_dep] = ~[]; + let deps: [crate_dep] = []; let cratedoc = ebml::new_doc(data); let depsdoc = ebml::get_doc(cratedoc, tag_crate_deps); let crate_num = 1; - for each depdoc: ebml::doc in - ebml::tagged_docs(depsdoc, tag_crate_dep) { + for each depdoc: ebml::doc in ebml::tagged_docs(depsdoc, tag_crate_dep) { let depname = str::unsafe_from_bytes(ebml::doc_data(depdoc)); - deps += ~[{cnum: crate_num, ident: depname}]; + deps += [{cnum: crate_num, ident: depname}]; crate_num += 1; } ret deps; @@ -383,7 +382,7 @@ fn list_crate_deps(data: @[u8], out: io::writer) { out.write_str("=External Dependencies=\n"); for dep: crate_dep in get_crate_deps(data) { - out.write_str(#fmt("%d %s\n", dep.cnum, dep.ident)); + out.write_str(#fmt["%d %s\n", dep.cnum, dep.ident]); } out.write_str("\n"); @@ -395,7 +394,7 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) { let items = ebml::get_doc(md, tag_items); let index = ebml::get_doc(paths, tag_index); let bs = ebml::get_doc(index, tag_index_buckets); - for each bucket: ebml::doc in + for each bucket: ebml::doc in ebml::tagged_docs(bs, tag_index_buckets_bucket) { let et = tag_index_buckets_bucket_elt; for each elt: ebml::doc in ebml::tagged_docs(bucket, et) { @@ -403,8 +402,8 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) { let def = ebml::doc_at(bytes, data.pos); let did_doc = ebml::get_doc(def, tag_def_id); let did = parse_def_id(ebml::doc_data(did_doc)); - out.write_str(#fmt("%s (%s)\n", data.path, - describe_def(items, did))); + out.write_str(#fmt["%s (%s)\n", data.path, + describe_def(items, did)]); } } out.write_str("\n"); diff --git a/src/comp/metadata/encoder.rs b/src/comp/metadata/encoder.rs index 32c21d116a9..babfc2ce77c 100644 --- a/src/comp/metadata/encoder.rs +++ b/src/comp/metadata/encoder.rs @@ -51,14 +51,13 @@ fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant], fn add_to_index(ebml_w: &ebml::writer, path: &[str], index: &mutable [entry<str>], name: &str) { - let full_path = path + ~[name]; + let full_path = path + [name]; index += - ~[{val: str::connect(full_path, "::"), - pos: ebml_w.writer.tell()}]; + [{val: str::connect(full_path, "::"), pos: ebml_w.writer.tell()}]; } -fn encode_native_module_item_paths(ebml_w: &ebml::writer, - nmod: &native_mod, path: &[str], +fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod, + path: &[str], index: &mutable [entry<str>]) { for nitem: @native_item in nmod.items { add_to_index(ebml_w, path, index, nitem.ident); @@ -93,7 +92,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, it.ident); encode_def_id(ebml_w, local_def(it.id)); - encode_module_item_paths(ebml_w, _mod, path + ~[it.ident], index); + encode_module_item_paths(ebml_w, _mod, path + [it.ident], index); ebml::end_tag(ebml_w); } item_native_mod(nmod) { @@ -101,7 +100,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, ebml::start_tag(ebml_w, tag_paths_data_mod); encode_name(ebml_w, it.ident); encode_def_id(ebml_w, local_def(it.id)); - encode_native_module_item_paths(ebml_w, nmod, path + ~[it.ident], + encode_native_module_item_paths(ebml_w, nmod, path + [it.ident], index); ebml::end_tag(ebml_w); } @@ -148,10 +147,9 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod, } } -fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> - [entry<str>] { - let index: [entry<str>] = ~[]; - let path: [str] = ~[]; +fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<str>] { + let index: [entry<str>] = []; + let path: [str] = []; ebml::start_tag(ebml_w, tag_paths); encode_module_item_paths(ebml_w, crate.node.module, path, index); ebml::end_tag(ebml_w); @@ -162,28 +160,29 @@ fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> // Item info table encoding fn encode_family(ebml_w: &ebml::writer, c: u8) { ebml::start_tag(ebml_w, tag_items_data_item_family); - ebml_w.writer.write(~[c]); + ebml_w.writer.write([c]); ebml::end_tag(ebml_w); } fn encode_inlineness(ebml_w: &ebml::writer, c: u8) { ebml::start_tag(ebml_w, tag_items_data_item_inlineness); - ebml_w.writer.write(~[c]); + ebml_w.writer.write([c]); ebml::end_tag(ebml_w); } -fn def_to_str(did: &def_id) -> str { ret #fmt("%d:%d", did.crate, did.node); } +fn def_to_str(did: &def_id) -> str { ret #fmt["%d:%d", did.crate, did.node]; } fn encode_type_param_kinds(ebml_w: &ebml::writer, tps: &[ty_param]) { ebml::start_tag(ebml_w, tag_items_data_item_ty_param_kinds); ebml::write_vint(ebml_w.writer, vec::len::<ty_param>(tps)); for tp: ty_param in tps { - let c = alt tp.kind { - kind_unique. { 'u' } - kind_shared. { 's' } - kind_pinned. { 'p' } - }; - ebml_w.writer.write(~[c as u8]); + let c = + alt tp.kind { + kind_unique. { 'u' } + kind_shared. { 's' } + kind_pinned. { 'p' } + }; + ebml_w.writer.write([c as u8]); } ebml::end_tag(ebml_w); } @@ -229,7 +228,7 @@ fn encode_tag_variant_info(ecx: &@encode_ctxt, ebml_w: &ebml::writer, index: &mutable [entry<int>], ty_params: &[ty_param]) { for variant: variant in variants { - index += ~[{val: variant.node.id, pos: ebml_w.writer.tell()}]; + index += [{val: variant.node.id, pos: ebml_w.writer.tell()}]; ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, local_def(variant.node.id)); encode_family(ebml_w, 'v' as u8); @@ -245,8 +244,8 @@ fn encode_tag_variant_info(ecx: &@encode_ctxt, ebml_w: &ebml::writer, } } -fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, - item: @item, index: &mutable [entry<int>]) { +fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, item: @item, + index: &mutable [entry<int>]) { alt item.node { item_const(_, _) { ebml::start_tag(ebml_w, tag_items_data_item); @@ -260,8 +259,10 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, local_def(item.id)); encode_family(ebml_w, - alt fd.decl.purity { pure_fn. { 'p' } impure_fn. { 'f' } } - as u8); + alt fd.decl.purity { + pure_fn. { 'p' } + impure_fn. { 'f' } + } as u8); encode_inlineness(ebml_w, alt fd.decl.il { il_normal. { 'n' } @@ -315,7 +316,7 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, encode_symbol(ecx, ebml_w, item.id); ebml::end_tag(ebml_w); - index += ~[{val: ctor_id, pos: ebml_w.writer.tell()}]; + index += [{val: ctor_id, pos: ebml_w.writer.tell()}]; ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, local_def(ctor_id)); encode_family(ebml_w, 'f' as u8); @@ -334,7 +335,7 @@ fn encode_info_for_item(ecx: @encode_ctxt, ebml_w: &ebml::writer, encode_type(ecx, ebml_w, ty::ty_fn_ret(ecx.ccx.tcx, fn_ty)); ebml::end_tag(ebml_w); - index += ~[{val: ctor_id, pos: ebml_w.writer.tell()}]; + index += [{val: ctor_id, pos: ebml_w.writer.tell()}]; ebml::start_tag(ebml_w, tag_items_data_item); encode_def_id(ebml_w, local_def(ctor_id)); encode_family(ebml_w, 'f' as u8); @@ -369,17 +370,17 @@ fn encode_info_for_native_item(ecx: &@encode_ctxt, ebml_w: &ebml::writer, fn encode_info_for_items(ecx: &@encode_ctxt, ebml_w: &ebml::writer) -> [entry<int>] { - let index: [entry<int>] = ~[]; + let index: [entry<int>] = []; ebml::start_tag(ebml_w, tag_items_data); - for each kvp: @{key: node_id, val: middle::ast_map::ast_node} in + for each kvp: @{key: node_id, val: middle::ast_map::ast_node} in ecx.ccx.ast_map.items() { alt kvp.val { middle::ast_map::node_item(i) { - index += ~[{val: kvp.key, pos: ebml_w.writer.tell()}]; + index += [{val: kvp.key, pos: ebml_w.writer.tell()}]; encode_info_for_item(ecx, ebml_w, i, index); } middle::ast_map::node_native_item(i) { - index += ~[{val: kvp.key, pos: ebml_w.writer.tell()}]; + index += [{val: kvp.key, pos: ebml_w.writer.tell()}]; encode_info_for_native_item(ecx, ebml_w, i); } _ { } @@ -392,30 +393,30 @@ fn encode_info_for_items(ecx: &@encode_ctxt, ebml_w: &ebml::writer) -> // Path and definition ID indexing -fn create_index<T>(index: &[entry<T>], hash_fn: fn(&T) -> uint ) -> +fn create_index<T>(index: &[entry<T>], hash_fn: fn(&T) -> uint) -> [@[entry<T>]] { - let buckets: [@mutable [entry<T>]] = ~[]; - for each i: uint in uint::range(0u, 256u) { buckets += ~[@mutable ~[]]; } + let buckets: [@mutable [entry<T>]] = []; + for each i: uint in uint::range(0u, 256u) { buckets += [@mutable []]; } for elt: entry<T> in index { let h = hash_fn(elt.val); - *buckets.(h % 256u) += ~[elt]; + *buckets[h % 256u] += [elt]; } - let buckets_frozen = ~[]; + let buckets_frozen = []; for bucket: @mutable [entry<T>] in buckets { - buckets_frozen += ~[@*bucket]; + buckets_frozen += [@*bucket]; } ret buckets_frozen; } fn encode_index<T>(ebml_w: &ebml::writer, buckets: &[@[entry<T>]], - write_fn: fn(&io::writer, &T) ) { + write_fn: fn(&io::writer, &T)) { let writer = io::new_writer_(ebml_w.writer); ebml::start_tag(ebml_w, tag_index); - let bucket_locs: [uint] = ~[]; + let bucket_locs: [uint] = []; ebml::start_tag(ebml_w, tag_index_buckets); for bucket: @[entry<T>] in buckets { - bucket_locs += ~[ebml_w.writer.tell()]; + bucket_locs += [ebml_w.writer.tell()]; ebml::start_tag(ebml_w, tag_index_buckets_bucket); for elt: entry<T> in *bucket { ebml::start_tag(ebml_w, tag_index_buckets_bucket_elt); @@ -508,30 +509,30 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] { attr::remove_meta_items_by_name(tmp, "vers") }; - let meta_items = ~[name_item, vers_item] + other_items; + let meta_items = [name_item, vers_item] + other_items; let link_item = attr::mk_list_item("link", meta_items); ret attr::mk_attr(link_item); } - let attrs: [attribute] = ~[]; + let attrs: [attribute] = []; let found_link_attr = false; for attr: attribute in crate.node.attrs { attrs += if attr::get_attr_name(attr) != "link" { - ~[attr] + [attr] } else { alt attr.node.value.node { meta_list(n, l) { found_link_attr = true; - ~[synthesize_link_attr(ecx, l)] + [synthesize_link_attr(ecx, l)] } - _ { ~[attr] } + _ { [attr] } } } } - if !found_link_attr { attrs += ~[synthesize_link_attr(ecx, ~[])]; } + if !found_link_attr { attrs += [synthesize_link_attr(ecx, [])]; } ret attrs; } @@ -543,9 +544,9 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) { type numname = {crate: crate_num, ident: str}; // Pull the cnums and names out of cstore - let pairs: [mutable numname] = ~[mutable]; + let pairs: [mutable numname] = [mutable]; for each hashkv: hashkv in cstore::iter_crate_data(cstore) { - pairs += ~[mutable {crate: hashkv.key, ident: hashkv.val.name}]; + pairs += [mutable {crate: hashkv.key, ident: hashkv.val.name}]; } // Sort by cnum @@ -612,7 +613,7 @@ fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> str { // Pad this, since something (LLVM, presumably) is cutting off the // remaining % 4 bytes. - buf_w.write(~[0u8, 0u8, 0u8, 0u8]); + buf_w.write([0u8, 0u8, 0u8, 0u8]); ret string_w.get_str(); } diff --git a/src/comp/metadata/tydecode.rs b/src/comp/metadata/tydecode.rs index a9a85e1190b..31034b7a6ae 100644 --- a/src/comp/metadata/tydecode.rs +++ b/src/comp/metadata/tydecode.rs @@ -19,17 +19,17 @@ export parse_ty_data; // data buffer. Whatever format you choose should not contain pipe characters. // Callback to translate defs to strs or back: -type str_def = fn(str) -> ast::def_id ; +type str_def = fn(str) -> ast::def_id; type pstate = {data: @[u8], crate: int, mutable pos: uint, len: uint, tcx: ty::ctxt}; tag ty_or_bang { a_ty(ty::t); a_bang; } -fn peek(st: @pstate) -> u8 { ret st.data.(st.pos); } +fn peek(st: @pstate) -> u8 { ret st.data[st.pos]; } fn next(st: @pstate) -> u8 { - let ch = st.data.(st.pos); + let ch = st.data[st.pos]; st.pos = st.pos + 1u; ret ch; } @@ -39,7 +39,7 @@ fn parse_ident(st: @pstate, sd: str_def, last: char) -> ast::ident { ret parse_ident_(st, sd, bind is_last(last, _)); } -fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool ) -> +fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool) -> ast::ident { let rslt = ""; while !is_last(peek(st) as char) { @@ -65,14 +65,14 @@ fn parse_ty_or_bang(st: @pstate, sd: str_def) -> ty_or_bang { } fn parse_constrs(st: @pstate, sd: str_def) -> [@ty::constr] { - let rslt: [@ty::constr] = ~[]; + let rslt: [@ty::constr] = []; alt peek(st) as char { ':' { do { next(st); let one: @ty::constr = parse_constr::<uint>(st, sd, parse_constr_arg); - rslt += ~[one]; + rslt += [one]; } while peek(st) as char == ';' } _ { } @@ -82,14 +82,14 @@ fn parse_constrs(st: @pstate, sd: str_def) -> [@ty::constr] { // FIXME less copy-and-paste fn parse_ty_constrs(st: @pstate, sd: str_def) -> [@ty::type_constr] { - let rslt: [@ty::type_constr] = ~[]; + let rslt: [@ty::type_constr] = []; alt peek(st) as char { ':' { do { next(st); let one: @ty::type_constr = parse_constr::<path>(st, sd, parse_ty_constr_arg); - rslt += ~[one]; + rslt += [one]; } while peek(st) as char == ';' } _ { } @@ -98,24 +98,24 @@ fn parse_ty_constrs(st: @pstate, sd: str_def) -> [@ty::type_constr] { } fn parse_path(st: @pstate, sd: str_def) -> ast::path { - let idents: [ast::ident] = ~[]; + let idents: [ast::ident] = []; fn is_last(c: char) -> bool { ret c == '(' || c == ':'; } - idents += ~[parse_ident_(st, sd, is_last)]; + idents += [parse_ident_(st, sd, is_last)]; while true { alt peek(st) as char { ':' { next(st); next(st); } c { if c == '(' { ret respan(ast::dummy_sp(), - {global: false, idents: idents, types: ~[]}); - } else { idents += ~[parse_ident_(st, sd, is_last)]; } + {global: false, idents: idents, types: []}); + } else { idents += [parse_ident_(st, sd, is_last)]; } } } } fail "parse_path: ill-formed path"; } -type arg_parser<T> = fn(@pstate, str_def) -> ast::constr_arg_general_<T> ; +type arg_parser<T> = fn(@pstate, str_def) -> ast::constr_arg_general_<T>; fn parse_constr_arg(st: @pstate, _sd: str_def) -> ast::fn_constr_arg { alt peek(st) as char { @@ -153,7 +153,7 @@ fn parse_ty_constr_arg(st: @pstate, sd: str_def) -> fn parse_constr<@T>(st: @pstate, sd: str_def, pser: arg_parser<T>) -> @ty::constr_general<T> { let sp = ast::dummy_sp(); // FIXME: use a real span - let args: [@sp_constr_arg<T>] = ~[]; + let args: [@sp_constr_arg<T>] = []; let pth: path = parse_path(st, sd); let ignore: char = next(st) as char; assert (ignore as char == '('); @@ -162,7 +162,7 @@ fn parse_constr<@T>(st: @pstate, sd: str_def, pser: arg_parser<T>) -> do { an_arg = pser(st, sd); // FIXME use a real span - args += ~[@respan(sp, an_arg)]; + args += [@respan(sp, an_arg)]; ignore = next(st) as char; } while ignore == ';' assert (ignore == ')'); @@ -197,21 +197,23 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { 't' { assert (next(st) as char == '['); let def = parse_def(st, sd); - let params: [ty::t] = ~[]; - while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; } + let params: [ty::t] = []; + while peek(st) as char != ']' { params += [parse_ty(st, sd)]; } st.pos = st.pos + 1u; ret ty::mk_tag(st.tcx, def, params); } 'p' { - let k = alt next(st) as char { - 'u' { kind_unique } - 's' { kind_shared } - 'p' { kind_pinned } - c { - log_err "unexpected char in encoded type param: "; - log_err c; fail - } - }; + let k = + alt next(st) as char { + 'u' { kind_unique } + 's' { kind_shared } + 'p' { kind_pinned } + c { + log_err "unexpected char in encoded type param: "; + log_err c; + fail + } + }; ret ty::mk_param(st.tcx, parse_int(st) as uint, k); } '@' { ret ty::mk_box(st.tcx, parse_mt(st, sd)); } @@ -220,22 +222,22 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { 'I' { ret ty::mk_vec(st.tcx, parse_mt(st, sd)); } 'R' { assert (next(st) as char == '['); - let fields: [ty::field] = ~[]; + let fields: [ty::field] = []; while peek(st) as char != ']' { let name = ""; while peek(st) as char != '=' { name += str::unsafe_from_byte(next(st)); } st.pos = st.pos + 1u; - fields += ~[{ident: name, mt: parse_mt(st, sd)}]; + fields += [{ident: name, mt: parse_mt(st, sd)}]; } st.pos = st.pos + 1u; ret ty::mk_rec(st.tcx, fields); } 'T' { assert (next(st) as char == '['); - let params = ~[]; - while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; } + let params = []; + while peek(st) as char != ']' { params += [parse_ty(st, sd)]; } st.pos = st.pos + 1u; ret ty::mk_tup(st.tcx, params); } @@ -268,7 +270,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { } 'O' { assert (next(st) as char == '['); - let methods: [ty::method] = ~[]; + let methods: [ty::method] = []; while peek(st) as char != ']' { let proto; alt next(st) as char { @@ -281,12 +283,12 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { } let func = parse_ty_fn(st, sd); methods += - ~[{proto: proto, - ident: name, - inputs: func.args, - output: func.ty, - cf: func.cf, - constrs: func.cs}]; + [{proto: proto, + ident: name, + inputs: func.args, + output: func.ty, + cf: func.cf, + constrs: func.cs}]; } st.pos += 1u; ret ty::mk_obj(st.tcx, methods); @@ -295,8 +297,8 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t { assert (next(st) as char == '['); let def = parse_def(st, sd); let inner = parse_ty(st, sd); - let params: [ty::t] = ~[]; - while peek(st) as char != ']' { params += ~[parse_ty(st, sd)]; } + let params: [ty::t] = []; + while peek(st) as char != ']' { params += [parse_ty(st, sd)]; } st.pos = st.pos + 1u; ret ty::mk_res(st.tcx, def, inner, params); } @@ -375,7 +377,7 @@ fn parse_hex(st: @pstate) -> uint { fn parse_ty_fn(st: @pstate, sd: str_def) -> {args: [ty::arg], ty: ty::t, cf: ast::controlflow, cs: [@ty::constr]} { assert (next(st) as char == '['); - let inputs: [ty::arg] = ~[]; + let inputs: [ty::arg] = []; while peek(st) as char != ']' { let mode = ty::mo_val; if peek(st) as char == '&' { @@ -389,7 +391,7 @@ fn parse_ty_fn(st: @pstate, sd: str_def) -> mode = ty::mo_move; st.pos += 1u; } - inputs += ~[{mode: mode, ty: parse_ty(st, sd)}]; + inputs += [{mode: mode, ty: parse_ty(st, sd)}]; } st.pos += 1u; // eat the ']' let cs = parse_constrs(st, sd); @@ -406,7 +408,7 @@ fn parse_ty_fn(st: @pstate, sd: str_def) -> fn parse_def_id(buf: &[u8]) -> ast::def_id { let colon_idx = 0u; let len = vec::len::<u8>(buf); - while colon_idx < len && buf.(colon_idx) != ':' as u8 { colon_idx += 1u; } + while colon_idx < len && buf[colon_idx] != ':' as u8 { colon_idx += 1u; } if colon_idx == len { log_err "didn't find ':' when parsing def id"; fail; @@ -414,10 +416,10 @@ fn parse_def_id(buf: &[u8]) -> ast::def_id { let crate_part = vec::slice::<u8>(buf, 0u, colon_idx); let def_part = vec::slice::<u8>(buf, colon_idx + 1u, len); - let crate_part_vec = ~[]; - let def_part_vec = ~[]; - for b: u8 in crate_part { crate_part_vec += ~[b]; } - for b: u8 in def_part { def_part_vec += ~[b]; } + let crate_part_vec = []; + let def_part_vec = []; + for b: u8 in crate_part { crate_part_vec += [b]; } + for b: u8 in def_part { def_part_vec += [b]; } let crate_num = uint::parse_buf(crate_part_vec, 10u) as int; let def_num = uint::parse_buf(def_part_vec, 10u) as int; diff --git a/src/comp/metadata/tyencode.rs b/src/comp/metadata/tyencode.rs index dbde5991558..5568804c056 100644 --- a/src/comp/metadata/tyencode.rs +++ b/src/comp/metadata/tyencode.rs @@ -17,9 +17,10 @@ export ac_no_abbrevs; export ac_use_abbrevs; export enc_ty; -type ctxt = // Def -> str Callback: +type ctxt = + // Def -> str Callback: // The type context. - {ds: fn(&def_id) -> str , tcx: ty::ctxt, abbrevs: abbrev_ctxt}; + {ds: fn(&def_id) -> str, tcx: ty::ctxt, abbrevs: abbrev_ctxt}; // Compact string representation for ty.t values. API ty_str & parse_from_str. // Extra parameters are for converting to/from def_ids in the string rep. @@ -151,7 +152,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { native_abi_llvm. { w.write_char('l'); } native_abi_x86stdcall. { w.write_char('s'); } } - enc_ty_fn(w, cx, args, out, return, ~[]); + enc_ty_fn(w, cx, args, out, return, []); } ty::ty_obj(methods) { w.write_str("O["); @@ -176,7 +177,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) { w.write_str(cx.ds(def)); w.write_char('|'); } - ty::ty_param(id,k) { + ty::ty_param(id, k) { alt k { kind_unique. { w.write_str("pu"); } kind_shared. { w.write_str("ps"); } @@ -210,9 +211,7 @@ fn enc_ty_fn(w: &io::writer, cx: &@ctxt, args: &[ty::arg], out: &ty::t, w.write_char('&'); if mut { w.write_char('m'); } } - ty::mo_move. { - w.write_char('-'); - } + ty::mo_move. { w.write_char('-'); } ty::mo_val. { } } enc_ty(w, cx, arg.ty); diff --git a/src/comp/middle/alias.rs b/src/comp/middle/alias.rs index 5d0afd7154d..738489bb400 100644 --- a/src/comp/middle/alias.rs +++ b/src/comp/middle/alias.rs @@ -42,12 +42,13 @@ fn check_crate(tcx: ty::ctxt, crate: &@ast::crate) { // Stores information about object fields and function // arguments that's otherwise not easily available. let cx = @{tcx: tcx, local_map: std::map::new_int_hash()}; - let v = @{visit_fn: bind visit_fn(cx, _, _, _, _, _, _, _), - visit_item: bind visit_item(cx, _, _, _), - visit_expr: bind visit_expr(cx, _, _, _), - visit_decl: bind visit_decl(cx, _, _, _) - with *visit::default_visitor::<scope>()}; - visit::visit_crate(*crate, @~[], visit::mk_vt(v)); + let v = + @{visit_fn: bind visit_fn(cx, _, _, _, _, _, _, _), + visit_item: bind visit_item(cx, _, _, _), + visit_expr: bind visit_expr(cx, _, _, _), + visit_decl: bind visit_decl(cx, _, _, _) + with *visit::default_visitor::<scope>()}; + visit::visit_crate(*crate, @[], visit::mk_vt(v)); tcx.sess.abort_if_errors(); } @@ -57,27 +58,36 @@ fn visit_fn(cx: &@ctx, f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span, for arg_: ast::arg in f.decl.inputs { cx.local_map.insert(arg_.id, arg(arg_.mode)); } - let scope = alt (f.proto) { - // Blocks need to obey any restrictions from the enclosing scope. - ast::proto_block. { sc } - // Closures need to prohibit writing to any of the upvars. - // This doesn't seem like a particularly clean way to do this. - ast::proto_closure. { - let dnums = ~[]; - for each nid in freevars::get_freevar_defs(cx.tcx, id).keys() { - dnums += ~[nid]; - } - @~[@{root_vars: ~[], - // I'm not sure if there is anything sensical to put here - block_defnum: 0, - bindings: dnums, - tys: ~[], - depends_on: ~[], - mutable ok: valid}] - } - // Non capturing functions start out fresh. - _ { @~[] } - }; + let scope = + alt f.proto { + + // Blocks need to obey any restrictions from the enclosing scope. + ast::proto_block. { + sc + } + + // Closures need to prohibit writing to any of the upvars. + // This doesn't seem like a particularly clean way to do this. + ast::proto_closure. { + let dnums = []; + for each nid in freevars::get_freevar_defs(cx.tcx, id).keys() { + dnums += [nid]; + }; + @[ + // I'm not sure if there is anything sensical to put here + @{root_vars: [], + block_defnum: 0, + bindings: dnums, + tys: [], + depends_on: [], + mutable ok: valid}] + } + + // Non capturing functions start out fresh. + _ { + @[] + } + }; v.visit_block(f.body, scope, v); } @@ -168,14 +178,14 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> {root_vars: [node_id], unsafe_ts: [ty::t]} { let fty = ty::expr_ty(cx.tcx, f); let arg_ts = fty_args(cx, fty); - let roots: [node_id] = ~[]; - let mut_roots: [{arg: uint, node: node_id}] = ~[]; - let unsafe_ts: [ty::t] = ~[]; - let unsafe_t_offsets: [uint] = ~[]; + let roots: [node_id] = []; + let mut_roots: [{arg: uint, node: node_id}] = []; + let unsafe_ts: [ty::t] = []; + let unsafe_t_offsets: [uint] = []; let i = 0u; for arg_t: ty::arg in arg_ts { if arg_t.mode != ty::mo_val { - let arg = args.(i); + let arg = args[i]; let root = expr_root(cx, arg, false); if arg_t.mode == ty::mo_alias(true) { alt path_def(cx, arg) { @@ -183,24 +193,27 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> let dnum = ast::def_id_of_def(def).node; if def_is_local(def, true) { if is_immutable_alias(cx, sc, dnum) { - cx.tcx.sess.span_err - (arg.span, "passing an immutable alias \ - by mutable alias"); + cx.tcx.sess.span_err( + arg.span, + "passing an immutable alias \ + by mutable alias"); } else if is_immutable_objfield(cx, dnum) { - cx.tcx.sess.span_err - (arg.span, "passing an immutable object \ - field by mutable alias"); + cx.tcx.sess.span_err( + arg.span, + "passing an immutable object \ + field by mutable alias"); } } else { - cx.tcx.sess.span_err - (arg.span, - "passing a static item by mutable alias"); + cx.tcx.sess.span_err( + arg.span, + "passing a static item by mutable alias"); } - mut_roots += ~[{arg: i, node: dnum}]; + mut_roots += [{arg: i, node: dnum}]; } _ { if !mut_field(root.ds) { - let m = "passing a temporary value or \ + let m = + "passing a temporary value or \ immutable field by mutable alias"; cx.tcx.sess.span_err(arg.span, m); } @@ -208,11 +221,11 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> } } alt path_def_id(cx, root.ex) { - some(did) { roots += ~[did.node]; } + some(did) { roots += [did.node]; } _ { } } alt inner_mut(root.ds) { - some(t) { unsafe_ts += ~[t]; unsafe_t_offsets += ~[i]; } + some(t) { unsafe_ts += [t]; unsafe_t_offsets += [i]; } _ { } } } @@ -223,9 +236,9 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> ast::expr_path(_) { if def_is_local(cx.tcx.def_map.get(f.id), true) { cx.tcx.sess.span_err(f.span, - #fmt("function may alias with \ + #fmt["function may alias with \ argument %u, which is not immutably rooted", - unsafe_t_offsets.(0))); + unsafe_t_offsets[0]]); } } _ { } @@ -233,17 +246,17 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> } let j = 0u; for unsafe: ty::t in unsafe_ts { - let offset = unsafe_t_offsets.(j); + let offset = unsafe_t_offsets[j]; j += 1u; let i = 0u; for arg_t: ty::arg in arg_ts { let mut_alias = arg_t.mode == ty::mo_alias(true); if i != offset && ty_can_unsafely_include(cx, unsafe, arg_t.ty, mut_alias) { - cx.tcx.sess.span_err(args.(i).span, - #fmt("argument %u may alias with \ + cx.tcx.sess.span_err(args[i].span, + #fmt["argument %u may alias with \ argument %u, which is not immutably rooted", - i, offset)); + i, offset]); } i += 1u; } @@ -265,7 +278,7 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) -> if mut_alias_to_root { - cx.tcx.sess.span_err(args.(root.arg).span, + cx.tcx.sess.span_err(args[root.arg].span, "passing a mutable alias to a \ variable that roots another alias"); } @@ -281,14 +294,14 @@ fn check_tail_call(cx: &ctx, call: &@ast::expr) { if arg_t.mode != ty::mo_val { let mut_a = arg_t.mode == ty::mo_alias(true); let ok = true; - alt args.(i).node { + alt args[i].node { ast::expr_path(_) { - let def = cx.tcx.def_map.get(args.(i).id); + let def = cx.tcx.def_map.get(args[i].id); let dnum = ast::def_id_of_def(def).node; alt cx.local_map.find(dnum) { some(arg(ast::alias(mut))) { if mut_a && !mut { - cx.tcx.sess.span_err(args.(i).span, + cx.tcx.sess.span_err(args[i].span, "passing an immutable \ alias by mutable alias"); } @@ -299,7 +312,7 @@ fn check_tail_call(cx: &ctx, call: &@ast::expr) { _ { ok = false; } } if !ok { - cx.tcx.sess.span_err(args.(i).span, + cx.tcx.sess.span_err(args[i].span, "can not pass a local value by \ alias to a tail call"); } @@ -313,26 +326,28 @@ fn check_alt(cx: &ctx, input: &@ast::expr, arms: &[ast::arm], sc: &scope, visit::visit_expr(input, sc, v); let root = expr_root(cx, input, true); let roots = - alt path_def_id(cx, root.ex) { some(did) { ~[did.node] } _ { ~[] } }; + alt path_def_id(cx, root.ex) { some(did) { [did.node] } _ { [] } }; let forbidden_tp: [ty::t] = - alt inner_mut(root.ds) { some(t) { ~[t] } _ { ~[] } }; + alt inner_mut(root.ds) { some(t) { [t] } _ { [] } }; for a: ast::arm in arms { let dnums = arm_defnums(a); let new_sc = sc; if vec::len(dnums) > 0u { - new_sc = @(*sc + ~[@{root_vars: roots, - block_defnum: dnums.(vec::len(dnums) - 1u), - bindings: dnums, - tys: forbidden_tp, - depends_on: deps(sc, roots), - mutable ok: valid}]); + new_sc = + @(*sc + + [@{root_vars: roots, + block_defnum: dnums[vec::len(dnums) - 1u], + bindings: dnums, + tys: forbidden_tp, + depends_on: deps(sc, roots), + mutable ok: valid}]); } visit::visit_arm(a, new_sc, v); } } fn arm_defnums(arm: &ast::arm) -> [node_id] { - ret ast::pat_binding_ids(arm.pats.(0)); + ret ast::pat_binding_ids(arm.pats[0]); } fn check_for_each(cx: &ctx, local: &@ast::local, call: &@ast::expr, @@ -342,13 +357,14 @@ fn check_for_each(cx: &ctx, local: &@ast::local, call: &@ast::expr, ast::expr_call(f, args) { let data = check_call(cx, f, args, sc); let bindings = ast::pat_binding_ids(local.node.pat); - let new_sc = @{root_vars: data.root_vars, - block_defnum: bindings.(vec::len(bindings) - 1u), - bindings: bindings, - tys: data.unsafe_ts, - depends_on: deps(sc, data.root_vars), - mutable ok: valid}; - visit::visit_block(blk, @(*sc + ~[new_sc]), v); + let new_sc = + @{root_vars: data.root_vars, + block_defnum: bindings[vec::len(bindings) - 1u], + bindings: bindings, + tys: data.unsafe_ts, + depends_on: deps(sc, data.root_vars), + mutable ok: valid}; + visit::visit_block(blk, @(*sc + [new_sc]), v); } } } @@ -358,15 +374,13 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk, visit::visit_expr(seq, sc, v); let root = expr_root(cx, seq, false); let root_def = - alt path_def_id(cx, root.ex) { some(did) { ~[did.node] } _ { ~[] } }; - let unsafe = alt inner_mut(root.ds) { some(t) { ~[t] } _ { ~[] } }; + alt path_def_id(cx, root.ex) { some(did) { [did.node] } _ { [] } }; + let unsafe = alt inner_mut(root.ds) { some(t) { [t] } _ { [] } }; // If this is a mutable vector, don't allow it to be touched. let seq_t = ty::expr_ty(cx.tcx, seq); alt ty::struct(cx.tcx, seq_t) { - ty::ty_vec(mt) { - if mt.mut != ast::imm { unsafe = ~[seq_t]; } - } + ty::ty_vec(mt) { if mt.mut != ast::imm { unsafe = [seq_t]; } } ty::ty_str. | ty::ty_istr. {/* no-op */ } _ { cx.tcx.sess.span_unimpl(seq.span, @@ -375,13 +389,14 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk, } } let bindings = ast::pat_binding_ids(local.node.pat); - let new_sc = @{root_vars: root_def, - block_defnum: bindings.(vec::len(bindings) - 1u), - bindings: bindings, - tys: unsafe, - depends_on: deps(sc, root_def), - mutable ok: valid}; - visit::visit_block(blk, @(*sc + ~[new_sc]), v); + let new_sc = + @{root_vars: root_def, + block_defnum: bindings[vec::len(bindings) - 1u], + bindings: bindings, + tys: unsafe, + depends_on: deps(sc, root_def), + mutable ok: valid}; + visit::visit_block(blk, @(*sc + [new_sc]), v); } fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id, @@ -391,6 +406,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id, let my_defnum = ast::def_id_of_def(def).node; let var_t = ty::expr_ty(cx.tcx, ex); for r: restrict in *sc { + // excludes variables introduced since the alias was made // FIXME This does not work anymore, now that we have macros. if my_defnum < r.block_defnum { @@ -399,7 +415,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id, r.ok = val_taken(ex.span, p); } } - } else if (vec::member(my_defnum, r.bindings)) { + } else if vec::member(my_defnum, r.bindings) { test_scope(cx, sc, r, p); } } @@ -411,7 +427,7 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) { let dnum = ast::def_id_of_def(cx.tcx.def_map.get(dest.id)).node; if is_immutable_alias(*cx, sc, dnum) { cx.tcx.sess.span_err(dest.span, "assigning to immutable alias"); - } else if (is_immutable_objfield(*cx, dnum)) { + } else if is_immutable_objfield(*cx, dnum) { cx.tcx.sess.span_err(dest.span, "assigning to immutable obj field"); } @@ -425,9 +441,9 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) { let root = expr_root(*cx, dest, false); if vec::len(*root.ds) == 0u { cx.tcx.sess.span_err(dest.span, "assignment to non-lvalue"); - } else if (!root.ds.(0).mut) { + } else if !root.ds[0].mut { let name = - alt root.ds.(0).kind { + alt root.ds[0].kind { unbox. { "box" } field. { "field" } index. { "vec content" } @@ -475,9 +491,7 @@ fn is_immutable_alias(cx: &ctx, sc: &scope, dnum: node_id) -> bool { some(arg(ast::alias(false))) { ret true; } _ { } } - for r: restrict in *sc { - if vec::member(dnum, r.bindings) { ret true; } - } + for r: restrict in *sc { if vec::member(dnum, r.bindings) { ret true; } } ret false; } @@ -489,17 +503,18 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) { let prob = r.ok; for dep: uint in r.depends_on { if prob != valid { break; } - prob = sc.(dep).ok; + prob = sc[dep].ok; } if prob != valid { - let msg = alt prob { - overwritten(sp, wpt) { - {span: sp, msg: "overwriting " + ast::path_name(wpt)} - } - val_taken(sp, vpt) { - {span: sp, msg: "taking the value of " + ast::path_name(vpt)} - } - }; + let msg = + alt prob { + overwritten(sp, wpt) { + {span: sp, msg: "overwriting " + ast::path_name(wpt)} + } + val_taken(sp, vpt) { + {span: sp, msg: "taking the value of " + ast::path_name(vpt)} + } + }; cx.tcx.sess.span_err(msg.span, msg.msg + " will invalidate alias " + ast::path_name(p) + ", which is still used"); @@ -508,10 +523,10 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) { fn deps(sc: &scope, roots: &[node_id]) -> [uint] { let i = 0u; - let result = ~[]; + let result = []; for r: restrict in *sc { for dn: node_id in roots { - if vec::member(dn, r.bindings) { result += ~[i]; } + if vec::member(dn, r.bindings) { result += [i]; } } i += 1u; } @@ -530,37 +545,37 @@ type deref = @{mut: bool, kind: deref_t, outer_t: ty::t}; fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) -> {ex: @ast::expr, ds: @[deref]} { fn maybe_auto_unbox(cx: &ctx, t: ty::t) -> {t: ty::t, ds: [deref]} { - let ds = ~[]; + let ds = []; while true { alt ty::struct(cx.tcx, t) { ty::ty_box(mt) { - ds += ~[@{mut: mt.mut != ast::imm, kind: unbox, outer_t: t}]; + ds += [@{mut: mt.mut != ast::imm, kind: unbox, outer_t: t}]; t = mt.ty; } ty::ty_uniq(mt) { - ds += ~[@{mut: false, kind: unbox, outer_t: t}]; + ds += [@{mut: false, kind: unbox, outer_t: t}]; } ty::ty_res(_, inner, tps) { - ds += ~[@{mut: false, kind: unbox, outer_t: t}]; + ds += [@{mut: false, kind: unbox, outer_t: t}]; t = ty::substitute_type_params(cx.tcx, tps, inner); } ty::ty_tag(did, tps) { let variants = ty::tag_variants(cx.tcx, did); if vec::len(variants) != 1u || - vec::len(variants.(0).args) != 1u { + vec::len(variants[0].args) != 1u { break; } - ds += ~[@{mut: false, kind: unbox, outer_t: t}]; + ds += [@{mut: false, kind: unbox, outer_t: t}]; t = ty::substitute_type_params(cx.tcx, tps, - variants.(0).args.(0)); + variants[0].args[0]); } _ { break; } } } ret {t: t, ds: ds}; } - let ds: [deref] = ~[]; + let ds: [deref] = []; while true { alt { ex.node } { ast::expr_field(base, ident) { @@ -577,7 +592,7 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) -> } ty::ty_obj(_) { } } - ds += ~[@{mut: mut, kind: field, outer_t: auto_unbox.t}]; + ds += [@{mut: mut, kind: field, outer_t: auto_unbox.t}]; ds += auto_unbox.ds; ex = base; } @@ -586,9 +601,9 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) -> alt ty::struct(cx.tcx, auto_unbox.t) { ty::ty_vec(mt) { ds += - ~[@{mut: mt.mut != ast::imm, - kind: index, - outer_t: auto_unbox.t}]; + [@{mut: mt.mut != ast::imm, + kind: index, + outer_t: auto_unbox.t}]; } } ds += auto_unbox.ds; @@ -605,7 +620,7 @@ fn expr_root(cx: &ctx, ex: @ast::expr, autoderef: bool) -> ty::ty_tag(_, _) { } ty::ty_ptr(mt) { mut = mt.mut != ast::imm; } } - ds += ~[@{mut: mut, kind: unbox, outer_t: base_t}]; + ds += [@{mut: mut, kind: unbox, outer_t: base_t}]; ex = base; } else { break; } } @@ -631,9 +646,9 @@ fn inner_mut(ds: &@[deref]) -> option::t<ty::t> { fn path_def(cx: &ctx, ex: &@ast::expr) -> option::t<ast::def> { ret alt ex.node { - ast::expr_path(_) { some(cx.tcx.def_map.get(ex.id)) } - _ { none } - } + ast::expr_path(_) { some(cx.tcx.def_map.get(ex.id)) } + _ { none } + } } fn path_def_id(cx: &ctx, ex: &@ast::expr) -> option::t<ast::def_id> { @@ -673,25 +688,23 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t, ret false; } ty::ty_tup(ts) { - for t in ts { - if helper(tcx, needle, t, mut) { - ret true; - } - } + for t in ts { if helper(tcx, needle, t, mut) { ret true; } } ret false; } + // These may contain anything. ty::ty_fn(_, _, _, _, _) { ret true; } ty::ty_obj(_) { ret true; } + // A type param may include everything, but can only be // treated as opaque downstream, and is thus safe unless we // saw mutable fields, in which case the whole thing can be // overwritten. - ty::ty_param(_,_) { + ty::ty_param(_, _) { ret mut; } _ { ret false; } diff --git a/src/comp/middle/ast_map.rs b/src/comp/middle/ast_map.rs index cca7667a691..afba7e20ced 100644 --- a/src/comp/middle/ast_map.rs +++ b/src/comp/middle/ast_map.rs @@ -60,14 +60,14 @@ fn new_smallintmap_int_adapter<@V>() -> std::map::hashmap<int, V> { // interface. // FIXME: hashmap and smallintmap should support the same interface. fn new_smallintmap_adapter<@K, - @V>(key_idx: fn(&K) -> uint , - idx_key: fn(&uint) -> K ) -> + @V>(key_idx: fn(&K) -> uint, + idx_key: fn(&uint) -> K) -> std::map::hashmap<K, V> { obj adapter<@K, @V>(map: smallintmap::smallintmap<V>, - key_idx: fn(&K) -> uint , - idx_key: fn(&uint) -> K ) { + key_idx: fn(&K) -> uint, + idx_key: fn(&uint) -> K) { fn size() -> uint { fail } @@ -128,45 +128,44 @@ mod test { #[test] fn test_node_span_item() { let expected: codemap::span = mk_sp(20u, 30u); - let node = node_item(@{ident: "test", - attrs: ~[], - id: 0, - node: item_mod({view_items: ~[], - items: ~[]}), - span: expected}); - assert node_span(node) == expected; + let node = + node_item(@{ident: "test", + attrs: [], + id: 0, + node: item_mod({view_items: [], items: []}), + span: expected}); + assert (node_span(node) == expected); } #[test] fn test_node_span_obj_ctor() { let expected: codemap::span = mk_sp(20u, 30u); - let node = node_obj_ctor(@{ident: "test", - attrs: ~[], - id: 0, - node: item_mod({view_items: ~[], - items: ~[]}), - span: expected}); - assert node_span(node) == expected; + let node = + node_obj_ctor(@{ident: "test", + attrs: [], + id: 0, + node: item_mod({view_items: [], items: []}), + span: expected}); + assert (node_span(node) == expected); } #[test] fn test_node_span_native_item() { let expected: codemap::span = mk_sp(20u, 30u); - let node = node_native_item(@{ident: "test", - attrs: ~[], - node: native_item_ty, - id: 0, - span: expected}); - assert node_span(node) == expected; + let node = + node_native_item(@{ident: "test", + attrs: [], + node: native_item_ty, + id: 0, + span: expected}); + assert (node_span(node) == expected); } #[test] fn test_node_span_expr() { let expected: codemap::span = mk_sp(20u, 30u); - let node = node_expr(@{id: 0, - node: expr_break, - span: expected}); - assert node_span(node) == expected; + let node = node_expr(@{id: 0, node: expr_break, span: expected}); + assert (node_span(node) == expected); } } diff --git a/src/comp/middle/check_alt.rs b/src/comp/middle/check_alt.rs index 29be298aad1..7c2f76c0590 100644 --- a/src/comp/middle/check_alt.rs +++ b/src/comp/middle/check_alt.rs @@ -5,7 +5,7 @@ fn check_crate(tcx: &ty::ctxt, crate: &@crate) { let v = @{visit_expr: bind check_expr(tcx, _, _, _), visit_local: bind check_local(tcx, _, _, _) - with *visit::default_visitor::<()>()}; + with *visit::default_visitor::<()>()}; visit::visit_crate(*crate, (), visit::mk_vt(v)); tcx.sess.abort_if_errors(); } @@ -22,7 +22,7 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) { let reachable = true; let j = 0; while j < i { - for prev_pat: @pat in arms.(j).pats { + for prev_pat: @pat in arms[j].pats { if pattern_supersedes(tcx, prev_pat, arm_pat) { reachable = false; } @@ -38,11 +38,10 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) { } fn pattern_supersedes(tcx: &ty::ctxt, a: &@pat, b: &@pat) -> bool { - fn patterns_supersede(tcx: &ty::ctxt, as: &[@pat], bs: &[@pat]) -> - bool { + fn patterns_supersede(tcx: &ty::ctxt, as: &[@pat], bs: &[@pat]) -> bool { let i = 0; for a: @pat in as { - if !pattern_supersedes(tcx, a, bs.(i)) { ret false; } + if !pattern_supersedes(tcx, a, bs[i]) { ret false; } i += 1; } ret true; @@ -119,19 +118,13 @@ fn is_refutable(tcx: &ty::ctxt, pat: &@pat) -> bool { ret false; } pat_tup(elts) { - for elt in elts { - if is_refutable(tcx, elt) { ret true; } - } + for elt in elts { if is_refutable(tcx, elt) { ret true; } } ret false; } pat_tag(_, args) { let vdef = variant_def_ids(tcx.def_map.get(pat.id)); - if std::vec::len(ty::tag_variants(tcx, vdef.tg)) != 1u { - ret true; - } - for p: @pat in args { - if is_refutable(tcx, p) { ret true; } - } + if std::vec::len(ty::tag_variants(tcx, vdef.tg)) != 1u { ret true; } + for p: @pat in args { if is_refutable(tcx, p) { ret true; } } ret false; } } diff --git a/src/comp/middle/freevars.rs b/src/comp/middle/freevars.rs index 2822e404e50..8bef22f8ad8 100644 --- a/src/comp/middle/freevars.rs +++ b/src/comp/middle/freevars.rs @@ -38,59 +38,62 @@ type freevar_map = hashmap<ast::node_id, freevar_info>; // of the AST, we take a walker function that we invoke with a visitor // in order to start the search. fn collect_freevars(def_map: &resolve::def_map, sess: &session::session, - walker: &fn(&visit::vt<()>) , + walker: &fn(&visit::vt<()>), initial_decls: [ast::node_id]) -> freevar_info { let decls = new_int_hash(); for decl: ast::node_id in initial_decls { set_add(decls, decl); } - let refs = @mutable ~[]; + let refs = @mutable []; - let walk_fn = lambda(f: &ast::_fn, _tps: &[ast::ty_param], _sp: &span, - _i: &ast::fn_ident, _nid: ast::node_id) { - for a: ast::arg in f.decl.inputs { set_add(decls, a.id); } - }; - let walk_expr = lambda(expr: &@ast::expr) { - alt expr.node { - ast::expr_path(path) { - if !def_map.contains_key(expr.id) { - sess.span_fatal(expr.span, - "internal error in collect_freevars"); + let walk_fn = + lambda (f: &ast::_fn, _tps: &[ast::ty_param], _sp: &span, + _i: &ast::fn_ident, _nid: ast::node_id) { + for a: ast::arg in f.decl.inputs { set_add(decls, a.id); } + }; + let walk_expr = + lambda (expr: &@ast::expr) { + alt expr.node { + ast::expr_path(path) { + if !def_map.contains_key(expr.id) { + sess.span_fatal(expr.span, + "internal error in collect_freevars"); + } + alt def_map.get(expr.id) { + ast::def_arg(did) { *refs += [expr.id]; } + ast::def_local(did) { *refs += [expr.id]; } + ast::def_binding(did) { *refs += [expr.id]; } + _ {/* no-op */ } + } + } + _ { } } - alt def_map.get(expr.id) { - ast::def_arg(did) { *refs += ~[expr.id]; } - ast::def_local(did) { *refs += ~[expr.id]; } - ast::def_binding(did) { *refs += ~[expr.id]; } - _ {/* no-op */ } + }; + let walk_local = + lambda (local: &@ast::local) { + for each b: @ast::pat in ast::pat_bindings(local.node.pat) { + set_add(decls, b.id); } - } - _ { } - } - }; - let walk_local = lambda(local: &@ast::local) { - for each b: @ast::pat in ast::pat_bindings(local.node.pat) { - set_add(decls, b.id); - } - }; - let walk_pat = lambda(p: &@ast::pat) { - alt p.node { ast::pat_bind(_) { set_add(decls, p.id); } _ { } } - }; - - walker(visit::mk_simple_visitor - (@{visit_local: walk_local, - visit_pat: walk_pat, - visit_expr: walk_expr, - visit_fn: walk_fn - with *visit::default_simple_visitor()})); + }; + let walk_pat = + lambda (p: &@ast::pat) { + alt p.node { ast::pat_bind(_) { set_add(decls, p.id); } _ { } } + }; + walker(visit::mk_simple_visitor(@{visit_local: walk_local, + visit_pat: walk_pat, + visit_expr: walk_expr, + visit_fn: walk_fn + with + *visit::default_simple_visitor()})); // Calculate (refs - decls). This is the set of captured upvars. // We build a vec of the node ids of the uses and a set of the // node ids of the definitions. - let canonical_refs = ~[]; + let canonical_refs = []; let defs = new_int_hash(); for ref_id_: ast::node_id in *refs { let ref_id = ref_id_; let def_id = ast::def_id_of_def(def_map.get(ref_id)).node; if !decls.contains_key(def_id) && !defs.contains_key(def_id) { - canonical_refs += ~[ref_id]; + canonical_refs += [ref_id]; set_add(defs, def_id); } } @@ -106,32 +109,34 @@ fn annotate_freevars(sess: &session::session, def_map: &resolve::def_map, crate: &@ast::crate) -> freevar_map { let freevars = new_int_hash(); - let walk_fn = lambda(f: &ast::_fn, tps: &[ast::ty_param], sp: &span, - i: &ast::fn_ident, nid: ast::node_id) { - let start_walk = lambda(v: &visit::vt<()>) { - v.visit_fn(f, tps, sp, i, nid, (), v); + let walk_fn = + lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span, + i: &ast::fn_ident, nid: ast::node_id) { + let start_walk = + lambda (v: &visit::vt<()>) { + v.visit_fn(f, tps, sp, i, nid, (), v); + }; + let vars = collect_freevars(def_map, sess, start_walk, []); + freevars.insert(nid, vars); + }; + let walk_expr = + lambda (expr: &@ast::expr) { + alt expr.node { + ast::expr_for_each(local, _, body) { + let start_walk = + lambda (v: &visit::vt<()>) { + v.visit_block(body, (), v); + }; + let bound = ast::pat_binding_ids(local.node.pat); + let vars = collect_freevars(def_map, sess, start_walk, bound); + freevars.insert(body.node.id, vars); + } + _ { } + } }; - let vars = collect_freevars(def_map, sess, start_walk, ~[]); - freevars.insert(nid, vars); - }; - let walk_expr = lambda(expr: &@ast::expr) { - alt expr.node { - ast::expr_for_each(local, _, body) { - let start_walk = lambda(v: &visit::vt<()>) { - v.visit_block(body, (), v); - }; - let bound = ast::pat_binding_ids(local.node.pat); - let vars = - collect_freevars(def_map, sess, start_walk, bound); - freevars.insert(body.node.id, vars); - } - _ { } - } - }; let visitor = - visit::mk_simple_visitor(@{visit_fn: walk_fn, - visit_expr: walk_expr + visit::mk_simple_visitor(@{visit_fn: walk_fn, visit_expr: walk_expr with *visit::default_simple_visitor()}); visit::visit_crate(*crate, (), visitor); diff --git a/src/comp/middle/gc.rs b/src/comp/middle/gc.rs index 878762294c6..103ce9eb47d 100644 --- a/src/comp/middle/gc.rs +++ b/src/comp/middle/gc.rs @@ -16,15 +16,13 @@ import std::vec; import lll = lib::llvm::llvm; -type ctxt = @{ mutable next_tydesc_num: uint }; +type ctxt = @{mutable next_tydesc_num: uint}; -fn mk_ctxt() -> ctxt { - ret @{ mutable next_tydesc_num: 0u }; -} +fn mk_ctxt() -> ctxt { ret @{mutable next_tydesc_num: 0u}; } fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: str) -> ValueRef { - let llglobal = lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), - str::buf(name)); + let llglobal = + lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), str::buf(name)); lll::LLVMSetInitializer(llglobal, llval); lll::LLVMSetGlobalConstant(llglobal, True); ret llglobal; @@ -33,7 +31,7 @@ fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: str) -> ValueRef { fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt { let bcx = cx; if !type_is_gc_relevant(bcx_tcx(cx), ty) || - ty::type_has_dynamic_size(bcx_tcx(cx), ty) { + ty::type_has_dynamic_size(bcx_tcx(cx), ty) { ret bcx; } @@ -52,48 +50,45 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt { let llvalptr = bcx.build.PointerCast(llval, T_ptr(T_ptr(T_i8()))); alt td_r.kind { - tk_derived. { - // It's a derived type descriptor. First, spill it. - let lltydescptr = trans::alloca(bcx, val_ty(lltydesc)); - bcx.build.Store(lltydesc, lltydescptr); - - let number = gc_cx.next_tydesc_num; - gc_cx.next_tydesc_num += 1u; - - let lldestindex = add_global(bcx_ccx(bcx), - C_struct(~[C_int(0), - C_uint(number)]), - "rust_gc_tydesc_dest_index"); - let llsrcindex = add_global(bcx_ccx(bcx), - C_struct(~[C_int(1), C_uint(number)]), - "rust_gc_tydesc_src_index"); - - lldestindex = lll::LLVMConstPointerCast(lldestindex, - T_ptr(T_i8())); - llsrcindex = lll::LLVMConstPointerCast(llsrcindex, - T_ptr(T_i8())); - - lltydescptr = bcx.build.PointerCast(lltydescptr, - T_ptr(T_ptr(T_i8()))); - - bcx.build.Call(gcroot, ~[ lltydescptr, lldestindex ]); - bcx.build.Call(gcroot, ~[ llvalptr, llsrcindex ]); - } - tk_param. { - bcx_tcx(cx).sess.bug("we should never be trying to root values " + - "of a type parameter"); - } - tk_static. { - // Static type descriptor. - - let llstaticgcmeta = add_global(bcx_ccx(bcx), - C_struct(~[C_int(2), lltydesc]), - "rust_gc_tydesc_static_gc_meta"); - let llstaticgcmetaptr = lll::LLVMConstPointerCast(llstaticgcmeta, - T_ptr(T_i8())); - - bcx.build.Call(gcroot, ~[ llvalptr, llstaticgcmetaptr ]); - } + tk_derived. { + // It's a derived type descriptor. First, spill it. + let lltydescptr = trans::alloca(bcx, val_ty(lltydesc)); + bcx.build.Store(lltydesc, lltydescptr); + + let number = gc_cx.next_tydesc_num; + gc_cx.next_tydesc_num += 1u; + + let lldestindex = + add_global(bcx_ccx(bcx), C_struct([C_int(0), C_uint(number)]), + "rust_gc_tydesc_dest_index"); + let llsrcindex = + add_global(bcx_ccx(bcx), C_struct([C_int(1), C_uint(number)]), + "rust_gc_tydesc_src_index"); + + lldestindex = lll::LLVMConstPointerCast(lldestindex, T_ptr(T_i8())); + llsrcindex = lll::LLVMConstPointerCast(llsrcindex, T_ptr(T_i8())); + + lltydescptr = + bcx.build.PointerCast(lltydescptr, T_ptr(T_ptr(T_i8()))); + + bcx.build.Call(gcroot, [lltydescptr, lldestindex]); + bcx.build.Call(gcroot, [llvalptr, llsrcindex]); + } + tk_param. { + bcx_tcx(cx).sess.bug("we should never be trying to root values " + + "of a type parameter"); + } + tk_static. { + // Static type descriptor. + + let llstaticgcmeta = + add_global(bcx_ccx(bcx), C_struct([C_int(2), lltydesc]), + "rust_gc_tydesc_static_gc_meta"); + let llstaticgcmetaptr = + lll::LLVMConstPointerCast(llstaticgcmeta, T_ptr(T_i8())); + + bcx.build.Call(gcroot, [llvalptr, llstaticgcmetaptr]); + } } ret bcx; @@ -101,45 +96,52 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt { fn type_is_gc_relevant(cx: &ty::ctxt, ty: &ty::t) -> bool { alt ty::struct(cx, ty) { - ty::ty_nil. | ty::ty_bot. | ty::ty_bool. | ty::ty_int. | - ty::ty_float. | ty::ty_uint. | ty::ty_machine(_) | ty::ty_char. | - ty::ty_istr. | ty::ty_type. | ty::ty_native(_) | ty::ty_ptr(_) | - ty::ty_type. | ty::ty_native(_) { - ret false; - } - - ty::ty_rec(fields) { - for f in fields { - if type_is_gc_relevant(cx, f.mt.ty) { ret true; } - } - ret false; - } - ty::ty_tup(elts) { - for elt in elts { - if type_is_gc_relevant(cx, elt) { ret true; } + ty::ty_nil. | ty::ty_bot. | ty::ty_bool. | ty::ty_int. | ty::ty_float. | + ty::ty_uint. | ty::ty_machine(_) | ty::ty_char. | ty::ty_istr. | + ty::ty_type. | ty::ty_native(_) | ty::ty_ptr(_) | ty::ty_type. | + ty::ty_native(_) { + ret false; + } + + + ty::ty_rec(fields) { + for f in fields { if type_is_gc_relevant(cx, f.mt.ty) { ret true; } } + ret false; + } + ty::ty_tup(elts) { + for elt in elts { if type_is_gc_relevant(cx, elt) { ret true; } } + ret false; + } + + + ty::ty_tag(did, tps) { + let variants = ty::tag_variants(cx, did); + for variant in variants { + for aty in variant.args { + let arg_ty = ty::substitute_type_params(cx, tps, aty); + if type_is_gc_relevant(cx, arg_ty) { ret true; } } - ret false; } + ret false; + } + + + ty::ty_vec(tm) { + ret type_is_gc_relevant(cx, tm.ty); + } + ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); } - ty::ty_tag(did, tps) { - let variants = ty::tag_variants(cx, did); - for variant in variants { - for aty in variant.args { - let arg_ty = ty::substitute_type_params(cx, tps, aty); - if type_is_gc_relevant(cx, arg_ty) { ret true; } - } - } - ret false; - } - ty::ty_vec(tm) { ret type_is_gc_relevant(cx, tm.ty); } - ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); } + ty::ty_str. | ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _) + | ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) | + ty::ty_res(_, _, _) { + ret true; + } - ty::ty_str. | ty::ty_box(_) | ty::ty_uniq(_) | - ty::ty_fn(_,_,_,_,_) | ty::ty_native_fn(_,_,_) | ty::ty_obj(_) | - ty::ty_param(_,_) | ty::ty_res(_,_,_) { ret true; } - ty::ty_var(_) { fail "ty_var in type_is_gc_relevant"; } + ty::ty_var(_) { + fail "ty_var in type_is_gc_relevant"; + } } } diff --git a/src/comp/middle/kind.rs b/src/comp/middle/kind.rs index e4333aab6f5..f5e833a86d2 100644 --- a/src/comp/middle/kind.rs +++ b/src/comp/middle/kind.rs @@ -101,35 +101,30 @@ fn kind_to_str(k: kind) -> str { } } -fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr) - -> {ty: ty::t, kind: ast::kind} { +fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr) -> + {ty: ty::t, kind: ast::kind} { let t = ty::expr_ty(tcx, e); let k = ty::type_kind(tcx, t); {ty: t, kind: k} } -fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, - k_need: ast::kind, descr: &str) { +fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind, + descr: &str) { let tk = type_and_kind(tcx, e); - log #fmt("for %s: want %s type, got %s type %s", - descr, - kind_to_str(k_need), - kind_to_str(tk.kind), - util::ppaux::ty_to_str(tcx, tk.ty)); + log #fmt["for %s: want %s type, got %s type %s", descr, + kind_to_str(k_need), kind_to_str(tk.kind), + util::ppaux::ty_to_str(tcx, tk.ty)]; - if ! kind_lteq(k_need, tk.kind) { + if !kind_lteq(k_need, tk.kind) { let s = - #fmt("mismatched kinds for %s: needed %s type, got %s type %s", - descr, - kind_to_str(k_need), - kind_to_str(tk.kind), - util::ppaux::ty_to_str(tcx, tk.ty)); + #fmt["mismatched kinds for %s: needed %s type, got %s type %s", + descr, kind_to_str(k_need), kind_to_str(tk.kind), + util::ppaux::ty_to_str(tcx, tk.ty)]; tcx.sess.span_err(e.span, s); } } -fn need_shared_lhs_rhs(tcx: &ty::ctxt, - a: &@ast::expr, b: &@ast::expr, +fn need_shared_lhs_rhs(tcx: &ty::ctxt, a: &@ast::expr, b: &@ast::expr, op: &str) { need_expr_kind(tcx, a, ast::kind_shared, op + " lhs"); need_expr_kind(tcx, b, ast::kind_shared, op + " rhs"); @@ -142,6 +137,7 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) { ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, "<->"); } ast::expr_call(callee, _) { let tpt = ty::expr_ty_params_and_ty(tcx, callee); + // If we have typarams, we're calling an item; we need to check // that all the types we're supplying as typarams conform to the // typaram kind constraints on that item. @@ -149,17 +145,16 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) { let callee_def = ast::def_id_of_def(tcx.def_map.get(callee.id)); let item_tk = ty::lookup_item_type(tcx, callee_def); let i = 0; - assert vec::len(item_tk.kinds) == vec::len(tpt.params); + assert (vec::len(item_tk.kinds) == vec::len(tpt.params)); for k_need: ast::kind in item_tk.kinds { - let t = tpt.params.(i); + let t = tpt.params[i]; let k = ty::type_kind(tcx, t); - if ! kind_lteq(k_need, k) { - let s = #fmt("mismatched kinds for typaram %d: \ + if !kind_lteq(k_need, k) { + let s = + #fmt["mismatched kinds for typaram %d: \ needed %s type, got %s type %s", - i, - kind_to_str(k_need), - kind_to_str(k), - util::ppaux::ty_to_str(tcx, t)); + i, kind_to_str(k_need), kind_to_str(k), + util::ppaux::ty_to_str(tcx, t)]; tcx.sess.span_err(e.span, s); } i += 1; @@ -171,9 +166,9 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) { } fn check_crate(tcx: &ty::ctxt, crate: &@ast::crate) { - let visit = visit::mk_simple_visitor - (@{visit_expr: bind check_expr(tcx, _) - with *visit::default_simple_visitor()}); + let visit = + visit::mk_simple_visitor(@{visit_expr: bind check_expr(tcx, _) + with *visit::default_simple_visitor()}); visit::visit_crate(*crate, (), visit); tcx.sess.abort_if_errors(); } diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs index 80bd61cd979..0785be75823 100644 --- a/src/comp/middle/resolve.rs +++ b/src/comp/middle/resolve.rs @@ -65,9 +65,11 @@ tag import_state { todo(ast::node_id, ast::ident, [ast::ident], codemap::span, scopes); resolving(span); resolved(option::t<def>, - /* value */ + + /* value */ option::t<def>, - /* type */ + + /* type */ option::t<def>); /* module */ } @@ -135,7 +137,7 @@ tag dir { inside; outside; } tag namespace { ns_value; ns_type; ns_module; } fn resolve_crate(sess: session, amap: &ast_map::map, crate: @ast::crate) -> - {def_map: def_map, ext_map: ext_map} { + {def_map: def_map, ext_map: ext_map} { let e = @{cstore: sess.get_cstore(), def_map: new_int_hash::<def>(), @@ -144,7 +146,7 @@ fn resolve_crate(sess: session, amap: &ast_map::map, crate: @ast::crate) -> mod_map: new_int_hash::<@indexed_mod>(), ext_map: new_def_hash::<[ident]>(), ext_cache: new_ext_hash(), - mutable reported: ~[], + mutable reported: [], sess: sess}; map_crate(e, crate); resolve_imports(*e); @@ -169,7 +171,7 @@ fn map_crate(e: &@env, c: &@ast::crate) { e.mod_map.insert(-1, @{m: some(c.node.module), index: index_mod(c.node.module), - mutable glob_imports: ~[], + mutable glob_imports: [], glob_imported_names: new_str_hash::<import_state>()}); fn index_vi(e: @env, i: &@ast::view_item, sc: &scopes, _v: &vt<scopes>) { alt i.node { @@ -180,8 +182,8 @@ fn map_crate(e: &@env, c: &@ast::crate) { for ident in idents { e.imports.insert(ident.node.id, todo(ident.node.id, ident.node.name, - mod_path + ~[ident.node.name], - ident.span, sc)); + mod_path + [ident.node.name], + ident.span, sc)); } } _ { } @@ -195,7 +197,7 @@ fn map_crate(e: &@env, c: &@ast::crate) { e.mod_map.insert(i.id, @{m: some(md), index: index_mod(md), - mutable glob_imports: ~[], + mutable glob_imports: [], glob_imported_names: s}); } ast::item_native_mod(nmd) { @@ -203,7 +205,7 @@ fn map_crate(e: &@env, c: &@ast::crate) { e.mod_map.insert(i.id, @{m: none::<ast::_mod>, index: index_nmod(nmd), - mutable glob_imports: ~[], + mutable glob_imports: [], glob_imported_names: s}); } _ { } @@ -237,12 +239,13 @@ fn map_crate(e: &@env, c: &@ast::crate) { } alt vi.node { + //if it really is a glob import, that is ast::view_item_import_glob(path, _) { let imp = follow_import(*e, sc, path, vi.span); if option::is_some(imp) { find_mod(e, sc).glob_imports += - ~[{def: option::get(imp), item: vi}]; + [{def: option::get(imp), item: vi}]; } } _ { } @@ -255,8 +258,7 @@ fn resolve_imports(e: &env) { { alt it.val { todo(node_id, name, path, span, scopes) { - resolve_import(e, local_def(node_id), - name, path, span, scopes); + resolve_import(e, local_def(node_id), name, path, span, scopes); } resolved(_, _, _) { } } @@ -318,8 +320,8 @@ fn resolve_names(e: &@env, c: &@ast::crate) { e.def_map.insert(pat.id, option::get(fnd)); } _ { - e.sess.span_err - (p.span, "not a tag variant: " + ast::path_name(p)); + e.sess.span_err(p.span, + "not a tag variant: " + ast::path_name(p)); } } } @@ -349,7 +351,7 @@ fn visit_fn_with_scope(e: &@env, f: &ast::_fn, tp: &[ast::ty_param], // is this a main fn declaration? alt name { some(nm) { - if is_main_name(~[nm]) && !e.sess.get_opts().library { + if is_main_name([nm]) && !e.sess.get_opts().library { // This is a main function -- set it in the session // as the main ID e.sess.set_main_id(id); @@ -361,9 +363,7 @@ fn visit_fn_with_scope(e: &@env, f: &ast::_fn, tp: &[ast::ty_param], // here's where we need to set up the mapping // for f's constrs in the table. - for c: @ast::constr in f.decl.constraints { - resolve_constr(e, c, sc, v); - } + for c: @ast::constr in f.decl.constraints { resolve_constr(e, c, sc, v); } visit::visit_fn(f, tp, sp, name, id, cons(scope_fn(f.decl, f.proto, tp), @sc), v); } @@ -372,24 +372,22 @@ fn visit_block_with_scope(b: &ast::blk, sc: &scopes, v: &vt<scopes>) { let pos = @mutable 0u, loc = @mutable 0u; let block_sc = cons(scope_block(b, pos, loc), @sc); for stmt in b.node.stmts { - v.visit_stmt(stmt, block_sc, v); - *pos += 1u; + v.visit_stmt(stmt, block_sc, v);; + *pos += 1u;; *loc = 0u; } visit::visit_expr_opt(b.node.expr, block_sc, v); } fn visit_decl_with_scope(d: &@decl, sc: &scopes, v: &vt<scopes>) { - let loc_pos = alt list::car(sc) { - scope_block(_, _, pos) { pos } - _ { @mutable 0u } - }; + let loc_pos = + alt list::car(sc) { + scope_block(_, _, pos) { pos } + _ { @mutable 0u } + }; alt d.node { decl_local(locs) { - for loc in locs { - v.visit_local(loc, sc, v); - *loc_pos += 1u; - } + for loc in locs { v.visit_local(loc, sc, v);; *loc_pos += 1u; } } decl_item(it) { v.visit_item(it, sc, v); } } @@ -408,7 +406,7 @@ fn visit_expr_with_scope(x: &@ast::expr, sc: &scopes, v: &vt<scopes>) { v.visit_block(blk, new_sc, v); } ast::expr_fn(f) { - visit::visit_expr(x, cons(scope_fn(f.decl, f.proto, ~[]), @sc), v); + visit::visit_expr(x, cons(scope_fn(f.decl, f.proto, []), @sc), v); } _ { visit::visit_expr(x, sc, v); } } @@ -417,12 +415,12 @@ fn visit_expr_with_scope(x: &@ast::expr, sc: &scopes, v: &vt<scopes>) { fn follow_import(e: &env, sc: &scopes, path: &[ident], sp: &span) -> option::t<def> { let path_len = vec::len(path); - let dcur = lookup_in_scope_strict(e, sc, sp, path.(0), ns_module); + let dcur = lookup_in_scope_strict(e, sc, sp, path[0], ns_module); let i = 1u; while true && option::is_some(dcur) { if i == path_len { break; } dcur = - lookup_in_mod_strict(e, sc, option::get(dcur), sp, path.(i), + lookup_in_mod_strict(e, sc, option::get(dcur), sp, path[i], ns_module, outside); i += 1u; } @@ -461,23 +459,22 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, ids: &[ast::ident], sp: &codemap::span, sc_in: &scopes) { e.imports.insert(defid.node, resolving(sp)); let n_idents = vec::len(ids); - let end_id = ids.(n_idents - 1u); + let end_id = ids[n_idents - 1u]; // Ignore the current scope if this import would shadow itself. let sc = - if str::eq(name, ids.(0)) { std::list::cdr(sc_in) } else { sc_in }; + if str::eq(name, ids[0]) { std::list::cdr(sc_in) } else { sc_in }; if n_idents == 1u { register(e, defid, sp, end_id, sc_in, lookup_in_scope(e, sc, sp, end_id, ns_value), lookup_in_scope(e, sc, sp, end_id, ns_type), lookup_in_scope(e, sc, sp, end_id, ns_module)); remove_if_unresolved(e.imports, defid.node); - } else { - let // FIXME (issue #521) - dcur = - alt lookup_in_scope(e, sc, sp, ids.(0), ns_module) { + } else { // FIXME (issue #521) + let dcur = + alt lookup_in_scope(e, sc, sp, ids[0], ns_module) { some(dcur) { dcur } none. { - unresolved_err(e, sc, sp, ids.(0), ns_name(ns_module)); + unresolved_err(e, sc, sp, ids[0], ns_name(ns_module)); remove_if_unresolved(e.imports, defid.node); ret () } @@ -488,20 +485,18 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident, register(e, defid, sp, end_id, sc_in, lookup_in_mod(e, dcur, sp, end_id, ns_value, outside), - lookup_in_mod(e, dcur, sp, end_id, ns_type, - outside), + lookup_in_mod(e, dcur, sp, end_id, ns_type, outside), lookup_in_mod(e, dcur, sp, end_id, ns_module, outside)); remove_if_unresolved(e.imports, defid.node); break; } else { dcur = - alt lookup_in_mod(e, dcur, sp, ids.(i), ns_module, - outside) { + alt lookup_in_mod(e, dcur, sp, ids[i], ns_module, outside) + { some(dcur) { dcur } none. { - unresolved_err(e, sc, sp, ids.(i), - ns_name(ns_module)); + unresolved_err(e, sc, sp, ids[i], ns_name(ns_module)); remove_if_unresolved(e.imports, defid.node); ret () // FIXME (issue #521) } @@ -563,7 +558,7 @@ fn unresolved_err(e: &env, sc: &scopes, sp: &span, name: &ident, kind: &str) { for rs: {ident: str, sc: scope} in e.reported { if str::eq(rs.ident, name) && err_scope == rs.sc { ret; } } - e.reported += ~[{ident: name, sc: err_scope}]; + e.reported += [{ident: name, sc: err_scope}]; e.sess.span_err(sp, mk_unresolved_msg(name, kind)); } @@ -572,7 +567,7 @@ fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &str) -> ! { } fn mk_unresolved_msg(id: &ident, kind: &str) -> str { - ret #fmt("unresolved %s: %s", kind, id); + ret #fmt["unresolved %s: %s", kind, id]; } // Lookup helpers @@ -587,13 +582,13 @@ fn lookup_path_strict(e: &env, sc: &scopes, sp: &span, pth: &ast::path_, } else { first_scope = sc; } let dcur = - lookup_in_scope_strict(e, first_scope, sp, pth.idents.(0), headns); + lookup_in_scope_strict(e, first_scope, sp, pth.idents[0], headns); let i = 1u; while i < n_idents && option::is_some(dcur) { let curns = if n_idents == i + 1u { ns } else { ns_module }; dcur = - lookup_in_mod_strict(e, sc, option::get(dcur), sp, pth.idents.(i), + lookup_in_mod_strict(e, sc, option::get(dcur), sp, pth.idents[i], curns, outside); i += 1u; } @@ -630,7 +625,7 @@ fn def_is_obj_field(d: &def) -> bool { } fn def_is_ty_arg(d: &def) -> bool { - ret alt d { ast::def_ty_arg(_,_) { true } _ { false } }; + ret alt d { ast::def_ty_arg(_, _) { true } _ { false } }; } fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident, @@ -675,7 +670,7 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident, if ns == ns_value { alt lookup_in_pat(name, local.node.pat) { some(did) { ret some(ast::def_local(did)); } - _ {} + _ { } } } } @@ -685,7 +680,7 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident, scope_arm(a) { if ns == ns_value { ret option::map(ast::def_binding, - lookup_in_pat(name, a.pats.(0))); + lookup_in_pat(name, a.pats[0])); } } } @@ -736,7 +731,7 @@ fn lookup_in_ty_params(name: &ident, ty_params: &[ast::ty_param]) -> option::t<def> { let i = 0u; for tp: ast::ty_param in ty_params { - if str::eq(tp.ident, name) { ret some(ast::def_ty_arg(i,tp.kind)); } + if str::eq(tp.ident, name) { ret some(ast::def_ty_arg(i, tp.kind)); } i += 1u; } ret none::<def>; @@ -746,9 +741,7 @@ fn lookup_in_pat(name: &ident, pat: &@ast::pat) -> option::t<def_id> { let found = none; for each bound in ast::pat_bindings(pat) { let p_name = alt bound.node { ast::pat_bind(n) { n } }; - if str::eq(p_name, name) { - found = some(local_def(bound.id)); - } + if str::eq(p_name, name) { found = some(local_def(bound.id)); } } ret found; } @@ -791,7 +784,7 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint, let i = vec::len(b.stmts); while i > 0u { i -= 1u; - let st = b.stmts.(i); + let st = b.stmts[i]; alt st.node { ast::stmt_decl(d, _) { alt d.node { @@ -800,11 +793,11 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint, let j = vec::len(locs); while j > 0u { j -= 1u; - let loc = locs.(j); + let loc = locs[j]; if ns == ns_value && (i < pos || j < loc_pos) { alt lookup_in_pat(name, loc.node.pat) { some(did) { ret some(ast::def_local(did)); } - _ {} + _ { } } } } @@ -817,7 +810,7 @@ fn lookup_in_block(name: &ident, b: &ast::blk_, pos: uint, loc_pos: uint, if str::eq(it.ident, name) { ret some(ast::def_ty(local_def(it.id))); } - } else if (ns == ns_value) { + } else if ns == ns_value { for v: ast::variant in variants { if str::eq(v.node.name, name) { let i = v.node.id; @@ -904,7 +897,7 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace, let cached = e.ext_cache.find({did: defid, ident: name, ns: ns}); if !is_none(cached) { ret cached; } - let path = ~[name]; + let path = [name]; if defid.node != -1 { path = e.ext_map.get(defid) + path; } let fnd = lookup_external(e, defid.crate, path, ns); if !is_none(fnd) { @@ -923,8 +916,7 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace, } } -fn found_view_item(e: &env, vi: @ast::view_item) -> - option::t<def> { +fn found_view_item(e: &env, vi: @ast::view_item) -> option::t<def> { alt vi.node { ast::view_item_use(_, _, id) { let cnum = cstore::get_use_stmt_cnum(e.cstore, id); @@ -936,8 +928,7 @@ fn found_view_item(e: &env, vi: @ast::view_item) -> fn lookup_import(e: &env, defid: def_id, ns: namespace) -> option::t<def> { alt e.imports.get(defid.node) { todo(node_id, name, path, span, scopes) { - resolve_import(e, local_def(node_id), - name, path, span, scopes); + resolve_import(e, local_def(node_id), name, path, span, scopes); ret lookup_import(e, defid, ns); } resolving(sp) { e.sess.span_err(sp, "cyclic import"); ret none; } @@ -998,15 +989,15 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident, let matches = vec::filter_map(bind lookup_in_mod_(e, _, sp, id, ns, dr), - { info.glob_imports }); + { info.glob_imports }); if vec::len(matches) == 0u { ret none; - } else if (vec::len(matches) == 1u) { - ret some(matches.(0).def); + } else if vec::len(matches) == 1u { + ret some(matches[0].def); } else { for match: glob_imp_def in matches { let sp = match.item.span; - e.sess.span_note(sp, #fmt("'%s' is imported here", id)); + e.sess.span_note(sp, #fmt["'%s' is imported here", id]); } e.sess.span_fatal(sp, "'" + id + "' is glob-imported from" + @@ -1051,7 +1042,7 @@ fn lookup_in_mie(e: &env, mie: &mod_index_entry, ns: namespace) -> alt item.node { ast::item_tag(variants, _) { if ns == ns_value { - let vid = variants.(variant_idx).node.id; + let vid = variants[variant_idx].node.id; ret some(ast::def_variant(local_def(item.id), local_def(vid))); } else { ret none::<def>; } @@ -1090,15 +1081,16 @@ fn index_mod(md: &ast::_mod) -> mod_index { let index = new_str_hash::<list<mod_index_entry>>(); for it: @ast::view_item in md.view_items { alt it.node { - ast::view_item_use(ident, _, _) - { + ast::view_item_use(ident, _, _) { add_to_index(index, ident, mie_view_item(it)); } + ast::view_item_import(ident, _, id) { add_to_index(index, ident, mie_import_ident(id, it.span)); } + ast::view_item_import_from(_, idents, _) { for ident in idents { add_to_index(index, ident.node.name, @@ -1106,6 +1098,7 @@ fn index_mod(md: &ast::_mod) -> mod_index { } } + //globbed imports have to be resolved lazily. ast::view_item_import_glob(_, _) | ast::view_item_export(_, _) { } @@ -1191,20 +1184,19 @@ fn lookup_external(e: &env, cnum: int, ids: &[ident], ns: namespace) -> fn check_for_collisions(e: &@env, c: &ast::crate) { // Module indices make checking those relatively simple -- just check each // name for multiple entities in the same namespace. - for each m: @{key: ast::node_id, val: @indexed_mod} - in e.mod_map.items() { - for each name: @{key: ident, val: list<mod_index_entry>} - in m.val.index.items() { + for each m: @{key: ast::node_id, val: @indexed_mod} in e.mod_map.items() { + for each name: @{key: ident, val: list<mod_index_entry>} in + m.val.index.items() { check_mod_name(*e, name.key, name.val); } } // Other scopes have to be checked the hard way. - let v = @{visit_item: bind check_item(e, _, _, _), - visit_block: bind check_block(e, _, _, _), - visit_arm: bind check_arm(e, _, _, _), - visit_expr: bind check_expr(e, _, _, _), - visit_ty: bind check_ty(e, _, _, _) - with *visit::default_visitor()}; + let v = + @{visit_item: bind check_item(e, _, _, _), + visit_block: bind check_block(e, _, _, _), + visit_arm: bind check_arm(e, _, _, _), + visit_expr: bind check_expr(e, _, _, _), + visit_ty: bind check_ty(e, _, _, _) with *visit::default_visitor()}; visit::visit_crate(c, (), visit::mk_vt(v)); } @@ -1252,16 +1244,16 @@ fn mie_span(mie: &mod_index_entry) -> span { fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) { fn typaram_names(tps: &[ast::ty_param]) -> [ident] { - let x: [ast::ident] = ~[]; - for tp: ast::ty_param in tps { x += ~[tp.ident] } + let x: [ast::ident] = []; + for tp: ast::ty_param in tps { x += [tp.ident] } ret x; } visit::visit_item(i, x, v); alt i.node { ast::item_fn(f, ty_params) { check_fn(*e, i.span, f); - ensure_unique(*e, i.span, typaram_names(ty_params), - ident_id, "type parameter"); + ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, + "type parameter"); } ast::item_obj(ob, ty_params, _) { fn field_name(field: &ast::obj_field) -> ident { ret field.ident; } @@ -1269,12 +1261,12 @@ fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) { for m: @ast::method in ob.methods { check_fn(*e, m.span, m.node.meth); } - ensure_unique(*e, i.span, typaram_names(ty_params), - ident_id, "type parameter"); + ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, + "type parameter"); } ast::item_tag(_, ty_params) { - ensure_unique(*e, i.span, typaram_names(ty_params), - ident_id, "type parameter"); + ensure_unique(*e, i.span, typaram_names(ty_params), ident_id, + "type parameter"); } _ { } } @@ -1290,25 +1282,25 @@ fn check_pat(ch: checker, p: &@ast::pat) { fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) { visit::visit_arm(a, x, v); let ch0 = checker(*e, "binding"); - check_pat(ch0, a.pats.(0)); + check_pat(ch0, a.pats[0]); let seen0 = ch0.seen; let i = vec::len(a.pats); while i > 1u { i -= 1u; let ch = checker(*e, "binding"); - check_pat(ch, a.pats.(i)); + check_pat(ch, a.pats[i]); // Ensure the bindings introduced in this pattern are the same as in // the first pattern. if vec::len(ch.seen) != vec::len(seen0) { - e.sess.span_err(a.pats.(i).span, + e.sess.span_err(a.pats[i].span, "inconsistent number of bindings"); } else { for name: ident in ch.seen { if is_none(vec::find(bind str::eq(name, _), seen0)) { // Fight the alias checker let name_ = name; - e.sess.span_err(a.pats.(i).span, + e.sess.span_err(a.pats[i].span, "binding " + name_ + " does not occur in first pattern"); } @@ -1395,7 +1387,7 @@ fn check_ty(e: &@env, ty: &@ast::ty, x: &(), v: &vt<()>) { type checker = @{mutable seen: [ident], kind: str, sess: session}; fn checker(e: &env, kind: str) -> checker { - let seen: [ident] = ~[]; + let seen: [ident] = []; ret @{mutable seen: seen, kind: kind, sess: e.sess}; } @@ -1408,12 +1400,12 @@ fn check_name(ch: &checker, sp: &span, name: &ident) { } fn add_name(ch: &checker, sp: &span, name: &ident) { check_name(ch, sp, name); - ch.seen += ~[name]; + ch.seen += [name]; } fn ident_id(i: &ident) -> ident { ret i; } -fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident , +fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident, kind: &str) { let ch = checker(e, kind); for elt: T in elts { add_name(ch, sp, id(elt)); } diff --git a/src/comp/middle/shape.rs b/src/comp/middle/shape.rs index e92f7c95ff0..a3d0dbe0b6e 100644 --- a/src/comp/middle/shape.rs +++ b/src/comp/middle/shape.rs @@ -34,61 +34,65 @@ import std::str; import ty_ctxt = middle::ty::ctxt; -type res_info = { did: ast::def_id, t: ty::t }; - -type ctxt = { - mutable next_tag_id: u16, - pad: u16, - tag_id_to_index: hashmap<ast::def_id,u16>, - mutable tag_order: [ast::def_id], - resources: interner::interner<res_info>, - llshapetablesty: TypeRef, - llshapetables: ValueRef -}; - -const shape_u8 : u8 = 0u8; -const shape_u16 : u8 = 1u8; -const shape_u32 : u8 = 2u8; -const shape_u64 : u8 = 3u8; -const shape_i8 : u8 = 4u8; -const shape_i16 : u8 = 5u8; -const shape_i32 : u8 = 6u8; -const shape_i64 : u8 = 7u8; -const shape_f32 : u8 = 8u8; -const shape_f64 : u8 = 9u8; -const shape_evec : u8 = 10u8; -const shape_ivec : u8 = 11u8; -const shape_tag : u8 = 12u8; -const shape_box : u8 = 13u8; -const shape_struct : u8 = 17u8; -const shape_fn : u8 = 18u8; -const shape_obj : u8 = 19u8; -const shape_res : u8 = 20u8; -const shape_var : u8 = 21u8; -const shape_uniq : u8 = 22u8; +type res_info = {did: ast::def_id, t: ty::t}; + +type ctxt = + {mutable next_tag_id: u16, + pad: u16, + tag_id_to_index: hashmap<ast::def_id, u16>, + mutable tag_order: [ast::def_id], + resources: interner::interner<res_info>, + llshapetablesty: TypeRef, + llshapetables: ValueRef}; + +const shape_u8: u8 = 0u8; +const shape_u16: u8 = 1u8; +const shape_u32: u8 = 2u8; +const shape_u64: u8 = 3u8; +const shape_i8: u8 = 4u8; +const shape_i16: u8 = 5u8; +const shape_i32: u8 = 6u8; +const shape_i64: u8 = 7u8; +const shape_f32: u8 = 8u8; +const shape_f64: u8 = 9u8; +const shape_evec: u8 = 10u8; +const shape_ivec: u8 = 11u8; +const shape_tag: u8 = 12u8; +const shape_box: u8 = 13u8; +const shape_struct: u8 = 17u8; +const shape_fn: u8 = 18u8; +const shape_obj: u8 = 19u8; +const shape_res: u8 = 20u8; +const shape_var: u8 = 21u8; +const shape_uniq: u8 = 22u8; // FIXME: This is a bad API in trans_common. -fn C_u8(n : u8) -> ValueRef { ret trans_common::C_u8(n as uint); } +fn C_u8(n: u8) -> ValueRef { ret trans_common::C_u8(n as uint); } -fn hash_res_info(ri : &res_info) -> uint { +fn hash_res_info(ri: &res_info) -> uint { let h = 5381u; - h *= 33u; h += (ri.did.crate as uint); - h *= 33u; h += (ri.did.node as uint); - h *= 33u; h += (ri.t as uint); + h *= 33u; + h += ri.did.crate as uint; + h *= 33u; + h += ri.did.node as uint; + h *= 33u; + h += ri.t as uint; ret h; } -fn eq_res_info(a : &res_info, b : &res_info) -> bool { +fn eq_res_info(a: &res_info, b: &res_info) -> bool { ret a.did.crate == b.did.crate && a.did.node == b.did.node && a.t == b.t; } -fn mk_global(ccx : &@crate_ctxt, name : &str, llval : ValueRef) -> ValueRef { - let llglobal = lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval), - str::buf(name)); +fn mk_global(ccx: &@crate_ctxt, name: &str, llval: ValueRef) -> ValueRef { + let llglobal = + lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval), + str::buf(name)); lib::llvm::llvm::LLVMSetInitializer(llglobal, llval); lib::llvm::llvm::LLVMSetGlobalConstant(llglobal, True); - lib::llvm::llvm::LLVMSetLinkage(llglobal, lib::llvm::LLVMInternalLinkage - as lib::llvm::llvm::Linkage); + lib::llvm::llvm::LLVMSetLinkage(llglobal, + lib::llvm::LLVMInternalLinkage as + lib::llvm::llvm::Linkage); ret llglobal; } @@ -99,18 +103,18 @@ fn mk_global(ccx : &@crate_ctxt, name : &str, llval : ValueRef) -> ValueRef { // // TODO: Use this in dynamic_size_of() as well. -fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] { +fn largest_variants(ccx: &@crate_ctxt, tag_id: &ast::def_id) -> [uint] { // Compute the minimum and maximum size and alignment for each variant. // // TODO: We could do better here; e.g. we know that any variant that // contains (T,T) must be as least as large as any variant that contains // just T. - let ranges = ~[]; + let ranges = []; let variants = ty::tag_variants(ccx.tcx, tag_id); - for variant : ty::variant_info in variants { + for variant: ty::variant_info in variants { let bounded = true; - let { a: min_size, b: min_align } = { a: 0u, b: 0u }; - for elem_t : ty::t in variant.args { + let {a: min_size, b: min_align} = {a: 0u, b: 0u}; + for elem_t: ty::t in variant.args { if ty::type_contains_params(ccx.tcx, elem_t) { // TODO: We could do better here; this causes us to // conservatively assume that (int, T) has minimum size 0, @@ -123,34 +127,34 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] { } } - ranges += ~[{ size: { min: min_size, bounded: bounded }, - align: { min: min_align, bounded: bounded } }]; + ranges += + [{size: {min: min_size, bounded: bounded}, + align: {min: min_align, bounded: bounded}}]; } // Initialize the candidate set to contain all variants. - let candidates = ~[mutable]; - for variant in variants { candidates += ~[mutable true]; } + let candidates = [mutable]; + for variant in variants { candidates += [mutable true]; } // Do a pairwise comparison among all variants still in the candidate set. // Throw out any variant that we know has size and alignment at least as // small as some other variant. let i = 0u; while i < vec::len(ranges) - 1u { - if candidates.(i) { + if candidates[i] { let j = i + 1u; - while (j < vec::len(ranges)) { - if candidates.(j) { - if ranges.(i).size.bounded && ranges.(i).align.bounded && - ranges.(j).size.bounded && - ranges.(j).align.bounded { - if ranges.(i).size >= ranges.(j).size && - ranges.(i).align >= ranges.(j).align { + while j < vec::len(ranges) { + if candidates[j] { + if ranges[i].size.bounded && ranges[i].align.bounded && + ranges[j].size.bounded && ranges[j].align.bounded { + if ranges[i].size >= ranges[j].size && + ranges[i].align >= ranges[j].align { // Throw out j. - candidates.(j) = false; - } else if ranges.(j).size >= ranges.(i).size && - ranges.(j).align >= ranges.(j).align { + candidates[j] = false; + } else if ranges[j].size >= ranges[i].size && + ranges[j].align >= ranges[j].align { // Throw out i. - candidates.(i) = false; + candidates[i] = false; } } } @@ -161,10 +165,10 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] { } // Return the resulting set. - let result = ~[]; + let result = []; i = 0u; while i < vec::len(candidates) { - if candidates.(i) { result += ~[i]; } + if candidates[i] { result += [i]; } i += 1u; } ret result; @@ -175,23 +179,24 @@ fn largest_variants(ccx : &@crate_ctxt, tag_id : &ast::def_id) -> [uint] { // // TODO: Migrate trans over to use this. -fn round_up(size : u16, align : u8) -> u16 { - assert align >= 1u8; +fn round_up(size: u16, align: u8) -> u16 { + assert (align >= 1u8); let alignment = align as u16; - ret ((size-1u16) + alignment) & !(alignment-1u16); + ret size - 1u16 + alignment & !(alignment - 1u16); } -type size_align = { size: u16, align: u8 }; +type size_align = {size: u16, align: u8}; -fn compute_static_tag_size(ccx : &@crate_ctxt, largest_variants : &[uint], - did : &ast::def_id) -> size_align { - let max_size = 0u16; let max_align = 1u8; +fn compute_static_tag_size(ccx: &@crate_ctxt, largest_variants: &[uint], + did: &ast::def_id) -> size_align { + let max_size = 0u16; + let max_align = 1u8; let variants = ty::tag_variants(ccx.tcx, did); - for vid : uint in largest_variants { + for vid: uint in largest_variants { // We increment a "virtual data pointer" to compute the size. - let lltys = ~[]; - for typ : ty::t in variants.(vid).args { - lltys += ~[trans::type_of(ccx, dummy_sp(), typ)]; + let lltys = []; + for typ: ty::t in variants[vid].args { + lltys += [trans::type_of(ccx, dummy_sp(), typ)]; } let llty = trans_common::T_struct(lltys); @@ -205,24 +210,17 @@ fn compute_static_tag_size(ccx : &@crate_ctxt, largest_variants : &[uint], // Add space for the tag if applicable. // FIXME (issue #792): This is wrong. If the tag starts with an 8 byte // aligned quantity, we don't align it. - if vec::len(variants) > 1u { - max_size += 4u16; - max_align = 4u8; - } + if vec::len(variants) > 1u { max_size += 4u16; max_align = 4u8; } - ret { size: max_size, align: max_align }; + ret {size: max_size, align: max_align}; } -tag tag_kind { - tk_unit; - tk_enum; - tk_complex; -} +tag tag_kind { tk_unit; tk_enum; tk_complex; } -fn tag_kind(ccx : &@crate_ctxt, did : &ast::def_id) -> tag_kind { +fn tag_kind(ccx: &@crate_ctxt, did: &ast::def_id) -> tag_kind { let variants = ty::tag_variants(ccx.tcx, did); if vec::len(variants) == 0u { ret tk_complex; } - for v : ty::variant_info in variants { + for v: ty::variant_info in variants { if vec::len(v.args) > 0u { ret tk_complex; } } if vec::len(variants) == 1u { ret tk_unit; } @@ -231,92 +229,101 @@ fn tag_kind(ccx : &@crate_ctxt, did : &ast::def_id) -> tag_kind { // Returns the code corresponding to the pointer size on this architecture. -fn s_int(_tcx : &ty_ctxt) -> u8 { - ret shape_i32; // TODO: x86-64 +fn s_int(_tcx: &ty_ctxt) -> u8 { + ret shape_i32; // TODO: x86-64 } -fn s_uint(_tcx : &ty_ctxt) -> u8 { - ret shape_u32; // TODO: x86-64 +fn s_uint(_tcx: &ty_ctxt) -> u8 { + ret shape_u32; // TODO: x86-64 } -fn s_float(_tcx : &ty_ctxt) -> u8 { - ret shape_f64; // TODO: x86-64 +fn s_float(_tcx: &ty_ctxt) -> u8 { + ret shape_f64; // TODO: x86-64 } -fn mk_ctxt(llmod : ModuleRef) -> ctxt { +fn mk_ctxt(llmod: ModuleRef) -> ctxt { let llshapetablesty = trans_common::T_named_struct("shapes"); let llshapetables = lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty, str::buf("shapes")); - ret { - mutable next_tag_id: 0u16, - pad: 0u16, - tag_id_to_index: common::new_def_hash(), - mutable tag_order: ~[], - resources: interner::mk(hash_res_info, eq_res_info), - llshapetablesty: llshapetablesty, - llshapetables: llshapetables - }; + ret {mutable next_tag_id: 0u16, + pad: 0u16, + tag_id_to_index: common::new_def_hash(), + mutable tag_order: [], + resources: interner::mk(hash_res_info, eq_res_info), + llshapetablesty: llshapetablesty, + llshapetables: llshapetables}; } -fn add_bool(dest : &mutable [u8], val : bool) { - dest += ~[if val { 1u8 } else { 0u8 }]; +fn add_bool(dest: &mutable [u8], val: bool) { + dest += [if val { 1u8 } else { 0u8 }]; } -fn add_u16(dest : &mutable [u8], val : u16) { - dest += ~[(val & 0xffu16) as u8, (val >> 8u16) as u8]; +fn add_u16(dest: &mutable [u8], val: u16) { + dest += [val & 0xffu16 as u8, val >> 8u16 as u8]; } -fn add_substr(dest : &mutable [u8], src : &[u8]) { +fn add_substr(dest: &mutable [u8], src: &[u8]) { add_u16(dest, vec::len(src) as u16); dest += src; } -fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] { - let s = ~[]; +fn shape_of(ccx: &@crate_ctxt, t: ty::t) -> [u8] { + let s = []; alt ty::struct(ccx.tcx, t) { ty::ty_nil. | ty::ty_bool. | ty::ty_machine(ast::ty_u8.) | ty::ty_bot. { - s += ~[shape_u8]; + s += [shape_u8]; + } + + + ty::ty_int. { + s += [s_int(ccx.tcx)]; } + ty::ty_float. { s += [s_float(ccx.tcx)]; } - ty::ty_int. { s += ~[s_int(ccx.tcx)]; } - ty::ty_float. { s += ~[s_float(ccx.tcx)]; } ty::ty_uint. | ty::ty_ptr(_) | ty::ty_type. | ty::ty_native(_) { - s += ~[s_uint(ccx.tcx)]; + s += [s_uint(ccx.tcx)]; } - ty::ty_machine(ast::ty_i8.) { s += ~[shape_i8]; } - ty::ty_machine(ast::ty_u16.) { s += ~[shape_u16]; } - ty::ty_machine(ast::ty_i16.) { s += ~[shape_i16]; } - ty::ty_machine(ast::ty_u32.) | ty::ty_char. { s += ~[shape_u32]; } - ty::ty_machine(ast::ty_i32.) { s += ~[shape_i32]; } - ty::ty_machine(ast::ty_u64.) { s += ~[shape_u64]; } - ty::ty_machine(ast::ty_i64.) { s += ~[shape_i64]; } - ty::ty_str. { s += ~[shape_evec, 1u8, 1u8, 0u8, shape_u8]; } - ty::ty_istr. { s += ~[shape_ivec, 1u8, 1u8, 0u8, shape_u8]; } + ty::ty_machine(ast::ty_i8.) { + s += [shape_i8]; + } + ty::ty_machine(ast::ty_u16.) { s += [shape_u16]; } + ty::ty_machine(ast::ty_i16.) { s += [shape_i16]; } + ty::ty_machine(ast::ty_u32.) | ty::ty_char. { s += [shape_u32]; } + ty::ty_machine(ast::ty_i32.) { s += [shape_i32]; } + ty::ty_machine(ast::ty_u64.) { s += [shape_u64]; } + ty::ty_machine(ast::ty_i64.) { s += [shape_i64]; } + + + ty::ty_str. { + s += [shape_evec, 1u8, 1u8, 0u8, shape_u8]; + } + ty::ty_istr. { s += [shape_ivec, 1u8, 1u8, 0u8, shape_u8]; } + ty::ty_tag(did, tps) { alt tag_kind(ccx, did) { tk_unit. { // FIXME: For now we do this. - s += ~[shape_u32]; + s += [shape_u32]; } - tk_enum. { s += ~[shape_u32]; } + tk_enum. { s += [shape_u32]; } tk_complex. { - s += ~[shape_tag]; + s += [shape_tag]; - let sub = ~[]; + let sub = []; let id; alt ccx.shape_cx.tag_id_to_index.find(did) { none. { id = ccx.shape_cx.next_tag_id; ccx.shape_cx.tag_id_to_index.insert(did, id); - ccx.shape_cx.tag_order += ~[did]; + ccx.shape_cx.tag_order += [did]; ccx.shape_cx.next_tag_id += 1u16; } some(existing_id) { id = existing_id; } @@ -324,7 +331,7 @@ fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] { add_u16(sub, id as u16); add_u16(sub, vec::len(tps) as u16); - for tp : ty::t in tps { + for tp: ty::t in tps { let subshape = shape_of(ccx, tp); add_u16(sub, vec::len(subshape) as u16); sub += subshape; @@ -335,91 +342,97 @@ fn shape_of(ccx : &@crate_ctxt, t : ty::t) -> [u8] { } } + ty::ty_box(mt) { - s += ~[shape_box]; + s += [shape_box]; add_substr(s, shape_of(ccx, mt.ty)); } ty::ty_uniq(subt) { - s += ~[shape_uniq]; + s += [shape_uniq]; add_substr(s, shape_of(ccx, subt)); } ty::ty_vec(mt) { - s += ~[shape_ivec]; + s += [shape_ivec]; add_bool(s, ty::type_is_pod(ccx.tcx, mt.ty)); add_size_hint(ccx, s, mt.ty); add_substr(s, shape_of(ccx, mt.ty)); } ty::ty_rec(fields) { - s += ~[shape_struct]; - let sub = ~[]; - for f : field in fields { sub += shape_of(ccx, f.mt.ty); } + s += [shape_struct]; + let sub = []; + for f: field in fields { sub += shape_of(ccx, f.mt.ty); } add_substr(s, sub); } ty::ty_tup(elts) { - s += ~[shape_struct]; - let sub = ~[]; + s += [shape_struct]; + let sub = []; for elt in elts { sub += shape_of(ccx, elt); } add_substr(s, sub); } - ty::ty_fn(_,_,_,_,_) { s += ~[shape_fn]; } - ty::ty_native_fn(_,_,_) { s += ~[shape_u32]; } - ty::ty_obj(_) { s += ~[shape_obj]; } + + ty::ty_fn(_, _, _, _, _) { + s += [shape_fn]; + } + ty::ty_native_fn(_, _, _) { s += [shape_u32]; } + ty::ty_obj(_) { s += [shape_obj]; } + ty::ty_res(did, raw_subt, tps) { let subt = ty::substitute_type_params(ccx.tcx, tps, raw_subt); - let ri = { did: did, t: subt }; + let ri = {did: did, t: subt}; let id = interner::intern(ccx.shape_cx.resources, ri); - s += ~[shape_res]; + s += [shape_res]; add_u16(s, id as u16); add_u16(s, vec::len(tps) as u16); - let sub = ~[]; - for tp : ty::t in tps { add_substr(s, sub); } + let sub = []; + for tp: ty::t in tps { add_substr(s, sub); } add_substr(s, sub); add_substr(s, shape_of(ccx, subt)); } - ty::ty_var(n) { fail "shape_of ty_var"; } - ty::ty_param(n,_) { s += ~[shape_var, n as u8]; } + + ty::ty_var(n) { + fail "shape_of ty_var"; + } + ty::ty_param(n, _) { s += [shape_var, n as u8]; } } ret s; } -fn add_size_hint(ccx : &@crate_ctxt, s : &mutable [u8], typ : ty::t) { - if (ty::type_has_dynamic_size(ccx.tcx, typ)) { - s += ~[ 0u8, 0u8, 0u8 ]; - ret; - } +fn add_size_hint(ccx: &@crate_ctxt, s: &mutable [u8], typ: ty::t) { + if ty::type_has_dynamic_size(ccx.tcx, typ) { s += [0u8, 0u8, 0u8]; ret; } let llty = trans::type_of(ccx, dummy_sp(), typ); add_u16(s, trans::llsize_of_real(ccx, llty) as u16); - s += ~[ trans::llalign_of_real(ccx, llty) as u8 ]; + s += [trans::llalign_of_real(ccx, llty) as u8]; } // FIXME: We might discover other variants as we traverse these. Handle this. -fn shape_of_variant(ccx : &@crate_ctxt, v : &ty::variant_info) -> [u8] { - let s = ~[]; - for t : ty::t in v.args { s += shape_of(ccx, t); } +fn shape_of_variant(ccx: &@crate_ctxt, v: &ty::variant_info) -> [u8] { + let s = []; + for t: ty::t in v.args { s += shape_of(ccx, t); } ret s; } -fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef { +fn gen_tag_shapes(ccx: &@crate_ctxt) -> ValueRef { // Loop over all the tag variants and write their shapes into a data // buffer. As we do this, it's possible for us to discover new tags, so we // must do this first. let i = 0u; - let data = ~[]; let offsets = ~[]; - while (i < vec::len(ccx.shape_cx.tag_order)) { - let did = ccx.shape_cx.tag_order.(i); + let data = []; + let offsets = []; + while i < vec::len(ccx.shape_cx.tag_order) { + let did = ccx.shape_cx.tag_order[i]; let variants = ty::tag_variants(ccx.tcx, did); - for v : ty::variant_info in variants { - offsets += ~[vec::len(data) as u16]; + for v: ty::variant_info in variants { + offsets += [vec::len(data) as u16]; let variant_shape = shape_of_variant(ccx, v); add_substr(data, variant_shape); @@ -432,13 +445,14 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef { // info records for each tag) and the info space (which contains offsets // to each variant shape). As we do so, build up the header. - let header = ~[]; let info = ~[]; + let header = []; + let info = []; let header_sz = 2u16 * ccx.shape_cx.next_tag_id; let data_sz = vec::len(data) as u16; let info_sz = 0u16; - for did_ : ast::def_id in ccx.shape_cx.tag_order { - let did = did_; // Satisfy alias checker. + for did_: ast::def_id in ccx.shape_cx.tag_order { + let did = did_; // Satisfy alias checker. let variants = ty::tag_variants(ccx.tcx, did); add_u16(header, header_sz + info_sz); info_sz += 2u16 * ((vec::len(variants) as u16) + 2u16) + 3u16; @@ -448,25 +462,25 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef { // variant. Also construct the largest-variant table for each tag, which // contains the variants that the size-of operation needs to look at. - let lv_table = ~[]; + let lv_table = []; i = 0u; - for did_ : ast::def_id in ccx.shape_cx.tag_order { - let did = did_; // Satisfy alias checker. + for did_: ast::def_id in ccx.shape_cx.tag_order { + let did = did_; // Satisfy alias checker. let variants = ty::tag_variants(ccx.tcx, did); add_u16(info, vec::len(variants) as u16); // Construct the largest-variants table. - add_u16(info, header_sz + info_sz + data_sz + - (vec::len(lv_table) as u16)); + add_u16(info, + header_sz + info_sz + data_sz + (vec::len(lv_table) as u16)); let lv = largest_variants(ccx, did); add_u16(lv_table, vec::len(lv) as u16); - for v : uint in lv { add_u16(lv_table, v as u16); } + for v: uint in lv { add_u16(lv_table, v as u16); } // Determine whether the tag has dynamic size. let dynamic = false; - for variant : ty::variant_info in variants { - for typ : ty::t in variant.args { + for variant: ty::variant_info in variants { + for typ: ty::t in variant.args { if ty::type_has_dynamic_size(ccx.tcx, typ) { dynamic = true; } } } @@ -475,24 +489,22 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef { // Otherwise, write a placeholder. let size_align; if dynamic { - size_align = { size: 0u16, align: 0u8 }; - } else { - size_align = compute_static_tag_size(ccx, lv, did); - } + size_align = {size: 0u16, align: 0u8}; + } else { size_align = compute_static_tag_size(ccx, lv, did); } add_u16(info, size_align.size); - info += ~[size_align.align]; + info += [size_align.align]; // Now write in the offset of each variant. - for v : ty::variant_info in variants { - add_u16(info, header_sz + info_sz + offsets.(i)); + for v: ty::variant_info in variants { + add_u16(info, header_sz + info_sz + offsets[i]); i += 1u; } } assert (i == vec::len(offsets)); - assert (header_sz == (vec::len(header) as u16)); - assert (info_sz == (vec::len(info) as u16)); - assert (data_sz == (vec::len(data) as u16)); + assert (header_sz == vec::len(header) as u16); + assert (info_sz == vec::len(info) as u16); + assert (data_sz == vec::len(data) as u16); header += info; header += data; @@ -501,32 +513,33 @@ fn gen_tag_shapes(ccx : &@crate_ctxt) -> ValueRef { ret mk_global(ccx, "tag_shapes", C_bytes(header)); } -fn gen_resource_shapes(ccx : &@crate_ctxt) -> ValueRef { - let dtors = ~[]; +fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef { + let dtors = []; let i = 0u; let len = interner::len(ccx.shape_cx.resources); while i < len { let ri = interner::get(ccx.shape_cx.resources, i); - dtors += ~[trans_common::get_res_dtor(ccx, dummy_sp(), ri.did, ri.t)]; + dtors += [trans_common::get_res_dtor(ccx, dummy_sp(), ri.did, ri.t)]; i += 1u; } ret mk_global(ccx, "resource_shapes", C_struct(dtors)); } -fn gen_shape_tables(ccx : &@crate_ctxt) { +fn gen_shape_tables(ccx: &@crate_ctxt) { let lltagstable = gen_tag_shapes(ccx); let llresourcestable = gen_resource_shapes(ccx); trans_common::set_struct_body(ccx.shape_cx.llshapetablesty, - ~[val_ty(lltagstable), - val_ty(llresourcestable)]); + [val_ty(lltagstable), + val_ty(llresourcestable)]); - let lltables = C_named_struct(ccx.shape_cx.llshapetablesty, - ~[lltagstable, llresourcestable]); + let lltables = + C_named_struct(ccx.shape_cx.llshapetablesty, + [lltagstable, llresourcestable]); lib::llvm::llvm::LLVMSetInitializer(ccx.shape_cx.llshapetables, lltables); lib::llvm::llvm::LLVMSetGlobalConstant(ccx.shape_cx.llshapetables, True); lib::llvm::llvm::LLVMSetLinkage(ccx.shape_cx.llshapetables, lib::llvm::LLVMInternalLinkage as - lib::llvm::llvm::Linkage); + lib::llvm::llvm::Linkage); } diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs index f587b842986..4c51c34d26a 100644 --- a/src/comp/middle/trans.rs +++ b/src/comp/middle/trans.rs @@ -89,15 +89,16 @@ fn type_of(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef { fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) -> [TypeRef] { - let atys: [TypeRef] = ~[]; + let atys: [TypeRef] = []; for arg: ty::arg in inputs { let t: TypeRef = type_of_inner(cx, sp, arg.ty); - t = alt arg.mode { - ty::mo_alias(_) { T_ptr(t) } - ty::mo_move. { T_ptr(t) } - _ { t } - }; - atys += ~[t]; + t = + alt arg.mode { + ty::mo_alias(_) { T_ptr(t) } + ty::mo_move. { T_ptr(t) } + _ { t } + }; + atys += [t]; } ret atys; } @@ -112,35 +113,30 @@ fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) -> fn type_of_fn_full(cx: &@crate_ctxt, sp: &span, proto: ast::proto, is_method: bool, inputs: &[ty::arg], output: &ty::t, ty_param_count: uint) -> TypeRef { - let atys: [TypeRef] = ~[]; + let atys: [TypeRef] = []; // Arg 0: Output pointer. - atys += ~[T_ptr(type_of_inner(cx, sp, output))]; + atys += [T_ptr(type_of_inner(cx, sp, output))]; // Arg 1: task pointer. - atys += ~[T_taskptr(*cx)]; + atys += [T_taskptr(*cx)]; // Arg 2: Env (closure-bindings / self-obj) if is_method { - atys += ~[T_ptr(cx.rust_object_type)]; - } else { atys += ~[T_opaque_closure_ptr(*cx)]; } + atys += [T_ptr(cx.rust_object_type)]; + } else { atys += [T_opaque_closure_ptr(*cx)]; } // Args >3: ty params, if not acquired via capture... if !is_method { let i = 0u; - while i < ty_param_count { - atys += ~[T_ptr(cx.tydesc_type)]; - i += 1u; - } + while i < ty_param_count { atys += [T_ptr(cx.tydesc_type)]; i += 1u; } } if proto == ast::proto_iter { // If it's an iter, the 'output' type of the iter is actually the // *input* type of the function we're given as our iter-block // argument. - atys += - ~[type_of_inner(cx, sp, ty::mk_iter_body_fn(cx.tcx, output))]; + atys += [type_of_inner(cx, sp, ty::mk_iter_body_fn(cx.tcx, output))]; } - // ... then explicit args. atys += type_of_explicit_args(cx, sp, inputs); ret T_fn(atys, llvm::LLVMVoidType()); @@ -153,26 +149,21 @@ fn type_of_fn(cx: &@crate_ctxt, sp: &span, proto: ast::proto, } // Given a function type and a count of ty params, construct an llvm type -fn type_of_fn_from_ty(cx: &@crate_ctxt, sp: &span, - fty: &ty::t, ty_param_count: uint) -> TypeRef { - ret type_of_fn(cx, sp, - ty::ty_fn_proto(cx.tcx, fty), - ty::ty_fn_args(cx.tcx, fty), - ty::ty_fn_ret(cx.tcx, fty), +fn type_of_fn_from_ty(cx: &@crate_ctxt, sp: &span, fty: &ty::t, + ty_param_count: uint) -> TypeRef { + ret type_of_fn(cx, sp, ty::ty_fn_proto(cx.tcx, fty), + ty::ty_fn_args(cx.tcx, fty), ty::ty_fn_ret(cx.tcx, fty), ty_param_count); } fn type_of_native_fn(cx: &@crate_ctxt, sp: &span, abi: ast::native_abi, inputs: &[ty::arg], output: &ty::t, ty_param_count: uint) -> TypeRef { - let atys: [TypeRef] = ~[]; + let atys: [TypeRef] = []; if abi == ast::native_abi_rust { - atys += ~[T_taskptr(*cx)]; + atys += [T_taskptr(*cx)]; let i = 0u; - while i < ty_param_count { - atys += ~[T_ptr(cx.tydesc_type)]; - i += 1u; - } + while i < ty_param_count { atys += [T_ptr(cx.tydesc_type)]; i += 1u; } } atys += type_of_explicit_args(cx, sp, inputs); ret T_fn(atys, type_of_inner(cx, sp, output)); @@ -221,9 +212,9 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef { } ty::ty_ptr(mt) { llty = T_ptr(type_of_inner(cx, sp, mt.ty)); } ty::ty_rec(fields) { - let tys: [TypeRef] = ~[]; + let tys: [TypeRef] = []; for f: ty::field in fields { - tys += ~[type_of_inner(cx, sp, f.mt.ty)]; + tys += [type_of_inner(cx, sp, f.mt.ty)]; } llty = T_struct(tys); } @@ -237,7 +228,7 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef { ty::ty_obj(meths) { llty = cx.rust_object_type; } ty::ty_res(_, sub, tps) { let sub1 = ty::substitute_type_params(cx.tcx, tps, sub); - ret T_struct(~[T_i32(), type_of_inner(cx, sp, sub1)]); + ret T_struct([T_i32(), type_of_inner(cx, sp, sub1)]); } ty::ty_var(_) { cx.tcx.sess.span_fatal(sp, "trans::type_of called on ty_var"); @@ -245,10 +236,8 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> TypeRef { ty::ty_param(_, _) { llty = T_typaram(cx.tn); } ty::ty_type. { llty = T_ptr(cx.tydesc_type); } ty::ty_tup(elts) { - let tys = ~[]; - for elt in elts { - tys += ~[type_of_inner(cx, sp, elt)]; - } + let tys = []; + for elt in elts { tys += [type_of_inner(cx, sp, elt)]; } llty = T_struct(tys); } } @@ -275,8 +264,8 @@ fn type_of_ty_param_kinds_and_ty(lcx: @local_ctxt, sp: &span, tpt: &ty::ty_param_kinds_and_ty) -> TypeRef { alt ty::struct(lcx.ccx.tcx, tpt.ty) { ty::ty_fn(_, _, _, _, _) { - let llfnty = type_of_fn_from_ty(lcx.ccx, sp, tpt.ty, - std::vec::len(tpt.kinds)); + let llfnty = + type_of_fn_from_ty(lcx.ccx, sp, tpt.ty, std::vec::len(tpt.kinds)); ret T_fn_pair(*lcx.ccx, llfnty); } _ { @@ -309,7 +298,7 @@ fn sanitize(s: &str) -> str { if c != 10u8 && c != '}' as u8 && c != ')' as u8 && c != ' ' as u8 && c != '\t' as u8 && c != ';' as u8 { - let v = ~[c]; + let v = [c]; result += str::unsafe_from_bytes(v); } } @@ -325,7 +314,7 @@ fn log_fn_time(ccx: &@crate_ctxt, name: str, start: &time::timeval, let elapsed = 1000 * (end.sec - start.sec as int) + ((end.usec as int) - (start.usec as int)) / 1000; - *ccx.stats.fn_times += ~[{ident: name, time: elapsed}]; + *ccx.stats.fn_times += [{ident: name, time: elapsed}]; } @@ -359,7 +348,7 @@ fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> } fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &str) -> ValueRef { - ret decl_cdecl_fn(llmod, s, T_fn(~[T_taskptr(cx)], T_void())); + ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(cx)], T_void())); } fn get_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef, @@ -387,26 +376,25 @@ fn get_simple_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef, } fn trans_native_call(b: &builder, externs: &hashmap<str, ValueRef>, - llmod: ModuleRef, name: &str, - args: &[ValueRef]) -> ValueRef { + llmod: ModuleRef, name: &str, args: &[ValueRef]) -> + ValueRef { let n: int = std::vec::len::<ValueRef>(args) as int; let llnative: ValueRef = get_simple_extern_fn(externs, llmod, name, n); - let call_args: [ValueRef] = ~[]; - for a: ValueRef in args { call_args += ~[b.ZExtOrBitCast(a, T_int())]; } + let call_args: [ValueRef] = []; + for a: ValueRef in args { call_args += [b.ZExtOrBitCast(a, T_int())]; } ret b.Call(llnative, call_args); } fn trans_non_gc_free(cx: &@block_ctxt, v: ValueRef) -> result { cx.build.Call(bcx_ccx(cx).upcalls.free, - ~[cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8())), - C_int(0)]); + [cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8())), + C_int(0)]); ret rslt(cx, C_int(0)); } fn trans_shared_free(cx: &@block_ctxt, v: ValueRef) -> result { cx.build.Call(bcx_ccx(cx).upcalls.shared_free, - ~[cx.fcx.lltaskptr, - cx.build.PointerCast(v, T_ptr(T_i8()))]); + [cx.fcx.lltaskptr, cx.build.PointerCast(v, T_ptr(T_i8()))]); ret rslt(cx, C_int(0)); } @@ -470,24 +458,24 @@ fn array_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef) -> ValueRef { let builder = new_builder(cx.fcx.lldynamicallocas); let lltaskptr = bcx_fcx(bcx).lltaskptr; alt bcx_fcx(cx).llobstacktoken { - none. { - bcx_fcx(cx).llobstacktoken = - some(mk_obstack_token(bcx_ccx(cx), cx.fcx.lldynamicallocas, - lltaskptr)); - } - some(_) { /* no-op */ } + none. { + bcx_fcx(cx).llobstacktoken = + some(mk_obstack_token(bcx_ccx(cx), cx.fcx.lldynamicallocas, + lltaskptr)); + } + some(_) {/* no-op */ } } let dynastack_alloc = bcx_ccx(bcx).upcalls.dynastack_alloc; let llsz = builder.Mul(C_uint(llsize_of_real(bcx_ccx(bcx), t)), n); - let llresult = builder.Call(dynastack_alloc, ~[lltaskptr, llsz]); + let llresult = builder.Call(dynastack_alloc, [lltaskptr, llsz]); ret builder.PointerCast(llresult, T_ptr(t)); } fn mk_obstack_token(ccx: &@crate_ctxt, lldynamicallocas: BasicBlockRef, lltaskptr: ValueRef) -> ValueRef { let builder = new_builder(lldynamicallocas); - ret builder.Call(ccx.upcalls.dynastack_mark, ~[lltaskptr]); + ret builder.Call(ccx.upcalls.dynastack_mark, [lltaskptr]); } @@ -502,21 +490,18 @@ fn simplify_type(ccx: &@crate_ctxt, typ: &ty::t) -> ty::t { ty::ty_uniq(_) { ret ty::mk_uniq(ccx.tcx, ty::mk_nil(ccx.tcx)); } ty::ty_fn(_, _, _, _, _) { ret ty::mk_tup(ccx.tcx, - ~[ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)), - ty::mk_imm_box(ccx.tcx, - ty::mk_nil(ccx.tcx))]); + [ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)), + ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx))]); } ty::ty_obj(_) { ret ty::mk_tup(ccx.tcx, - ~[ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)), - ty::mk_imm_box(ccx.tcx, - ty::mk_nil(ccx.tcx))]); + [ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx)), + ty::mk_imm_box(ccx.tcx, ty::mk_nil(ccx.tcx))]); } ty::ty_res(_, sub, tps) { let sub1 = ty::substitute_type_params(ccx.tcx, tps, sub); ret ty::mk_tup(ccx.tcx, - ~[ty::mk_int(ccx.tcx), - simplify_type(ccx, sub1)]); + [ty::mk_int(ccx.tcx), simplify_type(ccx, sub1)]); } _ { ret typ; } } @@ -540,8 +525,7 @@ fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: &ty::t) -> uint { let max_size = 0u; let variants = ty::tag_variants(cx.tcx, tid); for variant: ty::variant_info in variants { - let tup_ty = - simplify_type(cx, ty::mk_tup(cx.tcx, variant.args)); + let tup_ty = simplify_type(cx, ty::mk_tup(cx.tcx, variant.args)); // Perform any type parameter substitutions. tup_ty = ty::substitute_type_params(cx.tcx, subtys, tup_ty); @@ -586,18 +570,18 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result { ret rslt(bcx, off); } alt ty::struct(bcx_tcx(cx), t) { - ty::ty_param(p,_) { + ty::ty_param(p, _) { let szptr = field_of_tydesc(cx, t, false, abi::tydesc_field_size); ret rslt(szptr.bcx, szptr.bcx.build.Load(szptr.val)); } ty::ty_rec(flds) { - let tys: [ty::t] = ~[]; - for f: ty::field in flds { tys += ~[f.mt.ty]; } + let tys: [ty::t] = []; + for f: ty::field in flds { tys += [f.mt.ty]; } ret align_elements(cx, tys); } ty::ty_tup(elts) { - let tys = ~[]; - for tp in elts { tys += ~[tp]; } + let tys = []; + for tp in elts { tys += [tp]; } ret align_elements(cx, tys); } ty::ty_tag(tid, tps) { @@ -611,10 +595,10 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result { // Perform type substitution on the raw argument types. let raw_tys: [ty::t] = variant.args; - let tys: [ty::t] = ~[]; + let tys: [ty::t] = []; for raw_ty: ty::t in raw_tys { let t = ty::substitute_type_params(bcx_tcx(cx), tps, raw_ty); - tys += ~[t]; + tys += [t]; } let rslt = align_elements(bcx, tys); bcx = rslt.bcx; @@ -644,7 +628,7 @@ fn dynamic_size_of(cx: &@block_ctxt, t: ty::t) -> result { fn dynamic_align_of(cx: &@block_ctxt, t: &ty::t) -> result { alt ty::struct(bcx_tcx(cx), t) { - ty::ty_param(p,_) { + ty::ty_param(p, _) { let aptr = field_of_tydesc(cx, t, false, abi::tydesc_field_align); ret rslt(aptr.bcx, aptr.bcx.build.Load(aptr.val)); } @@ -684,20 +668,18 @@ fn dynamic_align_of(cx: &@block_ctxt, t: &ty::t) -> result { // Simple wrapper around GEP that takes an array of ints and wraps them // in C_int() fn GEPi(cx: &@block_ctxt, base: ValueRef, ixs: &[int]) -> ValueRef { - let v: [ValueRef] = ~[]; - for i: int in ixs { v += ~[C_int(i)]; } + let v: [ValueRef] = []; + for i: int in ixs { v += [C_int(i)]; } ret cx.build.InBoundsGEP(base, v); } // Increment a pointer by a given amount and then cast it to be a pointer // to a given type. -fn bump_ptr(bcx: &@block_ctxt, t: &ty::t, base: ValueRef, sz: ValueRef) - -> ValueRef { +fn bump_ptr(bcx: &@block_ctxt, t: &ty::t, base: ValueRef, sz: ValueRef) -> + ValueRef { let raw = bcx.build.PointerCast(base, T_ptr(T_i8())); - let bumped = bcx.build.GEP(raw, ~[sz]); - if ty::type_has_dynamic_size(bcx_tcx(bcx), t) { - ret bumped; - } + let bumped = bcx.build.GEP(raw, [sz]); + if ty::type_has_dynamic_size(bcx_tcx(bcx), t) { ret bumped; } let typ = T_ptr(type_of(bcx_ccx(bcx), bcx.sp, t)); ret bcx.build.PointerCast(bumped, typ); } @@ -743,15 +725,15 @@ fn GEP_tup_like(cx: &@block_ctxt, t: &ty::t, base: ValueRef, ixs: &[int]) -> // *single* structure, the first index (in GEP-ese) should just be // 0, to yield the pointee. - assert (ixs.(n) == 0); + assert (ixs[n] == 0); ret split_type(ccx, t, ixs, n + 1u); } assert (n < len); - let ix: int = ixs.(n); - let prefix: [ty::t] = ~[]; + let ix: int = ixs[n]; + let prefix: [ty::t] = []; let i: int = 0; while i < ix { - prefix += ~[ty::get_element_type(ccx.tcx, t, i as uint)]; + prefix += [ty::get_element_type(ccx.tcx, t, i as uint)]; i += 1; } let selected = ty::get_element_type(ccx.tcx, t, i as uint); @@ -775,8 +757,8 @@ fn GEP_tup_like(cx: &@block_ctxt, t: &ty::t, base: ValueRef, ixs: &[int]) -> let s = split_type(bcx_ccx(cx), t, ixs, 0u); - let args = ~[]; - for typ: ty::t in s.prefix { args += ~[typ]; } + let args = []; + for typ: ty::t in s.prefix { args += [typ]; } let prefix_ty = ty::mk_tup(bcx_tcx(cx), args); let bcx = cx; @@ -799,10 +781,10 @@ fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id, let elem_ty = ty::mk_nil(bcx_tcx(cx)); // typestate infelicity let i = 0; - let true_arg_tys: [ty::t] = ~[]; + let true_arg_tys: [ty::t] = []; for aty: ty::t in arg_tys { let arg_ty = ty::substitute_type_params(bcx_tcx(cx), ty_substs, aty); - true_arg_tys += ~[arg_ty]; + true_arg_tys += [arg_ty]; if i == ix { elem_ty = arg_ty; } i += 1; } @@ -817,7 +799,7 @@ fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id, } else { llunionptr = llblobptr; } // Do the GEP_tup_like(). - let rs = GEP_tup_like(cx, tup_ty, llunionptr, ~[0, ix]); + let rs = GEP_tup_like(cx, tup_ty, llunionptr, [0, ix]); // Cast the result to the appropriate type, if necessary. let val; @@ -837,7 +819,7 @@ fn trans_raw_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) -> let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type)); let rval = cx.build.Call(bcx_ccx(cx).upcalls.malloc, - ~[cx.fcx.lltaskptr, llsize, tydesc]); + [cx.fcx.lltaskptr, llsize, tydesc]); ret rslt(cx, cx.build.PointerCast(rval, llptr_ty)); } @@ -850,7 +832,7 @@ fn trans_shared_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type)); let rval = cx.build.Call(bcx_ccx(cx).upcalls.shared_malloc, - ~[cx.fcx.lltaskptr, llsize, tydesc]); + [cx.fcx.lltaskptr, llsize, tydesc]); ret rslt(cx, cx.build.PointerCast(rval, llptr_ty)); } @@ -868,8 +850,7 @@ fn trans_malloc_boxed_raw(cx: &@block_ctxt, t: ty::t) -> result { // The mk_int here is the space being // reserved for the refcount. - let boxed_body = - ty::mk_tup(bcx_tcx(cx), ~[ty::mk_int(bcx_tcx(cx)), t]); + let boxed_body = ty::mk_tup(bcx_tcx(cx), [ty::mk_int(bcx_tcx(cx)), t]); let box_ptr = ty::mk_imm_box(bcx_tcx(cx), t); let sz = size_of(cx, boxed_body); @@ -882,12 +863,12 @@ fn trans_malloc_boxed_raw(cx: &@block_ctxt, t: ty::t) -> result { // trans_malloc_boxed: usefully wraps trans_malloc_box_raw; allocates a box, // initializes the reference count to 1, and pulls out the body and rc fn trans_malloc_boxed(cx: &@block_ctxt, t: ty::t) -> - {bcx: @block_ctxt, box: ValueRef, body: ValueRef} { + {bcx: @block_ctxt, box: ValueRef, body: ValueRef} { let res = trans_malloc_boxed_raw(cx, t); let box = res.val; - let rc = GEPi(res.bcx, box, ~[0, abi::box_rc_field_refcnt]); + let rc = GEPi(res.bcx, box, [0, abi::box_rc_field_refcnt]); res.bcx.build.Store(C_int(1), rc); - let body = GEPi(res.bcx, box, ~[0, abi::box_rc_field_body]); + let body = GEPi(res.bcx, box, [0, abi::box_rc_field_body]); ret {bcx: res.bcx, box: res.val, body: body}; } @@ -901,7 +882,7 @@ fn field_of_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, field: int) -> let ti = none::<@tydesc_info>; let tydesc = get_tydesc(cx, t, escapes, ti).result; ret rslt(tydesc.bcx, - tydesc.bcx.build.GEP(tydesc.val, ~[C_int(0), C_int(field)])); + tydesc.bcx.build.GEP(tydesc.val, [C_int(0), C_int(field)])); } @@ -911,20 +892,17 @@ fn field_of_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, field: int) -> // constructing derived tydescs. fn linearize_ty_params(cx: &@block_ctxt, t: &ty::t) -> {params: [uint], descs: [ValueRef]} { - let param_vals: [ValueRef] = ~[]; - let param_defs: [uint] = ~[]; + let param_vals: [ValueRef] = []; + let param_defs: [uint] = []; type rr = {cx: @block_ctxt, mutable vals: [ValueRef], mutable defs: [uint]}; fn linearizer(r: @rr, t: ty::t) { alt ty::struct(bcx_tcx(r.cx), t) { - ty::ty_param(pid,_) { + ty::ty_param(pid, _) { let seen: bool = false; for d: uint in r.defs { if d == pid { seen = true; } } - if !seen { - r.vals += ~[r.cx.fcx.lltydescs.(pid)]; - r.defs += ~[pid]; - } + if !seen { r.vals += [r.cx.fcx.lltydescs[pid]]; r.defs += [pid]; } } _ { } } @@ -937,8 +915,8 @@ fn linearize_ty_params(cx: &@block_ctxt, t: &ty::t) -> fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef, llalign: ValueRef, llroottydesc: ValueRef, - llparamtydescs: ValueRef, - n_params: uint) -> ValueRef { + llparamtydescs: ValueRef, n_params: uint) + -> ValueRef { let llmyroottydesc = alloca(cx, bcx_ccx(cx).tydesc_type); // By convention, desc 0 is the root descriptor. @@ -946,15 +924,15 @@ fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef, cx.build.Store(llroottydesc, llmyroottydesc); // Store a pointer to the rest of the descriptors. - let llfirstparam = cx.build.GEP(llparamtydescs, ~[C_int(0), C_int(0)]); + let llfirstparam = cx.build.GEP(llparamtydescs, [C_int(0), C_int(0)]); store_inbounds(cx, llfirstparam, llmyroottydesc, - ~[C_int(0), C_int(abi::tydesc_field_first_param)]); + [C_int(0), C_int(abi::tydesc_field_first_param)]); store_inbounds(cx, C_uint(n_params), llmyroottydesc, - ~[C_int(0), C_int(abi::tydesc_field_n_params)]); + [C_int(0), C_int(abi::tydesc_field_n_params)]); store_inbounds(cx, llsz, llmyroottydesc, - ~[C_int(0), C_int(abi::tydesc_field_size)]); + [C_int(0), C_int(abi::tydesc_field_size)]); store_inbounds(cx, llalign, llmyroottydesc, - ~[C_int(0), C_int(abi::tydesc_field_align)]); + [C_int(0), C_int(abi::tydesc_field_align)]); ret llmyroottydesc; } @@ -991,11 +969,11 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, alloca(bcx, T_array(T_ptr(bcx_ccx(bcx).tydesc_type), 1u + n_params)); let i = 0; - let tdp = bcx.build.GEP(tydescs, ~[C_int(0), C_int(i)]); + let tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]); bcx.build.Store(root, tdp); i += 1; for td: ValueRef in tys.descs { - let tdp = bcx.build.GEP(tydescs, ~[C_int(0), C_int(i)]); + let tdp = bcx.build.GEP(tydescs, [C_int(0), C_int(i)]); bcx.build.Store(td, tdp); i += 1; } @@ -1004,17 +982,17 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type))); let td_val = bcx.build.Call(bcx_ccx(bcx).upcalls.get_type_desc, - ~[bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), - sz.val, align.val, C_int(1u + n_params as int), - lltydescsptr]); + [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val, + align.val, C_int(1u + n_params as int), + lltydescsptr]); v = td_val; } else { let llparamtydescs = - alloca(bcx, T_array(T_ptr(bcx_ccx(bcx).tydesc_type), - n_params + 1u)); + alloca(bcx, + T_array(T_ptr(bcx_ccx(bcx).tydesc_type), n_params + 1u)); let i = 0; for td: ValueRef in tys.descs { - let tdp = bcx.build.GEP(llparamtydescs, ~[C_int(0), C_int(i)]); + let tdp = bcx.build.GEP(llparamtydescs, [C_int(0), C_int(i)]); bcx.build.Store(td, tdp); i += 1; } @@ -1026,11 +1004,11 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: &ty::t, escapes: bool, ret rslt(cx, v); } -type get_tydesc_result = { kind: tydesc_kind, result: result }; +type get_tydesc_result = {kind: tydesc_kind, result: result}; fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool, - static_ti: &mutable option::t<@tydesc_info>) - -> get_tydesc_result { + static_ti: &mutable option::t<@tydesc_info>) -> + get_tydesc_result { let t = ty::strip_cname(bcx_tcx(cx), orig_t); @@ -1038,12 +1016,14 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool, alt ty::type_param(bcx_tcx(cx), t) { some(id) { if id < vec::len(cx.fcx.lltydescs) { - ret { kind: tk_param, result: rslt(cx, cx.fcx.lltydescs.(id)) }; - } - else { - bcx_tcx(cx).sess.span_bug(cx.sp, "Unbound typaram in get_tydesc: " - + "orig_t = " + ty_to_str(bcx_tcx(cx), orig_t) - + " ty_param = " + std::uint::str(id)); + ret {kind: tk_param, result: rslt(cx, cx.fcx.lltydescs[id])}; + } else { + bcx_tcx(cx).sess.span_bug(cx.sp, + "Unbound typaram in get_tydesc: " + + "orig_t = " + + ty_to_str(bcx_tcx(cx), orig_t) + + " ty_param = " + + std::uint::str(id)); } } none. {/* fall through */ } @@ -1051,16 +1031,14 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: &ty::t, escapes: bool, // Does it contain a type param? If so, generate a derived tydesc. if ty::type_contains_params(bcx_tcx(cx), t) { - ret { - kind: tk_derived, - result: get_derived_tydesc(cx, t, escapes, static_ti) - }; + ret {kind: tk_derived, + result: get_derived_tydesc(cx, t, escapes, static_ti)}; } // Otherwise, generate a tydesc if necessary, and return it. - let info = get_static_tydesc(cx, t, ~[]); + let info = get_static_tydesc(cx, t, []); static_ti = some::<@tydesc_info>(info); - ret { kind: tk_static, result: rslt(cx, info.tydesc) }; + ret {kind: tk_static, result: rslt(cx, info.tydesc)}; } fn get_static_tydesc(cx: &@block_ctxt, orig_t: &ty::t, ty_params: &[uint]) -> @@ -1179,18 +1157,18 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: &ty::t, let ty_param_count = std::vec::len::<uint>(ty_params); let lltyparams = llvm::LLVMGetParam(llfn, 3u); let copy_args_bcx = new_raw_block_ctxt(fcx, fcx.llcopyargs); - let lltydescs = ~[mutable]; + let lltydescs = [mutable]; let p = 0u; while p < ty_param_count { - let llparam = copy_args_bcx.build.GEP(lltyparams, ~[C_int(p as int)]); + let llparam = copy_args_bcx.build.GEP(lltyparams, [C_int(p as int)]); llparam = copy_args_bcx.build.Load(llparam); - std::vec::grow_set(lltydescs, ty_params.(p), 0 as ValueRef, llparam); + std::vec::grow_set(lltydescs, ty_params[p], 0 as ValueRef, llparam); p += 1u; } // TODO: Implement some kind of freeze operation in the standard library. - let lltydescs_frozen = ~[]; - for lltydesc: ValueRef in lltydescs { lltydescs_frozen += ~[lltydesc]; } + let lltydescs_frozen = []; + for lltydesc: ValueRef in lltydescs { lltydescs_frozen += [lltydesc]; } fcx.lltydescs = lltydescs_frozen; let bcx = new_top_block_ctxt(fcx); @@ -1250,20 +1228,20 @@ fn emit_tydescs(ccx: &@crate_ctxt) { let tydesc = C_named_struct(ccx.tydesc_type, - ~[C_null(T_ptr(T_ptr(ccx.tydesc_type))), - ti.size, // size - ti.align, // align - copy_glue, // copy_glue - drop_glue, // drop_glue - free_glue, // free_glue - C_null(glue_fn_ty), // sever_glue - C_null(glue_fn_ty), // mark_glue - C_null(glue_fn_ty), // obj_drop_glue - C_null(glue_fn_ty), // is_stateful - cmp_glue, // cmp_glue - C_shape(ccx, shape), // shape - shape_tables, // shape_tables - C_int(0)]); // n_params + [C_null(T_ptr(T_ptr(ccx.tydesc_type))), + ti.size, // size + ti.align, // align + copy_glue, // copy_glue + drop_glue, // drop_glue + free_glue, // free_glue + C_null(glue_fn_ty), // sever_glue + C_null(glue_fn_ty), // mark_glue + C_null(glue_fn_ty), // obj_drop_glue + C_null(glue_fn_ty), // is_stateful + cmp_glue, // cmp_glue + C_shape(ccx, shape), // shape + shape_tables, // shape_tables + C_int(0)]); // n_params let gvar = ti.tydesc; llvm::LLVMSetInitializer(gvar, tydesc); @@ -1280,7 +1258,7 @@ fn make_copy_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t) { if ty::type_is_boxed(bcx_tcx(cx), t) { bcx = incr_refcnt_of_boxed(cx, cx.build.Load(v)).bcx; - } else if (ty::type_is_structural(bcx_tcx(cx), t)) { + } else if ty::type_is_structural(bcx_tcx(cx), t) { bcx = duplicate_heap_parts_if_necessary(cx, v, t).bcx; bcx = iter_structural_ty(bcx, v, t, bind copy_ty(_, _, _)).bcx; } else { bcx = cx; } @@ -1290,7 +1268,7 @@ fn make_copy_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t) { fn incr_refcnt_of_boxed(cx: &@block_ctxt, box_ptr: ValueRef) -> result { let rc_ptr = - cx.build.GEP(box_ptr, ~[C_int(0), C_int(abi::box_rc_field_refcnt)]); + cx.build.GEP(box_ptr, [C_int(0), C_int(abi::box_rc_field_refcnt)]); let rc = cx.build.Load(rc_ptr); let rc_adj_cx = new_sub_block_ctxt(cx, "rc++"); let next_cx = new_sub_block_ctxt(cx, "next"); @@ -1312,72 +1290,62 @@ fn make_free_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) { let v = cx.build.Load(v0); if !bcx_ccx(cx).sess.get_opts().do_gc { trans_non_gc_free(cx, v) - } else { - rslt(cx, C_nil()) - } + } else { rslt(cx, C_nil()) } } ty::ty_box(body_mt) { let v = cx.build.Load(v0); let body = - cx.build.GEP(v, ~[C_int(0), C_int(abi::box_rc_field_body)]); + cx.build.GEP(v, [C_int(0), C_int(abi::box_rc_field_body)]); let body_ty = body_mt.ty; let body_val = load_if_immediate(cx, body, body_ty); let rs = drop_ty(cx, body_val, body_ty); if !bcx_ccx(cx).sess.get_opts().do_gc { trans_non_gc_free(rs.bcx, v) - } else { - rslt(cx, C_nil()) - } - } - ty::ty_uniq(_) { - fail "free uniq unimplemented"; + } else { rslt(cx, C_nil()) } } + ty::ty_uniq(_) { fail "free uniq unimplemented"; } ty::ty_obj(_) { // Call through the obj's own fields-drop glue first. // Then free the body. let box_cell = - cx.build.GEP(v0, ~[C_int(0), C_int(abi::obj_field_box)]); + cx.build.GEP(v0, [C_int(0), C_int(abi::obj_field_box)]); let b = cx.build.Load(box_cell); let ccx = bcx_ccx(cx); let llbox_ty = T_opaque_obj_ptr(*ccx); b = cx.build.PointerCast(b, llbox_ty); let body = - cx.build.GEP(b, ~[C_int(0), C_int(abi::box_rc_field_body)]); + cx.build.GEP(b, [C_int(0), C_int(abi::box_rc_field_body)]); let tydescptr = cx.build.GEP(body, - ~[C_int(0), C_int(abi::obj_body_elt_tydesc)]); + [C_int(0), C_int(abi::obj_body_elt_tydesc)]); let tydesc = cx.build.Load(tydescptr); let ti = none::<@tydesc_info>; call_tydesc_glue_full(cx, body, tydesc, abi::tydesc_field_drop_glue, ti); - if (!bcx_ccx(cx).sess.get_opts().do_gc) { + if !bcx_ccx(cx).sess.get_opts().do_gc { trans_non_gc_free(cx, b) - } else { - rslt(cx, C_nil()) - } + } else { rslt(cx, C_nil()) } } ty::ty_fn(_, _, _, _, _) { // Call through the closure's own fields-drop glue first. // Then free the body. let box_cell = - cx.build.GEP(v0, ~[C_int(0), C_int(abi::fn_field_box)]); + cx.build.GEP(v0, [C_int(0), C_int(abi::fn_field_box)]); let v = cx.build.Load(box_cell); let body = - cx.build.GEP(v, ~[C_int(0), C_int(abi::box_rc_field_body)]); + cx.build.GEP(v, [C_int(0), C_int(abi::box_rc_field_body)]); let bindings = cx.build.GEP(body, - ~[C_int(0), C_int(abi::closure_elt_bindings)]); + [C_int(0), C_int(abi::closure_elt_bindings)]); let tydescptr = cx.build.GEP(body, - ~[C_int(0), C_int(abi::closure_elt_tydesc)]); + [C_int(0), C_int(abi::closure_elt_tydesc)]); let ti = none::<@tydesc_info>; call_tydesc_glue_full(cx, bindings, cx.build.Load(tydescptr), abi::tydesc_field_drop_glue, ti); - if (!bcx_ccx(cx).sess.get_opts().do_gc) { + if !bcx_ccx(cx).sess.get_opts().do_gc { trans_non_gc_free(cx, v) - } else { - rslt(cx, C_nil()) - } + } else { rslt(cx, C_nil()) } } _ { rslt(cx, C_nil()) } }; @@ -1390,8 +1358,8 @@ fn maybe_free_ivec_heap_part(cx: &@block_ctxt, v0: ValueRef, unit_ty: ty::t) let llunitty = type_of_or_i8(cx, unit_ty); let stack_len = cx.build.Load(cx.build.InBoundsGEP(v0, - ~[C_int(0), - C_uint(abi::ivec_elt_len)])); + [C_int(0), + C_uint(abi::ivec_elt_len)])); let maybe_on_heap_cx = new_sub_block_ctxt(cx, "maybe_on_heap"); let next_cx = new_sub_block_ctxt(cx, "next"); let maybe_on_heap = @@ -1404,7 +1372,7 @@ fn maybe_free_ivec_heap_part(cx: &@block_ctxt, v0: ValueRef, unit_ty: ty::t) maybe_on_heap_cx.build.PointerCast(v0, T_ptr(T_ivec_heap(llunitty))); let heap_ptr = { - let v = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; + let v = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; let m = maybe_on_heap_cx.build.InBoundsGEP(stub_ptr, v); maybe_on_heap_cx.build.Load(m) }; @@ -1431,7 +1399,7 @@ fn make_drop_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) { ty::ty_uniq(_) { trans_shared_free(cx, cx.build.Load(v0)) } ty::ty_obj(_) { let box_cell = - cx.build.GEP(v0, ~[C_int(0), C_int(abi::obj_field_box)]); + cx.build.GEP(v0, [C_int(0), C_int(abi::obj_field_box)]); decr_refcnt_maybe_free(cx, box_cell, v0, t) } ty::ty_res(did, inner, tps) { @@ -1439,7 +1407,7 @@ fn make_drop_glue(cx: &@block_ctxt, v0: ValueRef, t: &ty::t) { } ty::ty_fn(_, _, _, _, _) { let box_cell = - cx.build.GEP(v0, ~[C_int(0), C_int(abi::fn_field_box)]); + cx.build.GEP(v0, [C_int(0), C_int(abi::fn_field_box)]); decr_refcnt_maybe_free(cx, box_cell, v0, t) } _ { @@ -1457,42 +1425,42 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id, inner_t: ty::t, tps: &[ty::t]) -> result { let ccx = bcx_ccx(cx); let inner_t_s = ty::substitute_type_params(ccx.tcx, tps, inner_t); - let tup_ty = ty::mk_tup(ccx.tcx, ~[ty::mk_int(ccx.tcx), inner_t_s]); + let tup_ty = ty::mk_tup(ccx.tcx, [ty::mk_int(ccx.tcx), inner_t_s]); let drop_cx = new_sub_block_ctxt(cx, "drop res"); let next_cx = new_sub_block_ctxt(cx, "next"); - let drop_flag = GEP_tup_like(cx, tup_ty, rs, ~[0, 0]); + let drop_flag = GEP_tup_like(cx, tup_ty, rs, [0, 0]); cx = drop_flag.bcx; let null_test = cx.build.IsNull(cx.build.Load(drop_flag.val)); cx.build.CondBr(null_test, next_cx.llbb, drop_cx.llbb); cx = drop_cx; - let val = GEP_tup_like(cx, tup_ty, rs, ~[0, 1]); + let val = GEP_tup_like(cx, tup_ty, rs, [0, 1]); cx = val.bcx; // Find and call the actual destructor. let dtor_pair = trans_common::get_res_dtor(ccx, cx.sp, did, inner_t); let dtor_addr = cx.build.Load(cx.build.GEP(dtor_pair, - ~[C_int(0), C_int(abi::fn_field_code)])); + [C_int(0), C_int(abi::fn_field_code)])); let dtor_env = cx.build.Load(cx.build.GEP(dtor_pair, - ~[C_int(0), C_int(abi::fn_field_box)])); - let args = ~[cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env]; - for tp: ty::t in tps { + [C_int(0), C_int(abi::fn_field_box)])); + let args = [cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env]; + for tp: ty::t in tps { let ti: option::t<@tydesc_info> = none; let td = get_tydesc(cx, tp, false, ti).result; - args += ~[td.val]; + args += [td.val]; cx = td.bcx; } // Kludge to work around the fact that we know the precise type of the // value here, but the dtor expects a type that still has opaque pointers // for type variables. let val_llty = - lib::llvm::fn_ty_param_tys(llvm::LLVMGetElementType - (llvm::LLVMTypeOf(dtor_addr))) - .(std::vec::len(args)); + lib::llvm::fn_ty_param_tys( + llvm::LLVMGetElementType( + llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)]; let val_cast = cx.build.BitCast(val.val, val_llty); - cx.build.FastCall(dtor_addr, args + ~[val_cast]); + cx.build.FastCall(dtor_addr, args + [val_cast]); cx = drop_slot(cx, val.val, inner_t_s).bcx; cx.build.Store(C_int(0), drop_flag.val); @@ -1514,7 +1482,7 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef, cx.build.CondBr(null_test, next_cx.llbb, load_rc_cx.llbb); let rc_ptr = load_rc_cx.build.GEP(box_ptr, - ~[C_int(0), C_int(abi::box_rc_field_refcnt)]); + [C_int(0), C_int(abi::box_rc_field_refcnt)]); let rc = load_rc_cx.build.Load(rc_ptr); let const_test = load_rc_cx.build.ICmp(lib::llvm::LLVMIntEQ, @@ -1530,9 +1498,9 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef, let t_else = T_nil(); let v_else = C_nil(); let phi = - next_cx.build.Phi(t_else, ~[v_else, v_else, v_else, free_res.val], - ~[cx.llbb, load_rc_cx.llbb, rc_adj_cx.llbb, - free_res.bcx.llbb]); + next_cx.build.Phi(t_else, [v_else, v_else, v_else, free_res.val], + [cx.llbb, load_rc_cx.llbb, rc_adj_cx.llbb, + free_res.bcx.llbb]); ret rslt(next_cx, phi); } @@ -1555,15 +1523,16 @@ fn compare_scalar_types(cx: @block_ctxt, lhs: ValueRef, rhs: ValueRef, alt ty::struct(bcx_tcx(cx), t) { ty::ty_nil. { ret f(nil_type); } - ty::ty_bool. | ty::ty_uint. | ty::ty_ptr(_) | - ty::ty_char. { ret f(unsigned_int); } + ty::ty_bool. | ty::ty_uint. | ty::ty_ptr(_) | ty::ty_char. { + ret f(unsigned_int); + } ty::ty_int. { ret f(signed_int); } ty::ty_float. { ret f(floating_point); } ty::ty_machine(_) { if ty::type_is_fp(bcx_tcx(cx), t) { // Floating point machine types ret f(floating_point); - } else if (ty::type_is_signed(bcx_tcx(cx), t)) { + } else if ty::type_is_signed(bcx_tcx(cx), t) { // Signed, integral machine types ret f(signed_int); } else { @@ -1634,7 +1603,7 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, let r: ValueRef; if nt == nil_type { r = C_bool(op != 0u); - } else if (nt == floating_point) { + } else if nt == floating_point { r = cx.build.FCmp(op, lhs, rhs); } else { r = cx.build.ICmp(op, lhs, rhs); } ret r; @@ -1656,21 +1625,21 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_lt), lt_cx.llbb); llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb); let last_result = - last_cx.build.Phi(T_i1(), ~[eq_result, lt_result, le_result], - ~[eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); + last_cx.build.Phi(T_i1(), [eq_result, lt_result, le_result], + [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]); ret rslt(last_cx, last_result); } -type val_pair_fn = fn(&@block_ctxt, ValueRef, ValueRef) -> result ; -type val_fn = fn(&@block_ctxt, ValueRef) -> result ; -type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result ; +type val_pair_fn = fn(&@block_ctxt, ValueRef, ValueRef) -> result; +type val_fn = fn(&@block_ctxt, ValueRef) -> result; +type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result; // Iterates through the elements of a structural type. fn iter_structural_ty(cx: &@block_ctxt, v: ValueRef, t: &ty::t, f: val_and_ty_fn) -> result { - fn adaptor_fn(f: val_and_ty_fn, cx: &@block_ctxt, av: ValueRef, - t: ty::t) -> result { + fn adaptor_fn(f: val_and_ty_fn, cx: &@block_ctxt, av: ValueRef, t: ty::t) + -> result { ret f(cx, av, t); } ret iter_structural_ty_full(cx, v, t, bind adaptor_fn(f, _, _, _)); @@ -1689,13 +1658,13 @@ fn store_inbounds(cx: &@block_ctxt, v: ValueRef, p: ValueRef, // This uses store and inboundsGEP, but it only doing so superficially; it's // really storing an incremented pointer to another pointer. fn incr_ptr(cx: &@block_ctxt, p: ValueRef, incr: ValueRef, pp: ValueRef) { - cx.build.Store(cx.build.InBoundsGEP(p, ~[incr]), pp); + cx.build.Store(cx.build.InBoundsGEP(p, [incr]), pp); } fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, f: &val_and_ty_fn) -> result { - fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) - -> result { + fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) -> + result { let box_ptr = cx.build.Load(box_cell); let tnil = ty::mk_nil(bcx_tcx(cx)); let tbox = ty::mk_imm_box(bcx_tcx(cx), tnil); @@ -1729,7 +1698,7 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, // known to not use pointer casts, which tend to confuse LLVM. let a_elem_i8 = bcx.build.PointerCast(a_elem, T_ptr(T_i8())); - let a_end_i8 = bcx.build.GEP(a_elem_i8, ~[len]); + let a_end_i8 = bcx.build.GEP(a_elem_i8, [len]); let a_end = bcx.build.PointerCast(a_end_i8, T_ptr(llunitty)); let dest_elem_ptr = alloca(bcx, T_ptr(llunitty)); @@ -1747,8 +1716,9 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, loop_header_cx.build.CondBr(not_yet_at_end, loop_body_cx.llbb, next_cx.llbb); - rs = f(loop_body_cx, - load_if_immediate(loop_body_cx, dest_elem, unit_ty), unit_ty); + rs = + f(loop_body_cx, + load_if_immediate(loop_body_cx, dest_elem, unit_ty), unit_ty); loop_body_cx = rs.bcx; @@ -1794,9 +1764,10 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, ty::ty_rec(fields) { let i: int = 0; for fld: ty::field in fields { - r = GEP_tup_like(r.bcx, t, av, ~[0, i]); + r = GEP_tup_like(r.bcx, t, av, [0, i]); let llfld_a = r.val; - r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, fld.mt.ty), + r = + f(r.bcx, load_if_immediate(r.bcx, llfld_a, fld.mt.ty), fld.mt.ty); i += 1; } @@ -1804,7 +1775,7 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, ty::ty_tup(args) { let i = 0; for arg in args { - r = GEP_tup_like(r.bcx, t, av, ~[0, i]); + r = GEP_tup_like(r.bcx, t, av, [0, i]); let llfld_a = r.val; r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, arg), arg); i += 1; @@ -1814,8 +1785,8 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, let tcx = bcx_tcx(cx); let inner1 = ty::substitute_type_params(tcx, tps, inner); let inner_t_s = ty::substitute_type_params(tcx, tps, inner); - let tup_t = ty::mk_tup(tcx, ~[ty::mk_int(tcx), inner_t_s]); - r = GEP_tup_like(r.bcx, tup_t, av, ~[0, 1]); + let tup_t = ty::mk_tup(tcx, [ty::mk_int(tcx), inner_t_s]); + r = GEP_tup_like(r.bcx, tup_t, av, [0, 1]); let llfld_a = r.val; r = f(r.bcx, load_if_immediate(r.bcx, llfld_a, inner1), inner1); } @@ -1825,13 +1796,13 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, // Cast the tags to types we can GEP into. if n_variants == 1u { - ret iter_variant(cx, av, variants.(0), tps, tid, f); + ret iter_variant(cx, av, variants[0], tps, tid, f); } let lltagty = T_opaque_tag_ptr(bcx_ccx(cx).tn); let av_tag = cx.build.PointerCast(av, lltagty); - let lldiscrim_a_ptr = cx.build.GEP(av_tag, ~[C_int(0), C_int(0)]); - let llunion_a_ptr = cx.build.GEP(av_tag, ~[C_int(0), C_int(1)]); + let lldiscrim_a_ptr = cx.build.GEP(av_tag, [C_int(0), C_int(0)]); + let llunion_a_ptr = cx.build.GEP(av_tag, [C_int(0), C_int(1)]); let lldiscrim_a = cx.build.Load(lldiscrim_a_ptr); // NB: we must hit the discriminant first so that structural @@ -1849,8 +1820,9 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, "tag-iter-variant-" + uint::to_str(i, 10u)); llvm::LLVMAddCase(llswitch, C_int(i as int), variant_cx.llbb); - variant_cx = iter_variant(variant_cx, llunion_a_ptr, variant, tps, - tid, f).bcx; + variant_cx = + iter_variant(variant_cx, llunion_a_ptr, variant, tps, tid, + f).bcx; variant_cx.build.Br(next_cx.llbb); i += 1u; } @@ -1858,12 +1830,12 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, } ty::ty_fn(_, _, _, _, _) { let box_cell_a = - cx.build.GEP(av, ~[C_int(0), C_int(abi::fn_field_box)]); + cx.build.GEP(av, [C_int(0), C_int(abi::fn_field_box)]); ret iter_boxpp(cx, box_cell_a, f); } ty::ty_obj(_) { let box_cell_a = - cx.build.GEP(av, ~[C_int(0), C_int(abi::obj_field_box)]); + cx.build.GEP(av, [C_int(0), C_int(abi::obj_field_box)]); ret iter_boxpp(cx, box_cell_a, f); } ty::ty_vec(unit_tm) { ret iter_ivec(cx, av, unit_tm.ty, f); } @@ -1879,12 +1851,15 @@ fn iter_structural_ty_full(cx: &@block_ctxt, av: ValueRef, t: &ty::t, // Iterates through a pointer range, until the src* hits the src_lim*. fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, - // elt* - src: ValueRef, - // elt* - src_lim: ValueRef, - // elt* - elt_sz: ValueRef, f: &val_pair_fn) -> result { + src: + // elt* + ValueRef, + src_lim: + // elt* + ValueRef, + elt_sz: + // elt* + ValueRef, f: &val_pair_fn) -> result { let bcx = cx; let dst_int: ValueRef = vp2i(bcx, dst); let src_int: ValueRef = vp2i(bcx, src); @@ -1894,9 +1869,9 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, let next_cx = new_sub_block_ctxt(cx, "next"); bcx.build.Br(cond_cx.llbb); let dst_curr: ValueRef = - cond_cx.build.Phi(T_int(), ~[dst_int], ~[bcx.llbb]); + cond_cx.build.Phi(T_int(), [dst_int], [bcx.llbb]); let src_curr: ValueRef = - cond_cx.build.Phi(T_int(), ~[src_int], ~[bcx.llbb]); + cond_cx.build.Phi(T_int(), [src_int], [bcx.llbb]); let end_test = cond_cx.build.ICmp(lib::llvm::LLVMIntULT, src_curr, src_lim_int); cond_cx.build.CondBr(end_test, body_cx.llbb, next_cx.llbb); @@ -1907,14 +1882,13 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, let dst_next = body_cx.build.Add(dst_curr, elt_sz); let src_next = body_cx.build.Add(src_curr, elt_sz); body_cx.build.Br(cond_cx.llbb); - cond_cx.build.AddIncomingToPhi(dst_curr, ~[dst_next], ~[body_cx.llbb]); - cond_cx.build.AddIncomingToPhi(src_curr, ~[src_next], ~[body_cx.llbb]); + cond_cx.build.AddIncomingToPhi(dst_curr, [dst_next], [body_cx.llbb]); + cond_cx.build.AddIncomingToPhi(src_curr, [src_next], [body_cx.llbb]); ret rslt(next_cx, C_nil()); } fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef, src_lim: - // elt* ValueRef, elt_ty: & // elt* @@ -1945,8 +1919,8 @@ fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: &ty::t, f: &val_and_ty_fn) let len; let bcx; if !interior { - p0 = cx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_data)]); - let lp = cx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_fill)]); + p0 = cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]); + let lp = cx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]); len = cx.build.Load(lp); bcx = cx; } else { @@ -2012,65 +1986,62 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int, alt { ti.copy_glue } { some(_) { } none. { - log #fmt("+++ lazily_emit_tydesc_glue TAKE %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + log #fmt["+++ lazily_emit_tydesc_glue TAKE %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), "copy"); ti.copy_glue = some::<ValueRef>(glue_fn); - make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, - make_copy_glue, ti.ty_params, - "take"); - log #fmt("--- lazily_emit_tydesc_glue TAKE %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_copy_glue, + ti.ty_params, "take"); + log #fmt["--- lazily_emit_tydesc_glue TAKE %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; } } - } else if (field == abi::tydesc_field_drop_glue) { + } else if field == abi::tydesc_field_drop_glue { alt { ti.drop_glue } { some(_) { } none. { - log #fmt("+++ lazily_emit_tydesc_glue DROP %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + log #fmt["+++ lazily_emit_tydesc_glue DROP %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), "drop"); ti.drop_glue = some::<ValueRef>(glue_fn); - make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, - make_drop_glue, ti.ty_params, - "drop"); - log #fmt("--- lazily_emit_tydesc_glue DROP %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_drop_glue, + ti.ty_params, "drop"); + log #fmt["--- lazily_emit_tydesc_glue DROP %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; } } - } else if (field == abi::tydesc_field_free_glue) { + } else if field == abi::tydesc_field_free_glue { alt { ti.free_glue } { some(_) { } none. { - log #fmt("+++ lazily_emit_tydesc_glue FREE %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + log #fmt["+++ lazily_emit_tydesc_glue FREE %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; let lcx = cx.fcx.lcx; let glue_fn = declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx), "free"); ti.free_glue = some::<ValueRef>(glue_fn); - make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, - make_free_glue, ti.ty_params, - "free"); - log #fmt("--- lazily_emit_tydesc_glue FREE %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + make_generic_glue(lcx, cx.sp, ti.ty, glue_fn, make_free_glue, + ti.ty_params, "free"); + log #fmt["--- lazily_emit_tydesc_glue FREE %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; } } - } else if (field == abi::tydesc_field_cmp_glue) { + } else if field == abi::tydesc_field_cmp_glue { alt { ti.cmp_glue } { some(_) { } none. { - log #fmt("+++ lazily_emit_tydesc_glue CMP %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + log #fmt["+++ lazily_emit_tydesc_glue CMP %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; ti.cmp_glue = some(bcx_ccx(cx).upcalls.cmp_type); - log #fmt("--- lazily_emit_tydesc_glue CMP %s", - ty_to_str(bcx_tcx(cx), ti.ty)); + log #fmt["--- lazily_emit_tydesc_glue CMP %s", + ty_to_str(bcx_tcx(cx), ti.ty)]; } } } @@ -2088,11 +2059,11 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef, some(sti) { if field == abi::tydesc_field_copy_glue { static_glue_fn = sti.copy_glue; - } else if (field == abi::tydesc_field_drop_glue) { + } else if field == abi::tydesc_field_drop_glue { static_glue_fn = sti.drop_glue; - } else if (field == abi::tydesc_field_free_glue) { + } else if field == abi::tydesc_field_free_glue { static_glue_fn = sti.free_glue; - } else if (field == abi::tydesc_field_cmp_glue) { + } else if field == abi::tydesc_field_cmp_glue { static_glue_fn = sti.cmp_glue; } } @@ -2101,21 +2072,21 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef, let llrawptr = cx.build.BitCast(v, T_ptr(T_i8())); let lltydescs = cx.build.GEP(tydesc, - ~[C_int(0), C_int(abi::tydesc_field_first_param)]); + [C_int(0), C_int(abi::tydesc_field_first_param)]); lltydescs = cx.build.Load(lltydescs); let llfn; alt static_glue_fn { none. { - let llfnptr = cx.build.GEP(tydesc, ~[C_int(0), C_int(field)]); + let llfnptr = cx.build.GEP(tydesc, [C_int(0), C_int(field)]); llfn = cx.build.Load(llfnptr); } some(sgf) { llfn = sgf; } } cx.build.Call(llfn, - ~[C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, - C_null(T_ptr(T_nil())), lltydescs, llrawptr]); + [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, + C_null(T_ptr(T_nil())), lltydescs, llrawptr]); } fn call_tydesc_glue(cx: &@block_ctxt, v: ValueRef, t: &ty::t, field: int) -> @@ -2142,7 +2113,7 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t, let lltydesc = r.val; let lltydescs = r.bcx.build.GEP(lltydesc, - ~[C_int(0), C_int(abi::tydesc_field_first_param)]); + [C_int(0), C_int(abi::tydesc_field_first_param)]); lltydescs = r.bcx.build.Load(lltydescs); let llfn; @@ -2150,7 +2121,7 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t, none. { let llfnptr = r.bcx.build.GEP(lltydesc, - ~[C_int(0), C_int(abi::tydesc_field_cmp_glue)]); + [C_int(0), C_int(abi::tydesc_field_cmp_glue)]); llfn = r.bcx.build.Load(llfnptr); } some(sti) { llfn = option::get(sti.cmp_glue); } @@ -2158,8 +2129,8 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: &ty::t, let llcmpresultptr = alloca(r.bcx, T_i1()); let llargs: [ValueRef] = - ~[llcmpresultptr, r.bcx.fcx.lltaskptr, lltydesc, - lltydescs, llrawlhsptr, llrawrhsptr, llop]; + [llcmpresultptr, r.bcx.fcx.lltaskptr, lltydesc, lltydescs, + llrawlhsptr, llrawrhsptr, llop]; r.bcx.build.Call(llfn, llargs); ret rslt(r.bcx, r.bcx.build.Load(llcmpresultptr)); } @@ -2218,7 +2189,7 @@ fn call_memmove(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, let volatile = C_bool(false); ret rslt(cx, cx.build.Call(memmove, - ~[dst_ptr, src_ptr, size, align, volatile])); + [dst_ptr, src_ptr, size, align, volatile])); } fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef, @@ -2237,7 +2208,7 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef, let volatile = C_bool(false); ret rslt(cx, cx.build.Call(memset, - ~[dst_ptr, C_u8(0u), size, align, volatile])); + [dst_ptr, C_u8(0u), size, align, volatile])); } fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: &ty::t) -> @@ -2248,9 +2219,7 @@ fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: &ty::t) -> } else if ty::type_is_structural(bcx_tcx(cx), t) { let llsz = llsize_of(type_of(bcx_ccx(cx), cx.sp, t)); ret call_memmove(cx, dst, src, llsz); - } else { - ret rslt(cx, cx.build.Store(cx.build.Load(src), dst)); - } + } else { ret rslt(cx, cx.build.Store(cx.build.Load(src), dst)); } } // Duplicates any heap-owned memory owned by a value of the given type. @@ -2279,17 +2248,17 @@ fn copy_val(cx: &@block_ctxt, action: copy_action, dst: ValueRef, if ty::type_is_scalar(ccx.tcx, t) || ty::type_is_native(ccx.tcx, t) { ret rslt(cx, cx.build.Store(src, dst)); - } else if (ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t)) { + } else if ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t) { ret rslt(cx, C_nil()); - } else if (ty::type_is_boxed(ccx.tcx, t)) { + } else if ty::type_is_boxed(ccx.tcx, t) { let bcx; if action == DROP_EXISTING { bcx = drop_ty(cx, cx.build.Load(dst), t).bcx; } else { bcx = cx; } bcx = copy_ty(bcx, src, t).bcx; ret rslt(bcx, bcx.build.Store(src, dst)); - } else if (ty::type_is_structural(ccx.tcx, t) || - ty::type_has_dynamic_size(ccx.tcx, t)) { + } else if ty::type_is_structural(ccx.tcx, t) || + ty::type_has_dynamic_size(ccx.tcx, t) { // Check for self-assignment. let do_copy_cx = new_sub_block_ctxt(cx, "do_copy"); let next_cx = new_sub_block_ctxt(cx, "next"); @@ -2326,11 +2295,11 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef, if src.is_mem { src_val = cx.build.Load(src_val); } cx.build.Store(src_val, dst); ret rslt(cx, C_nil()); - } else if (ty::type_is_nil(bcx_tcx(cx), t) || - ty::type_is_bot(bcx_tcx(cx), t)) { + } else if ty::type_is_nil(bcx_tcx(cx), t) || + ty::type_is_bot(bcx_tcx(cx), t) { ret rslt(cx, C_nil()); - } else if (ty::type_is_unique(bcx_tcx(cx), t) || - ty::type_is_boxed(bcx_tcx(cx), t)) { + } else if ty::type_is_unique(bcx_tcx(cx), t) || + ty::type_is_boxed(bcx_tcx(cx), t) { if src.is_mem { src_val = cx.build.Load(src_val); } if action == DROP_EXISTING { cx = drop_ty(cx, cx.build.Load(dst), t).bcx; @@ -2341,8 +2310,8 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef, // If we're here, it must be a temporary. revoke_clean(cx, src_val); ret rslt(cx, C_nil()); - } else if (ty::type_is_structural(bcx_tcx(cx), t) || - ty::type_has_dynamic_size(bcx_tcx(cx), t)) { + } else if ty::type_is_structural(bcx_tcx(cx), t) || + ty::type_has_dynamic_size(bcx_tcx(cx), t) { if action == DROP_EXISTING { cx = drop_ty(cx, dst, t).bcx; } cx = memmove_ty(cx, dst, src_val, t).bcx; if src.is_mem { @@ -2375,51 +2344,51 @@ fn trans_lit_istr(cx: &@block_ctxt, s: str) -> result { if len < 3u { // 3 because of the \0 cx.build.Store(C_uint(len + 1u), cx.build.InBoundsGEP(llstackpart, - ~[C_int(0), C_int(0)])); + [C_int(0), C_int(0)])); cx.build.Store(C_int(4), cx.build.InBoundsGEP(llstackpart, - ~[C_int(0), C_int(1)])); + [C_int(0), C_int(1)])); let i = 0u; while i < len { - cx.build.Store(C_u8(s.(i) as uint), + cx.build.Store(C_u8(s[i] as uint), cx.build.InBoundsGEP(llstackpart, - ~[C_int(0), C_int(2), - C_uint(i)])); + [C_int(0), C_int(2), + C_uint(i)])); i += 1u; } cx.build.Store(C_u8(0u), cx.build.InBoundsGEP(llstackpart, - ~[C_int(0), C_int(2), - C_uint(len)])); + [C_int(0), C_int(2), + C_uint(len)])); bcx = cx; } else { let r = trans_shared_malloc(cx, T_ptr(T_ivec_heap_part(T_i8())), - llsize_of(T_struct(~[T_int(), - T_array(T_i8(), - len + 1u)]))); + llsize_of(T_struct([T_int(), + T_array(T_i8(), + len + 1u)]))); bcx = r.bcx; let llheappart = r.val; bcx.build.Store(C_uint(len + 1u), bcx.build.InBoundsGEP(llheappart, - ~[C_int(0), C_int(0)])); + [C_int(0), C_int(0)])); bcx.build.Store(llvm::LLVMConstString(str::buf(s), len, False), bcx.build.InBoundsGEP(llheappart, - ~[C_int(0), C_int(1)])); + [C_int(0), C_int(1)])); let llspilledstackpart = bcx.build.PointerCast(llstackpart, T_ptr(T_ivec_heap(T_i8()))); bcx.build.Store(C_int(0), bcx.build.InBoundsGEP(llspilledstackpart, - ~[C_int(0), C_int(0)])); + [C_int(0), C_int(0)])); bcx.build.Store(C_uint(len + 1u), bcx.build.InBoundsGEP(llspilledstackpart, - ~[C_int(0), C_int(1)])); + [C_int(0), C_int(1)])); bcx.build.Store(llheappart, bcx.build.InBoundsGEP(llspilledstackpart, - ~[C_int(0), C_int(2)])); + [C_int(0), C_int(2)])); } ret rslt(bcx, llstackpart); @@ -2520,9 +2489,8 @@ fn trans_unary(cx: &@block_ctxt, op: ast::unop, e: &@ast::expr, } } -fn trans_compare(cx: &@block_ctxt, op: ast::binop, - lhs: ValueRef, _lhs_t: ty::t, rhs: ValueRef, - rhs_t: ty::t) -> result { +fn trans_compare(cx: &@block_ctxt, op: ast::binop, lhs: ValueRef, + _lhs_t: ty::t, rhs: ValueRef, rhs_t: ty::t) -> result { // Determine the operation we need. let llop; alt op { @@ -2542,9 +2510,8 @@ fn trans_compare(cx: &@block_ctxt, op: ast::binop, } } -fn trans_evec_append(cx: &@block_ctxt, t: &ty::t, - lhs: ValueRef, rhs: ValueRef) - -> result { +fn trans_evec_append(cx: &@block_ctxt, t: &ty::t, lhs: ValueRef, + rhs: ValueRef) -> result { let elt_ty = ty::sequence_element_type(bcx_tcx(cx), t); let skip_null = C_bool(false); alt ty::struct(bcx_tcx(cx), t) { @@ -2565,8 +2532,8 @@ fn trans_evec_append(cx: &@block_ctxt, t: &ty::t, let src = bcx.build.PointerCast(rhs, T_opaque_vec_ptr()); ret rslt(bcx, bcx.build.Call(bcx_ccx(cx).upcalls.evec_append, - ~[cx.fcx.lltaskptr, llvec_tydesc.val, - llelt_tydesc.val, dst, src, skip_null])); + [cx.fcx.lltaskptr, llvec_tydesc.val, + llelt_tydesc.val, dst, src, skip_null])); } mod ivec { @@ -2585,11 +2552,11 @@ mod ivec { let llunitty = type_of_or_i8(bcx, unit_ty); let stack_len = - load_inbounds(bcx, v, ~[C_int(0), C_uint(abi::ivec_elt_len)]); + load_inbounds(bcx, v, [C_int(0), C_uint(abi::ivec_elt_len)]); let stack_elem = bcx.build.InBoundsGEP(v, - ~[C_int(0), C_uint(abi::ivec_elt_elems), - C_int(0)]); + [C_int(0), C_uint(abi::ivec_elt_elems), + C_int(0)]); let on_heap = bcx.build.ICmp(lib::llvm::LLVMIntEQ, stack_len, C_int(0)); let on_heap_cx = new_sub_block_ctxt(bcx, "on_heap"); @@ -2599,7 +2566,7 @@ mod ivec { on_heap_cx.build.PointerCast(v, T_ptr(T_ivec_heap(llunitty))); let heap_ptr = load_inbounds(on_heap_cx, heap_stub, - ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]); + [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]); // Check whether the heap pointer is null. If it is, the vector length // is truly zero. @@ -2623,11 +2590,11 @@ mod ivec { let heap_len = load_inbounds(nonzero_len_cx, heap_ptr, - ~[C_int(0), C_uint(abi::ivec_heap_elt_len)]); + [C_int(0), C_uint(abi::ivec_heap_elt_len)]); let heap_elem = { let v = - ~[C_int(0), C_uint(abi::ivec_heap_elt_elems), C_int(0)]; + [C_int(0), C_uint(abi::ivec_heap_elt_elems), C_int(0)]; nonzero_len_cx.build.InBoundsGEP(heap_ptr, v) }; @@ -2636,14 +2603,14 @@ mod ivec { // first element. let len = - next_cx.build.Phi(T_int(), ~[stack_len, zero_len, heap_len], - ~[bcx.llbb, zero_len_cx.llbb, - nonzero_len_cx.llbb]); + next_cx.build.Phi(T_int(), [stack_len, zero_len, heap_len], + [bcx.llbb, zero_len_cx.llbb, + nonzero_len_cx.llbb]); let elem = next_cx.build.Phi(T_ptr(llunitty), - ~[stack_elem, zero_elem, heap_elem], - ~[bcx.llbb, zero_len_cx.llbb, - nonzero_len_cx.llbb]); + [stack_elem, zero_elem, heap_elem], + [bcx.llbb, zero_len_cx.llbb, + nonzero_len_cx.llbb]); ret {len: len, data: elem, bcx: next_cx}; } @@ -2652,10 +2619,10 @@ mod ivec { fn reserve_space(cx: &@block_ctxt, llunitty: TypeRef, v: ValueRef, len_needed: ValueRef) -> result { let stack_len_ptr = - cx.build.InBoundsGEP(v, ~[C_int(0), C_uint(abi::ivec_elt_len)]); + cx.build.InBoundsGEP(v, [C_int(0), C_uint(abi::ivec_elt_len)]); let stack_len = cx.build.Load(stack_len_ptr); let alen = - load_inbounds(cx, v, ~[C_int(0), C_uint(abi::ivec_elt_alen)]); + load_inbounds(cx, v, [C_int(0), C_uint(abi::ivec_elt_alen)]); // There are four cases we have to consider: // (1) On heap, no resize necessary. // (2) On heap, need to resize. @@ -2671,7 +2638,7 @@ mod ivec { let next_cx = new_sub_block_ctxt(cx, "next"); // We're possibly on the heap, unless the vector is zero-length. - let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; + let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; let stub_ptr = maybe_on_heap_cx.build.PointerCast(v, T_ptr(T_ivec_heap(llunitty))); @@ -2686,8 +2653,8 @@ mod ivec { let heap_len_ptr = on_heap_cx.build.InBoundsGEP(heap_ptr, - ~[C_int(0), - C_uint(abi::ivec_heap_elt_len)]); + [C_int(0), + C_uint(abi::ivec_heap_elt_len)]); let heap_len = on_heap_cx.build.Load(heap_len_ptr); let new_heap_len = on_heap_cx.build.Add(heap_len, len_needed); let heap_len_unscaled = @@ -2703,8 +2670,8 @@ mod ivec { let heap_data_no_resize = { let v = - ~[C_int(0), C_uint(abi::ivec_heap_elt_elems), - heap_len_unscaled]; + [C_int(0), C_uint(abi::ivec_heap_elt_elems), + heap_len_unscaled]; heap_no_resize_cx.build.InBoundsGEP(heap_ptr, v) }; heap_no_resize_cx.build.Store(new_heap_len, heap_len_ptr); @@ -2717,15 +2684,15 @@ mod ivec { heap_resize_cx.build.PointerCast(v, T_ptr(T_opaque_ivec())); let upcall = bcx_ccx(cx).upcalls.ivec_resize_shared; heap_resize_cx.build.Call(upcall, - ~[cx.fcx.lltaskptr, p, new_heap_len]); + [cx.fcx.lltaskptr, p, new_heap_len]); } let heap_ptr_resize = load_inbounds(heap_resize_cx, stub_ptr, stub_p); let heap_data_resize = { let v = - ~[C_int(0), C_uint(abi::ivec_heap_elt_elems), - heap_len_unscaled]; + [C_int(0), C_uint(abi::ivec_heap_elt_elems), + heap_len_unscaled]; heap_resize_cx.build.InBoundsGEP(heap_ptr_resize, v) }; heap_resize_cx.build.Br(next_cx.llbb); @@ -2745,9 +2712,9 @@ mod ivec { let stack_data_no_spill = stack_no_spill_cx.build.InBoundsGEP(v, - ~[C_int(0), - C_uint(abi::ivec_elt_elems), - stack_len_unscaled]); + [C_int(0), + C_uint(abi::ivec_elt_elems), + stack_len_unscaled]); stack_no_spill_cx.build.Store(new_stack_len, stack_len_ptr); stack_no_spill_cx.build.Br(next_cx.llbb); // Case (4): We're on the stack and need to spill. Like case (2), this @@ -2758,7 +2725,7 @@ mod ivec { stack_spill_cx.build.PointerCast(v, T_ptr(T_opaque_ivec())); let upcall = bcx_ccx(cx).upcalls.ivec_spill_shared; stack_spill_cx.build.Call(upcall, - ~[cx.fcx.lltaskptr, p, new_stack_len]); + [cx.fcx.lltaskptr, p, new_stack_len]); } let spill_stub = stack_spill_cx.build.PointerCast(v, T_ptr(T_ivec_heap(llunitty))); @@ -2769,8 +2736,8 @@ mod ivec { let heap_data_spill = { let v = - ~[C_int(0), C_uint(abi::ivec_heap_elt_elems), - stack_len_unscaled]; + [C_int(0), C_uint(abi::ivec_heap_elt_elems), + stack_len_unscaled]; stack_spill_cx.build.InBoundsGEP(heap_ptr_spill, v) }; stack_spill_cx.build.Br(next_cx.llbb); @@ -2778,10 +2745,10 @@ mod ivec { let data_ptr = next_cx.build.Phi(T_ptr(llunitty), - ~[heap_data_no_resize, heap_data_resize, - stack_data_no_spill, heap_data_spill], - ~[heap_no_resize_cx.llbb, heap_resize_cx.llbb, - stack_no_spill_cx.llbb, stack_spill_cx.llbb]); + [heap_data_no_resize, heap_data_resize, + stack_data_no_spill, heap_data_spill], + [heap_no_resize_cx.llbb, heap_resize_cx.llbb, + stack_no_spill_cx.llbb, stack_spill_cx.llbb]); ret rslt(next_cx, data_ptr); } fn trans_append(cx: &@block_ctxt, t: &ty::t, orig_lhs: ValueRef, @@ -2828,7 +2795,7 @@ mod ivec { // Work out the end pointer. let lhs_unscaled_idx = bcx.build.UDiv(rhs_len, llsize_of(llunitty)); - let lhs_end = bcx.build.InBoundsGEP(lhs_data, ~[lhs_unscaled_idx]); + let lhs_end = bcx.build.InBoundsGEP(lhs_data, [lhs_unscaled_idx]); // Now emit the copy loop. let dest_ptr = alloca(bcx, T_ptr(llunitty)); @@ -2948,12 +2915,12 @@ mod ivec { bcx.build.CondBr(len_is_zero, zero_len_cx.llbb, nonzero_len_cx.llbb); // Case (1): Length is zero. - let stub_z = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)]; - let stub_a = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]; - let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; + let stub_z = [C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)]; + let stub_a = [C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]; + let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; - let vec_l = ~[C_int(0), C_uint(abi::ivec_elt_len)]; - let vec_a = ~[C_int(0), C_uint(abi::ivec_elt_alen)]; + let vec_l = [C_int(0), C_uint(abi::ivec_elt_len)]; + let vec_a = [C_int(0), C_uint(abi::ivec_elt_alen)]; let stub_ptr_zero = zero_len_cx.build.PointerCast(llvecptr, @@ -2984,9 +2951,8 @@ mod ivec { stack_cx.build.InBoundsGEP(llvecptr, vec_a)); let dest_ptr_stack = stack_cx.build.InBoundsGEP(llvecptr, - ~[C_int(0), - C_uint(abi::ivec_elt_elems), - C_int(0)]); + [C_int(0), C_uint(abi::ivec_elt_elems), + C_int(0)]); let copy_cx = new_sub_block_ctxt(bcx, "copy"); stack_cx.build.Br(copy_cx.llbb); // Case (3): Allocate on heap and copy there. @@ -3004,35 +2970,35 @@ mod ivec { heap_cx.build.Store(heap_part, heap_cx.build.InBoundsGEP(stub_ptr_heap, stub_p)); { - let v = ~[C_int(0), C_uint(abi::ivec_heap_elt_len)]; + let v = [C_int(0), C_uint(abi::ivec_heap_elt_len)]; heap_cx.build.Store(lllen, heap_cx.build.InBoundsGEP(heap_part, v)); } let dest_ptr_heap = heap_cx.build.InBoundsGEP(heap_part, - ~[C_int(0), - C_uint(abi::ivec_heap_elt_elems), - C_int(0)]); + [C_int(0), + C_uint(abi::ivec_heap_elt_elems), + C_int(0)]); heap_cx.build.Br(copy_cx.llbb); // Emit the copy loop. let first_dest_ptr = copy_cx.build.Phi(T_ptr(llunitty), - ~[dest_ptr_stack, dest_ptr_heap], - ~[stack_cx.llbb, heap_cx.llbb]); + [dest_ptr_stack, dest_ptr_heap], + [stack_cx.llbb, heap_cx.llbb]); let lhs_end_ptr; let rhs_end_ptr; if ty::type_has_dynamic_size(bcx_tcx(cx), unit_ty) { - lhs_end_ptr = copy_cx.build.InBoundsGEP(lhs_data, ~[lhs_len]); - rhs_end_ptr = copy_cx.build.InBoundsGEP(rhs_data, ~[rhs_len]); + lhs_end_ptr = copy_cx.build.InBoundsGEP(lhs_data, [lhs_len]); + rhs_end_ptr = copy_cx.build.InBoundsGEP(rhs_data, [rhs_len]); } else { let lhs_len_unscaled = copy_cx.build.UDiv(lhs_len, unit_sz); lhs_end_ptr = - copy_cx.build.InBoundsGEP(lhs_data, ~[lhs_len_unscaled]); + copy_cx.build.InBoundsGEP(lhs_data, [lhs_len_unscaled]); let rhs_len_unscaled = copy_cx.build.UDiv(rhs_len, unit_sz); rhs_end_ptr = - copy_cx.build.InBoundsGEP(rhs_data, ~[rhs_len_unscaled]); + copy_cx.build.InBoundsGEP(rhs_data, [rhs_len_unscaled]); } let dest_ptr_ptr = alloca(copy_cx, T_ptr(llunitty)); @@ -3123,8 +3089,7 @@ mod ivec { // Check to see if the vector is heapified. let stack_len_ptr = - cx.build.InBoundsGEP(vptr, - ~[C_int(0), C_uint(abi::ivec_elt_len)]); + cx.build.InBoundsGEP(vptr, [C_int(0), C_uint(abi::ivec_elt_len)]); let stack_len = cx.build.Load(stack_len_ptr); let stack_len_is_zero = cx.build.ICmp(lib::llvm::LLVMIntEQ, stack_len, C_int(0)); @@ -3137,8 +3102,10 @@ mod ivec { maybe_on_heap_cx.build.PointerCast(vptr, T_ptr(T_ivec_heap(llunitty))); let heap_ptr_ptr = - maybe_on_heap_cx.build.InBoundsGEP - (stub_ptr, ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]); + maybe_on_heap_cx.build.InBoundsGEP( + stub_ptr, + [C_int(0), + C_uint(abi::ivec_heap_stub_elt_ptr)]); let heap_ptr = maybe_on_heap_cx.build.Load(heap_ptr_ptr); let heap_ptr_is_nonnull = maybe_on_heap_cx.build.ICmp(lib::llvm::LLVMIntNE, heap_ptr, @@ -3149,8 +3116,10 @@ mod ivec { // Ok, the vector is on the heap. Copy the heap part. let alen_ptr = - on_heap_cx.build.InBoundsGEP - (stub_ptr, ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]); + on_heap_cx.build.InBoundsGEP( + stub_ptr, + [C_int(0), + C_uint(abi::ivec_heap_stub_elt_alen)]); let alen = on_heap_cx.build.Load(alen_ptr); let heap_part_sz = @@ -3171,9 +3140,8 @@ mod ivec { } } -fn trans_evec_add(cx: &@block_ctxt, t: &ty::t, - lhs: ValueRef, rhs: ValueRef) -> - result { +fn trans_evec_add(cx: &@block_ctxt, t: &ty::t, lhs: ValueRef, rhs: ValueRef) + -> result { let r = alloc_ty(cx, t); let tmp = r.val; r = copy_val(r.bcx, INIT, tmp, lhs, t); @@ -3190,16 +3158,14 @@ fn trans_eager_binop(cx: &@block_ctxt, op: ast::binop, lhs: ValueRef, // If either is bottom, it diverges. So no need to do the // operation. - if (ty::type_is_bot(bcx_tcx(cx), lhs_t) || - ty::type_is_bot(bcx_tcx(cx), rhs_t)) { + if ty::type_is_bot(bcx_tcx(cx), lhs_t) || + ty::type_is_bot(bcx_tcx(cx), rhs_t) { ret rslt(cx, cx.build.Unreachable()); } let is_float = false; let intype = lhs_t; - if ty::type_is_bot(bcx_tcx(cx), intype) { - intype = rhs_t; - } + if ty::type_is_bot(bcx_tcx(cx), intype) { intype = rhs_t; } alt ty::struct(bcx_tcx(cx), intype) { ty::ty_float. { is_float = true; } @@ -3257,7 +3223,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t { alt ty::struct(ccx.tcx, t1) { ty::ty_box(mt) { let body = - cx.build.GEP(v1, ~[C_int(0), C_int(abi::box_rc_field_body)]); + cx.build.GEP(v1, [C_int(0), C_int(abi::box_rc_field_body)]); t1 = mt.ty; // Since we're changing levels of box indirection, we may have @@ -3272,17 +3238,16 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t { ty::ty_uniq(t) { fail "autoderef uniq unimplemented"; } ty::ty_res(did, inner, tps) { t1 = ty::substitute_type_params(ccx.tcx, tps, inner); - v1 = cx.build.GEP(v1, ~[C_int(0), C_int(1)]); + v1 = cx.build.GEP(v1, [C_int(0), C_int(1)]); } ty::ty_tag(did, tps) { let variants = ty::tag_variants(ccx.tcx, did); if std::vec::len(variants) != 1u || - std::vec::len(variants.(0).args) != 1u { + std::vec::len(variants[0].args) != 1u { break; } t1 = - ty::substitute_type_params(ccx.tcx, tps, - variants.(0).args.(0)); + ty::substitute_type_params(ccx.tcx, tps, variants[0].args[0]); if !ty::type_has_dynamic_size(ccx.tcx, t1) { v1 = cx.build.PointerCast(v1, T_ptr(type_of(ccx, cx.sp, t1))); } @@ -3296,6 +3261,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: &ty::t) -> result_t { fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr, b: &@ast::expr) -> result { + // First couple cases are lazy: alt op { ast::and. { @@ -3314,7 +3280,7 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr, let rhs_bcx = trans_block_cleanups(rhs_res.bcx, rhs_cx); lhs_res.bcx.build.CondBr(lhs_res.val, rhs_cx.llbb, lhs_false_cx.llbb); ret join_results(cx, T_bool(), - ~[lhs_false_res, {bcx: rhs_bcx, val: rhs_res.val}]); + [lhs_false_res, {bcx: rhs_bcx, val: rhs_res.val}]); } ast::or. { // Lazy-eval or @@ -3328,30 +3294,30 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr, let rhs_bcx = trans_block_cleanups(rhs_res.bcx, rhs_cx); lhs_res.bcx.build.CondBr(lhs_res.val, lhs_true_cx.llbb, rhs_cx.llbb); ret join_results(cx, T_bool(), - ~[lhs_true_res, {bcx: rhs_bcx, val: rhs_res.val}]); + [lhs_true_res, {bcx: rhs_bcx, val: rhs_res.val}]); } _ { // Remaining cases are eager: let lhs = trans_expr(cx, a); let rhs = trans_expr(lhs.bcx, b); - ret trans_eager_binop(rhs.bcx, op, - lhs.val, ty::expr_ty(bcx_tcx(cx), a), - rhs.val, ty::expr_ty(bcx_tcx(cx), b)); + ret trans_eager_binop(rhs.bcx, op, lhs.val, + ty::expr_ty(bcx_tcx(cx), a), rhs.val, + ty::expr_ty(bcx_tcx(cx), b)); } } } fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) -> result { - let live: [result] = ~[]; - let vals: [ValueRef] = ~[]; - let bbs: [BasicBlockRef] = ~[]; + let live: [result] = []; + let vals: [ValueRef] = []; + let bbs: [BasicBlockRef] = []; for r: result in ins { if !is_terminated(r.bcx) { - live += ~[r]; - vals += ~[r.val]; - bbs += ~[r.bcx.llbb]; + live += [r]; + vals += [r.val]; + bbs += [r.bcx.llbb]; } } alt std::vec::len::<result>(live) { @@ -3361,7 +3327,7 @@ fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) -> // is just going to propagate it outward. assert (std::vec::len::<result>(ins) >= 1u); - ret ins.(0); + ret ins[0]; } _ {/* fall through */ } } @@ -3384,19 +3350,16 @@ fn join_branches(parent_cx: &@block_ctxt, ins: &[result]) -> @block_ctxt { tag out_method { return; save_in(ValueRef); } fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk, - els: &option::t<@ast::expr>, output: &out_method) - -> result { + els: &option::t<@ast::expr>, output: &out_method) -> result { let cond_res = trans_expr(cx, cond); - if (ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), cond))) { + if ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), cond)) { + // No need to generate code for comparison, // since the cond diverges. - if (!cx.build.is_terminated()) { + if !cx.build.is_terminated() { ret rslt(cx, cx.build.Unreachable()); - } - else { - ret cond_res; - } + } else { ret cond_res; } } let then_cx = new_scope_block_ctxt(cx, "then"); @@ -3424,7 +3387,7 @@ fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk, _ { rslt(else_cx, C_nil()) } }; cond_res.bcx.build.CondBr(cond_res.val, then_cx.llbb, else_cx.llbb); - ret rslt(join_branches(cx, ~[then_res, else_res]), C_nil()); + ret rslt(join_branches(cx, [then_res, else_res]), C_nil()); } fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, @@ -3442,8 +3405,10 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, let local_res = alloc_local(scope_cx, local); let loc_r = copy_val(local_res.bcx, INIT, local_res.val, curr, t); add_clean(scope_cx, local_res.val, t); - let bcx = trans_alt::bind_irrefutable_pat - (loc_r.bcx, local.node.pat, local_res.val, cx.fcx.lllocals, false); + let bcx = + trans_alt::bind_irrefutable_pat(loc_r.bcx, local.node.pat, + local_res.val, cx.fcx.lllocals, + false); bcx = trans_block(bcx, body, return).bcx; if !bcx.build.is_terminated() { bcx.build.Br(next_cx.llbb); @@ -3470,8 +3435,8 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, // Otherwise, it is stack allocated and copies pointers to the upvars. fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], bound_tys: [ty::t], bound_vals: [lval_result], - copying: bool) - -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { + copying: bool) -> + {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { // Synthesize a closure type. // First, synthesize a tuple type containing the types of all the @@ -3487,8 +3452,7 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], // (We'll need room for that many tydescs in the closure.) let ty_param_count = std::vec::len(lltydescs); let tydesc_ty: ty::t = ty::mk_type(bcx_tcx(bcx)); - let captured_tys: [ty::t] = - std::vec::init_elt(tydesc_ty, ty_param_count); + let captured_tys: [ty::t] = std::vec::init_elt(tydesc_ty, ty_param_count); // Get all the types we've got (some of which we synthesized // ourselves) into a vector. The whole things ends up looking @@ -3497,28 +3461,30 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], // closure_tys = [tydesc_ty, [bound_ty1, bound_ty2, ...], [tydesc_ty, // tydesc_ty, ...]] let closure_tys: [ty::t] = - ~[tydesc_ty, bindings_ty, ty::mk_tup(bcx_tcx(bcx), captured_tys)]; + [tydesc_ty, bindings_ty, ty::mk_tup(bcx_tcx(bcx), captured_tys)]; // Finally, synthesize a type for that whole vector. let closure_ty: ty::t = ty::mk_tup(bcx_tcx(bcx), closure_tys); // Allocate a box that can hold something closure-sized. - let r = if copying { - trans_malloc_boxed(bcx, closure_ty) - } else { - // We need to dummy up a box on the stack - let ty = ty::mk_tup(bcx_tcx(bcx), - ~[ty::mk_int(bcx_tcx(bcx)), closure_ty]); - let r = alloc_ty(bcx, ty); - let body = GEPi(bcx, r.val, ~[0, abi::box_rc_field_body]); - {bcx: r.bcx, box: r.val, body: body} - }; + let r = + if copying { + trans_malloc_boxed(bcx, closure_ty) + } else { + // We need to dummy up a box on the stack + let ty = + ty::mk_tup(bcx_tcx(bcx), + [ty::mk_int(bcx_tcx(bcx)), closure_ty]); + let r = alloc_ty(bcx, ty); + let body = GEPi(bcx, r.val, [0, abi::box_rc_field_body]); + {bcx: r.bcx, box: r.val, body: body} + }; bcx = r.bcx; let closure = r.body; // Store bindings tydesc. if copying { - let bound_tydesc = GEPi(bcx, closure, ~[0, abi::closure_elt_tydesc]); + let bound_tydesc = GEPi(bcx, closure, [0, abi::closure_elt_tydesc]); let ti = none; let bindings_tydesc = get_tydesc(bcx, bindings_ty, true, ti).result; lazily_emit_tydesc_glue(bcx, abi::tydesc_field_drop_glue, ti); @@ -3531,18 +3497,16 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], let i = 0u; let bindings = GEP_tup_like(bcx, closure_ty, closure, - ~[0, abi::closure_elt_bindings]); + [0, abi::closure_elt_bindings]); bcx = bindings.bcx; for lv: lval_result in bound_vals { - let bound = GEP_tup_like(bcx, bindings_ty, bindings.val, - ~[0, i as int]); + let bound = + GEP_tup_like(bcx, bindings_ty, bindings.val, [0, i as int]); bcx = bound.bcx; if copying { - bcx = move_val_if_temp(bcx, INIT, - bound.val, lv, bound_tys.(i)).bcx; - } else { - bcx.build.Store(lv.res.val, bound.val); - } + bcx = + move_val_if_temp(bcx, INIT, bound.val, lv, bound_tys[i]).bcx; + } else { bcx.build.Store(lv.res.val, bound.val); } i += 1u; } @@ -3550,11 +3514,11 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], // appropriate slot in the closure. let ty_params_slot = GEP_tup_like(bcx, closure_ty, closure, - ~[0, abi::closure_elt_ty_params]); + [0, abi::closure_elt_ty_params]); bcx = ty_params_slot.bcx; i = 0u; for td: ValueRef in lltydescs { - let ty_param_slot = GEPi(bcx, ty_params_slot.val, ~[0, i as int]); + let ty_param_slot = GEPi(bcx, ty_params_slot.val, [0, i as int]); bcx.build.Store(td, ty_param_slot); i += 1u; } @@ -3564,25 +3528,25 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef], // Given a context and a list of upvars, build a closure. This just // collects the upvars and packages them up for build_environment. -fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool) - -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { - let closure_vals: [lval_result] = ~[]; - let closure_tys: [ty::t] = ~[]; - // If we need to, package up the iterator body to call - if !copying && !option::is_none(cx.fcx.lliterbody) { - closure_vals += ~[lval_mem(cx, option::get(cx.fcx.lliterbody))]; - closure_tys += ~[option::get(cx.fcx.iterbodyty)]; - } - // Package up the upvars - for nid: ast::node_id in *upvars { - closure_vals += ~[trans_var(cx, cx.sp, nid)]; - let ty = ty::node_id_to_monotype(bcx_tcx(cx), nid); - if !copying { ty = ty::mk_mut_ptr(bcx_tcx(cx), ty); } - closure_tys += ~[ty]; - } +fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool) -> + {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} { + let closure_vals: [lval_result] = []; + let closure_tys: [ty::t] = []; + // If we need to, package up the iterator body to call + if !copying && !option::is_none(cx.fcx.lliterbody) { + closure_vals += [lval_mem(cx, option::get(cx.fcx.lliterbody))]; + closure_tys += [option::get(cx.fcx.iterbodyty)]; + } + // Package up the upvars + for nid: ast::node_id in *upvars { + closure_vals += [trans_var(cx, cx.sp, nid)]; + let ty = ty::node_id_to_monotype(bcx_tcx(cx), nid); + if !copying { ty = ty::mk_mut_ptr(bcx_tcx(cx), ty); } + closure_tys += [ty]; + } - ret build_environment(cx, cx.fcx.lltydescs, - closure_tys, closure_vals, copying); + ret build_environment(cx, cx.fcx.lltydescs, closure_tys, closure_vals, + copying); } // Return a pointer to the stored typarams in a closure. @@ -3593,34 +3557,36 @@ fn build_closure(cx: &@block_ctxt, upvars: &@[ast::node_id], copying: bool) fn find_environment_tydescs(bcx: &@block_ctxt, envty: &ty::t, closure: ValueRef) -> ValueRef { ret if !ty::type_has_dynamic_size(bcx_tcx(bcx), envty) { - // If we can find the typarams statically, do it - GEPi(bcx, closure, - ~[0, abi::box_rc_field_body, abi::closure_elt_ty_params]) - } else { - // Ugh. We need to load the size of the bindings out of the - // closure's tydesc and use that to skip over the bindings. - let descsty = - ty::get_element_type(bcx_tcx(bcx), envty, - abi::closure_elt_ty_params as uint); - let llenv = GEPi(bcx, closure, ~[0, abi::box_rc_field_body]); - // Load the tydesc and find the size of the body - let lldesc = - bcx.build.Load(GEPi(bcx, llenv, ~[0, abi::closure_elt_tydesc])); - let llsz = bcx.build.Load( - GEPi(bcx, lldesc, ~[0, abi::tydesc_field_size])); - // Get the bindings pointer and add the size to it - let llbinds = GEPi(bcx, llenv, ~[0, abi::closure_elt_bindings]); - bump_ptr(bcx, descsty, llbinds, llsz) - } + // If we can find the typarams statically, do it + GEPi(bcx, closure, + [0, abi::box_rc_field_body, abi::closure_elt_ty_params]) + } else { + // Ugh. We need to load the size of the bindings out of the + // closure's tydesc and use that to skip over the bindings. + let descsty = + ty::get_element_type(bcx_tcx(bcx), envty, + abi::closure_elt_ty_params as uint); + let llenv = GEPi(bcx, closure, [0, abi::box_rc_field_body]); + // Load the tydesc and find the size of the body + let lldesc = + bcx.build.Load(GEPi(bcx, llenv, + [0, abi::closure_elt_tydesc])); + let llsz = + bcx.build.Load(GEPi(bcx, lldesc, + [0, abi::tydesc_field_size])); + + // Get the bindings pointer and add the size to it + let llbinds = GEPi(bcx, llenv, [0, abi::closure_elt_bindings]); + bump_ptr(bcx, descsty, llbinds, llsz) + } } // Given an enclosing block context, a new function context, a closure type, // and a list of upvars, generate code to load and populate the environment // with the upvars and type descriptors. -fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt, - envty: &ty::t, upvars: &@[ast::node_id], - copying: bool) { +fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt, envty: &ty::t, + upvars: &@[ast::node_id], copying: bool) { let bcx = new_raw_block_ctxt(fcx, fcx.llcopyargs); let ty = ty::mk_imm_box(bcx_tcx(bcx), envty); @@ -3634,26 +3600,26 @@ fn load_environment(enclosing_cx: &@block_ctxt, fcx: &@fn_ctxt, let lltydescs = find_environment_tydescs(bcx, envty, llclosure); let i = 0u; while i < tydesc_count { - let lltydescptr = GEPi(bcx, lltydescs, ~[0, i as int]); - fcx.lltydescs += ~[bcx.build.Load(lltydescptr)]; + let lltydescptr = GEPi(bcx, lltydescs, [0, i as int]); + fcx.lltydescs += [bcx.build.Load(lltydescptr)]; i += 1u; } // Populate the upvars from the environment. - let path = ~[0, abi::box_rc_field_body, abi::closure_elt_bindings]; + let path = [0, abi::box_rc_field_body, abi::closure_elt_bindings]; i = 0u; // If this is an aliasing closure/for-each body, we need to load // the iterbody. if !copying && !option::is_none(enclosing_cx.fcx.lliterbody) { - let iterbodyptr = GEP_tup_like(bcx, ty, llclosure, path + ~[0]); + let iterbodyptr = GEP_tup_like(bcx, ty, llclosure, path + [0]); fcx.lliterbody = some(bcx.build.Load(iterbodyptr.val)); bcx = iterbodyptr.bcx; i += 1u; } + // Load the acutal upvars. for upvar_id: ast::node_id in *upvars { - let upvarptr = - GEP_tup_like(bcx, ty, llclosure, path + ~[i as int]); + let upvarptr = GEP_tup_like(bcx, ty, llclosure, path + [i as int]); bcx = upvarptr.bcx; let llupvarptr = upvarptr.val; if !copying { llupvarptr = bcx.build.Load(llupvarptr); } @@ -3720,9 +3686,10 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr, let bcx = new_top_block_ctxt(fcx); // Add bindings for the loop variable alias. - bcx = trans_alt::bind_irrefutable_pat - (bcx, local.node.pat, llvm::LLVMGetParam(fcx.llfn, 3u), - bcx.fcx.lllocals, false); + bcx = + trans_alt::bind_irrefutable_pat(bcx, local.node.pat, + llvm::LLVMGetParam(fcx.llfn, 3u), + bcx.fcx.lllocals, false); let lltop = bcx.llbb; let r = trans_block(bcx, body, return); finish_fn(fcx, lltop); @@ -3770,12 +3737,8 @@ fn trans_do_while(cx: &@block_ctxt, body: &ast::blk, cond: &@ast::expr) -> // This is kind of ridiculous, but no permutations // involving body_res or body_cx.val worked. let rs = trans_block(cx, body, return); - if ! is_terminated (next_cx) { - next_cx.build.Unreachable(); - } - if ! is_terminated (body_cx) { - body_cx.build.Unreachable(); - } + if !is_terminated(next_cx) { next_cx.build.Unreachable(); } + if !is_terminated(body_cx) { body_cx.build.Unreachable(); } ret rs; } let cond_res = trans_expr(body_res.bcx, cond); @@ -3834,16 +3797,16 @@ fn lval_generic_fn(cx: &@block_ctxt, tpt: &ty::ty_param_kinds_and_ty, let tys = ty::node_id_to_type_params(bcx_tcx(cx), id); if std::vec::len::<ty::t>(tys) != 0u { let bcx = lv.res.bcx; - let tydescs: [ValueRef] = ~[]; - let tis: [option::t<@tydesc_info>] = ~[]; + let tydescs: [ValueRef] = []; + let tis: [option::t<@tydesc_info>] = []; for t: ty::t in tys { // TODO: Doesn't always escape. let ti = none::<@tydesc_info>; let td = get_tydesc(bcx, t, true, ti).result; - tis += ~[ti]; + tis += [ti]; bcx = td.bcx; - tydescs += ~[td.val]; + tydescs += [td.val]; } let gen = {item_type: tpt.ty, static_tis: tis, tydescs: tydescs}; lv = {res: rslt(bcx, lv.res.val), generic: some(gen) with lv}; @@ -3868,8 +3831,7 @@ fn lookup_discriminant(lcx: &@local_ctxt, vid: &ast::def_id) -> ValueRef { } } -fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) -> - lval_result { +fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) -> lval_result { let ccx = bcx_ccx(cx); alt freevars::def_lookup(bcx_tcx(cx), cx.fcx.id, id) { some(ast::def_upvar(did, _)) { @@ -3916,7 +3878,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) -> let lldiscrim_gv = lookup_discriminant(bcx.fcx.lcx, vid); let lldiscrim = bcx.build.Load(lldiscrim_gv); let lldiscrimptr = - bcx.build.GEP(lltagptr, ~[C_int(0), C_int(0)]); + bcx.build.GEP(lltagptr, [C_int(0), C_int(0)]); bcx.build.Store(lldiscrim, lldiscrimptr); } ret lval_val(bcx, lltagptr); @@ -3929,7 +3891,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, id: ast::node_id) -> ret lval_mem(cx, ccx.consts.get(did.node)); } else { let tp = ty::node_id_to_monotype(ccx.tcx, id); - let k: [ast::kind] = ~[]; + let k: [ast::kind] = []; ret lval_val(cx, load_if_immediate(cx, trans_external_path(cx, did, @@ -3958,20 +3920,20 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: &ty::t, alt ty::struct(bcx_tcx(cx), t) { ty::ty_rec(fields) { let ix: uint = ty::field_idx(bcx_ccx(cx).sess, sp, field, fields); - let v = GEP_tup_like(r.bcx, t, r.val, ~[0, ix as int]); + let v = GEP_tup_like(r.bcx, t, r.val, [0, ix as int]); ret lval_mem(v.bcx, v.val); } ty::ty_obj(methods) { let ix: uint = ty::method_idx(bcx_ccx(cx).sess, sp, field, methods); let vtbl = - r.bcx.build.GEP(r.val, ~[C_int(0), C_int(abi::obj_field_vtbl)]); + r.bcx.build.GEP(r.val, [C_int(0), C_int(abi::obj_field_vtbl)]); vtbl = r.bcx.build.Load(vtbl); let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u)); vtbl = cx.build.PointerCast(vtbl, vtbl_type); - let v = r.bcx.build.GEP(vtbl, ~[C_int(0), C_int(ix as int)]); - let fn_ty: ty::t = ty::method_ty_to_fn_ty(bcx_tcx(cx), methods.(ix)); + let v = r.bcx.build.GEP(vtbl, [C_int(0), C_int(ix as int)]); + let fn_ty: ty::t = ty::method_ty_to_fn_ty(bcx_tcx(cx), methods[ix]); let tcx = bcx_tcx(cx); let ll_fn_ty = type_of_fn_full(bcx_ccx(cx), sp, ty::ty_fn_proto(tcx, fn_ty), @@ -4005,7 +3967,7 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr, let int_size = llsize_of_real(bcx_ccx(cx), T_int()); if ix_size < int_size { ix_val = bcx.build.ZExt(ix.val, T_int()); - } else if (ix_size > int_size) { + } else if ix_size > int_size { ix_val = bcx.build.Trunc(ix.val, T_int()); } else { ix_val = ix.val; } let unit_ty = node_id_type(bcx_ccx(cx), id); @@ -4024,7 +3986,7 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr, alt interior_len_and_data { some(lad) { lim = lad.len; } none. { - lim = bcx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_fill)]); + lim = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_fill)]); lim = bcx.build.Load(lim); } } @@ -4041,16 +4003,15 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr, none. { body = next_cx.build.GEP(v, - ~[C_int(0), C_int(abi::vec_elt_data), - C_int(0)]); + [C_int(0), C_int(abi::vec_elt_data), C_int(0)]); } } let elt; if ty::type_has_dynamic_size(bcx_tcx(cx), unit_ty) { body = next_cx.build.PointerCast(body, T_ptr(T_i8())); - elt = next_cx.build.GEP(body, ~[scaled_ix]); + elt = next_cx.build.GEP(body, [scaled_ix]); } else { - elt = next_cx.build.GEP(body, ~[ix_val]); + elt = next_cx.build.GEP(body, [ix_val]); // We're crossing a box boundary here, so we may need to pointer cast. let llunitty = type_of(bcx_ccx(next_cx), sp, unit_ty); @@ -4082,12 +4043,12 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result { alt ty::struct(ccx.tcx, t) { ty::ty_box(_) { sub.bcx.build.InBoundsGEP(sub.val, - ~[C_int(0), - C_int(abi::box_rc_field_body)]) + [C_int(0), + C_int(abi::box_rc_field_body)]) } ty::ty_uniq(_) { fail "uniq lval translation unimplemented" } ty::ty_res(_, _, _) { - sub.bcx.build.InBoundsGEP(sub.val, ~[C_int(0), C_int(1)]) + sub.bcx.build.InBoundsGEP(sub.val, [C_int(0), C_int(1)]) } ty::ty_tag(_, _) { let ety = ty::expr_ty(ccx.tcx, e); @@ -4147,9 +4108,9 @@ fn int_cast(bcx: &@block_ctxt, lldsttype: TypeRef, llsrctype: TypeRef, let dstsz = llvm::LLVMGetIntTypeWidth(lldsttype); ret if dstsz == srcsz { bcx.build.BitCast(llsrc, lldsttype) - } else if (srcsz > dstsz) { + } else if srcsz > dstsz { bcx.build.TruncOrBitCast(llsrc, lldsttype) - } else if (signed) { + } else if signed { bcx.build.SExtOrBitCast(llsrc, lldsttype) } else { bcx.build.ZExtOrBitCast(llsrc, lldsttype) }; } @@ -4160,7 +4121,7 @@ fn float_cast(bcx: &@block_ctxt, lldsttype: TypeRef, llsrctype: TypeRef, let dstsz = lib::llvm::float_width(lldsttype); ret if dstsz > srcsz { bcx.build.FPExt(llsrc, lldsttype) - } else if (srcsz > dstsz) { + } else if srcsz > dstsz { bcx.build.FPTrunc(llsrc, lldsttype) } else { llsrc }; } @@ -4177,9 +4138,9 @@ fn trans_cast(cx: &@block_ctxt, e: &@ast::expr, id: ast::node_id) -> result { fn t_kind(tcx: &ty::ctxt, t: ty::t) -> kind { ret if ty::type_is_fp(tcx, t) { float - } else if (ty::type_is_native(tcx, t)) { + } else if ty::type_is_native(tcx, t) { native_ - } else if (ty::type_is_integral(tcx, t)) { + } else if ty::type_is_integral(tcx, t) { integral } else { other }; } @@ -4223,7 +4184,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, outgoing_fty: &ty::t, args: &[option::t<@ast::expr>], env_ty: &ty::t, ty_param_count: uint, target_fn: &option::t<ValueRef>) -> - {val: ValueRef, ty: TypeRef} { + {val: ValueRef, ty: TypeRef} { // Here we're not necessarily constructing a thunk in the sense of // "function with no arguments". The result of compiling 'bind f(foo, @@ -4281,22 +4242,23 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, // creating. (In our running example, target is the function f.) Pick // out the pointer to the target function from the environment. The // target function lives in the first binding spot. - let (lltarget, starting_idx) = alt target_fn { - some(lltarget) { (lltarget, 0) } - none. { - let lltarget = - GEP_tup_like(bcx, closure_ty, llclosure, - ~[0, abi::box_rc_field_body, - abi::closure_elt_bindings, 0]); - bcx = lltarget.bcx; - (lltarget.val, 1) - } - }; + let (lltarget, starting_idx) = + alt target_fn { + some(lltarget) { (lltarget, 0) } + none. { + let lltarget = + GEP_tup_like(bcx, closure_ty, llclosure, + [0, abi::box_rc_field_body, + abi::closure_elt_bindings, 0]); + bcx = lltarget.bcx;; + (lltarget.val, 1) + } + }; // And then, pick out the target function's own environment. That's what // we'll use as the environment the thunk gets. let lltargetclosure = - bcx.build.GEP(lltarget, ~[C_int(0), C_int(abi::fn_field_box)]); + bcx.build.GEP(lltarget, [C_int(0), C_int(abi::fn_field_box)]); lltargetclosure = bcx.build.Load(lltargetclosure); // Get f's return type, which will also be the return type of the entire @@ -4315,19 +4277,19 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, } // Set up the three implicit arguments to the thunk. - let llargs: [ValueRef] = ~[llretptr, fcx.lltaskptr, lltargetclosure]; + let llargs: [ValueRef] = [llretptr, fcx.lltaskptr, lltargetclosure]; // Copy in the type parameters. let i: uint = 0u; while i < ty_param_count { let lltyparam_ptr = GEP_tup_like(copy_args_bcx, closure_ty, llclosure, - ~[0, abi::box_rc_field_body, - abi::closure_elt_ty_params, i as int]); + [0, abi::box_rc_field_body, + abi::closure_elt_ty_params, i as int]); copy_args_bcx = lltyparam_ptr.bcx; let td = copy_args_bcx.build.Load(lltyparam_ptr.val); - llargs += ~[td]; - fcx.lltydescs += ~[td]; + llargs += [td]; + fcx.lltydescs += [td]; i += 1u; } @@ -4337,25 +4299,26 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, let llout_arg_tys: [TypeRef] = type_of_explicit_args(cx.ccx, sp, outgoing_args); for arg: option::t<@ast::expr> in args { - let out_arg = outgoing_args.(outgoing_arg_index); - let llout_arg_ty = llout_arg_tys.(outgoing_arg_index); + let out_arg = outgoing_args[outgoing_arg_index]; + let llout_arg_ty = llout_arg_tys[outgoing_arg_index]; let is_val = out_arg.mode == ty::mo_val; alt arg { + // Arg provided at binding time; thunk copies it from // closure. some(e) { let e_ty = ty::expr_ty(cx.ccx.tcx, e); let bound_arg = GEP_tup_like(bcx, closure_ty, llclosure, - ~[0, abi::box_rc_field_body, - abi::closure_elt_bindings, b]); + [0, abi::box_rc_field_body, + abi::closure_elt_bindings, b]); bcx = bound_arg.bcx; let val = bound_arg.val; // If the type is parameterized, then we need to cast the // type we actually have to the parameterized out type. if ty::type_contains_params(cx.ccx.tcx, out_arg.ty) { - let ty = if is_val - { T_ptr(llout_arg_ty) } else { llout_arg_ty }; + let ty = + if is_val { T_ptr(llout_arg_ty) } else { llout_arg_ty }; val = bcx.build.PointerCast(val, ty); } if is_val { @@ -4367,14 +4330,16 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, val = bcx.build.Load(val); } } - llargs += ~[val]; + llargs += [val]; b += 1; } + // Arg will be provided when the thunk is invoked. none. { let arg: ValueRef = llvm::LLVMGetParam(llthunk, a); if ty::type_contains_params(cx.ccx.tcx, out_arg.ty) { + // If the argument was passed by value and isn't a // pointer type, we need to spill it to an alloca in // order to do a pointer cast. Argh. @@ -4382,11 +4347,9 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, let argp = do_spill(bcx, arg); argp = bcx.build.PointerCast(argp, T_ptr(llout_arg_ty)); arg = bcx.build.Load(argp); - } else { - arg = bcx.build.PointerCast(arg, llout_arg_ty); - } + } else { arg = bcx.build.PointerCast(arg, llout_arg_ty); } } - llargs += ~[arg]; + llargs += [arg]; a += 1u; } } @@ -4394,7 +4357,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: &ty::t, } let lltargetfn = - bcx.build.GEP(lltarget, ~[C_int(0), C_int(abi::fn_field_code)]); + bcx.build.GEP(lltarget, [C_int(0), C_int(abi::fn_field_code)]); // Cast the outgoing function to the appropriate type. // This is necessary because the type of the function that we have @@ -4417,11 +4380,10 @@ fn trans_bind(cx: &@block_ctxt, f: &@ast::expr, } fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result, - args: &[option::t<@ast::expr>], id: ast::node_id) -> - result { - let bound: [@ast::expr] = ~[]; + args: &[option::t<@ast::expr>], id: ast::node_id) -> result { + let bound: [@ast::expr] = []; for argopt: option::t<@ast::expr> in args { - alt argopt { none. { } some(e) { bound += ~[e]; } } + alt argopt { none. { } some(e) { bound += [e]; } } } // Figure out which tydescs we need to pass, if any. @@ -4429,7 +4391,7 @@ fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result, let outgoing_fty_real; // the type with typarams still in it let lltydescs: [ValueRef]; alt f_res.generic { - none. { outgoing_fty_real = outgoing_fty; lltydescs = ~[]; } + none. { outgoing_fty_real = outgoing_fty; lltydescs = []; } some(ginfo) { lazily_emit_all_generic_info_tydesc_glues(cx, ginfo); outgoing_fty_real = ginfo.item_type; @@ -4447,51 +4409,48 @@ fn trans_bind_1(cx: &@block_ctxt, f: &@ast::expr, f_res: &lval_result, // Arrange for the bound function to live in the first binding spot // if the function is not statically known. - let (bound_tys, bound_vals, target_res) = if f_res.is_mem { - // Cast the function we are binding to be the type that the closure - // will expect it to have. The type the closure knows about has the - // type parameters substituted with the real types. - let llclosurety = T_ptr(type_of(bcx_ccx(cx), cx.sp, outgoing_fty)); - let src_loc = bcx.build.PointerCast(f_res.res.val, llclosurety); - let bound_f = {res: {bcx: bcx, val: src_loc} with f_res}; - (~[outgoing_fty], ~[bound_f], none) - } else { - (~[], ~[], some(f_res.res.val)) - }; + let (bound_tys, bound_vals, target_res) = + if f_res.is_mem { + // Cast the function we are binding to be the type that the + // closure will expect it to have. The type the closure knows + // about has the type parameters substituted with the real types. + let llclosurety = + T_ptr(type_of(bcx_ccx(cx), cx.sp, outgoing_fty)); + let src_loc = bcx.build.PointerCast(f_res.res.val, llclosurety); + let bound_f = {res: {bcx: bcx, val: src_loc} with f_res}; + ([outgoing_fty], [bound_f], none) + } else { ([], [], some(f_res.res.val)) }; // Translate the bound expressions. for e: @ast::expr in bound { let lv = trans_lval(bcx, e); bcx = lv.res.bcx; - bound_vals += ~[lv]; - bound_tys += ~[ty::expr_ty(bcx_tcx(cx), e)]; + bound_vals += [lv]; + bound_tys += [ty::expr_ty(bcx_tcx(cx), e)]; } // Actually construct the closure - let closure = build_environment(bcx, lltydescs, - bound_tys, bound_vals, true); + let closure = + build_environment(bcx, lltydescs, bound_tys, bound_vals, true); bcx = closure.bcx; // Make thunk // The type of the entire bind expression. let pair_ty = node_id_type(bcx_ccx(cx), id); let llthunk = - trans_bind_thunk(cx.fcx.lcx, cx.sp, pair_ty, outgoing_fty_real, - args, closure.ptrty, ty_param_count, - target_res); + trans_bind_thunk(cx.fcx.lcx, cx.sp, pair_ty, outgoing_fty_real, args, + closure.ptrty, ty_param_count, target_res); // Construct the function pair - let pair_v = create_real_fn_pair(bcx, llthunk.ty, llthunk.val, - closure.ptr); + let pair_v = + create_real_fn_pair(bcx, llthunk.ty, llthunk.val, closure.ptr); add_clean_temp(cx, pair_v, pair_ty); ret rslt(bcx, pair_v); } -fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, - lldestty0: TypeRef, - to_zero: &mutable[{v:ValueRef, t: ty::t}], - to_revoke: &mutable[ValueRef], - e: &@ast::expr) -> result { +fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, lldestty0: TypeRef, + to_zero: &mutable [{v: ValueRef, t: ty::t}], + to_revoke: &mutable [ValueRef], e: &@ast::expr) -> result { let ccx = bcx_ccx(cx); let e_ty = ty::expr_ty(ccx.tcx, e); let is_bot = ty::type_is_bot(ccx.tcx, e_ty); @@ -4504,12 +4463,12 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, // be inspected. It's important for the value // to have type lldestty0 (the callee's expected type). val = llvm::LLVMGetUndef(lldestty0); - } else if (arg.mode == ty::mo_val) { + } else if arg.mode == ty::mo_val { if ty::type_owns_heap_mem(ccx.tcx, e_ty) { let dst = alloc_ty(bcx, e_ty); val = dst.val; bcx = move_val_if_temp(dst.bcx, INIT, val, lv, e_ty).bcx; - } else if (lv.is_mem) { + } else if lv.is_mem { val = load_if_immediate(bcx, val, e_ty); bcx = copy_ty(bcx, val, e_ty).bcx; } else { @@ -4529,7 +4488,7 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, bcx = copy_ty(bcx, val, e_ty).bcx; } else { revoke_clean(bcx, val); } } - } else if (type_is_immediate(ccx, e_ty) && !lv.is_mem) { + } else if type_is_immediate(ccx, e_ty) && !lv.is_mem { val = do_spill(bcx, val); } @@ -4549,12 +4508,10 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, // Collect arg for later if it happens to be one we've moving out. if arg.mode == ty::mo_move { if lv.is_mem { - // Use actual ty, not declared ty -- anything else doesn't make sense - // if declared ty is a ty param - to_zero += ~[{v: lv.res.val, t: e_ty}]; - } else { - to_revoke += ~[lv.res.val]; - } + // Use actual ty, not declared ty -- anything else doesn't make + // sense if declared ty is a ty param + to_zero += [{v: lv.res.val, t: e_ty}]; + } else { to_revoke += [lv.res.val]; } } ret rslt(bcx, val); } @@ -4572,14 +4529,14 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef, {bcx: @block_ctxt, args: [ValueRef], retslot: ValueRef, - to_zero: [{v:ValueRef, t: ty::t}], - to_revoke: [ValueRef] } { + to_zero: [{v: ValueRef, t: ty::t}], + to_revoke: [ValueRef]} { let args: [ty::arg] = ty::ty_fn_args(bcx_tcx(cx), fn_ty); - let llargs: [ValueRef] = ~[]; - let lltydescs: [ValueRef] = ~[]; - let to_zero = ~[]; - let to_revoke = ~[]; + let llargs: [ValueRef] = []; + let lltydescs: [ValueRef] = []; + let to_zero = []; + let to_revoke = []; let bcx: @block_ctxt = cx; // Arg 0: Output pointer. @@ -4589,8 +4546,11 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef, if bcx.build.is_terminated() { // This means an earlier arg was divergent. // So this arg can't be evaluated. - ret {bcx: bcx, args: ~[], retslot: C_nil(), - to_zero: to_zero, to_revoke: to_revoke}; + ret {bcx: bcx, + args: [], + retslot: C_nil(), + to_zero: to_zero, + to_revoke: to_revoke}; } let retty = ty::ty_fn_ret(bcx_tcx(cx), fn_ty); let llretslot_res = alloc_ty(bcx, retty); @@ -4605,21 +4565,21 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef, } _ { } } - if (ty::type_contains_params(bcx_tcx(cx), retty)) { + if ty::type_contains_params(bcx_tcx(cx), retty) { // It's possible that the callee has some generic-ness somewhere in // its return value -- say a method signature within an obj or a fn // type deep in a structure -- which the caller has a concrete view // of. If so, cast the caller's view of the restlot to the callee's // view, for the sake of making a type-compatible call. let llretty = T_ptr(type_of_inner(bcx_ccx(bcx), bcx.sp, retty)); - llargs += ~[cx.build.PointerCast(llretslot, llretty)]; - } else { llargs += ~[llretslot]; } + llargs += [cx.build.PointerCast(llretslot, llretty)]; + } else { llargs += [llretslot]; } // Arg 1: task pointer. - llargs += ~[bcx.fcx.lltaskptr]; + llargs += [bcx.fcx.lltaskptr]; // Arg 2: Env (closure-bindings / self-obj) - llargs += ~[llenv]; + llargs += [llenv]; // Args >3: ty_params ... llargs += lltydescs; @@ -4628,12 +4588,13 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef, alt lliterbody { none. { } some(lli) { - let lli = if (ty::type_contains_params(bcx_tcx(cx), retty)) { - let body_ty = ty::mk_iter_body_fn(bcx_tcx(cx), retty); - let body_llty = type_of_inner(bcx_ccx(cx), cx.sp, body_ty); - bcx.build.PointerCast(lli, T_ptr(body_llty)) - } else { lli }; - llargs += ~[cx.build.Load(lli)]; + let lli = + if ty::type_contains_params(bcx_tcx(cx), retty) { + let body_ty = ty::mk_iter_body_fn(bcx_tcx(cx), retty); + let body_llty = type_of_inner(bcx_ccx(cx), cx.sp, body_ty); + bcx.build.PointerCast(lli, T_ptr(body_llty)) + } else { lli }; + llargs += [cx.build.Load(lli)]; } } @@ -4650,14 +4611,17 @@ fn trans_args(cx: &@block_ctxt, llenv: ValueRef, // So this arg can't be evaluated. break; } - let r = trans_arg_expr(bcx, args.(i), arg_tys.(i), - to_zero, to_revoke, e); + let r = + trans_arg_expr(bcx, args[i], arg_tys[i], to_zero, to_revoke, e); bcx = r.bcx; - llargs += ~[r.val]; + llargs += [r.val]; i += 1u; } - ret {bcx: bcx, args: llargs, retslot: llretslot, - to_zero: to_zero, to_revoke: to_revoke}; + ret {bcx: bcx, + args: llargs, + retslot: llretslot, + to_zero: to_zero, + to_revoke: to_revoke}; } fn trans_call(cx: &@block_ctxt, f: &@ast::expr, @@ -4695,10 +4659,10 @@ fn trans_call(cx: &@block_ctxt, f: &@ast::expr, fn_ty = res.ty; let pair = res.val; - faddr = bcx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_code)]); + faddr = bcx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_code)]); faddr = bcx.build.Load(faddr); let llclosure = - bcx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_box)]); + bcx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_box)]); llenv = bcx.build.Load(llclosure); } } @@ -4742,18 +4706,16 @@ fn trans_call(cx: &@block_ctxt, f: &@ast::expr, } // Forget about anything we moved out. - for {v,t}: {v: ValueRef, t: ty::t} in args_res.to_zero { + for {v: v, t: t}: {v: ValueRef, t: ty::t} in args_res.to_zero { zero_alloca(bcx, v, t) } - for v: ValueRef in args_res.to_revoke { - revoke_clean(bcx, v) - } + for v: ValueRef in args_res.to_revoke { revoke_clean(bcx, v) } } ret rslt(bcx, retval); } -fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id) - -> result { +fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id) -> + result { let bcx = cx; let t = node_id_type(bcx.fcx.lcx.ccx, id); let tup_res = alloc_ty(bcx, t); @@ -4765,7 +4727,7 @@ fn trans_tup(cx: &@block_ctxt, elts: &[@ast::expr], id: ast::node_id) let e_ty = ty::expr_ty(cx.fcx.lcx.ccx.tcx, e); let src = trans_lval(bcx, e); bcx = src.res.bcx; - let dst_res = GEP_tup_like(bcx, t, tup_val, ~[0, i]); + let dst_res = GEP_tup_like(bcx, t, tup_val, [0, i]); bcx = move_val_if_temp(dst_res.bcx, INIT, dst_res.val, src, e_ty).bcx; i += 1; } @@ -4801,22 +4763,22 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) -> bcx.build.Store(lllen, bcx.build.InBoundsGEP(llvecptr, - ~[C_int(0), - C_uint(abi::ivec_elt_len)])); + [C_int(0), + C_uint(abi::ivec_elt_len)])); bcx.build.Store(llalen, bcx.build.InBoundsGEP(llvecptr, - ~[C_int(0), - C_uint(abi::ivec_elt_alen)])); + [C_int(0), + C_uint(abi::ivec_elt_alen)])); llfirsteltptr = bcx.build.InBoundsGEP(llvecptr, - ~[C_int(0), C_uint(abi::ivec_elt_elems), - C_int(0)]); + [C_int(0), C_uint(abi::ivec_elt_elems), + C_int(0)]); } else { // Heap case. - let stub_z = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)]; - let stub_a = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]; - let stub_p = ~[C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; + let stub_z = [C_int(0), C_uint(abi::ivec_heap_stub_elt_zero)]; + let stub_a = [C_int(0), C_uint(abi::ivec_heap_stub_elt_alen)]; + let stub_p = [C_int(0), C_uint(abi::ivec_heap_stub_elt_ptr)]; let llstubty = T_ivec_heap(llunitty); let llstubptr = bcx.build.PointerCast(llvecptr, T_ptr(llstubty)); bcx.build.Store(C_int(0), bcx.build.InBoundsGEP(llstubptr, stub_z)); @@ -4837,13 +4799,13 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) -> let llheapptr = rslt.val; bcx.build.Store(llheapptr, bcx.build.InBoundsGEP(llstubptr, stub_p)); - let heap_l = ~[C_int(0), C_uint(abi::ivec_heap_elt_len)]; + let heap_l = [C_int(0), C_uint(abi::ivec_heap_elt_len)]; bcx.build.Store(lllen, bcx.build.InBoundsGEP(llheapptr, heap_l)); llfirsteltptr = bcx.build.InBoundsGEP(llheapptr, - ~[C_int(0), - C_uint(abi::ivec_heap_elt_elems), - C_int(0)]); + [C_int(0), + C_uint(abi::ivec_heap_elt_elems), + C_int(0)]); } } // Store the individual elements. @@ -4856,9 +4818,9 @@ fn trans_ivec(bcx: @block_ctxt, args: &[@ast::expr], id: ast::node_id) -> if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) { lleltptr = bcx.build.InBoundsGEP(llfirsteltptr, - ~[bcx.build.Mul(C_uint(i), unit_sz)]); + [bcx.build.Mul(C_uint(i), unit_sz)]); } else { - lleltptr = bcx.build.InBoundsGEP(llfirsteltptr, ~[C_uint(i)]); + lleltptr = bcx.build.InBoundsGEP(llfirsteltptr, [C_uint(i)]); } bcx = move_val_if_temp(bcx, INIT, lleltptr, lv, unit_ty).bcx; i += 1u; @@ -4884,11 +4846,11 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field], base_val = base_res.val; } } - let ty_fields: [ty::field] = ~[]; + let ty_fields: [ty::field] = []; alt ty::struct(bcx_tcx(cx), t) { ty::ty_rec(flds) { ty_fields = flds; } } for tf: ty::field in ty_fields { let e_ty = tf.mt.ty; - let dst_res = GEP_tup_like(bcx, t, rec_val, ~[0, i]); + let dst_res = GEP_tup_like(bcx, t, rec_val, [0, i]); bcx = dst_res.bcx; let expr_provided = false; for f: ast::field in fields { @@ -4902,7 +4864,7 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field], } } if !expr_provided { - let src_res = GEP_tup_like(bcx, t, base_val, ~[0, i]); + let src_res = GEP_tup_like(bcx, t, base_val, [0, i]); src_res = rslt(src_res.bcx, load_if_immediate(bcx, src_res.val, e_ty)); bcx = @@ -4928,12 +4890,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> } ast::expr_binary(op, x, y) { ret trans_binary(cx, op, x, y); } ast::expr_if(cond, thn, els) { - ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, - e.id, output); + ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, e.id, + output); } ast::expr_if_check(cond, thn, els) { - ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, - e.id, output); + ret with_out_method(bind trans_if(cx, cond, thn, els, _), cx, e.id, + output); } ast::expr_ternary(_, _, _) { ret trans_expr_out(cx, ast::ternary_to_if(e), output); @@ -4945,8 +4907,8 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> ast::expr_while(cond, body) { ret trans_while(cx, cond, body); } ast::expr_do_while(body, cond) { ret trans_do_while(cx, body, cond); } ast::expr_alt(expr, arms) { - ret with_out_method(bind trans_alt::trans_alt(cx, expr, arms, _), - cx, e.id, output); + ret with_out_method(bind trans_alt::trans_alt(cx, expr, arms, _), cx, + e.id, output); } ast::expr_fn(f) { let ccx = bcx_ccx(cx); @@ -4958,12 +4920,14 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let fn_res = trans_closure(some(cx), some(llfnty), sub_cx, e.span, f, llfn, - none, ~[], e.id); + none, [], e.id); let fn_pair = alt fn_res { some(fn_pair) { fn_pair } - none. { {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false), - bcx: cx} } + none. { + {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false), + bcx: cx} + } }; ret rslt(fn_pair.bcx, fn_pair.fn_pair); } @@ -5040,14 +5004,14 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> rhs_res.val); } ret trans_evec_append(rhs_res.bcx, t, lhs_res.res.val, - rhs_res.val); + rhs_res.val); } _ { } } } let lhs_val = load_if_immediate(rhs_res.bcx, lhs_res.res.val, t); - let v = trans_eager_binop(rhs_res.bcx, op, lhs_val, t, - rhs_res.val, t); + let v = + trans_eager_binop(rhs_res.bcx, op, lhs_val, t, rhs_res.val, t); // FIXME: calculate copy init-ness in typestate. // This is always a temporary, so can always be safely moved let move_res = @@ -5060,9 +5024,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> ret trans_call(cx, f, none::<ValueRef>, args, e.id); } ast::expr_cast(val, _) { ret trans_cast(cx, val, e.id); } - ast::expr_vec(args, _) { - ret trans_ivec(cx, args, e.id); - } + ast::expr_vec(args, _) { ret trans_ivec(cx, args, e.id); } ast::expr_rec(args, base) { ret trans_rec(cx, args, base, e.id); } ast::expr_tup(args) { ret trans_tup(cx, args, e.id); } ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug("unexpanded macro"); } @@ -5089,7 +5051,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> let els = rslt(else_cx, C_nil()); cx.build.CondBr(cond, then_cx.llbb, else_cx.llbb); - ret rslt(join_branches(cx, ~[check_res, els]), C_nil()); + ret rslt(join_branches(cx, [check_res, els]), C_nil()); } ast::expr_break. { ret trans_break(e.span, cx); } ast::expr_cont. { ret trans_cont(e.span, cx); } @@ -5116,7 +5078,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) -> ret rslt(sub.res.bcx, v); } -fn with_out_method(work: fn(&out_method) -> result , cx: @block_ctxt, +fn with_out_method(work: fn(&out_method) -> result, cx: @block_ctxt, id: ast::node_id, outer_output: &out_method) -> result { let ccx = bcx_ccx(cx); if outer_output != return { @@ -5202,7 +5164,7 @@ fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result { let llval_i8 = log_bcx.build.PointerCast(llvalptr, T_ptr(T_i8())); log_bcx.build.Call(bcx_ccx(log_bcx).upcalls.log_type, - ~[log_bcx.fcx.lltaskptr, r.val, llval_i8, C_int(lvl)]); + [log_bcx.fcx.lltaskptr, r.val, llval_i8, C_int(lvl)]); log_bcx = trans_block_cleanups(log_bcx, log_cx); log_bcx.build.Br(after_cx.llbb); @@ -5233,7 +5195,7 @@ fn trans_fail_expr(cx: &@block_ctxt, sp_opt: &option::t<span>, if ty::type_is_str(tcx, e_ty) { let elt = bcx.build.GEP(expr_res.val, - ~[C_int(0), C_int(abi::vec_elt_data)]); + [C_int(0), C_int(abi::vec_elt_data)]); ret trans_fail_value(bcx, sp_opt, elt); } else { bcx_ccx(cx).sess.span_bug(expr.span, @@ -5266,7 +5228,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>, } let V_str = cx.build.PointerCast(V_fail_str, T_ptr(T_i8())); V_filename = cx.build.PointerCast(V_filename, T_ptr(T_i8())); - let args = ~[cx.fcx.lltaskptr, V_str, V_filename, C_int(V_line)]; + let args = [cx.fcx.lltaskptr, V_str, V_filename, C_int(V_line)]; cx.build.Call(bcx_ccx(cx).upcalls._fail, args); cx.build.Unreachable(); ret rslt(cx, C_nil()); @@ -5279,26 +5241,26 @@ fn trans_put(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { some(lli) { let slot = alloca(cx, val_ty(lli)); cx.build.Store(lli, slot); - llcallee = cx.build.GEP(slot, ~[C_int(0), C_int(abi::fn_field_code)]); + llcallee = cx.build.GEP(slot, [C_int(0), C_int(abi::fn_field_code)]); llcallee = cx.build.Load(llcallee); - llenv = cx.build.GEP(slot, ~[C_int(0), C_int(abi::fn_field_box)]); + llenv = cx.build.GEP(slot, [C_int(0), C_int(abi::fn_field_box)]); llenv = cx.build.Load(llenv); } } let bcx = cx; let dummy_retslot = alloca(bcx, T_nil()); - let llargs: [ValueRef] = ~[dummy_retslot, cx.fcx.lltaskptr, llenv]; + let llargs: [ValueRef] = [dummy_retslot, cx.fcx.lltaskptr, llenv]; alt e { none. { } some(x) { let e_ty = ty::expr_ty(bcx_tcx(cx), x); let arg = {mode: ty::mo_alias(false), ty: e_ty}; - let arg_tys = type_of_explicit_args(bcx_ccx(cx), x.span, ~[arg]); - let z = ~[]; - let k = ~[]; - let r = trans_arg_expr(bcx, arg, arg_tys.(0), z, k, x); + let arg_tys = type_of_explicit_args(bcx_ccx(cx), x.span, [arg]); + let z = []; + let k = []; + let r = trans_arg_expr(bcx, arg, arg_tys[0], z, k, x); bcx = r.bcx; - llargs += ~[r.val]; + llargs += [r.val]; } } bcx.build.FastCall(llcallee, llargs); @@ -5378,14 +5340,16 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { let t = ty::expr_ty(bcx_tcx(cx), x); let lv = trans_lval(cx, x); bcx = lv.res.bcx; - let is_local = alt x.node { - ast::expr_path(p) { - alt bcx_tcx(bcx).def_map.get(x.id) { - ast::def_local(_) { true } _ { false } - } - } - _ { false } - }; + let is_local = + alt x.node { + ast::expr_path(p) { + alt bcx_tcx(bcx).def_map.get(x.id) { + ast::def_local(_) { true } + _ { false } + } + } + _ { false } + }; if is_local { bcx = move_val(bcx, INIT, cx.fcx.llretptr, lv, t).bcx; } else { @@ -5412,9 +5376,7 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result { ret rslt(new_sub_block_ctxt(bcx, "ret.unreachable"), C_nil()); } -fn build_return(bcx: &@block_ctxt) { - bcx.build.Br(bcx_fcx(bcx).llreturn); -} +fn build_return(bcx: &@block_ctxt) { bcx.build.Br(bcx_fcx(bcx).llreturn); } fn trans_be(cx: &@block_ctxt, e: &@ast::expr) -> result { // FIXME: This should be a typestate precondition @@ -5450,8 +5412,9 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result { } _ { bcx = zero_alloca(bcx, llptr, ty).bcx; } } - bcx = trans_alt::bind_irrefutable_pat(bcx, local.node.pat, llptr, - bcx.fcx.lllocals, false); + bcx = + trans_alt::bind_irrefutable_pat(bcx, local.node.pat, llptr, + bcx.fcx.lllocals, false); ret rslt(bcx, llptr); } @@ -5494,7 +5457,7 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result { // next three functions instead. fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind, name: &str) -> @block_ctxt { - let cleanups: [cleanup] = ~[]; + let cleanups: [cleanup] = []; let s = str::buf(""); let held_name; //HACK for str::buf, which doesn't keep its value alive if cx.lcx.ccx.sess.get_opts().save_temps || @@ -5538,7 +5501,7 @@ fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt { } fn new_raw_block_ctxt(fcx: &@fn_ctxt, llbb: BasicBlockRef) -> @block_ctxt { - let cleanups: [cleanup] = ~[]; + let cleanups: [cleanup] = []; ret @{llbb: llbb, build: new_builder(llbb), parent: parent_none, @@ -5565,7 +5528,7 @@ fn trans_block_cleanups(cx: &@block_ctxt, cleanup_cx: &@block_ctxt) -> let i = std::vec::len::<cleanup>(cleanup_cx.cleanups); while i > 0u { i -= 1u; - let c = cleanup_cx.cleanups.(i); + let c = cleanup_cx.cleanups[i]; alt c { clean(cfn) { bcx = cfn(bcx).bcx; } clean_temp(_, cfn) { bcx = cfn(bcx).bcx; } @@ -5576,16 +5539,17 @@ fn trans_block_cleanups(cx: &@block_ctxt, cleanup_cx: &@block_ctxt) -> fn trans_fn_cleanups(fcx: &@fn_ctxt, build: &lib::llvm::builder) { alt fcx.llobstacktoken { - some(lltoken_) { - let lltoken = lltoken_; // satisfy alias checker - build.Call(fcx_ccx(fcx).upcalls.dynastack_free, ~[fcx.lltaskptr, - lltoken]); - } - none. { /* nothing to do */ } + some(lltoken_) { + let lltoken = lltoken_; // satisfy alias checker + build.Call(fcx_ccx(fcx).upcalls.dynastack_free, + [fcx.lltaskptr, lltoken]); + } + none. {/* nothing to do */ } } } iter block_locals(b: &ast::blk) -> @ast::local { + // FIXME: putting from inside an iter block doesn't work, so we can't // use the index here. for s: @ast::stmt in b.node.stmts { @@ -5604,7 +5568,7 @@ iter block_locals(b: &ast::blk) -> @ast::local { } fn llstaticallocas_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt { - let cleanups: [cleanup] = ~[]; + let cleanups: [cleanup] = []; ret @{llbb: fcx.llstaticallocas, build: new_builder(fcx.llstaticallocas), parent: parent_none, @@ -5615,7 +5579,7 @@ fn llstaticallocas_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt { } fn llderivedtydescs_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt { - let cleanups: [cleanup] = ~[]; + let cleanups: [cleanup] = []; ret @{llbb: fcx.llderivedtydescs, build: new_builder(fcx.llderivedtydescs), parent: parent_none, @@ -5638,9 +5602,7 @@ fn alloc_ty(cx: &@block_ctxt, t: &ty::t) -> result { let n = size_of(llderivedtydescs_block_ctxt(bcx.fcx), t); bcx.fcx.llderivedtydescs = n.bcx.llbb; val = array_alloca(bcx, T_i8(), n.val); - } else { - val = alloca(bcx, type_of(bcx_ccx(cx), cx.sp, t)); - } + } else { val = alloca(bcx, type_of(bcx_ccx(cx), cx.sp, t)); } // NB: since we've pushed all size calculations in this // function up to the alloca block, we actually return the // block passed into us unmodified; it doesn't really @@ -5648,7 +5610,7 @@ fn alloc_ty(cx: &@block_ctxt, t: &ty::t) -> result { // past caller conventions and may well make sense again, // so we leave it as-is. - if (bcx_tcx(cx).sess.get_opts().do_gc) { + if bcx_tcx(cx).sess.get_opts().do_gc { bcx = gc::add_gc_root(bcx, val, t); } @@ -5664,7 +5626,7 @@ fn alloc_local(cx: &@block_ctxt, local: &@ast::local) -> result { llvm::LLVMSetValueName(r.val, str::buf(ident)); } } - _ {} + _ { } } ret r; } @@ -5728,11 +5690,11 @@ fn trans_block(cx: &@block_ctxt, b: &ast::blk, output: &out_method) -> } fn new_local_ctxt(ccx: &@crate_ctxt) -> @local_ctxt { - let pth: [str] = ~[]; + let pth: [str] = []; ret @{path: pth, - module_path: ~[ccx.link_meta.name], - obj_typarams: ~[], - obj_fields: ~[], + module_path: [ccx.link_meta.name], + obj_typarams: [], + obj_fields: [], ccx: ccx}; } @@ -5792,7 +5754,7 @@ fn new_fn_ctxt_w_id(cx: @local_ctxt, sp: &span, llfndecl: ValueRef, llobjfields: llobjfields, lllocals: lllocals, llupvars: llupvars, - mutable lltydescs: ~[], + mutable lltydescs: [], derived_tydescs: derived_tydescs, id: id, sp: sp, @@ -5831,7 +5793,7 @@ fn create_llargs_for_fn_args(cx: &@fn_ctxt, proto: ast::proto, for tp: ast::ty_param in ty_params { let llarg = llvm::LLVMGetParam(cx.llfn, arg_n); assert (llarg as int != 0); - cx.lltydescs += ~[llarg]; + cx.lltydescs += [llarg]; arg_n += 1u; i += 1u; } @@ -5868,8 +5830,9 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, args: &[ast::arg]) { alt bcx.fcx.llargs.find(aarg.id) { some(x) { argval = x; } _ { - bcx_ccx(bcx).sess.span_fatal - (aarg.ty.span, "unbound arg ID in copy_args_to_allocas"); + bcx_ccx(bcx).sess.span_fatal( + aarg.ty.span, + "unbound arg ID in copy_args_to_allocas"); } } let a = do_spill(bcx, argval); @@ -5890,11 +5853,12 @@ fn add_cleanups_for_args(bcx: &@block_ctxt, args: &[ast::arg], alt bcx.fcx.llargs.find(aarg.id) { some(x) { argval = x; } _ { - bcx_ccx(bcx).sess.span_fatal - (aarg.ty.span, "unbound arg ID in add_cleanups_for_args"); + bcx_ccx(bcx).sess.span_fatal( + aarg.ty.span, + "unbound arg ID in add_cleanups_for_args"); } } - add_clean(bcx, argval, arg_tys.(arg_n).ty); + add_clean(bcx, argval, arg_tys[arg_n].ty); } arg_n += 1u; } @@ -5913,9 +5877,9 @@ fn arg_tys_of_fn(ccx: &@crate_ctxt, id: ast::node_id) -> [ty::arg] { fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) { let bcx = llstaticallocas_block_ctxt(fcx); - let field_tys: [ty::t] = ~[]; + let field_tys: [ty::t] = []; for f: ast::obj_field in bcx.fcx.lcx.obj_fields { - field_tys += ~[node_id_type(bcx_ccx(bcx), f.id)]; + field_tys += [node_id_type(bcx_ccx(bcx), f.id)]; } // Synthesize a tuple type for the fields so that GEP_tup_like() can work // its magic. @@ -5924,13 +5888,13 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) { let n_typarams = std::vec::len::<ast::ty_param>(bcx.fcx.lcx.obj_typarams); let llobj_box_ty: TypeRef = T_obj_ptr(*bcx_ccx(bcx), n_typarams); let box_cell = - bcx.build.GEP(llself.v, ~[C_int(0), C_int(abi::obj_field_box)]); + bcx.build.GEP(llself.v, [C_int(0), C_int(abi::obj_field_box)]); let box_ptr = bcx.build.Load(box_cell); box_ptr = bcx.build.PointerCast(box_ptr, llobj_box_ty); let obj_typarams = bcx.build.GEP(box_ptr, - ~[C_int(0), C_int(abi::box_rc_field_body), - C_int(abi::obj_body_elt_typarams)]); + [C_int(0), C_int(abi::box_rc_field_body), + C_int(abi::obj_body_elt_typarams)]); // The object fields immediately follow the type parameters, so we skip // over them to get the pointer. @@ -5947,14 +5911,14 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) { let i: int = 0; for p: ast::ty_param in fcx.lcx.obj_typarams { let lltyparam: ValueRef = - bcx.build.GEP(obj_typarams, ~[C_int(0), C_int(i)]); + bcx.build.GEP(obj_typarams, [C_int(0), C_int(i)]); lltyparam = bcx.build.Load(lltyparam); - fcx.lltydescs += ~[lltyparam]; + fcx.lltydescs += [lltyparam]; i += 1; } i = 0; for f: ast::obj_field in fcx.lcx.obj_fields { - let rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, ~[0, i]); + let rslt = GEP_tup_like(bcx, fields_tup_ty, obj_fields, [0, i]); bcx = llstaticallocas_block_ctxt(fcx); let llfield = rslt.val; fcx.llobjfields.insert(f.id, llfield); @@ -5983,8 +5947,8 @@ fn finish_fn(fcx: &@fn_ctxt, lltop: BasicBlockRef) { fn trans_closure(bcx_maybe: &option::t<@block_ctxt>, llfnty: &option::t<TypeRef>, cx: @local_ctxt, sp: &span, f: &ast::_fn, llfndecl: ValueRef, ty_self: option::t<ty::t>, - ty_params: &[ast::ty_param], id: ast::node_id) - -> option::t<{fn_pair: ValueRef, bcx: @block_ctxt}> { + ty_params: &[ast::ty_param], id: ast::node_id) -> + option::t<{fn_pair: ValueRef, bcx: @block_ctxt}> { set_uwtable(llfndecl); // Set up arguments to the function. @@ -6000,24 +5964,26 @@ fn trans_closure(bcx_maybe: &option::t<@block_ctxt>, copy_args_to_allocas(fcx, f.decl.inputs); // Figure out if we need to build a closure and act accordingly - let res = alt f.proto { - ast::proto_block. | ast::proto_closure. { - let bcx = option::get(bcx_maybe); - let upvars = get_freevars(cx.ccx.tcx, id); - - let copying = f.proto == ast::proto_closure; - let env = build_closure(bcx, upvars, copying); - load_environment(bcx, fcx, env.ptrty, upvars, copying); - - let closure = create_real_fn_pair(env.bcx, option::get(llfnty), - llfndecl, env.ptr); - if copying { - add_clean_temp(bcx, closure, node_id_type(cx.ccx, id)) - } - some({fn_pair: closure, bcx: env.bcx}) - } - _ { none } - }; + let res = + alt f.proto { + ast::proto_block. | ast::proto_closure. { + let bcx = option::get(bcx_maybe); + let upvars = get_freevars(cx.ccx.tcx, id); + + let copying = f.proto == ast::proto_closure; + let env = build_closure(bcx, upvars, copying); + load_environment(bcx, fcx, env.ptrty, upvars, copying); + + let closure = + create_real_fn_pair(env.bcx, option::get(llfnty), llfndecl, + env.ptr); + if copying { + add_clean_temp(bcx, closure, node_id_type(cx.ccx, id)) + } + some({fn_pair: closure, bcx: env.bcx}) + } + _ { none } + }; // Create the first basic block in the function and keep a handle on it to // pass to finish_fn later. @@ -6032,10 +5998,10 @@ fn trans_closure(bcx_maybe: &option::t<@block_ctxt>, // (trans_block, trans_expr, et cetera). let rslt = if !ty::type_is_nil(cx.ccx.tcx, block_ty) && - !ty::type_is_bot(cx.ccx.tcx, block_ty) && - f.proto != ast::proto_iter { - trans_block(bcx, f.body, save_in(fcx.llretptr)) - } else { trans_block(bcx, f.body, return) }; + !ty::type_is_bot(cx.ccx.tcx, block_ty) && + f.proto != ast::proto_iter { + trans_block(bcx, f.body, save_in(fcx.llretptr)) + } else { trans_block(bcx, f.body, return) }; bcx = rslt.bcx; if !is_terminated(bcx) { @@ -6087,24 +6053,23 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn, dtor.decl.inputs, ty_params); let bcx = new_top_block_ctxt(fcx); let lltop = bcx.llbb; - let arg_t = arg_tys_of_fn(cx.ccx, ctor_id).(0).ty; - let tup_t = ty::mk_tup(cx.ccx.tcx, ~[ty::mk_int(cx.ccx.tcx), arg_t]); + let arg_t = arg_tys_of_fn(cx.ccx, ctor_id)[0].ty; + let tup_t = ty::mk_tup(cx.ccx.tcx, [ty::mk_int(cx.ccx.tcx), arg_t]); let arg; - alt fcx.llargs.find(dtor.decl.inputs.(0).id) { + alt fcx.llargs.find(dtor.decl.inputs[0].id) { some(x) { arg = load_if_immediate(bcx, x, arg_t); } _ { cx.ccx.sess.span_fatal(sp, "unbound dtor decl in trans_res_ctor"); } } - let llretptr = fcx.llretptr; if ty::type_has_dynamic_size(cx.ccx.tcx, ret_t) { - let llret_t = T_ptr(T_struct(~[T_i32(), llvm::LLVMTypeOf(arg)])); + let llret_t = T_ptr(T_struct([T_i32(), llvm::LLVMTypeOf(arg)])); llretptr = bcx.build.BitCast(llretptr, llret_t); } - let dst = GEP_tup_like(bcx, tup_t, llretptr, ~[0, 1]); + let dst = GEP_tup_like(bcx, tup_t, llretptr, [0, 1]); bcx = dst.bcx; bcx = copy_val(bcx, INIT, dst.val, arg, arg_t).bcx; - let flag = GEP_tup_like(bcx, tup_t, llretptr, ~[0, 0]); + let flag = GEP_tup_like(bcx, tup_t, llretptr, [0, 0]); bcx = flag.bcx; bcx.build.Store(C_int(1), flag.val); build_return(bcx); @@ -6121,14 +6086,14 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, } // Translate variant arguments to function arguments. - let fn_args: [ast::arg] = ~[]; + let fn_args: [ast::arg] = []; let i = 0u; for varg: ast::variant_arg in variant.node.args { fn_args += - ~[{mode: ast::alias(false), - ty: varg.ty, - ident: "arg" + uint::to_str(i, 10u), - id: varg.id}]; + [{mode: ast::alias(false), + ty: varg.ty, + ident: "arg" + uint::to_str(i, 10u), + id: varg.id}]; } assert (cx.ccx.item_ids.contains_key(variant.node.id)); let llfndecl: ValueRef; @@ -6143,10 +6108,10 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, create_llargs_for_fn_args(fcx, ast::proto_fn, none::<ty::t>, ty::ret_ty_of_fn(cx.ccx.tcx, variant.node.id), fn_args, ty_params); - let ty_param_substs: [ty::t] = ~[]; + let ty_param_substs: [ty::t] = []; i = 0u; for tp: ast::ty_param in ty_params { - ty_param_substs += ~[ty::mk_param(cx.ccx.tcx, i, tp.kind)]; + ty_param_substs += [ty::mk_param(cx.ccx.tcx, i, tp.kind)]; i += 1u; } let arg_tys = arg_tys_of_fn(cx.ccx, variant.node.id); @@ -6162,9 +6127,9 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, let lltagptr = bcx.build.PointerCast(fcx.llretptr, T_opaque_tag_ptr(fcx.lcx.ccx.tn)); - let lldiscrimptr = bcx.build.GEP(lltagptr, ~[C_int(0), C_int(0)]); + let lldiscrimptr = bcx.build.GEP(lltagptr, [C_int(0), C_int(0)]); bcx.build.Store(C_int(index), lldiscrimptr); - bcx.build.GEP(lltagptr, ~[C_int(0), C_int(1)]) + bcx.build.GEP(lltagptr, [C_int(0), C_int(1)]) }; i = 0u; for va: ast::variant_arg in variant.node.args { @@ -6186,7 +6151,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id, trans_tag_variant"); } } - let arg_ty = arg_tys.(i).ty; + let arg_ty = arg_tys[i].ty; let llargval; if ty::type_is_structural(cx.ccx.tcx, arg_ty) || ty::type_has_dynamic_size(cx.ccx.tcx, arg_ty) { @@ -6262,8 +6227,8 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) { } ast::item_mod(m) { let sub_cx = - @{path: cx.path + ~[item.ident], - module_path: cx.module_path + ~[item.ident] with *cx}; + @{path: cx.path + [item.ident], + module_path: cx.module_path + [item.ident] with *cx}; trans_mod(sub_cx, m); } ast::item_tag(variants, tps) { @@ -6305,8 +6270,8 @@ fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], flav: str, fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str], _flav: str, ty_params: &[ast::ty_param], node_id: ast::node_id, node_type: ty::t) { - let llfty = type_of_fn_from_ty(ccx, sp, node_type, - std::vec::len(ty_params)); + let llfty = + type_of_fn_from_ty(ccx, sp, node_type, std::vec::len(ty_params)); alt ty::struct(ccx.tcx, node_type) { ty::ty_fn(proto, inputs, output, _, _) { llfty = @@ -6315,8 +6280,7 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str], } _ { ccx.sess.bug("decl_fn_and_pair(): fn item doesn't have fn type!"); } } - - let s: str = mangle_internal_name_by_path(ccx, path); + let s: str = mangle_internal_name_by_path(ccx, path); let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod, s, llfty); // Declare the global constant pair that points to it. @@ -6324,45 +6288,36 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str], register_fn_pair(ccx, ps, llfty, llfn, node_id); let is_main: bool = is_main_name(path) && !ccx.sess.get_opts().library; - if is_main { - create_main_wrapper(ccx, sp, llfn, node_type); - } + if is_main { create_main_wrapper(ccx, sp, llfn, node_type); } } // Create a _rust_main(args: [str]) function which will be called from the // runtime rust_start function -fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, - main_llfn: ValueRef, main_node_type: ty::t) { +fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, + main_node_type: ty::t) { if ccx.main_fn != none::<ValueRef> { ccx.sess.span_fatal(sp, "multiple 'main' functions"); } - let main_takes_ivec = alt ty::struct(ccx.tcx, main_node_type) { - ty::ty_fn(_, args, _ ,_ ,_) { - std::vec::len(args) != 0u - } - }; + let main_takes_ivec = + alt ty::struct(ccx.tcx, main_node_type) { + ty::ty_fn(_, args, _, _, _) { std::vec::len(args) != 0u } + }; let llfn = create_main(ccx, sp, main_llfn, main_takes_ivec); ccx.main_fn = some(llfn); - fn create_main(ccx: &@crate_ctxt, - sp: &span, - main_llfn: ValueRef, + fn create_main(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef, takes_ivec: bool) -> ValueRef { - let ivecarg_ty: ty::arg = { - mode: ty::mo_val, - ty: ty::mk_vec(ccx.tcx, { - ty: ty::mk_str(ccx.tcx), - mut: ast::imm - }) - }; - let llfty = type_of_fn(ccx, sp, - ast::proto_fn, - ~[ivecarg_ty], - ty::mk_nil(ccx.tcx), - 0u); + let ivecarg_ty: ty::arg = + {mode: ty::mo_val, + ty: + ty::mk_vec(ccx.tcx, + {ty: ty::mk_str(ccx.tcx), mut: ast::imm})}; + let llfty = + type_of_fn(ccx, sp, ast::proto_fn, [ivecarg_ty], + ty::mk_nil(ccx.tcx), 0u); let llfdecl = decl_fastcall_fn(ccx.llmod, "_rust_main", llfty); let fcx = new_fn_ctxt(new_local_ctxt(ccx), sp, llfdecl); @@ -6375,10 +6330,7 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, let lltaskarg = llvm::LLVMGetParam(llfdecl, 1u); let llenvarg = llvm::LLVMGetParam(llfdecl, 2u); let llargvarg = llvm::LLVMGetParam(llfdecl, 3u); - let args = ~[lloutputarg, - lltaskarg, - llenvarg, - llargvarg]; + let args = [lloutputarg, lltaskarg, llenvarg, llargvarg]; bcx.build.FastCall(main_llfn, args); } else { let lloutputarg = llvm::LLVMGetParam(llfdecl, 0u); @@ -6390,12 +6342,11 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, // we're responsible for freeing it let llivecptr = alloca(bcx, val_ty(llargvarg)); bcx.build.Store(llargvarg, llivecptr); - bcx = maybe_free_ivec_heap_part(bcx, llivecptr, - ty::mk_str(ccx.tcx)).bcx; + bcx = + maybe_free_ivec_heap_part(bcx, llivecptr, + ty::mk_str(ccx.tcx)).bcx; - let args = ~[lloutputarg, - lltaskarg, - llenvarg]; + let args = [lloutputarg, lltaskarg, llenvarg]; bcx.build.FastCall(main_llfn, args); } build_return(bcx); @@ -6414,7 +6365,7 @@ fn create_fn_pair(cx: &@crate_ctxt, ps: str, llfnty: TypeRef, llfn: ValueRef, external: bool) -> ValueRef { let gvar = llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty), str::buf(ps)); - let pair = C_struct(~[llfn, C_null(T_opaque_closure_ptr(*cx))]); + let pair = C_struct([llfn, C_null(T_opaque_closure_ptr(*cx))]); llvm::LLVMSetInitializer(gvar, pair); llvm::LLVMSetGlobalConstant(gvar, True); if !external { @@ -6432,10 +6383,9 @@ fn create_real_fn_pair(cx: &@block_ctxt, llfnty: TypeRef, llfn: ValueRef, let lcx = cx.fcx.lcx; let pair = alloca(cx, T_fn_pair(*lcx.ccx, llfnty)); - let code_cell = - cx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_code)]); + let code_cell = cx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_code)]); cx.build.Store(llfn, code_cell); - let env_cell = cx.build.GEP(pair, ~[C_int(0), C_int(abi::fn_field_box)]); + let env_cell = cx.build.GEP(pair, [C_int(0), C_int(abi::fn_field_box)]); let llenvblobptr = cx.build.PointerCast(llenvptr, T_opaque_closure_ptr(*lcx.ccx)); cx.build.Store(llenvblobptr, env_cell); @@ -6547,18 +6497,18 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], lltaskptr = vp2i(bcx, fcx.lltaskptr); } else { lltaskptr = fcx.lltaskptr; } - let call_args: [ValueRef] = ~[]; - if pass_task { call_args += ~[lltaskptr]; } - if uses_retptr { call_args += ~[bcx.fcx.llretptr]; } + let call_args: [ValueRef] = []; + if pass_task { call_args += [lltaskptr]; } + if uses_retptr { call_args += [bcx.fcx.llretptr]; } let arg_n = 3u; for each i: uint in uint::range(0u, num_ty_param) { let llarg = llvm::LLVMGetParam(fcx.llfn, arg_n); - fcx.lltydescs += ~[llarg]; + fcx.lltydescs += [llarg]; assert (llarg as int != 0); if cast_to_i32 { - call_args += ~[vp2i(bcx, llarg)]; - } else { call_args += ~[llarg]; } + call_args += [vp2i(bcx, llarg)]; + } else { call_args += [llarg]; } arg_n += 1u; } fn convert_arg_to_i32(cx: &@block_ctxt, v: ValueRef, t: ty::t, @@ -6582,10 +6532,10 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], fn trans_simple_native_abi(bcx: &@block_ctxt, name: str, call_args: &mutable [ValueRef], fn_type: ty::t, - uses_retptr: bool, cc: uint) - -> {val: ValueRef, rptr: ValueRef} { - let call_arg_tys: [TypeRef] = ~[]; - for arg: ValueRef in call_args { call_arg_tys += ~[val_ty(arg)]; } + uses_retptr: bool, cc: uint) -> + {val: ValueRef, rptr: ValueRef} { + let call_arg_tys: [TypeRef] = []; + for arg: ValueRef in call_args { call_arg_tys += [val_ty(arg)]; } let llnativefnty; if uses_retptr { @@ -6611,18 +6561,16 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], let args = ty::ty_fn_args(ccx.tcx, fn_type); // Build up the list of arguments. - let drop_args: [{val: ValueRef, ty: ty::t}] = ~[]; + let drop_args: [{val: ValueRef, ty: ty::t}] = []; let i = arg_n; for arg: ty::arg in args { let llarg = llvm::LLVMGetParam(fcx.llfn, i); assert (llarg as int != 0); if cast_to_i32 { let llarg_i32 = convert_arg_to_i32(bcx, llarg, arg.ty, arg.mode); - call_args += ~[llarg_i32]; - } else { call_args += ~[llarg]; } - if arg.mode == ty::mo_val { - drop_args += ~[{val: llarg, ty: arg.ty}]; - } + call_args += [llarg_i32]; + } else { call_args += [llarg]; } + if arg.mode == ty::mo_val { drop_args += [{val: llarg, ty: arg.ty}]; } i += 1u; } let r; @@ -6653,8 +6601,8 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], } _ { r = - trans_native_call(bcx.build, ccx.externs, - ccx.llmod, name, call_args); + trans_native_call(bcx.build, ccx.externs, ccx.llmod, name, + call_args); rptr = bcx.build.BitCast(fcx.llretptr, T_ptr(T_i32())); } } @@ -6671,7 +6619,7 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], finish_fn(fcx, lltop); } -fn item_path(item: &@ast::item) -> [str] { ret ~[item.ident]; } +fn item_path(item: &@ast::item) -> [str] { ret [item.ident]; } fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[str], _v: &vt<[str]>) { @@ -6692,7 +6640,7 @@ fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[str], ast::item_const(_, _) { let typ = node_id_type(ccx, i.id); let s = - mangle_exported_name(ccx, pt + ~[i.ident], + mangle_exported_name(ccx, pt + [i.ident], node_id_type(ccx, i.id)); let g = llvm::LLVMAddGlobal(ccx.llmod, type_of(ccx, i.span, typ), @@ -6740,8 +6688,8 @@ fn collect_items(ccx: &@crate_ctxt, crate: @ast::crate) { visit_item: bind collect_item_1(ccx, _, _, _) with *visitor0}; let visitor2 = @{visit_item: bind collect_item_2(ccx, _, _, _) with *visitor0}; - visit::visit_crate(*crate, ~[], visit::mk_vt(visitor1)); - visit::visit_crate(*crate, ~[], visit::mk_vt(visitor2)); + visit::visit_crate(*crate, [], visit::mk_vt(visitor1)); + visit::visit_crate(*crate, [], visit::mk_vt(visitor2)); } fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str], @@ -6752,7 +6700,7 @@ fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str], ast::item_tag(variants, tps) { for variant: ast::variant in variants { if std::vec::len(variant.node.args) != 0u { - decl_fn_and_pair(ccx, i.span, new_pt + ~[variant.node.name], + decl_fn_and_pair(ccx, i.span, new_pt + [variant.node.name], "tag", tps, variant.node.id); } } @@ -6765,7 +6713,7 @@ fn collect_tag_ctors(ccx: &@crate_ctxt, crate: @ast::crate) { let visitor = @{visit_item: bind collect_tag_ctor(ccx, _, _, _) with *visit::default_visitor()}; - visit::visit_crate(*crate, ~[], visit::mk_vt(visitor)); + visit::visit_crate(*crate, [], visit::mk_vt(visitor)); } @@ -6779,8 +6727,8 @@ fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[str], let i = 0u; let n_variants = std::vec::len::<ast::variant>(variants); while i < n_variants { - let variant = variants.(i); - let p = new_pt + ~[it.ident, variant.node.name, "discrim"]; + let variant = variants[i]; + let p = new_pt + [it.ident, variant.node.name, "discrim"]; let s = mangle_exported_name(ccx, p, ty::mk_int(ccx.tcx)); let discrim_gvar = llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(s)); @@ -6801,7 +6749,7 @@ fn trans_constants(ccx: &@crate_ctxt, crate: @ast::crate) { let visitor = @{visit_item: bind trans_constant(ccx, _, _, _) with *visit::default_visitor()}; - visit::visit_crate(*crate, ~[], visit::mk_vt(visitor)); + visit::visit_crate(*crate, [], visit::mk_vt(visitor)); } fn vp2i(cx: &@block_ctxt, v: ValueRef) -> ValueRef { @@ -6816,20 +6764,20 @@ fn p2i(v: ValueRef) -> ValueRef { ret llvm::LLVMConstPtrToInt(v, T_int()); } fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> { let T_memmove32_args: [TypeRef] = - ~[T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()]; + [T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()]; let T_memmove64_args: [TypeRef] = - ~[T_ptr(T_i8()), T_ptr(T_i8()), T_i64(), T_i32(), T_i1()]; + [T_ptr(T_i8()), T_ptr(T_i8()), T_i64(), T_i32(), T_i1()]; let T_memset32_args: [TypeRef] = - ~[T_ptr(T_i8()), T_i8(), T_i32(), T_i32(), T_i1()]; + [T_ptr(T_i8()), T_i8(), T_i32(), T_i32(), T_i1()]; let T_memset64_args: [TypeRef] = - ~[T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()]; - let T_trap_args: [TypeRef] = ~[]; + [T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()]; + let T_trap_args: [TypeRef] = []; let gcroot = decl_cdecl_fn(llmod, "llvm.gcroot", - T_fn(~[T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void())); + T_fn([T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void())); let gcread = decl_cdecl_fn(llmod, "llvm.gcread", - T_fn(~[T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void())); + T_fn([T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void())); let memmove32 = decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32", T_fn(T_memmove32_args, T_void())); @@ -6855,7 +6803,7 @@ fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> { } fn trap(bcx: &@block_ctxt) { - let v: [ValueRef] = ~[]; + let v: [ValueRef] = []; alt bcx_ccx(bcx).intrinsics.find("llvm.trap") { some(x) { bcx.build.Call(x, v); } _ { bcx_ccx(bcx).sess.bug("unbound llvm.trap in trap"); } @@ -6863,7 +6811,7 @@ fn trap(bcx: &@block_ctxt) { } fn decl_no_op_type_glue(llmod: ModuleRef, taskptr_type: TypeRef) -> ValueRef { - let ty = T_fn(~[taskptr_type, T_ptr(T_i8())], T_void()); + let ty = T_fn([taskptr_type, T_ptr(T_i8())], T_void()); ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty); } @@ -6875,11 +6823,11 @@ fn make_no_op_type_glue(fun: ValueRef) { fn vec_fill(bcx: &@block_ctxt, v: ValueRef) -> ValueRef { ret bcx.build.Load(bcx.build.GEP(v, - ~[C_int(0), C_int(abi::vec_elt_fill)])); + [C_int(0), C_int(abi::vec_elt_fill)])); } fn vec_p0(bcx: &@block_ctxt, v: ValueRef) -> ValueRef { - let p = bcx.build.GEP(v, ~[C_int(0), C_int(abi::vec_elt_data)]); + let p = bcx.build.GEP(v, [C_int(0), C_int(abi::vec_elt_data)]); ret bcx.build.PointerCast(p, T_ptr(T_i8())); } @@ -6909,19 +6857,19 @@ fn make_common_glue(sess: &session::session, output: &str) { } fn create_module_map(ccx: &@crate_ctxt) -> ValueRef { - let elttype = T_struct(~[T_int(), T_int()]); + let elttype = T_struct([T_int(), T_int()]); let maptype = T_array(elttype, ccx.module_data.size() + 1u); let map = llvm::LLVMAddGlobal(ccx.llmod, maptype, str::buf("_rust_mod_map")); llvm::LLVMSetLinkage(map, lib::llvm::LLVMInternalLinkage as llvm::Linkage); - let elts: [ValueRef] = ~[]; + let elts: [ValueRef] = []; for each item: @{key: str, val: ValueRef} in ccx.module_data.items() { - let elt = C_struct(~[p2i(C_cstr(ccx, item.key)), p2i(item.val)]); - elts += ~[elt]; + let elt = C_struct([p2i(C_cstr(ccx, item.key)), p2i(item.val)]); + elts += [elt]; } - let term = C_struct(~[C_int(0), C_int(0)]); - elts += ~[term]; + let term = C_struct([C_int(0), C_int(0)]); + elts += [term]; llvm::LLVMSetInitializer(map, C_array(elttype, elts)); ret map; } @@ -6929,37 +6877,36 @@ fn create_module_map(ccx: &@crate_ctxt) -> ValueRef { // FIXME use hashed metadata instead of crate names once we have that fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef { - let subcrates: [ValueRef] = ~[]; + let subcrates: [ValueRef] = []; let i = 1; let cstore = ccx.sess.get_cstore(); while cstore::have_crate_data(cstore, i) { let nm = "_rust_crate_map_" + cstore::get_crate_data(cstore, i).name; - let cr = - llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(nm)); - subcrates += ~[p2i(cr)]; + let cr = llvm::LLVMAddGlobal(ccx.llmod, T_int(), str::buf(nm)); + subcrates += [p2i(cr)]; i += 1; } - subcrates += ~[C_int(0)]; + subcrates += [C_int(0)]; let mapname; if ccx.sess.get_opts().library { mapname = ccx.link_meta.name; } else { mapname = "toplevel"; } let sym_name = "_rust_crate_map_" + mapname; let arrtype = T_array(T_int(), std::vec::len::<ValueRef>(subcrates)); - let maptype = T_struct(~[T_int(), arrtype]); + let maptype = T_struct([T_int(), arrtype]); let map = llvm::LLVMAddGlobal(ccx.llmod, maptype, str::buf(sym_name)); llvm::LLVMSetLinkage(map, lib::llvm::LLVMExternalLinkage as llvm::Linkage); llvm::LLVMSetInitializer(map, - C_struct(~[p2i(create_module_map(ccx)), - C_array(T_int(), subcrates)])); + C_struct([p2i(create_module_map(ccx)), + C_array(T_int(), subcrates)])); ret map; } fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) { if !cx.sess.get_opts().library { ret; } let llmeta = C_postr(metadata::encoder::encode_metadata(cx, crate)); - let llconst = trans_common::C_struct(~[llmeta]); + let llconst = trans_common::C_struct([llmeta]); let llglobal = llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst), str::buf("rust_metadata")); @@ -6976,7 +6923,7 @@ fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) { str::buf("llvm.used")); llvm::LLVMSetLinkage(llvm_used, lib::llvm::LLVMAppendingLinkage as llvm::Linkage); - llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, ~[llglobal])); + llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, [llglobal])); } fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, @@ -7038,7 +6985,7 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, mutable n_glues_created: 0u, mutable n_null_glues: 0u, mutable n_real_glues: 0u, - fn_times: @mutable ~[]}, + fn_times: @mutable []}, upcalls: upcall::declare_upcalls(tn, tydesc_type, taskptr_type, llmod), rust_object_type: T_rust_object(), @@ -7059,15 +7006,15 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt, write_metadata(cx.ccx, crate); if ccx.sess.get_opts().stats { log_err "--- trans stats ---"; - log_err #fmt("n_static_tydescs: %u", ccx.stats.n_static_tydescs); - log_err #fmt("n_derived_tydescs: %u", ccx.stats.n_derived_tydescs); - log_err #fmt("n_glues_created: %u", ccx.stats.n_glues_created); - log_err #fmt("n_null_glues: %u", ccx.stats.n_null_glues); - log_err #fmt("n_real_glues: %u", ccx.stats.n_real_glues); + log_err #fmt["n_static_tydescs: %u", ccx.stats.n_static_tydescs]; + log_err #fmt["n_derived_tydescs: %u", ccx.stats.n_derived_tydescs]; + log_err #fmt["n_glues_created: %u", ccx.stats.n_glues_created]; + log_err #fmt["n_null_glues: %u", ccx.stats.n_null_glues]; + log_err #fmt["n_real_glues: %u", ccx.stats.n_real_glues]; for timing: {ident: str, time: int} in *ccx.stats.fn_times { - log_err #fmt("time: %s took %d ms", timing.ident, timing.time); + log_err #fmt["time: %s took %d ms", timing.ident, timing.time]; } } ret llmod; diff --git a/src/comp/middle/trans_alt.rs b/src/comp/middle/trans_alt.rs index ec029e6dd98..b1c94862120 100644 --- a/src/comp/middle/trans_alt.rs +++ b/src/comp/middle/trans_alt.rs @@ -72,24 +72,24 @@ fn matches_always(p: &@ast::pat) -> bool { fn bind_for_pat(p: &@ast::pat, br: &match_branch, val: ValueRef) { alt p.node { - ast::pat_bind(name) { br.bound += ~[{ident: name, val: val}]; } + ast::pat_bind(name) { br.bound += [{ident: name, val: val}]; } _ { } } } -type enter_pat = fn(&@ast::pat) -> option::t<[@ast::pat]> ; +type enter_pat = fn(&@ast::pat) -> option::t<[@ast::pat]>; fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match { - let result = ~[]; + let result = []; for br: match_branch in m { - alt e(br.pats.(col)) { + alt e(br.pats[col]) { some(sub) { let pats = vec::slice(br.pats, 0u, col) + sub + vec::slice(br.pats, col + 1u, vec::len(br.pats)); let new_br = @{pats: pats with *br}; - result += ~[new_br]; - bind_for_pat(br.pats.(col), new_br, val); + result += [new_br]; + bind_for_pat(br.pats[col], new_br, val); } none. { } } @@ -99,7 +99,7 @@ fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match { fn enter_default(m: &match, col: uint, val: ValueRef) -> match { fn e(p: &@ast::pat) -> option::t<[@ast::pat]> { - ret if matches_always(p) { some(~[]) } else { none }; + ret if matches_always(p) { some([]) } else { none }; } ret enter_match(m, col, val, e); } @@ -116,7 +116,7 @@ fn enter_opt(ccx: &@crate_ctxt, m: &match, opt: &opt, col: uint, } else { none }; } ast::pat_lit(l) { - ret if opt_eq(lit(l), opt) { some(~[]) } else { none }; + ret if opt_eq(lit(l), opt) { some([]) } else { none }; } _ { ret some(vec::init_elt(dummy, size)); } } @@ -131,13 +131,13 @@ fn enter_rec(m: &match, col: uint, fields: &[ast::ident], val: ValueRef) -> option::t<[@ast::pat]> { alt p.node { ast::pat_rec(fpats, _) { - let pats = ~[]; + let pats = []; for fname: ast::ident in fields { let pat = dummy; for fpat: ast::field_pat in fpats { if str::eq(fpat.ident, fname) { pat = fpat.pat; break; } } - pats += ~[pat]; + pats += [pat]; } ret some(pats); } @@ -149,8 +149,8 @@ fn enter_rec(m: &match, col: uint, fields: &[ast::ident], val: ValueRef) -> fn enter_tup(m: &match, col: uint, val: ValueRef, n_elts: uint) -> match { let dummy = @{id: 0, node: ast::pat_wild, span: dummy_sp()}; - fn e(dummy: &@ast::pat, n_elts: uint, p: &@ast::pat) - -> option::t<[@ast::pat]> { + fn e(dummy: &@ast::pat, n_elts: uint, p: &@ast::pat) -> + option::t<[@ast::pat]> { alt p.node { ast::pat_tup(elts) { ret some(elts); } _ { ret some(vec::init_elt(dummy, n_elts)); } @@ -163,8 +163,8 @@ fn enter_box(m: &match, col: uint, val: ValueRef) -> match { let dummy = @{id: 0, node: ast::pat_wild, span: dummy_sp()}; fn e(dummy: &@ast::pat, p: &@ast::pat) -> option::t<[@ast::pat]> { alt p.node { - ast::pat_box(sub) { ret some(~[sub]); } - _ { ret some(~[dummy]); } + ast::pat_box(sub) { ret some([sub]); } + _ { ret some([dummy]); } } } ret enter_match(m, col, val, bind e(dummy, _)); @@ -173,15 +173,15 @@ fn enter_box(m: &match, col: uint, val: ValueRef) -> match { fn get_options(ccx: &@crate_ctxt, m: &match, col: uint) -> [opt] { fn add_to_set(set: &mutable [opt], val: &opt) { for l: opt in set { if opt_eq(l, val) { ret; } } - set += ~[val]; + set += [val]; } - let found = ~[]; + let found = []; for br: match_branch in m { - alt br.pats.(col).node { + alt br.pats[col].node { ast::pat_lit(l) { add_to_set(found, lit(l)); } ast::pat_tag(_, _) { - add_to_set(found, variant_opt(ccx, br.pats.(col).id)); + add_to_set(found, variant_opt(ccx, br.pats[col].id)); } _ { } } @@ -190,20 +190,20 @@ fn get_options(ccx: &@crate_ctxt, m: &match, col: uint) -> [opt] { } fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id, - vdefs: &{tg: def_id, var: def_id}, val: ValueRef) - -> {vals: [ValueRef], bcx: @block_ctxt} { + vdefs: &{tg: def_id, var: def_id}, val: ValueRef) -> + {vals: [ValueRef], bcx: @block_ctxt} { let ccx = bcx.fcx.lcx.ccx; let ty_param_substs = ty::node_id_to_type_params(ccx.tcx, pat_id); let blobptr = val; let variants = ty::tag_variants(ccx.tcx, vdefs.tg); - let args = ~[]; + let args = []; let size = vec::len(ty::tag_variant_with_id(ccx.tcx, vdefs.tg, vdefs.var).args); if size > 0u && vec::len(variants) != 1u { let tagptr = bcx.build.PointerCast(val, trans_common::T_opaque_tag_ptr(ccx.tn)); - blobptr = bcx.build.GEP(tagptr, ~[C_int(0), C_int(1)]); + blobptr = bcx.build.GEP(tagptr, [C_int(0), C_int(1)]); } let i = 0u; while i < size { @@ -211,20 +211,20 @@ fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id, trans::GEP_tag(bcx, blobptr, vdefs.tg, vdefs.var, ty_param_substs, i as int); bcx = r.bcx; - args += ~[r.val]; + args += [r.val]; i += 1u; } ret {vals: args, bcx: bcx}; } fn collect_record_fields(m: &match, col: uint) -> [ast::ident] { - let fields = ~[]; + let fields = []; for br: match_branch in m { - alt br.pats.(col).node { + alt br.pats[col].node { ast::pat_rec(fs, _) { for f: ast::field_pat in fs { if !vec::any(bind str::eq(f.ident, _), fields) { - fields += ~[f.ident]; + fields += [f.ident]; } } } @@ -236,14 +236,14 @@ fn collect_record_fields(m: &match, col: uint) -> [ast::ident] { fn any_box_pat(m: &match, col: uint) -> bool { for br: match_branch in m { - alt br.pats.(col).node { ast::pat_box(_) { ret true; } _ { } } + alt br.pats[col].node { ast::pat_box(_) { ret true; } _ { } } } ret false; } fn any_tup_pat(m: &match, col: uint) -> bool { for br: match_branch in m { - alt br.pats.(col).node { ast::pat_tup(_) { ret true; } _ { } } + alt br.pats[col].node { ast::pat_tup(_) { ret true; } _ { } } } ret false; } @@ -252,13 +252,13 @@ type exit_node = {bound: bind_map, from: BasicBlockRef, to: BasicBlockRef}; type mk_fail = fn() -> BasicBlockRef; fn pick_col(m: &match) -> uint { - let scores = vec::init_elt_mut(0u, vec::len(m.(0).pats)); + let scores = vec::init_elt_mut(0u, vec::len(m[0].pats)); for br: match_branch in m { let i = 0u; for p: @ast::pat in br.pats { alt p.node { - ast::pat_lit(_) | ast::pat_tag(_, _) { scores.(i) += 1u; } - _ {} + ast::pat_lit(_) | ast::pat_tag(_, _) { scores[i] += 1u; } + _ { } } i += 1u; } @@ -272,10 +272,7 @@ fn pick_col(m: &match) -> uint { if score == 0u { ret i; } // If no irrefutable ones are found, we pick the one with the biggest // branching factor. - if score > max_score { - max_score = score; - best_col = i; - } + if score > max_score { max_score = score; best_col = i; } i += 1u; } ret best_col; @@ -284,22 +281,24 @@ fn pick_col(m: &match) -> uint { fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], f: &mk_fail, exits: &mutable [exit_node]) { if vec::len(m) == 0u { bcx.build.Br(f()); ret; } - if vec::len(m.(0).pats) == 0u { - exits += ~[{bound: m.(0).bound, from: bcx.llbb, to: m.(0).body}]; - bcx.build.Br(m.(0).body); + if vec::len(m[0].pats) == 0u { + exits += [{bound: m[0].bound, from: bcx.llbb, to: m[0].body}]; + bcx.build.Br(m[0].body); ret; } let col = pick_col(m); - let val = vals.(col); - let vals_left = vec::slice(vals, 0u, col) + - vec::slice(vals, col + 1u, vec::len(vals)); + let val = vals[col]; + let vals_left = + vec::slice(vals, 0u, col) + + vec::slice(vals, col + 1u, vec::len(vals)); let ccx = bcx.fcx.lcx.ccx; let pat_id = 0; for br: match_branch in m { + // Find a real id (we're adding placeholder wildcard patterns, but // each column is guaranteed to have at least one real pattern) - if pat_id == 0 { pat_id = br.pats.(col).id; } + if pat_id == 0 { pat_id = br.pats[col].id; } } let rec_fields = collect_record_fields(m, col); @@ -308,12 +307,12 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let rec_ty = ty::node_id_to_monotype(ccx.tcx, pat_id); let fields = alt ty::struct(ccx.tcx, rec_ty) { ty::ty_rec(fields) { fields } }; - let rec_vals = ~[]; + let rec_vals = []; for field_name: ast::ident in rec_fields { let ix: uint = ty::field_idx(ccx.sess, dummy_sp(), field_name, fields); - let r = trans::GEP_tup_like(bcx, rec_ty, val, ~[0, ix as int]); - rec_vals += ~[r.val]; + let r = trans::GEP_tup_like(bcx, rec_ty, val, [0, ix as int]); + rec_vals += [r.val]; bcx = r.bcx; } compile_submatch(bcx, enter_rec(m, col, rec_fields, val), @@ -323,13 +322,14 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], if any_tup_pat(m, col) { let tup_ty = ty::node_id_to_monotype(ccx.tcx, pat_id); - let n_tup_elts = alt ty::struct(ccx.tcx, tup_ty) { - ty::ty_tup(elts) { vec::len(elts) } - }; - let tup_vals = ~[], i = 0u; + let n_tup_elts = + alt ty::struct(ccx.tcx, tup_ty) { + ty::ty_tup(elts) { vec::len(elts) } + }; + let tup_vals = [], i = 0u; while i < n_tup_elts { - let r = trans::GEP_tup_like(bcx, tup_ty, val, ~[0, i as int]); - tup_vals += ~[r.val]; + let r = trans::GEP_tup_like(bcx, tup_ty, val, [0, i as int]); + tup_vals += [r.val]; bcx = r.bcx; i += 1u; } @@ -343,9 +343,9 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let box = bcx.build.Load(val); let unboxed = bcx.build.InBoundsGEP(box, - ~[C_int(0), - C_int(back::abi::box_rc_field_body)]); - compile_submatch(bcx, enter_box(m, col, val), ~[unboxed] + vals_left, + [C_int(0), + C_int(back::abi::box_rc_field_body)]); + compile_submatch(bcx, enter_box(m, col, val), [unboxed] + vals_left, f, exits); ret; } @@ -356,14 +356,16 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let kind = no_branch; let test_val = val; if vec::len(opts) > 0u { - alt opts.(0) { + alt opts[0] { var(_, vdef) { if vec::len(ty::tag_variants(ccx.tcx, vdef.tg)) == 1u { kind = single; } else { - let tagptr = bcx.build.PointerCast - (val, trans_common::T_opaque_tag_ptr(ccx.tn)); - let discrimptr = bcx.build.GEP(tagptr, ~[C_int(0), C_int(0)]); + let tagptr = + bcx.build.PointerCast( + val, + trans_common::T_opaque_tag_ptr(ccx.tn)); + let discrimptr = bcx.build.GEP(tagptr, [C_int(0), C_int(0)]); test_val = bcx.build.Load(discrimptr); kind = switch; } @@ -398,15 +400,15 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef], let r = trans_opt(bcx, opt); bcx = r.bcx; let t = ty::node_id_to_type(ccx.tcx, pat_id); - let eq = trans::trans_compare(bcx, ast::eq, test_val, t, - r.val, t); + let eq = + trans::trans_compare(bcx, ast::eq, test_val, t, r.val, t); bcx = new_sub_block_ctxt(bcx, "next"); eq.bcx.build.CondBr(eq.val, opt_cx.llbb, bcx.llbb); } _ { } } let size = 0u; - let unpacked = ~[]; + let unpacked = []; alt opt { var(_, vdef) { let args = extract_variant_args(opt_cx, pat_id, vdef, val); @@ -441,18 +443,18 @@ fn make_phi_bindings(bcx: &@block_ctxt, map: &[exit_node], let our_block = bcx.llbb as uint; let success = true; for each item: @{key: ast::ident, val: ast::node_id} in ids.items() { - let llbbs = ~[]; - let vals = ~[]; + let llbbs = []; + let vals = []; for ex: exit_node in map { if ex.to as uint == our_block { alt assoc(item.key, ex.bound) { - some(val) { llbbs += ~[ex.from]; vals += ~[val]; } + some(val) { llbbs += [ex.from]; vals += [val]; } none. { } } } } if vec::len(vals) > 0u { - let phi = bcx.build.Phi(val_ty(vals.(0)), vals, llbbs); + let phi = bcx.build.Phi(val_ty(vals[0]), vals, llbbs); bcx.fcx.lllocals.insert(item.val, phi); } else { success = false; } } @@ -461,25 +463,23 @@ fn make_phi_bindings(bcx: &@block_ctxt, map: &[exit_node], fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm], output: &trans::out_method) -> result { - let bodies = ~[]; - let match: match = ~[]; + let bodies = []; + let match: match = []; let er = trans::trans_expr(cx, expr); - if (ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), expr))) { + if ty::type_is_bot(bcx_tcx(cx), ty::expr_ty(bcx_tcx(cx), expr)) { + // No need to generate code for alt, // since the disc diverges. - if (!cx.build.is_terminated()) { + if !cx.build.is_terminated() { ret rslt(cx, cx.build.Unreachable()); - } - else { - ret er; - } + } else { ret er; } } for a: ast::arm in arms { let body = new_scope_block_ctxt(cx, "case_body"); - bodies += ~[body]; + bodies += [body]; for p: @ast::pat in a.pats { - match += ~[@{pats: ~[p], body: body.llbb, mutable bound: ~[]}]; + match += [@{pats: [p], body: body.llbb, mutable bound: []}]; } } @@ -489,26 +489,26 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm], done: @mutable option::t<BasicBlockRef>) -> BasicBlockRef { alt *done { some(bb) { ret bb; } _ { } } let fail_cx = new_sub_block_ctxt(cx, "case_fallthrough"); - trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure"); + trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure");; *done = some(fail_cx.llbb); ret fail_cx.llbb; } - let exit_map = ~[]; + let exit_map = []; let t = trans::node_id_type(cx.fcx.lcx.ccx, expr.id); let v = trans::spill_if_immediate(er.bcx, er.val, t); - compile_submatch(er.bcx, match, ~[v], - bind mk_fail(cx, expr.span, fail_cx), exit_map); + compile_submatch(er.bcx, match, [v], bind mk_fail(cx, expr.span, fail_cx), + exit_map); let i = 0u; - let arm_results = ~[]; + let arm_results = []; for a: ast::arm in arms { - let body_cx = bodies.(i); - if make_phi_bindings(body_cx, exit_map, ast::pat_id_map(a.pats.(0))) { + let body_cx = bodies[i]; + if make_phi_bindings(body_cx, exit_map, ast::pat_id_map(a.pats[0])) { let block_res = trans::trans_block(body_cx, a.body, output); - arm_results += ~[block_res]; + arm_results += [block_res]; } else { // Unreachable - arm_results += ~[rslt(body_cx, C_nil())]; + arm_results += [rslt(body_cx, C_nil())]; } i += 1u; } @@ -518,8 +518,7 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm], // Not alt-related, but similar to the pattern-munging code above fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, table: hashmap<ast::node_id, ValueRef>, - make_copy: bool) - -> @block_ctxt { + make_copy: bool) -> @block_ctxt { let ccx = bcx.fcx.lcx.ccx; alt pat.node { ast::pat_bind(_) { @@ -532,9 +531,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, bcx = trans::copy_ty(bcx, loaded, ty).bcx; table.insert(pat.id, alloc); trans_common::add_clean(bcx, alloc, ty); - } else { - table.insert(pat.id, val); - } + } else { table.insert(pat.id, val); } } ast::pat_tag(_, sub) { if vec::len(sub) == 0u { ret bcx; } @@ -542,8 +539,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, let args = extract_variant_args(bcx, pat.id, vdefs, val); let i = 0; for argval: ValueRef in args.vals { - bcx = bind_irrefutable_pat(bcx, sub.(i), argval, table, - make_copy); + bcx = bind_irrefutable_pat(bcx, sub[i], argval, table, make_copy); i += 1; } } @@ -554,7 +550,7 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, for f: ast::field_pat in fields { let ix: uint = ty::field_idx(ccx.sess, pat.span, f.ident, rec_fields); - let r = trans::GEP_tup_like(bcx, rec_ty, val, ~[0, ix as int]); + let r = trans::GEP_tup_like(bcx, rec_ty, val, [0, ix as int]); bcx = bind_irrefutable_pat(r.bcx, f.pat, r.val, table, make_copy); } } @@ -562,18 +558,20 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef, let tup_ty = ty::node_id_to_monotype(ccx.tcx, pat.id); let i = 0u; for elem in elems { - let r = trans::GEP_tup_like(bcx, tup_ty, val, ~[0, i as int]); + let r = trans::GEP_tup_like(bcx, tup_ty, val, [0, i as int]); bcx = bind_irrefutable_pat(r.bcx, elem, r.val, table, make_copy); i += 1u; } } ast::pat_box(inner) { let box = bcx.build.Load(val); - let unboxed = bcx.build.InBoundsGEP - (box, ~[C_int(0), C_int(back::abi::box_rc_field_body)]); + let unboxed = + bcx.build.InBoundsGEP(box, + [C_int(0), + C_int(back::abi::box_rc_field_body)]); bcx = bind_irrefutable_pat(bcx, inner, unboxed, table, true); } - ast::pat_wild. | ast::pat_lit(_) {} + ast::pat_wild. | ast::pat_lit(_) { } } ret bcx; } diff --git a/src/comp/middle/trans_common.rs b/src/comp/middle/trans_common.rs index 732c8305f84..e53f4a47b27 100644 --- a/src/comp/middle/trans_common.rs +++ b/src/comp/middle/trans_common.rs @@ -71,9 +71,9 @@ type derived_tydesc_info = {lltydesc: ValueRef, escapes: bool}; type glue_fns = {no_op_type_glue: ValueRef}; tag tydesc_kind { - tk_static; // Static (monomorphic) type descriptor. - tk_param; // Type parameter. - tk_derived; // Derived from a typaram or another derived tydesc. + tk_static; // Static (monomorphic) type descriptor. + tk_param; // Type parameter. + tk_derived; // Derived from a typaram or another derived tydesc. } type tydesc_info = @@ -111,46 +111,44 @@ type stats = fn_times: @mutable [{ident: str, time: int}]}; // Crate context. Every crate we compile has one of these. -type crate_ctxt = { - sess: session::session, - llmod: ModuleRef, - td: target_data, - tn: type_names, - externs: hashmap<str, ValueRef>, - intrinsics: hashmap<str, ValueRef>, - +type crate_ctxt = // A mapping from the def_id of each item in this crate to the address // of the first instruction of the item's definition in the executable // we're generating. - item_ids: hashmap<ast::node_id, ValueRef>, - ast_map: ast_map::map, - item_symbols: hashmap<ast::node_id, str>, - mutable main_fn: option::t<ValueRef>, - link_meta: link::link_meta, // TODO: hashmap<tup(tag_id,subtys), @tag_info> - tag_sizes: hashmap<ty::t, uint>, - discrims: hashmap<ast::node_id, ValueRef>, - discrim_symbols: hashmap<ast::node_id, str>, - fn_pairs: hashmap<ast::node_id, ValueRef>, - consts: hashmap<ast::node_id, ValueRef>, - obj_methods: hashmap<ast::node_id, ()>, - tydescs: hashmap<ty::t, @tydesc_info>, - module_data: hashmap<str, ValueRef>, - lltypes: hashmap<ty::t, TypeRef>, - glues: @glue_fns, - names: namegen, - sha: std::sha1::sha1, - type_sha1s: hashmap<ty::t, str>, - type_short_names: hashmap<ty::t, str>, - tcx: ty::ctxt, - stats: stats, - upcalls: @upcall::upcalls, - rust_object_type: TypeRef, - tydesc_type: TypeRef, - task_type: TypeRef, - shape_cx: shape::ctxt, - gc_cx: gc::ctxt -}; + {sess: session::session, + llmod: ModuleRef, + td: target_data, + tn: type_names, + externs: hashmap<str, ValueRef>, + intrinsics: hashmap<str, ValueRef>, + item_ids: hashmap<ast::node_id, ValueRef>, + ast_map: ast_map::map, + item_symbols: hashmap<ast::node_id, str>, + mutable main_fn: option::t<ValueRef>, + link_meta: link::link_meta, + tag_sizes: hashmap<ty::t, uint>, + discrims: hashmap<ast::node_id, ValueRef>, + discrim_symbols: hashmap<ast::node_id, str>, + fn_pairs: hashmap<ast::node_id, ValueRef>, + consts: hashmap<ast::node_id, ValueRef>, + obj_methods: hashmap<ast::node_id, ()>, + tydescs: hashmap<ty::t, @tydesc_info>, + module_data: hashmap<str, ValueRef>, + lltypes: hashmap<ty::t, TypeRef>, + glues: @glue_fns, + names: namegen, + sha: std::sha1::sha1, + type_sha1s: hashmap<ty::t, str>, + type_short_names: hashmap<ty::t, str>, + tcx: ty::ctxt, + stats: stats, + upcalls: @upcall::upcalls, + rust_object_type: TypeRef, + tydesc_type: TypeRef, + task_type: TypeRef, + shape_cx: shape::ctxt, + gc_cx: gc::ctxt}; type local_ctxt = {path: [str], @@ -164,12 +162,11 @@ type val_self_pair = {v: ValueRef, t: ty::t}; // Function context. Every LLVM function we create will have one of // these. -type fn_ctxt = { +type fn_ctxt = // The ValueRef returned from a call to llvm::LLVMAddFunction; the // address of the first instruction in the sequence of // instructions for this function that will go in the .text // section of the executable we're generating. - llfn: ValueRef, // The three implicit arguments that arrive in the function we're // creating. For instance, foo(int, int) is really foo(ret*, @@ -179,16 +176,13 @@ type fn_ctxt = { // convenience. // Points to the current task. - lltaskptr: ValueRef, // Points to the current environment (bindings of variables to // values), if this is a regular function; points to the current // object, if this is a method. - llenv: ValueRef, // Points to where the return value of this function should end // up. - llretptr: ValueRef, // The next three elements: "hoisted basic blocks" containing // administrative activities that have to happen in only one place in @@ -196,20 +190,16 @@ type fn_ctxt = { // A block for all the function's static allocas, so that LLVM // will coalesce them into a single alloca call. - mutable llstaticallocas: BasicBlockRef, // A block containing code that copies incoming arguments to space // already allocated by code in one of the llallocas blocks. // (LLVM requires that arguments be copied to local allocas before // allowing most any operation to be performed on them.) - mutable llcopyargs: BasicBlockRef, // The first block containing derived tydescs received from the // runtime. See description of derived_tydescs, below. - mutable llderivedtydescs_first: BasicBlockRef, // The last block of the llderivedtydescs group. - mutable llderivedtydescs: BasicBlockRef, // A block for all of the dynamically sized allocas. This must be // after llderivedtydescs, because these sometimes depend on @@ -219,52 +209,41 @@ type fn_ctxt = { // for incoming function arguments? Or is it merely the block // containing code that copies incoming args to space already // alloca'd by code in llallocas? - mutable lldynamicallocas: BasicBlockRef, - mutable llreturn: BasicBlockRef, // The token used to clear the dynamic allocas at the end of this frame. - mutable llobstacktoken: option::t<ValueRef>, // The 'self' object currently in use in this function, if there // is one. - mutable llself: option::t<val_self_pair>, // If this function is actually a iter, a block containing the // code called whenever the iter calls 'put'. - mutable lliterbody: option::t<ValueRef>, // If this function is actually a iter, the type of the function // that that we call when we call 'put'. Having to track this is // pretty irritating. We have to do it because we need the type if // we are going to put the iterbody into a closure (if it appears // in a for-each inside of an iter). - mutable iterbodyty: option::t<ty::t>, // The next four items: hash tables mapping from AST def_ids to // LLVM-stuff-in-the-frame. // Maps arguments to allocas created for them in llallocas. - llargs: hashmap<ast::node_id, ValueRef>, // Maps fields in objects to pointers into the interior of // llself's body. - llobjfields: hashmap<ast::node_id, ValueRef>, // Maps the def_ids for local variables to the allocas created for // them in llallocas. - lllocals: hashmap<ast::node_id, ValueRef>, // The same as above, but for variables accessed via the frame // pointer we pass into an iter, for access to the static // environment of the iter-calling frame. - llupvars: hashmap<ast::node_id, ValueRef>, // For convenience, a vector of the incoming tydescs for each of // this functions type parameters, fetched via llvm::LLVMGetParam. // For example, for a function foo::<A, B, C>(), lltydescs contains // the ValueRefs for the tydescs for A, B, and C. - mutable lltydescs: [ValueRef], // Derived tydescs are tydescs created at runtime, for types that // involve type parameters inside type constructors. For example, @@ -275,31 +254,48 @@ type fn_ctxt = { // when information about both "[T]" and "T" are available. When // such a tydesc is created, we cache it in the derived_tydescs // table for the next time that such a tydesc is needed. - derived_tydescs: hashmap<ty::t, derived_tydesc_info>, // The node_id of the function, or -1 if it doesn't correspond to // a user-defined function. - id: ast::node_id, // The source span where this function comes from, for error // reporting. - sp: span, // This function's enclosing local context. - lcx: @local_ctxt -}; + {llfn: ValueRef, + lltaskptr: ValueRef, + llenv: ValueRef, + llretptr: ValueRef, + mutable llstaticallocas: BasicBlockRef, + mutable llcopyargs: BasicBlockRef, + mutable llderivedtydescs_first: BasicBlockRef, + mutable llderivedtydescs: BasicBlockRef, + mutable lldynamicallocas: BasicBlockRef, + mutable llreturn: BasicBlockRef, + mutable llobstacktoken: option::t<ValueRef>, + mutable llself: option::t<val_self_pair>, + mutable lliterbody: option::t<ValueRef>, + mutable iterbodyty: option::t<ty::t>, + llargs: hashmap<ast::node_id, ValueRef>, + llobjfields: hashmap<ast::node_id, ValueRef>, + lllocals: hashmap<ast::node_id, ValueRef>, + llupvars: hashmap<ast::node_id, ValueRef>, + mutable lltydescs: [ValueRef], + derived_tydescs: hashmap<ty::t, derived_tydesc_info>, + id: ast::node_id, + sp: span, + lcx: @local_ctxt}; tag cleanup { - clean(fn(&@block_ctxt) -> result ); - clean_temp(ValueRef, fn(&@block_ctxt) -> result ); + clean(fn(&@block_ctxt) -> result); + clean_temp(ValueRef, fn(&@block_ctxt) -> result); } fn add_clean(cx: &@block_ctxt, val: ValueRef, ty: ty::t) { - find_scope_cx(cx).cleanups += ~[clean(bind drop_slot(_, val, ty))]; + find_scope_cx(cx).cleanups += [clean(bind drop_slot(_, val, ty))]; } fn add_clean_temp(cx: &@block_ctxt, val: ValueRef, ty: ty::t) { - find_scope_cx(cx).cleanups += - ~[clean_temp(val, bind drop_ty(_, val, ty))]; + find_scope_cx(cx).cleanups += [clean_temp(val, bind drop_ty(_, val, ty))]; } // Note that this only works for temporaries. We should, at some point, move @@ -326,22 +322,23 @@ fn revoke_clean(cx: &@block_ctxt, val: ValueRef) { sc_cx.cleanups = std::vec::slice(sc_cx.cleanups, 0u, found as uint) + std::vec::slice(sc_cx.cleanups, (found as uint) + 1u, - std::vec::len(sc_cx.cleanups)); + std::vec::len(sc_cx.cleanups)); } -fn get_res_dtor(ccx : &@crate_ctxt, sp : &span, did : &ast::def_id, - inner_t : ty::t) -> ValueRef { +fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id, + inner_t: ty::t) -> ValueRef { if did.crate == ast::local_crate { alt ccx.fn_pairs.find(did.node) { - some(x) { ret x; } - _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); } + some(x) { ret x; } + _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); } } } let params = csearch::get_type_param_count(ccx.sess.get_cstore(), did); - let f_t = trans::type_of_fn(ccx, sp, ast::proto_fn, - ~[{ mode: ty::mo_alias(false), ty: inner_t }], - ty::mk_nil(ccx.tcx), params); + let f_t = + trans::type_of_fn(ccx, sp, ast::proto_fn, + [{mode: ty::mo_alias(false), ty: inner_t}], + ty::mk_nil(ccx.tcx), params); ret trans::get_extern_const(ccx.externs, ccx.llmod, csearch::get_symbol(ccx.sess.get_cstore(), did), @@ -378,36 +375,35 @@ tag block_kind { // code. Each basic block we generate is attached to a function, typically // with many basic blocks per function. All the basic blocks attached to a // function are organized as a directed graph. -type block_ctxt = { +type block_ctxt = // The BasicBlockRef returned from a call to // llvm::LLVMAppendBasicBlock(llfn, name), which adds a basic // block to the function pointed to by llfn. We insert // instructions into that block by way of this block context. - llbb: BasicBlockRef, // The llvm::builder object serving as an interface to LLVM's // LLVMBuild* functions. - build: builder, // The block pointing to this one in the function's digraph. - parent: block_parent, // The 'kind' of basic block this is. - kind: block_kind, // A list of functions that run at the end of translating this // block, cleaning up any variables that were introduced in the // block and need to go out of scope at the end of it. - mutable cleanups: [cleanup], // The source span where this block comes from, for error // reporting. - sp: span, // The function context for the function to which this block is // attached. - fcx: @fn_ctxt -}; + {llbb: BasicBlockRef, + build: builder, + parent: block_parent, + kind: block_kind, + mutable cleanups: [cleanup], + sp: span, + fcx: @fn_ctxt}; // FIXME: we should be able to use option::t<@block_parent> here but // the infinite-tag check in rustboot gets upset. @@ -417,7 +413,7 @@ type result = {bcx: @block_ctxt, val: ValueRef}; type result_t = {bcx: @block_ctxt, val: ValueRef, ty: ty::t}; fn extend_path(cx: @local_ctxt, name: &str) -> @local_ctxt { - ret @{path: cx.path + ~[name] with *cx}; + ret @{path: cx.path + [name] with *cx}; } fn rslt(bcx: @block_ctxt, val: ValueRef) -> result { @@ -438,7 +434,7 @@ fn struct_elt(llstructty: TypeRef, n: uint) -> TypeRef { assert (n < elt_count); let elt_tys = std::vec::init_elt(T_nil(), elt_count); llvm::LLVMGetStructElementTypes(llstructty, std::vec::to_ptr(elt_tys)); - ret llvm::LLVMGetElementType(elt_tys.(n)); + ret llvm::LLVMGetElementType(elt_tys[n]); } fn find_scope_cx(cx: &@block_ctxt) -> @block_ctxt { @@ -459,8 +455,8 @@ fn bcx_tcx(bcx: &@block_ctxt) -> ty::ctxt { ret bcx.fcx.lcx.ccx.tcx; } fn bcx_ccx(bcx: &@block_ctxt) -> @crate_ctxt { ret bcx.fcx.lcx.ccx; } fn bcx_lcx(bcx: &@block_ctxt) -> @local_ctxt { ret bcx.fcx.lcx; } fn bcx_fcx(bcx: &@block_ctxt) -> @fn_ctxt { ret bcx.fcx; } -fn fcx_ccx(fcx: &@fn_ctxt) -> @crate_ctxt { ret fcx.lcx.ccx; } -fn fcx_tcx(fcx: &@fn_ctxt) -> ty::ctxt { ret fcx.lcx.ccx.tcx; } +fn fcx_ccx(fcx: &@fn_ctxt) -> @crate_ctxt { ret fcx.lcx.ccx; } +fn fcx_tcx(fcx: &@fn_ctxt) -> ty::ctxt { ret fcx.lcx.ccx.tcx; } fn lcx_ccx(lcx: &@local_ctxt) -> @crate_ctxt { ret lcx.ccx; } fn ccx_tcx(ccx: &@crate_ctxt) -> ty::ctxt { ret ccx.tcx; } @@ -527,7 +523,7 @@ fn T_fn(inputs: &[TypeRef], output: TypeRef) -> TypeRef { } fn T_fn_pair(cx: &crate_ctxt, tfn: TypeRef) -> TypeRef { - ret T_struct(~[T_ptr(tfn), T_opaque_closure_ptr(cx)]); + ret T_struct([T_ptr(tfn), T_opaque_closure_ptr(cx)]); } fn T_ptr(t: TypeRef) -> TypeRef { ret llvm::LLVMPointerType(t, 0u); } @@ -547,7 +543,7 @@ fn set_struct_body(t: TypeRef, elts: &[TypeRef]) { False); } -fn T_empty_struct() -> TypeRef { ret T_struct(~[]); } +fn T_empty_struct() -> TypeRef { ret T_struct([]); } // NB: This will return something different every time it's called. If // you need a generic object type that matches the type of your @@ -556,25 +552,27 @@ fn T_empty_struct() -> TypeRef { ret T_struct(~[]); } fn T_rust_object() -> TypeRef { let t = T_named_struct("rust_object"); let e = T_ptr(T_empty_struct()); - set_struct_body(t, ~[e, e]); + set_struct_body(t, [e, e]); ret t; } fn T_task() -> TypeRef { let t = T_named_struct("task"); - let // Refcount - // Delegate pointer - // Stack segment pointer - // Runtime SP - // Rust SP - // GC chain - - // Domain pointer - // Crate cache pointer - elems = - ~[T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), - T_int()]; + // Refcount + // Delegate pointer + // Stack segment pointer + // Runtime SP + // Rust SP + // GC chain + + + // Domain pointer + // Crate cache pointer + + let elems = + [T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), + T_int()]; set_struct_body(t, elems); ret t; } @@ -586,7 +584,7 @@ fn T_tydesc_field(cx: &crate_ctxt, field: int) -> TypeRef { std::vec::init_elt::<TypeRef>(T_nil(), abi::n_tydesc_fields as uint); llvm::LLVMGetStructElementTypes(cx.tydesc_type, std::vec::to_ptr::<TypeRef>(tydesc_elts)); - let t = llvm::LLVMGetElementType(tydesc_elts.(field)); + let t = llvm::LLVMGetElementType(tydesc_elts[field]); ret t; } @@ -611,16 +609,16 @@ fn T_tydesc(taskptr_type: TypeRef) -> TypeRef { let tydescpp = T_ptr(T_ptr(tydesc)); let pvoid = T_ptr(T_i8()); let glue_fn_ty = - T_ptr(T_fn(~[T_ptr(T_nil()), taskptr_type, T_ptr(T_nil()), tydescpp, - pvoid], T_void())); + T_ptr(T_fn([T_ptr(T_nil()), taskptr_type, T_ptr(T_nil()), tydescpp, + pvoid], T_void())); let cmp_glue_fn_ty = - T_ptr(T_fn(~[T_ptr(T_i1()), taskptr_type, T_ptr(tydesc), tydescpp, - pvoid, pvoid, T_i8()], T_void())); + T_ptr(T_fn([T_ptr(T_i1()), taskptr_type, T_ptr(tydesc), tydescpp, + pvoid, pvoid, T_i8()], T_void())); let elems = - ~[tydescpp, T_int(), T_int(), glue_fn_ty, glue_fn_ty, glue_fn_ty, - glue_fn_ty, glue_fn_ty, glue_fn_ty, glue_fn_ty, cmp_glue_fn_ty, - T_ptr(T_i8()), T_ptr(T_i8()), T_int()]; + [tydescpp, T_int(), T_int(), glue_fn_ty, glue_fn_ty, glue_fn_ty, + glue_fn_ty, glue_fn_ty, glue_fn_ty, glue_fn_ty, cmp_glue_fn_ty, + T_ptr(T_i8()), T_ptr(T_i8()), T_int()]; set_struct_body(tydesc, elems); ret tydesc; } @@ -628,13 +626,13 @@ fn T_tydesc(taskptr_type: TypeRef) -> TypeRef { fn T_array(t: TypeRef, n: uint) -> TypeRef { ret llvm::LLVMArrayType(t, n); } fn T_evec(t: TypeRef) -> TypeRef { - ret T_struct(~[T_int(), // Refcount - T_int(), // Alloc - T_int(), // Fill + ret T_struct([T_int(), // Refcount + T_int(), // Alloc + T_int(), // Fill - T_int(), // Pad - // Body elements - T_array(t, 0u)]); + T_int(), // Pad + // Body elements + T_array(t, 0u)]); } fn T_opaque_vec_ptr() -> TypeRef { ret T_ptr(T_evec(T_int())); } @@ -644,24 +642,24 @@ fn T_opaque_vec_ptr() -> TypeRef { ret T_ptr(T_evec(T_int())); } // // TODO: Support user-defined vector sizes. fn T_ivec(t: TypeRef) -> TypeRef { - ret T_struct(~[T_int(), // Length ("fill"; if zero, heapified) - T_int(), // Alloc - T_array(t, abi::ivec_default_length)]); // Body elements + ret T_struct([T_int(), // Length ("fill"; if zero, heapified) + T_int(), // Alloc + T_array(t, abi::ivec_default_length)]); // Body elements } // Note that the size of this one is in bytes. fn T_opaque_ivec() -> TypeRef { - ret T_struct(~[T_int(), // Length ("fill"; if zero, heapified) - T_int(), // Alloc - T_array(T_i8(), 0u)]); // Body elements + ret T_struct([T_int(), // Length ("fill"; if zero, heapified) + T_int(), // Alloc + T_array(T_i8(), 0u)]); // Body elements } fn T_ivec_heap_part(t: TypeRef) -> TypeRef { - ret T_struct(~[T_int(), // Real length - T_array(t, 0u)]); // Body elements + ret T_struct([T_int(), // Real length + T_array(t, 0u)]); // Body elements } @@ -669,36 +667,36 @@ fn T_ivec_heap_part(t: TypeRef) -> TypeRef { // Interior vector on the heap, also known as the "stub". Cast to this when // the allocated length (second element of T_ivec above) is zero. fn T_ivec_heap(t: TypeRef) -> TypeRef { - ret T_struct(~[T_int(), // Length (zero) - T_int(), // Alloc - T_ptr(T_ivec_heap_part(t))]); // Pointer + ret T_struct([T_int(), // Length (zero) + T_int(), // Alloc + T_ptr(T_ivec_heap_part(t))]); // Pointer } fn T_opaque_ivec_heap_part() -> TypeRef { - ret T_struct(~[T_int(), // Real length - T_array(T_i8(), 0u)]); // Body elements + ret T_struct([T_int(), // Real length + T_array(T_i8(), 0u)]); // Body elements } fn T_opaque_ivec_heap() -> TypeRef { - ret T_struct(~[T_int(), // Length (zero) - T_int(), // Alloc - T_ptr(T_opaque_ivec_heap_part())]); // Pointer + ret T_struct([T_int(), // Length (zero) + T_int(), // Alloc + T_ptr(T_opaque_ivec_heap_part())]); // Pointer } fn T_str() -> TypeRef { ret T_evec(T_i8()); } -fn T_box(t: TypeRef) -> TypeRef { ret T_struct(~[T_int(), t]); } +fn T_box(t: TypeRef) -> TypeRef { ret T_struct([T_int(), t]); } fn T_port(_t: TypeRef) -> TypeRef { - ret T_struct(~[T_int()]); // Refcount + ret T_struct([T_int()]); // Refcount } fn T_chan(_t: TypeRef) -> TypeRef { - ret T_struct(~[T_int()]); // Refcount + ret T_struct([T_int()]); // Refcount } @@ -716,14 +714,13 @@ fn T_typaram(tn: &type_names) -> TypeRef { fn T_typaram_ptr(tn: &type_names) -> TypeRef { ret T_ptr(T_typaram(tn)); } -fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef, - n_ty_params: uint) -> TypeRef { +fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef, n_ty_params: uint) + -> TypeRef { // NB: keep this in sync with code in trans_bind; we're making // an LLVM typeref structure that has the same "shape" as the ty::t // it constructs. - ret T_ptr(T_box(T_struct(~[T_ptr(cx.tydesc_type), - llbindings_ty, - T_captured_tydescs(cx, n_ty_params)]))); + ret T_ptr(T_box(T_struct([T_ptr(cx.tydesc_type), llbindings_ty, + T_captured_tydescs(cx, n_ty_params)]))); } fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef { @@ -737,7 +734,7 @@ fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef { fn T_tag(tn: &type_names, size: uint) -> TypeRef { let s = "tag_" + uint::to_str(size, 10u); if tn.name_has_type(s) { ret tn.get_type(s); } - let t = T_struct(~[T_int(), T_array(T_i8(), size)]); + let t = T_struct([T_int(), T_array(T_i8(), size)]); tn.associate(s, t); ret t; } @@ -745,7 +742,7 @@ fn T_tag(tn: &type_names, size: uint) -> TypeRef { fn T_opaque_tag(tn: &type_names) -> TypeRef { let s = "opaque_tag"; if tn.name_has_type(s) { ret tn.get_type(s); } - let t = T_struct(~[T_int(), T_i8()]); + let t = T_struct([T_int(), T_i8()]); tn.associate(s, t); ret t; } @@ -763,8 +760,8 @@ fn T_obj_ptr(cx: &crate_ctxt, n_captured_tydescs: uint) -> TypeRef { // type. The dynamically-sized fields follow the captured tydescs. fn T_obj(cx: &crate_ctxt, n_captured_tydescs: uint) -> TypeRef { - ret T_struct(~[T_ptr(cx.tydesc_type), - T_captured_tydescs(cx, n_captured_tydescs)]); + ret T_struct([T_ptr(cx.tydesc_type), + T_captured_tydescs(cx, n_captured_tydescs)]); } ret T_ptr(T_box(T_obj(cx, n_captured_tydescs))); } @@ -832,14 +829,15 @@ fn C_cstr(cx: &@crate_ctxt, s: &str) -> ValueRef { // A rust boxed-and-length-annotated string. fn C_str(cx: &@crate_ctxt, s: &str) -> ValueRef { - let len = str::byte_len(s); - let // 'alloc' - // 'fill' - // 'pad' - box = - C_struct(~[C_int(abi::const_refcount as int), C_int(len + 1u as int), - C_int(len + 1u as int), C_int(0), - llvm::LLVMConstString(str::buf(s), len, False)]); + let len = + str::byte_len(s); // 'alloc' + // 'fill' + // 'pad' + + let box = + C_struct([C_int(abi::const_refcount as int), C_int(len + 1u as int), + C_int(len + 1u as int), C_int(0), + llvm::LLVMConstString(str::buf(s), len, False)]); let g = llvm::LLVMAddGlobal(cx.llmod, val_ty(box), str::buf(cx.names.next("str"))); @@ -856,8 +854,8 @@ fn C_postr(s: &str) -> ValueRef { fn C_zero_byte_arr(size: uint) -> ValueRef { let i = 0u; - let elts: [ValueRef] = ~[]; - while i < size { elts += ~[C_u8(0u)]; i += 1u; } + let elts: [ValueRef] = []; + while i < size { elts += [C_u8(0u)]; i += 1u; } ret llvm::LLVMConstArray(T_i8(), std::vec::to_ptr(elts), std::vec::len(elts)); } @@ -873,19 +871,19 @@ fn C_named_struct(T: TypeRef, elts: &[ValueRef]) -> ValueRef { } fn C_array(ty: TypeRef, elts: &[ValueRef]) -> ValueRef { - ret llvm::LLVMConstArray(ty, std::vec::to_ptr(elts), - std::vec::len(elts)); + ret llvm::LLVMConstArray(ty, std::vec::to_ptr(elts), std::vec::len(elts)); } -fn C_bytes(bytes : &[u8]) -> ValueRef { +fn C_bytes(bytes: &[u8]) -> ValueRef { ret llvm::LLVMConstString(unsafe::reinterpret_cast(vec::to_ptr(bytes)), vec::len(bytes), False); } -fn C_shape(ccx : &@crate_ctxt, bytes : &[u8]) -> ValueRef { +fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef { let llshape = C_bytes(bytes); - let llglobal = llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), - str::buf(ccx.names.next("shape"))); + let llglobal = + llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), + str::buf(ccx.names.next("shape"))); llvm::LLVMSetInitializer(llglobal, llshape); llvm::LLVMSetGlobalConstant(llglobal, True); llvm::LLVMSetLinkage(llglobal, diff --git a/src/comp/middle/trans_objects.rs b/src/comp/middle/trans_objects.rs index 8a95fb90334..627dedf90a1 100644 --- a/src/comp/middle/trans_objects.rs +++ b/src/comp/middle/trans_objects.rs @@ -43,10 +43,10 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // The fields of our object will become the arguments to the function // we're creating. - let fn_args: [ast::arg] = ~[]; + let fn_args: [ast::arg] = []; for f: ast::obj_field in ob.fields { fn_args += - ~[{mode: ast::alias(false), ty: f.ty, ident: f.ident, id: f.id}]; + [{mode: ast::alias(false), ty: f.ty, ident: f.ident, id: f.id}]; } let fcx = new_fn_ctxt(cx, sp, llctor_decl); @@ -77,15 +77,14 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // abi::obj_field_vtbl and abi::obj_field_box simply specify words 0 and 1 // of 'pair'. let pair_vtbl = - bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_vtbl)]); - let pair_box = - bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_box)]); + bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_vtbl)]); + let pair_box = bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_box)]); // Make a vtable for this object: a static array of pointers to functions. // It will be located in the read-only memory of the executable we're // creating and will contain ValueRefs for all of this object's methods. // create_vtbl returns a pointer to the vtable, which we store. - let vtbl = create_vtbl(cx, sp, self_ty, ob, ty_params, none, ~[]); + let vtbl = create_vtbl(cx, sp, self_ty, ob, ty_params, none, []); vtbl = bcx.build.PointerCast(vtbl, T_ptr(T_empty_struct())); bcx.build.Store(vtbl, pair_vtbl); @@ -103,18 +102,18 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // Store null into pair, if no args or typarams. bcx.build.Store(C_null(llbox_ty), pair_box); } else { - let obj_fields: [ty::t] = ~[]; - for a: ty::arg in arg_tys { obj_fields += ~[a.ty]; } + let obj_fields: [ty::t] = []; + for a: ty::arg in arg_tys { obj_fields += [a.ty]; } - let tps: [ty::t] = ~[]; + let tps: [ty::t] = []; let tydesc_ty = ty::mk_type(ccx.tcx); - for tp: ast::ty_param in ty_params { tps += ~[tydesc_ty]; } + for tp: ast::ty_param in ty_params { tps += [tydesc_ty]; } // Synthesize an object body type and hand it off to // trans_malloc_boxed, which allocates a box, including space for a // refcount. - let body_ty: ty::t = create_object_body_type(ccx.tcx, obj_fields, tps, - none); + let body_ty: ty::t = + create_object_body_type(ccx.tcx, obj_fields, tps, none); let box = trans_malloc_boxed(bcx, body_ty); bcx = box.bcx; let body = box.body; @@ -129,8 +128,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // later. let body_tydesc = - GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_tydesc]); + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_tydesc]); bcx = body_tydesc.bcx; let ti = none::<@tydesc_info>; let body_td = get_tydesc(bcx, body_ty, true, ti).result; @@ -148,16 +146,15 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // Copy typarams into captured typarams. let body_typarams = - GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_typarams]); + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_typarams]); bcx = body_typarams.bcx; // TODO: can we just get typarams_ty out of body_ty instead? let typarams_ty: ty::t = ty::mk_tup(ccx.tcx, tps); let i: int = 0; for tp: ast::ty_param in ty_params { - let typaram = bcx.fcx.lltydescs.(i); + let typaram = bcx.fcx.lltydescs[i]; let capture = - GEP_tup_like(bcx, typarams_ty, body_typarams.val, ~[0, i]); + GEP_tup_like(bcx, typarams_ty, body_typarams.val, [0, i]); bcx = capture.bcx; bcx = copy_val(bcx, INIT, capture.val, typaram, tydesc_ty).bcx; i += 1; @@ -165,20 +162,19 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj, // Copy args into body fields. let body_fields = - GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_fields]); + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_fields]); bcx = body_fields.bcx; i = 0; for f: ast::obj_field in ob.fields { alt bcx.fcx.llargs.find(f.id) { some(arg1) { - let arg = load_if_immediate(bcx, arg1, arg_tys.(i).ty); + let arg = load_if_immediate(bcx, arg1, arg_tys[i].ty); // TODO: can we just get fields_ty out of body_ty instead? let fields_ty: ty::t = ty::mk_tup(ccx.tcx, obj_fields); let field = - GEP_tup_like(bcx, fields_ty, body_fields.val, ~[0, i]); + GEP_tup_like(bcx, fields_ty, body_fields.val, [0, i]); bcx = field.bcx; - bcx = copy_val(bcx, INIT, field.val, arg, arg_tys.(i).ty).bcx; + bcx = copy_val(bcx, INIT, field.val, arg, arg_tys[i].ty).bcx; i += 1; } none. { @@ -210,16 +206,16 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // Fields. FIXME (part of issue #538): Where do we fill in the field // *values* from the outer object? - let additional_fields: [ast::anon_obj_field] = ~[]; - let additional_field_vals: [result] = ~[]; - let additional_field_tys: [ty::t] = ~[]; + let additional_fields: [ast::anon_obj_field] = []; + let additional_field_vals: [result] = []; + let additional_field_tys: [ty::t] = []; alt anon_obj.fields { none. { } some(fields) { additional_fields = fields; for f: ast::anon_obj_field in fields { - additional_field_tys += ~[node_id_type(ccx, f.id)]; - additional_field_vals += ~[trans_expr(bcx, f.expr)]; + additional_field_tys += [node_id_type(ccx, f.id)]; + additional_field_vals += [trans_expr(bcx, f.expr)]; } } } @@ -236,7 +232,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, let wrapper_obj: ast::_obj = {fields: std::vec::map(ast::obj_field_from_anon_obj_field, - additional_fields), + additional_fields), methods: anon_obj.methods}; let inner_obj_ty: ty::t; @@ -251,7 +247,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // just pass the outer object to create_vtbl(). Our vtable won't need // to have any forwarding slots. vtbl = - create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, ~[], none, + create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, [], none, additional_field_tys); } some(e) { @@ -269,7 +265,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // forwarding slot. And, of course, we need to create a normal vtable // entry for every method being added. vtbl = - create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, ~[], + create_vtbl(bcx.fcx.lcx, sp, outer_obj_ty, wrapper_obj, [], some(inner_obj_ty), additional_field_tys); } } @@ -283,9 +279,8 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // Grab onto the first and second elements of the pair. let pair_vtbl = - bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_vtbl)]); - let pair_box = - bcx.build.GEP(pair, ~[C_int(0), C_int(abi::obj_field_box)]); + bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_vtbl)]); + let pair_box = bcx.build.GEP(pair, [C_int(0), C_int(abi::obj_field_box)]); vtbl = bcx.build.PointerCast(vtbl, T_ptr(T_empty_struct())); bcx.build.Store(vtbl, pair_vtbl); @@ -307,9 +302,9 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // Synthesize a type for the object body and hand it off to // trans_malloc_boxed, which allocates a box, including space for a // refcount. - let body_ty: ty::t = create_object_body_type(ccx.tcx, - additional_field_tys, - ~[], some(inner_obj_ty)); + let body_ty: ty::t = + create_object_body_type(ccx.tcx, additional_field_tys, [], + some(inner_obj_ty)); let box = trans_malloc_boxed(bcx, body_ty); bcx = box.bcx; let body = box.body; @@ -323,8 +318,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // the types of the object's fields, so that the fields can be freed // later. let body_tydesc = - GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_tydesc]); + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_tydesc]); bcx = body_tydesc.bcx; let ti = none::<@tydesc_info>; let body_td = get_tydesc(bcx, body_ty, true, ti).result; @@ -338,23 +332,20 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // function in its closure: the fields were passed to the object // constructor and are now available to the object's methods. let body_fields = - GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_fields]); + GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_fields]); bcx = body_fields.bcx; let i: int = 0; for f: ast::anon_obj_field in additional_fields { // FIXME (part of issue #538): make this work eventually, when we // have additional field exprs in the AST. - load_if_immediate(bcx, additional_field_vals.(i).val, - additional_field_tys.(i)); - let fields_ty: ty::t = ty::mk_tup(ccx.tcx, - additional_field_tys); - let field = - GEP_tup_like(bcx, fields_ty, body_fields.val, ~[0, i]); + load_if_immediate(bcx, additional_field_vals[i].val, + additional_field_tys[i]); + let fields_ty: ty::t = ty::mk_tup(ccx.tcx, additional_field_tys); + let field = GEP_tup_like(bcx, fields_ty, body_fields.val, [0, i]); bcx = field.bcx; bcx = - copy_val(bcx, INIT, field.val, additional_field_vals.(i).val, - additional_field_tys.(i)).bcx; + copy_val(bcx, INIT, field.val, additional_field_vals[i].val, + additional_field_tys[i]).bcx; i += 1; } @@ -370,7 +361,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, let body_inner_obj = GEP_tup_like(bcx, body_ty, body, - ~[0, abi::obj_body_elt_inner_obj]); + [0, abi::obj_body_elt_inner_obj]); bcx = body_inner_obj.bcx; bcx = copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val, @@ -390,6 +381,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj, // Used only inside create_vtbl and create_backwarding_vtbl to distinguish // different kinds of slots we'll have to create. tag vtbl_mthd { + // Normal methods are complete AST nodes, but for forwarding methods, the // only information we'll have about them is their type. normal_mthd(@ast::method); @@ -421,9 +413,8 @@ fn vtbl_mthd_lteq(a: &vtbl_mthd, b: &vtbl_mthd) -> bool { // filtering_fn: Used by create_vtbl to filter a list of methods to remove the // ones that we don't need forwarding slots for. -fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, - addtl_meths: [@ast::method]) -> - option::t<vtbl_mthd> { +fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, addtl_meths: [@ast::method]) + -> option::t<vtbl_mthd> { // Since m is a fwding_mthd, and we're checking to see if it's in // addtl_meths (which only contains normal_mthds), we can't just check if @@ -448,10 +439,10 @@ fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, // object, and return a pointer to it. fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, ob: &ast::_obj, ty_params: &[ast::ty_param], - inner_obj_ty: option::t<ty::t>, - additional_field_tys: &[ty::t]) -> ValueRef { + inner_obj_ty: option::t<ty::t>, additional_field_tys: &[ty::t]) + -> ValueRef { - let llmethods: [ValueRef] = ~[]; + let llmethods: [ValueRef] = []; alt inner_obj_ty { none. { @@ -460,12 +451,12 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, // Sort and process all the methods. let meths = - std::sort::merge_sort::<@ast::method> - (bind ast_mthd_lteq(_, _), ob.methods); + std::sort::merge_sort::<@ast::method>(bind ast_mthd_lteq(_, _), + ob.methods); for m: @ast::method in meths { - llmethods += ~[process_normal_mthd(cx, m, outer_obj_ty, - ty_params)]; + llmethods += + [process_normal_mthd(cx, m, outer_obj_ty, ty_params)]; } } some(inner_obj_ty) { @@ -478,13 +469,13 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, // we take the set difference of { methods on the original object } // and { methods being added, whether entirely new or overriding }. - let meths: [vtbl_mthd] = ~[]; + let meths: [vtbl_mthd] = []; // Gather up methods on the inner object. alt ty::struct(cx.ccx.tcx, inner_obj_ty) { ty::ty_obj(inner_obj_methods) { for m: ty::method in inner_obj_methods { - meths += ~[fwding_mthd(@m)]; + meths += [fwding_mthd(@m)]; } } _ { @@ -500,12 +491,12 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, // And now add the additional ones, both overriding ones and entirely // new ones. These will just be normal methods. - for m: @ast::method in ob.methods { meths += ~[normal_mthd(m)]; } + for m: @ast::method in ob.methods { meths += [normal_mthd(m)]; } // Sort all the methods and process them. meths = - std::sort::merge_sort::<vtbl_mthd> - (bind vtbl_mthd_lteq(_, _), meths); + std::sort::merge_sort::<vtbl_mthd>(bind vtbl_mthd_lteq(_, _), + meths); // To create forwarding methods, we'll need a "backwarding" vtbl. See // create_backwarding_vtbl and process_bkwding_method for details. @@ -516,13 +507,13 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t, alt m { normal_mthd(nm) { llmethods += - ~[process_normal_mthd(cx, nm, outer_obj_ty, ty_params)]; + [process_normal_mthd(cx, nm, outer_obj_ty, ty_params)]; } fwding_mthd(fm) { llmethods += - ~[process_fwding_mthd(cx, sp, fm, ty_params, inner_obj_ty, - backwarding_vtbl, - additional_field_tys)]; + [process_fwding_mthd(cx, sp, fm, ty_params, inner_obj_ty, + backwarding_vtbl, + additional_field_tys)]; } } } @@ -542,40 +533,36 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t, // object, and it needs to forward them to the corresponding slots on the // outer object. All we know about either one are their types. - let llmethods: [ValueRef] = ~[]; - let meths: [ty::method]= ~[]; + let llmethods: [ValueRef] = []; + let meths: [ty::method] = []; // Gather up methods on the inner object. alt ty::struct(cx.ccx.tcx, inner_obj_ty) { - ty::ty_obj(inner_obj_methods) { - for m: ty::method in inner_obj_methods { - meths += ~[m]; - } - } - _ { - // Shouldn't happen. - cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \ + ty::ty_obj(inner_obj_methods) { + for m: ty::method in inner_obj_methods { meths += [m]; } + } + _ { + // Shouldn't happen. + cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \ non-object"); - } + } } // Methods should have already been sorted, so no need to do so again. for m: ty::method in meths { // We pass outer_obj_ty to process_fwding_mthd() because it's the one // being forwarded to. - llmethods += ~[process_bkwding_mthd( - cx, sp, @m, ~[], outer_obj_ty, ~[])]; + llmethods += [process_bkwding_mthd(cx, sp, @m, [], outer_obj_ty, [])]; } - ret finish_vtbl(cx, llmethods, "backwarding_vtbl"); } // finish_vtbl: Given a vector of vtable entries, create the table in // read-only memory and return a pointer to it. -fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str) - -> ValueRef { +fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str) -> + ValueRef { let vtbl = C_struct(llmethods); - let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + ~[name]); + let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + [name]); let gvar = llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), str::buf(vtbl_name)); llvm::LLVMSetInitializer(gvar, vtbl); @@ -600,17 +587,17 @@ fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: str) // the corresponding method on inner does, calls that method on outer, and // returns the value returned from that call. fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, - ty_params: &[ast::ty_param], outer_obj_ty: ty::t, - _additional_field_tys: &[ty::t]) -> ValueRef { + ty_params: &[ast::ty_param], outer_obj_ty: ty::t, + _additional_field_tys: &[ty::t]) -> ValueRef { // Create a local context that's aware of the name of the method we're // creating. - let mcx: @local_ctxt = @{path: cx.path + ~["method", m.ident] with *cx}; + let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx}; // Make up a name for the backwarding function. let fn_name: str = "backwarding_fn"; - let s: str = mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, - fn_name); + let s: str = + mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name); // Get the backwarding function's type and declare it. let llbackwarding_fn_ty: TypeRef = @@ -630,19 +617,17 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // self-stack to get to the one we really want. // Cast to self-stack's type. - let llenv = bcx.build.PointerCast( - fcx.llenv, - T_ptr(T_struct(~[cx.ccx.rust_object_type, - T_ptr(cx.ccx.rust_object_type)]))); - - let llself_obj_ptr = bcx.build.GEP(llenv, - ~[C_int(0), - C_int(1)]); + let llenv = + bcx.build.PointerCast( + fcx.llenv, + T_ptr(T_struct([cx.ccx.rust_object_type, + T_ptr(cx.ccx.rust_object_type)]))); + let llself_obj_ptr = bcx.build.GEP(llenv, [C_int(0), C_int(1)]); llself_obj_ptr = bcx.build.Load(llself_obj_ptr); // Cast it back to pointer-to-object-type, so LLVM won't complain. - llself_obj_ptr = bcx.build.PointerCast(llself_obj_ptr, - T_ptr(cx.ccx.rust_object_type)); + llself_obj_ptr = + bcx.build.PointerCast(llself_obj_ptr, T_ptr(cx.ccx.rust_object_type)); // The 'llretptr' that will arrive in the backwarding function we're // creating also needs to be the correct type. Cast it to the method's @@ -670,13 +655,12 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u)); let llouter_obj_vtbl = - bcx.build.GEP(llself_obj_ptr, - ~[C_int(0), C_int(abi::obj_field_vtbl)]); + bcx.build.GEP(llself_obj_ptr, [C_int(0), C_int(abi::obj_field_vtbl)]); llouter_obj_vtbl = bcx.build.Load(llouter_obj_vtbl); llouter_obj_vtbl = bcx.build.PointerCast(llouter_obj_vtbl, vtbl_type); let llouter_mthd = - bcx.build.GEP(llouter_obj_vtbl, ~[C_int(0), C_int(ix as int)]); + bcx.build.GEP(llouter_obj_vtbl, [C_int(0), C_int(ix as int)]); // Set up the outer method to be called. let outer_mthd_ty = ty::method_ty_to_fn_ty(cx.ccx.tcx, *m); @@ -692,7 +676,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Set up the three implicit arguments to the outer method we'll need to // call. let self_arg = llself_obj_ptr; - let llouter_mthd_args: [ValueRef] = ~[llretptr, fcx.lltaskptr, self_arg]; + let llouter_mthd_args: [ValueRef] = [llretptr, fcx.lltaskptr, self_arg]; // Copy the explicit arguments that are being passed into the forwarding // function (they're in fcx.llargs) to llouter_mthd_args. @@ -703,7 +687,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, if arg.mode == ty::mo_val { passed_arg = load_if_immediate(bcx, passed_arg, arg.ty); } - llouter_mthd_args += ~[passed_arg]; + llouter_mthd_args += [passed_arg]; a += 1u; } @@ -737,12 +721,12 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Create a local context that's aware of the name of the method we're // creating. - let mcx: @local_ctxt = @{path: cx.path + ~["method", m.ident] with *cx}; + let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx}; // Make up a name for the forwarding function. let fn_name: str = "forwarding_fn"; - let s: str = mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, - fn_name); + let s: str = + mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name); // Get the forwarding function's type and declare it. let llforwarding_fn_ty: TypeRef = @@ -776,7 +760,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // First, grab the box out of the self_obj. It contains a refcount and a // body. let llself_obj_box = - bcx.build.GEP(llself_obj_ptr, ~[C_int(0), C_int(abi::obj_field_box)]); + bcx.build.GEP(llself_obj_ptr, [C_int(0), C_int(abi::obj_field_box)]); llself_obj_box = bcx.build.Load(llself_obj_box); let ccx = bcx_ccx(bcx); @@ -786,13 +770,13 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Now, reach into the box and grab the body. let llself_obj_body = bcx.build.GEP(llself_obj_box, - ~[C_int(0), C_int(abi::box_rc_field_body)]); + [C_int(0), C_int(abi::box_rc_field_body)]); // Now, we need to figure out exactly what type the body is supposed to be // cast to. - let body_ty: ty::t = create_object_body_type(cx.ccx.tcx, - additional_field_tys, ~[], - some(inner_obj_ty)); + let body_ty: ty::t = + create_object_body_type(cx.ccx.tcx, additional_field_tys, [], + some(inner_obj_ty)); // And cast to that type. llself_obj_body = bcx.build.PointerCast(llself_obj_body, @@ -801,7 +785,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // Now, reach into the body and grab the inner_obj. let llinner_obj = GEP_tup_like(bcx, body_ty, llself_obj_body, - ~[0, abi::obj_body_elt_inner_obj]); + [0, abi::obj_body_elt_inner_obj]); bcx = llinner_obj.bcx; // And, now, somewhere in inner_obj is a vtable with an entry for the @@ -810,12 +794,11 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, // call it. let llinner_obj_vtbl = bcx.build.GEP(llinner_obj.val, - ~[C_int(0), C_int(abi::obj_field_vtbl)]); + [C_int(0), C_int(abi::obj_field_vtbl)]); llinner_obj_vtbl = bcx.build.Load(llinner_obj_vtbl); let llinner_obj_body = - bcx.build.GEP(llinner_obj.val, - ~[C_int(0), C_int(abi::obj_field_box)]); + bcx.build.GEP(llinner_obj.val, [C_int(0), C_int(abi::obj_field_box)]); llinner_obj_body = bcx.build.Load(llinner_obj_body); // Get the index of the method we want. @@ -836,7 +819,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, llinner_obj_vtbl = bcx.build.PointerCast(llinner_obj_vtbl, vtbl_type); let llorig_mthd = - bcx.build.GEP(llinner_obj_vtbl, ~[C_int(0), C_int(ix as int)]); + bcx.build.GEP(llinner_obj_vtbl, [C_int(0), C_int(ix as int)]); // Set up the original method to be called. let orig_mthd_ty = ty::method_ty_to_fn_ty(cx.ccx.tcx, *m); @@ -850,21 +833,21 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, llorig_mthd = bcx.build.Load(llorig_mthd); // Set up the self-stack. - let self_stack = alloca(bcx, T_struct(~[cx.ccx.rust_object_type, - T_ptr(cx.ccx.rust_object_type)])); - self_stack = populate_self_stack(bcx, - self_stack, - llself_obj_ptr, - backwarding_vtbl, - llinner_obj_body); + let self_stack = + alloca(bcx, + T_struct([cx.ccx.rust_object_type, + T_ptr(cx.ccx.rust_object_type)])); + self_stack = + populate_self_stack(bcx, self_stack, llself_obj_ptr, backwarding_vtbl, + llinner_obj_body); // Cast self_stack back to pointer-to-object-type to make LLVM happy. - self_stack = bcx.build.PointerCast(self_stack, - T_ptr(cx.ccx.rust_object_type)); + self_stack = + bcx.build.PointerCast(self_stack, T_ptr(cx.ccx.rust_object_type)); // Set up the three implicit arguments to the original method we'll need // to call. - let llorig_mthd_args: [ValueRef] = ~[llretptr, fcx.lltaskptr, self_stack]; + let llorig_mthd_args: [ValueRef] = [llretptr, fcx.lltaskptr, self_stack]; // Copy the explicit arguments that are being passed into the forwarding // function (they're in fcx.llargs) to llorig_mthd_args. @@ -875,7 +858,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method, if arg.mode == ty::mo_val { passed_arg = load_if_immediate(bcx, passed_arg, arg.ty); } - llorig_mthd_args += ~[passed_arg]; + llorig_mthd_args += [passed_arg]; a += 1u; } @@ -901,12 +884,14 @@ fn create_object_body_type(tcx: &ty::ctxt, fields_ty: &[ty::t], let body_ty: ty::t; alt maybe_inner_obj_ty { some(inner_obj_ty) { - body_ty = ty::mk_tup(tcx, ~[tydesc_ty, typarams_ty_tup, - fields_ty_tup, inner_obj_ty]); + body_ty = + ty::mk_tup(tcx, + [tydesc_ty, typarams_ty_tup, fields_ty_tup, + inner_obj_ty]); } none { - body_ty = ty::mk_tup(tcx, ~[tydesc_ty, typarams_ty_tup, - fields_ty_tup]); + body_ty = + ty::mk_tup(tcx, [tydesc_ty, typarams_ty_tup, fields_ty_tup]); } } @@ -927,7 +912,7 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t, } } let mcx: @local_ctxt = - @{path: cx.path + ~["method", m.node.ident] with *cx}; + @{path: cx.path + ["method", m.node.ident] with *cx}; let s: str = mangle_internal_name_by_path(mcx.ccx, mcx.path); let llfn: ValueRef = decl_internal_fastcall_fn(cx.ccx.llmod, s, llfnty); @@ -949,32 +934,23 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t, // via the llenv argument, and we want the forwarding function to call a // method on a "self" that's inner-obj-shaped, but we also want to hold onto // the outer obj for potential use later by backwarding functions. -fn populate_self_stack(bcx: @block_ctxt, - self_stack: ValueRef, outer_obj: ValueRef, - backwarding_vtbl: ValueRef, inner_obj_body: ValueRef) - -> ValueRef { +fn populate_self_stack(bcx: @block_ctxt, self_stack: ValueRef, + outer_obj: ValueRef, backwarding_vtbl: ValueRef, + inner_obj_body: ValueRef) -> ValueRef { // Drop the outer obj into the second slot. - let self_pair_ptr = bcx.build.GEP(self_stack, - ~[C_int(0), - C_int(1)]); + let self_pair_ptr = bcx.build.GEP(self_stack, [C_int(0), C_int(1)]); bcx.build.Store(outer_obj, self_pair_ptr); // Drop in the backwarding vtbl. - let wrapper_pair = bcx.build.GEP(self_stack, - ~[C_int(0), - C_int(0)]); - let wrapper_vtbl_ptr = bcx.build.GEP(wrapper_pair, - ~[C_int(0), - C_int(0)]); + let wrapper_pair = bcx.build.GEP(self_stack, [C_int(0), C_int(0)]); + let wrapper_vtbl_ptr = bcx.build.GEP(wrapper_pair, [C_int(0), C_int(0)]); let backwarding_vtbl_cast = bcx.build.PointerCast(backwarding_vtbl, T_ptr(T_empty_struct())); bcx.build.Store(backwarding_vtbl_cast, wrapper_vtbl_ptr); // Drop in the inner obj body. - let wrapper_body_ptr = bcx.build.GEP(wrapper_pair, - ~[C_int(0), - C_int(1)]); + let wrapper_body_ptr = bcx.build.GEP(wrapper_pair, [C_int(0), C_int(1)]); bcx.build.Store(inner_obj_body, wrapper_body_ptr); ret self_stack; diff --git a/src/comp/middle/tstate/annotate.rs b/src/comp/middle/tstate/annotate.rs index 1d9fa056363..6aa35018f2f 100644 --- a/src/comp/middle/tstate/annotate.rs +++ b/src/comp/middle/tstate/annotate.rs @@ -23,21 +23,21 @@ import aux::crate_ctxt; import aux::add_node; import middle::tstate::ann::empty_ann; -fn collect_ids_expr(e: &@expr, rs: @mutable [node_id]) { *rs += ~[e.id]; } +fn collect_ids_expr(e: &@expr, rs: @mutable [node_id]) { *rs += [e.id]; } -fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += ~[b.node.id]; } +fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += [b.node.id]; } fn collect_ids_stmt(s: &@stmt, rs: @mutable [node_id]) { alt s.node { stmt_decl(_, id) { log "node_id " + int::str(id); - log_stmt(*s); - *rs += ~[id]; + log_stmt(*s);; + *rs += [id]; } stmt_expr(_, id) { log "node_id " + int::str(id); - log_stmt(*s); - *rs += ~[id]; + log_stmt(*s);; + *rs += [id]; } _ { } } @@ -67,7 +67,7 @@ fn init_vecs(ccx: &crate_ctxt, node_ids: &[node_id], len: uint) { fn visit_fn(ccx: &crate_ctxt, num_constraints: uint, f: &_fn, tps: &[ty_param], sp: &span, i: &fn_ident, id: node_id) { - let node_ids: @mutable [node_id] = @mutable ~[]; + let node_ids: @mutable [node_id] = @mutable []; node_ids_in_fn(f, tps, sp, i, id, node_ids); let node_id_vec = *node_ids; init_vecs(ccx, node_id_vec, num_constraints); diff --git a/src/comp/middle/tstate/auxiliary.rs b/src/comp/middle/tstate/auxiliary.rs index 3e5b25ec5ee..8f9a56b5e20 100644 --- a/src/comp/middle/tstate/auxiliary.rs +++ b/src/comp/middle/tstate/auxiliary.rs @@ -122,7 +122,7 @@ fn tos(v: &[uint]) -> str { for i: uint in v { if i == 0u { rslt += "0"; - } else if (i == 1u) { rslt += "1"; } else { rslt += "?"; } + } else if i == 1u { rslt += "1"; } else { rslt += "?"; } } ret rslt; } @@ -239,45 +239,45 @@ type norm_constraint = {bit_num: uint, c: sp_constr}; type constr_map = @std::map::hashmap<def_id, constraint>; /* Contains stuff that has to be computed up front */ +/* For easy access, the fn_info stores two special constraints for each +function. i_return holds if all control paths in this function terminate +in either a return expression, or an appropriate tail expression. +i_diverge holds if all control paths in this function terminate in a fail +or diverging call. + +It might be tempting to use a single constraint C for both properties, +where C represents i_return and !C represents i_diverge. This is +inadvisable, because then the sense of the bit depends on context. If we're +inside a ! function, that reverses the sense of the bit: C would be +i_diverge and !C would be i_return. That's awkward, because we have to +pass extra context around to functions that shouldn't care. + +Okay, suppose C represents i_return and !C represents i_diverge, regardless +of context. Consider this code: + +if (foo) { ret; } else { fail; } + +C is true in the consequent and false in the alternative. What's T `join` +F, then? ? doesn't work, because this code should definitely-return if the +context is a returning function (and be definitely-rejected if the context +is a ! function). F doesn't work, because then the code gets incorrectly +rejected if the context is a returning function. T would work, but it +doesn't make sense for T `join` F to be T (consider init constraints, for +example).; + +So we need context. And so it seems clearer to just have separate +constraints. +*/ type fn_info = {constrs: constr_map, num_constraints: uint, cf: controlflow, -/* For easy access, the fn_info stores two special constraints for each - function. i_return holds if all control paths in this function terminate - in either a return expression, or an appropriate tail expression. - i_diverge holds if all control paths in this function terminate in a fail - or diverging call. - - It might be tempting to use a single constraint C for both properties, - where C represents i_return and !C represents i_diverge. This is - inadvisable, because then the sense of the bit depends on context. If we're - inside a ! function, that reverses the sense of the bit: C would be - i_diverge and !C would be i_return. That's awkward, because we have to - pass extra context around to functions that shouldn't care. - - Okay, suppose C represents i_return and !C represents i_diverge, regardless - of context. Consider this code: - - if (foo) { ret; } else { fail; } - - C is true in the consequent and false in the alternative. What's T `join` - F, then? ? doesn't work, because this code should definitely-return if the - context is a returning function (and be definitely-rejected if the context - is a ! function). F doesn't work, because then the code gets incorrectly - rejected if the context is a returning function. T would work, but it - doesn't make sense for T `join` F to be T (consider init constraints, for - example).; - - So we need context. And so it seems clearer to just have separate - constraints. -*/ i_return: tsconstr, i_diverge: tsconstr, - /* list, accumulated during pre/postcondition + /* list, accumulated during pre/postcondition computation, of all local variables that may be used */ -// Doesn't seem to work without the @ -- bug + // Doesn't seem to work without the @ -- bug used_vars: @mutable [node_id]}; fn tsconstr_to_def_id(t: &tsconstr) -> def_id { @@ -285,9 +285,10 @@ fn tsconstr_to_def_id(t: &tsconstr) -> def_id { } fn tsconstr_to_node_id(t: &tsconstr) -> node_id { - alt t { ninit(id, _) { id } - npred(_, id, _) { - fail "tsconstr_to_node_id called on pred constraint" } } + alt t { + ninit(id, _) { id } + npred(_, id, _) { fail "tsconstr_to_node_id called on pred constraint" } + } } /* mapping from node ID to typestate annotation */ @@ -298,10 +299,7 @@ type node_ann_table = @mutable [mutable ts_ann]; type fn_info_map = @std::map::hashmap<node_id, fn_info>; type fn_ctxt = - {enclosing: fn_info, - id: node_id, - name: ident, - ccx: crate_ctxt}; + {enclosing: fn_info, id: node_id, name: ident, ccx: crate_ctxt}; type crate_ctxt = {tcx: ty::ctxt, node_anns: node_ann_table, fm: fn_info_map}; @@ -315,12 +313,12 @@ fn add_node(ccx: &crate_ctxt, i: node_id, a: &ts_ann) { if sz <= i as uint { vec::grow_mut(*ccx.node_anns, (i as uint) - sz + 1u, empty_ann(0u)); } - ccx.node_anns.(i) = a; + ccx.node_anns[i] = a; } fn get_ts_ann(ccx: &crate_ctxt, i: node_id) -> option::t<ts_ann> { if i as uint < vec::len(*ccx.node_anns) { - ret some::<ts_ann>(ccx.node_anns.(i)); + ret some::<ts_ann>(ccx.node_anns[i]); } else { ret none::<ts_ann>; } } @@ -507,7 +505,7 @@ fn pure_exp(ccx: &crate_ctxt, id: node_id, p: &prestate) -> bool { fn num_constraints(m: fn_info) -> uint { ret m.num_constraints; } fn new_crate_ctxt(cx: ty::ctxt) -> crate_ctxt { - let na: [mutable ts_ann] = ~[mutable]; + let na: [mutable ts_ann] = [mutable]; ret {tcx: cx, node_anns: @mutable na, fm: @new_int_hash::<fn_info>()}; } @@ -524,7 +522,7 @@ fn controlflow_expr(ccx: &crate_ctxt, e: @expr) -> controlflow { fn constraints_expr(cx: &ty::ctxt, e: @expr) -> [@ty::constr] { alt ty::struct(cx, ty::node_id_to_type(cx, e.id)) { ty::ty_fn(_, _, _, _, cs) { ret cs; } - _ { ret ~[]; } + _ { ret []; } } } @@ -557,14 +555,14 @@ fn node_id_to_def_upvar(cx: &fn_ctxt, id: node_id) -> option::t<def> { fn norm_a_constraint(id: def_id, c: &constraint) -> [norm_constraint] { alt c { cinit(n, sp, i) { - ret ~[{bit_num: n, c: respan(sp, ninit(id.node, i))}]; + ret [{bit_num: n, c: respan(sp, ninit(id.node, i))}]; } cpred(p, descs) { - let rslt: [norm_constraint] = ~[]; + let rslt: [norm_constraint] = []; for pd: pred_args in *descs { rslt += - ~[{bit_num: pd.node.bit_num, - c: respan(pd.span, npred(p, id, pd.node.args))}]; + [{bit_num: pd.node.bit_num, + c: respan(pd.span, npred(p, id, pd.node.args))}]; } ret rslt; } @@ -575,8 +573,8 @@ fn norm_a_constraint(id: def_id, c: &constraint) -> [norm_constraint] { // Tried to write this as an iterator, but I got a // non-exhaustive match in trans. fn constraints(fcx: &fn_ctxt) -> [norm_constraint] { - let rslt: [norm_constraint] = ~[]; - for each p: @{key: def_id, val: constraint} in + let rslt: [norm_constraint] = []; + for each p: @{key: def_id, val: constraint} in fcx.enclosing.constrs.items() { rslt += norm_a_constraint(p.key, p.val); } @@ -614,12 +612,12 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use { alt tcx.def_map.find(e.id) { some(def_local(l_id)) { ret @respan(p.span, - carg_ident({ident: p.node.idents.(0), + carg_ident({ident: p.node.idents[0], node: l_id.node})); } some(def_arg(a_id)) { ret @respan(p.span, - carg_ident({ident: p.node.idents.(0), + carg_ident({ident: p.node.idents[0], node: a_id.node})); } _ { @@ -638,17 +636,17 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use { } } -fn exprs_to_constr_args(tcx: ty::ctxt, args: &[@expr]) -> - [@constr_arg_use] { +fn exprs_to_constr_args(tcx: ty::ctxt, args: &[@expr]) -> [@constr_arg_use] { let f = bind expr_to_constr_arg(tcx, _); - let rslt: [@constr_arg_use] = ~[]; - for e: @expr in args { rslt += ~[f(e)]; } + let rslt: [@constr_arg_use] = []; + for e: @expr in args { rslt += [f(e)]; } rslt } fn expr_to_constr(tcx: ty::ctxt, e: &@expr) -> sp_constr { alt e.node { + // FIXME change the first pattern to expr_path to test a // typechecker bug expr_call(operator, args) { @@ -681,9 +679,9 @@ fn pred_args_to_str(p: &pred_args) -> str { fn substitute_constr_args(cx: &ty::ctxt, actuals: &[@expr], c: &@ty::constr) -> tsconstr { - let rslt: [@constr_arg_use] = ~[]; + let rslt: [@constr_arg_use] = []; for a: @constr_arg in c.node.args { - rslt += ~[substitute_arg(cx, actuals, a)]; + rslt += [substitute_arg(cx, actuals, a)]; } ret npred(c.node.path, c.node.id, rslt); } @@ -694,7 +692,7 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) -> alt a.node { carg_ident(i) { if i < num_actuals { - ret expr_to_constr_arg(cx, actuals.(i)); + ret expr_to_constr_arg(cx, actuals[i]); } else { cx.sess.span_fatal(a.span, "Constraint argument out of bounds"); } @@ -704,11 +702,11 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) -> } } -fn pred_args_matches(pattern: &[constr_arg_general_<inst>], - desc: &pred_args) -> bool { +fn pred_args_matches(pattern: &[constr_arg_general_<inst>], desc: &pred_args) + -> bool { let i = 0u; for c: @constr_arg_use in desc.node.args { - let n = pattern.(i); + let n = pattern[i]; alt c.node { carg_ident(p) { alt n { @@ -729,8 +727,8 @@ fn pred_args_matches(pattern: &[constr_arg_general_<inst>], ret true; } -fn find_instance_(pattern: &[constr_arg_general_<inst>], - descs: &[pred_args]) -> option::t<uint> { +fn find_instance_(pattern: &[constr_arg_general_<inst>], descs: &[pred_args]) + -> option::t<uint> { for d: pred_args in descs { if pred_args_matches(pattern, d) { ret some(d.node.bit_num); } } @@ -743,7 +741,7 @@ type subst = [{from: inst, to: inst}]; fn find_instances(_fcx: &fn_ctxt, subst: &subst, c: &constraint) -> [{from: uint, to: uint}] { - let rslt = ~[]; + let rslt = []; if vec::len(subst) == 0u { ret rslt; } alt c { @@ -754,7 +752,7 @@ fn find_instances(_fcx: &fn_ctxt, subst: &subst, c: &constraint) -> let old_bit_num = d.node.bit_num; let new = replace(subst, d); alt find_instance_(new, *descs) { - some(d1) { rslt += ~[{from: old_bit_num, to: d1}]; } + some(d1) { rslt += [{from: old_bit_num, to: d1}]; } _ { } } } @@ -791,18 +789,18 @@ fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> str { } fn replace(subst: subst, d: pred_args) -> [constr_arg_general_<inst>] { - let rslt: [constr_arg_general_<inst>] = ~[]; + let rslt: [constr_arg_general_<inst>] = []; for c: @constr_arg_use in d.node.args { alt c.node { carg_ident(p) { alt find_in_subst(p.node, subst) { - some(new) { rslt += ~[carg_ident(new)]; } - _ { rslt += ~[c.node]; } + some(new) { rslt += [carg_ident(new)]; } + _ { rslt += [c.node]; } } } _ { // log_err "##"; - rslt += ~[c.node]; + rslt += [c.node]; } } } @@ -893,15 +891,15 @@ fn copy_in_poststate_two(fcx: &fn_ctxt, src_post: &poststate, ty: oper_type) { let subst; alt ty { - oper_swap. { subst = ~[{from: dest, to: src}, {from: src, to: dest}]; } + oper_swap. { subst = [{from: dest, to: src}, {from: src, to: dest}]; } oper_assign_op. { ret; // Don't do any propagation } - _ { subst = ~[{from: src, to: dest}]; } + _ { subst = [{from: src, to: dest}]; } } - for each p: @{key: def_id, val: constraint} in + for each p: @{key: def_id, val: constraint} in fcx.enclosing.constrs.items() { // replace any occurrences of the src def_id with the // dest def_id @@ -1000,7 +998,7 @@ fn constraint_mentions(_fcx: &fn_ctxt, c: &norm_constraint, v: node_id) -> bool { ret alt c.c.node { ninit(id, _) { v == id } - npred(_, _, args) { args_mention(args, any_eq, ~[v]) } + npred(_, _, args) { args_mention(args, any_eq, [v]) } }; } @@ -1008,11 +1006,11 @@ fn non_init_constraint_mentions(_fcx: &fn_ctxt, c: &norm_constraint, v: &node_id) -> bool { ret alt c.c.node { ninit(_, _) { false } - npred(_, _, args) { args_mention(args, any_eq, ~[v]) } + npred(_, _, args) { args_mention(args, any_eq, [v]) } }; } -fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool , +fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool, s: &[T]) -> bool { /* FIXME @@ -1038,7 +1036,7 @@ fn args_mention<T>(args: &[@constr_arg_use], q: fn(&[T], node_id) -> bool , ret false; } -fn use_var(fcx: &fn_ctxt, v: &node_id) { *fcx.enclosing.used_vars += ~[v]; } +fn use_var(fcx: &fn_ctxt, v: &node_id) { *fcx.enclosing.used_vars += [v]; } // FIXME: This should be a function in std::vec::. fn vec_contains(v: &@mutable [node_id], i: &node_id) -> bool { @@ -1057,9 +1055,9 @@ fn do_nothing<T>(_f: &_fn, _tp: &[ty_param], _sp: &span, _i: &fn_ident, fn args_to_constr_args(sp: &span, args: &[arg]) -> [@constr_arg_use] { - let actuals: [@constr_arg_use] = ~[]; + let actuals: [@constr_arg_use] = []; for a: arg in args { - actuals += ~[@respan(sp, carg_ident({ident: a.ident, node: a.id}))]; + actuals += [@respan(sp, carg_ident({ident: a.ident, node: a.id}))]; } ret actuals; } @@ -1079,56 +1077,49 @@ fn ast_constr_to_sp_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) -> type binding = {lhs: [inst], rhs: option::t<initializer>}; -fn local_to_bindings(loc : &@local) -> binding { - let lhs = ~[]; +fn local_to_bindings(loc: &@local) -> binding { + let lhs = []; for each p: @pat in pat_bindings(loc.node.pat) { let ident = alt p.node { pat_bind(name) { name } }; - lhs += ~[{ident: ident, node: p.id}]; + lhs += [{ident: ident, node: p.id}]; } - {lhs: lhs, - rhs: loc.node.init} + {lhs: lhs, rhs: loc.node.init} } -fn locals_to_bindings(locals : &[@local]) -> [binding] { +fn locals_to_bindings(locals: &[@local]) -> [binding] { vec::map(local_to_bindings, locals) } fn callee_modes(fcx: &fn_ctxt, callee: node_id) -> [ty::mode] { - let ty = ty::type_autoderef(fcx.ccx.tcx, - ty::node_id_to_type(fcx.ccx.tcx, callee)); + let ty = + ty::type_autoderef(fcx.ccx.tcx, + ty::node_id_to_type(fcx.ccx.tcx, callee)); alt ty::struct(fcx.ccx.tcx, ty) { - ty::ty_fn(_, args, _, _, _) - | ty::ty_native_fn(_, args, _) { - let modes = ~[]; - for arg: ty::arg in args { - modes += ~[arg.mode]; - } + ty::ty_fn(_, args, _, _, _) | ty::ty_native_fn(_, args, _) { + let modes = []; + for arg: ty::arg in args { modes += [arg.mode]; } ret modes; } _ { // Shouldn't happen; callee should be ty_fn. - fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: " - + util::ppaux::ty_to_str(fcx.ccx.tcx, ty)); + fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: " + + util::ppaux::ty_to_str(fcx.ccx.tcx, ty)); } - } + } } fn callee_arg_init_ops(fcx: &fn_ctxt, callee: node_id) -> [init_op] { fn mode_to_op(m: &ty::mode) -> init_op { - alt m { - ty::mo_move. { init_move } - _ { init_assign } - } + alt m { ty::mo_move. { init_move } _ { init_assign } } } vec::map(mode_to_op, callee_modes(fcx, callee)) } -fn anon_bindings(ops: &[init_op], es : &[@expr]) -> [binding] { - let bindings: [binding] = ~[]; +fn anon_bindings(ops: &[init_op], es: &[@expr]) -> [binding] { + let bindings: [binding] = []; let i = 0; for op: init_op in ops { - bindings += ~[{lhs: ~[], - rhs: some({op:op, expr: es.(i)})}]; + bindings += [{lhs: [], rhs: some({op: op, expr: es[i]})}]; i += 1; } ret bindings; diff --git a/src/comp/middle/tstate/bitvectors.rs b/src/comp/middle/tstate/bitvectors.rs index 6e45902dfcf..8c37df3cec4 100644 --- a/src/comp/middle/tstate/bitvectors.rs +++ b/src/comp/middle/tstate/bitvectors.rs @@ -79,7 +79,7 @@ fn seq_tritv(p: &postcond, q: &postcond) { fn seq_postconds(fcx: &fn_ctxt, ps: &[postcond]) -> postcond { let sz = vec::len(ps); if sz >= 1u { - let prev = tritv_clone(ps.(0)); + let prev = tritv_clone(ps[0]); for p: postcond in vec::slice(ps, 1u, sz) { seq_tritv(prev, p); } ret prev; } else { ret ann::empty_poststate(num_constraints(fcx.enclosing)); } @@ -97,7 +97,7 @@ fn seq_preconds(fcx: &fn_ctxt, pps: &[pre_and_post]) -> precond { first: &pre_and_post) -> precond { let sz: uint = vec::len(pps); if sz >= 1u { - let second = pps.(0); + let second = pps[0]; assert (pps_len(second) == num_constraints(fcx.enclosing)); let second_pre = clone(second.precondition); difference(second_pre, first.postcondition); @@ -113,7 +113,7 @@ fn seq_preconds(fcx: &fn_ctxt, pps: &[pre_and_post]) -> precond { if sz >= 1u { - let first = pps.(0); + let first = pps[0]; assert (pps_len(first) == num_vars); ret seq_preconds_go(fcx, vec::slice(pps, 1u, sz), first); } else { ret true_precond(num_vars); } @@ -150,7 +150,7 @@ fn relax_precond_stmt(s: &@stmt, cx: &relax_ctxt, visit::visit_stmt(s, cx, vt); } -type relax_ctxt = {fcx:fn_ctxt, i:node_id}; +type relax_ctxt = {fcx: fn_ctxt, i: node_id}; fn relax_precond_block_inner(b: &blk, cx: &relax_ctxt, vt: &visit::vt<relax_ctxt>) { @@ -158,16 +158,16 @@ fn relax_precond_block_inner(b: &blk, cx: &relax_ctxt, visit::visit_block(b, cx, vt); } -fn relax_precond_block(fcx: &fn_ctxt, i: node_id, b:&blk) { +fn relax_precond_block(fcx: &fn_ctxt, i: node_id, b: &blk) { let cx = {fcx: fcx, i: i}; let visitor = visit::default_visitor::<relax_ctxt>(); visitor = @{visit_block: relax_precond_block_inner, visit_expr: relax_precond_expr, visit_stmt: relax_precond_stmt, - visit_item: (fn (_i: &@item, _cx: &relax_ctxt, - _vt: &visit::vt<relax_ctxt>) {}) - with *visitor}; + visit_item: + fn (_i: &@item, _cx: &relax_ctxt, _vt: &visit::vt<relax_ctxt>) { + } with *visitor}; let v1 = visit::mk_vt(visitor); v1.visit_block(b, cx, v1); } @@ -217,7 +217,7 @@ fn clear_in_poststate_expr(fcx: &fn_ctxt, e: &@expr, t: &poststate) { } } -fn kill_poststate_(fcx : &fn_ctxt, c : &tsconstr, post : &poststate) -> bool { +fn kill_poststate_(fcx: &fn_ctxt, c: &tsconstr, post: &poststate) -> bool { log "kill_poststate_"; ret clear_in_poststate_(bit_num(fcx, c), post); } @@ -241,8 +241,8 @@ fn clear_in_prestate_ident(fcx: &fn_ctxt, id: &node_id, ident: &ident, ret kill_prestate(fcx, parent, ninit(id, ident)); } -fn clear_in_poststate_ident_(fcx : &fn_ctxt, id : &node_id, ident : &ident, - post : &poststate) -> bool { +fn clear_in_poststate_ident_(fcx: &fn_ctxt, id: &node_id, ident: &ident, + post: &poststate) -> bool { ret kill_poststate_(fcx, ninit(id, ident), post); } diff --git a/src/comp/middle/tstate/ck.rs b/src/comp/middle/tstate/ck.rs index 4caa5ca071a..ca28e06c9f8 100644 --- a/src/comp/middle/tstate/ck.rs +++ b/src/comp/middle/tstate/ck.rs @@ -52,8 +52,8 @@ fn check_unused_vars(fcx: &fn_ctxt) { for c: norm_constraint in constraints(fcx) { alt c.c.node { ninit(id, v) { - if !vec_contains(fcx.enclosing.used_vars, id) && - v.(0) != ('_' as u8) { + if !vec_contains(fcx.enclosing.used_vars, id) && v[0] != '_' as u8 + { fcx.ccx.tcx.sess.span_warn(c.c.span, "unused variable " + v); } } @@ -143,17 +143,18 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn, /* Check that the return value is initialized */ let post = aux::block_poststate(fcx.ccx, f.body); if f.proto == ast::proto_fn && - !promises(fcx, post, fcx.enclosing.i_return) && - !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) && - f.decl.cf == return { + !promises(fcx, post, fcx.enclosing.i_return) && + !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) && + f.decl.cf == return { fcx.ccx.tcx.sess.span_err(f.body.span, - "In function " + fcx.name + - ", not all control paths \ + "In function " + fcx.name + + ", not all control paths \ return a value"); fcx.ccx.tcx.sess.span_fatal(f.decl.output.span, "see declared return type of '" + ty_to_str(f.decl.output) + "'"); - } else if (f.decl.cf == noreturn) { + } else if f.decl.cf == noreturn { + // check that this really always fails // Note that it's ok for i_diverge and i_return to both be true. // In fact, i_diverge implies i_return. (But not vice versa!) diff --git a/src/comp/middle/tstate/collect_locals.rs b/src/comp/middle/tstate/collect_locals.rs index 44d48c5037c..277704998ce 100644 --- a/src/comp/middle/tstate/collect_locals.rs +++ b/src/comp/middle/tstate/collect_locals.rs @@ -16,16 +16,17 @@ type ctxt = {cs: @mutable [sp_constr], tcx: ty::ctxt}; fn collect_local(loc: &@local, cx: &ctxt, v: &visit::vt<ctxt>) { for each p: @pat in pat_bindings(loc.node.pat) { let ident = alt p.node { pat_bind(id) { id } }; - log "collect_local: pushing " + ident; - *cx.cs += ~[respan(loc.span, ninit(p.id, ident))]; + log "collect_local: pushing " + ident;; + *cx.cs += [respan(loc.span, ninit(p.id, ident))]; } visit::visit_local(loc, cx, v); } fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) { alt e.node { - expr_check(_, ch) { *cx.cs += ~[expr_to_constr(cx.tcx, ch)]; } - expr_if_check(ex, _, _) { *cx.cs += ~[expr_to_constr(cx.tcx, ex)]; } + expr_check(_, ch) { *cx.cs += [expr_to_constr(cx.tcx, ch)]; } + expr_if_check(ex, _, _) { *cx.cs += [expr_to_constr(cx.tcx, ex)]; } + // If it's a call, generate appropriate instances of the // call's constraints. @@ -34,7 +35,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) { let ct: sp_constr = respan(c.span, aux::substitute_constr_args(cx.tcx, operands, c)); - *cx.cs += ~[ct]; + *cx.cs += [ct]; } } _ { } @@ -45,7 +46,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) { fn find_locals(tcx: &ty::ctxt, f: &_fn, tps: &[ty_param], sp: &span, i: &fn_ident, id: node_id) -> ctxt { - let cx: ctxt = {cs: @mutable ~[], tcx: tcx}; + let cx: ctxt = {cs: @mutable [], tcx: tcx}; let visitor = visit::default_visitor::<ctxt>(); visitor = @@ -70,13 +71,13 @@ fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map) " as a variable and a pred"); } cpred(_, pds) { - *pds += ~[respan(c.span, {args: args, bit_num: next})]; + *pds += [respan(c.span, {args: args, bit_num: next})]; } } } none. { let rslt: @mutable [pred_args] = - @mutable ~[respan(c.span, {args: args, bit_num: next})]; + @mutable [respan(c.span, {args: args, bit_num: next})]; tbl.insert(d_id, cpred(p, rslt)); } } @@ -111,18 +112,18 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span, /* Need to add constraints for args too, b/c they can be deinitialized */ - for a:arg in f.decl.inputs { - next = add_constraint(cx.tcx, respan(f_sp, - ninit(a.id, a.ident)), - next, res_map); + for a: arg in f.decl.inputs { + next = + add_constraint(cx.tcx, respan(f_sp, ninit(a.id, a.ident)), next, + res_map); } /* add the special i_diverge and i_return constraints (see the type definition for auxiliary::fn_info for an explanation) */ // use the name of the function for the "return" constraint - next = add_constraint(cx.tcx, respan(f_sp, ninit(id, name)), next, - res_map); + next = + add_constraint(cx.tcx, respan(f_sp, ninit(id, name)), next, res_map); // and the name of the function, with a '!' appended to it, for the // "diverges" constraint let diverges_id = ccx.tcx.sess.next_node_id(); @@ -130,13 +131,14 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span, add_constraint(cx.tcx, respan(f_sp, ninit(diverges_id, diverges_name)), next, res_map); - let v: @mutable [node_id] = @mutable ~[]; + let v: @mutable [node_id] = @mutable []; let rslt = {constrs: res_map, - num_constraints: + // add 2 to account for the i_return and i_diverge constraints - vec::len(*cx.cs) + vec::len(f.decl.constraints) - + vec::len(f.decl.inputs) + 2u, + num_constraints: + vec::len(*cx.cs) + vec::len(f.decl.constraints) + + vec::len(f.decl.inputs) + 2u, cf: f.decl.cf, i_return: ninit(id, name), i_diverge: ninit(diverges_id, diverges_name), diff --git a/src/comp/middle/tstate/pre_post_conditions.rs b/src/comp/middle/tstate/pre_post_conditions.rs index 9c54b8f15a3..0d04d5656e7 100644 --- a/src/comp/middle/tstate/pre_post_conditions.rs +++ b/src/comp/middle/tstate/pre_post_conditions.rs @@ -59,13 +59,14 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) { alt i.node { item_const(_, e) { // make a fake fcx - let v: @mutable [node_id] = @mutable ~[]; + let v: @mutable [node_id] = @mutable []; let fake_fcx = - {enclosing: + { + // just bogus + enclosing: {constrs: @new_def_hash::<constraint>(), num_constraints: 0u, cf: return, - // just bogus i_return: ninit(0, ""), i_diverge: ninit(0, ""), used_vars: v}, @@ -104,7 +105,7 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) { fn find_pre_post_exprs(fcx: &fn_ctxt, args: &[@expr], id: node_id) { if vec::len::<@expr>(args) > 0u { log "find_pre_post_exprs: oper ="; - log_expr(*args.(0)); + log_expr(*args[0]); } fn do_one(fcx: fn_ctxt, e: &@expr) { find_pre_post_expr(fcx, e); } for e: @expr in args { do_one(fcx, e); } @@ -132,8 +133,7 @@ fn find_pre_post_loop(fcx: &fn_ctxt, l: &@local, index: &@expr, body: &blk, } let loop_precond = - seq_preconds(fcx, - ~[expr_pp(fcx.ccx, index), block_pp(fcx.ccx, body)]); + seq_preconds(fcx, [expr_pp(fcx.ccx, index), block_pp(fcx.ccx, body)]); let loop_postcond = intersect_states(expr_postcond(fcx.ccx, index), block_postcond(fcx.ccx, body)); @@ -159,8 +159,8 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk, let precond_res = seq_preconds(fcx, - ~[expr_pp(fcx.ccx, antec), - block_pp(fcx.ccx, conseq)]); + [expr_pp(fcx.ccx, antec), + block_pp(fcx.ccx, conseq)]); set_pre_and_post(fcx.ccx, id, precond_res, expr_poststate(fcx.ccx, antec)); } @@ -173,12 +173,11 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk, find_pre_post_expr(fcx, altern); let precond_false_case = seq_preconds(fcx, - ~[expr_pp(fcx.ccx, antec), - expr_pp(fcx.ccx, altern)]); + [expr_pp(fcx.ccx, antec), expr_pp(fcx.ccx, altern)]); let postcond_false_case = seq_postconds(fcx, - ~[expr_postcond(fcx.ccx, antec), - expr_postcond(fcx.ccx, altern)]); + [expr_postcond(fcx.ccx, antec), + expr_postcond(fcx.ccx, altern)]); /* Be sure to set the bit for the check condition here, so that it's *not* set in the alternative. */ @@ -191,15 +190,15 @@ fn join_then_else(fcx: &fn_ctxt, antec: &@expr, conseq: &blk, } let precond_true_case = seq_preconds(fcx, - ~[expr_pp(fcx.ccx, antec), - block_pp(fcx.ccx, conseq)]); + [expr_pp(fcx.ccx, antec), + block_pp(fcx.ccx, conseq)]); let postcond_true_case = seq_postconds(fcx, - ~[expr_postcond(fcx.ccx, antec), - block_postcond(fcx.ccx, conseq)]); + [expr_postcond(fcx.ccx, antec), + block_postcond(fcx.ccx, conseq)]); let precond_res = - seq_postconds(fcx, ~[precond_true_case, precond_false_case]); + seq_postconds(fcx, [precond_true_case, precond_false_case]); let postcond_res = intersect_states(postcond_true_case, postcond_false_case); set_pre_and_post(fcx.ccx, id, precond_res, postcond_res); @@ -220,10 +219,10 @@ fn gen_if_local(fcx: &fn_ctxt, lhs: @expr, rhs: @expr, larger_id: node_id, gen(fcx, larger_id, ninit(d_id.node, path_to_ident(fcx.ccx.tcx, pth))); } - _ { find_pre_post_exprs(fcx, ~[lhs, rhs], larger_id); } + _ { find_pre_post_exprs(fcx, [lhs, rhs], larger_id); } } } - _ { find_pre_post_exprs(fcx, ~[lhs, rhs], larger_id); } + _ { find_pre_post_exprs(fcx, [lhs, rhs], larger_id); } } } @@ -303,13 +302,12 @@ fn handle_var(fcx: &fn_ctxt, rslt: &pre_and_post, id: node_id, name: ident) { } } -fn forget_args_moved_in(fcx: &fn_ctxt, parent: &@expr, - modes: &[ty::mode], +fn forget_args_moved_in(fcx: &fn_ctxt, parent: &@expr, modes: &[ty::mode], operands: &[@expr]) { let i = 0u; for mode: ty::mode in modes { if mode == ty::mo_move { - forget_in_postcond(fcx, parent.id, operands.(i).id); + forget_in_postcond(fcx, parent.id, operands[i].id); } i += 1u; } @@ -324,8 +322,10 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { alt e.node { expr_call(operator, operands) { - let /* copy */args = operands; - args += ~[operator]; + /* copy */ + + let args = operands; + args += [operator]; find_pre_post_exprs(fcx, args, e.id); /* see if the call has any constraints on its type */ @@ -377,12 +377,10 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { } expr_rec(fields, maybe_base) { let es = field_exprs(fields); - alt maybe_base { none. {/* no-op */ } some(b) { es += ~[b]; } } + alt maybe_base { none. {/* no-op */ } some(b) { es += [b]; } } find_pre_post_exprs(fcx, es, e.id); } - expr_tup(elts) { - find_pre_post_exprs(fcx, elts, e.id); - } + expr_tup(elts) { find_pre_post_exprs(fcx, elts, e.id); } expr_copy(a) { find_pre_post_expr(fcx, a); copy_pre_post(fcx.ccx, e.id, a); @@ -394,7 +392,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { /* Different from expr_assign in that the lhs *must* already be initialized */ - find_pre_post_exprs(fcx, ~[lhs, rhs], e.id); + find_pre_post_exprs(fcx, [lhs, rhs], e.id); forget_in_postcond_still_init(fcx, e.id, lhs.id); } expr_lit(_) { clear_pp(expr_pp(fcx.ccx, e)); } @@ -426,12 +424,11 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { find_pre_post_expr(fcx, l); find_pre_post_expr(fcx, r); let overall_pre = - seq_preconds(fcx, - ~[expr_pp(fcx.ccx, l), expr_pp(fcx.ccx, r)]); + seq_preconds(fcx, [expr_pp(fcx.ccx, l), expr_pp(fcx.ccx, r)]); set_precondition(node_id_to_ts_ann(fcx.ccx, e.id), overall_pre); set_postcondition(node_id_to_ts_ann(fcx.ccx, e.id), expr_postcond(fcx.ccx, l)); - } else { find_pre_post_exprs(fcx, ~[l, r], e.id); } + } else { find_pre_post_exprs(fcx, [l, r], e.id); } } expr_unary(_, operand) { find_pre_post_expr(fcx, operand); @@ -446,8 +443,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { find_pre_post_block(fcx, body); set_pre_and_post(fcx.ccx, e.id, seq_preconds(fcx, - ~[expr_pp(fcx.ccx, test), - block_pp(fcx.ccx, body)]), + [expr_pp(fcx.ccx, test), + block_pp(fcx.ccx, body)]), intersect_states(expr_postcond(fcx.ccx, test), block_postcond(fcx.ccx, body))); } @@ -456,8 +453,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { find_pre_post_expr(fcx, test); let loop_postcond = seq_postconds(fcx, - ~[block_postcond(fcx.ccx, body), - expr_postcond(fcx.ccx, test)]); + [block_postcond(fcx.ccx, body), + expr_postcond(fcx.ccx, test)]); /* conservative approximation: if the body could break or cont, the test may never be executed */ @@ -466,8 +463,8 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { } set_pre_and_post(fcx.ccx, e.id, seq_preconds(fcx, - ~[block_pp(fcx.ccx, body), - expr_pp(fcx.ccx, test)]), + [block_pp(fcx.ccx, body), + expr_pp(fcx.ccx, test)]), loop_postcond); } expr_for(d, index, body) { @@ -476,18 +473,18 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { expr_for_each(d, index, body) { find_pre_post_loop(fcx, d, index, body, e.id); } - expr_index(val, sub) { find_pre_post_exprs(fcx, ~[val, sub], e.id); } + expr_index(val, sub) { find_pre_post_exprs(fcx, [val, sub], e.id); } expr_alt(ex, alts) { find_pre_post_expr(fcx, ex); fn do_an_alt(fcx: &fn_ctxt, an_alt: &arm) -> pre_and_post { find_pre_post_block(fcx, an_alt.body); ret block_pp(fcx.ccx, an_alt.body); } - let alt_pps = ~[]; - for a: arm in alts { alt_pps += ~[do_an_alt(fcx, a)]; } + let alt_pps = []; + for a: arm in alts { alt_pps += [do_an_alt(fcx, a)]; } fn combine_pp(antec: pre_and_post, fcx: fn_ctxt, pp: &pre_and_post, next: &pre_and_post) -> pre_and_post { - union(pp.precondition, seq_preconds(fcx, ~[antec, next])); + union(pp.precondition, seq_preconds(fcx, [antec, next])); intersect(pp.postcondition, next.postcondition); ret pp; } @@ -536,22 +533,20 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { } + expr_bind(operator, maybe_args) { - let args = ~[]; + let args = []; let cmodes = callee_modes(fcx, operator.id); - let modes = ~[]; + let modes = []; let i = 0; for expr_opt: option::t<@expr> in maybe_args { alt expr_opt { none. {/* no-op */ } - some(expr) { - modes += ~[cmodes.(i)]; - args += ~[expr]; - } + some(expr) { modes += [cmodes[i]]; args += [expr]; } } i += 1; } - args += ~[operator]; /* ??? order of eval? */ + args += [operator]; /* ??? order of eval? */ forget_args_moved_in(fcx, e, modes, args); find_pre_post_exprs(fcx, args, e.id); } @@ -567,7 +562,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) { none. { clear_pp(expr_pp(fcx.ccx, e)); } } } - expr_uniq(sub) { find_pre_post_exprs(fcx, ~[sub], e.id); } + expr_uniq(sub) { find_pre_post_exprs(fcx, [sub], e.id); } } } @@ -603,23 +598,25 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) { /* FIXME: This won't be necessary when typestate works well enough for pat_bindings to return a refinement-typed thing. */ - let ident = alt pat.node { - pat_bind(n) { n } - _ { - fcx.ccx.tcx.sess.span_bug(pat.span, - "Impossible LHS"); - } - }; + let ident = + alt pat.node { + pat_bind(n) { n } + _ { + fcx.ccx.tcx.sess.span_bug(pat.span, + "Impossible LHS"); + } + }; alt p { some(p) { copy_in_postcond(fcx, id, {ident: ident, node: pat.id}, {ident: - path_to_ident(fcx.ccx.tcx, p), + path_to_ident(fcx.ccx.tcx, + p), node: an_init.expr.id}, op_to_oper_ty(an_init.op)); } - none. {} + none. { } } gen(fcx, id, ninit(pat.id, ident)); } @@ -645,10 +642,9 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) { fcx.ccx.tcx.sess.span_bug(pat.span, "Impossible LHS"); } - }; + } } - copy_pre_post_(fcx.ccx, id, - prev_pp.precondition, + copy_pre_post_(fcx.ccx, id, prev_pp.precondition, prev_pp.postcondition); } none. { @@ -694,33 +690,33 @@ fn find_pre_post_block(fcx: &fn_ctxt, b: blk) { let nv = num_constraints(fcx.enclosing); fn do_one_(fcx: fn_ctxt, s: &@stmt) { find_pre_post_stmt(fcx, *s); -/* - log_err "pre_post for stmt:"; - log_stmt_err(*s); - log_err "is:"; - log_pp_err(stmt_pp(fcx.ccx, *s)); -*/ + /* + log_err "pre_post for stmt:"; + log_stmt_err(*s); + log_err "is:"; + log_pp_err(stmt_pp(fcx.ccx, *s)); + */ } for s: @stmt in b.node.stmts { do_one_(fcx, s); } fn do_inner_(fcx: fn_ctxt, e: &@expr) { find_pre_post_expr(fcx, e); } let do_inner = bind do_inner_(fcx, _); option::map::<@expr, ()>(do_inner, b.node.expr); - let pps: [pre_and_post] = ~[]; - for s: @stmt in b.node.stmts { pps += ~[stmt_pp(fcx.ccx, *s)]; } + let pps: [pre_and_post] = []; + for s: @stmt in b.node.stmts { pps += [stmt_pp(fcx.ccx, *s)]; } alt b.node.expr { none. {/* no-op */ } - some(e) { pps += ~[expr_pp(fcx.ccx, e)]; } + some(e) { pps += [expr_pp(fcx.ccx, e)]; } } let block_precond = seq_preconds(fcx, pps); - let postconds = ~[]; - for pp: pre_and_post in pps { postconds += ~[get_post(pp)]; } + let postconds = []; + for pp: pre_and_post in pps { postconds += [get_post(pp)]; } /* A block may be empty, so this next line ensures that the postconds vector is non-empty. */ - postconds += ~[block_precond]; + postconds += [block_precond]; let block_postcond = empty_poststate(nv); /* conservative approximation */ diff --git a/src/comp/middle/tstate/states.rs b/src/comp/middle/tstate/states.rs index 7bba52ceb6d..3d8d8767ceb 100644 --- a/src/comp/middle/tstate/states.rs +++ b/src/comp/middle/tstate/states.rs @@ -30,9 +30,9 @@ import util::common::log_stmt_err; import util::common::log_expr_err; fn handle_move_or_copy(fcx: &fn_ctxt, post: &poststate, rhs_path: &path, - rhs_id: &node_id, instlhs: &inst, init_op: &init_op) { + rhs_id: &node_id, instlhs: &inst, init_op: &init_op) { let rhs_d = local_node_id_to_def_id(fcx, rhs_id); - alt (rhs_d) { + alt rhs_d { some(rhsid) { // RHS is a local var let instrhs = @@ -46,19 +46,19 @@ fn handle_move_or_copy(fcx: &fn_ctxt, post: &poststate, rhs_path: &path, } } -fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding]) - -> {changed: bool, post: poststate} { +fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding]) -> + {changed: bool, post: poststate} { let changed = false; let post = tritv_clone(pres); - for b:binding in bindings { - alt (b.rhs) { + for b: binding in bindings { + alt b.rhs { some(an_init) { // an expression, with or without a destination - changed |= find_pre_post_state_expr(fcx, post, an_init.expr) - || changed; + changed |= + find_pre_post_state_expr(fcx, post, an_init.expr) || changed; post = tritv_clone(expr_poststate(fcx.ccx, an_init.expr)); for i: inst in b.lhs { - alt (an_init.expr.node) { + alt an_init.expr.node { expr_path(p) { handle_move_or_copy(fcx, post, p, an_init.expr.id, i, an_init.op); @@ -67,6 +67,7 @@ fn seq_states(fcx: &fn_ctxt, pres: &prestate, bindings: &[binding]) } set_in_poststate_ident(fcx, i.node, i.ident, post); } + // Forget the RHS if we just moved it. if an_init.op == init_move { forget_in_poststate(fcx, post, an_init.expr.id); @@ -168,18 +169,17 @@ fn find_pre_post_state_call(fcx: &fn_ctxt, pres: &prestate, a: &@expr, // FIXME: This could be a typestate constraint if vec::len(bs) != vec::len(ops) { fcx.ccx.tcx.sess.span_bug(a.span, - #fmt("mismatched arg lengths: \ + #fmt["mismatched arg lengths: \ %u exprs vs. %u ops", - vec::len(bs), vec::len(ops))); + vec::len(bs), vec::len(ops)]); } - ret find_pre_post_state_exprs(fcx, expr_poststate(fcx.ccx, a), id, - ops, bs, cf) - || changed; + ret find_pre_post_state_exprs(fcx, expr_poststate(fcx.ccx, a), id, ops, + bs, cf) || changed; } fn find_pre_post_state_exprs(fcx: &fn_ctxt, pres: &prestate, id: node_id, - ops: &[init_op], es: &[@expr], - cf: controlflow) -> bool { + ops: &[init_op], es: &[@expr], cf: controlflow) + -> bool { let rs = seq_states(fcx, pres, anon_bindings(ops, es)); let changed = rs.changed | set_prestate_ann(fcx.ccx, id, pres); /* if this is a failing call, it sets everything as initialized */ @@ -315,8 +315,8 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> expr_vec(elts, _) { ret find_pre_post_state_exprs(fcx, pres, e.id, vec::init_elt(init_assign, - vec::len(elts)), - elts, return); + vec::len(elts)), elts, + return); } expr_call(operator, operands) { ret find_pre_post_state_call(fcx, pres, operator, e.id, @@ -325,17 +325,14 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> controlflow_expr(fcx.ccx, operator)); } expr_bind(operator, maybe_args) { - let args = ~[]; + let args = []; let callee_ops = callee_arg_init_ops(fcx, operator.id); - let ops = ~[]; + let ops = []; let i = 0; for a_opt: option::t<@expr> in maybe_args { alt a_opt { none. {/* no-op */ } - some(a) { - ops += ~[callee_ops.(i)]; - args += ~[a]; - } + some(a) { ops += [callee_ops[i]]; args += [a]; } } i += 1; } @@ -366,9 +363,8 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> let changed = find_pre_post_state_exprs(fcx, pres, e.id, vec::init_elt(init_assign, - vec::len(fields)), - field_exprs(fields), - return); + vec::len(fields)), + field_exprs(fields), return); alt maybe_base { none. {/* do nothing */ } some(base) { @@ -383,12 +379,10 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> expr_tup(elts) { ret find_pre_post_state_exprs(fcx, pres, e.id, vec::init_elt(init_assign, - vec::len(elts)), - elts, return); - } - expr_copy(a) { - ret find_pre_post_state_sub(fcx, pres, a, e.id, none); + vec::len(elts)), elts, + return); } + expr_copy(a) { ret find_pre_post_state_sub(fcx, pres, a, e.id, none); } expr_move(lhs, rhs) { ret find_pre_post_state_two(fcx, pres, lhs, rhs, e.id, oper_move); } @@ -405,14 +399,14 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> /* normally, everything is true if execution continues after a ret expression (since execution never continues locally after a ret expression */ -// FIXME should factor this out + // FIXME should factor this out let post = false_postcond(num_constrs); // except for the "diverges" bit... kill_poststate_(fcx, fcx.enclosing.i_diverge, post); set_poststate_ann(fcx.ccx, e.id, post); - alt maybe_ret_val { + alt maybe_ret_val { none. {/* do nothing */ } some(ret_val) { changed |= find_pre_post_state_expr(fcx, pres, ret_val); @@ -565,14 +559,12 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> woo! */ let post = false_postcond(num_constrs); alt fcx.enclosing.cf { - noreturn. { - kill_poststate_(fcx, ninit(fcx.id, fcx.name), post); - } - _ {} + noreturn. { kill_poststate_(fcx, ninit(fcx.id, fcx.name), post); } + _ { } } ret set_prestate_ann(fcx.ccx, e.id, pres) | - set_poststate_ann(fcx.ccx, e.id, post) - | alt maybe_fail_val { + set_poststate_ann(fcx.ccx, e.id, post) | + alt maybe_fail_val { none. { false } some(fail_val) { find_pre_post_state_expr(fcx, pres, fail_val) @@ -603,74 +595,73 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) -> } } -fn find_pre_post_state_stmt(fcx: &fn_ctxt, pres: &prestate, s: @stmt) - -> bool { +fn find_pre_post_state_stmt(fcx: &fn_ctxt, pres: &prestate, s: @stmt) -> + bool { let stmt_ann = stmt_to_ann(fcx.ccx, *s); -/* - log_err ("[" + fcx.name + "]"); - log_err "*At beginning: stmt = "; - log_stmt_err(*s); - log_err "*prestate = "; - log_tritv_err(fcx, stmt_ann.states.prestate); - log_err "*poststate ="; - log_tritv_err(fcx, stmt_ann.states.poststate); - log_err "pres = "; - log_tritv_err(fcx, pres); -*/ - - alt (s.node) { + /* + log_err ("[" + fcx.name + "]"); + log_err "*At beginning: stmt = "; + log_stmt_err(*s); + log_err "*prestate = "; + log_tritv_err(fcx, stmt_ann.states.prestate); + log_err "*poststate ="; + log_tritv_err(fcx, stmt_ann.states.poststate); + log_err "pres = "; + log_tritv_err(fcx, pres); + */ + + alt s.node { stmt_decl(adecl, id) { - alt (adecl.node) { + alt adecl.node { decl_local(alocals) { set_prestate(stmt_ann, pres); - let c_and_p = seq_states(fcx, pres, - locals_to_bindings(alocals)); + let c_and_p = seq_states(fcx, pres, locals_to_bindings(alocals)); /* important to do this in one step to ensure termination (don't want to set changed to true for intermediate changes) */ - let changed = (set_poststate(stmt_ann, c_and_p.post) - | c_and_p.changed); + let changed = + set_poststate(stmt_ann, c_and_p.post) | c_and_p.changed; -/* - log_err "Summary: stmt = "; - log_stmt_err(*s); - log_err "prestate = "; - log_tritv_err(fcx, stmt_ann.states.prestate); - log_err "poststate ="; - log_tritv_err(fcx, stmt_ann.states.poststate); - log_err "changed ="; - log_err changed; -*/ + /* + log_err "Summary: stmt = "; + log_stmt_err(*s); + log_err "prestate = "; + log_tritv_err(fcx, stmt_ann.states.prestate); + log_err "poststate ="; + log_tritv_err(fcx, stmt_ann.states.poststate); + log_err "changed ="; + log_err changed; + */ ret changed; } decl_item(an_item) { - ret set_prestate(stmt_ann, pres) | - set_poststate(stmt_ann, pres); + ret set_prestate(stmt_ann, pres) | set_poststate(stmt_ann, pres); /* the outer visitor will recurse into the item */ } } } stmt_expr(ex, _) { - let changed = find_pre_post_state_expr(fcx, pres, ex) | + let changed = + find_pre_post_state_expr(fcx, pres, ex) | set_prestate(stmt_ann, expr_prestate(fcx.ccx, ex)) | set_poststate(stmt_ann, expr_poststate(fcx.ccx, ex)); -/* - log_err "Finally:"; - log_stmt_err(*s); - log_err("prestate = "); - // log_err(bitv::to_str(stmt_ann.states.prestate)); - log_tritv_err(fcx, stmt_ann.states.prestate); - log_err("poststate ="); - // log_err(bitv::to_str(stmt_ann.states.poststate)); - log_tritv_err(fcx, stmt_ann.states.poststate); - log_err("changed ="); -*/ + /* + log_err "Finally:"; + log_stmt_err(*s); + log_err("prestate = "); + log_err(bitv::to_str(stmt_ann.states.prestate)); + log_tritv_err(fcx, stmt_ann.states.prestate); + log_err("poststate ="); + log_err(bitv::to_str(stmt_ann.states.poststate)); + log_tritv_err(fcx, stmt_ann.states.poststate); + log_err("changed ="); + */ - ret changed; + ret changed; } _ { ret false; } } @@ -706,18 +697,18 @@ fn find_pre_post_state_block(fcx: &fn_ctxt, pres0: &prestate, b: &blk) -> set_poststate_ann(fcx.ccx, b.node.id, post); -/* - log_err "For block:"; - log_block_err(b); - log_err "poststate = "; - log_states_err(block_states(fcx.ccx, b)); - log_err "pres0:"; - log_tritv_err(fcx, pres0); - log_err "post:"; - log_tritv_err(fcx, post); - log_err "changed = "; - log_err changed; -*/ + /* + log_err "For block:"; + log_block_err(b); + log_err "poststate = "; + log_states_err(block_states(fcx.ccx, b)); + log_err "pres0:"; + log_tritv_err(fcx, pres0); + log_err "post:"; + log_tritv_err(fcx, post); + log_err "changed = "; + log_err changed; + */ ret changed; } @@ -731,7 +722,7 @@ fn find_pre_post_state_fn(fcx: &fn_ctxt, f: &_fn) -> bool { // Arguments start out initialized let block_pre = block_prestate(fcx.ccx, f.body); - for a:arg in f.decl.inputs { + for a: arg in f.decl.inputs { set_in_prestate_constr(fcx, ninit(a.id, a.ident), block_pre); } diff --git a/src/comp/middle/tstate/tritv.rs b/src/comp/middle/tstate/tritv.rs index 1a280297bbe..77e3575c175 100644 --- a/src/comp/middle/tstate/tritv.rs +++ b/src/comp/middle/tstate/tritv.rs @@ -54,9 +54,10 @@ fn trit_minus(a: trit, b: trit) -> trit { alt b { ttrue. { dont_care } tfalse. { ttrue } - /* internally contradictory, but - I guess it'll get flagged? */ - dont_care. { + + /* internally contradictory, but + I guess it'll get flagged? */ + dont_care. { ttrue } } @@ -64,7 +65,8 @@ fn trit_minus(a: trit, b: trit) -> trit { tfalse. { alt b { ttrue. { tfalse } - /* see above comment */ + + /* see above comment */ _ { tfalse } @@ -80,7 +82,8 @@ fn trit_or(a: trit, b: trit) -> trit { tfalse. { alt b { ttrue. { dont_care } - /* FIXME: ?????? */ + + /* FIXME: ?????? */ _ { tfalse } @@ -97,15 +100,18 @@ fn trit_or(a: trit, b: trit) -> trit { fn trit_and(a: trit, b: trit) -> trit { alt a { dont_care. { b } - // also seems wrong for case b = ttrue + + // also seems wrong for case b = ttrue ttrue. { alt b { dont_care. { ttrue } - // ??? Seems wrong + + // ??? Seems wrong ttrue. { ttrue } + // false wins, since if something is uninit // on one path, we care // (Rationale: it's always safe to assume that @@ -117,6 +123,7 @@ fn trit_and(a: trit, b: trit) -> trit { } } + // Rationale: if it's uninit on one path, // we can consider it as uninit on all paths tfalse. { @@ -180,7 +187,7 @@ fn tritv_get(v: &t, i: uint) -> trit { let b1 = bitv::get(v.uncertain, i); let b2 = bitv::get(v.val, i); assert (!(b1 && b2)); - if b1 { dont_care } else if (b2) { ttrue } else { tfalse } + if b1 { dont_care } else if b2 { ttrue } else { tfalse } } fn tritv_set(i: uint, v: &t, t: trit) -> bool { @@ -241,14 +248,14 @@ fn tritv_doesntcare(v: &t) -> bool { fn to_vec(v: &t) -> [uint] { let i: uint = 0u; - let rslt: [uint] = ~[]; + let rslt: [uint] = []; while i < v.nbits { rslt += - ~[alt tritv_get(v, i) { - dont_care. { 2u } - ttrue. { 1u } - tfalse. { 0u } - }]; + [alt tritv_get(v, i) { + dont_care. { 2u } + ttrue. { 1u } + tfalse. { 0u } + }]; i += 1u; } ret rslt; diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs index b1c90844e99..c2594c98f2d 100644 --- a/src/comp/middle/ty.rs +++ b/src/comp/middle/ty.rs @@ -207,13 +207,12 @@ type mt = {ty: t, mut: ast::mutability}; type creader_cache = hashmap<{cnum: int, pos: uint, len: uint}, ty::t>; type ctxt = - // constr_table fn_constrs, + // We need the ext_map just for printing the types of tags defined in + // other crates. Once we get cnames back it should go. @{ts: @type_store, sess: session::session, def_map: resolve::def_map, - // We need the ext_map just for printing the types of tags defined in - // other crates. Once we get cnames back it should go. ext_map: resolve::ext_map, node_types: node_type_table, items: ast_map::map, @@ -460,7 +459,7 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t { ty_istr. {/* no-op */ } ty_type. {/* no-op */ } ty_native(_) {/* no-op */ } - ty_param(_,_) { has_params = true; } + ty_param(_, _) { has_params = true; } ty_var(_) { has_vars = true; } ty_tag(_, tys) { for tt: t in tys { derive_flags_t(cx, has_params, has_vars, tt); } @@ -475,9 +474,7 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t { } } ty_tup(ts) { - for tt in ts { - derive_flags_t(cx, has_params, has_vars, tt); - } + for tt in ts { derive_flags_t(cx, has_params, has_vars, tt); } } ty_fn(_, args, tt, _, _) { derive_flags_sig(cx, has_params, has_vars, args, tt); @@ -604,9 +601,8 @@ fn mk_type(_cx: &ctxt) -> t { ret idx_type; } fn mk_native(cx: &ctxt, did: &def_id) -> t { ret gen_ty(cx, ty_native(did)); } fn mk_iter_body_fn(cx: &ctxt, output: &t) -> t { - ret mk_fn(cx, ast::proto_block, - ~[{mode: ty::mo_alias(false), ty: output}], - ty::mk_nil(cx), ast::return, ~[]); + ret mk_fn(cx, ast::proto_block, [{mode: ty::mo_alias(false), ty: output}], + ty::mk_nil(cx), ast::return, []); } // Returns the one-level-deep type structure of the given type. @@ -622,7 +618,7 @@ fn cname(cx: &ctxt, typ: &t) -> option::t<str> { // Type folds -type ty_walk = fn(t) ; +type ty_walk = fn(t); fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) { alt struct(cx, ty) { @@ -647,9 +643,7 @@ fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) { ty_rec(fields) { for fl: field in fields { walk_ty(cx, walker, fl.mt.ty); } } - ty_tup(ts) { - for tt in ts { walk_ty(cx, walker, tt); } - } + ty_tup(ts) { for tt in ts { walk_ty(cx, walker, tt); } } ty_fn(proto, args, ret_ty, _, _) { for a: arg in args { walk_ty(cx, walker, a.ty); } walk_ty(cx, walker, ret_ty); @@ -668,20 +662,18 @@ fn walk_ty(cx: &ctxt, walker: ty_walk, ty: t) { walk_ty(cx, walker, sub); for tp: t in tps { walk_ty(cx, walker, tp); } } - ty_constr(sub, _) { - walk_ty(cx, walker, sub); - } + ty_constr(sub, _) { walk_ty(cx, walker, sub); } ty_var(_) {/* no-op */ } - ty_param(_,_) {/* no-op */ } + ty_param(_, _) {/* no-op */ } ty_uniq(sub) { walk_ty(cx, walker, sub); } } walker(ty); } tag fold_mode { - fm_var(fn(int) -> t ); - fm_param(fn(uint,ast::kind) -> t ); - fm_general(fn(t) -> t ); + fm_var(fn(int) -> t); + fm_param(fn(uint, ast::kind) -> t); + fm_general(fn(t) -> t); } fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { @@ -717,31 +709,29 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { ty = mk_vec(cx, {ty: fold_ty(cx, fld, tm.ty), mut: tm.mut}); } ty_tag(tid, subtys) { - let new_subtys: [t] = ~[]; - for subty: t in subtys { new_subtys += ~[fold_ty(cx, fld, subty)]; } + let new_subtys: [t] = []; + for subty: t in subtys { new_subtys += [fold_ty(cx, fld, subty)]; } ty = copy_cname(cx, mk_tag(cx, tid, new_subtys), ty); } ty_rec(fields) { - let new_fields: [field] = ~[]; + let new_fields: [field] = []; for fl: field in fields { let new_ty = fold_ty(cx, fld, fl.mt.ty); let new_mt = {ty: new_ty, mut: fl.mt.mut}; - new_fields += ~[{ident: fl.ident, mt: new_mt}]; + new_fields += [{ident: fl.ident, mt: new_mt}]; } ty = copy_cname(cx, mk_rec(cx, new_fields), ty); } ty_tup(ts) { - let new_ts = ~[]; - for tt in ts { - new_ts += ~[fold_ty(cx, fld, tt)]; - } + let new_ts = []; + for tt in ts { new_ts += [fold_ty(cx, fld, tt)]; } ty = copy_cname(cx, mk_tup(cx, new_ts), ty); } ty_fn(proto, args, ret_ty, cf, constrs) { - let new_args: [arg] = ~[]; + let new_args: [arg] = []; for a: arg in args { let new_ty = fold_ty(cx, fld, a.ty); - new_args += ~[{mode: a.mode, ty: new_ty}]; + new_args += [{mode: a.mode, ty: new_ty}]; } ty = copy_cname(cx, @@ -749,10 +739,10 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { cf, constrs), ty); } ty_native_fn(abi, args, ret_ty) { - let new_args: [arg] = ~[]; + let new_args: [arg] = []; for a: arg in args { let new_ty = fold_ty(cx, fld, a.ty); - new_args += ~[{mode: a.mode, ty: new_ty}]; + new_args += [{mode: a.mode, ty: new_ty}]; } ty = copy_cname(cx, @@ -760,25 +750,25 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { fold_ty(cx, fld, ret_ty)), ty); } ty_obj(methods) { - let new_methods: [method] = ~[]; + let new_methods: [method] = []; for m: method in methods { - let new_args: [arg] = ~[]; + let new_args: [arg] = []; for a: arg in m.inputs { - new_args += ~[{mode: a.mode, ty: fold_ty(cx, fld, a.ty)}]; + new_args += [{mode: a.mode, ty: fold_ty(cx, fld, a.ty)}]; } new_methods += - ~[{proto: m.proto, - ident: m.ident, - inputs: new_args, - output: fold_ty(cx, fld, m.output), - cf: m.cf, - constrs: m.constrs}]; + [{proto: m.proto, + ident: m.ident, + inputs: new_args, + output: fold_ty(cx, fld, m.output), + cf: m.cf, + constrs: m.constrs}]; } ty = copy_cname(cx, mk_obj(cx, new_methods), ty); } ty_res(did, subty, tps) { - let new_tps = ~[]; - for tp: t in tps { new_tps += ~[fold_ty(cx, fld, tp)]; } + let new_tps = []; + for tp: t in tps { new_tps += [fold_ty(cx, fld, tp)]; } ty = copy_cname(cx, mk_res(cx, did, fold_ty(cx, fld, subty), new_tps), ty); @@ -786,8 +776,8 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t { ty_var(id) { alt fld { fm_var(folder) { ty = folder(id); } _ {/* no-op */ } } } - ty_param(id,k) { - alt fld { fm_param(folder) { ty = folder(id,k); } _ {/* no-op */ } } + ty_param(id, k) { + alt fld { fm_param(folder) { ty = folder(id, k); } _ {/* no-op */ } } } } @@ -867,7 +857,10 @@ fn type_is_str(cx: &ctxt, ty: &t) -> bool { fn sequence_is_interior(cx: &ctxt, ty: &t) -> bool { alt struct(cx, ty) { - ty::ty_str. { ret false; } + + ty::ty_str. { + ret false; + } ty::ty_vec(_) { ret true; } ty::ty_istr. { ret true; } _ { cx.sess.bug("sequence_is_interior called on non-sequence type"); } @@ -895,8 +888,8 @@ fn type_is_tup_like(cx: &ctxt, ty: &t) -> bool { fn get_element_type(cx: &ctxt, ty: &t, i: uint) -> t { alt struct(cx, ty) { - ty_rec(flds) { ret flds.(i).mt.ty; } - ty_tup(ts) { ret ts.(i); } + ty_rec(flds) { ret flds[i].mt.ty; } + ty_tup(ts) { ret ts[i]; } _ { cx.sess.bug("get_element_type called on type " + ty_to_str(cx, ty) + " - expected a \ @@ -948,6 +941,7 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool { let result = false; alt struct(cx, ty) { + // scalar types ty_nil. { /* no-op */ @@ -964,16 +958,11 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool { ty_native(_) {/* no-op */ } ty_rec(flds) { for f: field in flds { - if type_has_pointers(cx, f.mt.ty) { - result = true; - break; - } + if type_has_pointers(cx, f.mt.ty) { result = true; break; } } } ty_tup(elts) { - for m in elts { - if type_has_pointers(cx, m) { result = true; } - } + for m in elts { if type_has_pointers(cx, m) { result = true; } } } ty_tag(did, tps) { let variants = tag_variants(cx, did); @@ -981,10 +970,7 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool { for aty: t in variant.args { // Perform any type parameter substitutions. let arg_ty = substitute_type_params(cx, tps, aty); - if type_has_pointers(cx, arg_ty) { - result = true; - break; - } + if type_has_pointers(cx, arg_ty) { result = true; break; } } if result { break; } } @@ -1002,9 +988,9 @@ fn type_has_pointers(cx: &ctxt, ty: &t) -> bool { fn type_needs_drop(cx: &ctxt, ty: &t) -> bool { ret alt struct(cx, ty) { - ty_res(_, _, _) { true } - _ { type_has_pointers(cx, ty) } - }; + ty_res(_, _, _) { true } + _ { type_has_pointers(cx, ty) } + }; } fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { @@ -1020,42 +1006,52 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { alt struct(cx, ty) { + // Scalar types are unique-kind, no substructure. - ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float. - | ty_machine(_) | ty_char. | ty_native(_) { + ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float. | + ty_machine(_) | ty_char. | ty_native(_) { // no-op } + // A handful of other built-in are unique too. ty_type. | ty_istr. | ty_native_fn(_, _, _) { // no-op } + // Those things with refcounts-to-interior are just shared. ty_str. { result = kind_shared; } + // FIXME: obj is broken for now, since we aren't asserting // anything about its fields. - ty_obj(_) { result = kind_shared; } + ty_obj(_) { + result = kind_shared; + } + // FIXME: the environment capture mode is not fully encoded // here yet, leading to weirdness around closure. ty_fn(proto, _, _, _, _) { - result = alt proto { - ast::proto_block. { ast::kind_pinned } - ast::proto_closure. { ast::kind_shared } - _ { ast::kind_unique } - } + result = + alt proto { + ast::proto_block. { ast::kind_pinned } + ast::proto_closure. { ast::kind_shared } + _ { ast::kind_unique } + } } + // Those with refcounts-to-inner raise pinned to shared, // lower unique to shared. Therefore just set result to shared. ty_box(mt) { result = ast::kind_shared; } + // Pointers and unique boxes / vecs raise pinned to shared, // otherwise pass through their pointee kind. ty_ptr(tm) | ty_vec(tm) { @@ -1064,6 +1060,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { result = kind::lower_kind(result, k); } + // Records lower to the lowest of their members. ty_rec(flds) { for f: field in flds { @@ -1071,6 +1068,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { if result == ast::kind_pinned { break; } } } + // Tuples lower to the lowest of their members. ty_tup(tys) { for ty: t in tys { @@ -1079,6 +1077,7 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { } } + // Tags lower to the lowest of their variants. ty_tag(did, tps) { let variants = tag_variants(cx, did); @@ -1093,27 +1092,34 @@ fn type_kind(cx: &ctxt, ty: &t) -> ast::kind { } } + // Resources are always pinned. ty_res(did, inner, tps) { result = ast::kind_pinned; } - ty_var(_) { fail; } - ty_param(_,k) { + ty_var(_) { + fail; + } + + + ty_param(_, k) { result = kind::lower_kind(result, k); } + ty_constr(t, _) { result = type_kind(cx, t); } - _ { - cx.sess.bug("missed case: " + ty_to_str(cx, ty)); - } + _ { + cx.sess.bug("missed case: " + ty_to_str(cx, ty)); + } } + cx.kind_cache.insert(ty, result); ret result; } @@ -1140,7 +1146,7 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool { ty_tag(_, subtys) { let i = 0u; while i < vec::len::<t>(subtys) { - if type_has_dynamic_size(cx, subtys.(i)) { ret true; } + if type_has_dynamic_size(cx, subtys[i]) { ret true; } i += 1u; } ret false; @@ -1151,15 +1157,13 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool { ty_rec(fields) { let i = 0u; while i < vec::len::<field>(fields) { - if type_has_dynamic_size(cx, fields.(i).mt.ty) { ret true; } + if type_has_dynamic_size(cx, fields[i].mt.ty) { ret true; } i += 1u; } ret false; } ty_tup(ts) { - for tt in ts { - if type_has_dynamic_size(cx, tt) { ret true; } - } + for tt in ts { if type_has_dynamic_size(cx, tt) { ret true; } } ret false; } ty_fn(_, _, _, _, _) { ret false; } @@ -1170,7 +1174,7 @@ fn type_has_dynamic_size(cx: &ctxt, ty: &t) -> bool { ret type_has_dynamic_size(cx, sub); } ty_var(_) { fail "ty_var in type_has_dynamic_size()"; } - ty_param(_,_) { ret true; } + ty_param(_, _) { ret true; } ty_type. { ret false; } ty_native(_) { ret false; } ty_uniq(_) { ret false; } @@ -1242,6 +1246,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool { ty_istr. { result = true; } + // scalar types ty_nil. { result = false; @@ -1257,6 +1262,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool { ty_native(_) { result = false; } + // boxed types ty_str. { result = false; @@ -1267,6 +1273,7 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool { ty_obj(_) { result = false; } + // structural types ty_tag(did, tps) { let variants = tag_variants(cx, did); @@ -1284,20 +1291,19 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool { } } ty_tup(elts) { - for m in elts { - if type_owns_heap_mem(cx, m) { result = true; } - } + for m in elts { if type_owns_heap_mem(cx, m) { result = true; } } } ty_res(_, inner, tps) { result = type_owns_heap_mem(cx, substitute_type_params(cx, tps, inner)); } + ty_ptr(_) { result = false; } ty_var(_) { fail "ty_var in type_owns_heap_mem"; } - ty_param(_,_) { result = false; } + ty_param(_, _) { result = false; } } cx.owns_heap_mem_cache.insert(ty, result); @@ -1305,48 +1311,53 @@ fn type_owns_heap_mem(cx: &ctxt, ty: &t) -> bool { } // Whether a type is Plain Old Data (i.e. can be safely memmoved). -fn type_is_pod(cx : &ctxt, ty : &t) -> bool { +fn type_is_pod(cx: &ctxt, ty: &t) -> bool { let result = true; alt struct(cx, ty) { - // Scalar types - ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. | - ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) { - result = true; - } - // Boxed types - ty_str. | ty_istr. | ty_box(_) | ty_vec(_) | - ty_fn(_,_,_,_,_) | ty_native_fn(_,_,_) | ty_obj(_) { result = false; } + // Scalar types + ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. | + ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) { + result = true; + } - // Structural types - ty_tag(did, tps) { - let variants = tag_variants(cx, did); - for variant : variant_info in variants { - let tup_ty = mk_tup(cx, variant.args); - // Perform any type parameter substitutions. - tup_ty = substitute_type_params(cx, tps, tup_ty); - if !type_is_pod(cx, tup_ty) { result = false; } - } - } - ty_rec(flds) { - for f : field in flds { - if !type_is_pod(cx, f.mt.ty) { result = false; } - } - } - ty_tup(elts) { - for elt in elts { - if !type_is_pod(cx, elt) { result = false; } - } + // Boxed types + ty_str. | ty_istr. | ty_box(_) | ty_vec(_) | ty_fn(_, _, _, _, _) | + ty_native_fn(_, _, _) | ty_obj(_) { + result = false; + } + + + // Structural types + ty_tag(did, tps) { + let variants = tag_variants(cx, did); + for variant: variant_info in variants { + let tup_ty = mk_tup(cx, variant.args); + + // Perform any type parameter substitutions. + tup_ty = substitute_type_params(cx, tps, tup_ty); + if !type_is_pod(cx, tup_ty) { result = false; } } - ty_res(_, inner, tps) { - result = type_is_pod(cx, - substitute_type_params(cx, tps, inner)); + } + ty_rec(flds) { + for f: field in flds { + if !type_is_pod(cx, f.mt.ty) { result = false; } } - ty_constr(subt, _) { result = type_is_pod(cx, subt); } + } + ty_tup(elts) { + for elt in elts { if !type_is_pod(cx, elt) { result = false; } } + } + ty_res(_, inner, tps) { + result = type_is_pod(cx, substitute_type_params(cx, tps, inner)); + } + ty_constr(subt, _) { result = type_is_pod(cx, subt); } + - ty_var(_) { fail "ty_var in type_is_pod"; } - ty_param(_,_) { result = false; } + ty_var(_) { + fail "ty_var in type_is_pod"; + } + ty_param(_, _) { result = false; } } ret result; @@ -1354,7 +1365,7 @@ fn type_is_pod(cx : &ctxt, ty : &t) -> bool { fn type_param(cx: &ctxt, ty: &t) -> option::t<uint> { alt struct(cx, ty) { - ty_param(id,_) { ret some(id); } + ty_param(id, _) { ret some(id); } _ {/* fall through */ } } ret none; @@ -1362,16 +1373,11 @@ fn type_param(cx: &ctxt, ty: &t) -> option::t<uint> { // Returns a vec of all the type variables // occurring in t. It may contain duplicates. -fn vars_in_type(cx:&ctxt, ty: &t) -> [int] { - fn collect_var(cx:&ctxt, vars: &@mutable [int], ty: t) { - alt struct(cx, ty) { - ty_var(v) { - *vars += ~[v]; - } - _ {} - } +fn vars_in_type(cx: &ctxt, ty: &t) -> [int] { + fn collect_var(cx: &ctxt, vars: &@mutable [int], ty: t) { + alt struct(cx, ty) { ty_var(v) { *vars += [v]; } _ { } } } - let rslt: @mutable [int] = @mutable (~[]); + let rslt: @mutable [int] = @mutable []; walk_ty(cx, bind collect_var(cx, rslt, _), ty); // Works because of a "convenient" bug that lets us // return a mutable vec as if it's immutable @@ -1388,11 +1394,10 @@ fn type_autoderef(cx: &ctxt, t: &ty::t) -> ty::t { } ty::ty_tag(did, tps) { let variants = tag_variants(cx, did); - if vec::len(variants) != 1u || vec::len(variants.(0).args) != 1u - { + if vec::len(variants) != 1u || vec::len(variants[0].args) != 1u { break; } - t1 = substitute_type_params(cx, tps, variants.(0).args.(0)); + t1 = substitute_type_params(cx, tps, variants[0].args[0]); } _ { break; } } @@ -1490,6 +1495,7 @@ fn hash_type_structure(st: &sty) -> uint { ret h; } + // ??? ty_fn(_, args, rty, _, _) { ret hash_fn(27u, args, rty); @@ -1501,7 +1507,7 @@ fn hash_type_structure(st: &sty) -> uint { ret h; } ty_var(v) { ret hash_uint(30u, v as uint); } - ty_param(pid,_) { ret hash_uint(31u, pid); } + ty_param(pid, _) { ret hash_uint(31u, pid); } ty_type. { ret 32u; } ty_native(did) { ret hash_def(33u, did); } ty_bot. { ret 34u; } @@ -1516,11 +1522,7 @@ fn hash_type_structure(st: &sty) -> uint { for c: @type_constr in cs { h += h << 5u + hash_type_constr(h, c); } ret h; } - ty_uniq(t) { - let h = 37u; - h += h << 5u + hash_ty(t); - ret h; - } + ty_uniq(t) { let h = 37u; h += h << 5u + hash_ty(t); ret h; } } } @@ -1542,7 +1544,7 @@ fn hash_ty(typ: &t) -> uint { ret typ; } // users should use `eq_ty()` instead. fn eq_int(x: &uint, y: &uint) -> bool { ret x == y; } -fn arg_eq<T>(eq: &fn(&T, &T) -> bool , a: @sp_constr_arg<T>, +fn arg_eq<T>(eq: &fn(&T, &T) -> bool, a: @sp_constr_arg<T>, b: @sp_constr_arg<T>) -> bool { alt a.node { ast::carg_base. { @@ -1557,11 +1559,11 @@ fn arg_eq<T>(eq: &fn(&T, &T) -> bool , a: @sp_constr_arg<T>, } } -fn args_eq<T>(eq: fn(&T, &T) -> bool , a: &[@sp_constr_arg<T>], +fn args_eq<T>(eq: fn(&T, &T) -> bool, a: &[@sp_constr_arg<T>], b: &[@sp_constr_arg<T>]) -> bool { let i: uint = 0u; for arg: @sp_constr_arg<T> in a { - if !arg_eq(eq, arg, b.(i)) { ret false; } + if !arg_eq(eq, arg, b[i]) { ret false; } i += 1u; } ret true; @@ -1576,7 +1578,7 @@ fn constr_eq(c: &@constr, d: &@constr) -> bool { fn constrs_eq(cs: &[@constr], ds: &[@constr]) -> bool { if vec::len(cs) != vec::len(ds) { ret false; } let i = 0u; - for c: @constr in cs { if !constr_eq(c, ds.(i)) { ret false; } i += 1u; } + for c: @constr in cs { if !constr_eq(c, ds[i]) { ret false; } i += 1u; } ret true; } @@ -1630,7 +1632,7 @@ fn node_id_to_type(cx: &ctxt, id: &ast::node_id) -> t { fn node_id_to_type_params(cx: &ctxt, id: &ast::node_id) -> [t] { alt node_id_to_ty_param_substs_opt_and_ty(cx, id).substs { - none. { ret ~[]; } + none. { ret []; } some(tps) { ret tps; } } } @@ -1663,17 +1665,17 @@ fn node_id_to_monotype(cx: &ctxt, id: ast::node_id) -> t { fn count_ty_params(cx: &ctxt, ty: t) -> uint { fn counter(cx: &ctxt, param_indices: @mutable [uint], ty: t) { alt struct(cx, ty) { - ty_param(param_idx,_) { + ty_param(param_idx, _) { let seen = false; for other_param_idx: uint in *param_indices { if param_idx == other_param_idx { seen = true; } } - if !seen { *param_indices += ~[param_idx]; } + if !seen { *param_indices += [param_idx]; } } _ {/* fall through */ } } } - let param_indices: @mutable [uint] = @mutable ~[]; + let param_indices: @mutable [uint] = @mutable []; let f = bind counter(cx, param_indices, _); walk_ty(cx, f, ty); ret vec::len::<uint>(*param_indices); @@ -1810,31 +1812,32 @@ fn is_lval(expr: &@ast::expr) -> bool { } } -fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: &t) - -> bool { - if (!type_contains_vars(tcx, rt)) { +fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: &t) -> + bool { + if !type_contains_vars(tcx, rt) { // Fast path ret false; } + // Occurs check! if vec::member(vid, vars_in_type(tcx, rt)) { alt sp { - some (s) { + some(s) { // Maybe this should be span_err -- however, there's an // assertion later on that the type doesn't contain // variables, so in this case we have to be sure to die. - tcx.sess.span_fatal(s, - "Type inference failed because I \ - could not find a type\n that's both of the form " + - ty_to_str(tcx, ty::mk_var(tcx, (vid))) - + " and of the form " + ty_to_str(tcx, rt) - + ". Such a type would have to be infinitely \ - large."); + tcx.sess.span_fatal( + s, + "Type inference failed because I \ + could not find a type\n that's both of the form " + + ty_to_str(tcx, ty::mk_var(tcx, vid)) + + " and of the form " + ty_to_str(tcx, rt) + + ". Such a type would have to be infinitely \ + large."); } _ { ret true; } } - } - else { ret false; } + } else { ret false; } } // Type unification via Robinson's algorithm (Robinson 1965). Implemented as @@ -1893,10 +1896,7 @@ mod unify { alt smallintmap::find(cx.vb.types, root_a) { none. { alt smallintmap::find(cx.vb.types, root_b) { - none. { - ufind::union(cx.vb.sets, set_a, set_b); - ret unres_ok; - } + none. { ufind::union(cx.vb.sets, set_a, set_b); ret unres_ok; } some(t_b) { replace_type(cx, t_b); ret unres_ok; } } } @@ -1958,7 +1958,7 @@ mod unify { let i = 0u; let rslt; for c: @type_constr in expected { - rslt = unify_constr(base_t, c, actual.(i)); + rslt = unify_constr(base_t, c, actual[i]); alt rslt { ures_ok(_) { } ures_err(_) { ret rslt; } } i += 1u; } @@ -1975,7 +1975,7 @@ mod unify { let i = 0u; let actual; for a: @ty_constr_arg in expected.node.args { - actual = actual_constr.node.args.(i); + actual = actual_constr.node.args[i]; alt a.node { carg_base. { alt actual.node { carg_base. { } _ { ret err_res; } } @@ -2021,22 +2021,22 @@ mod unify { } // TODO: as above, we should have an iter2 iterator. - let result_ins: [arg] = ~[]; + let result_ins: [arg] = []; let i = 0u; while i < expected_len { - let expected_input = expected_inputs.(i); - let actual_input = actual_inputs.(i); + let expected_input = expected_inputs[i]; + let actual_input = actual_inputs[i]; // Unify the result modes. let result_mode; if expected_input.mode != actual_input.mode { - ret fn_common_res_err - (ures_err(terr_mode_mismatch(expected_input.mode, - actual_input.mode))); + ret fn_common_res_err( + ures_err(terr_mode_mismatch(expected_input.mode, + actual_input.mode))); } else { result_mode = expected_input.mode; } let result = unify_step(cx, expected_input.ty, actual_input.ty); alt result { - ures_ok(rty) { result_ins += ~[{mode: result_mode, ty: rty}]; } + ures_ok(rty) { result_ins += [{mode: result_mode, ty: rty}]; } _ { ret fn_common_res_err(result); } } i += 1u; @@ -2053,12 +2053,13 @@ mod unify { expected: &t, actual: &t, expected_inputs: &[arg], expected_output: &t, actual_inputs: &[arg], actual_output: &t, expected_cf: &controlflow, actual_cf: &controlflow, - _expected_constrs: &[@constr], actual_constrs: &[@constr]) - -> result { + _expected_constrs: &[@constr], actual_constrs: &[@constr]) -> + result { if e_proto != a_proto { ret ures_err(terr_mismatch); } alt expected_cf { ast::return. { } - // ok + + // ok ast::noreturn. { alt actual_cf { ast::noreturn. { @@ -2109,14 +2110,14 @@ mod unify { fn unify_obj(cx: &@ctxt, expected: &t, actual: &t, expected_meths: &[method], actual_meths: &[method]) -> result { - let result_meths: [method] = ~[]; + let result_meths: [method] = []; let i: uint = 0u; let expected_len: uint = vec::len::<method>(expected_meths); let actual_len: uint = vec::len::<method>(actual_meths); if expected_len != actual_len { ret ures_err(terr_meth_count); } while i < expected_len { - let e_meth = expected_meths.(i); - let a_meth = actual_meths.(i); + let e_meth = expected_meths[i]; + let a_meth = actual_meths[i]; if !str::eq(e_meth.ident, a_meth.ident) { ret ures_err(terr_obj_meths(e_meth.ident, a_meth.ident)); } @@ -2130,8 +2131,8 @@ mod unify { alt struct(cx.tcx, tfn) { ty_fn(proto, ins, out, cf, constrs) { result_meths += - ~[{inputs: ins, output: out, cf: cf, constrs: constrs - with e_meth}]; + [{inputs: ins, output: out, cf: cf, constrs: constrs + with e_meth}]; } } } @@ -2148,9 +2149,7 @@ mod unify { fixup_result { alt struct(tcx, typ) { ty_var(vid) { - if vid as uint >= ufind::set_count(vb.sets) { - ret fix_err(vid); - } + if vid as uint >= ufind::set_count(vb.sets) { ret fix_err(vid); } let root_id = ufind::find(vb.sets, vid as uint); alt smallintmap::find::<t>(vb.types, root_id) { none. { ret fix_err(vid); } @@ -2172,6 +2171,7 @@ mod unify { alt struct(cx.tcx, actual) { + // If the RHS is a variable type, then just do the // appropriate binding. ty::ty_var(actual_id) { @@ -2219,6 +2219,7 @@ mod unify { alt struct(cx.tcx, expected) { ty::ty_nil. { ret struct_cmp(cx, expected, actual); } + // _|_ unifies with anything ty::ty_bot. { ret ures_ok(actual); @@ -2242,7 +2243,7 @@ mod unify { _ { ret ures_err(terr_mismatch); } } } - ty::ty_param(_,_) { ret struct_cmp(cx, expected, actual); } + ty::ty_param(_, _) { ret struct_cmp(cx, expected, actual); } ty::ty_tag(expected_id, expected_tps) { alt struct(cx.tcx, actual) { ty::ty_tag(actual_id, actual_tps) { @@ -2251,15 +2252,15 @@ mod unify { ret ures_err(terr_mismatch); } // TODO: factor this cruft out - let result_tps: [t] = ~[]; + let result_tps: [t] = []; let i = 0u; let expected_len = vec::len::<t>(expected_tps); while i < expected_len { - let expected_tp = expected_tps.(i); - let actual_tp = actual_tps.(i); + let expected_tp = expected_tps[i]; + let actual_tp = actual_tps[i]; let result = unify_step(cx, expected_tp, actual_tp); alt result { - ures_ok(rty) { result_tps += ~[rty]; } + ures_ok(rty) { result_tps += [rty]; } _ { ret result; } } i += 1u; @@ -2354,11 +2355,11 @@ mod unify { alt result { ures_ok(res_inner) { let i = 0u; - let res_tps = ~[]; + let res_tps = []; for ex_tp: t in ex_tps { - let result = unify_step(cx, ex_tp, act_tps.(i)); + let result = unify_step(cx, ex_tp, act_tps[i]); alt result { - ures_ok(rty) { res_tps += ~[rty]; } + ures_ok(rty) { res_tps += [rty]; } _ { ret result; } } i += 1u; @@ -2383,11 +2384,11 @@ mod unify { // TODO: implement an iterator that can iterate over // two arrays simultaneously. - let result_fields: [field] = ~[]; + let result_fields: [field] = []; let i = 0u; while i < expected_len { - let expected_field = expected_fields.(i); - let actual_field = actual_fields.(i); + let expected_field = expected_fields[i]; + let actual_field = actual_fields[i]; let mut; alt unify_mut(expected_field.mt.mut, actual_field.mt.mut) { @@ -2406,7 +2407,7 @@ mod unify { alt result { ures_ok(rty) { let mt = {ty: rty, mut: mut}; - result_fields += ~[{mt: mt with expected_field}]; + result_fields += [{mt: mt with expected_field}]; } _ { ret result; } } @@ -2422,24 +2423,21 @@ mod unify { ty::ty_tup(actual_elems) { let expected_len = vec::len(expected_elems); let actual_len = vec::len(actual_elems); - if (expected_len != actual_len) { + if expected_len != actual_len { let err = terr_tuple_size(expected_len, actual_len); ret ures_err(err); } // TODO: implement an iterator that can iterate over // two arrays simultaneously. - let result_elems = ~[]; + let result_elems = []; let i = 0u; while i < expected_len { - let expected_elem = expected_elems.(i); - let actual_elem = actual_elems.(i); - let result = unify_step(cx, expected_elem, - actual_elem); + let expected_elem = expected_elems[i]; + let actual_elem = actual_elems[i]; + let result = unify_step(cx, expected_elem, actual_elem); alt result { - ures_ok(rty) { - result_elems += ~[rty]; - } + ures_ok(rty) { result_elems += [rty]; } _ { ret result; } } i += 1u; @@ -2519,9 +2517,7 @@ mod unify { let sets = ""; let j = 0u; while j < vec::len::<option::t<uint>>(vb.sets.nodes) { - if ufind::find(vb.sets, j) == i { - sets += #fmt(" %u", j); - } + if ufind::find(vb.sets, j) == i { sets += #fmt[" %u", j]; } j += 1u; } let typespec; @@ -2529,7 +2525,7 @@ mod unify { none. { typespec = ""; } some(typ) { typespec = " =" + ty_to_str(tcx, typ); } } - log_err #fmt("set %u:%s%s", i, typespec, sets); + log_err #fmt["set %u:%s%s", i, typespec, sets]; i += 1u; } } @@ -2538,8 +2534,8 @@ mod unify { // Takes an optional span - complain about occurs check violations // iff the span is present (so that if we already know we're going // to error anyway, we don't complain) - fn fixup_vars(tcx: ty_ctxt, sp: &option::t<span>, - vb: @var_bindings, typ: t) -> fixup_result { + fn fixup_vars(tcx: ty_ctxt, sp: &option::t<span>, vb: @var_bindings, + typ: t) -> fixup_result { fn subst_vars(tcx: ty_ctxt, sp: &option::t<span>, vb: @var_bindings, unresolved: @mutable option::t<int>, vid: int) -> t { // Should really return a fixup_result instead of a t, but fold_ty @@ -2553,11 +2549,13 @@ mod unify { none. { *unresolved = some(vid); ret ty::mk_var(tcx, vid); } some(rt) { if occurs_check_fails(tcx, sp, vid, rt) { - // Return the type unchanged, so we can error out downstream + // Return the type unchanged, so we can error out + // downstream ret rt; } ret fold_ty(tcx, - fm_var(bind subst_vars(tcx, sp, vb, unresolved, _)), rt); + fm_var(bind subst_vars(tcx, sp, vb, unresolved, + _)), rt); } } } @@ -2572,8 +2570,7 @@ mod unify { } } fn resolve_type_var(tcx: &ty_ctxt, sp: &option::t<span>, - vb: &@var_bindings, vid: int) -> - fixup_result { + vb: &@var_bindings, vid: int) -> fixup_result { if vid as uint >= ufind::set_count(vb.sets) { ret fix_err(vid); } let root_id = ufind::find(vb.sets, vid as uint); alt smallintmap::find::<t>(vb.types, root_id) { @@ -2594,8 +2591,8 @@ fn type_err_to_str(err: &ty::type_err) -> str { terr_vec_mutability. { ret "vectors differ in mutability"; } terr_tuple_size(e_sz, a_sz) { ret "expected a tuple with " + uint::to_str(e_sz, 10u) + - " elements but found one with " + uint::to_str(a_sz, 10u) - + " elements"; + " elements but found one with " + uint::to_str(a_sz, 10u) + + " elements"; } terr_record_size(e_sz, a_sz) { ret "expected a record with " + uint::to_str(e_sz, 10u) + @@ -2634,25 +2631,23 @@ fn type_err_to_str(err: &ty::type_err) -> str { // Converts type parameters in a type to type variables and returns the // resulting type along with a list of type variable IDs. -fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int , - typ: t, ty_param_count: uint) -> {ids: [int], ty: t} { - let param_var_ids: @mutable [int] = @mutable ~[]; +fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int, typ: t, + ty_param_count: uint) -> {ids: [int], ty: t} { + let param_var_ids: @mutable [int] = @mutable []; let i = 0u; - while i < ty_param_count { *param_var_ids += ~[next_ty_var()]; i += 1u; } + while i < ty_param_count { *param_var_ids += [next_ty_var()]; i += 1u; } fn binder(sp: span, cx: ctxt, param_var_ids: @mutable [int], - _next_ty_var: fn() -> int , index: uint, _kind: ast::kind) - -> t { + _next_ty_var: fn() -> int, index: uint, _kind: ast::kind) -> t { if index < vec::len(*param_var_ids) { - ret mk_var(cx, param_var_ids.(index)); + ret mk_var(cx, param_var_ids[index]); } else { cx.sess.span_fatal(sp, "Unbound type parameter in callee's type"); } } let new_typ = fold_ty(cx, - fm_param(bind binder(sp, cx, param_var_ids, next_ty_var, - _, _)), - typ); + fm_param(bind binder(sp, cx, param_var_ids, next_ty_var, _, + _)), typ); ret {ids: *param_var_ids, ty: new_typ}; } @@ -2661,10 +2656,10 @@ fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int , // substitions. fn substitute_type_params(cx: &ctxt, substs: &[ty::t], typ: t) -> t { if !type_contains_params(cx, typ) { ret typ; } - fn substituter(_cx: ctxt, substs: @[ty::t], idx: uint, - _kind: ast::kind) -> t { + fn substituter(_cx: ctxt, substs: @[ty::t], idx: uint, _kind: ast::kind) + -> t { // FIXME: bounds check can fail - ret substs.(idx); + ret substs[idx]; } ret fold_ty(cx, fm_param(bind substituter(cx, @substs, _, _)), typ); } @@ -2679,7 +2674,7 @@ fn def_has_ty_params(def: &ast::def) -> bool { ast::def_local(_) { ret false; } ast::def_variant(_, _) { ret true; } ast::def_ty(_) { ret false; } - ast::def_ty_arg(_,_) { ret false; } + ast::def_ty_arg(_, _) { ret false; } ast::def_binding(_) { ret false; } ast::def_use(_) { ret false; } ast::def_native_ty(_) { ret false; } @@ -2702,20 +2697,20 @@ fn tag_variants(cx: &ctxt, id: &ast::def_id) -> [variant_info] { ast_map::node_item(item) { alt item.node { ast::item_tag(variants, _) { - let result: [variant_info] = ~[]; + let result: [variant_info] = []; for variant: ast::variant in variants { let ctor_ty = node_id_to_monotype(cx, variant.node.id); - let arg_tys: [t] = ~[]; + let arg_tys: [t] = []; if std::vec::len(variant.node.args) > 0u { for a: arg in ty_fn_args(cx, ctor_ty) { - arg_tys += ~[a.ty]; + arg_tys += [a.ty]; } } let did = variant.node.id; result += - ~[{args: arg_tys, - ctor_ty: ctor_ty, - id: ast::local_def(did)}]; + [{args: arg_tys, + ctor_ty: ctor_ty, + id: ast::local_def(did)}]; } ret result; } @@ -2731,7 +2726,7 @@ fn tag_variant_with_id(cx: &ctxt, tag_id: &ast::def_id, let variants = tag_variants(cx, tag_id); let i = 0u; while i < vec::len::<variant_info>(variants) { - let variant = variants.(i); + let variant = variants[i]; if def_eq(variant.id, variant_id) { ret variant; } i += 1u; } @@ -2841,7 +2836,7 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool { ty_rec(_) { tycat_struct } ty_tup(_) { tycat_struct } ty_tag(_, _) { tycat_struct } - ty_bot. { tycat_bot } + ty_bot. { tycat_bot } _ { tycat_other } } } @@ -2852,24 +2847,20 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool { /*. add, shift, bit . sub, rel, logic . mult, eq, */ - let /*other*/ - /*bool*/ - /*int*/ - /*float*/ - /*str*/ - /*vec*/ - /*bot*/ - tbl = - ~[~[f, f, f, f, t, t, f, f], - ~[f, f, f, f, t, t, t, t], - ~[t, t, t, t, t, t, t, f], - ~[t, t, t, f, t, t, f, f], - ~[t, f, f, f, t, t, f, f], - ~[t, f, f, f, t, t, f, f], - ~[f, f, f, f, t, t, f, f], - ~[t, t, t, t, t, t, t, t]]; /*struct*/ - - ret tbl.(tycat(cx, ty)).(opcat(op)); + /*other*/ + /*bool*/ + /*int*/ + /*float*/ + /*str*/ + /*vec*/ + /*bot*/ + let tbl = + [[f, f, f, f, t, t, f, f], [f, f, f, f, t, t, t, t], + [t, t, t, t, t, t, t, f], [t, t, t, f, t, t, f, f], + [t, f, f, f, t, t, f, f], [t, f, f, f, t, t, f, f], + [f, f, f, f, t, t, f, f], [t, t, t, t, t, t, t, t]]; /*struct*/ + + ret tbl[tycat(cx, ty)][opcat(op)]; } fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) -> @@ -2880,10 +2871,10 @@ fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) -> {path: c.node.path, args: c.node.args, id: pred_id}); } _ { - tcx.sess.span_fatal - (c.span, "Predicate " + path_to_str(c.node.path) + - " is unbound or bound to a non-function or an \ - impure function"); + tcx.sess.span_fatal(c.span, + "Predicate " + path_to_str(c.node.path) + + " is unbound or bound to a non-function or an \ + impure function"); } } } diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs index 7d6ba76e7eb..9e9d0682249 100644 --- a/src/comp/middle/typeck.rs +++ b/src/comp/middle/typeck.rs @@ -53,8 +53,10 @@ type ty_table = hashmap<ast::def_id, ty::t>; // Used for typechecking the methods of an object. tag obj_info { + // Regular objects have a node_id at compile time. regular_obj([ast::obj_field], ast::node_id); + // Anonymous objects only have a type at compile time. It's optional // because not all anonymous objects have a inner_obj to attach to. anon_obj([ast::obj_field], option::t<ty::sty>); @@ -78,14 +80,14 @@ type fn_ctxt = // Used for ast_ty_to_ty() below. -type ty_getter = fn(&ast::def_id) -> ty::ty_param_kinds_and_ty ; +type ty_getter = fn(&ast::def_id) -> ty::ty_param_kinds_and_ty; fn lookup_local(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> int { alt fcx.locals.find(id) { some(x) { x } _ { - fcx.ccx.tcx.sess.span_fatal - (sp, "internal error looking up a local var") + fcx.ccx.tcx.sess.span_fatal(sp, + "internal error looking up a local var") } } } @@ -94,23 +96,23 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def { alt fcx.ccx.tcx.def_map.find(id) { some(x) { x } _ { - fcx.ccx.tcx.sess.span_fatal - (sp, "internal error looking up a definition") + fcx.ccx.tcx.sess.span_fatal(sp, + "internal error looking up a definition") } } } fn ident_for_local(loc: &@ast::local) -> ast::ident { ret alt loc.node.pat.node { - ast::pat_bind(name) { name } - _ { "local" } // FIXME DESTR - }; + ast::pat_bind(name) { name } + _ { "local" } + }; // FIXME DESTR } // Returns the type parameter count and the type for the given definition. fn ty_param_kinds_and_ty_for_def(fcx: &@fn_ctxt, sp: &span, defn: &ast::def) -> ty_param_kinds_and_ty { - let no_kinds: [ast::kind] = ~[]; + let no_kinds: [ast::kind] = []; alt defn { ast::def_arg(id) { @@ -168,22 +170,25 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path, if ty_substs_len > 0u { let param_var_len = vec::len(ty_param_vars); if param_var_len == 0u { - fcx.ccx.tcx.sess.span_fatal - (sp, "this item does not take type parameters"); - } else if (ty_substs_len > param_var_len) { - fcx.ccx.tcx.sess.span_fatal - (sp, "too many type parameter provided for this item"); - } else if (ty_substs_len < param_var_len) { - fcx.ccx.tcx.sess.span_fatal - (sp, "not enough type parameters provided for this item"); - } - let ty_substs: [ty::t] = ~[]; + fcx.ccx.tcx.sess.span_fatal( + sp, + "this item does not take type parameters"); + } else if ty_substs_len > param_var_len { + fcx.ccx.tcx.sess.span_fatal( + sp, + "too many type parameter provided for this item"); + } else if ty_substs_len < param_var_len { + fcx.ccx.tcx.sess.span_fatal( + sp, + "not enough type parameters provided for this item"); + } + let ty_substs: [ty::t] = []; let i = 0u; while i < ty_substs_len { - let ty_var = ty::mk_var(fcx.ccx.tcx, ty_param_vars.(i)); - let ty_subst = ast_ty_to_ty_crate(fcx.ccx, pth.node.types.(i)); + let ty_var = ty::mk_var(fcx.ccx.tcx, ty_param_vars[i]); + let ty_subst = ast_ty_to_ty_crate(fcx.ccx, pth.node.types[i]); let res_ty = demand::simple(fcx, pth.span, ty_var, ty_subst); - ty_substs += ~[res_ty]; + ty_substs += [res_ty]; i += 1u; } ty_substs_opt = some::<[ty::t]>(ty_substs); @@ -194,10 +199,10 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path, } } else { // We will acquire the type parameters through unification. - let ty_substs: [ty::t] = ~[]; + let ty_substs: [ty::t] = []; let i = 0u; while i < ty_param_count { - ty_substs += ~[ty::mk_var(fcx.ccx.tcx, ty_param_vars.(i))]; + ty_substs += [ty::mk_var(fcx.ccx.tcx, ty_param_vars[i])]; i += 1u; } ty_substs_opt = some::<[ty::t]>(ty_substs); @@ -215,13 +220,13 @@ fn ast_mode_to_mode(mode: ast::mode) -> ty::mode { // Type tests -fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) -> - ty::t { +fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) -> ty::t { alt ty::unify::resolve_type_structure(fcx.ccx.tcx, fcx.var_bindings, tp) { fix_ok(typ_s) { ret typ_s; } fix_err(_) { - fcx.ccx.tcx.sess.span_fatal - (sp, "the type of this value must be known in this context"); + fcx.ccx.tcx.sess.span_fatal( + sp, + "the type of this value must be known in this context"); } } } @@ -293,12 +298,11 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> // The typedef is type-parametric. Do the type substitution. // - let param_bindings: [ty::t] = ~[]; + let param_bindings: [ty::t] = []; for ast_ty: @ast::ty in args { - param_bindings += ~[ast_ty_to_ty(tcx, getter, ast_ty)]; + param_bindings += [ast_ty_to_ty(tcx, getter, ast_ty)]; } - if vec::len(param_bindings) != - vec::len(ty_param_kinds_and_ty.kinds) { + if vec::len(param_bindings) != vec::len(ty_param_kinds_and_ty.kinds) { tcx.sess.span_fatal(sp, "Wrong number of type arguments for a \ polymorphic type"); @@ -335,23 +339,23 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> typ = ty::mk_tup(tcx, flds); } ast::ty_rec(fields) { - let flds: [field] = ~[]; + let flds: [field] = []; for f: ast::ty_field in fields { let tm = ast_mt_to_mt(tcx, getter, f.node.mt); - flds += ~[{ident: f.node.ident, mt: tm}]; + flds += [{ident: f.node.ident, mt: tm}]; } typ = ty::mk_rec(tcx, flds); } ast::ty_fn(proto, inputs, output, cf, constrs) { - let i = ~[]; + let i = []; for ta: ast::ty_arg in inputs { - i += ~[ast_arg_to_arg(tcx, getter, ta)]; + i += [ast_arg_to_arg(tcx, getter, ta)]; } let out_ty = ast_ty_to_ty(tcx, getter, output); - let out_constrs = ~[]; + let out_constrs = []; for constr: @ast::constr in constrs { - out_constrs += ~[ty::ast_constr_to_constr(tcx, constr)]; + out_constrs += [ty::ast_constr_to_constr(tcx, constr)]; } typ = ty::mk_fn(tcx, proto, i, out_ty, cf, out_constrs); } @@ -361,7 +365,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> typ = instantiate(tcx, ast_ty.span, getter, id, path.node.types); } some(ast::def_native_ty(id)) { typ = getter(id).ty; } - some(ast::def_ty_arg(id,k)) { typ = ty::mk_param(tcx, id, k); } + some(ast::def_ty_arg(id, k)) { typ = ty::mk_param(tcx, id, k); } some(_) { tcx.sess.span_fatal(ast_ty.span, "found type name used as a variable"); @@ -373,17 +377,17 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> cname = some(path_to_str(path)); } ast::ty_obj(meths) { - let tmeths: [ty::method] = ~[]; + let tmeths: [ty::method] = []; for m: ast::ty_method in meths { - let ins = ~[]; + let ins = []; for ta: ast::ty_arg in m.node.inputs { - ins += ~[ast_arg_to_arg(tcx, getter, ta)]; + ins += [ast_arg_to_arg(tcx, getter, ta)]; } let out = ast_ty_to_ty(tcx, getter, m.node.output); - let out_constrs = ~[]; + let out_constrs = []; for constr: @ast::constr in m.node.constrs { - out_constrs += ~[ty::ast_constr_to_constr(tcx, constr)]; + out_constrs += [ty::ast_constr_to_constr(tcx, constr)]; } let new_m: ty::method = {proto: m.node.proto, @@ -392,20 +396,19 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) -> output: out, cf: m.node.cf, constrs: out_constrs}; - tmeths += ~[new_m]; + tmeths += [new_m]; } typ = ty::mk_obj(tcx, ty::sort_methods(tmeths)); } ast::ty_constr(t, cs) { - let out_cs = ~[]; + let out_cs = []; for constr: @ast::ty_constr in cs { - out_cs += ~[ty::ast_constr_to_constr(tcx, constr)]; + out_cs += [ty::ast_constr_to_constr(tcx, constr)]; } typ = ty::mk_constr(tcx, ast_ty_to_ty(tcx, getter, t), out_cs); } ast::ty_infer. { - tcx.sess.span_bug(ast_ty.span, - "found ty_infer in unexpected place"); + tcx.sess.span_bug(ast_ty.span, "found ty_infer in unexpected place"); } } alt cname { @@ -429,8 +432,8 @@ fn ast_ty_to_ty_crate(ccx: @crate_ctxt, ast_ty: &@ast::ty) -> ty::t { } // A wrapper around ast_ty_to_ty_crate that handles ty_infer. -fn ast_ty_to_ty_crate_infer(ccx: @crate_ctxt, ast_ty: &@ast::ty) - -> option::t<ty::t> { +fn ast_ty_to_ty_crate_infer(ccx: @crate_ctxt, ast_ty: &@ast::ty) -> + option::t<ty::t> { alt ast_ty.node { ast::ty_infer. { none } _ { some(ast_ty_to_ty_crate(ccx, ast_ty)) } @@ -467,7 +470,7 @@ mod write { tpot: &ty_param_substs_opt_and_ty) { inner(fcx.ccx.tcx.node_types, node_id, tpot); if ty::type_contains_vars(fcx.ccx.tcx, tpot.ty) { - fcx.fixups += ~[node_id]; + fcx.fixups += [node_id]; } } @@ -521,35 +524,33 @@ mod collect { type ctxt = {tcx: ty::ctxt}; fn mk_ty_params(cx: &@ctxt, atps: &[ast::ty_param]) -> [ty::t] { - let tps = ~[]; + let tps = []; let i = 0u; for atp: ast::ty_param in atps { - tps += ~[ty::mk_param(cx.tcx, i, atp.kind)]; + tps += [ty::mk_param(cx.tcx, i, atp.kind)]; i += 1u; } ret tps; } fn ty_param_kinds(tps: &[ast::ty_param]) -> [ast::kind] { - let k: [ast::kind] = ~[]; - for p: ast::ty_param in tps { - k += ~[p.kind] - } + let k: [ast::kind] = []; + for p: ast::ty_param in tps { k += [p.kind] } ret k; } - fn ty_of_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t , - ty_of_arg: &fn(&ast::arg) -> arg , decl: &ast::fn_decl, + fn ty_of_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t, + ty_of_arg: &fn(&ast::arg) -> arg, decl: &ast::fn_decl, proto: ast::proto, ty_params: &[ast::ty_param], def_id: &option::t<ast::def_id>) -> ty::ty_param_kinds_and_ty { - let input_tys = ~[]; - for a: ast::arg in decl.inputs { input_tys += ~[ty_of_arg(a)]; } + let input_tys = []; + for a: ast::arg in decl.inputs { input_tys += [ty_of_arg(a)]; } let output_ty = convert(decl.output); - let out_constrs = ~[]; + let out_constrs = []; for constr: @ast::constr in decl.constraints { - out_constrs += ~[ty::ast_constr_to_constr(cx.tcx, constr)]; + out_constrs += [ty::ast_constr_to_constr(cx.tcx, constr)]; } let t_fn = ty::mk_fn(cx.tcx, proto_to_ty_proto(proto), input_tys, output_ty, @@ -558,13 +559,13 @@ mod collect { alt def_id { some(did) { cx.tcx.tcache.insert(did, tpt); } _ { } } ret tpt; } - fn ty_of_native_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t , - ty_of_arg: &fn(&ast::arg) -> arg , + fn ty_of_native_fn_decl(cx: &@ctxt, convert: &fn(&@ast::ty) -> ty::t, + ty_of_arg: &fn(&ast::arg) -> arg, decl: &ast::fn_decl, abi: ast::native_abi, ty_params: &[ast::ty_param], def_id: &ast::def_id) -> ty::ty_param_kinds_and_ty { - let input_tys = ~[]; - for a: ast::arg in decl.inputs { input_tys += ~[ty_of_arg(a)]; } + let input_tys = []; + for a: ast::arg in decl.inputs { input_tys += [ty_of_arg(a)]; } let output_ty = convert(decl.output); let t_fn = ty::mk_native_fn(cx.tcx, abi, input_tys, output_ty); @@ -608,16 +609,16 @@ mod collect { let get = bind getter(cx, _); let convert = bind ast_ty_to_ty(cx.tcx, get, _); - let inputs = ~[]; + let inputs = []; for a: ast::arg in m.node.meth.decl.inputs { - inputs += ~[ty_of_arg(cx, a)]; + inputs += [ty_of_arg(cx, a)]; } let output = convert(m.node.meth.decl.output); - let out_constrs = ~[]; + let out_constrs = []; for constr: @ast::constr in m.node.meth.decl.constraints { - out_constrs += ~[ty::ast_constr_to_constr(cx.tcx, constr)]; + out_constrs += [ty::ast_constr_to_constr(cx.tcx, constr)]; } ret {proto: proto_to_ty_proto(m.node.meth.proto), ident: m.node.ident, @@ -638,16 +639,16 @@ mod collect { ty::ty_param_kinds_and_ty { let t_obj = ty_of_obj(cx, id, ob, ty_params); - let t_inputs: [arg] = ~[]; + let t_inputs: [arg] = []; for f: ast::obj_field in ob.fields { let g = bind getter(cx, _); let t_field = ast_ty_to_ty(cx.tcx, g, f.ty); - t_inputs += ~[{mode: ty::mo_alias(false), ty: t_field}]; + t_inputs += [{mode: ty::mo_alias(false), ty: t_field}]; } let t_fn = ty::mk_fn(cx.tcx, ast::proto_fn, t_inputs, t_obj.ty, ast::return, - ~[]); + []); let tpt = {kinds: ty_param_kinds(ty_params), ty: t_fn}; cx.tcx.tcache.insert(local_def(ctor_id), tpt); ret tpt; @@ -655,7 +656,7 @@ mod collect { fn ty_of_item(cx: &@ctxt, it: &@ast::item) -> ty::ty_param_kinds_and_ty { let get = bind getter(cx, _); let convert = bind ast_ty_to_ty(cx.tcx, get, _); - let no_kinds: [ast::kind] = ~[]; + let no_kinds: [ast::kind] = []; alt it.node { ast::item_const(t, _) { let typ = convert(t); @@ -687,7 +688,7 @@ mod collect { ret tpt; } ast::item_res(f, _, tps, _) { - let t_arg = ty_of_arg(cx, f.decl.inputs.(0)); + let t_arg = ty_of_arg(cx, f.decl.inputs[0]); let t_res = {kinds: ty_param_kinds(tps), ty: @@ -710,7 +711,7 @@ mod collect { } fn ty_of_native_item(cx: &@ctxt, it: &@ast::native_item, abi: ast::native_abi) -> ty::ty_param_kinds_and_ty { - let no_kinds: [ast::kind] = ~[]; + let no_kinds: [ast::kind] = []; alt it.node { ast::native_item_fn(_, fn_decl, params) { let get = bind getter(cx, _); @@ -749,16 +750,16 @@ mod collect { // should be called to resolve named types. let f = bind getter(cx, _); - let args: [arg] = ~[]; + let args: [arg] = []; for va: ast::variant_arg in variant.node.args { let arg_ty = ast_ty_to_ty(cx.tcx, f, va.ty); - args += ~[{mode: ty::mo_alias(false), ty: arg_ty}]; + args += [{mode: ty::mo_alias(false), ty: arg_ty}]; } let tag_t = ty::mk_tag(cx.tcx, tag_id, ty_param_tys); // FIXME: this will be different for constrained types result_ty = ty::mk_fn(cx.tcx, ast::proto_fn, args, tag_t, ast::return, - ~[]); + []); } let tpt = {kinds: ty_param_kinds(ty_params), ty: result_ty}; cx.tcx.tcache.insert(local_def(variant.node.id), tpt); @@ -766,9 +767,9 @@ mod collect { } } fn get_obj_method_types(cx: &@ctxt, object: &ast::_obj) -> [ty::method] { - let meths = ~[]; + let meths = []; for m: @ast::method in object.methods { - meths += ~[ty_of_method(cx, m)]; + meths += [ty_of_method(cx, m)]; } ret meths; } @@ -793,8 +794,8 @@ mod collect { // we write into the table for this item. ty_of_item(cx, it); - let tpt = ty_of_obj_ctor(cx, it.ident, object, - ctor_id, ty_params); + let tpt = + ty_of_obj_ctor(cx, it.ident, object, ctor_id, ty_params); write::ty_only(cx.tcx, ctor_id, tpt.ty); // Write the methods into the type table. // @@ -804,9 +805,9 @@ mod collect { let method_types = get_obj_method_types(cx, object); let i = 0u; while i < vec::len::<@ast::method>(object.methods) { - write::ty_only(cx.tcx, object.methods.(i).node.id, + write::ty_only(cx.tcx, object.methods[i].node.id, ty::method_ty_to_fn_ty(cx.tcx, - method_types.(i))); + method_types[i])); i += 1u; } // Write in the types of the object fields. @@ -816,22 +817,22 @@ mod collect { let args = ty::ty_fn_args(cx.tcx, tpt.ty); i = 0u; while i < vec::len::<ty::arg>(args) { - let fld = object.fields.(i); - write::ty_only(cx.tcx, fld.id, args.(i).ty); + let fld = object.fields[i]; + write::ty_only(cx.tcx, fld.id, args[i].ty); i += 1u; } } ast::item_res(f, dtor_id, tps, ctor_id) { - let t_arg = ty_of_arg(cx, f.decl.inputs.(0)); + let t_arg = ty_of_arg(cx, f.decl.inputs[0]); let t_res = ty::mk_res(cx.tcx, local_def(it.id), t_arg.ty, mk_ty_params(cx, tps)); let t_ctor = - ty::mk_fn(cx.tcx, ast::proto_fn, ~[t_arg], t_res, ast::return, - ~[]); + ty::mk_fn(cx.tcx, ast::proto_fn, [t_arg], t_res, ast::return, + []); let t_dtor = - ty::mk_fn(cx.tcx, ast::proto_fn, ~[t_arg], ty::mk_nil(cx.tcx), - ast::return, ~[]); + ty::mk_fn(cx.tcx, ast::proto_fn, [t_arg], ty::mk_nil(cx.tcx), + ast::return, []); write::ty_only(cx.tcx, it.id, t_res); write::ty_only(cx.tcx, ctor_id, t_ctor); cx.tcx.tcache.insert(local_def(ctor_id), @@ -869,10 +870,12 @@ mod collect { // contained within the native module. let abi = @mutable none::<ast::native_abi>; let cx = @{tcx: tcx}; - let visit = visit::mk_simple_visitor - (@{visit_item: bind convert(cx, abi, _), - visit_native_item: bind convert_native(cx, abi, _) - with *visit::default_simple_visitor()}); + let visit = + visit::mk_simple_visitor(@{visit_item: bind convert(cx, abi, _), + visit_native_item: + bind convert_native(cx, abi, _) + with + *visit::default_simple_visitor()}); visit::visit_crate(*crate, (), visit); } } @@ -901,7 +904,7 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t { break; } } - _ {} + _ { } } t1 = inner.ty; } @@ -910,13 +913,12 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t { } ty::ty_tag(did, tps) { let variants = ty::tag_variants(fcx.ccx.tcx, did); - if vec::len(variants) != 1u || vec::len(variants.(0).args) != 1u - { + if vec::len(variants) != 1u || vec::len(variants[0].args) != 1u { ret t1; } t1 = ty::substitute_type_params(fcx.ccx.tcx, tps, - variants.(0).args.(0)); + variants[0].args[0]); } _ { ret t1; } } @@ -926,6 +928,7 @@ fn do_autoderef(fcx: &@fn_ctxt, sp: &span, t: &ty::t) -> ty::t { fn do_fn_block_coerce(fcx: &@fn_ctxt, sp: &span, actual: &ty::t, expected: &ty::t) -> ty::t { + // fns can be silently coerced to blocks when being used as // function call or bind arguments, but not the reverse. // If our actual type is a fn and our expected type is a block, @@ -962,16 +965,16 @@ type ty_param_substs_and_ty = {substs: [ty::t], ty: ty::t}; mod demand { fn simple(fcx: &@fn_ctxt, sp: &span, expected: &ty::t, actual: &ty::t) -> ty::t { - full(fcx, sp, expected, actual, ~[], false).ty + full(fcx, sp, expected, actual, [], false).ty } - fn block_coerce(fcx: &@fn_ctxt, sp: &span, - expected: &ty::t, actual: &ty::t) -> ty::t { - full(fcx, sp, expected, actual, ~[], true).ty + fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: &ty::t, + actual: &ty::t) -> ty::t { + full(fcx, sp, expected, actual, [], true).ty } fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: &ty::t, actual: &ty::t, ty_param_substs_0: &[ty::t]) -> - ty_param_substs_and_ty { + ty_param_substs_and_ty { full(fcx, sp, expected, actual, ty_param_substs_0, false) } @@ -984,33 +987,31 @@ mod demand { actual = do_fn_block_coerce(fcx, sp, actual, expected); } - let ty_param_substs: [mutable ty::t] = ~[mutable]; - let ty_param_subst_var_ids: [int] = ~[]; + let ty_param_substs: [mutable ty::t] = [mutable]; + let ty_param_subst_var_ids: [int] = []; for ty_param_subst: ty::t in ty_param_substs_0 { // Generate a type variable and unify it with the type parameter // substitution. We will then pull out these type variables. let t_0 = next_ty_var(fcx); - ty_param_substs += ~[mutable t_0]; - ty_param_subst_var_ids += ~[ty::ty_var_id(fcx.ccx.tcx, t_0)]; + ty_param_substs += [mutable t_0]; + ty_param_subst_var_ids += [ty::ty_var_id(fcx.ccx.tcx, t_0)]; simple(fcx, sp, ty_param_subst, t_0); } fn mk_result(fcx: &@fn_ctxt, result_ty: &ty::t, ty_param_subst_var_ids: &[int]) -> ty_param_substs_and_ty { - let result_ty_param_substs: [ty::t] = ~[]; + let result_ty_param_substs: [ty::t] = []; for var_id: int in ty_param_subst_var_ids { let tp_subst = ty::mk_var(fcx.ccx.tcx, var_id); - result_ty_param_substs += ~[tp_subst]; + result_ty_param_substs += [tp_subst]; } ret {substs: result_ty_param_substs, ty: result_ty}; } alt unify::unify(fcx, expected, actual) { - ures_ok(t) { - ret mk_result(fcx, t, ty_param_subst_var_ids); - } + ures_ok(t) { ret mk_result(fcx, t, ty_param_subst_var_ids); } ures_err(err) { let e_err = resolve_type_vars_if_possible(fcx, expected); let a_err = resolve_type_vars_if_possible(fcx, actual); @@ -1039,7 +1040,7 @@ fn are_compatible(fcx: &@fn_ctxt, expected: &ty::t, actual: &ty::t) -> bool { // Returns the types of the arguments to a tag variant. fn variant_arg_types(ccx: &@crate_ctxt, _sp: &span, vid: &ast::def_id, tag_ty_params: &[ty::t]) -> [ty::t] { - let result: [ty::t] = ~[]; + let result: [ty::t] = []; let tpt = ty::lookup_item_type(ccx.tcx, vid); alt ty::struct(ccx.tcx, tpt.ty) { ty::ty_fn(_, ins, _, _, _) { @@ -1049,7 +1050,7 @@ fn variant_arg_types(ccx: &@crate_ctxt, _sp: &span, vid: &ast::def_id, for arg: ty::arg in ins { let arg_ty = ty::substitute_type_params(ccx.tcx, tag_ty_params, arg.ty); - result += ~[arg_ty]; + result += [arg_ty]; } } _ { @@ -1077,8 +1078,8 @@ mod writeback { fn resolve_type_vars_in_type(fcx: &@fn_ctxt, sp: &span, typ: ty::t) -> option::t<ty::t> { if !ty::type_contains_vars(fcx.ccx.tcx, typ) { ret some(typ); } - alt ty::unify::fixup_vars(fcx.ccx.tcx, some(sp), - fcx.var_bindings, typ) { + alt ty::unify::fixup_vars(fcx.ccx.tcx, some(sp), fcx.var_bindings, + typ) { fix_ok(new_type) { ret some(new_type); } fix_err(vid) { fcx.ccx.tcx.sess.span_err(sp, @@ -1101,10 +1102,10 @@ mod writeback { alt tpot.substs { none::<[ty::t]>. { new_substs_opt = none::<[ty::t]>; } some::<[ty::t]>(substs) { - let new_substs: [ty::t] = ~[]; + let new_substs: [ty::t] = []; for subst: ty::t in substs { alt resolve_type_vars_in_type(fcx, sp, subst) { - some(t) { new_substs += ~[t]; } + some(t) { new_substs += [t]; } none. { wbcx.success = false; ret; } } } @@ -1163,28 +1164,28 @@ mod writeback { fn resolve_type_vars_in_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool { let wbcx = {fcx: fcx, mutable success: true}; - let visit = visit::mk_vt - (@{visit_item: visit_item, - visit_stmt: visit_stmt, - visit_expr: visit_expr, - visit_block: visit_block, - visit_pat: visit_pat, - visit_local: visit_local - with *visit::default_visitor()}); + let visit = + visit::mk_vt(@{visit_item: visit_item, + visit_stmt: visit_stmt, + visit_expr: visit_expr, + visit_block: visit_block, + visit_pat: visit_pat, + visit_local: visit_local + with *visit::default_visitor()}); visit::visit_expr(e, wbcx, visit); ret wbcx.success; } fn resolve_type_vars_in_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool { let wbcx = {fcx: fcx, mutable success: true}; - let visit = visit::mk_vt - (@{visit_item: visit_item, - visit_stmt: visit_stmt, - visit_expr: visit_expr, - visit_block: visit_block, - visit_pat: visit_pat, - visit_local: visit_local - with *visit::default_visitor()}); + let visit = + visit::mk_vt(@{visit_item: visit_item, + visit_stmt: visit_stmt, + visit_expr: visit_expr, + visit_block: visit_block, + visit_pat: visit_pat, + visit_local: visit_local + with *visit::default_visitor()}); visit::visit_block(blk, wbcx, visit); ret wbcx.success; } @@ -1202,42 +1203,40 @@ type gather_result = // Used only as a helper for check_fn. fn gather_locals(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, old_fcx: &option::t<@fn_ctxt>) -> gather_result { - let {vb, locals, local_names, nvi} = alt old_fcx { - none. { - { vb: ty::unify::mk_var_bindings(), - locals: new_int_hash::<int>(), - local_names: new_int_hash::<ast::ident>(), - nvi: @mutable 0 } - } - some(fcx) { - { vb: fcx.var_bindings, - locals: fcx.locals, - local_names: fcx.local_names, - nvi: fcx.next_var_id } - } - }; + let {vb: vb, locals: locals, local_names: local_names, nvi: nvi} = + alt old_fcx { + none. { + {vb: ty::unify::mk_var_bindings(), + locals: new_int_hash::<int>(), + local_names: new_int_hash::<ast::ident>(), + nvi: @mutable 0} + } + some(fcx) { + {vb: fcx.var_bindings, + locals: fcx.locals, + local_names: fcx.local_names, + nvi: fcx.next_var_id} + } + }; let tcx = ccx.tcx; - let next_var_id = lambda() -> int { - let rv = *nvi; - *nvi += 1; - ret rv; - }; - let assign = lambda(nid: ast::node_id, ident: &ast::ident, - ty_opt: option::t<ty::t>) { - let var_id = next_var_id(); - locals.insert(nid, var_id); - local_names.insert(nid, ident); - alt ty_opt { - none. {/* nothing to do */ } - some(typ) { - ty::unify::unify(ty::mk_var(tcx, var_id), typ, vb, tcx); - } - } - }; + let next_var_id = lambda () -> int { let rv = *nvi; *nvi += 1; ret rv; }; + let assign = + lambda (nid: ast::node_id, ident: &ast::ident, + ty_opt: option::t<ty::t>) { + let var_id = next_var_id(); + locals.insert(nid, var_id); + local_names.insert(nid, ident); + alt ty_opt { + none. {/* nothing to do */ } + some(typ) { + ty::unify::unify(ty::mk_var(tcx, var_id), typ, vb, tcx); + } + } + }; // Add object fields, if any. - let obj_fields = ~[]; + let obj_fields = []; alt get_obj_info(ccx) { some(oinfo) { alt oinfo { @@ -1256,32 +1255,33 @@ fn gather_locals(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, let args = ty::ty_fn_args(ccx.tcx, ty::node_id_to_type(ccx.tcx, id)); let i = 0u; for arg: ty::arg in args { - assign(f.decl.inputs.(i).id, f.decl.inputs.(i).ident, some(arg.ty)); + assign(f.decl.inputs[i].id, f.decl.inputs[i].ident, some(arg.ty)); i += 1u; } // Add explicitly-declared locals. - let visit_local = lambda(local: &@ast::local, e: &(), v: &visit::vt<()>) { - let local_ty = ast_ty_to_ty_crate_infer(ccx, local.node.ty); - assign(local.node.id, ident_for_local(local), local_ty); - visit::visit_local(local, e, v); - }; + let visit_local = + lambda (local: &@ast::local, e: &(), v: &visit::vt<()>) { + let local_ty = ast_ty_to_ty_crate_infer(ccx, local.node.ty); + assign(local.node.id, ident_for_local(local), local_ty); + visit::visit_local(local, e, v); + }; // Add pattern bindings. - let visit_pat = lambda(p: &@ast::pat, e: &(), v: &visit::vt<()>) { - alt p.node { - ast::pat_bind(ident) { - assign(p.id, ident, none); - } - _ {/* no-op */ } - } - visit::visit_pat(p, e, v); - }; + let visit_pat = + lambda (p: &@ast::pat, e: &(), v: &visit::vt<()>) { + alt p.node { + ast::pat_bind(ident) { assign(p.id, ident, none); } + _ {/* no-op */ } + } + visit::visit_pat(p, e, v); + }; // Don't descend into fns and items fn visit_fn<E>(_f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span, _i: &ast::fn_ident, _id: ast::node_id, _e: &E, - _v: &visit::vt<E>) { } + _v: &visit::vt<E>) { + } fn visit_item<E>(_i: &@ast::item, _e: &E, _v: &visit::vt<E>) { } let visit = @@ -1371,11 +1371,11 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, // TODO (issue #448): Wrap a #fmt string over multiple // lines... let s = - #fmt("this pattern has %u field%s, but the \ + #fmt["this pattern has %u field%s, but the \ corresponding variant has %u field%s", subpats_len, if subpats_len == 1u { "" } else { "s" }, - arg_len, if arg_len == 1u { "" } else { "s" }); + arg_len, if arg_len == 1u { "" } else { "s" }]; fcx.ccx.tcx.sess.span_fatal(pat.span, s); } @@ -1383,18 +1383,20 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, let i = 0u; for subpat: @ast::pat in subpats { - check_pat(fcx, map, subpat, arg_types.(i)); + check_pat(fcx, map, subpat, arg_types[i]); i += 1u; } - } else if (subpats_len > 0u) { + } else if subpats_len > 0u { // TODO: note definition of tag variant - fcx.ccx.tcx.sess.span_fatal - (pat.span, #fmt("this pattern has %u field%s, \ - but the corresponding \ - variant has no fields", - subpats_len, - if subpats_len == 1u { "" } - else { "s" })); + fcx.ccx.tcx.sess.span_fatal( + pat.span, + #fmt["this pattern has %u field%s, \ + but the corresponding \ + variant has no fields", + subpats_len, + if subpats_len == 1u { + "" + } else { "s" }]); } write::ty_fixup(fcx, pat.id, path_tpot); } @@ -1402,10 +1404,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, // FIXME: Switch expected and actual in this message? I // can never tell. fcx.ccx.tcx.sess.span_fatal(pat.span, - #fmt("mismatched types: \ + #fmt["mismatched types: \ expected %s, found tag", ty_to_str(fcx.ccx.tcx, - expected))); + expected)]); } } write::ty_fixup(fcx, pat.id, path_tpot); @@ -1416,19 +1418,21 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, ty::ty_rec(fields) { ex_fields = fields; } _ { fcx.ccx.tcx.sess.span_fatal(pat.span, - #fmt("mismatched types: expected %s, \ + #fmt["mismatched types: expected %s, \ found record", ty_to_str(fcx.ccx.tcx, - expected))); + expected)]); } } let f_count = vec::len(fields); let ex_f_count = vec::len(ex_fields); if ex_f_count < f_count || !etc && ex_f_count > f_count { - fcx.ccx.tcx.sess.span_fatal - (pat.span, #fmt("mismatched types: expected a record \ - with %u fields, found one with %u \ - fields", ex_f_count, f_count)); + fcx.ccx.tcx.sess.span_fatal( + pat.span, + #fmt["mismatched types: expected a record \ + with %u fields, found one with %u \ + fields", + ex_f_count, f_count]); } fn matches(name: &str, f: &ty::field) -> bool { ret str::eq(name, f.ident); @@ -1438,9 +1442,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, some(field) { check_pat(fcx, map, f.pat, field.mt.ty); } none. { fcx.ccx.tcx.sess.span_fatal(pat.span, - #fmt("mismatched types: did not \ + #fmt["mismatched types: did not \ expect a record with a field %s", - f.ident)); + f.ident]); } } } @@ -1452,23 +1456,23 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast::pat_id_map, pat: &@ast::pat, ty::ty_tup(elts) { ex_elts = elts; } _ { fcx.ccx.tcx.sess.span_fatal(pat.span, - #fmt("mismatched types: expected %s, \ - found tuple", ty_to_str(fcx.ccx.tcx, - expected))); + #fmt["mismatched types: expected %s, \ + found tuple", + ty_to_str(fcx.ccx.tcx, + expected)]); } } let e_count = vec::len(elts); if e_count != vec::len(ex_elts) { - fcx.ccx.tcx.sess.span_fatal - (pat.span, #fmt("mismatched types: expected a tuple \ - with %u fields, found one with %u \ - fields", vec::len(ex_elts), e_count)); + fcx.ccx.tcx.sess.span_fatal( + pat.span, + #fmt["mismatched types: expected a tuple \ + with %u fields, found one with %u \ + fields", + vec::len(ex_elts), e_count]); } let i = 0u; - for elt in elts { - check_pat(fcx, map, elt, ex_elts.(i)); - i += 1u; - } + for elt in elts { check_pat(fcx, map, elt, ex_elts[i]); i += 1u; } write::ty_only_fixup(fcx, pat.id, expected); } ast::pat_box(inner) { @@ -1506,31 +1510,31 @@ fn require_pure_call(ccx: @crate_ctxt, caller_purity: &ast::purity, alt ccx.tcx.def_map.find(callee.id) { some(ast::def_fn(_, ast::pure_fn.)) { ret; } _ { - ccx.tcx.sess.span_fatal - (sp, "Pure function calls function not known to be pure"); + ccx.tcx.sess.span_fatal( + sp, + "Pure function calls function not known to be pure"); } } } } } -type unifier = fn(fcx: &@fn_ctxt, sp: &span, - expected: &ty::t, actual: &ty::t) -> ty::t; +type unifier = fn(&@fn_ctxt, &span, &ty::t, &ty::t) -> ty::t; fn check_expr(fcx: &@fn_ctxt, expr: &@ast::expr) -> bool { - fn dummy_unify(_fcx: &@fn_ctxt, _sp: &span, - _expected: &ty::t, actual: &ty::t) -> ty::t { + fn dummy_unify(_fcx: &@fn_ctxt, _sp: &span, _expected: &ty::t, + actual: &ty::t) -> ty::t { actual } ret check_expr_with_unifier(fcx, expr, dummy_unify, 0u); } -fn check_expr_with(fcx: &@fn_ctxt, expr: &@ast::expr, expected: &ty::t) - -> bool { +fn check_expr_with(fcx: &@fn_ctxt, expr: &@ast::expr, expected: &ty::t) -> + bool { ret check_expr_with_unifier(fcx, expr, demand::simple, expected); } -fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, - unify: &unifier, expected: &ty::t) -> bool { +fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier, + expected: &ty::t) -> bool { //log_err "typechecking expr " + syntax::print::pprust::expr_to_str(expr); // A generic function to factor out common logic from call and bind @@ -1558,48 +1562,54 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ty::ty_fn(ast::proto_iter., _, _, _, _) { if call_kind != kind_for_each { fcx.ccx.tcx.sess.span_err( - sp, "calling iter outside of for each loop"); + sp, + "calling iter outside of for each loop"); } } _ { - if call_kind == kind_for_each { + if call_kind == kind_for_each { fcx.ccx.tcx.sess.span_err( - sp, "calling non-iter as sequence of for each loop"); + sp, + "calling non-iter as sequence of for each loop"); } } } // Grab the argument types - let arg_tys = alt sty { - ty::ty_fn(_, arg_tys, _, _, _) | - ty::ty_native_fn(_, arg_tys, _) { arg_tys } - _ { - fcx.ccx.tcx.sess.span_fatal(f.span, - "mismatched types: \ + let arg_tys = + alt sty { + ty::ty_fn(_, arg_tys, _, _, _) | ty::ty_native_fn(_, arg_tys, _) + { + arg_tys + } + _ { + fcx.ccx.tcx.sess.span_fatal(f.span, + "mismatched types: \ expected function or native \ function but found " - + ty_to_str(fcx.ccx.tcx, fty)) - } - }; + + ty_to_str(fcx.ccx.tcx, fty)) + } + }; // Check that the correct number of arguments were supplied. let expected_arg_count = vec::len(arg_tys); let supplied_arg_count = vec::len(args); if expected_arg_count != supplied_arg_count { - fcx.ccx.tcx.sess.span_err( - sp, - #fmt("this function takes %u \ + fcx.ccx.tcx.sess.span_err(sp, + #fmt["this function takes %u \ parameter%s but %u parameter%s supplied", - expected_arg_count, - if expected_arg_count == 1u { "" } else { "s" }, - supplied_arg_count, - if supplied_arg_count == 1u - { " was" } else { "s were" })); + expected_arg_count, + if expected_arg_count == 1u { + "" + } else { "s" }, supplied_arg_count, + if supplied_arg_count == 1u { + " was" + } else { "s were" }]); // HACK: extend the arguments list with dummy arguments to // check against let dummy = {mode: ty::mo_val, ty: ty::mk_nil(fcx.ccx.tcx)}; while vec::len(arg_tys) < supplied_arg_count { - arg_tys += ~[dummy]; + arg_tys += [dummy]; } } @@ -1609,26 +1619,31 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // functions. This is so that we have more information about the types // of arguments when we typecheck the functions. This isn't really the // right way to do this. - let check_args = lambda(check_blocks: bool) -> bool { - let i = 0u; - let bot = false; - for a_opt: option::t<@ast::expr> in args { - alt a_opt { - some(a) { - let is_block = - alt a.node { ast::expr_fn(_) { true } _ { false } }; - if is_block == check_blocks { - bot |= check_expr_with_unifier(fcx, a, - demand::block_coerce, - arg_tys.(i).ty); + let check_args = + lambda (check_blocks: bool) -> bool { + let i = 0u; + let bot = false; + for a_opt: option::t<@ast::expr> in args { + alt a_opt { + some(a) { + let is_block = + alt a.node { + ast::expr_fn(_) { true } + _ { false } + }; + if is_block == check_blocks { + bot |= + check_expr_with_unifier(fcx, a, + demand::block_coerce, + arg_tys[i].ty); + } + } + none. { } } - } - none. {} + i += 1u; } - i += 1u; - } - ret bot; - }; + ret bot; + }; bot |= check_args(false); bot |= check_args(true); @@ -1647,9 +1662,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // A generic function for checking call expressions fn check_call(fcx: &@fn_ctxt, sp: &span, f: &@ast::expr, args: &[@ast::expr], call_kind: call_kind) -> bool { - let args_opt_0: [option::t<@ast::expr>] = ~[]; + let args_opt_0: [option::t<@ast::expr>] = []; for arg: @ast::expr in args { - args_opt_0 += ~[some::<@ast::expr>(arg)]; + args_opt_0 += [some::<@ast::expr>(arg)]; } // Call the generic checker. @@ -1687,8 +1702,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, element_ty: ty::t, body: &ast::blk, node_id: ast::node_id) -> bool { let locid = lookup_local(fcx, local.span, local.node.id); - element_ty = demand::simple(fcx, local.span, element_ty, - ty::mk_var(fcx.ccx.tcx, locid)); + element_ty = + demand::simple(fcx, local.span, element_ty, + ty::mk_var(fcx.ccx.tcx, locid)); let bot = check_decl_local(fcx, local); check_block(fcx, body); // Unify type of decl with element type of the seq @@ -1812,9 +1828,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, bot = check_expr(fcx, oper); let oper_t = expr_ty(tcx, oper); alt unop { - ast::box(mut) { - oper_t = ty::mk_box(tcx, {ty: oper_t, mut: mut}); - } + ast::box(mut) { oper_t = ty::mk_box(tcx, {ty: oper_t, mut: mut}); } ast::deref. { alt structure_of(fcx, expr.span, oper_t) { ty::ty_box(inner) { oper_t = inner.ty; } @@ -1822,22 +1836,22 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ty::ty_tag(id, tps) { let variants = ty::tag_variants(tcx, id); if vec::len(variants) != 1u || - vec::len(variants.(0).args) != 1u { - tcx.sess.span_fatal - (expr.span, "can only dereference tags " + - "with a single variant which has a " - + "single argument"); + vec::len(variants[0].args) != 1u { + tcx.sess.span_fatal( + expr.span, + "can only dereference tags " + + "with a single variant which has a " + + "single argument"); } oper_t = - ty::substitute_type_params(tcx, tps, - variants.(0).args.(0)); + ty::substitute_type_params(tcx, tps, variants[0].args[0]); } ty::ty_ptr(inner) { oper_t = inner.ty; } _ { tcx.sess.span_fatal(expr.span, "dereferencing non-" + - "dereferenceable type: " + - ty_to_str(tcx, oper_t)); + "dereferenceable type: " + + ty_to_str(tcx, oper_t)); } } } @@ -1845,17 +1859,19 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, if !type_is_integral(fcx, oper.span, oper_t) && structure_of(fcx, oper.span, oper_t) != ty::ty_bool { tcx.sess.span_err(expr.span, - #fmt("mismatched types: expected bool \ + #fmt["mismatched types: expected bool \ or integer but found %s", - ty_to_str(tcx, oper_t))); + ty_to_str(tcx, oper_t)]); } } ast::neg. { oper_t = structurally_resolved_type(fcx, oper.span, oper_t); if !(ty::type_is_integral(tcx, oper_t) || - ty::type_is_fp(tcx, oper_t)) { - tcx.sess.span_err(expr.span, "applying unary minus to \ - non-numeric type " + ty_to_str(tcx, oper_t)); + ty::type_is_fp(tcx, oper_t)) { + tcx.sess.span_err(expr.span, + "applying unary minus to \ + non-numeric type " + + ty_to_str(tcx, oper_t)); } } } @@ -1883,9 +1899,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, bot = true; alt expr_opt { none. {/* do nothing */ } - some(e) { - check_expr_with(fcx, e, ty::mk_str(tcx)); - } + some(e) { check_expr_with(fcx, e, ty::mk_str(tcx)); } } write::bot_ty(tcx, id); } @@ -1901,15 +1915,13 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, "ret; in function returning non-nil"); } } - some(e) { - check_expr_with(fcx, e, fcx.ret_ty); - } + some(e) { check_expr_with(fcx, e, fcx.ret_ty); } } write::bot_ty(tcx, id); } ast::expr_put(expr_opt) { require_impure(tcx.sess, fcx.purity, expr.span); - if (fcx.proto != ast::proto_iter) { + if fcx.proto != ast::proto_iter { tcx.sess.span_err(expr.span, "put in non-iterator"); } alt expr_opt { @@ -1920,9 +1932,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, "put; in iterator yielding non-nil"); } } - some(e) { - bot = check_expr_with(fcx, e, fcx.ret_ty); - } + some(e) { bot = check_expr_with(fcx, e, fcx.ret_ty); } } write::nil_ty(tcx, id); } @@ -1942,8 +1952,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, write::nil_ty(tcx, id); } ast::expr_if_check(cond, thn, elsopt) { - bot = check_pred_expr(fcx, cond) | - check_then_else(fcx, thn, elsopt, id, expr.span); + bot = + check_pred_expr(fcx, cond) | + check_then_else(fcx, thn, elsopt, id, expr.span); } ast::expr_ternary(_, _, _) { bot = check_expr(fcx, ast::ternary_to_if(expr)); @@ -1954,8 +1965,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } ast::expr_copy(a) { bot = check_expr_with_unifier(fcx, a, unify, expected); - let tpot = ty::node_id_to_ty_param_substs_opt_and_ty(fcx.ccx.tcx, - a.id); + let tpot = + ty::node_id_to_ty_param_substs_opt_and_ty(fcx.ccx.tcx, a.id); write::ty_fixup(fcx, id, tpot); } @@ -1974,12 +1985,12 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ast::expr_assign_op(op, lhs, rhs) { require_impure(tcx.sess, fcx.purity, expr.span); bot = check_assignment(fcx, expr.span, lhs, rhs, id); - check_binop_type_compat(fcx, expr.span, expr_ty(tcx, lhs), - op); + check_binop_type_compat(fcx, expr.span, expr_ty(tcx, lhs), op); } ast::expr_if(cond, thn, elsopt) { - bot = check_expr_with(fcx, cond, ty::mk_bool(tcx)) | - check_then_else(fcx, thn, elsopt, id, expr.span); + bot = + check_expr_with(fcx, cond, ty::mk_bool(tcx)) | + check_then_else(fcx, thn, elsopt, id, expr.span); } ast::expr_for(decl, seq, body) { bot = check_expr(fcx, seq); @@ -1990,24 +2001,27 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ty::ty_vec(vec_elt_ty) { elt_ty = vec_elt_ty.ty; } ty::ty_istr. { elt_ty = ty::mk_mach(tcx, ast::ty_u8); } _ { - tcx.sess.span_fatal - (expr.span, "mismatched types: expected vector or string but " - + "found " + ty_to_str(tcx, ety)); + tcx.sess.span_fatal( + expr.span, + "mismatched types: expected vector or string but " + + "found " + ty_to_str(tcx, ety)); } } bot |= check_for_or_for_each(fcx, decl, elt_ty, body, id); } ast::expr_for_each(decl, seq, body) { - alt (seq.node) { + alt seq.node { ast::expr_call(f, args) { - bot = check_call_full(fcx, seq.span, f, args, - kind_for_each, seq.id); + bot = + check_call_full(fcx, seq.span, f, args, kind_for_each, + seq.id); + } + _ { + tcx.sess.span_fatal(expr.span, + "sequence in for each loop not a call"); } - _ { tcx.sess.span_fatal( - expr.span, "sequence in for each loop not a call"); } } - bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq), - body, id); + bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq), body, id); } ast::expr_while(cond, body) { bot = check_expr_with(fcx, cond, ty::mk_bool(tcx)); @@ -2025,7 +2039,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // bindings. let pattern_ty = ty::expr_ty(tcx, expr); for arm: ast::arm in arms { - let id_map = ast::pat_id_map(arm.pats.(0)); + let id_map = ast::pat_id_map(arm.pats[0]); for p: @ast::pat in arm.pats { check_pat(fcx, id_map, p, pattern_ty); } @@ -2045,14 +2059,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ast::expr_fn(f) { let cx = @{tcx: tcx}; let convert = bind ast_ty_to_ty_crate_tyvar(fcx, _); - let ty_of_arg = lambda(a: &ast::arg) -> ty::arg { - let ty_mode = ast_mode_to_mode(a.mode); - let tt = ast_ty_to_ty_crate_tyvar(fcx, a.ty); - ret {mode: ty_mode, ty: tt}; - }; + let ty_of_arg = + lambda (a: &ast::arg) -> ty::arg { + let ty_mode = ast_mode_to_mode(a.mode); + let tt = ast_ty_to_ty_crate_tyvar(fcx, a.ty); + ret {mode: ty_mode, ty: tt}; + }; let fty = collect::ty_of_fn_decl(cx, convert, ty_of_arg, f.decl, f.proto, - ~[], none).ty; + [], none).ty; write::ty_only_fixup(fcx, id, fty); // Unify the type of the function with the expected type before we @@ -2065,10 +2080,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } ast::expr_block(b) { bot = check_block(fcx, b); - let typ = alt b.node.expr { - some(expr) { expr_ty(tcx, expr) } - none. { ty::mk_nil(tcx) } - }; + let typ = + alt b.node.expr { + some(expr) { expr_ty(tcx, expr) } + none. { ty::mk_nil(tcx) } + }; write::ty_only_fixup(fcx, id, typ); } ast::expr_bind(f, args) { @@ -2077,7 +2093,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // Pull the argument and return types out. let proto_1; - let arg_tys_1: [ty::arg] = ~[]; + let arg_tys_1: [ty::arg] = []; let rt_1; let fty = expr_ty(tcx, f); let t_1; @@ -2093,17 +2109,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // to the resulting function type. let i = 0u; while i < vec::len::<option::t<@ast::expr>>(args) { - alt args.(i) { + alt args[i] { some(_) {/* no-op */ } - none. { arg_tys_1 += ~[arg_tys.(i)]; } + none. { arg_tys_1 += [arg_tys[i]]; } } i += 1u; } t_1 = ty::mk_fn(tcx, proto_1, arg_tys_1, rt_1, cf, constrs); } - _ { - fail "LHS of bind expr didn't have a function type?!"; - } + _ { fail "LHS of bind expr didn't have a function type?!"; } } write::ty_only_fixup(fcx, id, t_1); } @@ -2120,6 +2134,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, alt oinfo { regular_obj(_, obj_id) { let did = local_def(obj_id); + // Try looking up the current object in the type // cache. alt tcx.tcache.find(did) { @@ -2131,7 +2146,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } none. { tcx.sess.bug("didn't find " + int::str(did.node) + - " in type cache"); + " in type cache"); } } } @@ -2172,33 +2187,31 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, type_is_scalar(fcx, expr.span, t_1)) { tcx.sess.span_err(expr.span, "non-scalar cast: " + - ty_to_str(tcx, expr_ty(tcx, e)) - + " as " + ty_to_str(tcx, t_1)); + ty_to_str(tcx, expr_ty(tcx, e)) + " as " + + ty_to_str(tcx, t_1)); } write::ty_only_fixup(fcx, id, t_1); } ast::expr_vec(args, mut) { let t: ty::t = next_ty_var(fcx); - for e: @ast::expr in args { - bot |= check_expr_with(fcx, e, t); - } + for e: @ast::expr in args { bot |= check_expr_with(fcx, e, t); } let typ = ty::mk_vec(tcx, {ty: t, mut: mut}); write::ty_only_fixup(fcx, id, typ); } ast::expr_tup(elts) { - let elt_ts = ~[]; + let elt_ts = []; vec::reserve(elt_ts, vec::len(elts)); for e in elts { check_expr(fcx, e); let ety = expr_ty(fcx.ccx.tcx, e); - elt_ts += ~[ety]; + elt_ts += [ety]; } let typ = ty::mk_tup(fcx.ccx.tcx, elt_ts); write::ty_only_fixup(fcx, id, typ); } ast::expr_rec(fields, base) { alt base { none. {/* no-op */ } some(b_0) { check_expr(fcx, b_0); } } - let fields_t: [spanned<field>] = ~[]; + let fields_t: [spanned<field>] = []; for f: ast::field in fields { bot |= check_expr(fcx, f.node.expr); let expr_t = expr_ty(tcx, f.node.expr); @@ -2206,8 +2219,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // for the most precise error message, // should be f.node.expr.span, not f.span fields_t += - ~[respan(f.node.expr.span, - {ident: f.node.ident, mt: expr_mt})]; + [respan(f.node.expr.span, + {ident: f.node.ident, mt: expr_mt})]; } alt base { none. { @@ -2218,7 +2231,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, some(bexpr) { bot |= check_expr(fcx, bexpr); let bexpr_t = expr_ty(tcx, bexpr); - let base_fields: [field] = ~[]; + let base_fields: [field] = []; alt structure_of(fcx, expr.span, bexpr_t) { ty::ty_rec(flds) { base_fields = flds; } _ { @@ -2237,8 +2250,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } if !found { tcx.sess.span_fatal(f.span, - "unknown field in record update: " - + f.node.ident); + "unknown field in record update: " + + f.node.ident); } } } @@ -2250,12 +2263,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, base_t = do_autoderef(fcx, expr.span, base_t); alt structure_of(fcx, expr.span, base_t) { ty::ty_rec(fields) { - let ix: uint = - ty::field_idx(tcx.sess, expr.span, field, fields); + let ix: uint = ty::field_idx(tcx.sess, expr.span, field, fields); if ix >= vec::len::<ty::field>(fields) { tcx.sess.span_fatal(expr.span, "bad index on record"); } - write::ty_only_fixup(fcx, id, fields.(ix).mt.ty); + write::ty_only_fixup(fcx, id, fields[ix].mt.ty); } ty::ty_obj(methods) { let ix: uint = @@ -2263,17 +2275,17 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, if ix >= vec::len::<ty::method>(methods) { tcx.sess.span_fatal(expr.span, "bad index on obj"); } - let meth = methods.(ix); + let meth = methods[ix]; let t = - ty::mk_fn(tcx, meth.proto, meth.inputs, meth.output, - meth.cf, meth.constrs); + ty::mk_fn(tcx, meth.proto, meth.inputs, meth.output, meth.cf, + meth.constrs); write::ty_only_fixup(fcx, id, t); } _ { let t_err = resolve_type_vars_if_possible(fcx, base_t); let msg = - #fmt("attempted field access on type %s", - ty_to_str(tcx, t_err)); + #fmt["attempted field access on type %s", + ty_to_str(tcx, t_err)]; tcx.sess.span_fatal(expr.span, msg); } } @@ -2288,7 +2300,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, tcx.sess.span_err(idx.span, "mismatched types: expected \ integer but found " - + ty_to_str(tcx, idx_t)); + + ty_to_str(tcx, idx_t)); } alt structure_of(fcx, expr.span, base_t) { ty::ty_vec(mt) { write::ty_only_fixup(fcx, id, mt.ty); } @@ -2303,12 +2315,12 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, _ { tcx.sess.span_fatal(expr.span, "vector-indexing bad type: " + - ty_to_str(tcx, base_t)); + ty_to_str(tcx, base_t)); } } } ast::expr_anon_obj(ao) { - let fields: [ast::anon_obj_field] = ~[]; + let fields: [ast::anon_obj_field] = []; alt ao.fields { none. { } some(v) { fields = v; } } // FIXME: These next three functions are largely ripped off from @@ -2321,16 +2333,16 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, fn ty_of_method(ccx: @crate_ctxt, m: &@ast::method) -> ty::method { let convert = bind ast_ty_to_ty_crate(ccx, _); - let inputs = ~[]; + let inputs = []; for aa: ast::arg in m.node.meth.decl.inputs { - inputs += ~[ty_of_arg(ccx, aa)]; + inputs += [ty_of_arg(ccx, aa)]; } let output = convert(m.node.meth.decl.output); - let out_constrs = ~[]; + let out_constrs = []; for constr: @ast::constr in m.node.meth.decl.constraints { - out_constrs += ~[ty::ast_constr_to_constr(ccx.tcx, constr)]; + out_constrs += [ty::ast_constr_to_constr(ccx.tcx, constr)]; } ret {proto: m.node.meth.proto, @@ -2341,18 +2353,18 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, constrs: out_constrs}; } - let method_types: [ty::method] = ~[]; + let method_types: [ty::method] = []; { // Outer methods. for m: @ast::method in ao.methods { - method_types += ~[ty_of_method(fcx.ccx, m)]; + method_types += [ty_of_method(fcx.ccx, m)]; } // Inner methods. // Typecheck 'inner_obj'. If it exists, it had better have object // type. - let inner_obj_methods: [ty::method] = ~[]; + let inner_obj_methods: [ty::method] = []; let inner_obj_ty: ty::t = ty::mk_nil(tcx); let inner_obj_sty: option::t<ty::sty> = none; alt ao.inner_obj { @@ -2371,9 +2383,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, ty::ty_obj(ms) { inner_obj_methods = ms; } _ { // The user is trying to extend a non-object. - tcx.sess.span_fatal - (e.span, syntax::print::pprust::expr_to_str(e) + - " does not have object type"); + tcx.sess.span_fatal( + e.span, + syntax::print::pprust::expr_to_str(e) + + + " does not have object type"); } } } @@ -2382,16 +2396,15 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } fcx.ccx.obj_infos += - ~[anon_obj(vec::map(ast::obj_field_from_anon_obj_field, - fields), inner_obj_sty)]; + [anon_obj(vec::map(ast::obj_field_from_anon_obj_field, + fields), inner_obj_sty)]; // Whenever an outer method overrides an inner, we need to remove // that inner from the type. Filter inner_obj_methods to remove // any methods that share a name with an outer method. - fn filtering_fn(ccx: @crate_ctxt, - m: &ty::method, + fn filtering_fn(ccx: @crate_ctxt, m: &ty::method, outer_obj_methods: [@ast::method]) -> - option::t<ty::method> { + option::t<ty::method> { for om: @ast::method in outer_obj_methods { if str::eq(om.node.ident, m.ident) { @@ -2401,8 +2414,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, if new_type != m { ccx.tcx.sess.span_fatal( om.span, - "Attempted to override method " + - m.ident + " with one of a different type"); + "Attempted to override method " + + m.ident + + " with one of a different type"); } ret none; } @@ -2426,9 +2440,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, // collect::convert for regular objects.) let i = 0u; while i < vec::len::<@ast::method>(ao.methods) { - write::ty_only(tcx, ao.methods.(i).node.id, - ty::method_ty_to_fn_ty(tcx, - method_types.(i))); + write::ty_only(tcx, ao.methods[i].node.id, + ty::method_ty_to_fn_ty(tcx, method_types[i])); i += 1u; } @@ -2447,9 +2460,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, } _ { tcx.sess.unimpl("expr type in typeck::check_expr"); } } - if bot { - write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx)); - } + if bot { write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx)); } unify(fcx, expr.span, expected, expr_ty(tcx, expr)); ret bot; @@ -2481,7 +2492,7 @@ fn check_decl_local(fcx: &@fn_ctxt, local: &@ast::local) -> bool { alt fcx.locals.find(local.node.id) { none. { fcx.ccx.tcx.sess.bug("check_decl_local: local id not found " + - ident_for_local(local)); + ident_for_local(local)); } some(i) { let t = ty::mk_var(fcx.ccx.tcx, i); @@ -2523,11 +2534,13 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool { let warned = false; for s: @ast::stmt in blk.node.stmts { if bot && !warned && - alt s.node { - ast::stmt_decl(@{node: ast::decl_local(_), _}, _) | - ast::stmt_expr(_, _) { true } - _ { false } - } { + alt s.node { + ast::stmt_decl(@{node: ast::decl_local(_), _}, _) | + ast::stmt_expr(_, _) { + true + } + _ { false } + } { fcx.ccx.tcx.sess.span_warn(s.span, "unreachable statement"); warned = true; } @@ -2555,7 +2568,7 @@ fn check_const(ccx: &@crate_ctxt, _sp: &span, e: &@ast::expr, // FIXME: this is kinda a kludge; we manufacture a fake function context // and statement context for checking the initializer expression. let rty = node_id_to_type(ccx.tcx, id); - let fixups: [ast::node_id] = ~[]; + let fixups: [ast::node_id] = []; let fcx: @fn_ctxt = @{ret_ty: rty, purity: ast::pure_fn, @@ -2574,7 +2587,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, let decl = f.decl; let body = f.body; let gather_result = gather_locals(ccx, f, id, old_fcx); - let fixups: [ast::node_id] = ~[]; + let fixups: [ast::node_id] = []; let fcx: @fn_ctxt = @{ret_ty: ty::ty_fn_ret(ccx.tcx, ty::node_id_to_type(ccx.tcx, id)), purity: decl.purity, @@ -2588,6 +2601,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, check_block(fcx, body); alt decl.purity { ast::pure_fn. { + // This just checks that the declared type is bool, and trusts // that that's the actual return type. if !ty::type_is_bool(ccx.tcx, fcx.ret_ty) { @@ -2598,16 +2612,17 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, _ { } } -// For non-iterator fns, we unify the tail expr's type with the -// function result type, if there is a tail expr. -// We don't do this check for an iterator, as the tail expr doesn't -// have to have the result type of the iterator. + // For non-iterator fns, we unify the tail expr's type with the + // function result type, if there is a tail expr. + // We don't do this check for an iterator, as the tail expr doesn't + // have to have the result type of the iterator. if option::is_some(body.node.expr) && f.proto != ast::proto_iter { let tail_expr = option::get(body.node.expr); // The use of resolve_type_vars_if_possible makes me very // afraid :-( - let tail_expr_ty = resolve_type_vars_if_possible( - fcx, expr_ty(ccx.tcx, tail_expr)); + let tail_expr_ty = + resolve_type_vars_if_possible(fcx, expr_ty(ccx.tcx, tail_expr)); + // Hacky compromise: use eq and not are_compatible // This allows things like while loops and ifs with no // else to appear in tail position without a trailing @@ -2623,7 +2638,7 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id, // force any remaining type vars to be resolved. // If we have an enclosing function scope, our type variables will be // resolved when the enclosing scope finishes up. - if (option::is_none(old_fcx)) { + if option::is_none(old_fcx) { writeback::resolve_type_vars_in_block(fcx, body); } } @@ -2639,7 +2654,7 @@ fn check_item(ccx: @crate_ctxt, it: &@ast::item) { ast::item_res(f, dtor_id, _, _) { check_fn(ccx, f, dtor_id, none); } ast::item_obj(ob, _, _) { // We're entering an object, so gather up the info we need. - ccx.obj_infos += ~[regular_obj(ob.fields, it.id)]; + ccx.obj_infos += [regular_obj(ob.fields, it.id)]; // Typecheck the methods. for method: @ast::method in ob.methods { check_method(ccx, method); } @@ -2672,17 +2687,19 @@ fn check_main_fn_ty(tcx: &ty::ctxt, main_id: &ast::node_id) { ok &= ty::type_is_nil(tcx, rs); let num_args = vec::len(args); ok &= - num_args == 0u || num_args == 1u && arg_is_argv_ty(tcx, args.(0)); + num_args == 0u || num_args == 1u && arg_is_argv_ty(tcx, args[0]); if !ok { let span = ast_map::node_span(tcx.items.get(main_id)); - tcx.sess.span_err(span, "wrong type in main function: found " + - ty_to_str(tcx, main_t)); + tcx.sess.span_err(span, + "wrong type in main function: found " + + ty_to_str(tcx, main_t)); } } _ { let span = ast_map::node_span(tcx.items.get(main_id)); - tcx.sess.span_bug(span, "main has a non-function type: found" + - ty_to_str(tcx, main_t)); + tcx.sess.span_bug(span, + "main has a non-function type: found" + + ty_to_str(tcx, main_t)); } } } @@ -2699,12 +2716,12 @@ fn check_for_main_fn(tcx: &ty::ctxt, crate: &@ast::crate) { fn check_crate(tcx: &ty::ctxt, crate: &@ast::crate) { collect::collect_item_types(tcx, crate); - let obj_infos: [obj_info] = ~[]; + let obj_infos: [obj_info] = []; let ccx = @{mutable obj_infos: obj_infos, tcx: tcx}; - let visit = visit::mk_simple_visitor - (@{visit_item: bind check_item(ccx, _) - with *visit::default_simple_visitor()}); + let visit = + visit::mk_simple_visitor(@{visit_item: bind check_item(ccx, _) + with *visit::default_simple_visitor()}); visit::visit_crate(*crate, (), visit); check_for_main_fn(tcx, crate); tcx.sess.abort_if_errors(); diff --git a/src/comp/syntax/ast.rs b/src/comp/syntax/ast.rs index 7c9bd7c6897..80d327b119b 100644 --- a/src/comp/syntax/ast.rs +++ b/src/comp/syntax/ast.rs @@ -49,6 +49,7 @@ tag def { def_arg(def_id); def_local(def_id); def_variant(def_id, /* tag */def_id); + /* variant */ def_ty(def_id); def_ty_arg(uint, kind); @@ -56,6 +57,7 @@ tag def { def_use(def_id); def_native_ty(def_id); def_native_fn(def_id); + /* A "fake" def for upvars. This never appears in the def_map, but * freevars::def_lookup will return it for a def that is an upvar. * It contains the actual def. */ @@ -77,7 +79,7 @@ fn def_id_of_def(d: def) -> def_id { def_local(id) { ret id; } def_variant(_, id) { ret id; } def_ty(id) { ret id; } - def_ty_arg(_,_) { fail; } + def_ty_arg(_, _) { fail; } def_binding(id) { ret id; } def_use(id) { ret id; } def_native_ty(id) { ret id; } @@ -100,10 +102,7 @@ type crate_ = tag crate_directive_ { cdir_src_mod(ident, option::t<filename>, [attribute]); - cdir_dir_mod(ident, - option::t<filename>, - [@crate_directive], - [attribute]); + cdir_dir_mod(ident, option::t<filename>, [@crate_directive], [attribute]); cdir_view_item(@view_item); cdir_syntax(path); cdir_auth(path, _auth); @@ -155,30 +154,22 @@ iter pat_bindings(pat: &@pat) -> @pat { alt pat.node { pat_bind(_) { put pat; } pat_tag(_, sub) { - for p in sub { - for each b in pat_bindings(p) { put b; } - } + for p in sub { for each b in pat_bindings(p) { put b; } } } pat_rec(fields, _) { - for f in fields { - for each b in pat_bindings(f.pat) { put b; } - } + for f in fields { for each b in pat_bindings(f.pat) { put b; } } } pat_tup(elts) { - for elt in elts { - for each b in pat_bindings(elt) { put b; } - } - } - pat_box(sub) { - for each b in pat_bindings(sub) { put b; } + for elt in elts { for each b in pat_bindings(elt) { put b; } } } - pat_wild. | pat_lit(_) {} + pat_box(sub) { for each b in pat_bindings(sub) { put b; } } + pat_wild. | pat_lit(_) { } } } fn pat_binding_ids(pat: &@pat) -> [node_id] { - let found = ~[]; - for each b in pat_bindings(pat) { found += ~[b.id]; } + let found = []; + for each b in pat_bindings(pat) { found += [b.id]; } ret found; } @@ -258,6 +249,7 @@ type stmt = spanned<stmt_>; tag stmt_ { stmt_decl(@decl, node_id); stmt_expr(@expr, node_id); + // These only exist in crate-level blocks. stmt_crate_directive(@crate_directive); } @@ -266,10 +258,8 @@ tag init_op { init_assign; init_move; } type initializer = {op: init_op, expr: @expr}; -type local_ = {ty: @ty, - pat: @pat, // FIXME: should really be a refinement on pat - init: option::t<initializer>, - id: node_id}; +type local_ = // FIXME: should really be a refinement on pat + {ty: @ty, pat: @pat, init: option::t<initializer>, id: node_id}; type local = spanned<local_>; @@ -312,6 +302,7 @@ tag expr_ { expr_alt(@expr, [arm]); expr_fn(_fn); expr_block(blk); + /* * FIXME: many of these @exprs should be constrained with * is_lval once we have constrained types working. @@ -331,10 +322,13 @@ tag expr_ { expr_put(option::t<@expr>); expr_be(@expr); expr_log(int, @expr); + /* just an assert, no significance to typestate */ expr_assert(@expr); + /* preds that typestate is aware of */ expr_check(check_mode, @expr); + /* FIXME Would be nice if expr_check desugared to expr_if_check. */ expr_if_check(@expr, blk, option::t<@expr>); @@ -428,10 +422,11 @@ tag ty_ { ty_bot; /* return type of ! functions and type of ret/fail/break/cont. there is no syntax for this type. */ + /* bot represents the value of functions that don't return a value locally to their context. in contrast, things like log that do return, but don't return a meaningful value, have result type nil. */ - ty_bool; + ty_bool; ty_int; ty_uint; ty_float; @@ -453,6 +448,7 @@ tag ty_ { ty_type; ty_constr(@ty, [@ty_constr]); ty_mac(mac); + // ty_infer means the type should be inferred instead of it having been // specified. This should only appear at the "top level" of a type and not // nested in one. @@ -514,6 +510,7 @@ tag purity { tag controlflow { noreturn; // functions with return type _|_ that always // raise an error or exit (i.e. never return to the caller) + return; // everything else } @@ -531,9 +528,9 @@ type _obj = {fields: [obj_field], methods: [@method]}; type anon_obj = // New fields and methods, if they exist. + // inner_obj: the original object being extended, if it exists. {fields: option::t<[anon_obj_field]>, methods: [@method], - // inner_obj: the original object being extended, if it exists. inner_obj: option::t<@expr>}; type _mod = {view_items: [@view_item], items: [@item]}; @@ -601,10 +598,14 @@ tag item_ { item_ty(@ty, [ty_param]); item_tag([variant], [ty_param]); item_obj(_obj, [ty_param], /* constructor id */node_id); - item_res(_fn, /* dtor */ - node_id, /* dtor id */ + item_res(_fn, + /* dtor */ + node_id, + /* dtor id */ [ty_param], - node_id /* ctor id */); + + /* ctor id */ + node_id); } type native_item = @@ -637,11 +638,7 @@ fn is_exported(i: ident, m: _mod) -> bool { for vi: @ast::view_item in m.view_items { alt vi.node { ast::view_item_export(ids, _) { - for id in ids { - if str::eq(i, id) { - ret true; - } - } + for id in ids { if str::eq(i, id) { ret true; } } count += 1u; } _ {/* fall through */ } @@ -670,7 +667,7 @@ fn eq_ty(a: &@ty, b: &@ty) -> bool { ret std::box::ptr_eq(a, b); } fn hash_ty(t: &@ty) -> uint { ret t.span.lo << 16u + t.span.hi; } fn block_from_expr(e: @expr) -> blk { - let blk_ = {stmts: ~[], expr: option::some::<@expr>(e), id: e.id}; + let blk_ = {stmts: [], expr: option::some::<@expr>(e), id: e.id}; ret {node: blk_, span: e.span}; } diff --git a/src/comp/syntax/codemap.rs b/src/comp/syntax/codemap.rs index a2542e5fddf..a52a58e629e 100644 --- a/src/comp/syntax/codemap.rs +++ b/src/comp/syntax/codemap.rs @@ -23,36 +23,36 @@ type codemap = @{mutable files: [filemap]}; type loc = {filename: filename, line: uint, col: uint}; -fn new_codemap() -> codemap { ret @{mutable files: ~[]}; } +fn new_codemap() -> codemap { ret @{mutable files: []}; } fn new_filemap(filename: filename, start_pos_ch: uint, start_pos_byte: uint) -> filemap { ret @{name: filename, start_pos: {ch: start_pos_ch, byte: start_pos_byte}, - mutable lines: ~[{ch: start_pos_ch, byte: start_pos_byte}]}; + mutable lines: [{ch: start_pos_ch, byte: start_pos_byte}]}; } fn next_line(file: filemap, chpos: uint, byte_pos: uint) { - file.lines += ~[{ch: chpos, byte: byte_pos}]; + file.lines += [{ch: chpos, byte: byte_pos}]; } -type lookup_fn = fn(file_pos) -> uint ; +type lookup_fn = fn(file_pos) -> uint; fn lookup_pos(map: codemap, pos: uint, lookup: lookup_fn) -> loc { let a = 0u; let b = vec::len(map.files); while b - a > 1u { let m = (a + b) / 2u; - if lookup(map.files.(m).start_pos) > pos { b = m; } else { a = m; } + if lookup(map.files[m].start_pos) > pos { b = m; } else { a = m; } } - let f = map.files.(a); + let f = map.files[a]; a = 0u; b = vec::len(f.lines); while b - a > 1u { let m = (a + b) / 2u; - if lookup(f.lines.(m)) > pos { b = m; } else { a = m; } + if lookup(f.lines[m]) > pos { b = m; } else { a = m; } } - ret {filename: f.name, line: a + 1u, col: pos - lookup(f.lines.(a))}; + ret {filename: f.name, line: a + 1u, col: pos - lookup(f.lines[a])}; } fn lookup_char_pos(map: codemap, pos: uint) -> loc { @@ -65,7 +65,8 @@ fn lookup_byte_pos(map: codemap, pos: uint) -> loc { ret lookup_pos(map, pos, lookup); } -tag opt_span { //hack (as opposed to option::t), to make `span` compile +tag opt_span { + //hack (as opposed to option::t), to make `span` compile os_none; os_some(@span); } @@ -75,13 +76,14 @@ fn span_to_str(sp: &span, cm: &codemap) -> str { let cur = sp; let res = ""; let prev_file = none; - while(true) { + while true { let lo = lookup_char_pos(cm, cur.lo); let hi = lookup_char_pos(cm, cur.hi); - res += #fmt("%s:%u:%u:%u:%u", - if some(lo.filename) == prev_file { "-" } - else { lo.filename }, - lo.line, lo.col, hi.line, hi.col); + res += + #fmt["%s:%u:%u:%u:%u", + if some(lo.filename) == prev_file { + "-" + } else { lo.filename }, lo.line, lo.col, hi.line, hi.col]; alt cur.expanded_from { os_none. { break; } os_some(new_sp) { @@ -110,11 +112,9 @@ fn emit_diagnostic(sp: &option::t<span>, msg: &str, kind: &str, color: u8, if term::color_supported() { term::fg(io::stdout().get_buf_writer(), color); } - io::stdout().write_str(#fmt("%s:", kind)); - if term::color_supported() { - term::reset(io::stdout().get_buf_writer()); - } - io::stdout().write_str(#fmt(" %s\n", msg)); + io::stdout().write_str(#fmt["%s:", kind]); + if term::color_supported() { term::reset(io::stdout().get_buf_writer()); } + io::stdout().write_str(#fmt[" %s\n", msg]); maybe_highlight_lines(sp, cm, maybe_lines); } @@ -143,14 +143,14 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap, } // Print the offending lines for line: uint in display_lines { - io::stdout().write_str(#fmt("%s:%u ", fm.name, line + 1u)); + io::stdout().write_str(#fmt["%s:%u ", fm.name, line + 1u]); let s = get_line(fm, line as int, file); if !str::ends_with(s, "\n") { s += "\n"; } io::stdout().write_str(s); } if elided { - let last_line = display_lines.(vec::len(display_lines) - 1u); - let s = #fmt("%s:%u ", fm.name, last_line + 1u); + let last_line = display_lines[vec::len(display_lines) - 1u]; + let s = #fmt["%s:%u ", fm.name, last_line + 1u]; let indent = str::char_len(s); let out = ""; while indent > 0u { out += " "; indent -= 1u; } @@ -163,7 +163,7 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap, if vec::len(lines.lines) == 1u { let lo = lookup_char_pos(cm, option::get(sp).lo); let digits = 0u; - let num = lines.lines.(0) / 10u; + let num = lines.lines[0] / 10u; // how many digits must be indent past? while num > 0u { num /= 10u; digits += 1u; } @@ -202,18 +202,18 @@ type file_lines = {name: str, lines: [uint]}; fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines { let lo = lookup_char_pos(cm, sp.lo); let hi = lookup_char_pos(cm, sp.hi); - let lines = ~[]; + let lines = []; for each i: uint in uint::range(lo.line - 1u, hi.line as uint) { - lines += ~[i]; + lines += [i]; } ret @{name: lo.filename, lines: lines}; } fn get_line(fm: filemap, line: int, file: &str) -> str { - let begin: uint = fm.lines.(line).byte - fm.start_pos.byte; + let begin: uint = fm.lines[line].byte - fm.start_pos.byte; let end: uint; if line as uint < vec::len(fm.lines) - 1u { - end = fm.lines.(line + 1).byte - fm.start_pos.byte; + end = fm.lines[line + 1].byte - fm.start_pos.byte; } else { // If we're not done parsing the file, we're at the limit of what's // parsed. If we just slice the rest of the string, we'll print out @@ -232,7 +232,6 @@ fn get_filemap(cm: codemap, filename: str) -> filemap { // (or expected function, found _|_) fail; // ("asking for " + filename + " which we don't know about"); } - // // Local Variables: // mode: rust diff --git a/src/comp/syntax/ext/base.rs b/src/comp/syntax/ext/base.rs index 9c0ea438678..6d1bd6626c2 100644 --- a/src/comp/syntax/ext/base.rs +++ b/src/comp/syntax/ext/base.rs @@ -7,10 +7,10 @@ import std::map::new_str_hash; import codemap; type syntax_expander = - fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> @ast::expr ; + fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> @ast::expr; type macro_def = {ident: str, ext: syntax_extension}; type macro_definer = - fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> macro_def ; + fn(&ext_ctxt, span, @ast::expr, option::t<str>) -> macro_def; tag syntax_extension { normal(syntax_expander); @@ -34,20 +34,22 @@ fn syntax_expander_table() -> hashmap<str, syntax_extension> { ret syntax_expanders; } -obj ext_ctxt(sess: @session, crate_file_name_hack: str, +obj ext_ctxt(sess: @session, + crate_file_name_hack: str, mutable backtrace: codemap::opt_span) { fn crate_file_name() -> str { ret crate_file_name_hack; } fn session() -> @session { ret sess; } - fn print_backtrace() { - } + fn print_backtrace() { } fn backtrace() -> codemap::opt_span { ret backtrace; } fn bt_push(sp: span) { - backtrace = codemap::os_some(@{lo: sp.lo, hi: sp.hi, - expanded_from: backtrace}); + backtrace = + codemap::os_some(@{lo: sp.lo, + hi: sp.hi, + expanded_from: backtrace}); } fn bt_pop() { alt backtrace { @@ -67,21 +69,16 @@ obj ext_ctxt(sess: @session, crate_file_name_hack: str, self.print_backtrace(); sess.span_err(sp, msg); } - fn span_unimpl(sp:span, msg: str) -> ! { + fn span_unimpl(sp: span, msg: str) -> ! { self.print_backtrace(); sess.span_unimpl(sp, msg); } - fn span_bug(sp:span, msg: str) -> ! { + fn span_bug(sp: span, msg: str) -> ! { self.print_backtrace(); sess.span_bug(sp, msg); } - fn bug(msg: str) -> ! { - self.print_backtrace(); - sess.bug(msg); - } - fn next_id() -> ast::node_id { - ret sess.next_node_id(); - } + fn bug(msg: str) -> ! { self.print_backtrace(); sess.bug(msg); } + fn next_id() -> ast::node_id { ret sess.next_node_id(); } } @@ -93,7 +90,7 @@ fn mk_ctxt(sess: &session) -> ext_ctxt { // the extensions the file name of the crate being compiled so they can // use it to guess whether paths should be prepended with "std::". This is // super-ugly and needs a better solution. - let crate_file_name_hack = sess.get_codemap().files.(0).name; + let crate_file_name_hack = sess.get_codemap().files[0].name; ret ext_ctxt(@sess, crate_file_name_hack, codemap::os_none); } @@ -115,7 +112,7 @@ fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr, error: str) -> ast::ident { ast::expr_path(p) { if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u { cx.span_fatal(expr.span, error); - } else { ret p.node.idents.(0); } + } else { ret p.node.idents[0]; } } _ { cx.span_fatal(expr.span, error); } } diff --git a/src/comp/syntax/ext/concat_idents.rs b/src/comp/syntax/ext/concat_idents.rs index 13f87e044c4..466f55e60e6 100644 --- a/src/comp/syntax/ext/concat_idents.rs +++ b/src/comp/syntax/ext/concat_idents.rs @@ -4,18 +4,21 @@ import syntax::ast; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, _body: option::t<str>) -> @ast::expr { - let args: [@ast::expr] = alt arg.node { - ast::expr_vec(elts, _) { elts } - _ { cx.span_fatal(sp, "#concat_idents requires a vector argument .") } - }; + let args: [@ast::expr] = + alt arg.node { + ast::expr_vec(elts, _) { elts } + _ { + cx.span_fatal(sp, "#concat_idents requires a vector argument .") + } + }; let res: ast::ident = ""; for e: @ast::expr in args { res += expr_to_ident(cx, e, "expected an ident"); } ret @{id: cx.next_id(), - node: ast::expr_path( { - node: {global: false, idents: ~[res], types: ~[]}, - span: sp}), + node: + ast::expr_path({node: {global: false, idents: [res], types: []}, + span: sp}), span: sp}; } diff --git a/src/comp/syntax/ext/env.rs b/src/comp/syntax/ext/env.rs index 50c5bda5858..52a738ab97f 100644 --- a/src/comp/syntax/ext/env.rs +++ b/src/comp/syntax/ext/env.rs @@ -12,17 +12,20 @@ export expand_syntax_ext; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, _body: option::t<str>) -> @ast::expr { - let args: [@ast::expr] = alt arg.node { - ast::expr_vec(elts, _) { elts } - _ { cx.span_fatal(sp, "#env requires arguments of the form `[...]`.") } - }; + let args: [@ast::expr] = + alt arg.node { + ast::expr_vec(elts, _) { elts } + _ { + cx.span_fatal(sp, "#env requires arguments of the form `[...]`.") + } + }; if vec::len::<@ast::expr>(args) != 1u { cx.span_fatal(sp, "malformed #env call"); } // FIXME: if this was more thorough it would manufacture an // option::t<str> rather than just an maybe-empty string. - let var = expr_to_str(cx, args.(0), "#env requires a string"); + let var = expr_to_str(cx, args[0], "#env requires a string"); alt generic_os::getenv(var) { option::none. { ret make_new_str(cx, sp, ""); } option::some(s) { ret make_new_str(cx, sp, s); } diff --git a/src/comp/syntax/ext/expand.rs b/src/comp/syntax/ext/expand.rs index 044bee4ba2b..149216aa6cd 100644 --- a/src/comp/syntax/ext/expand.rs +++ b/src/comp/syntax/ext/expand.rs @@ -15,14 +15,14 @@ import syntax::ext::base::*; fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt, - e: &expr_, fld: ast_fold, - orig: &fn(&expr_, ast_fold) -> expr_ ) -> expr_ { + e: &expr_, fld: ast_fold, orig: &fn(&expr_, ast_fold) -> expr_) + -> expr_ { ret alt e { expr_mac(mac) { alt mac.node { mac_invoc(pth, args, body) { assert (vec::len(pth.node.idents) > 0u); - let extname = pth.node.idents.(0); + let extname = pth.node.idents[0]; alt exts.find(extname) { none. { cx.span_fatal(pth.span, @@ -41,7 +41,7 @@ fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt, some(macro_defining(ext)) { let named_extension = ext(cx, pth.span, args, body); exts.insert(named_extension.ident, named_extension.ext); - ast::expr_rec(~[], none) + ast::expr_rec([], none) } } } @@ -65,7 +65,6 @@ fn expand_crate(sess: &session::session, c: &@crate) -> @crate { ret res; } - // Local Variables: // mode: rust // fill-column: 78; diff --git a/src/comp/syntax/ext/fmt.rs b/src/comp/syntax/ext/fmt.rs index 738b65c7d91..9b8a1b61684 100644 --- a/src/comp/syntax/ext/fmt.rs +++ b/src/comp/syntax/ext/fmt.rs @@ -17,17 +17,20 @@ export expand_syntax_ext; fn expand_syntax_ext(cx: &ext_ctxt, sp: span, arg: @ast::expr, _body: option::t<str>) -> @ast::expr { - let args: [@ast::expr] = alt arg.node { - ast::expr_vec(elts, _) { elts } - _ { cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.") } - }; + let args: [@ast::expr] = + alt arg.node { + ast::expr_vec(elts, _) { elts } + _ { + cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.") + } + }; if vec::len::<@ast::expr>(args) == 0u { cx.span_fatal(sp, "#fmt requires a format string"); } let fmt = - expr_to_str(cx, args.(0), + expr_to_str(cx, args[0], "first argument to #fmt must be a " + "string literal."); - let fmtspan = args.(0).span; + let fmtspan = args[0].span; log "Format string:"; log fmt; fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: str) -> ! { @@ -66,7 +69,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], } fn make_path_expr(cx: &ext_ctxt, sp: span, idents: &[ast::ident]) -> @ast::expr { - let path = {global: false, idents: idents, types: ~[]}; + let path = {global: false, idents: idents, types: []}; let sp_path = {node: path, span: sp}; let pathexpr = ast::expr_path(sp_path); ret @{id: cx.next_id(), node: pathexpr, span: sp}; @@ -85,13 +88,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], fn make_rec_expr(cx: &ext_ctxt, sp: span, fields: &[{ident: ast::ident, ex: @ast::expr}]) -> @ast::expr { - let astfields: [ast::field] = ~[]; + let astfields: [ast::field] = []; for field: {ident: ast::ident, ex: @ast::expr} in fields { let ident = field.ident; let val = field.ex; let astfield = {node: {mut: ast::imm, ident: ident, expr: val}, span: sp}; - astfields += ~[astfield]; + astfields += [astfield]; } let recexpr = ast::expr_rec(astfields, option::none::<@ast::expr>); ret @{id: cx.next_id(), node: recexpr, span: sp}; @@ -101,8 +104,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], ret str::find(cx.crate_file_name(), "std.rc") >= 0; } if compiling_std(cx) { - ret ~["extfmt", "rt", ident]; - } else { ret ~["std", "extfmt", "rt", ident]; } + ret ["extfmt", "rt", ident]; + } else { ret ["std", "extfmt", "rt", ident]; } } fn make_rt_path_expr(cx: &ext_ctxt, sp: span, ident: str) -> @ast::expr { let path = make_path_vec(cx, ident); @@ -112,9 +115,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], // which tells the RT::conv* functions how to perform the conversion fn make_rt_conv_expr(cx: &ext_ctxt, sp: span, cnv: &conv) -> @ast::expr { - fn make_flags(cx: &ext_ctxt, sp: span, flags: &[flag]) -> - @ast::expr { - let flagexprs: [@ast::expr] = ~[]; + fn make_flags(cx: &ext_ctxt, sp: span, flags: &[flag]) -> @ast::expr { + let flagexprs: [@ast::expr] = []; for f: flag in flags { let fstr; alt f { @@ -124,14 +126,14 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], flag_sign_always. { fstr = "flag_sign_always"; } flag_alternate. { fstr = "flag_alternate"; } } - flagexprs += ~[make_rt_path_expr(cx, sp, fstr)]; + flagexprs += [make_rt_path_expr(cx, sp, fstr)]; } // FIXME: 0-length vectors can't have their type inferred // through the rec that these flags are a member of, so // this is a hack placeholder flag if vec::len::<@ast::expr>(flagexprs) == 0u { - flagexprs += ~[make_rt_path_expr(cx, sp, "flag_none")]; + flagexprs += [make_rt_path_expr(cx, sp, "flag_none")]; } ret make_vec_expr(cx, sp, flagexprs); } @@ -143,7 +145,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], count_is(c) { let count_lit = make_new_int(cx, sp, c); let count_is_path = make_path_vec(cx, "count_is"); - let count_is_args = ~[count_lit]; + let count_is_args = [count_lit]; ret make_call(cx, sp, count_is_path, count_is_args); } _ { cx.span_unimpl(sp, "unimplemented #fmt conversion"); } @@ -168,10 +170,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], width_expr: @ast::expr, precision_expr: @ast::expr, ty_expr: @ast::expr) -> @ast::expr { ret make_rec_expr(cx, sp, - ~[{ident: "flags", ex: flags_expr}, - {ident: "width", ex: width_expr}, - {ident: "precision", ex: precision_expr}, - {ident: "ty", ex: ty_expr}]); + [{ident: "flags", ex: flags_expr}, + {ident: "width", ex: width_expr}, + {ident: "precision", ex: precision_expr}, + {ident: "ty", ex: ty_expr}]); } let rt_conv_flags = make_flags(cx, sp, cnv.flags); let rt_conv_width = make_count(cx, sp, cnv.width); @@ -185,7 +187,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], let fname = "conv_" + conv_type; let path = make_path_vec(cx, fname); let cnv_expr = make_rt_conv_expr(cx, sp, cnv); - let args = ~[cnv_expr, arg]; + let args = [cnv_expr, arg]; ret make_call(cx, arg.span, path, args); } fn make_new_conv(cx: &ext_ctxt, sp: span, cnv: conv, arg: @ast::expr) -> @@ -304,7 +306,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], ty_octal. { log "type: octal"; } } } - let fmt_sp = args.(0).span; + let fmt_sp = args[0].span; let n = 0u; let tmp_expr = make_new_str(cx, sp, ""); let nargs = vec::len::<@ast::expr>(args); @@ -323,7 +325,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], } log "Building conversion:"; log_conv(conv); - let arg_expr = args.(n); + let arg_expr = args[n]; let c_expr = make_new_conv(cx, fmt_sp, conv, arg_expr); tmp_expr = make_add_expr(cx, fmt_sp, tmp_expr, c_expr); } @@ -332,9 +334,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece], let expected_nargs = n + 1u; // n conversions + the fmt string if expected_nargs < nargs { - cx.span_fatal - (sp, #fmt("too many arguments to #fmt. found %u, expected %u", - nargs, expected_nargs)); + cx.span_fatal( + sp, + #fmt["too many arguments to #fmt. found %u, expected %u", + nargs, expected_nargs]); } ret tmp_expr; } diff --git a/src/comp/syntax/ext/ident_to_str.rs b/src/comp/syntax/ext/ident_to_str.rs index ce24e2605e4..4eb381762fe 100644 --- a/src/comp/syntax/ext/ident_to_str.rs +++ b/src/comp/syntax/ext/ident_to_str.rs @@ -5,16 +5,19 @@ import syntax::ast; fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, _body: option::t<str>) -> @ast::expr { - let args: [@ast::expr] = alt arg.node { - ast::expr_vec(elts, _) { elts } - _ { cx.span_fatal(sp, "#ident_to_str requires a vector argument .") } - }; + let args: [@ast::expr] = + alt arg.node { + ast::expr_vec(elts, _) { elts } + _ { + cx.span_fatal(sp, "#ident_to_str requires a vector argument .") + } + }; if vec::len::<@ast::expr>(args) != 1u { cx.span_fatal(sp, "malformed #ident_to_str call"); } ret make_new_lit(cx, sp, - ast::lit_str(expr_to_ident(cx, args.(0u), + ast::lit_str(expr_to_ident(cx, args[0u], "expected an ident"), ast::sk_rc)); diff --git a/src/comp/syntax/ext/log_syntax.rs b/src/comp/syntax/ext/log_syntax.rs index f0834f4f079..a03ff11a66d 100644 --- a/src/comp/syntax/ext/log_syntax.rs +++ b/src/comp/syntax/ext/log_syntax.rs @@ -9,5 +9,5 @@ fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr, std::io::stdout().write_line(print::pprust::expr_to_str(arg)); //trivial expression - ret @{id: cx.next_id(), node: ast::expr_rec(~[], option::none), span: sp}; + ret @{id: cx.next_id(), node: ast::expr_rec([], option::none), span: sp}; } diff --git a/src/comp/syntax/ext/simplext.rs b/src/comp/syntax/ext/simplext.rs index 9b8a5e28e09..e5dd343203a 100644 --- a/src/comp/syntax/ext/simplext.rs +++ b/src/comp/syntax/ext/simplext.rs @@ -34,7 +34,7 @@ export add_new_extension; fn path_to_ident(pth: &path) -> option::t<ident> { if vec::len(pth.node.idents) == 1u && vec::len(pth.node.types) == 0u { - ret some(pth.node.idents.(0u)); + ret some(pth.node.idents[0u]); } ret none; } @@ -89,10 +89,10 @@ fn match_error(cx: &ext_ctxt, m: &matchable, expected: &str) -> ! { // we'll want to return something indicating amount of progress and location // of failure instead of `none`. type match_result = option::t<arb_depth<matchable>>; -type selector = fn(&matchable) -> match_result ; +type selector = fn(&matchable) -> match_result; -fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) - -> {pre: [@expr], rep: option::t<@expr>, post: [@expr]} { +fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) -> + {pre: [@expr], rep: option::t<@expr>, post: [@expr]} { let idx: uint = 0u; let res = none; for elt: @expr in elts { @@ -103,10 +103,10 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) if res != none { cx.span_fatal(m.span, "only one ellipsis allowed"); } - res = some({pre: vec::slice(elts, 0u, idx - 1u), - rep: some(elts.(idx - 1u)), - post: vec::slice(elts, idx + 1u, - vec::len(elts))}); + res = + some({pre: vec::slice(elts, 0u, idx - 1u), + rep: some(elts[idx - 1u]), + post: vec::slice(elts, idx + 1u, vec::len(elts))}); } _ { } } @@ -116,16 +116,16 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) idx += 1u; } ret alt res { - some(val) { val } - none. { {pre: elts, rep: none, post: ~[]} } - } + some(val) { val } + none. { {pre: elts, rep: none, post: []} } + } } fn option_flatten_map<T, U>(f: &fn(&T) -> option::t<U>, v: &[T]) -> option::t<[U]> { - let res = ~[]; + let res = []; for elem: T in v { - alt f(elem) { none. { ret none; } some(fv) { res += ~[fv]; } } + alt f(elem) { none. { ret none; } some(fv) { res += [fv]; } } } ret some(res); } @@ -168,7 +168,7 @@ fn acumm_bindings(_cx: &ext_ctxt, _b_dest: &bindings, _b_src: &bindings) { } fn pattern_to_selectors(cx: &ext_ctxt, e: @expr) -> binders { let res: binders = {real_binders: new_str_hash::<selector>(), - mutable literal_ast_matchers: ~[]}; + mutable literal_ast_matchers: []}; //this oughta return binders instead, but macro args are a sequence of //expressions, rather than a single expression fn trivial_selector(m: &matchable) -> match_result { ret some(leaf(m)); } @@ -203,7 +203,7 @@ fn use_selectors_to_bind(b: &binders, e: @expr) -> option::t<bindings> { /* use the bindings on the body to generate the expanded code */ fn transcribe(cx: &ext_ctxt, b: &bindings, body: @expr) -> @expr { - let idx_path: @mutable [uint] = @mutable ~[]; + let idx_path: @mutable [uint] = @mutable []; fn new_id(_old: node_id, cx: &ext_ctxt) -> node_id { ret cx.next_id(); } fn new_span(cx: &ext_ctxt, sp: &span) -> span { /* this discards information in the case of macro-defining macros */ @@ -236,7 +236,7 @@ fn follow(m: &arb_depth<matchable>, idx_path: @mutable [uint]) -> for idx: uint in *idx_path { alt res { leaf(_) { ret res;/* end of the line */ } - seq(new_ms, _) { res = new_ms.(idx); } + seq(new_ms, _) { res = new_ms[idx]; } } } ret res; @@ -282,13 +282,12 @@ iter free_vars(b: &bindings, e: @expr) -> ident { /* handle sequences (anywhere in the AST) of exprs, either real or ...ed */ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], - recur: fn(&@expr) -> @expr , exprs: [@expr]) - -> [@expr] { + recur: fn(&@expr) -> @expr, exprs: [@expr]) -> [@expr] { alt elts_to_ell(cx, exprs) { {pre: pre, rep: repeat_me_maybe, post: post} { let res = vec::map(recur, pre); alt repeat_me_maybe { - none. {} + none. { } some(repeat_me) { let repeat: option::t<{rep_count: uint, name: ident}> = none; /* we need to walk over all the free vars in lockstep, except for @@ -305,9 +304,10 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], some({rep_count: old_len, name: old_name}) { let len = vec::len(*ms); if old_len != len { - let msg = #fmt("'%s' occurs %u times, but ", fv, - len) + #fmt("'%s' occurs %u times", - old_name, old_len); + let msg = + #fmt["'%s' occurs %u times, but ", fv, len] + + #fmt["'%s' occurs %u times", old_name, + old_len]; cx.span_fatal(repeat_me.span, msg); } } @@ -319,14 +319,14 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], none. { cx.span_fatal(repeat_me.span, "'...' surrounds an expression without any" + - " repeating syntax variables"); + " repeating syntax variables"); } some({rep_count: rc, _}) { /* Whew, we now know how how many times to repeat */ let idx: uint = 0u; while idx < rc { - *idx_path += ~[idx]; - res += ~[recur(repeat_me)]; // whew! + *idx_path += [idx]; + res += [recur(repeat_me)]; // whew! vec::pop(*idx_path); idx += 1u; } @@ -357,9 +357,9 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], p: &path_, _fld: ast_fold) -> path_ { // Don't substitute into qualified names. if vec::len(p.types) > 0u || vec::len(p.idents) != 1u { ret p; } - ret alt follow_for_trans(cx, b.find(p.idents.(0)), idx_path) { + ret alt follow_for_trans(cx, b.find(p.idents[0]), idx_path) { some(match_ident(id)) { - {global: false, idents: ~[id.node], types: ~[]} + {global: false, idents: [id.node], types: []} } some(match_path(a_pth)) { a_pth.node } some(m) { match_error(cx, m, "a path") } @@ -370,21 +370,20 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], e: &ast::expr_, fld: ast_fold, - orig: fn(&ast::expr_, ast_fold) -> ast::expr_ ) -> + orig: fn(&ast::expr_, ast_fold) -> ast::expr_) -> ast::expr_ { ret alt e { expr_path(p) { // Don't substitute into qualified names. - if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u - { + if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u { e } - alt follow_for_trans(cx, b.find(p.node.idents.(0)), idx_path) { + alt follow_for_trans(cx, b.find(p.node.idents[0]), idx_path) { some(match_ident(id)) { expr_path(respan(id.span, {global: false, - idents: ~[id.node], - types: ~[]})) + idents: [id.node], + types: []})) } some(match_path(a_pth)) { expr_path(a_pth) } some(match_expr(a_exp)) { a_exp.node } @@ -398,7 +397,7 @@ fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], t: &ast::ty_, fld: ast_fold, - orig: fn(&ast::ty_, ast_fold) -> ast::ty_ ) -> ast::ty_ { + orig: fn(&ast::ty_, ast_fold) -> ast::ty_) -> ast::ty_ { ret alt t { ast::ty_path(pth, _) { alt path_to_ident(pth) { @@ -422,12 +421,13 @@ fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], fn transcribe_block(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint], blk: &blk_, fld: ast_fold, - orig: fn(&blk_, ast_fold) -> blk_ ) -> blk_ { + orig: fn(&blk_, ast_fold) -> blk_) -> blk_ { ret alt block_to_ident(blk) { some(id) { alt follow_for_trans(cx, b.find(id), idx_path) { some(match_block(new_blk)) { new_blk.node } + // possibly allow promotion of ident/path/expr to blocks? some(m) { match_error(cx, m, "a block") @@ -452,20 +452,20 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { expr_vec(p_elts, _) { alt elts_to_ell(cx, p_elts) { {pre: pre, rep: some(repeat_me), post: post} { - p_t_s_r_length(cx, vec::len(pre) + vec::len(post), - true, s, b); - if(vec::len(pre) > 0u) { + p_t_s_r_length(cx, vec::len(pre) + vec::len(post), true, s, + b); + if vec::len(pre) > 0u { p_t_s_r_actual_vector(cx, pre, true, s, b); } p_t_s_r_ellipses(cx, repeat_me, vec::len(pre), s, b); - if(vec::len(post) > 0u) { + if vec::len(post) > 0u { cx.span_unimpl(e.span, "matching after `...` not yet supported"); } } {pre: pre, rep: none., post: post} { - if post != ~[] { + if post != [] { cx.bug("elts_to_ell provided an invalid result"); } p_t_s_r_length(cx, vec::len(pre), false, s, b); @@ -474,6 +474,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { } } + /* TODO: handle embedded types and blocks, at least */ expr_mac(mac) { p_t_s_r_mac(cx, mac, s, b); @@ -488,7 +489,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) { _ { cx.bug("broken traversal in p_t_s_r") } } } - b.literal_ast_matchers += ~[bind select(cx, _, e)]; + b.literal_ast_matchers += [bind select(cx, _, e)]; } } } @@ -545,7 +546,7 @@ fn block_to_ident(blk: &blk_) -> option::t<ident> { fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) { fn select_pt_1(cx: &ext_ctxt, m: &matchable, - fn_m: fn(&ast::mac) -> match_result ) -> match_result { + fn_m: fn(&ast::mac) -> match_result) -> match_result { ret alt m { match_expr(e) { alt e.node { expr_mac(mac) { fn_m(mac) } _ { none } } @@ -603,17 +604,18 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) { fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint, s: &selector, b: &binders) { fn select(cx: &ext_ctxt, repeat_me: @expr, offset: uint, m: &matchable) -> - match_result { + match_result { ret alt m { match_expr(e) { alt e.node { expr_vec(arg_elts, _) { - let elts = ~[]; + let elts = []; let idx = offset; while idx < vec::len(arg_elts) { - elts += ~[leaf(match_expr(arg_elts.(idx)))]; + elts += [leaf(match_expr(arg_elts[idx]))]; idx += 1u; } + // using repeat_me.span is a little wacky, but the // error we want to report is one in the macro def some(seq(@elts, repeat_me.span)) @@ -631,14 +633,14 @@ fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint, fn p_t_s_r_length(cx: &ext_ctxt, len: uint, at_least: bool, s: selector, b: &binders) { - fn len_select(_cx: &ext_ctxt, m: &matchable, at_least: bool, len: uint) - -> match_result { + fn len_select(_cx: &ext_ctxt, m: &matchable, at_least: bool, len: uint) -> + match_result { ret alt m { match_expr(e) { alt e.node { expr_vec(arg_elts, _) { let actual_len = vec::len(arg_elts); - if (at_least && actual_len >= len) || actual_len == len { + if at_least && actual_len >= len || actual_len == len { some(leaf(match_exact)) } else { none } } @@ -649,7 +651,7 @@ fn p_t_s_r_length(cx: &ext_ctxt, len: uint, at_least: bool, s: selector, } } b.literal_ast_matchers += - ~[compose_sels(s, bind len_select(cx, _, at_least, len))]; + [compose_sels(s, bind len_select(cx, _, at_least, len))]; } fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, @@ -661,7 +663,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, match_expr(e) { alt e.node { expr_vec(arg_elts, _) { - some(leaf(match_expr(arg_elts.(idx)))) + some(leaf(match_expr(arg_elts[idx]))) } _ { none } } @@ -669,7 +671,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, _ { cx.bug("broken traversal in p_t_s_r") } } } - p_t_s_rec(cx, match_expr(elts.(idx)), + p_t_s_rec(cx, match_expr(elts[idx]), compose_sels(s, bind select(cx, _, idx)), b); idx += 1u; } @@ -677,15 +679,17 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool, fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, _body: option::t<str>) -> base::macro_def { - let args: [@ast::expr] = alt arg.node { - ast::expr_vec(elts, _) { elts } - _ { - cx.span_fatal(sp, "#macro requires arguments of the form `[...]`.") - } - }; + let args: [@ast::expr] = + alt arg.node { + ast::expr_vec(elts, _) { elts } + _ { + cx.span_fatal(sp, + "#macro requires arguments of the form `[...]`.") + } + }; let macro_name: option::t<str> = none; - let clauses: [@clause] = ~[]; + let clauses: [@clause] = []; for arg: @expr in args { alt arg.node { expr_vec(elts, mut) { @@ -696,7 +700,7 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, } - alt elts.(0u).node { + alt elts[0u].node { expr_mac(mac) { alt mac.node { mac_invoc(pth, invoc_arg, body) { @@ -706,8 +710,9 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, none. { macro_name = some(id); } some(other_id) { if id != other_id { - cx.span_fatal(pth.span, "macro name must be " - + "consistent"); + cx.span_fatal(pth.span, + "macro name must be " + + "consistent"); } } } @@ -718,15 +723,15 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, } } clauses += - ~[@{params: pattern_to_selectors(cx, invoc_arg), - body: elts.(1u)}]; + [@{params: pattern_to_selectors(cx, invoc_arg), + body: elts[1u]}]; // FIXME: check duplicates (or just simplify // the macro arg situation) } } } _ { - cx.span_fatal(elts.(0u).span, + cx.span_fatal(elts[0u].span, "extension clause must" + " start with a macro invocation."); } @@ -756,9 +761,7 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr, _body: option::t<str>, clauses: [@clause]) -> @expr { for c: @clause in clauses { alt use_selectors_to_bind(c.params, arg) { - some(bindings) { - ret transcribe(cx, bindings, c.body) - } + some(bindings) { ret transcribe(cx, bindings, c.body) } none. { cont; } } } diff --git a/src/comp/syntax/fold.rs b/src/comp/syntax/fold.rs index 5593ddb21c6..b781a2481c2 100644 --- a/src/comp/syntax/fold.rs +++ b/src/comp/syntax/fold.rs @@ -20,57 +20,57 @@ type ast_fold = @mutable a_f; type ast_fold_precursor = //unlike the others, item_ is non-trivial - {fold_crate: fn(&crate_, ast_fold) -> crate_ , + {fold_crate: fn(&crate_, ast_fold) -> crate_, fold_crate_directive: - fn(&crate_directive_, ast_fold) -> crate_directive_ , - fold_view_item: fn(&view_item_, ast_fold) -> view_item_ , - fold_native_item: fn(&@native_item, ast_fold) -> @native_item , - fold_item: fn(&@item, ast_fold) -> @item , - fold_item_underscore: fn(&item_, ast_fold) -> item_ , - fold_method: fn(&method_, ast_fold) -> method_ , - fold_block: fn(&blk_, ast_fold) -> blk_ , - fold_stmt: fn(&stmt_, ast_fold) -> stmt_ , - fold_arm: fn(&arm, ast_fold) -> arm , - fold_pat: fn(&pat_, ast_fold) -> pat_ , - fold_decl: fn(&decl_, ast_fold) -> decl_ , - fold_expr: fn(&expr_, ast_fold) -> expr_ , - fold_ty: fn(&ty_, ast_fold) -> ty_ , - fold_constr: fn(&ast::constr_, ast_fold) -> constr_ , - fold_fn: fn(&_fn, ast_fold) -> _fn , - fold_mod: fn(&_mod, ast_fold) -> _mod , - fold_native_mod: fn(&native_mod, ast_fold) -> native_mod , - fold_variant: fn(&variant_, ast_fold) -> variant_ , - fold_ident: fn(&ident, ast_fold) -> ident , - fold_path: fn(&path_, ast_fold) -> path_ , - fold_local: fn(&local_, ast_fold) -> local_ , - map_exprs: fn(fn(&@expr) -> @expr , [@expr]) -> [@expr], + fn(&crate_directive_, ast_fold) -> crate_directive_, + fold_view_item: fn(&view_item_, ast_fold) -> view_item_, + fold_native_item: fn(&@native_item, ast_fold) -> @native_item, + fold_item: fn(&@item, ast_fold) -> @item, + fold_item_underscore: fn(&item_, ast_fold) -> item_, + fold_method: fn(&method_, ast_fold) -> method_, + fold_block: fn(&blk_, ast_fold) -> blk_, + fold_stmt: fn(&stmt_, ast_fold) -> stmt_, + fold_arm: fn(&arm, ast_fold) -> arm, + fold_pat: fn(&pat_, ast_fold) -> pat_, + fold_decl: fn(&decl_, ast_fold) -> decl_, + fold_expr: fn(&expr_, ast_fold) -> expr_, + fold_ty: fn(&ty_, ast_fold) -> ty_, + fold_constr: fn(&ast::constr_, ast_fold) -> constr_, + fold_fn: fn(&_fn, ast_fold) -> _fn, + fold_mod: fn(&_mod, ast_fold) -> _mod, + fold_native_mod: fn(&native_mod, ast_fold) -> native_mod, + fold_variant: fn(&variant_, ast_fold) -> variant_, + fold_ident: fn(&ident, ast_fold) -> ident, + fold_path: fn(&path_, ast_fold) -> path_, + fold_local: fn(&local_, ast_fold) -> local_, + map_exprs: fn(fn(&@expr) -> @expr, [@expr]) -> [@expr], new_id: fn(node_id) -> node_id, new_span: fn(&span) -> span}; type a_f = - {fold_crate: fn(&crate) -> crate , - fold_crate_directive: fn(&@crate_directive) -> @crate_directive , - fold_view_item: fn(&@view_item) -> @view_item , - fold_native_item: fn(&@native_item) -> @native_item , - fold_item: fn(&@item) -> @item , - fold_item_underscore: fn(&item_) -> item_ , - fold_method: fn(&@method) -> @method , - fold_block: fn(&blk) -> blk , - fold_stmt: fn(&@stmt) -> @stmt , - fold_arm: fn(&arm) -> arm , - fold_pat: fn(&@pat) -> @pat , - fold_decl: fn(&@decl) -> @decl , - fold_expr: fn(&@expr) -> @expr , - fold_ty: fn(&@ty) -> @ty , - fold_constr: fn(&@constr) -> @constr , - fold_fn: fn(&_fn) -> _fn , - fold_mod: fn(&_mod) -> _mod , - fold_native_mod: fn(&native_mod) -> native_mod , - fold_variant: fn(&variant) -> variant , - fold_ident: fn(&ident) -> ident , - fold_path: fn(&path) -> path , - fold_local: fn(&@local) -> @local , - map_exprs: fn(fn(&@expr) -> @expr , [@expr]) -> [@expr], + {fold_crate: fn(&crate) -> crate, + fold_crate_directive: fn(&@crate_directive) -> @crate_directive, + fold_view_item: fn(&@view_item) -> @view_item, + fold_native_item: fn(&@native_item) -> @native_item, + fold_item: fn(&@item) -> @item, + fold_item_underscore: fn(&item_) -> item_, + fold_method: fn(&@method) -> @method, + fold_block: fn(&blk) -> blk, + fold_stmt: fn(&@stmt) -> @stmt, + fold_arm: fn(&arm) -> arm, + fold_pat: fn(&@pat) -> @pat, + fold_decl: fn(&@decl) -> @decl, + fold_expr: fn(&@expr) -> @expr, + fold_ty: fn(&@ty) -> @ty, + fold_constr: fn(&@constr) -> @constr, + fold_fn: fn(&_fn) -> _fn, + fold_mod: fn(&_mod) -> _mod, + fold_native_mod: fn(&native_mod) -> native_mod, + fold_variant: fn(&variant) -> variant, + fold_ident: fn(&ident) -> ident, + fold_path: fn(&path) -> path, + fold_local: fn(&@local) -> @local, + map_exprs: fn(fn(&@expr) -> @expr, [@expr]) -> [@expr], new_id: fn(node_id) -> node_id, new_span: fn(&span) -> span}; @@ -120,7 +120,7 @@ fn fold_meta_item_(mi: &@meta_item, fld: ast_fold) -> @meta_item { span: mi.span}; } //used in noop_fold_item and noop_fold_crate -fn fold_attribute_(at: &attribute, fmi: fn(&@meta_item) -> @meta_item ) -> +fn fold_attribute_(at: &attribute, fmi: fn(&@meta_item) -> @meta_item) -> attribute { ret {node: {style: at.node.style, value: *fmi(@at.node.value)}, span: at.span}; @@ -135,14 +135,14 @@ fn fold_arg_(a: &arg, fld: ast_fold) -> arg { //used in noop_fold_expr, and possibly elsewhere in the future fn fold_mac_(m: &mac, fld: ast_fold) -> mac { ret {node: - alt m.node { - mac_invoc(pth, arg, body) { - mac_invoc(fld.fold_path(pth), fld.fold_expr(arg), body) - } - mac_embed_type(ty) { mac_embed_type(fld.fold_ty(ty)) } - mac_embed_block(blk) { mac_embed_block(fld.fold_block(blk)) } - mac_ellipsis. { mac_ellipsis } - }, + alt m.node { + mac_invoc(pth, arg, body) { + mac_invoc(fld.fold_path(pth), fld.fold_expr(arg), body) + } + mac_embed_type(ty) { mac_embed_type(fld.fold_ty(ty)) } + mac_embed_block(blk) { mac_embed_block(fld.fold_block(blk)) } + mac_ellipsis. { mac_ellipsis } + }, span: m.span}; } @@ -200,7 +200,7 @@ fn noop_fold_native_item(ni: &@native_item, fld: ast_fold) -> @native_item { cf: fdec.cf, constraints: vec::map(fld.fold_constr, - fdec.constraints)}, typms) + fdec.constraints)}, typms) } }, id: ni.id, @@ -238,8 +238,8 @@ fn noop_fold_item_underscore(i: &item_, fld: ast_fold) -> item_ { } item_obj(o, typms, d) { item_obj({fields: vec::map(fold_obj_field, o.fields), - methods: vec::map(fld.fold_method, o.methods)}, - typms, d) + methods: vec::map(fld.fold_method, o.methods)}, typms, + d) } item_res(dtor, did, typms, cid) { item_res(fld.fold_fn(dtor), did, typms, cid) @@ -269,8 +269,7 @@ fn noop_fold_stmt(s: &stmt_, fld: ast_fold) -> stmt_ { } fn noop_fold_arm(a: &arm, fld: ast_fold) -> arm { - ret {pats: vec::map(fld.fold_pat, a.pats), - body: fld.fold_block(a.body)}; + ret {pats: vec::map(fld.fold_pat, a.pats), body: fld.fold_block(a.body)}; } fn noop_fold_pat(p: &pat_, fld: ast_fold) -> pat_ { @@ -282,15 +281,13 @@ fn noop_fold_pat(p: &pat_, fld: ast_fold) -> pat_ { pat_tag(fld.fold_path(pth), vec::map(fld.fold_pat, pats)) } pat_rec(fields, etc) { - let fs = ~[]; + let fs = []; for f: ast::field_pat in fields { - fs += ~[{ident: f.ident, pat: fld.fold_pat(f.pat)}]; + fs += [{ident: f.ident, pat: fld.fold_pat(f.pat)}]; } pat_rec(fs, etc) } - pat_tup(elts) { - pat_tup(vec::map(fld.fold_pat, elts)) - } + pat_tup(elts) { pat_tup(vec::map(fld.fold_pat, elts)) } pat_box(inner) { pat_box(fld.fold_pat(inner)) } }; } @@ -346,9 +343,7 @@ fn noop_fold_expr(e: &expr_, fld: ast_fold) -> expr_ { expr_rec(vec::map(fold_field, fields), option::map(fld.fold_expr, maybe_expr)) } - expr_tup(elts) { - expr_tup(vec::map(fld.fold_expr, elts)) - } + expr_tup(elts) { expr_tup(vec::map(fld.fold_expr, elts)) } expr_call(f, args) { expr_call(fld.fold_expr(f), fld.map_exprs(fld.fold_expr, args)) } @@ -393,9 +388,7 @@ fn noop_fold_expr(e: &expr_, fld: ast_fold) -> expr_ { expr_move(el, er) { expr_move(fld.fold_expr(el), fld.fold_expr(er)) } - expr_copy(e) { - expr_copy(fld.fold_expr(e)) - } + expr_copy(e) { expr_copy(fld.fold_expr(e)) } expr_assign(el, er) { expr_assign(fld.fold_expr(el), fld.fold_expr(er)) } @@ -487,19 +480,20 @@ fn noop_fold_path(p: &path_, fld: ast_fold) -> path_ { fn noop_fold_local(l: &local_, fld: ast_fold) -> local_ { ret {ty: fld.fold_ty(l.ty), pat: fld.fold_pat(l.pat), - init: alt l.init { - option::none::<initializer>. { l.init } - option::some::<initializer>(init) { - option::some::<initializer>({op: init.op, - expr: fld.fold_expr(init.expr)}) - } - }, + init: + alt l.init { + option::none::<initializer>. { l.init } + option::some::<initializer>(init) { + option::some::<initializer>({op: init.op, + expr: fld.fold_expr(init.expr)}) + } + }, id: l.id}; } /* temporarily eta-expand because of a compiler bug with using `fn<T>` as a value */ -fn noop_map_exprs(f: fn(&@expr) -> @expr , es: [@expr]) -> [@expr] { +fn noop_map_exprs(f: fn(&@expr) -> @expr, es: [@expr]) -> [@expr] { ret vec::map(f, es); } @@ -634,14 +628,16 @@ fn make_fold(afp: &ast_fold_precursor) -> ast_fold { } fn f_pat(afp: &ast_fold_precursor, f: ast_fold, x: &@pat) -> @pat { ret @{id: afp.new_id(x.id), - node: afp.fold_pat(x.node, f), span: afp.new_span(x.span)}; + node: afp.fold_pat(x.node, f), + span: afp.new_span(x.span)}; } fn f_decl(afp: &ast_fold_precursor, f: ast_fold, x: &@decl) -> @decl { ret @{node: afp.fold_decl(x.node, f), span: afp.new_span(x.span)}; } fn f_expr(afp: &ast_fold_precursor, f: ast_fold, x: &@expr) -> @expr { ret @{id: afp.new_id(x.id), - node: afp.fold_expr(x.node, f), span: afp.new_span(x.span)}; + node: afp.fold_expr(x.node, f), + span: afp.new_span(x.span)}; } fn f_ty(afp: &ast_fold_precursor, f: ast_fold, x: &@ty) -> @ty { ret @{node: afp.fold_ty(x.node, f), span: afp.new_span(x.span)}; diff --git a/src/comp/syntax/parse/eval.rs b/src/comp/syntax/parse/eval.rs index fb52960517d..af1ba91b37b 100644 --- a/src/comp/syntax/parse/eval.rs +++ b/src/comp/syntax/parse/eval.rs @@ -26,8 +26,7 @@ type ctx = cfg: ast::crate_cfg}; fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive], - prefix: str, - view_items: &mutable [@ast::view_item], + prefix: str, view_items: &mutable [@ast::view_item], items: &mutable [@ast::item]) { for sub_cdir: @ast::crate_directive in cdirs { eval_crate_directive(cx, sub_cdir, prefix, view_items, items); @@ -36,8 +35,8 @@ fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive], fn eval_crate_directives_to_mod(cx: ctx, cdirs: &[@ast::crate_directive], prefix: str) -> ast::_mod { - let view_items: [@ast::view_item] = ~[]; - let items: [@ast::item] = ~[]; + let view_items: [@ast::view_item] = []; + let items: [@ast::item] = []; eval_crate_directives(cx, cdirs, prefix, view_items, items); ret {view_items: view_items, items: items}; } @@ -53,7 +52,7 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str, if std::fs::path_is_absolute(file_path) { file_path } else { prefix + std::fs::path_sep() + file_path }; - if cx.mode == mode_depend { cx.deps += ~[full_path]; ret; } + if cx.mode == mode_depend { cx.deps += [full_path]; ret; } let p0 = new_parser_from_file(cx.sess, cx.cfg, full_path, cx.chpos, cx.byte_pos, SOURCE_FILE); @@ -68,7 +67,7 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str, // Thread defids, chpos and byte_pos through the parsers cx.chpos = p0.get_chpos(); cx.byte_pos = p0.get_byte_pos(); - items += ~[i]; + items += [i]; } ast::cdir_dir_mod(id, dir_opt, cdirs, attrs) { let path = id; @@ -85,9 +84,9 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: str, node: ast::item_mod(m0), span: cdir.span}; cx.sess.next_id += 1; - items += ~[i]; + items += [i]; } - ast::cdir_view_item(vi) { view_items += ~[vi]; } + ast::cdir_view_item(vi) { view_items += [vi]; } ast::cdir_syntax(pth) { } ast::cdir_auth(pth, eff) { } } diff --git a/src/comp/syntax/parse/lexer.rs b/src/comp/syntax/parse/lexer.rs index 9e78c8e7e82..6e4cc10abb7 100644 --- a/src/comp/syntax/parse/lexer.rs +++ b/src/comp/syntax/parse/lexer.rs @@ -14,18 +14,18 @@ import codemap; type reader = obj { - fn is_eof() -> bool ; - fn curr() -> char ; - fn next() -> char ; - fn init() ; - fn bump() ; - fn get_str_from(uint) -> str ; - fn get_interner() -> @interner::interner<str> ; - fn get_chpos() -> uint ; - fn get_byte_pos() -> uint ; - fn get_col() -> uint ; - fn get_filemap() -> codemap::filemap ; - fn err(str) ; + fn is_eof() -> bool; + fn curr() -> char; + fn next() -> char; + fn init(); + fn bump(); + fn get_str_from(uint) -> str; + fn get_interner() -> @interner::interner<str>; + fn get_chpos() -> uint; + fn get_byte_pos() -> uint; + fn get_col() -> uint; + fn get_filemap() -> codemap::filemap; + fn err(str); }; fn new_reader(cm: &codemap::codemap, src: str, filemap: codemap::filemap, @@ -81,7 +81,7 @@ fn new_reader(cm: &codemap::codemap, src: str, filemap: codemap::filemap, codemap::emit_error(some(ast::mk_sp(chpos, chpos)), m, cm); } } - let strs: [str] = ~[]; + let strs: [str] = []; let rd = reader(cm, src, str::byte_len(src), 0u, 0u, -1 as char, filemap.start_pos.ch, strs, filemap, itr); @@ -166,10 +166,7 @@ fn consume_block_comment(rdr: &reader) { fn digits_to_string(s: str) -> int { let accum_int: int = 0; - for c: u8 in s { - accum_int *= 10; - accum_int += dec_digit_val(c as char); - } + for c: u8 in s { accum_int *= 10; accum_int += dec_digit_val(c as char); } ret accum_int; } @@ -177,11 +174,11 @@ fn scan_exponent(rdr: &reader) -> option::t<str> { let c = rdr.curr(); let rslt = ""; if c == 'e' || c == 'E' { - rslt += str::unsafe_from_bytes(~[c as u8]); + rslt += str::unsafe_from_bytes([c as u8]); rdr.bump(); c = rdr.curr(); if c == '-' || c == '+' { - rslt += str::unsafe_from_bytes(~[c as u8]); + rslt += str::unsafe_from_bytes([c as u8]); rdr.bump(); } let exponent = scan_dec_digits(rdr); @@ -195,7 +192,7 @@ fn scan_dec_digits(rdr: &reader) -> str { let c = rdr.curr(); let rslt: str = ""; while is_dec_digit(c) || c == '_' { - if c != '_' { rslt += str::unsafe_from_bytes(~[c as u8]); } + if c != '_' { rslt += str::unsafe_from_bytes([c as u8]); } rdr.bump(); c = rdr.curr(); } @@ -216,7 +213,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token { rdr.bump(); c = rdr.curr(); } - } else if (c == '0' && n == 'b') { + } else if c == '0' && n == 'b' { rdr.bump(); rdr.bump(); c = rdr.curr(); @@ -290,7 +287,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token { ret token::LIT_MACH_FLOAT(ast::ty_f32, intern(*rdr.get_interner(), float_str)); - } else if (c == '6' && n == '4') { + } else if c == '6' && n == '4' { rdr.bump(); rdr.bump(); ret token::LIT_MACH_FLOAT(ast::ty_f64, @@ -302,14 +299,14 @@ fn scan_number(c: char, rdr: &reader) -> token::token { } } else { ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(), - float_str)); + float_str)); } } let maybe_exponent = scan_exponent(rdr); alt maybe_exponent { some(s) { ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(), - dec_str + s)); + dec_str + s)); } none. { ret token::LIT_INT(accum_int); } } @@ -321,7 +318,7 @@ fn scan_numeric_escape(rdr: &reader, n_hex_digits: uint) -> char { let n = rdr.curr(); rdr.bump(); if !is_hex_digit(n) { - rdr.err(#fmt("illegal numeric character escape: %d", n as int)); + rdr.err(#fmt["illegal numeric character escape: %d", n as int]); fail; } accum_int *= 16; @@ -351,7 +348,7 @@ fn next_token_inner(rdr: &reader) -> token::token { if str::eq(accum_str, "_") { ret token::UNDERSCORE; } let is_mod_name = c == ':' && rdr.next() == ':'; ret token::IDENT(interner::intern::<str>(*rdr.get_interner(), - accum_str), is_mod_name); + accum_str), is_mod_name); } if is_dec_digit(c) { ret scan_number(c, rdr); } fn binop(rdr: &reader, op: token::binop) -> token::token { @@ -363,6 +360,7 @@ fn next_token_inner(rdr: &reader) -> token::token { } alt c { + // One-byte tokens. '?' { rdr.bump(); @@ -401,6 +399,7 @@ fn next_token_inner(rdr: &reader) -> token::token { } else { ret token::COLON; } } + // Multi-byte tokens. '=' { rdr.bump(); @@ -461,7 +460,7 @@ fn next_token_inner(rdr: &reader) -> token::token { 'u' { c2 = scan_numeric_escape(rdr, 4u); } 'U' { c2 = scan_numeric_escape(rdr, 8u); } c2 { - rdr.err(#fmt("unknown character escape: %d", c2 as int)); + rdr.err(#fmt["unknown character escape: %d", c2 as int]); fail; } } @@ -500,7 +499,7 @@ fn next_token_inner(rdr: &reader) -> token::token { str::push_char(accum_str, scan_numeric_escape(rdr, 8u)); } c2 { - rdr.err(#fmt("unknown string escape: %d", c2 as int)); + rdr.err(#fmt["unknown string escape: %d", c2 as int]); fail; } } @@ -510,7 +509,7 @@ fn next_token_inner(rdr: &reader) -> token::token { } rdr.bump(); ret token::LIT_STR(interner::intern::<str>(*rdr.get_interner(), - accum_str)); + accum_str)); } '-' { if rdr.next() == '>' { @@ -537,7 +536,7 @@ fn next_token_inner(rdr: &reader) -> token::token { '/' { ret binop(rdr, token::SLASH); } '^' { ret binop(rdr, token::CARET); } '%' { ret binop(rdr, token::PERCENT); } - c { rdr.err(#fmt("unkown start of token: %d", c as int)); fail; } + c { rdr.err(#fmt["unkown start of token: %d", c as int]); fail; } } } @@ -562,7 +561,7 @@ fn read_to_eol(rdr: &reader) -> str { fn read_one_line_comment(rdr: &reader) -> str { let val = read_to_eol(rdr); - assert (val.(0) == '/' as u8 && val.(1) == '/' as u8); + assert (val[0] == '/' as u8 && val[1] == '/' as u8); ret val; } @@ -578,8 +577,8 @@ fn consume_non_eol_whitespace(rdr: &reader) { fn push_blank_line_comment(rdr: &reader, comments: &mutable [cmnt]) { log ">>> blank-line comment"; - let v: [str] = ~[]; - comments += ~[{style: blank_line, lines: v, pos: rdr.get_chpos()}]; + let v: [str] = []; + comments += [{style: blank_line, lines: v, pos: rdr.get_chpos()}]; } fn consume_whitespace_counting_blank_lines(rdr: &reader, @@ -595,11 +594,11 @@ fn consume_whitespace_counting_blank_lines(rdr: &reader, fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt { log ">>> line comments"; let p = rdr.get_chpos(); - let lines: [str] = ~[]; + let lines: [str] = []; while rdr.curr() == '/' && rdr.next() == '/' { let line = read_one_line_comment(rdr); log line; - lines += ~[line]; + lines += [line]; consume_non_eol_whitespace(rdr); } log "<<< line comments"; @@ -610,10 +609,7 @@ fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt { fn all_whitespace(s: &str, begin: uint, end: uint) -> bool { let i: uint = begin; - while i != end { - if !is_whitespace(s.(i) as char) { ret false; } - i += 1u; - } + while i != end { if !is_whitespace(s[i] as char) { ret false; } i += 1u; } ret true; } @@ -626,20 +622,20 @@ fn trim_whitespace_prefix_and_push_line(lines: &mutable [str], s: &str, } else { s1 = ""; } } else { s1 = s; } log "pushing line: " + s1; - lines += ~[s1]; + lines += [s1]; } fn read_block_comment(rdr: &reader, code_to_the_left: bool) -> cmnt { log ">>> block comment"; let p = rdr.get_chpos(); - let lines: [str] = ~[]; + let lines: [str] = []; let col: uint = rdr.get_col(); rdr.bump(); rdr.bump(); let curr_line = "/*"; let level: int = 1; while level > 0 { - log #fmt("=== block comment level %d", level); + log #fmt["=== block comment level %d", level]; if rdr.is_eof() { rdr.err("unterminated block comment"); fail; } if rdr.curr() == '\n' { trim_whitespace_prefix_and_push_line(lines, curr_line, col); @@ -683,9 +679,9 @@ fn consume_comment(rdr: &reader, code_to_the_left: bool, comments: &mutable [cmnt]) { log ">>> consume comment"; if rdr.curr() == '/' && rdr.next() == '/' { - comments += ~[read_line_comments(rdr, code_to_the_left)]; - } else if (rdr.curr() == '/' && rdr.next() == '*') { - comments += ~[read_block_comment(rdr, code_to_the_left)]; + comments += [read_line_comments(rdr, code_to_the_left)]; + } else if rdr.curr() == '/' && rdr.next() == '*' { + comments += [read_block_comment(rdr, code_to_the_left)]; } else { fail; } log "<<< consume comment"; } @@ -712,8 +708,8 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: str, let src = str::unsafe_from_bytes(srdr.read_whole_stream()); let itr = @interner::mk::<str>(str::hash, str::eq); let rdr = new_reader(cm, src, codemap::new_filemap(path, 0u, 0u), itr); - let comments: [cmnt] = ~[]; - let literals: [lit] = ~[]; + let comments: [cmnt] = []; + let literals: [lit] = []; let first_read: bool = true; while !rdr.is_eof() { while true { @@ -731,7 +727,7 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: str, } let tok = next_token(rdr); if is_lit(tok.tok) { - literals += ~[{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}]; + literals += [{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}]; } log "tok: " + token::to_str(rdr, tok.tok); first_read = false; diff --git a/src/comp/syntax/parse/parser.rs b/src/comp/syntax/parse/parser.rs index 2d11ae974d3..8113f9fd94d 100644 --- a/src/comp/syntax/parse/parser.rs +++ b/src/comp/syntax/parse/parser.rs @@ -33,39 +33,38 @@ fn next_node_id(sess: &parse_sess) -> node_id { type parser = obj { - fn peek() -> token::token ; - fn bump() ; - fn swap(token::token, uint, uint) ; - fn look_ahead(uint) -> token::token ; - fn fatal(str) -> ! ; - fn warn(str) ; - fn restrict(restriction) ; - fn get_restriction() -> restriction ; - fn get_file_type() -> file_type ; - fn get_cfg() -> ast::crate_cfg ; - fn get_span() -> span ; - fn get_lo_pos() -> uint ; - fn get_hi_pos() -> uint ; - fn get_last_lo_pos() -> uint ; - fn get_last_hi_pos() -> uint ; - fn get_prec_table() -> @[op_spec] ; - fn get_str(token::str_num) -> str ; - fn get_reader() -> lexer::reader ; - fn get_filemap() -> codemap::filemap ; - fn get_bad_expr_words() -> hashmap<str, ()> ; - fn get_chpos() -> uint ; - fn get_byte_pos() -> uint ; - fn get_id() -> node_id ; - fn get_sess() -> parse_sess ; + fn peek() -> token::token; + fn bump(); + fn swap(token::token, uint, uint); + fn look_ahead(uint) -> token::token; + fn fatal(str) -> ! ; + fn warn(str); + fn restrict(restriction); + fn get_restriction() -> restriction; + fn get_file_type() -> file_type; + fn get_cfg() -> ast::crate_cfg; + fn get_span() -> span; + fn get_lo_pos() -> uint; + fn get_hi_pos() -> uint; + fn get_last_lo_pos() -> uint; + fn get_last_hi_pos() -> uint; + fn get_prec_table() -> @[op_spec]; + fn get_str(token::str_num) -> str; + fn get_reader() -> lexer::reader; + fn get_filemap() -> codemap::filemap; + fn get_bad_expr_words() -> hashmap<str, ()>; + fn get_chpos() -> uint; + fn get_byte_pos() -> uint; + fn get_id() -> node_id; + fn get_sess() -> parse_sess; }; -fn new_parser_from_file(sess: parse_sess, cfg: - ast::crate_cfg, path: str, - chpos: uint, byte_pos: uint, - ftype: file_type) -> parser { +fn new_parser_from_file(sess: parse_sess, cfg: ast::crate_cfg, path: str, + chpos: uint, byte_pos: uint, ftype: file_type) -> + parser { let src = io::read_whole_file_str(path); let filemap = codemap::new_filemap(path, chpos, byte_pos); - sess.cm.files += ~[filemap]; + sess.cm.files += [filemap]; let itr = @interner::mk(str::hash, str::eq); let rdr = lexer::new_reader(sess.cm, src, filemap, itr); @@ -106,9 +105,9 @@ fn new_parser(sess: parse_sess, cfg: ast::crate_cfg, rdr: lexer::reader, while vec::len(buffer) < distance { let next = lexer::next_token(rdr); let sp = ast::mk_sp(next.chpos, rdr.get_chpos()); - buffer = ~[{tok: next.tok, span: sp}] + buffer; + buffer = [{tok: next.tok, span: sp}] + buffer; } - ret buffer.(distance - 1u).tok; + ret buffer[distance - 1u].tok; } fn fatal(m: str) -> ! { codemap::emit_error(some(self.get_span()), m, sess.cm); @@ -141,7 +140,7 @@ fn new_parser(sess: parse_sess, cfg: ast::crate_cfg, rdr: lexer::reader, let tok0 = lexer::next_token(rdr); let span0 = ast::mk_sp(tok0.chpos, rdr.get_chpos()); - ret stdio_parser(sess, cfg, ftype, tok0.tok, span0, span0, ~[], + ret stdio_parser(sess, cfg, ftype, tok0.tok, span0, span0, [], UNRESTRICTED, rdr, prec_table(), bad_expr_word_table()); } @@ -213,8 +212,7 @@ fn expect_gt(p: &parser) { } else if p.peek() == token::BINOP(token::LSR) { p.swap(token::GT, p.get_lo_pos() + 1u, p.get_hi_pos()); } else if p.peek() == token::BINOP(token::ASR) { - p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u, - p.get_hi_pos()); + p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u, p.get_hi_pos()); } else { let s: str = "expecting "; s += token::to_str(p.get_reader(), token::GT); @@ -304,7 +302,7 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ { parse_fn_input_ty, p); // FIXME: there's no syntax for this right now anyway // auto constrs = parse_constrs(~[], p); - let constrs: [@ast::constr] = ~[]; + let constrs: [@ast::constr] = []; let output: @ast::ty; let cf = ast::return; if p.peek() == token::RARROW { @@ -324,11 +322,11 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ { fn parse_proto(p: &parser) -> ast::proto { if eat_word(p, "iter") { ret ast::proto_iter; - } else if (eat_word(p, "fn")) { + } else if eat_word(p, "fn") { ret ast::proto_fn; - } else if (eat_word(p, "block")) { + } else if eat_word(p, "block") { ret ast::proto_block; - } else if (eat_word(p, "pred")) { + } else if eat_word(p, "pred") { ret ast::proto_fn; } else { unexpected(p, p.peek()); } } @@ -431,10 +429,10 @@ fn parse_constr_in_type(p: &parser) -> @ast::ty_constr { fn parse_constrs<T>(pser: fn(&parser) -> @ast::constr_general<T>, p: &parser) -> [@ast::constr_general<T>] { - let constrs: [@ast::constr_general<T>] = ~[]; + let constrs: [@ast::constr_general<T>] = []; while true { let constr = pser(p); - constrs += ~[constr]; + constrs += [constr]; if p.peek() == token::COMMA { p.bump(); } else { break; } } constrs @@ -445,7 +443,7 @@ fn parse_type_constraints(p: &parser) -> [@ast::ty_constr] { } fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool) - -> @ast::ty { + -> @ast::ty { let lo = p.get_lo_pos(); if colons_before_params && p.peek() == token::MOD_SEP { @@ -453,9 +451,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool) expect(p, token::LT); } else if !colons_before_params && p.peek() == token::LT { p.bump(); - } else { - ret @spanned(lo, p.get_lo_pos(), orig_t); - } + } else { ret @spanned(lo, p.get_lo_pos(), orig_t); } // If we're here, we have explicit type parameter instantiation. let seq = parse_seq_to_gt(some(token::COMMA), bind parse_ty(_, false), p); @@ -469,9 +465,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool) idents: pth.node.idents, types: seq}), ann)); } - _ { - p.fatal("type parameter instantiation only allowed for paths"); - } + _ { p.fatal("type parameter instantiation only allowed for paths"); } } } @@ -490,73 +484,71 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty { if eat_word(p, "bool") { t = ast::ty_bool; - } else if (eat_word(p, "int")) { + } else if eat_word(p, "int") { t = ast::ty_int; - } else if (eat_word(p, "uint")) { + } else if eat_word(p, "uint") { t = ast::ty_uint; - } else if (eat_word(p, "float")) { + } else if eat_word(p, "float") { t = ast::ty_float; - } else if (eat_word(p, "str")) { + } else if eat_word(p, "str") { t = ast::ty_str; - } else if (eat_word(p, "istr")) { + } else if eat_word(p, "istr") { t = ast::ty_istr; - } else if (eat_word(p, "char")) { + } else if eat_word(p, "char") { t = ast::ty_char; -/* - } else if (eat_word(p, "task")) { - t = ast::ty_task; -*/ - } else if (eat_word(p, "i8")) { + /* + } else if (eat_word(p, "task")) { + t = ast::ty_task; + */ + } else if eat_word(p, "i8") { t = ast::ty_machine(ast::ty_i8); - } else if (eat_word(p, "i16")) { + } else if eat_word(p, "i16") { t = ast::ty_machine(ast::ty_i16); - } else if (eat_word(p, "i32")) { + } else if eat_word(p, "i32") { t = ast::ty_machine(ast::ty_i32); - } else if (eat_word(p, "i64")) { + } else if eat_word(p, "i64") { t = ast::ty_machine(ast::ty_i64); - } else if (eat_word(p, "u8")) { + } else if eat_word(p, "u8") { t = ast::ty_machine(ast::ty_u8); - } else if (eat_word(p, "u16")) { + } else if eat_word(p, "u16") { t = ast::ty_machine(ast::ty_u16); - } else if (eat_word(p, "u32")) { + } else if eat_word(p, "u32") { t = ast::ty_machine(ast::ty_u32); - } else if (eat_word(p, "u64")) { + } else if eat_word(p, "u64") { t = ast::ty_machine(ast::ty_u64); - } else if (eat_word(p, "f32")) { + } else if eat_word(p, "f32") { t = ast::ty_machine(ast::ty_f32); - } else if (eat_word(p, "f64")) { + } else if eat_word(p, "f64") { t = ast::ty_machine(ast::ty_f64); - } else if (p.peek() == token::LPAREN) { + } else if p.peek() == token::LPAREN { p.bump(); if p.peek() == token::RPAREN { hi = p.get_hi_pos(); p.bump(); t = ast::ty_nil; } else { - let ts = ~[parse_ty(p, false)]; + let ts = [parse_ty(p, false)]; while p.peek() == token::COMMA { p.bump(); - ts += ~[parse_ty(p, false)]; + ts += [parse_ty(p, false)]; } if vec::len(ts) == 1u { - t = ts.(0).node; - } else { - t = ast::ty_tup(ts); - } + t = ts[0].node; + } else { t = ast::ty_tup(ts); } hi = p.get_hi_pos(); expect(p, token::RPAREN); } - } else if (p.peek() == token::AT) { + } else if p.peek() == token::AT { p.bump(); let mt = parse_mt(p); hi = mt.ty.span.hi; t = ast::ty_box(mt); - } else if (p.peek() == token::BINOP(token::STAR)) { + } else if p.peek() == token::BINOP(token::STAR) { p.bump(); let mt = parse_mt(p); hi = mt.ty.span.hi; t = ast::ty_ptr(mt); - } else if (p.peek() == token::LBRACE) { + } else if p.peek() == token::LBRACE { let elems = parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA), parse_ty_field, p); @@ -568,28 +560,28 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty { ast::ty_constr(@spanned(lo, hi, t), parse_type_constraints(p)); } - } else if (p.peek() == token::LBRACKET) { + } else if p.peek() == token::LBRACKET { expect(p, token::LBRACKET); t = ast::ty_vec(parse_mt(p)); hi = p.get_hi_pos(); expect(p, token::RBRACKET); - } else if (eat_word(p, "fn")) { + } else if eat_word(p, "fn") { t = parse_ty_fn(ast::proto_fn, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if (eat_word(p, "block")) { + } else if eat_word(p, "block") { t = parse_ty_fn(ast::proto_block, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if (eat_word(p, "iter")) { + } else if eat_word(p, "iter") { t = parse_ty_fn(ast::proto_iter, p); alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } } - } else if (eat_word(p, "obj")) { + } else if eat_word(p, "obj") { t = parse_ty_obj(p, hi); - } else if (eat_word(p, "mutable")) { + } else if eat_word(p, "mutable") { p.warn("ignoring deprecated 'mutable' type constructor"); let typ = parse_ty(p, false); t = typ.node; hi = typ.span.hi; - } else if (p.peek() == token::MOD_SEP || is_ident(p.peek())) { + } else if p.peek() == token::MOD_SEP || is_ident(p.peek()) { let path = parse_path(p); t = ast::ty_path(path, p.get_id()); hi = path.span.hi; @@ -602,9 +594,7 @@ fn parse_arg_mode(p: &parser) -> ast::mode { ast::alias(eat_word(p, "mutable")) } else if eat(p, token::BINOP(token::MINUS)) { ast::move - } else { - ast::val - } + } else { ast::val } } fn parse_arg(p: &parser) -> ast::arg { @@ -625,15 +615,14 @@ fn parse_fn_block_arg(p: &parser) -> ast::arg { fn parse_seq_to_before_gt<T>(sep: option::t<token::token>, f: fn(&parser) -> T, p: &parser) -> [T] { let first = true; - let v = ~[]; - while p.peek() != token::GT && - p.peek() != token::BINOP(token::LSR) && - p.peek() != token::BINOP(token::ASR) { + let v = []; + while p.peek() != token::GT && p.peek() != token::BINOP(token::LSR) && + p.peek() != token::BINOP(token::ASR) { alt sep { some(t) { if first { first = false; } else { expect(p, t); } } _ { } } - v += ~[f(p)]; + v += [f(p)]; } ret v; @@ -658,30 +647,30 @@ fn parse_seq_lt_gt<T>(sep: option::t<token::token>, f: fn(&parser) -> T, } fn parse_seq_to_end<T>(ket: token::token, sep: option::t<token::token>, - f: fn(&parser) -> T , p: &parser) -> [T] { + f: fn(&parser) -> T, p: &parser) -> [T] { let val = parse_seq_to_before_end(ket, sep, f, p); p.bump(); ret val; } fn parse_seq_to_before_end<T>(ket: token::token, sep: option::t<token::token>, - f: fn(&parser) -> T , p: &parser) -> [T] { + f: fn(&parser) -> T, p: &parser) -> [T] { let first: bool = true; - let v: [T] = ~[]; + let v: [T] = []; while p.peek() != ket { alt sep { some(t) { if first { first = false; } else { expect(p, t); } } _ { } } - v += ~[f(p)]; + v += [f(p)]; } ret v; } fn parse_seq<T>(bra: token::token, ket: token::token, - sep: option::t<token::token>, f: fn(&parser) -> T , - p: &parser) -> spanned<[T]> { + sep: option::t<token::token>, f: fn(&parser) -> T, p: &parser) + -> spanned<[T]> { let lo = p.get_lo_pos(); expect(p, bra); let result = parse_seq_to_before_end::<T>(ket, sep, f, p); @@ -696,7 +685,7 @@ fn parse_lit(p: &parser) -> ast::lit { let lit: ast::lit_ = ast::lit_nil; if eat_word(p, "true") { lit = ast::lit_bool(true); - } else if (eat_word(p, "false")) { + } else if eat_word(p, "false") { lit = ast::lit_bool(false); } else { alt p.peek() { @@ -749,24 +738,22 @@ fn parse_path(p: &parser) -> ast::path { p.bump(); } else { global = false; } - let ids: [ast::ident] = ~[]; + let ids: [ast::ident] = []; while true { alt p.peek() { token::IDENT(i, _) { hi = p.get_hi_pos(); - ids += ~[p.get_str(i)]; + ids += [p.get_str(i)]; hi = p.get_hi_pos(); p.bump(); if p.peek() == token::MOD_SEP && p.look_ahead(1u) != token::LT { p.bump(); - } else { - break; - } + } else { break; } } _ { break; } } } - ret spanned(lo, hi, {global: global, idents: ids, types: ~[]}); + ret spanned(lo, hi, {global: global, idents: ids, types: []}); } fn parse_path_and_ty_param_substs(p: &parser) -> ast::path { @@ -775,8 +762,8 @@ fn parse_path_and_ty_param_substs(p: &parser) -> ast::path { if p.peek() == token::MOD_SEP { p.bump(); - let seq = parse_seq_lt_gt(some(token::COMMA), bind parse_ty(_, false), - p); + let seq = + parse_seq_lt_gt(some(token::COMMA), bind parse_ty(_, false), p); let hi = seq.span.hi; path = spanned(lo, hi, @@ -827,28 +814,23 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let lit = @spanned(lo, hi, ast::lit_nil); ret mk_expr(p, lo, hi, ast::expr_lit(lit)); } - let es = ~[parse_expr(p)]; - while p.peek() == token::COMMA { - p.bump(); - es += ~[parse_expr(p)]; - } + let es = [parse_expr(p)]; + while p.peek() == token::COMMA { p.bump(); es += [parse_expr(p)]; } hi = p.get_hi_pos(); expect(p, token::RPAREN); if vec::len(es) == 1u { - ret mk_expr(p, lo, hi, es.(0).node); - } else { - ret mk_expr(p, lo, hi, ast::expr_tup(es)); - } - } else if (p.peek() == token::LBRACE) { + ret mk_expr(p, lo, hi, es[0].node); + } else { ret mk_expr(p, lo, hi, ast::expr_tup(es)); } + } else if p.peek() == token::LBRACE { p.bump(); if is_word(p, "mutable") || is_plain_ident(p) && p.look_ahead(1u) == token::COLON { - let fields = ~[parse_field(p, token::COLON)]; + let fields = [parse_field(p, token::COLON)]; let base = none; while p.peek() != token::RBRACE { if eat_word(p, "with") { base = some(parse_expr(p)); break; } expect(p, token::COMMA); - fields += ~[parse_field(p, token::COLON)]; + fields += [parse_field(p, token::COLON)]; } hi = p.get_hi_pos(); expect(p, token::RBRACE); @@ -859,48 +841,48 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let blk = parse_block_tail(p, lo); ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk)); } - } else if (eat_word(p, "if")) { + } else if eat_word(p, "if") { ret parse_if_expr(p); - } else if (eat_word(p, "for")) { + } else if eat_word(p, "for") { ret parse_for_expr(p); - } else if (eat_word(p, "while")) { + } else if eat_word(p, "while") { ret parse_while_expr(p); - } else if (eat_word(p, "do")) { + } else if eat_word(p, "do") { ret parse_do_while_expr(p); - } else if (eat_word(p, "alt")) { + } else if eat_word(p, "alt") { ret parse_alt_expr(p); -/* - } else if (eat_word(p, "spawn")) { - ret parse_spawn_expr(p); -*/ - } else if (eat_word(p, "fn")) { + /* + } else if (eat_word(p, "spawn")) { + ret parse_spawn_expr(p); + */ + } else if eat_word(p, "fn") { ret parse_fn_expr(p, ast::proto_fn); - } else if (eat_word(p, "block")) { + } else if eat_word(p, "block") { ret parse_fn_expr(p, ast::proto_block); - } else if (eat_word(p, "lambda")) { + } else if eat_word(p, "lambda") { ret parse_fn_expr(p, ast::proto_closure); - } else if (p.peek() == token::LBRACKET) { + } else if p.peek() == token::LBRACKET { p.bump(); let mut = parse_mutability(p); let es = parse_seq_to_end(token::RBRACKET, some(token::COMMA), parse_expr, p); ex = ast::expr_vec(es, mut); - } else if (p.peek() == token::POUND_LT) { + } else if p.peek() == token::POUND_LT { p.bump(); let ty = parse_ty(p, false); expect(p, token::GT); /* hack: early return to take advantage of specialized function */ ret mk_mac_expr(p, lo, p.get_hi_pos(), ast::mac_embed_type(ty)) - } else if (p.peek() == token::POUND_LBRACE) { + } else if p.peek() == token::POUND_LBRACE { p.bump(); let blk = ast::mac_embed_block(parse_block_tail(p, lo)); ret mk_mac_expr(p, lo, p.get_hi_pos(), blk); - } else if (p.peek() == token::ELLIPSIS) { + } else if p.peek() == token::ELLIPSIS { p.bump(); ret mk_mac_expr(p, lo, p.get_hi_pos(), ast::mac_ellipsis) - } else if (p.peek() == token::TILDE) { + } else if p.peek() == token::TILDE { p.bump(); alt p.peek() { token::LBRACKET. { // unique array (temporary) @@ -920,7 +902,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { } _ { ex = ast::expr_uniq(parse_expr(p)); } } - } else if (eat_word(p, "obj")) { + } else if eat_word(p, "obj") { // Anonymous object // Only make people type () if they're actually adding new fields @@ -931,13 +913,13 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { some(parse_seq_to_end(token::RPAREN, some(token::COMMA), parse_anon_obj_field, p)); } - let meths: [@ast::method] = ~[]; + let meths: [@ast::method] = []; let inner_obj: option::t<@ast::expr> = none; expect(p, token::LBRACE); while p.peek() != token::RBRACE { if eat_word(p, "with") { inner_obj = some(parse_expr(p)); - } else { meths += ~[parse_method(p)]; } + } else { meths += [parse_method(p)]; } } hi = p.get_hi_pos(); expect(p, token::RBRACE); @@ -949,7 +931,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { // "spanned". let ob = {fields: fields, methods: meths, inner_obj: inner_obj}; ex = ast::expr_anon_obj(ob); - } else if (eat_word(p, "bind")) { + } else if eat_word(p, "bind") { let e = parse_expr_res(p, RESTRICT_NO_CALL_EXPRS); fn parse_expr_opt(p: &parser) -> option::t<@ast::expr> { alt p.peek() { @@ -962,29 +944,29 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { parse_expr_opt, p); hi = es.span.hi; ex = ast::expr_bind(e, es.node); - } else if (p.peek() == token::POUND) { + } else if p.peek() == token::POUND { let ex_ext = parse_syntax_ext(p); hi = ex_ext.span.hi; ex = ex_ext.node; - } else if (eat_word(p, "fail")) { + } else if eat_word(p, "fail") { if can_begin_expr(p.peek()) { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_fail(some(e)); } else { ex = ast::expr_fail(none); } - } else if (eat_word(p, "log")) { + } else if eat_word(p, "log") { let e = parse_expr(p); ex = ast::expr_log(1, e); hi = e.span.hi; - } else if (eat_word(p, "log_err")) { + } else if eat_word(p, "log_err") { let e = parse_expr(p); ex = ast::expr_log(0, e); hi = e.span.hi; - } else if (eat_word(p, "assert")) { + } else if eat_word(p, "assert") { let e = parse_expr(p); ex = ast::expr_assert(e); hi = e.span.hi; - } else if (eat_word(p, "check")) { + } else if eat_word(p, "check") { /* Should be a predicate (pure boolean function) applied to arguments that are all either slot variables or literals. but the typechecker enforces that. */ @@ -992,7 +974,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_check(ast::checked, e); - } else if (eat_word(p, "claim")) { + } else if eat_word(p, "claim") { /* Same rules as check, except that if check-claims is enabled (a command-line flag), then the parser turns claims into check */ @@ -1000,19 +982,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_check(ast::unchecked, e); - } else if (eat_word(p, "ret")) { + } else if eat_word(p, "ret") { if can_begin_expr(p.peek()) { let e = parse_expr(p); hi = e.span.hi; ex = ast::expr_ret(some(e)); } else { ex = ast::expr_ret(none); } - } else if (eat_word(p, "break")) { + } else if eat_word(p, "break") { ex = ast::expr_break; hi = p.get_hi_pos(); - } else if (eat_word(p, "cont")) { + } else if eat_word(p, "cont") { ex = ast::expr_cont; hi = p.get_hi_pos(); - } else if (eat_word(p, "put")) { + } else if eat_word(p, "put") { alt p.peek() { token::SEMI. { ex = ast::expr_put(none); } _ { @@ -1021,18 +1003,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { ex = ast::expr_put(some(e)); } } - } else if (eat_word(p, "be")) { + } else if eat_word(p, "be") { let e = parse_expr(p); + // FIXME: Is this the right place for this check? if /*check*/ast::is_call_expr(e) { hi = e.span.hi; ex = ast::expr_be(e); } else { p.fatal("Non-call expression in tail call"); } - } else if (eat_word(p, "copy")) { + } else if eat_word(p, "copy") { let e = parse_expr(p); ex = ast::expr_copy(e); hi = e.span.hi; - } else if (eat_word(p, "self")) { + } else if eat_word(p, "self") { expect(p, token::DOT); // The rest is a call expression. let f: @ast::expr = parse_self_method(p); @@ -1041,9 +1024,9 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr { parse_expr, p); hi = es.span.hi; ex = ast::expr_call(f, es.node); - } else if (p.peek() == token::MOD_SEP || - is_ident(p.peek()) && !is_word(p, "true") && - !is_word(p, "false")) { + } else if p.peek() == token::MOD_SEP || + is_ident(p.peek()) && !is_word(p, "true") && + !is_word(p, "false") { check_bad_word(p); let pth = parse_path_and_ty_param_substs(p); hi = pth.span.hi; @@ -1068,16 +1051,16 @@ fn parse_syntax_ext_naked(p: &parser, lo: uint) -> @ast::expr { p.fatal("expected a syntax expander name"); } //temporary for a backwards-compatible cycle: - let es = if p.peek() == token::LPAREN { - parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), - parse_expr, p) - } else { - parse_seq(token::LBRACKET, token::RBRACKET, some(token::COMMA), - parse_expr, p) - }; + let es = + if p.peek() == token::LPAREN { + parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), + parse_expr, p) + } else { + parse_seq(token::LBRACKET, token::RBRACKET, some(token::COMMA), + parse_expr, p) + }; let hi = es.span.hi; - let e = mk_expr(p, es.span.lo, hi, - ast::expr_vec(es.node, ast::imm)); + let e = mk_expr(p, es.span.lo, hi, ast::expr_vec(es.node, ast::imm)); ret mk_mac_expr(p, lo, hi, ast::mac_invoc(pth, e, none)); } @@ -1204,26 +1187,26 @@ type op_spec = {tok: token::token, op: ast::binop, prec: int}; // FIXME make this a const, don't store it in parser state fn prec_table() -> @[op_spec] { - ret @~[{tok: token::BINOP(token::STAR), op: ast::mul, prec: 11}, - {tok: token::BINOP(token::SLASH), op: ast::div, prec: 11}, - {tok: token::BINOP(token::PERCENT), op: ast::rem, prec: 11}, - {tok: token::BINOP(token::PLUS), op: ast::add, prec: 10}, - {tok: token::BINOP(token::MINUS), op: ast::sub, prec: 10}, - {tok: token::BINOP(token::LSL), op: ast::lsl, prec: 9}, - {tok: token::BINOP(token::LSR), op: ast::lsr, prec: 9}, - {tok: token::BINOP(token::ASR), op: ast::asr, prec: 9}, - {tok: token::BINOP(token::AND), op: ast::bitand, prec: 8}, - {tok: token::BINOP(token::CARET), op: ast::bitxor, prec: 6}, - {tok: token::BINOP(token::OR), op: ast::bitor, prec: 6}, - // 'as' sits between here with 5 - {tok: token::LT, op: ast::lt, prec: 4}, - {tok: token::LE, op: ast::le, prec: 4}, - {tok: token::GE, op: ast::ge, prec: 4}, - {tok: token::GT, op: ast::gt, prec: 4}, - {tok: token::EQEQ, op: ast::eq, prec: 3}, - {tok: token::NE, op: ast::ne, prec: 3}, - {tok: token::ANDAND, op: ast::and, prec: 2}, - {tok: token::OROR, op: ast::or, prec: 1}]; + ret @[{tok: token::BINOP(token::STAR), op: ast::mul, prec: 11}, + {tok: token::BINOP(token::SLASH), op: ast::div, prec: 11}, + {tok: token::BINOP(token::PERCENT), op: ast::rem, prec: 11}, + {tok: token::BINOP(token::PLUS), op: ast::add, prec: 10}, + {tok: token::BINOP(token::MINUS), op: ast::sub, prec: 10}, + {tok: token::BINOP(token::LSL), op: ast::lsl, prec: 9}, + {tok: token::BINOP(token::LSR), op: ast::lsr, prec: 9}, + {tok: token::BINOP(token::ASR), op: ast::asr, prec: 9}, + {tok: token::BINOP(token::AND), op: ast::bitand, prec: 8}, + {tok: token::BINOP(token::CARET), op: ast::bitxor, prec: 6}, + {tok: token::BINOP(token::OR), op: ast::bitor, prec: 6}, + // 'as' sits between here with 5 + {tok: token::LT, op: ast::lt, prec: 4}, + {tok: token::LE, op: ast::le, prec: 4}, + {tok: token::GE, op: ast::ge, prec: 4}, + {tok: token::GT, op: ast::gt, prec: 4}, + {tok: token::EQEQ, op: ast::eq, prec: 3}, + {tok: token::NE, op: ast::ne, prec: 3}, + {tok: token::ANDAND, op: ast::and, prec: 2}, + {tok: token::OROR, op: ast::or, prec: 1}]; } fn parse_binops(p: &parser) -> @ast::expr { @@ -1388,11 +1371,11 @@ fn parse_alt_expr(p: &parser) -> @ast::expr { let lo = p.get_last_lo_pos(); let discriminant = parse_expr(p); expect(p, token::LBRACE); - let arms: [ast::arm] = ~[]; + let arms: [ast::arm] = []; while p.peek() != token::RBRACE { let pats = parse_pats(p); let blk = parse_block(p); - arms += ~[{pats: pats, body: blk}]; + arms += [{pats: pats, body: blk}]; } let hi = p.get_hi_pos(); p.bump(); @@ -1422,6 +1405,7 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> { ret some({op: ast::init_move, expr: parse_expr(p)}); } + // Now that the the channel is the first argument to receive, // combining it with an initializer doesn't really make sense. // case (token::RECV) { @@ -1436,9 +1420,9 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> { } fn parse_pats(p: &parser) -> [@ast::pat] { - let pats = ~[]; + let pats = []; while true { - pats += ~[parse_pat(p)]; + pats += [parse_pat(p)]; if p.peek() == token::BINOP(token::OR) { p.bump(); } else { break; } } ret pats; @@ -1458,7 +1442,7 @@ fn parse_pat(p: &parser) -> @ast::pat { } token::LBRACE. { p.bump(); - let fields = ~[]; + let fields = []; let etc = false; let first = true; while p.peek() != token::RBRACE { @@ -1488,7 +1472,7 @@ fn parse_pat(p: &parser) -> @ast::pat { node: ast::pat_bind(fieldname), span: ast::mk_sp(lo, hi)}; } - fields += ~[{ident: fieldname, pat: subpat}]; + fields += [{ident: fieldname, pat: subpat}]; } hi = p.get_hi_pos(); p.bump(); @@ -1499,13 +1483,13 @@ fn parse_pat(p: &parser) -> @ast::pat { if p.peek() == token::RPAREN { hi = p.get_hi_pos(); p.bump(); - pat = ast::pat_lit(@{node: ast::lit_nil, - span: ast::mk_sp(lo,hi)}); + pat = + ast::pat_lit(@{node: ast::lit_nil, span: ast::mk_sp(lo, hi)}); } else { - let fields = ~[parse_pat(p)]; + let fields = [parse_pat(p)]; while p.peek() == token::COMMA { p.bump(); - fields += ~[parse_pat(p)]; + fields += [parse_pat(p)]; } if vec::len(fields) == 1u { expect(p, token::COMMA); } hi = p.get_hi_pos(); @@ -1518,13 +1502,13 @@ fn parse_pat(p: &parser) -> @ast::pat { let lit = parse_lit(p); hi = lit.span.hi; pat = ast::pat_lit(@lit); - } else if (is_plain_ident(p) && - alt p.look_ahead(1u) { - token::DOT. | token::LPAREN. | token::LBRACKET. { - false - } - _ { true } - }) { + } else if is_plain_ident(p) && + alt p.look_ahead(1u) { + token::DOT. | token::LPAREN. | token::LBRACKET. { + false + } + _ { true } + } { hi = p.get_hi_pos(); pat = ast::pat_bind(parse_value_ident(p)); } else { @@ -1539,7 +1523,7 @@ fn parse_pat(p: &parser) -> @ast::pat { args = a.node; hi = a.span.hi; } - token::DOT. { args = ~[]; p.bump(); } + token::DOT. { args = []; p.bump(); } _ { expect(p, token::LPAREN); fail; } } pat = ast::pat_tag(tag_path, args); @@ -1556,18 +1540,15 @@ fn parse_local(p: &parser, allow_init: bool) -> @ast::local { if eat(p, token::COLON) { ty = parse_ty(p, false); } let init = if allow_init { parse_initializer(p) } else { none }; ret @spanned(lo, p.get_last_hi_pos(), - {ty: ty, - pat: pat, - init: init, - id: p.get_id()}); + {ty: ty, pat: pat, init: init, id: p.get_id()}); } fn parse_let(p: &parser) -> @ast::decl { let lo = p.get_lo_pos(); - let locals = ~[parse_local(p, true)]; + let locals = [parse_local(p, true)]; while p.peek() == token::COMMA { p.bump(); - locals += ~[parse_local(p, true)]; + locals += [parse_local(p, true)]; } ret @spanned(lo, p.get_last_hi_pos(), ast::decl_local(locals)); } @@ -1579,7 +1560,7 @@ fn parse_stmt(p: &parser) -> @ast::stmt { } fn parse_crate_stmt(p: &parser) -> @ast::stmt { - let cdir = parse_crate_directive(p, ~[]); + let cdir = parse_crate_directive(p, []); ret @spanned(cdir.span.lo, cdir.span.hi, ast::stmt_crate_directive(@cdir)); } @@ -1593,7 +1574,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt { let item_attrs; alt parse_outer_attrs_or_ext(p) { - none. { item_attrs = ~[]; } + none. { item_attrs = []; } some(left(attrs)) { item_attrs = attrs; } some(right(ext)) { ret @spanned(lo, ext.span.hi, ast::stmt_expr(ext, p.get_id())); @@ -1682,6 +1663,7 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool { } } + // We should not be calling this on a cdir. ast::stmt_crate_directive(cdir) { fail; @@ -1697,7 +1679,7 @@ fn parse_block(p: &parser) -> ast::blk { // some blocks start with "#{"... fn parse_block_tail(p: &parser, lo: uint) -> ast::blk { - let stmts: [@ast::stmt] = ~[]; + let stmts: [@ast::stmt] = []; let expr: option::t<@ast::expr> = none; while p.peek() != token::RBRACE { alt p.peek() { @@ -1709,7 +1691,7 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk { alt stmt_to_expr(stmt) { some(e) { alt p.peek() { - token::SEMI. { p.bump(); stmts += ~[stmt]; } + token::SEMI. { p.bump(); stmts += [stmt]; } token::RBRACE. { expr = some(e); } t { if stmt_ends_with_semi(*stmt) { @@ -1717,13 +1699,13 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk { "expression but found " + token::to_str(p.get_reader(), t)); } - stmts += ~[stmt]; + stmts += [stmt]; } } } none. { // Not an expression statement. - stmts += ~[stmt]; + stmts += [stmt]; if p.get_file_type() == SOURCE_FILE && @@ -1742,16 +1724,17 @@ fn parse_block_tail(p: &parser, lo: uint) -> ast::blk { } fn parse_ty_param(p: &parser) -> ast::ty_param { - let k = alt p.peek() { - token::TILDE. { p.bump(); ast::kind_unique } - token::AT. { p.bump(); ast::kind_shared } - _ { ast::kind_pinned } - }; + let k = + alt p.peek() { + token::TILDE. { p.bump(); ast::kind_unique } + token::AT. { p.bump(); ast::kind_shared } + _ { ast::kind_pinned } + }; ret {ident: parse_ident(p), kind: k}; } fn parse_ty_params(p: &parser) -> [ast::ty_param] { - let ty_params: [ast::ty_param] = ~[]; + let ty_params: [ast::ty_param] = []; if p.peek() == token::LT { p.bump(); ty_params = parse_seq_to_gt(some(token::COMMA), parse_ty_param, p); @@ -1764,8 +1747,8 @@ fn parse_ty_params(p: &parser) -> [ast::ty_param] { ret ty_params; } -fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness) - -> ast::fn_decl { +fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness) -> + ast::fn_decl { let inputs: ast::spanned<[ast::arg]> = parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), parse_arg, p); @@ -1773,7 +1756,7 @@ fn parse_fn_decl(p: &parser, purity: ast::purity, il: ast::inlineness) // Use the args list to translate each bound variable // mentioned in a constraint to an arg index. // Seems weird to do this in the parser, but I'm not sure how else to. - let constrs = ~[]; + let constrs = []; if p.peek() == token::COLON { p.bump(); constrs = parse_constrs(bind parse_ty_constr(inputs.node, _), p); @@ -1813,7 +1796,7 @@ fn parse_fn_block_decl(p: &parser) -> ast::fn_decl { purity: ast::impure_fn, il: ast::il_normal, cf: ast::return, - constraints: ~[]}; + constraints: []}; } fn parse_fn(p: &parser, proto: ast::proto, purity: ast::purity, @@ -1839,8 +1822,8 @@ fn mk_item(p: &parser, lo: uint, hi: uint, ident: &ast::ident, } fn parse_item_fn_or_iter(p: &parser, purity: ast::purity, proto: ast::proto, - attrs: &[ast::attribute], il: ast::inlineness) - -> @ast::item { + attrs: &[ast::attribute], il: ast::inlineness) -> + @ast::item { let lo = p.get_last_lo_pos(); let t = parse_fn_header(p); let f = parse_fn(p, proto, purity, il); @@ -1875,19 +1858,16 @@ fn parse_method(p: &parser) -> @ast::method { ret @spanned(lo, f.body.span.hi, meth); } -fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) -> - @ast::item { +fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) -> @ast::item { let lo = p.get_last_lo_pos(); let ident = parse_value_ident(p); let ty_params = parse_ty_params(p); let fields: ast::spanned<[ast::obj_field]> = parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), parse_obj_field, p); - let meths: [@ast::method] = ~[]; + let meths: [@ast::method] = []; expect(p, token::LBRACE); - while p.peek() != token::RBRACE { - meths += ~[parse_method(p)]; - } + while p.peek() != token::RBRACE { meths += [parse_method(p)]; } let hi = p.get_hi_pos(); expect(p, token::RBRACE); let ob: ast::_obj = {fields: fields.node, methods: meths}; @@ -1895,8 +1875,7 @@ fn parse_item_obj(p: &parser, attrs: &[ast::attribute]) -> attrs); } -fn parse_item_res(p: &parser, attrs: &[ast::attribute]) -> - @ast::item { +fn parse_item_res(p: &parser, attrs: &[ast::attribute]) -> @ast::item { let lo = p.get_last_lo_pos(); let ident = parse_value_ident(p); let ty_params = parse_ty_params(p); @@ -1908,15 +1887,15 @@ fn parse_item_res(p: &parser, attrs: &[ast::attribute]) -> let dtor = parse_block(p); let decl = {inputs: - ~[{mode: ast::alias(false), - ty: t, - ident: arg_ident, - id: p.get_id()}], + [{mode: ast::alias(false), + ty: t, + ident: arg_ident, + id: p.get_id()}], output: @spanned(lo, lo, ast::ty_nil), purity: ast::impure_fn, il: ast::il_normal, cf: ast::return, - constraints: ~[]}; + constraints: []}; let f = {decl: decl, proto: ast::proto_fn, body: dtor}; ret mk_item(p, lo, dtor.span.hi, ident, ast::item_res(f, p.get_id(), ty_params, p.get_id()), attrs); @@ -1926,14 +1905,14 @@ fn parse_mod_items(p: &parser, term: token::token, first_item_attrs: &[ast::attribute]) -> ast::_mod { // Shouldn't be any view items since we've already parsed an item attr let view_items = - if vec::len(first_item_attrs) == 0u { parse_view(p) } else { ~[] }; - let items: [@ast::item] = ~[]; + if vec::len(first_item_attrs) == 0u { parse_view(p) } else { [] }; + let items: [@ast::item] = []; let initial_attrs = first_item_attrs; while p.peek() != term { let attrs = initial_attrs + parse_outer_attributes(p); - initial_attrs = ~[]; + initial_attrs = []; alt parse_item(p, attrs) { - some(i) { items += ~[i]; } + some(i) { items += [i]; } _ { p.fatal("expected item but found " + token::to_str(p.get_reader(), p.peek())); @@ -1999,25 +1978,25 @@ fn parse_native_item(p: &parser, attrs: &[ast::attribute]) -> @ast::native_item { if eat_word(p, "type") { ret parse_item_native_type(p, attrs); - } else if (eat_word(p, "fn")) { + } else if eat_word(p, "fn") { ret parse_item_native_fn(p, attrs); } else { unexpected(p, p.peek()); } } fn parse_native_mod_items(p: &parser, native_name: &str, abi: ast::native_abi, - first_item_attrs: &[ast::attribute]) - -> ast::native_mod { + first_item_attrs: &[ast::attribute]) -> + ast::native_mod { // Shouldn't be any view items since we've already parsed an item attr let view_items = if vec::len(first_item_attrs) == 0u { parse_native_view(p) - } else { ~[] }; - let items: [@ast::native_item] = ~[]; + } else { [] }; + let items: [@ast::native_item] = []; let initial_attrs = first_item_attrs; while p.peek() != token::RBRACE { let attrs = initial_attrs + parse_outer_attributes(p); - initial_attrs = ~[]; - items += ~[parse_native_item(p, attrs)]; + initial_attrs = []; + items += [parse_native_item(p, attrs)]; } ret {native_name: native_name, abi: abi, @@ -2031,13 +2010,13 @@ fn parse_item_native_mod(p: &parser, attrs: &[ast::attribute]) -> @ast::item { if !is_word(p, "mod") { let t = parse_str(p); if str::eq(t, "cdecl") { - } else if (str::eq(t, "rust")) { + } else if str::eq(t, "rust") { abi = ast::native_abi_rust; - } else if (str::eq(t, "llvm")) { + } else if str::eq(t, "llvm") { abi = ast::native_abi_llvm; - } else if (str::eq(t, "rust-intrinsic")) { + } else if str::eq(t, "rust-intrinsic") { abi = ast::native_abi_rust_intrinsic; - } else if (str::eq(t, "x86stdcall")) { + } else if str::eq(t, "x86stdcall") { abi = ast::native_abi_x86stdcall; } else { p.fatal("unsupported abi: " + t); } } @@ -2079,7 +2058,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { let lo = p.get_last_lo_pos(); let id = parse_ident(p); let ty_params = parse_ty_params(p); - let variants: [ast::variant] = ~[]; + let variants: [ast::variant] = []; // Newtype syntax if p.peek() == token::EQ { if p.get_bad_expr_words().contains_key(id) { @@ -2091,10 +2070,10 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { let variant = spanned(ty.span.lo, ty.span.hi, {name: id, - args: ~[{ty: ty, id: p.get_id()}], + args: [{ty: ty, id: p.get_id()}], id: p.get_id()}); ret mk_item(p, lo, ty.span.hi, id, - ast::item_tag(~[variant], ty_params), attrs); + ast::item_tag([variant], ty_params), attrs); } expect(p, token::LBRACE); while p.peek() != token::RBRACE { @@ -2104,7 +2083,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { check_bad_word(p); let vlo = p.get_lo_pos(); p.bump(); - let args: [ast::variant_arg] = ~[]; + let args: [ast::variant_arg] = []; let vhi = p.get_hi_pos(); alt p.peek() { token::LPAREN. { @@ -2112,7 +2091,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { parse_seq(token::LPAREN, token::RPAREN, some(token::COMMA), bind parse_ty(_, false), p); for ty: @ast::ty in arg_tys.node { - args += ~[{ty: ty, id: p.get_id()}]; + args += [{ty: ty, id: p.get_id()}]; } vhi = arg_tys.span.hi; } @@ -2121,7 +2100,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item { expect(p, token::SEMI); p.get_id(); let vr = {name: p.get_str(name), args: args, id: p.get_id()}; - variants += ~[spanned(vlo, vhi, vr)]; + variants += [spanned(vlo, vhi, vr)]; } token::RBRACE. {/* empty */ } _ { @@ -2144,33 +2123,33 @@ fn parse_auth(p: &parser) -> ast::_auth { fn parse_item(p: &parser, attrs: &[ast::attribute]) -> option::t<@ast::item> { if eat_word(p, "const") { ret some(parse_item_const(p, attrs)); - } else if (eat_word(p, "inline")) { + } else if eat_word(p, "inline") { expect_word(p, "fn"); ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn, attrs, ast::il_inline)); - } else if (is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN) { + } else if is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN { p.bump(); ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn, attrs, ast::il_normal)); - } else if (eat_word(p, "pred")) { - ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn, - attrs, ast::il_normal)); - } else if (eat_word(p, "iter")) { + } else if eat_word(p, "pred") { + ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn, attrs, + ast::il_normal)); + } else if eat_word(p, "iter") { ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_iter, attrs, ast::il_normal)); - } else if (eat_word(p, "mod")) { + } else if eat_word(p, "mod") { ret some(parse_item_mod(p, attrs)); - } else if (eat_word(p, "native")) { + } else if eat_word(p, "native") { ret some(parse_item_native_mod(p, attrs)); } if eat_word(p, "type") { ret some(parse_item_type(p, attrs)); - } else if (eat_word(p, "tag")) { + } else if eat_word(p, "tag") { ret some(parse_item_tag(p, attrs)); - } else if (is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN) { + } else if is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN { p.bump(); ret some(parse_item_obj(p, attrs)); - } else if (eat_word(p, "resource")) { + } else if eat_word(p, "resource") { ret some(parse_item_res(p, attrs)); } else { ret none; } } @@ -2185,8 +2164,8 @@ fn parse_outer_attrs_or_ext(p: &parser) -> attr_or_ext { p.bump(); if p.peek() == token::LBRACKET { let first_attr = parse_attribute_naked(p, ast::attr_outer, lo); - ret some(left(~[first_attr] + parse_outer_attributes(p))); - } else if (!(p.peek() == token::LT || p.peek() == token::LBRACKET)) { + ret some(left([first_attr] + parse_outer_attributes(p))); + } else if !(p.peek() == token::LT || p.peek() == token::LBRACKET) { ret some(right(parse_syntax_ext_naked(p, lo))); } else { ret none; } } else { ret none; } @@ -2194,9 +2173,9 @@ fn parse_outer_attrs_or_ext(p: &parser) -> attr_or_ext { // Parse attributes that appear before an item fn parse_outer_attributes(p: &parser) -> [ast::attribute] { - let attrs: [ast::attribute] = ~[]; + let attrs: [ast::attribute] = []; while p.peek() == token::POUND { - attrs += ~[parse_attribute(p, ast::attr_outer)]; + attrs += [parse_attribute(p, ast::attr_outer)]; } ret attrs; } @@ -2224,19 +2203,19 @@ fn parse_attribute_naked(p: &parser, style: ast::attr_style, lo: uint) -> // until we see the semi). fn parse_inner_attrs_and_next(p: &parser) -> {inner: [ast::attribute], next: [ast::attribute]} { - let inner_attrs: [ast::attribute] = ~[]; - let next_outer_attrs: [ast::attribute] = ~[]; + let inner_attrs: [ast::attribute] = []; + let next_outer_attrs: [ast::attribute] = []; while p.peek() == token::POUND { let attr = parse_attribute(p, ast::attr_inner); if p.peek() == token::SEMI { p.bump(); - inner_attrs += ~[attr]; + inner_attrs += [attr]; } else { // It's not really an inner attribute let outer_attr = spanned(attr.span.lo, attr.span.hi, {style: ast::attr_outer, value: attr.node.value}); - next_outer_attrs += ~[outer_attr]; + next_outer_attrs += [outer_attr]; break; } } @@ -2271,7 +2250,7 @@ fn parse_meta_seq(p: &parser) -> [@ast::meta_item] { } fn parse_optional_meta(p: &parser) -> [@ast::meta_item] { - alt p.peek() { token::LPAREN. { ret parse_meta_seq(p); } _ { ret ~[]; } } + alt p.peek() { token::LPAREN. { ret parse_meta_seq(p); } _ { ret []; } } } fn parse_use(p: &parser) -> ast::view_item_ { @@ -2283,16 +2262,14 @@ fn parse_use(p: &parser) -> ast::view_item_ { fn parse_rest_import_name(p: &parser, first: ast::ident, def_ident: option::t<ast::ident>) -> ast::view_item_ { - let identifiers: [ast::ident] = ~[first]; + let identifiers: [ast::ident] = [first]; let glob: bool = false; let from_idents = option::none::<[ast::import_ident]>; while true { alt p.peek() { token::SEMI. { break; } token::MOD_SEP. { - if glob { - p.fatal("cannot path into a glob"); - } + if glob { p.fatal("cannot path into a glob"); } if option::is_some(from_idents) { p.fatal("cannot path into import list"); } @@ -2301,7 +2278,8 @@ fn parse_rest_import_name(p: &parser, first: ast::ident, _ { p.fatal("expecting '::' or ';'"); } } alt p.peek() { - token::IDENT(_, _) { identifiers += ~[parse_ident(p)]; } + token::IDENT(_, _) { identifiers += [parse_ident(p)]; } + //the lexer can't tell the different kinds of stars apart ) : token::BINOP(token::STAR.) { @@ -2309,33 +2287,32 @@ fn parse_rest_import_name(p: &parser, first: ast::ident, p.bump(); } + token::LBRACE. { fn parse_import_ident(p: &parser) -> ast::import_ident { let lo = p.get_lo_pos(); let ident = parse_ident(p); let hi = p.get_hi_pos(); - ret spanned(lo, hi, {name: ident, - id: p.get_id()}); + ret spanned(lo, hi, {name: ident, id: p.get_id()}); } - let from_idents_ = parse_seq(token::LBRACE, - token::RBRACE, - some(token::COMMA), - parse_import_ident, - p).node; + let from_idents_ = + parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA), + parse_import_ident, p).node; if vec::is_empty(from_idents_) { p.fatal("at least one import is required"); } from_idents = some(from_idents_); } - _ { p.fatal("expecting an identifier, or '*'"); } + + _ { + p.fatal("expecting an identifier, or '*'"); + } } } alt def_ident { some(i) { - if glob { - p.fatal("globbed imports can't be renamed"); - } + if glob { p.fatal("globbed imports can't be renamed"); } if option::is_some(from_idents) { p.fatal("can't rename import list"); } @@ -2350,7 +2327,7 @@ fn parse_rest_import_name(p: &parser, first: ast::ident, p.get_id()); } else { let len = vec::len(identifiers); - ret ast::view_item_import(identifiers.(len - 1u), identifiers, + ret ast::view_item_import(identifiers[len - 1u], identifiers, p.get_id()); } } @@ -2385,8 +2362,9 @@ fn parse_import(p: &parser) -> ast::view_item_ { } fn parse_export(p: &parser) -> ast::view_item_ { - let ids = parse_seq_to_before_end( - token::SEMI, option::some(token::COMMA), parse_ident, p); + let ids = + parse_seq_to_before_end(token::SEMI, option::some(token::COMMA), + parse_ident, p); ret ast::view_item_export(ids, p.get_id()); } @@ -2395,9 +2373,9 @@ fn parse_view_item(p: &parser) -> @ast::view_item { let the_item = if eat_word(p, "use") { parse_use(p) - } else if (eat_word(p, "import")) { + } else if eat_word(p, "import") { parse_import(p) - } else if (eat_word(p, "export")) { parse_export(p) } else { fail }; + } else if eat_word(p, "export") { parse_export(p) } else { fail }; let hi = p.get_lo_pos(); expect(p, token::SEMI); ret @spanned(lo, hi, the_item); @@ -2415,14 +2393,14 @@ fn is_view_item(p: &parser) -> bool { } fn parse_view(p: &parser) -> [@ast::view_item] { - let items: [@ast::view_item] = ~[]; - while is_view_item(p) { items += ~[parse_view_item(p)]; } + let items: [@ast::view_item] = []; + while is_view_item(p) { items += [parse_view_item(p)]; } ret items; } fn parse_native_view(p: &parser) -> [@ast::view_item] { - let items: [@ast::view_item] = ~[]; - while is_view_item(p) { items += ~[parse_view_item(p)]; } + let items: [@ast::view_item] = []; + while is_view_item(p) { items += [parse_view_item(p)]; } ret items; } @@ -2436,7 +2414,7 @@ fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg, sess: &parse_sess) -> @ast::crate { let ftype = SOURCE_FILE; let filemap = codemap::new_filemap(name, 0u, 0u); - sess.cm.files += ~[filemap]; + sess.cm.files += [filemap]; let itr = @interner::mk(str::hash, str::eq); let rdr = lexer::new_reader(sess.cm, source, filemap, itr); let p = new_parser(sess, cfg, rdr, ftype); @@ -2444,14 +2422,13 @@ fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg, } // Parses a source module as a crate -fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) -> - @ast::crate { +fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) -> @ast::crate { let lo = p.get_lo_pos(); let crate_attrs = parse_inner_attrs_and_next(p); let first_item_outer_attrs = crate_attrs.next; let m = parse_mod_items(p, token::EOF, first_item_outer_attrs); ret @spanned(lo, p.get_lo_pos(), - {directives: ~[], + {directives: [], module: m, attrs: crate_attrs.inner, config: p.get_cfg()}); @@ -2488,6 +2465,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> }; alt p.peek() { + // mod x = "foo.rs"; token::SEMI. { let hi = p.get_hi_pos(); @@ -2495,6 +2473,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> ret spanned(lo, hi, ast::cdir_src_mod(id, file_opt, outer_attrs)); } + // mod x = "foo_dir" { ...directives... } token::LBRACE. { p.bump(); @@ -2510,14 +2489,14 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) -> } t { unexpected(p, t); } } - } else if (eat_word(p, "auth")) { + } else if eat_word(p, "auth") { let n = parse_path(p); expect(p, token::EQ); let a = parse_auth(p); let hi = p.get_hi_pos(); expect(p, token::SEMI); ret spanned(lo, hi, ast::cdir_auth(n, a)); - } else if (is_view_item(p)) { + } else if is_view_item(p) { let vi = parse_view_item(p); ret spanned(lo, vi.span.hi, ast::cdir_view_item(vi)); } else { ret p.fatal("expected crate directive"); } @@ -2534,10 +2513,10 @@ fn parse_crate_directives(p: &parser, term: token::token, expect_word(p, "mod"); } - let cdirs: [@ast::crate_directive] = ~[]; + let cdirs: [@ast::crate_directive] = []; while p.peek() != term { let cdir = @parse_crate_directive(p, first_outer_attr); - cdirs += ~[cdir]; + cdirs += [cdir]; } ret cdirs; } @@ -2551,7 +2530,7 @@ fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg, let crate_attrs = leading_attrs.inner; let first_cdir_attr = leading_attrs.next; let cdirs = parse_crate_directives(p, token::EOF, first_cdir_attr); - let deps: [str] = ~[]; + let deps: [str] = []; let cx = @{p: p, mode: eval::mode_parse, @@ -2570,15 +2549,14 @@ fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg, config: p.get_cfg()}); } -fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg, - sess: &parse_sess) -> @ast::crate { +fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess) + -> @ast::crate { if str::ends_with(input, ".rc") { parse_crate_from_crate_file(input, cfg, sess) } else if str::ends_with(input, ".rs") { parse_crate_from_source_file(input, cfg, sess) } else { - codemap::emit_error(none, - "unknown input file type: " + input, + codemap::emit_error(none, "unknown input file type: " + input, sess.cm); fail } diff --git a/src/comp/syntax/parse/token.rs b/src/comp/syntax/parse/token.rs index 574684dc234..c974dc915c4 100644 --- a/src/comp/syntax/parse/token.rs +++ b/src/comp/syntax/parse/token.rs @@ -116,6 +116,7 @@ fn to_str(r: lexer::reader, t: token) -> str { BINOP(op) { ret binop_to_str(op); } BINOPEQ(op) { ret binop_to_str(op) + "="; } + /* Structural symbols */ AT. { ret "@"; @@ -140,6 +141,7 @@ fn to_str(r: lexer::reader, t: token) -> str { POUND_LBRACE. { ret "#{"; } POUND_LT. { ret "#<"; } + /* Literals */ LIT_INT(i) { ret int::to_str(i, 10u); @@ -165,6 +167,7 @@ fn to_str(r: lexer::reader, t: token) -> str { } LIT_BOOL(b) { if b { ret "true"; } else { ret "false"; } } + /* Name components */ IDENT(s, _) { ret interner::get::<str>(*r.get_interner(), s); diff --git a/src/comp/syntax/print/pp.rs b/src/comp/syntax/print/pp.rs index bd67c552cbb..adeccd4150c 100644 --- a/src/comp/syntax/print/pp.rs +++ b/src/comp/syntax/print/pp.rs @@ -66,7 +66,7 @@ tag token { STRING(str, int); BREAK(break_t); BEGIN(begin_t); END; EOF; } fn tok_str(t: token) -> str { alt t { - STRING(s, len) { ret #fmt("STR(%s,%d)", s, len); } + STRING(s, len) { ret #fmt["STR(%s,%d)", s, len]; } BREAK(_) { ret "BREAK"; } BEGIN(_) { ret "BEGIN"; } END. { ret "END"; } @@ -84,7 +84,7 @@ fn buf_str(toks: &[mutable token], szs: &[mutable int], left: uint, while i != right && L != 0u { L -= 1u; if i != left { s += ", "; } - s += #fmt("%d=%s", szs.(i), tok_str(toks.(i))); + s += #fmt["%d=%s", szs[i], tok_str(toks[i])]; i += 1u; i %= n; } @@ -103,11 +103,11 @@ fn mk_printer(out: io::writer, linewidth: uint) -> printer { // fall behind. let n: uint = 3u * linewidth; - log #fmt("mk_printer %u", linewidth); + log #fmt["mk_printer %u", linewidth]; let token: [mutable token] = vec::init_elt_mut(EOF, n); let size: [mutable int] = vec::init_elt_mut(0, n); let scan_stack: [mutable uint] = vec::init_elt_mut(0u, n); - let print_stack: [print_stack_elt] = ~[]; + let print_stack: [print_stack_elt] = []; ret printer(out, n, linewidth as int, // margin linewidth as int, // space 0u, // left @@ -237,18 +237,18 @@ obj printer(out: io::writer, // buffered indentation to avoid writing trailing whitespace mutable pending_indentation: int) { - fn last_token() -> token { ret token.(right); } + fn last_token() -> token { ret token[right]; } // be very careful with this! - fn replace_last_token(t: token) { token.(right) = t; } + fn replace_last_token(t: token) { token[right] = t; } fn pretty_print(t: token) { - log #fmt("pp [%u,%u]", left, right); + log #fmt["pp [%u,%u]", left, right]; alt t { EOF. { if !scan_stack_empty { self.check_stack(0); - self.advance_left(token.(left), size.(left)); + self.advance_left(token[left], size[left]); } self.indent(0); } @@ -259,20 +259,20 @@ obj printer(out: io::writer, left = 0u; right = 0u; } else { self.advance_right(); } - log #fmt("pp BEGIN/buffer [%u,%u]", left, right); - token.(right) = t; - size.(right) = -right_total; + log #fmt["pp BEGIN/buffer [%u,%u]", left, right]; + token[right] = t; + size[right] = -right_total; self.scan_push(right); } END. { if scan_stack_empty { - log #fmt("pp END/print [%u,%u]", left, right); + log #fmt["pp END/print [%u,%u]", left, right]; self.print(t, 0); } else { - log #fmt("pp END/buffer [%u,%u]", left, right); + log #fmt["pp END/buffer [%u,%u]", left, right]; self.advance_right(); - token.(right) = t; - size.(right) = -1; + token[right] = t; + size[right] = -1; self.scan_push(right); } } @@ -283,22 +283,22 @@ obj printer(out: io::writer, left = 0u; right = 0u; } else { self.advance_right(); } - log #fmt("pp BREAK/buffer [%u,%u]", left, right); + log #fmt["pp BREAK/buffer [%u,%u]", left, right]; self.check_stack(0); self.scan_push(right); - token.(right) = t; - size.(right) = -right_total; + token[right] = t; + size[right] = -right_total; right_total += b.blank_space; } STRING(s, len) { if scan_stack_empty { - log #fmt("pp STRING/print [%u,%u]", left, right); + log #fmt["pp STRING/print [%u,%u]", left, right]; self.print(t, len); } else { - log #fmt("pp STRING/buffer [%u,%u]", left, right); + log #fmt["pp STRING/buffer [%u,%u]", left, right]; self.advance_right(); - token.(right) = t; - size.(right) = len; + token[right] = t; + size[right] = len; right_total += len; self.check_stream(); } @@ -306,43 +306,40 @@ obj printer(out: io::writer, } } fn check_stream() { - log #fmt("check_stream [%u, %u] with left_total=%d, right_total=%d", - left, right, left_total, right_total); + log #fmt["check_stream [%u, %u] with left_total=%d, right_total=%d", + left, right, left_total, right_total]; if right_total - left_total > space { - log #fmt("scan window is %d, longer than space on line (%d)", - right_total - left_total, space); + log #fmt["scan window is %d, longer than space on line (%d)", + right_total - left_total, space]; if !scan_stack_empty { - if left == scan_stack.(bottom) { - log #fmt("setting %u to infinity and popping", left); - size.(self.scan_pop_bottom()) = size_infinity; + if left == scan_stack[bottom] { + log #fmt["setting %u to infinity and popping", left]; + size[self.scan_pop_bottom()] = size_infinity; } } - self.advance_left(token.(left), size.(left)); + self.advance_left(token[left], size[left]); if left != right { self.check_stream(); } } } fn scan_push(x: uint) { - log #fmt("scan_push %u", x); + log #fmt["scan_push %u", x]; if scan_stack_empty { scan_stack_empty = false; } else { top += 1u; top %= buf_len; assert (top != bottom); } - scan_stack.(top) = x; + scan_stack[top] = x; } fn scan_pop() -> uint { assert (!scan_stack_empty); - let x = scan_stack.(top); + let x = scan_stack[top]; if top == bottom { scan_stack_empty = true; } else { top += buf_len - 1u; top %= buf_len; } ret x; } - fn scan_top() -> uint { - assert (!scan_stack_empty); - ret scan_stack.(top); - } + fn scan_top() -> uint { assert (!scan_stack_empty); ret scan_stack[top]; } fn scan_pop_bottom() -> uint { assert (!scan_stack_empty); - let x = scan_stack.(bottom); + let x = scan_stack[bottom]; if top == bottom { scan_stack_empty = true; } else { bottom += 1u; bottom %= buf_len; } @@ -354,7 +351,7 @@ obj printer(out: io::writer, assert (right != left); } fn advance_left(x: token, L: int) { - log #fmt("advnce_left [%u,%u], sizeof(%u)=%d", left, right, left, L); + log #fmt["advnce_left [%u,%u], sizeof(%u)=%d", left, right, left, L]; if L >= 0 { self.print(x, L); alt x { @@ -365,47 +362,47 @@ obj printer(out: io::writer, if left != right { left += 1u; left %= buf_len; - self.advance_left(token.(left), size.(left)); + self.advance_left(token[left], size[left]); } } } fn check_stack(k: int) { if !scan_stack_empty { let x = self.scan_top(); - alt token.(x) { + alt token[x] { BEGIN(b) { if k > 0 { - size.(self.scan_pop()) = size.(x) + right_total; + size[self.scan_pop()] = size[x] + right_total; self.check_stack(k - 1); } } END. { // paper says + not =, but that makes no sense. - size.(self.scan_pop()) = 1; + size[self.scan_pop()] = 1; self.check_stack(k + 1); } _ { - size.(self.scan_pop()) = size.(x) + right_total; + size[self.scan_pop()] = size[x] + right_total; if k > 0 { self.check_stack(k); } } } } } fn print_newline(amount: int) { - log #fmt("NEWLINE %d", amount); + log #fmt["NEWLINE %d", amount]; out.write_str("\n"); pending_indentation = 0; self.indent(amount); } fn indent(amount: int) { - log #fmt("INDENT %d", amount); + log #fmt["INDENT %d", amount]; pending_indentation += amount; } fn top() -> print_stack_elt { let n = vec::len(print_stack); let top: print_stack_elt = {offset: 0, pbreak: broken(inconsistent)}; - if n != 0u { top = print_stack.(n - 1u); } + if n != 0u { top = print_stack[n - 1u]; } ret top; } fn write_str(s: str) { @@ -416,18 +413,18 @@ obj printer(out: io::writer, out.write_str(s); } fn print(x: token, L: int) { - log #fmt("print %s %d (remaining line space=%d)", tok_str(x), L, - space); + log #fmt["print %s %d (remaining line space=%d)", tok_str(x), L, + space]; log buf_str(token, size, left, right, 6u); alt x { BEGIN(b) { if L > space { let col = margin - space + b.offset; - log #fmt("print BEGIN -> push broken block at col %d", col); - print_stack += ~[{offset: col, pbreak: broken(b.breaks)}]; + log #fmt["print BEGIN -> push broken block at col %d", col]; + print_stack += [{offset: col, pbreak: broken(b.breaks)}]; } else { log "print BEGIN -> push fitting block"; - print_stack += ~[{offset: 0, pbreak: fits}]; + print_stack += [{offset: 0, pbreak: fits}]; } } END. { diff --git a/src/comp/syntax/print/pprust.rs b/src/comp/syntax/print/pprust.rs index 0e23928699e..c0e38a3b40e 100644 --- a/src/comp/syntax/print/pprust.rs +++ b/src/comp/syntax/print/pprust.rs @@ -32,7 +32,7 @@ tag ann_node { node_expr(ps, @ast::expr); node_pat(ps, @ast::pat); } -type pp_ann = {pre: fn(&ann_node) , post: fn(&ann_node) }; +type pp_ann = {pre: fn(&ann_node), post: fn(&ann_node)}; fn no_ann() -> pp_ann { fn ignore(_node: &ann_node) { } @@ -49,12 +49,12 @@ type ps = mutable boxes: [pp::breaks], ann: pp_ann}; -fn ibox(s: &ps, u: uint) { s.boxes += ~[pp::inconsistent]; pp::ibox(s.s, u); } +fn ibox(s: &ps, u: uint) { s.boxes += [pp::inconsistent]; pp::ibox(s.s, u); } fn end(s: &ps) { vec::pop(s.boxes); pp::end(s.s); } fn rust_printer(writer: io::writer) -> ps { - let boxes: [pp::breaks] = ~[]; + let boxes: [pp::breaks] = []; ret @{s: pp::mk_printer(writer, default_columns), cm: none::<codemap>, comments: none::<[lexer::cmnt]>, @@ -75,7 +75,7 @@ const default_columns: uint = 78u; // copy forward. fn print_crate(cm: &codemap, crate: @ast::crate, filename: str, in: io::reader, out: io::writer, ann: &pp_ann) { - let boxes: [pp::breaks] = ~[]; + let boxes: [pp::breaks] = []; let r = lexer::gather_comments_and_literals(cm, filename, in); let s = @{s: pp::mk_printer(out, default_columns), @@ -135,12 +135,9 @@ fn attribute_to_str(attr: &ast::attribute) -> str { be to_str(attr, print_attribute); } -fn cbox(s: &ps, u: uint) { s.boxes += ~[pp::consistent]; pp::cbox(s.s, u); } +fn cbox(s: &ps, u: uint) { s.boxes += [pp::consistent]; pp::cbox(s.s, u); } -fn box(s: &ps, u: uint, b: pp::breaks) { - s.boxes += ~[b]; - pp::box(s.s, u, b); -} +fn box(s: &ps, u: uint, b: pp::breaks) { s.boxes += [b]; pp::box(s.s, u, b); } fn nbsp(s: &ps) { word(s.s, " "); } @@ -175,22 +172,16 @@ fn bclose_(s: &ps, span: codemap::span, indented: uint) { fn bclose(s: &ps, span: codemap::span) { bclose_(s, span, indent_unit); } fn is_begin(s: &ps) -> bool { - alt s.s.last_token() { - pp::BEGIN(_) { true } - _ { false } - } + alt s.s.last_token() { pp::BEGIN(_) { true } _ { false } } } fn is_end(s: &ps) -> bool { - alt s.s.last_token() { - pp::END. { true } - _ { false } - } + alt s.s.last_token() { pp::END. { true } _ { false } } } fn is_bol(s: &ps) -> bool { ret s.s.last_token() == pp::EOF || - s.s.last_token() == pp::hardbreak_tok(); + s.s.last_token() == pp::hardbreak_tok(); } fn hardbreak_if_not_bol(s: &ps) { if !is_bol(s) { hardbreak(s.s); } } @@ -218,7 +209,7 @@ fn synth_comment(s: &ps, text: str) { word(s.s, "*/"); } -fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ) { +fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN)) { box(s, 0u, b); let first = true; for elt: IN in elts { @@ -229,8 +220,8 @@ fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) ) { } -fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) , - get_span: fn(&IN) -> codemap::span ) { +fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN), + get_span: fn(&IN) -> codemap::span) { box(s, 0u, b); let len = vec::len::<IN>(elts); let i = 0u; @@ -241,7 +232,7 @@ fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN) , if i < len { word(s.s, ","); maybe_print_trailing_comment(s, get_span(elt), - some(get_span(elts.(i)).hi)); + some(get_span(elts[i]).hi)); space_if_not_bol(s); } } @@ -290,7 +281,7 @@ fn print_type(s: &ps, ty: &@ast::ty) { alt mt.mut { ast::mut. { word_space(s, "mutable"); } ast::maybe_mut. { word_space(s, "mutable?"); } - ast::imm. {} + ast::imm. { } } print_type(s, mt.ty); word(s.s, "]"); @@ -322,9 +313,9 @@ fn print_type(s: &ps, ty: &@ast::ty) { word(s.s, "}"); } ast::ty_tup(elts) { - popen(s); - commasep(s, inconsistent, elts, print_type); - pclose(s); + popen(s); + commasep(s, inconsistent, elts, print_type); + pclose(s); } ast::ty_fn(proto, inputs, output, cf, constrs) { print_ty_fn(s, proto, none::<str>, inputs, output, cf, constrs); @@ -371,6 +362,7 @@ fn print_native_item(s: &ps, item: &@ast::native_item) { } + ast::native_item_fn(lname, decl, typarams) { print_fn(s, decl, ast::proto_fn, item.ident, typarams, decl.constraints); @@ -457,8 +449,8 @@ fn print_item(s: &ps, item: &@ast::item) { ast::item_tag(variants, params) { let newtype = vec::len(variants) == 1u && - str::eq(item.ident, variants.(0).node.name) && - vec::len(variants.(0).node.args) == 1u; + str::eq(item.ident, variants[0].node.name) && + vec::len(variants[0].node.args) == 1u; if newtype { ibox(s, indent_unit); word_space(s, "tag"); @@ -468,7 +460,7 @@ fn print_item(s: &ps, item: &@ast::item) { space(s.s); if newtype { word_space(s, "="); - print_type(s, variants.(0).node.args.(0).ty); + print_type(s, variants[0].node.args[0].ty); word(s.s, ";"); end(s); } else { @@ -509,11 +501,11 @@ fn print_item(s: &ps, item: &@ast::item) { space(s.s); bopen(s); for meth: @ast::method in _obj.methods { - let typarams: [ast::ty_param] = ~[]; + let typarams: [ast::ty_param] = []; hardbreak_if_not_bol(s); maybe_print_comment(s, meth.span.lo); print_fn(s, meth.node.meth.decl, meth.node.meth.proto, - meth.node.ident, typarams, ~[]); + meth.node.ident, typarams, []); word(s.s, " "); print_block(s, meth.node.meth.body); } @@ -524,8 +516,8 @@ fn print_item(s: &ps, item: &@ast::item) { word(s.s, item.ident); print_type_params(s, tps); popen(s); - word_space(s, dt.decl.inputs.(0).ident + ":"); - print_type(s, dt.decl.inputs.(0).ty); + word_space(s, dt.decl.inputs[0].ident + ":"); + print_type(s, dt.decl.inputs[0].ty); pclose(s); space(s.s); print_block(s, dt.body); @@ -620,85 +612,77 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type, // extra semi to make sure the output retains the same meaning. fn maybe_protect_block(s: &ps, last: &option::t<@ast::stmt>, next: &expr_or_stmt) { - let last_expr_is_block = alt last { - option::some(@{node: ast::stmt_expr(e, _), _}) { - alt e.node { - ast::expr_if(_ ,_ ,_) - | ast::expr_alt(_, _) - | ast::expr_block(_) { true } + let last_expr_is_block = + alt last { + option::some(@{node: ast::stmt_expr(e, _), _}) { + alt e.node { + ast::expr_if(_, _, _) | ast::expr_alt(_, _) | + ast::expr_block(_) { + true + } + _ { false } + } + true + } _ { false } - } - true - } - _ { false } - }; + }; if !last_expr_is_block { ret; } - let next_expr_is_ambig = alt next { - expr_(e) { expr_is_ambig(e) } - stmt_(@{node: ast::stmt_expr(e, _), _}) { - expr_is_ambig(e) - } - _ { false } - }; + let next_expr_is_ambig = + alt next { + expr_(e) { expr_is_ambig(e) } + stmt_(@{node: ast::stmt_expr(e, _), _}) { expr_is_ambig(e) } + _ { false } + }; - if last_expr_is_block && next_expr_is_ambig { - word(s.s, ";"); - } + if last_expr_is_block && next_expr_is_ambig { word(s.s, ";"); } fn expr_is_ambig(ex: @ast::expr) -> bool { - // We're going to walk the expression to the 'left' looking for - // various properties that might indicate ambiguity - - type env = @mutable bool; - let visitor = visit::mk_vt(@{ - visit_expr: visit_expr - with *visit::default_visitor() - }); - let env = @mutable false; - visit_expr(ex, env, visitor); - ret *env; - - fn visit_expr(ex: &@ast::expr, e: &env, v: &visit::vt<env>) { - assert *e == false; - - if expr_is_ambig(ex) { - *e = true; - ret; - } - - alt ex.node { - ast::expr_assign(x, _) { v.visit_expr(x, e, v); } - ast::expr_assign_op(_, x, _) { visit_expr(x, e, v); } - ast::expr_move(x, _) { v.visit_expr(x, e, v); } - ast::expr_field(x, _) { v.visit_expr(x, e, v); } - ast::expr_index(x, _) { v.visit_expr(x, e, v); } - ast::expr_binary(op, x, _) { - if need_parens(x, operator_prec(op)) { - *e = true; - ret; + // We're going to walk the expression to the 'left' looking for + // various properties that might indicate ambiguity + + type env = @mutable bool; + let visitor = + visit::mk_vt(@{visit_expr: visit_expr + with *visit::default_visitor()}); + let env = @mutable false; + visit_expr(ex, env, visitor); + ret *env; + + fn visit_expr(ex: &@ast::expr, e: &env, v: &visit::vt<env>) { + assert (*e == false); + + if expr_is_ambig(ex) { *e = true; ret; } + + alt ex.node { + ast::expr_assign(x, _) { v.visit_expr(x, e, v); } + ast::expr_assign_op(_, x, _) { visit_expr(x, e, v); } + ast::expr_move(x, _) { v.visit_expr(x, e, v); } + ast::expr_field(x, _) { v.visit_expr(x, e, v); } + ast::expr_index(x, _) { v.visit_expr(x, e, v); } + ast::expr_binary(op, x, _) { + if need_parens(x, operator_prec(op)) { *e = true; ret; } + v.visit_expr(x, e, v); } - v.visit_expr(x, e, v); - } - ast::expr_cast(x, _) { - if need_parens(x, parse::parser::as_prec) { - *e = true; - ret; + ast::expr_cast(x, _) { + if need_parens(x, parse::parser::as_prec) { + *e = true; + ret; + } } + ast::expr_ternary(x, _, _) { v.visit_expr(x, e, v); } + _ { } } - ast::expr_ternary(x, _, _) { v.visit_expr(x, e, v); } - _ { } - } - } + } - fn expr_is_ambig(ex: @ast::expr) -> bool { - alt ex.node { - ast::expr_unary(_, _) { true } - ast::expr_tup(_) { true } - _ { false } - } - } + fn expr_is_ambig(ex: @ast::expr) -> bool { + alt ex.node { + ast::expr_unary(_, _) { true } + ast::expr_tup(_) { true } + _ { false } + } + } } } } @@ -706,10 +690,8 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type, // ret and fail, without arguments cannot appear is the discriminant of if, // alt, do, & while unambiguously without being parenthesized fn print_maybe_parens_discrim(s: &ps, e: &@ast::expr) { - let disambig = alt e.node { - ast::expr_ret(option::none.) { true } - _ { false } - }; + let disambig = + alt e.node { ast::expr_ret(option::none.) { true } _ { false } }; if disambig { popen(s) } print_expr(s, e); if disambig { pclose(s) } @@ -727,6 +709,7 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, some(_else) { alt _else.node { + // "another else-if" ast::expr_if(i, t, e) { cbox(s, indent_unit - 1u); @@ -738,6 +721,7 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk, do_else(s, e); } + // "final else" ast::expr_block(b) { cbox(s, indent_unit - 1u); @@ -758,10 +742,7 @@ fn print_mac(s: &ps, m: &ast::mac) { ast::mac_invoc(path, arg, body) { word(s.s, "#"); print_path(s, path, false); - alt (arg.node) { - ast::expr_vec(_,_) {} - _ { word(s.s, " "); } - } + alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, " "); } } print_expr(s, arg); // FIXME: extension 'body' } @@ -930,6 +911,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) { bclose_(s, expr.span, alt_indent_unit); } ast::expr_fn(f) { + // If the return type is the magic ty_infer, then we need to // pretty print as a lambda-block if f.decl.output.node == ast::ty_infer { @@ -939,11 +921,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) { ibox(s, 0u); word(s.s, "{"); print_fn_block_args(s, f.decl); - print_possibly_embedded_block(s, f.body, - block_block_fn, indent_unit); + print_possibly_embedded_block(s, f.body, block_block_fn, + indent_unit); } else { head(s, proto_to_str(f.proto)); - print_fn_args_and_ret(s, f.decl, ~[]); + print_fn_args_and_ret(s, f.decl, []); space(s.s); print_block(s, f.body); } @@ -955,10 +937,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) { ibox(s, 0u); print_block(s, blk); } - ast::expr_copy(e) { - word_space(s, "copy"); - print_expr(s, e); - } + ast::expr_copy(e) { word_space(s, "copy"); print_expr(s, e); } ast::expr_move(lhs, rhs) { print_expr(s, lhs); space(s.s); @@ -1070,11 +1049,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) { // Methods for meth: @ast::method in anon_obj.methods { - let typarams: [ast::ty_param] = ~[]; + let typarams: [ast::ty_param] = []; hardbreak_if_not_bol(s); maybe_print_comment(s, meth.span.lo); print_fn(s, meth.node.meth.decl, meth.node.meth.proto, - meth.node.ident, typarams, ~[]); + meth.node.ident, typarams, []); word(s.s, " "); print_block(s, meth.node.meth.body); } @@ -1082,18 +1061,11 @@ fn print_expr(s: &ps, expr: &@ast::expr) { // With object alt anon_obj.inner_obj { none. { } - some(e) { - space(s.s); - word_space(s, "with"); - print_expr(s, e); - } + some(e) { space(s.s); word_space(s, "with"); print_expr(s, e); } } bclose(s, expr.span); } - ast::expr_uniq(expr) { - word(s.s, "~"); - print_expr(s, expr); - } + ast::expr_uniq(expr) { word(s.s, "~"); print_expr(s, expr); } } s.ann.post(ann_node); end(s); @@ -1224,7 +1196,7 @@ fn print_fn(s: &ps, decl: ast::fn_decl, proto: ast::proto, name: str, } fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl, - constrs: [@ast::constr]) { + constrs: [@ast::constr]) { popen(s); fn print_arg(s: &ps, x: &ast::arg) { ibox(s, indent_unit); @@ -1270,7 +1242,7 @@ fn print_kind(s: &ps, kind: ast::kind) { alt kind { ast::kind_unique. { word(s.s, "~"); } ast::kind_shared. { word(s.s, "@"); } - _ { /* fallthrough */ } + _ {/* fallthrough */ } } } @@ -1320,7 +1292,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) { } ast::view_item_import(id, ids, _) { head(s, "import"); - if !str::eq(id, ids.(vec::len(ids) - 1u)) { + if !str::eq(id, ids[vec::len(ids) - 1u]) { word_space(s, id); word_space(s, "="); } @@ -1332,13 +1304,10 @@ fn print_view_item(s: &ps, item: &@ast::view_item) { } ast::view_item_import_from(mod_path, idents, _) { head(s, "import"); - for elt: str in mod_path { - word(s.s, elt); - word(s.s, "::"); - } + for elt: str in mod_path { word(s.s, elt); word(s.s, "::"); } word(s.s, "{"); commasep(s, inconsistent, idents, - fn(s: &ps, w: &ast::import_ident) { + fn (s: &ps, w: &ast::import_ident) { word(s.s, w.node.name) }); word(s.s, "}"); @@ -1354,8 +1323,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) { } ast::view_item_export(ids, _) { head(s, "export"); - commasep(s, inconsistent, ids, - fn(s: &ps, w: &str) { word(s.s, w) }); + commasep(s, inconsistent, ids, fn (s: &ps, w: &str) { word(s.s, w) }); } } word(s.s, ";"); @@ -1377,16 +1345,15 @@ fn operator_prec(op: ast::binop) -> int { fn need_parens(expr: &@ast::expr, outer_prec: int) -> bool { alt expr.node { - ast::expr_binary(op, _, _) { - operator_prec(op) < outer_prec - } + ast::expr_binary(op, _, _) { operator_prec(op) < outer_prec } ast::expr_cast(_, _) { parse::parser::as_prec < outer_prec } - ast::expr_ternary(_, _, _) { - parse::parser::ternary_prec < outer_prec - } + ast::expr_ternary(_, _, _) { parse::parser::ternary_prec < outer_prec } + // This may be too conservative in some cases - ast::expr_assign(_, _) { true } + ast::expr_assign(_, _) { + true + } ast::expr_move(_, _) { true } ast::expr_swap(_, _) { true } ast::expr_assign_op(_, _, _) { true } @@ -1485,7 +1452,7 @@ fn print_remaining_comments(s: &ps) { fn in_cbox(s: &ps) -> bool { let len = vec::len(s.boxes); if len == 0u { ret false; } - ret s.boxes.(len - 1u) == pp::consistent; + ret s.boxes[len - 1u] == pp::consistent; } fn print_literal(s: &ps, lit: &@ast::lit) { @@ -1502,8 +1469,9 @@ fn print_literal(s: &ps, lit: &@ast::lit) { print_string(s, st); } ast::lit_char(ch) { - word(s.s, "'" + escape_str( - str::unsafe_from_bytes(~[ch as u8]), '\'') + "'"); + word(s.s, + "'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') + + "'"); } ast::lit_int(val) { word(s.s, int::str(val)); } ast::lit_uint(val) { word(s.s, uint::str(val) + "u"); } @@ -1530,7 +1498,7 @@ fn next_lit(s: &ps) -> option::t<lexer::lit> { alt s.literals { some(lits) { if s.cur_lit < vec::len(lits) { - ret some(lits.(s.cur_lit)); + ret some(lits[s.cur_lit]); } else { ret none::<lexer::lit>; } } _ { ret none::<lexer::lit>; } @@ -1556,7 +1524,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { lexer::mixed. { assert (vec::len(cmnt.lines) == 1u); zerobreak(s.s); - word(s.s, cmnt.lines.(0)); + word(s.s, cmnt.lines[0]); zerobreak(s.s); } lexer::isolated. { @@ -1571,7 +1539,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { lexer::trailing. { word(s.s, " "); if vec::len(cmnt.lines) == 1u { - word(s.s, cmnt.lines.(0)); + word(s.s, cmnt.lines[0]); hardbreak(s.s); } else { ibox(s, 0u); @@ -1584,10 +1552,11 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) { } lexer::blank_line. { // We need to do at least one, possibly two hardbreaks. - let is_semi = alt s.s.last_token() { - pp::STRING(s, _) { s == ";" } - _ { false } - }; + let is_semi = + alt s.s.last_token() { + pp::STRING(s, _) { s == ";" } + _ { false } + }; if is_semi || is_begin(s) || is_end(s) { hardbreak(s.s) } hardbreak(s.s); } @@ -1605,7 +1574,7 @@ fn escape_str(st: str, to_escape: char) -> str { let len = str::byte_len(st); let i = 0u; while i < len { - alt st.(i) as char { + alt st[i] as char { '\n' { out += "\\n"; } '\t' { out += "\\t"; } '\r' { out += "\\r"; } @@ -1622,7 +1591,7 @@ fn escape_str(st: str, to_escape: char) -> str { ret out; } -fn to_str<T>(t: &T, f: fn(&ps, &T) ) -> str { +fn to_str<T>(t: &T, f: fn(&ps, &T)) -> str { let writer = io::string_writer(); let s = rust_printer(writer.get_writer()); f(s, t); @@ -1634,7 +1603,7 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> { alt s.comments { some(cmnts) { if s.cur_cmnt < vec::len(cmnts) { - ret some(cmnts.(s.cur_cmnt)); + ret some(cmnts[s.cur_cmnt]); } else { ret none::<lexer::cmnt>; } } _ { ret none::<lexer::cmnt>; } @@ -1643,8 +1612,8 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> { // Removing the aliases from the type of f in the next two functions // triggers memory corruption, but I haven't isolated the bug yet. FIXME -fn constr_args_to_str<T>(f: &fn(&T) -> str , - args: &[@ast::sp_constr_arg<T>]) -> str { +fn constr_args_to_str<T>(f: &fn(&T) -> str, args: &[@ast::sp_constr_arg<T>]) + -> str { let comma = false; let s = "("; for a: @ast::sp_constr_arg<T> in args { @@ -1655,8 +1624,8 @@ fn constr_args_to_str<T>(f: &fn(&T) -> str , ret s; } -fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>) - -> str { +fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>) -> + str { alt c { ast::carg_base. { ret "*"; } ast::carg_ident(i) { ret f(i); } @@ -1686,7 +1655,7 @@ fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> str { } fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> str { - decl.inputs.(idx).ident + decl.inputs[idx].ident } fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str { @@ -1696,8 +1665,7 @@ fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str { } // FIXME: fix repeated code -fn ast_fn_constrs_str(decl: &ast::fn_decl, - constrs: &[@ast::constr]) -> str { +fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> str { let s = ""; let colon = true; for c: @ast::constr in constrs { @@ -1717,9 +1685,7 @@ fn proto_to_str(p: &ast::proto) -> str { } fn ty_constr_to_str(c: &@ast::ty_constr) -> str { - fn ty_constr_path_to_str(p: &ast::path) -> str { - "*." + path_to_str(p) - } + fn ty_constr_path_to_str(p: &ast::path) -> str { "*." + path_to_str(p) } ret path_to_str(c.node.path) + constr_args_to_str::<ast::path>(ty_constr_path_to_str, diff --git a/src/comp/syntax/util/interner.rs b/src/comp/syntax/util/interner.rs index 0b80bdd5bfd..31656886a45 100644 --- a/src/comp/syntax/util/interner.rs +++ b/src/comp/syntax/util/interner.rs @@ -18,7 +18,7 @@ type interner<T> = fn mk<@T>(hasher: hashfn<T>, eqer: eqfn<T>) -> interner<T> { let m = map::mk_hashmap::<T, uint>(hasher, eqer); - ret {map: m, mutable vect: ~[], hasher: hasher, eqer: eqer}; + ret {map: m, mutable vect: [], hasher: hasher, eqer: eqer}; } fn intern<@T>(itr: &interner<T>, val: &T) -> uint { @@ -27,13 +27,13 @@ fn intern<@T>(itr: &interner<T>, val: &T) -> uint { none. { let new_idx = vec::len::<T>(itr.vect); itr.map.insert(val, new_idx); - itr.vect += ~[val]; + itr.vect += [val]; ret new_idx; } } } -fn get<T>(itr: &interner<T>, idx: uint) -> T { ret itr.vect.(idx); } +fn get<T>(itr: &interner<T>, idx: uint) -> T { ret itr.vect[idx]; } -fn len<T>(itr : &interner<T>) -> uint { ret vec::len(itr.vect); } +fn len<T>(itr: &interner<T>) -> uint { ret vec::len(itr.vect); } diff --git a/src/comp/syntax/visit.rs b/src/comp/syntax/visit.rs index bd1064af843..350dfc3dd44 100644 --- a/src/comp/syntax/visit.rs +++ b/src/comp/syntax/visit.rs @@ -32,8 +32,7 @@ type visitor<E> = visit_expr: fn(&@expr, &E, &vt<E>), visit_ty: fn(&@ty, &E, &vt<E>), visit_constr: fn(&path, &span, node_id, &E, &vt<E>), - visit_fn: - fn(&_fn, &[ty_param], &span, &fn_ident, node_id, &E, &vt<E>) }; + visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id, &E, &vt<E>)}; fn default_visitor<E>() -> visitor<E> { ret @{visit_mod: bind visit_mod::<E>(_, _, _, _), @@ -104,8 +103,8 @@ fn visit_item<E>(i: &@item, e: &E, v: &vt<E>) { item_obj(ob, _, _) { for f: obj_field in ob.fields { v.visit_ty(f.ty, e, v); } for m: @method in ob.methods { - v.visit_fn(m.node.meth, ~[], m.span, some(m.node.ident), - m.node.id, e, v); + v.visit_fn(m.node.meth, [], m.span, some(m.node.ident), m.node.id, + e, v); } } } @@ -132,9 +131,7 @@ fn visit_ty<E>(t: &@ty, e: &E, v: &vt<E>) { ty_rec(flds) { for f: ty_field in flds { v.visit_ty(f.node.mt.ty, e, v); } } - ty_tup(ts) { - for tt in ts { v.visit_ty(tt, e, v); } - } + ty_tup(ts) { for tt in ts { v.visit_ty(tt, e, v); } } ty_fn(_, args, out, _, constrs) { for a: ty_arg in args { v.visit_ty(a.node.ty, e, v); } for c: @constr in constrs { @@ -174,9 +171,7 @@ fn visit_pat<E>(p: &@pat, e: &E, v: &vt<E>) { pat_rec(fields, _) { for f: field_pat in fields { v.visit_pat(f.pat, e, v); } } - pat_tup(elts) { - for elt in elts { v.visit_pat(elt, e, v); } - } + pat_tup(elts) { for elt in elts { v.visit_pat(elt, e, v); } } pat_box(inner) { v.visit_pat(inner, e, v); } _ { } } @@ -249,9 +244,7 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) { for f: field in flds { v.visit_expr(f.node.expr, e, v); } visit_expr_opt(base, e, v); } - expr_tup(elts) { - for el in elts { v.visit_expr(el, e, v); } - } + expr_tup(elts) { for el in elts { v.visit_expr(el, e, v); } } expr_call(callee, args) { v.visit_expr(callee, e, v); visit_exprs(args, e, v); @@ -291,7 +284,7 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) { v.visit_expr(x, e, v); for a: arm in arms { v.visit_arm(a, e, v); } } - expr_fn(f) { v.visit_fn(f, ~[], ex.span, none, ex.id, e, v); } + expr_fn(f) { v.visit_fn(f, [], ex.span, none, ex.id, e, v); } expr_block(b) { v.visit_block(b, e, v); } expr_assign(a, b) { v.visit_expr(b, e, v); v.visit_expr(a, e, v); } expr_copy(a) { v.visit_expr(a, e, v); } @@ -328,8 +321,8 @@ fn visit_expr<E>(ex: &@expr, e: &E, v: &vt<E>) { some(ex) { v.visit_expr(ex, e, v); } } for m: @method in anon_obj.methods { - v.visit_fn(m.node.meth, ~[], m.span, some(m.node.ident), - m.node.id, e, v); + v.visit_fn(m.node.meth, [], m.span, some(m.node.ident), m.node.id, + e, v); } } expr_mac(mac) { visit_mac(mac, e, v); } @@ -348,20 +341,20 @@ fn visit_arm<E>(a: &arm, e: &E, v: &vt<E>) { type simple_visitor = // takes the components so that one function can be // generic over constr and ty_constr - @{visit_mod: fn(&_mod, &span) , - visit_view_item: fn(&@view_item) , - visit_native_item: fn(&@native_item) , - visit_item: fn(&@item) , - visit_local: fn(&@local) , - visit_block: fn(&ast::blk) , - visit_stmt: fn(&@stmt) , - visit_arm: fn(&arm) , - visit_pat: fn(&@pat) , - visit_decl: fn(&@decl) , - visit_expr: fn(&@expr) , - visit_ty: fn(&@ty) , - visit_constr: fn(&path, &span, node_id) , - visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id) }; + @{visit_mod: fn(&_mod, &span), + visit_view_item: fn(&@view_item), + visit_native_item: fn(&@native_item), + visit_item: fn(&@item), + visit_local: fn(&@local), + visit_block: fn(&ast::blk), + visit_stmt: fn(&@stmt), + visit_arm: fn(&arm), + visit_pat: fn(&@pat), + visit_decl: fn(&@decl), + visit_expr: fn(&@expr), + visit_ty: fn(&@ty), + visit_constr: fn(&path, &span, node_id), + visit_fn: fn(&_fn, &[ty_param], &span, &fn_ident, node_id)}; fn default_simple_visitor() -> simple_visitor { ret @{visit_mod: fn (_m: &_mod, _sp: &span) { }, @@ -384,61 +377,61 @@ fn default_simple_visitor() -> simple_visitor { } fn mk_simple_visitor(v: &simple_visitor) -> vt<()> { - fn v_mod(f: fn(&_mod, &span) , m: &_mod, sp: &span, e: &(), v: &vt<()>) { + fn v_mod(f: fn(&_mod, &span), m: &_mod, sp: &span, e: &(), v: &vt<()>) { f(m, sp); visit_mod(m, sp, e, v); } - fn v_view_item(f: fn(&@view_item) , vi: &@view_item, e: &(), v: &vt<()>) { + fn v_view_item(f: fn(&@view_item), vi: &@view_item, e: &(), v: &vt<()>) { f(vi); visit_view_item(vi, e, v); } - fn v_native_item(f: fn(&@native_item) , ni: &@native_item, e: &(), + fn v_native_item(f: fn(&@native_item), ni: &@native_item, e: &(), v: &vt<()>) { f(ni); visit_native_item(ni, e, v); } - fn v_item(f: fn(&@item) , i: &@item, e: &(), v: &vt<()>) { + fn v_item(f: fn(&@item), i: &@item, e: &(), v: &vt<()>) { f(i); visit_item(i, e, v); } - fn v_local(f: fn(&@local) , l: &@local, e: &(), v: &vt<()>) { + fn v_local(f: fn(&@local), l: &@local, e: &(), v: &vt<()>) { f(l); visit_local(l, e, v); } - fn v_block(f: fn(&ast::blk) , bl: &ast::blk, e: &(), v: &vt<()>) { + fn v_block(f: fn(&ast::blk), bl: &ast::blk, e: &(), v: &vt<()>) { f(bl); visit_block(bl, e, v); } - fn v_stmt(f: fn(&@stmt) , st: &@stmt, e: &(), v: &vt<()>) { + fn v_stmt(f: fn(&@stmt), st: &@stmt, e: &(), v: &vt<()>) { f(st); visit_stmt(st, e, v); } - fn v_arm(f: fn(&arm) , a: &arm, e: &(), v: &vt<()>) { + fn v_arm(f: fn(&arm), a: &arm, e: &(), v: &vt<()>) { f(a); visit_arm(a, e, v); } - fn v_pat(f: fn(&@pat) , p: &@pat, e: &(), v: &vt<()>) { + fn v_pat(f: fn(&@pat), p: &@pat, e: &(), v: &vt<()>) { f(p); visit_pat(p, e, v); } - fn v_decl(f: fn(&@decl) , d: &@decl, e: &(), v: &vt<()>) { + fn v_decl(f: fn(&@decl), d: &@decl, e: &(), v: &vt<()>) { f(d); visit_decl(d, e, v); } - fn v_expr(f: fn(&@expr) , ex: &@expr, e: &(), v: &vt<()>) { + fn v_expr(f: fn(&@expr), ex: &@expr, e: &(), v: &vt<()>) { f(ex); visit_expr(ex, e, v); } - fn v_ty(f: fn(&@ty) , ty: &@ty, e: &(), v: &vt<()>) { + fn v_ty(f: fn(&@ty), ty: &@ty, e: &(), v: &vt<()>) { f(ty); visit_ty(ty, e, v); } - fn v_constr(f: fn(&path, &span, node_id) , pt: &path, sp: &span, + fn v_constr(f: fn(&path, &span, node_id), pt: &path, sp: &span, id: node_id, e: &(), v: &vt<()>) { f(pt, sp, id); visit_constr(pt, sp, id, e, v); } - fn v_fn(f: fn(&_fn, &[ty_param], &span, &fn_ident, node_id) , ff: &_fn, + fn v_fn(f: fn(&_fn, &[ty_param], &span, &fn_ident, node_id), ff: &_fn, tps: &[ty_param], sp: &span, ident: &fn_ident, id: node_id, e: &(), v: &vt<()>) { f(ff, tps, sp, ident, id); diff --git a/src/comp/util/common.rs b/src/comp/util/common.rs index 984e047834b..ddd12d77229 100644 --- a/src/comp/util/common.rs +++ b/src/comp/util/common.rs @@ -50,8 +50,8 @@ fn new_def_hash<@V>() -> std::map::hashmap<ast::def_id, V> { fn field_expr(f: &ast::field) -> @ast::expr { ret f.node.expr; } fn field_exprs(fields: &[ast::field]) -> [@ast::expr] { - let es = ~[]; - for f: ast::field in fields { es += ~[f.node.expr]; } + let es = []; + for f: ast::field in fields { es += [f.node.expr]; } ret es; } @@ -160,8 +160,7 @@ fn is_main_name(path: &[str]) -> bool { // FIXME mode this to std::float when editing the stdlib no longer // requires a snapshot fn float_to_str(num: float, digits: uint) -> str { - let accum = if num < 0.0 { num = -num; "-" } - else { "" }; + let accum = if num < 0.0 { num = -num; "-" } else { "" }; let trunc = num as uint; let frac = num - (trunc as float); accum += uint::str(trunc); diff --git a/src/comp/util/ppaux.rs b/src/comp/util/ppaux.rs index a1c0c145681..5a71005acc2 100644 --- a/src/comp/util/ppaux.rs +++ b/src/comp/util/ppaux.rs @@ -38,7 +38,7 @@ fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> str { } fn get_id_ident(cx: &ctxt, id: ast::def_id) -> str { - if (id.crate != ast::local_crate) { + if id.crate != ast::local_crate { str::connect(cx.ext_map.get(id), "::") } else { alt cx.items.find(id.node) { @@ -60,8 +60,8 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> str { let s = proto_to_str(proto); alt ident { some(i) { s += " "; s += i; } _ { } } s += "("; - let strs = ~[]; - for a: arg in inputs { strs += ~[fn_input_to_str(cx, a)]; } + let strs = []; + for a: arg in inputs { strs += [fn_input_to_str(cx, a)]; } s += str::connect(strs, ", "); s += ")"; if struct(cx, output) != ty_nil { @@ -91,60 +91,59 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> str { } alt cname(cx, typ) { some(cs) { ret cs; } _ { } } ret alt struct(cx, typ) { - ty_native(_) { "native" } - ty_nil. { "()" } - ty_bot. { "_|_" } - ty_bool. { "bool" } - ty_int. { "int" } - ty_float. { "float" } - ty_uint. { "uint" } - ty_machine(tm) { ty_mach_to_str(tm) } - ty_char. { "char" } - ty_str. { "str" } - ty_istr. { "istr" } - ty_box(tm) { "@" + mt_to_str(cx, tm) } - ty_uniq(t) { "~" + ty_to_str(cx, t) } - ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" } - ty_type. { "type" } - ty_rec(elems) { - let strs: [str] = ~[]; - for fld: field in elems { strs += ~[field_to_str(cx, fld)]; } - "{" + str::connect(strs, ",") + "}" - } - ty_tup(elems) { - let strs = ~[]; - for elem in elems { strs += ~[ty_to_str(cx, elem)]; } - "(" + str::connect(strs, ",") + ")" - } - ty_tag(id, tps) { - let s = get_id_ident(cx, id); - if vec::len::<t>(tps) > 0u { - let strs: [str] = ~[]; - for typ: t in tps { strs += ~[ty_to_str(cx, typ)]; } - s += "[" + str::connect(strs, ",") + "]"; + ty_native(_) { "native" } + ty_nil. { "()" } + ty_bot. { "_|_" } + ty_bool. { "bool" } + ty_int. { "int" } + ty_float. { "float" } + ty_uint. { "uint" } + ty_machine(tm) { ty_mach_to_str(tm) } + ty_char. { "char" } + ty_str. { "str" } + ty_istr. { "istr" } + ty_box(tm) { "@" + mt_to_str(cx, tm) } + ty_uniq(t) { "~" + ty_to_str(cx, t) } + ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" } + ty_type. { "type" } + ty_rec(elems) { + let strs: [str] = []; + for fld: field in elems { strs += [field_to_str(cx, fld)]; } + "{" + str::connect(strs, ",") + "}" + } + ty_tup(elems) { + let strs = []; + for elem in elems { strs += [ty_to_str(cx, elem)]; } + "(" + str::connect(strs, ",") + ")" + } + ty_tag(id, tps) { + let s = get_id_ident(cx, id); + if vec::len::<t>(tps) > 0u { + let strs: [str] = []; + for typ: t in tps { strs += [ty_to_str(cx, typ)]; } + s += "[" + str::connect(strs, ",") + "]"; + } + s + } + ty_fn(proto, inputs, output, cf, constrs) { + fn_to_str(cx, proto, none, inputs, output, cf, constrs) + } + ty_native_fn(_, inputs, output) { + fn_to_str(cx, ast::proto_fn, none, inputs, output, ast::return, + []) + } + ty_obj(meths) { + let strs = []; + for m: method in meths { strs += [method_to_str(cx, m)]; } + "obj {\n\t" + str::connect(strs, "\n\t") + "\n}" + } + ty_res(id, _, _) { get_id_ident(cx, id) } + ty_var(v) { "<T" + int::str(v) + ">" } + ty_param(id, _) { + "'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)]) + } + _ { ty_to_short_str(cx, typ) } } - s - } - ty_fn(proto, inputs, output, cf, constrs) { - fn_to_str(cx, proto, none, inputs, output, cf, constrs) - } - ty_native_fn(_, inputs, output) { - fn_to_str(cx, ast::proto_fn, none, inputs, output, ast::return, ~[]) - } - ty_obj(meths) { - let strs = ~[]; - for m: method in meths { strs += ~[method_to_str(cx, m)]; } - "obj {\n\t" + str::connect(strs, "\n\t") + "\n}" - } - ty_res(id, _, _) { - get_id_ident(cx, id) - } - ty_var(v) { "<T" + int::str(v) + ">" } - ty_param(id,_) { - "'" + str::unsafe_from_bytes(~[('a' as u8) + (id as u8)]) - } - _ { ty_to_short_str(cx, typ) } - } } fn ty_to_short_str(cx: &ctxt, typ: t) -> str { diff --git a/src/fuzzer/ast_match.rs b/src/fuzzer/ast_match.rs index ebd3bf339bb..de8696baf3f 100644 --- a/src/fuzzer/ast_match.rs +++ b/src/fuzzer/ast_match.rs @@ -1,13 +1,13 @@ use std; import std::vec; -fn vec_equal<T>(v: &[T], u: &[T], element_equality_test: fn(&T, &T) -> bool ) +fn vec_equal<T>(v: &[T], u: &[T], element_equality_test: fn(&T, &T) -> bool) -> bool { let Lv = vec::len(v); if Lv != vec::len(u) { ret false; } let i = 0u; while i < Lv { - if !element_equality_test(v.(i), u.(i)) { ret false; } + if !element_equality_test(v[i], u[i]) { ret false; } i += 1u; } ret true; @@ -18,10 +18,10 @@ fn builtin_equal<T>(a: &T, b: &T) -> bool { ret a == b; } fn main() { assert (builtin_equal(5, 5)); assert (!builtin_equal(5, 4)); - assert (!vec_equal(~[5, 5], ~[5], builtin_equal)); - assert (!vec_equal(~[5, 5], ~[5, 4], builtin_equal)); - assert (!vec_equal(~[5, 5], ~[4, 5], builtin_equal)); - assert (vec_equal(~[5, 5], ~[5, 5], builtin_equal)); + assert (!vec_equal([5, 5], [5], builtin_equal)); + assert (!vec_equal([5, 5], [5, 4], builtin_equal)); + assert (!vec_equal([5, 5], [4, 5], builtin_equal)); + assert (vec_equal([5, 5], [5, 5], builtin_equal)); log_err "Pass"; } diff --git a/src/fuzzer/fuzzer.rs b/src/fuzzer/fuzzer.rs index a9f4c96cdb2..d9c3f979e39 100644 --- a/src/fuzzer/fuzzer.rs +++ b/src/fuzzer/fuzzer.rs @@ -21,11 +21,9 @@ import rustc::syntax::parse::parser; import rustc::syntax::print::pprust; fn write_file(filename: &str, content: &str) { - io::file_writer(filename, - ~[io::create, - io::truncate]).write_str(content); + io::file_writer(filename, [io::create, io::truncate]).write_str(content); // Work around https://github.com/graydon/rust/issues/726 - std::run::run_program("chmod", ~["644", filename]); + std::run::run_program("chmod", ["644", filename]); } fn file_contains(filename: &str, needle: &str) -> bool { @@ -41,9 +39,8 @@ fn find_rust_files(files: &mutable [str], path: str) { if str::ends_with(path, ".rs") { if file_contains(path, "xfail-stage1") { //log_err "Skipping " + path + " because it is marked as xfail-stage1"; - } else { files += ~[path]; } - } else if (fs::file_is_dir(path) && str::find(path, "compile-fail") == -1) - { + } else { files += [path]; } + } else if fs::file_is_dir(path) && str::find(path, "compile-fail") == -1 { for p in fs::list_dir(path) { find_rust_files(files, p); } } } @@ -51,6 +48,7 @@ fn find_rust_files(files: &mutable [str], path: str) { fn safe_to_steal(e: ast::expr_) -> bool { alt e { + // pretty-printer precedence issues -- https://github.com/graydon/rust/issues/670 ast::expr_unary(_, _) { false @@ -73,13 +71,23 @@ fn safe_to_steal(e: ast::expr_) -> bool { ast::expr_binary(_, _, _) { false } ast::expr_assign(_, _) { false } ast::expr_assign_op(_, _, _) { false } - ast::expr_fail(option::none.) { false /* https://github.com/graydon/rust/issues/764 */ } + ast::expr_fail(option::none.) { + false + /* https://github.com/graydon/rust/issues/764 */ + + } ast::expr_ret(option::none.) { false } ast::expr_put(option::none.) { false } - ast::expr_ret(_) { false /* lots of code generation issues, such as https://github.com/graydon/rust/issues/770 */ } + + ast::expr_ret(_) { + false + /* lots of code generation issues, such as https://github.com/graydon/rust/issues/770 */ + + } ast::expr_fail(_) { false } + _ { true } @@ -87,17 +95,17 @@ fn safe_to_steal(e: ast::expr_) -> bool { } fn steal_exprs(crate: &ast::crate) -> [ast::expr] { - let exprs: @mutable [ast::expr] = @mutable ~[]; + let exprs: @mutable [ast::expr] = @mutable []; // "Stash" is not type-parameterized because of the need for safe_to_steal fn stash_expr(es: @mutable [ast::expr], e: &@ast::expr) { if safe_to_steal(e.node) { - *es += ~[*e]; + *es += [*e]; } else {/* now my indices are wrong :( */ } } - let v = visit::mk_simple_visitor - (@{visit_expr: bind stash_expr(exprs, _) - with *visit::default_simple_visitor()}); - visit::visit_crate(crate, (), v); + let v = + visit::mk_simple_visitor(@{visit_expr: bind stash_expr(exprs, _) + with *visit::default_simple_visitor()}); + visit::visit_crate(crate, (), v);; *exprs } @@ -128,6 +136,7 @@ fn replace_expr_in_crate(crate: &ast::crate, i: uint, newexpr: ast::expr_) -> let af = fold::make_fold(afp); let crate2: @ast::crate = @af.fold_crate(crate); fold::dummy_out(af); // work around a leak (https://github.com/graydon/rust/issues/651) + ; *crate2 } @@ -138,26 +147,28 @@ iter under(n: uint) -> uint { fn devnull() -> io::writer { std::io::string_writer().get_writer() } -fn as_str(f: fn(io::writer) ) -> str { +fn as_str(f: fn(io::writer)) -> str { let w = std::io::string_writer(); f(w.get_writer()); ret w.get_str(); } -fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, filename: &str) { +fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, + filename: &str) { let exprs = steal_exprs(crate); let exprsL = vec::len(exprs); - if (exprsL < 100u) { + if exprsL < 100u { for each i: uint in under(uint::min(exprsL, 20u)) { - log_err "Replacing... " + pprust::expr_to_str(@exprs.(i)); + log_err "Replacing... " + pprust::expr_to_str(@exprs[i]); for each j: uint in under(uint::min(exprsL, 5u)) { - log_err "With... " + pprust::expr_to_str(@exprs.(j)); - let crate2 = @replace_expr_in_crate(crate, i, exprs.(j).node); + log_err "With... " + pprust::expr_to_str(@exprs[j]); + let crate2 = @replace_expr_in_crate(crate, i, exprs[j].node); // It would be best to test the *crate* for stability, but testing the // string for stability is easier and ok for now. - let str3 = as_str(bind pprust::print_crate(codemap, crate2, filename, - io::string_reader(""), _, - pprust::no_ann())); + let str3 = + as_str(bind pprust::print_crate(codemap, crate2, filename, + io::string_reader(""), _, + pprust::no_ann())); // 1u would be sane here, but the pretty-printer currently has lots of whitespace and paren issues, // and https://github.com/graydon/rust/issues/766 is hilarious. check_roundtrip_convergence(str3, 7u); @@ -174,37 +185,52 @@ fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap, filenam fn check_whole_compiler(code: &str) { let filename = "test.rs"; write_file(filename, code); - let p = std::run::program_output("/Users/jruderman/code/rust/build/stage1/rustc", ~["-c", filename]); + let p = + std::run::program_output("/Users/jruderman/code/rust/build/stage1/rustc", + ["-c", filename]); + //log_err #fmt("Status: %d", p.status); //log_err "Output: " + p.out; if p.err != "" { if contains(p.err, "argument of incompatible type") { log_err "https://github.com/graydon/rust/issues/769"; - } else if contains(p.err, "Cannot create binary operator with two operands of differing type") { + } else if contains(p.err, + "Cannot create binary operator with two operands of differing type") + { log_err "https://github.com/graydon/rust/issues/770"; } else if contains(p.err, "May only branch on boolean predicates!") { log_err "https://github.com/graydon/rust/issues/770 or https://github.com/graydon/rust/issues/776"; - } else if contains(p.err, "Invalid constantexpr cast!") && contains(code, "!") { + } else if contains(p.err, "Invalid constantexpr cast!") && + contains(code, "!") { log_err "https://github.com/graydon/rust/issues/777"; - } else if contains(p.err, "Both operands to ICmp instruction are not of the same type!") && contains(code, "!") { + } else if contains(p.err, + "Both operands to ICmp instruction are not of the same type!") + && contains(code, "!") { log_err "https://github.com/graydon/rust/issues/777 #issuecomment-1678487"; - } else if contains(p.err, "Ptr must be a pointer to Val type!") && contains(code, "!") { + } else if contains(p.err, "Ptr must be a pointer to Val type!") && + contains(code, "!") { log_err "https://github.com/graydon/rust/issues/779"; - } else if contains(p.err, "Calling a function with bad signature!") && (contains(code, "iter") || contains(code, "range")) { + } else if contains(p.err, "Calling a function with bad signature!") && + (contains(code, "iter") || contains(code, "range")) { log_err "https://github.com/graydon/rust/issues/771 - calling an iter fails"; - } else if contains(p.err, "Calling a function with a bad signature!") && contains(code, "empty") { + } else if contains(p.err, "Calling a function with a bad signature!") + && contains(code, "empty") { log_err "https://github.com/graydon/rust/issues/775 - possibly a modification of run-pass/import-glob-crate.rs"; - } else if contains(p.err, "Invalid type for pointer element!") && contains(code, "put") { + } else if contains(p.err, "Invalid type for pointer element!") && + contains(code, "put") { log_err "https://github.com/graydon/rust/issues/773 - put put ()"; - } else if contains(p.err, "pointer being freed was not allocated") && contains(p.out, "Out of stack space, sorry") { + } else if contains(p.err, "pointer being freed was not allocated") && + contains(p.out, "Out of stack space, sorry") { log_err "https://github.com/graydon/rust/issues/768 + https://github.com/graydon/rust/issues/778" } else { log_err "Stderr: " + p.err; fail "Unfamiliar error message"; } - } else if contains(p.out, "non-exhaustive match failure") && contains(p.out, "alias.rs") { + } else if contains(p.out, "non-exhaustive match failure") && + contains(p.out, "alias.rs") { log_err "https://github.com/graydon/rust/issues/772"; - } else if contains(p.out, "non-exhaustive match failure") && contains(p.out, "trans.rs") && contains(code, "put") { + } else if contains(p.out, "non-exhaustive match failure") && + contains(p.out, "trans.rs") && contains(code, "put") { log_err "https://github.com/graydon/rust/issues/774"; } else if contains(p.out, "Out of stack space, sorry") { log_err "Possibly a variant of https://github.com/graydon/rust/issues/768"; @@ -214,74 +240,64 @@ fn check_whole_compiler(code: &str) { } } else if p.status == 11 { log_err "What is this I don't even"; - } else if p.status != 0 { - fail "Unfamiliar status code"; - } + } else if p.status != 0 { fail "Unfamiliar status code"; } } fn parse_and_print(code: &str) -> str { let filename = "tmp.rs"; let sess = @{cm: codemap::new_codemap(), mutable next_id: 0}; //write_file(filename, code); - let crate = - parser::parse_crate_from_source_str(filename, code, ~[], sess); + let crate = parser::parse_crate_from_source_str(filename, code, [], sess); ret as_str(bind pprust::print_crate(sess.cm, crate, filename, io::string_reader(code), _, pprust::no_ann())); } fn content_is_dangerous_to_modify(code: &str) -> bool { - let dangerous_patterns = [ - "obj", // not safe to steal; https://github.com/graydon/rust/issues/761 + let dangerous_patterns = + ["obj", // not safe to steal; https://github.com/graydon/rust/issues/761 "#macro", // not safe to steal things inside of it, because they have a special syntax "#", // strange representation of the arguments to #fmt, for example " be ", // don't want to replace its child with a non-call: "Non-call expression in tail call" - "@" // hangs when compiling: https://github.com/graydon/rust/issues/768 - ]; + "@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768 for p: str in dangerous_patterns { if contains(code, p) { ret true; } } ret false; } -fn content_is_confusing(code: &str) -> bool { - let // https://github.com/graydon/rust/issues/671 - // https://github.com/graydon/rust/issues/669 - // https://github.com/graydon/rust/issues/669 - // https://github.com/graydon/rust/issues/669 - // crazy rules enforced by parser rather than typechecker? - // more precedence issues - // more precedence issues? - confusing_patterns = +fn content_is_confusing(code: &str) -> + bool { // https://github.com/graydon/rust/issues/671 + // https://github.com/graydon/rust/issues/669 + // https://github.com/graydon/rust/issues/669 + // https://github.com/graydon/rust/issues/669 + // crazy rules enforced by parser rather than typechecker? + // more precedence issues + // more precedence issues? + + let confusing_patterns = ["#macro", "][]", "][mutable]", "][mutable ]", "self", "spawn", - "bind", - "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759 + "bind", "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759 " : ", // https://github.com/graydon/rust/issues/760 - "if ret", - "alt ret", - "if fail", - "alt fail" - ]; + "if ret", "alt ret", "if fail", "alt fail"]; for p: str in confusing_patterns { if contains(code, p) { ret true; } } ret false; } fn file_is_confusing(filename: &str) -> bool { - let - // https://github.com/graydon/rust/issues/674 + // https://github.com/graydon/rust/issues/674 - // something to do with () as a lone pattern + // something to do with () as a lone pattern - // an issue where -2147483648 gains an - // extra negative sign each time through, - // which i can't reproduce using "rustc - // --pretty normal"??? - confusing_files = + // an issue where -2147483648 gains an + // extra negative sign each time through, + // which i can't reproduce using "rustc + // --pretty normal"??? + let confusing_files = ["block-expr-precedence.rs", "nil-pattern.rs", "syntax-extension-fmt.rs", - "newtype.rs" // modifying it hits something like https://github.com/graydon/rust/issues/670 - ]; + "newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670 for f in confusing_files { if contains(filename, f) { ret true; } } @@ -303,23 +319,25 @@ fn check_roundtrip_convergence(code: &str, maxIters: uint) { } if old == new { - log_err #fmt("Converged after %u iterations", i); + log_err #fmt["Converged after %u iterations", i]; } else { - log_err #fmt("Did not converge after %u iterations!", i); + log_err #fmt["Did not converge after %u iterations!", i]; write_file("round-trip-a.rs", old); write_file("round-trip-b.rs", new); - std::run::run_program("diff", ~["-w", "-u", "round-trip-a.rs", "round-trip-b.rs"]); + std::run::run_program("diff", + ["-w", "-u", "round-trip-a.rs", + "round-trip-b.rs"]); fail "Mismatch"; } } fn check_convergence(files: &[str]) { - log_err #fmt("pp convergence tests: %u files", vec::len(files)); + log_err #fmt["pp convergence tests: %u files", vec::len(files)]; for file in files { if !file_is_confusing(file) { let s = io::read_whole_file_str(file); if !content_is_confusing(s) { - log_err #fmt("pp converge: %s", file); + log_err #fmt["pp converge: %s", file]; // Change from 7u to 2u when https://github.com/graydon/rust/issues/759 is fixed check_roundtrip_convergence(s, 7u); } @@ -331,13 +349,16 @@ fn check_variants(files: &[str]) { for file in files { if !file_is_confusing(file) { let s = io::read_whole_file_str(file); - if content_is_dangerous_to_modify(s) || content_is_confusing(s) { cont; } + if content_is_dangerous_to_modify(s) || content_is_confusing(s) { + cont; + } log_err "check_variants: " + file; let sess = @{cm: codemap::new_codemap(), mutable next_id: 0}; - let crate = parser::parse_crate_from_source_str(file, s, ~[], sess); + let crate = + parser::parse_crate_from_source_str(file, s, [], sess); log_err as_str(bind pprust::print_crate(sess.cm, crate, file, - io::string_reader(s), _, - pprust::no_ann())); + io::string_reader(s), _, + pprust::no_ann())); check_variants_of_ast(*crate, sess.cm, file); } } @@ -345,11 +366,11 @@ fn check_variants(files: &[str]) { fn main(args: [str]) { if vec::len(args) != 2u { - log_err #fmt("usage: %s <testdir>", args.(0)); + log_err #fmt["usage: %s <testdir>", args[0]]; ret; } - let files = ~[]; - let root = args.(1); + let files = []; + let root = args[1]; find_rust_files(files, root); check_convergence(files); diff --git a/src/fuzzer/ivec_fuzz.rs b/src/fuzzer/ivec_fuzz.rs index 2d6c51c4225..3dd24875c52 100644 --- a/src/fuzzer/ivec_fuzz.rs +++ b/src/fuzzer/ivec_fuzz.rs @@ -32,19 +32,19 @@ fn vec_omit<T>(v: &[T], i: uint) -> [T] { slice(v, 0u, i) + slice(v, i + 1u, len(v)) } fn vec_dup<T>(v: &[T], i: uint) -> [T] { - slice(v, 0u, i) + ~[v.(i)] + slice(v, i, len(v)) + slice(v, 0u, i) + [v[i]] + slice(v, i, len(v)) } fn vec_swadj<T>(v: &[T], i: uint) -> [T] { - slice(v, 0u, i) + ~[v.(i + 1u), v.(i)] + slice(v, i + 2u, len(v)) + slice(v, 0u, i) + [v[i + 1u], v[i]] + slice(v, i + 2u, len(v)) } fn vec_prefix<T>(v: &[T], i: uint) -> [T] { slice(v, 0u, i) } fn vec_suffix<T>(v: &[T], i: uint) -> [T] { slice(v, i, len(v)) } fn vec_poke<T>(v: &[T], i: uint, x: &T) -> [T] { - slice(v, 0u, i) + ~[x] + slice(v, i + 1u, len(v)) + slice(v, 0u, i) + [x] + slice(v, i + 1u, len(v)) } fn vec_insert<T>(v: &[T], i: uint, x: &T) -> [T] { - slice(v, 0u, i) + ~[x] + slice(v, i, len(v)) + slice(v, 0u, i) + [x] + slice(v, i, len(v)) } // Iterates over 0...length, skipping the specified number on each side. @@ -55,28 +55,28 @@ iter ix(skip_low: uint, skip_high: uint, length: uint) -> uint { // Returns a bunch of modified versions of v, some of which introduce new elements (borrowed from xs). fn vec_edits<T>(v: &[T], xs: &[T]) -> [[T]] { - let edits: [[T]] = ~[]; + let edits: [[T]] = []; let Lv: uint = len(v); if Lv != 1u { edits += - ~[~[]]; // When Lv == 1u, this is redundant with omit - //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; } + [[]]; // When Lv == 1u, this is redundant with omit + //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; } - } - for each i: uint in ix(0u, 1u, Lv) { edits += ~[vec_omit(v, i)]; } - for each i: uint in ix(0u, 1u, Lv) { edits += ~[vec_dup(v, i)]; } - for each i: uint in ix(0u, 2u, Lv) { edits += ~[vec_swadj(v, i)]; } - for each i: uint in ix(1u, 2u, Lv) { edits += ~[vec_prefix(v, i)]; } - for each i: uint in ix(2u, 1u, Lv) { edits += ~[vec_suffix(v, i)]; } + } + for each i: uint in ix(0u, 1u, Lv) { edits += [vec_omit(v, i)]; } + for each i: uint in ix(0u, 1u, Lv) { edits += [vec_dup(v, i)]; } + for each i: uint in ix(0u, 2u, Lv) { edits += [vec_swadj(v, i)]; } + for each i: uint in ix(1u, 2u, Lv) { edits += [vec_prefix(v, i)]; } + for each i: uint in ix(2u, 1u, Lv) { edits += [vec_suffix(v, i)]; } for each j: uint in ix(0u, 1u, len(xs)) { for each i: uint in ix(0u, 1u, Lv) { - edits += ~[vec_poke(v, i, xs.(j))]; + edits += [vec_poke(v, i, xs[j])]; } for each i: uint in ix(0u, 0u, Lv) { - edits += ~[vec_insert(v, i, xs.(j))]; + edits += [vec_insert(v, i, xs[j])]; } } @@ -89,7 +89,7 @@ fn vec_to_str(v: &[int]) -> str { let i = 0u; let s = "["; while i < len(v) { - s += int::str(v.(i)); + s += int::str(v[i]); if i + 1u < len(v) { s += ", " } i += 1u; } @@ -99,16 +99,16 @@ fn vec_to_str(v: &[int]) -> str { fn show_edits(a: &[int], xs: &[int]) { log_err "=== Edits of " + vec_to_str(a) + " ==="; let b = vec_edits(a, xs); - for each i: uint in ix(0u, 1u, len(b)) { log_err vec_to_str(b.(i)); } + for each i: uint in ix(0u, 1u, len(b)) { log_err vec_to_str(b[i]); } } fn demo_edits() { - let xs = ~[7, 8]; - show_edits(~[], xs); - show_edits(~[1], xs); - show_edits(~[1, 2], xs); - show_edits(~[1, 2, 3], xs); - show_edits(~[1, 2, 3, 4], xs); + let xs = [7, 8]; + show_edits([], xs); + show_edits([1], xs); + show_edits([1, 2], xs); + show_edits([1, 2, 3], xs); + show_edits([1, 2, 3, 4], xs); } fn main() { demo_edits(); } diff --git a/src/lib/aio.rs b/src/lib/aio.rs index fc10e40a327..c2e9c13dc89 100644 --- a/src/lib/aio.rs +++ b/src/lib/aio.rs @@ -28,26 +28,17 @@ native "rust" mod rustrt { // currently in the sendable kind, so we'll unsafely cast between ints. type server = rustrt::server; type client = rustrt::socket; -tag pending_connection { - remote(net::ip_addr,int); - incoming(server); -} +tag pending_connection { remote(net::ip_addr, int); incoming(server); } -tag socket_event { - connected(client); - closed; - received([u8]); -} +tag socket_event { connected(client); closed; received([u8]); } -tag server_event { - pending(_chan<_chan<socket_event>>); -} +tag server_event { pending(_chan<_chan<socket_event>>); } tag request { quit; - connect(pending_connection,_chan<socket_event>); - serve(net::ip_addr,int,_chan<server_event>,_chan<server>); - write(client,[u8],_chan<bool>); + connect(pending_connection, _chan<socket_event>); + serve(net::ip_addr, int, _chan<server_event>, _chan<server>); + write(client, [u8], _chan<bool>); close_server(server, _chan<bool>); close_client(client); } @@ -74,12 +65,12 @@ fn new_client(client: client, evt: _chan<socket_event>) { send(evt, connected(client)); - while (true) { + while true { log "waiting for bytes"; let data: [u8] = reader.recv(); log "got some bytes"; log vec::len::<u8>(data); - if (vec::len::<u8>(data) == 0u) { + if vec::len::<u8>(data) == 0u { log "got empty buffer, bailing"; break; } @@ -104,19 +95,17 @@ fn accept_task(client: client, events: _chan<server_event>) { fn server_task(ip: net::ip_addr, portnum: int, events: _chan<server_event>, server: _chan<server>) { let accepter: _port<client> = mk_port(); - send(server, rustrt::aio_serve(ip_to_sbuf(ip), portnum, - accepter.mk_chan())); + send(server, + rustrt::aio_serve(ip_to_sbuf(ip), portnum, accepter.mk_chan())); let client: client; - while (true) { + while true { log "preparing to accept a client"; client = accepter.recv(); - if (rustrt::aio_is_null_client(client)) { - log "client was actually null, returning"; - ret; - } else { - task::_spawn(bind accept_task(client, events)); - } + if rustrt::aio_is_null_client(client) { + log "client was actually null, returning"; + ret; + } else { task::_spawn(bind accept_task(client, events)); } } } @@ -128,7 +117,7 @@ fn request_task(c: _chan<ctx>) { log "uv run task spawned"; // Spin for requests let req: request; - while (true) { + while true { req = p.recv(); alt req { quit. { @@ -137,20 +126,19 @@ fn request_task(c: _chan<ctx>) { rustrt::aio_stop(); ret; } - connect(remote(ip,portnum),client) { + connect(remote(ip, portnum), client) { task::_spawn(bind connect_task(ip, portnum, client)); } - serve(ip,portnum,events,server) { + serve(ip, portnum, events, server) { task::_spawn(bind server_task(ip, portnum, events, server)); } - write(socket,v,status) { - rustrt::aio_writedata(socket, - vec::to_ptr::<u8>(v), vec::len::<u8>(v), - status); + write(socket, v, status) { + rustrt::aio_writedata(socket, vec::to_ptr::<u8>(v), + vec::len::<u8>(v), status); } - close_server(server,status) { + close_server(server, status) { log "closing server"; - rustrt::aio_close_server(server,status); + rustrt::aio_close_server(server, status); } close_client(client) { log "closing client"; diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs index c42ef07bfb2..019aa32f36a 100644 --- a/src/lib/bitv.rs +++ b/src/lib/bitv.rs @@ -35,16 +35,16 @@ fn create(nbits: uint, init: bool) -> t { ret @{storage: storage, nbits: nbits}; } -fn process(op: &block(uint, uint) -> uint , v0: &t, v1: &t) -> bool { +fn process(op: &block(uint, uint) -> uint, v0: &t, v1: &t) -> bool { let len = vec::len(v1.storage); assert (vec::len(v0.storage) == len); assert (v0.nbits == v1.nbits); let changed = false; for each i: uint in uint::range(0u, len) { - let w0 = v0.storage.(i); - let w1 = v1.storage.(i); + let w0 = v0.storage[i]; + let w1 = v1.storage[i]; let w = op(w0, w1); - if w0 != w { changed = true; v0.storage.(i) = w; } + if w0 != w { changed = true; v0.storage[i] = w; } } ret changed; } @@ -70,7 +70,7 @@ fn assign(v0: &t, v1: t) -> bool { fn clone(v: t) -> t { let storage = vec::init_elt_mut::<uint>(0u, v.nbits / uint_bits() + 1u); let len = vec::len(v.storage); - for each i: uint in uint::range(0u, len) { storage.(i) = v.storage.(i); } + for each i: uint in uint::range(0u, len) { storage[i] = v.storage[i]; } ret @{storage: storage, nbits: v.nbits}; } @@ -79,7 +79,7 @@ fn get(v: &t, i: uint) -> bool { let bits = uint_bits(); let w = i / bits; let b = i % bits; - let x = 1u & v.storage.(w) >> b; + let x = 1u & v.storage[w] >> b; ret x == 1u; } @@ -90,7 +90,7 @@ fn equal(v0: &t, v1: &t) -> bool { let len = vec::len(v1.storage); let i = 0u; while i < len { - if v0.storage.(i) != v1.storage.(i) { ret false; } + if v0.storage[i] != v1.storage[i] { ret false; } i = i + 1u; } ret true; @@ -98,7 +98,7 @@ fn equal(v0: &t, v1: &t) -> bool { fn clear(v: &t) { for each i: uint in uint::range(0u, vec::len(v.storage)) { - v.storage.(i) = 0u; + v.storage[i] = 0u; } } @@ -108,7 +108,7 @@ fn set_all(v: &t) { fn invert(v: &t) { for each i: uint in uint::range(0u, vec::len(v.storage)) { - v.storage.(i) = !v.storage.(i); + v.storage[i] = !v.storage[i]; } } @@ -127,8 +127,7 @@ fn set(v: &t, i: uint, x: bool) { let w = i / bits; let b = i % bits; let flag = 1u << b; - v.storage.(w) = - if x { v.storage.(w) | flag } else { v.storage.(w) & !flag }; + v.storage[w] = if x { v.storage[w] | flag } else { v.storage[w] & !flag }; } @@ -154,9 +153,7 @@ fn to_vec(v: &t) -> [uint] { fn to_str(v: &t) -> str { let rs = ""; - for i: uint in to_vec(v) { - if i == 1u { rs += "1"; } else { rs += "0"; } - } + for i: uint in to_vec(v) { if i == 1u { rs += "1"; } else { rs += "0"; } } ret rs; } @@ -166,7 +163,7 @@ fn eq_vec(v0: &t, v1: &[uint]) -> bool { let i = 0u; while i < len { let w0 = get(v0, i); - let w1 = v1.(i); + let w1 = v1[i]; if !w0 && w1 != 0u || w0 && w1 == 0u { ret false; } i = i + 1u; } diff --git a/src/lib/char.rs b/src/lib/char.rs index 65e6de5373d..634c9b9647c 100644 --- a/src/lib/char.rs +++ b/src/lib/char.rs @@ -26,31 +26,55 @@ pred is_whitespace(c: char) -> bool { const ch_next_line: char = '\u0085'; const ch_no_break_space: char = '\u00a0'; - if c == ch_space { true } - else if c == ch_ogham_space_mark { true } - else if c == ch_mongolian_vowel_sep { true } - else if c == ch_en_quad { true } - else if c == ch_em_quad { true } - else if c == ch_en_space { true } - else if c == ch_em_space { true } - else if c == ch_three_per_em_space { true } - else if c == ch_four_per_em_space { true } - else if c == ch_six_per_em_space { true } - else if c == ch_figure_space { true } - else if c == ch_punctuation_space { true } - else if c == ch_thin_space { true } - else if c == ch_hair_space { true } - else if c == ch_narrow_no_break_space { true } - else if c == ch_medium_mathematical_space { true } - else if c == ch_ideographic_space { true } - else if c == ch_line_tabulation { true } - else if c == ch_paragraph_separator { true } - else if c == ch_character_tabulation { true } - else if c == ch_line_feed { true } - else if c == ch_line_tabulation { true } - else if c == ch_form_feed { true } - else if c == ch_carriage_return { true } - else if c == ch_next_line { true } - else if c == ch_no_break_space { true } - else { false } -} \ No newline at end of file + if c == ch_space { + true + } else if c == ch_ogham_space_mark { + true + } else if c == ch_mongolian_vowel_sep { + true + } else if c == ch_en_quad { + true + } else if c == ch_em_quad { + true + } else if c == ch_en_space { + true + } else if c == ch_em_space { + true + } else if c == ch_three_per_em_space { + true + } else if c == ch_four_per_em_space { + true + } else if c == ch_six_per_em_space { + true + } else if c == ch_figure_space { + true + } else if c == ch_punctuation_space { + true + } else if c == ch_thin_space { + true + } else if c == ch_hair_space { + true + } else if c == ch_narrow_no_break_space { + true + } else if c == ch_medium_mathematical_space { + true + } else if c == ch_ideographic_space { + true + } else if c == ch_line_tabulation { + true + } else if c == ch_paragraph_separator { + true + } else if c == ch_character_tabulation { + true + } else if c == ch_line_feed { + true + } else if c == ch_line_tabulation { + true + } else if c == ch_form_feed { + true + } else if c == ch_carriage_return { + true + } else if c == ch_next_line { + true + } else if c == ch_no_break_space { true } else { false } +} diff --git a/src/lib/comm.rs b/src/lib/comm.rs index 615686a49e0..ebe9c75bc39 100644 --- a/src/lib/comm.rs +++ b/src/lib/comm.rs @@ -17,22 +17,21 @@ native "rust" mod rustrt { type void; type rust_port; - fn chan_id_send<~T>(target_task : task_id, target_port : port_id, - data : -T); + fn chan_id_send<~T>(target_task: task_id, target_port: port_id, data: -T); - fn new_port(unit_sz : uint) -> *rust_port; - fn del_port(po : *rust_port); - fn drop_port(po : *rust_port); - fn get_port_id(po : *rust_port) -> port_id; + fn new_port(unit_sz: uint) -> *rust_port; + fn del_port(po: *rust_port); + fn drop_port(po: *rust_port); + fn get_port_id(po: *rust_port) -> port_id; } native "rust-intrinsic" mod rusti { - fn recv<~T>(port : *rustrt::rust_port) -> T; + fn recv<~T>(port: *rustrt::rust_port) -> T; } type port_id = int; -type chan_handle<~T> = { task : task_id, port : port_id}; +type chan_handle<~T> = {task: task_id, port: port_id}; tag chan<~T> { chan_t(chan_handle<T>); } type _chan<~T> = chan<T>; @@ -44,22 +43,16 @@ resource port_ptr(po: *rustrt::rust_port) { tag port<~T> { port_t(@port_ptr); } -obj port_obj<~T>(raw_port : port<T>) { - fn mk_chan() -> chan<T> { - chan(raw_port) - } +obj port_obj<~T>(raw_port: port<T>) { + fn mk_chan() -> chan<T> { chan(raw_port) } - fn recv() -> T { - recv(raw_port) - } + fn recv() -> T { recv(raw_port) } } type _port<~T> = port_obj<T>; -fn mk_port<~T>() -> _port<T> { - ret port_obj::<T>(port::<T>()); -} +fn mk_port<~T>() -> _port<T> { ret port_obj::<T>(port::<T>()); } -fn send<~T>(ch : &chan<T>, data : -T) { +fn send<~T>(ch: &chan<T>, data: -T) { rustrt::chan_id_send(ch.task, ch.port, data); } @@ -67,13 +60,8 @@ fn port<~T>() -> port<T> { port_t(@port_ptr(rustrt::new_port(sys::size_of::<T>()))) } -fn recv<~T>(p : &port<T>) -> T { - ret rusti::recv(***p) -} +fn recv<~T>(p: &port<T>) -> T { ret rusti::recv(***p) } -fn chan<~T>(p : &port<T>) -> chan<T> { - chan_t({ - task: task::get_task_id(), - port: rustrt::get_port_id(***p) - }) +fn chan<~T>(p: &port<T>) -> chan<T> { + chan_t({task: task::get_task_id(), port: rustrt::get_port_id(***p)}) } diff --git a/src/lib/deque.rs b/src/lib/deque.rs index 19d74f14789..5b2d8db418b 100644 --- a/src/lib/deque.rs +++ b/src/lib/deque.rs @@ -6,14 +6,14 @@ */ type t<T> = obj { - fn size() -> uint ; - fn add_front(&T) ; - fn add_back(&T) ; - fn pop_front() -> T ; - fn pop_back() -> T ; - fn peek_front() -> T ; - fn peek_back() -> T ; - fn get(int) -> T ; + fn size() -> uint; + fn add_front(&T); + fn add_back(&T); + fn pop_front() -> T; + fn pop_back() -> T; + fn peek_front() -> T; + fn peek_back() -> T; + fn get(int) -> T; }; fn create<@T>() -> t<T> { @@ -26,24 +26,25 @@ fn create<@T>() -> t<T> { */ + fn grow<@T>(nelts: uint, lo: uint, elts: &[mutable cell<T>]) -> [mutable cell<T>] { assert (nelts == vec::len(elts)); - let rv = ~[mutable]; + let rv = [mutable]; let i = 0u; let nalloc = uint::next_power_of_two(nelts + 1u); while i < nalloc { if i < nelts { - rv += ~[mutable elts.((lo + i) % nelts)]; - } else { rv += ~[mutable option::none]; } + rv += [mutable elts[(lo + i) % nelts]]; + } else { rv += [mutable option::none]; } i += 1u; } ret rv; } fn get<@T>(elts: &[mutable cell<T>], i: uint) -> T { - ret alt elts.(i) { option::some(t) { t } _ { fail } }; + ret alt elts[i] { option::some(t) { t } _ { fail } }; } obj deque<@T>(mutable nelts: uint, mutable lo: uint, @@ -60,7 +61,7 @@ fn create<@T>() -> t<T> { lo = vec::len::<cell<T>>(elts) - 1u; hi = nelts; } - elts.(lo) = option::some::<T>(t); + elts[lo] = option::some::<T>(t); nelts += 1u; } fn add_back(t: &T) { @@ -69,7 +70,7 @@ fn create<@T>() -> t<T> { lo = 0u; hi = nelts; } - elts.(hi) = option::some::<T>(t); + elts[hi] = option::some::<T>(t); hi = (hi + 1u) % vec::len::<cell<T>>(elts); nelts += 1u; } @@ -80,7 +81,7 @@ fn create<@T>() -> t<T> { */ fn pop_front() -> T { let t: T = get::<T>(elts, lo); - elts.(lo) = option::none::<T>; + elts[lo] = option::none::<T>; lo = (lo + 1u) % vec::len::<cell<T>>(elts); nelts -= 1u; ret t; @@ -90,7 +91,7 @@ fn create<@T>() -> t<T> { hi = vec::len::<cell<T>>(elts) - 1u; } else { hi -= 1u; } let t: T = get::<T>(elts, hi); - elts.(hi) = option::none::<T>; + elts[hi] = option::none::<T>; nelts -= 1u; ret t; } diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs index 31814b8d098..09d0bee1a60 100644 --- a/src/lib/ebml.rs +++ b/src/lib/ebml.rs @@ -18,23 +18,23 @@ type ebml_state = {ebml_tag: ebml_tag, tag_pos: uint, data_pos: uint}; type doc = {data: @[u8], start: uint, end: uint}; fn vint_at(data: &[u8], start: uint) -> {val: uint, next: uint} { - let a = data.(start); + let a = data[start]; if a & 0x80u8 != 0u8 { ret {val: a & 0x7fu8 as uint, next: start + 1u}; } if a & 0x40u8 != 0u8 { - ret {val: (a & 0x3fu8 as uint) << 8u | (data.(start + 1u) as uint), + ret {val: (a & 0x3fu8 as uint) << 8u | (data[start + 1u] as uint), next: start + 2u}; - } else if (a & 0x20u8 != 0u8) { + } else if a & 0x20u8 != 0u8 { ret {val: (a & 0x1fu8 as uint) << 16u | - (data.(start + 1u) as uint) << 8u | - (data.(start + 2u) as uint), + (data[start + 1u] as uint) << 8u | + (data[start + 2u] as uint), next: start + 3u}; - } else if (a & 0x10u8 != 0u8) { + } else if a & 0x10u8 != 0u8 { ret {val: (a & 0x0fu8 as uint) << 24u | - (data.(start + 1u) as uint) << 16u | - (data.(start + 2u) as uint) << 8u | - (data.(start + 3u) as uint), + (data[start + 1u] as uint) << 16u | + (data[start + 2u] as uint) << 8u | + (data[start + 3u] as uint), next: start + 4u}; } else { log_err "vint too big"; fail; } } @@ -105,7 +105,7 @@ fn be_uint_from_bytes(data: &@[u8], start: uint, size: uint) -> uint { let pos = start; while sz > 0u { sz -= 1u; - val += (data.(pos) as uint) << sz * 8u; + val += (data[pos] as uint) << sz * 8u; pos += 1u; } ret val; @@ -122,17 +122,17 @@ type writer = {writer: io::buf_writer, mutable size_positions: [uint]}; fn write_sized_vint(w: &io::buf_writer, n: uint, size: uint) { let buf: [u8]; alt size { - 1u { buf = ~[0x80u8 | (n as u8)]; } - 2u { buf = ~[0x40u8 | (n >> 8u as u8), n & 0xffu as u8]; } + 1u { buf = [0x80u8 | (n as u8)]; } + 2u { buf = [0x40u8 | (n >> 8u as u8), n & 0xffu as u8]; } 3u { buf = - ~[0x20u8 | (n >> 16u as u8), n >> 8u & 0xffu as u8, - n & 0xffu as u8]; + [0x20u8 | (n >> 16u as u8), n >> 8u & 0xffu as u8, + n & 0xffu as u8]; } 4u { buf = - ~[0x10u8 | (n >> 24u as u8), n >> 16u & 0xffu as u8, - n >> 8u & 0xffu as u8, n & 0xffu as u8]; + [0x10u8 | (n >> 24u as u8), n >> 16u & 0xffu as u8, + n >> 8u & 0xffu as u8, n & 0xffu as u8]; } _ { log_err "vint to write too big"; fail; } } @@ -149,7 +149,7 @@ fn write_vint(w: &io::buf_writer, n: uint) { } fn create_writer(w: &io::buf_writer) -> writer { - let size_positions: [uint] = ~[]; + let size_positions: [uint] = []; ret {writer: w, mutable size_positions: size_positions}; } @@ -161,8 +161,8 @@ fn start_tag(w: &writer, tag_id: uint) { write_vint(w.writer, tag_id); // Write a placeholder four-byte size. - w.size_positions += ~[w.writer.tell()]; - let zeroes: [u8] = ~[0u8, 0u8, 0u8, 0u8]; + w.size_positions += [w.writer.tell()]; + let zeroes: [u8] = [0u8, 0u8, 0u8, 0u8]; w.writer.write(zeroes); } diff --git a/src/lib/either.rs b/src/lib/either.rs index 95f1d9aca21..6f2a27a958d 100644 --- a/src/lib/either.rs +++ b/src/lib/either.rs @@ -5,32 +5,33 @@ import option::none; tag t<T, U> { left(T); right(U); } -fn either<T, U, V>(f_left: &block(&T) -> V, f_right: &block(&U) -> V, - value: &t<T, U>) -> V { +fn either<T, U, + V>(f_left: &block(&T) -> V, f_right: &block(&U) -> V, + value: &t<T, U>) -> V { alt value { left(l) { f_left(l) } right(r) { f_right(r) } } } fn lefts<T, U>(eithers: &[t<T, U>]) -> [T] { - let result: [T] = ~[]; + let result: [T] = []; for elt: t<T, U> in eithers { - alt elt { left(l) { result += ~[l] } _ {/* fallthrough */ } } + alt elt { left(l) { result += [l] } _ {/* fallthrough */ } } } ret result; } fn rights<T, U>(eithers: &[t<T, U>]) -> [U] { - let result: [U] = ~[]; + let result: [U] = []; for elt: t<T, U> in eithers { - alt elt { right(r) { result += ~[r] } _ {/* fallthrough */ } } + alt elt { right(r) { result += [r] } _ {/* fallthrough */ } } } ret result; } fn partition<T, U>(eithers: &[t<T, U>]) -> {lefts: [T], rights: [U]} { - let lefts: [T] = ~[]; - let rights: [U] = ~[]; + let lefts: [T] = []; + let rights: [U] = []; for elt: t<T, U> in eithers { - alt elt { left(l) { lefts += ~[l] } right(r) { rights += ~[r] } } + alt elt { left(l) { lefts += [l] } right(r) { rights += [r] } } } ret {lefts: lefts, rights: rights}; } diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs index d7460a6b24e..7f7605a1d85 100644 --- a/src/lib/extfmt.rs +++ b/src/lib/extfmt.rs @@ -69,16 +69,16 @@ mod ct { // A fragment of the output sequence tag piece { piece_string(str); piece_conv(conv); } - type error_fn = fn(str) -> ! ; + type error_fn = fn(str) -> ! ; fn parse_fmt_string(s: str, error: error_fn) -> [piece] { - let pieces: [piece] = ~[]; + let pieces: [piece] = []; let lim = str::byte_len(s); let buf = ""; fn flush_buf(buf: str, pieces: &mutable [piece]) -> str { if str::byte_len(buf) > 0u { let piece = piece_string(buf); - pieces += ~[piece]; + pieces += [piece]; } ret ""; } @@ -96,7 +96,7 @@ mod ct { } else { buf = flush_buf(buf, pieces); let rs = parse_conversion(s, i, lim, error); - pieces += ~[rs.piece]; + pieces += [rs.piece]; i = rs.next; } } else { buf += curr; i += 1u; } @@ -107,7 +107,7 @@ mod ct { fn peek_num(s: str, i: uint, lim: uint) -> option::t<{num: uint, next: uint}> { if i >= lim { ret none; } - let c = s.(i); + let c = s[i]; if !('0' as u8 <= c && c <= '9' as u8) { ret option::none; } let n = c - ('0' as u8) as uint; ret alt peek_num(s, i + 1u, lim) { @@ -143,7 +143,7 @@ mod ct { some(t) { let n = t.num; let j = t.next; - if j < lim && s.(j) == '$' as u8 { + if j < lim && s[j] == '$' as u8 { {param: some(n as int), next: j + 1u} } else { {param: none, next: i} } } @@ -151,7 +151,7 @@ mod ct { } fn parse_flags(s: str, i: uint, lim: uint) -> {flags: [flag], next: uint} { - let noflags: [flag] = ~[]; + let noflags: [flag] = []; if i >= lim { ret {flags: noflags, next: i}; } // FIXME: This recursion generates illegal instructions if the return @@ -161,27 +161,27 @@ mod ct { let next = parse_flags(s, i + 1u, lim); let rest = next.flags; let j = next.next; - let curr: [flag] = ~[f]; + let curr: [flag] = [f]; ret @{flags: curr + rest, next: j}; } let more = bind more_(_, s, i, lim); - let f = s.(i); + let f = s[i]; ret if f == '-' as u8 { *more(flag_left_justify) - } else if (f == '0' as u8) { + } else if f == '0' as u8 { *more(flag_left_zero_pad) - } else if (f == ' ' as u8) { + } else if f == ' ' as u8 { *more(flag_space_for_sign) - } else if (f == '+' as u8) { + } else if f == '+' as u8 { *more(flag_sign_always) - } else if (f == '#' as u8) { + } else if f == '#' as u8 { *more(flag_alternate) } else { {flags: noflags, next: i} }; } fn parse_count(s: str, i: uint, lim: uint) -> {count: count, next: uint} { ret if i >= lim { {count: count_implied, next: i} - } else if (s.(i) == '*' as u8) { + } else if s[i] == '*' as u8 { let param = parse_parameter(s, i + 1u, lim); let j = param.next; alt param.param { @@ -202,7 +202,7 @@ mod ct { {count: count, next: uint} { ret if i >= lim { {count: count_implied, next: i} - } else if (s.(i) == '.' as u8) { + } else if s[i] == '.' as u8 { let count = parse_count(s, i + 1u, lim); @@ -223,21 +223,21 @@ mod ct { let t = if str::eq(tstr, "b") { ty_bool - } else if (str::eq(tstr, "s")) { + } else if str::eq(tstr, "s") { ty_str - } else if (str::eq(tstr, "c")) { + } else if str::eq(tstr, "c") { ty_char - } else if (str::eq(tstr, "d") || str::eq(tstr, "i")) { + } else if str::eq(tstr, "d") || str::eq(tstr, "i") { ty_int(signed) - } else if (str::eq(tstr, "u")) { + } else if str::eq(tstr, "u") { ty_int(unsigned) - } else if (str::eq(tstr, "x")) { + } else if str::eq(tstr, "x") { ty_hex(case_lower) - } else if (str::eq(tstr, "X")) { + } else if str::eq(tstr, "X") { ty_hex(case_upper) - } else if (str::eq(tstr, "t")) { + } else if str::eq(tstr, "t") { ty_bits - } else if (str::eq(tstr, "o")) { + } else if str::eq(tstr, "o") { ty_octal } else { error("unknown type in conversion: " + tstr) }; ret {ty: t, next: i + 1u}; @@ -277,7 +277,7 @@ mod rt { if 0 <= i { if have_flag(cv.flags, flag_sign_always) { s = "+" + s; - } else if (have_flag(cv.flags, flag_space_for_sign)) { + } else if have_flag(cv.flags, flag_space_for_sign) { s = " " + s; } } @@ -404,9 +404,9 @@ mod rt { // instead. if signed && zero_padding && str::byte_len(s) > 0u { - let head = s.(0); + let head = s[0]; if head == '+' as u8 || head == '-' as u8 || head == ' ' as u8 { - let headstr = str::unsafe_from_bytes(~[head]); + let headstr = str::unsafe_from_bytes([head]); let bytelen = str::byte_len(s); let numpart = str::substr(s, 1u, bytelen - 1u); ret headstr + padstr + numpart; diff --git a/src/lib/fs.rs b/src/lib/fs.rs index e3eb47802b6..c49d77815a3 100644 --- a/src/lib/fs.rs +++ b/src/lib/fs.rs @@ -35,7 +35,7 @@ fn basename(p: path) -> path { // FIXME: Need some typestate to avoid bounds check when len(pre) == 0 fn connect(pre: path, post: path) -> path { let len = str::byte_len(pre); - ret if pre.(len - 1u) == os_fs::path_sep as u8 { + ret if pre[len - 1u] == os_fs::path_sep as u8 { // Trailing '/'? pre + post @@ -46,11 +46,11 @@ fn file_is_dir(p: path) -> bool { ret rustrt::rust_file_is_dir(p) != 0; } fn list_dir(p: path) -> [str] { let pl = str::byte_len(p); - if pl == 0u || p.(pl - 1u) as char != os_fs::path_sep { p += path_sep(); } - let full_paths: [str] = ~[]; + if pl == 0u || p[pl - 1u] as char != os_fs::path_sep { p += path_sep(); } + let full_paths: [str] = []; for filename: str in os_fs::list_dir(p) { if !str::eq(filename, ".") { - if !str::eq(filename, "..") { full_paths += ~[p + filename]; } + if !str::eq(filename, "..") { full_paths += [p + filename]; } } } ret full_paths; diff --git a/src/lib/generic_os.rs b/src/lib/generic_os.rs index acb9a772048..80bc7747b47 100644 --- a/src/lib/generic_os.rs +++ b/src/lib/generic_os.rs @@ -28,7 +28,7 @@ fn getenv(n: str) -> option::t<str> { let res = os::kernel32::GetEnvironmentVariableA(nbuf, vbuf, nsize); if res == 0u { ret option::none; - } else if (res < nsize) { + } else if res < nsize { ret option::some(str::str_from_cstr(vbuf)); } else { nsize = res; } } diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs index 22628f8aa6e..95747e3c453 100644 --- a/src/lib/getopts.rs +++ b/src/lib/getopts.rs @@ -68,7 +68,7 @@ tag optval { val(str); given; } type match = {opts: [opt], vals: [mutable [optval]], free: [str]}; fn is_arg(arg: str) -> bool { - ret str::byte_len(arg) > 1u && arg.(0) == '-' as u8; + ret str::byte_len(arg) > 1u && arg[0] == '-' as u8; } fn name_str(nm: name) -> str { @@ -78,7 +78,7 @@ fn name_str(nm: name) -> str { fn find_opt(opts: &[opt], nm: name) -> option::t<uint> { let i = 0u; let l = vec::len::<opt>(opts); - while i < l { if opts.(i).name == nm { ret some::<uint>(i); } i += 1u; } + while i < l { if opts[i].name == nm { ret some::<uint>(i); } i += 1u; } ret none::<uint>; } @@ -108,30 +108,30 @@ tag result { success(match); failure(fail_); } fn getopts(args: &[str], opts: &[opt]) -> result { let n_opts = vec::len::<opt>(opts); - fn f(_x: uint) -> [optval] { ret ~[]; } + fn f(_x: uint) -> [optval] { ret []; } let vals = vec::init_fn_mut::<[optval]>(f, n_opts); - let free: [str] = ~[]; + let free: [str] = []; let l = vec::len::<str>(args); let i = 0u; while i < l { - let cur = args.(i); + let cur = args[i]; let curlen = str::byte_len(cur); if !is_arg(cur) { - free += ~[cur]; - } else if (str::eq(cur, "--")) { + free += [cur]; + } else if str::eq(cur, "--") { let j = i + 1u; - while j < l { free += ~[args.(j)]; j += 1u; } + while j < l { free += [args[j]]; j += 1u; } break; } else { let names; let i_arg = option::none::<str>; - if cur.(1) == '-' as u8 { + if cur[1] == '-' as u8 { let tail = str::slice(cur, 2u, curlen); let eq = str::index(tail, '=' as u8); if eq == -1 { - names = ~[long(tail)]; + names = [long(tail)]; } else { - names = ~[long(str::slice(tail, 0u, eq as uint))]; + names = [long(str::slice(tail, 0u, eq as uint))]; i_arg = option::some::<str>(str::slice(tail, (eq as uint) + 1u, @@ -139,10 +139,10 @@ fn getopts(args: &[str], opts: &[opt]) -> result { } } else { let j = 1u; - names = ~[]; + names = []; while j < curlen { let range = str::char_range_at(cur, j); - names += ~[short(range.ch)]; + names += [short(range.ch)]; j = range.next; } } @@ -154,27 +154,27 @@ fn getopts(args: &[str], opts: &[opt]) -> result { some(id) { optid = id; } none. { ret failure(unrecognized_option(name_str(nm))); } } - alt opts.(optid).hasarg { + alt opts[optid].hasarg { no. { if !option::is_none::<str>(i_arg) { ret failure(unexpected_argument(name_str(nm))); } - vals.(optid) += ~[given]; + vals[optid] += [given]; } maybe. { if !option::is_none::<str>(i_arg) { - vals.(optid) += ~[val(option::get(i_arg))]; - } else if (name_pos < vec::len::<name>(names) || - i + 1u == l || is_arg(args.(i + 1u))) { - vals.(optid) += ~[given]; - } else { i += 1u; vals.(optid) += ~[val(args.(i))]; } + vals[optid] += [val(option::get(i_arg))]; + } else if name_pos < vec::len::<name>(names) || + i + 1u == l || is_arg(args[i + 1u]) { + vals[optid] += [given]; + } else { i += 1u; vals[optid] += [val(args[i])]; } } yes. { if !option::is_none::<str>(i_arg) { - vals.(optid) += ~[val(option::get::<str>(i_arg))]; - } else if (i + 1u == l) { + vals[optid] += [val(option::get::<str>(i_arg))]; + } else if i + 1u == l { ret failure(argument_missing(name_str(nm))); - } else { i += 1u; vals.(optid) += ~[val(args.(i))]; } + } else { i += 1u; vals[optid] += [val(args[i])]; } } } } @@ -183,16 +183,16 @@ fn getopts(args: &[str], opts: &[opt]) -> result { } i = 0u; while i < n_opts { - let n = vec::len::<optval>(vals.(i)); - let occ = opts.(i).occur; + let n = vec::len::<optval>(vals[i]); + let occ = opts[i].occur; if occ == req { if n == 0u { - ret failure(option_missing(name_str(opts.(i).name))); + ret failure(option_missing(name_str(opts[i].name))); } } if occ != multi { if n > 1u { - ret failure(option_duplicated(name_str(opts.(i).name))); + ret failure(option_duplicated(name_str(opts[i].name))); } } i += 1u; @@ -202,12 +202,12 @@ fn getopts(args: &[str], opts: &[opt]) -> result { fn opt_vals(m: &match, nm: str) -> [optval] { ret alt find_opt(m.opts, mkname(nm)) { - some(id) { m.vals.(id) } + some(id) { m.vals[id] } none. { log_err "No option '" + nm + "' defined."; fail } }; } -fn opt_val(m: &match, nm: str) -> optval { ret opt_vals(m, nm).(0); } +fn opt_val(m: &match, nm: str) -> optval { ret opt_vals(m, nm)[0]; } fn opt_present(m: &match, nm: str) -> bool { ret vec::len::<optval>(opt_vals(m, nm)) > 0u; @@ -218,9 +218,9 @@ fn opt_str(m: &match, nm: str) -> str { } fn opt_strs(m: &match, nm: str) -> [str] { - let acc: [str] = ~[]; + let acc: [str] = []; for v: optval in opt_vals(m, nm) { - alt v { val(s) { acc += ~[s]; } _ { } } + alt v { val(s) { acc += [s]; } _ { } } } ret acc; } @@ -228,7 +228,7 @@ fn opt_strs(m: &match, nm: str) -> [str] { fn opt_maybe_str(m: &match, nm: str) -> option::t<str> { let vals = opt_vals(m, nm); if vec::len::<optval>(vals) == 0u { ret none::<str>; } - ret alt vals.(0) { val(s) { some::<str>(s) } _ { none::<str> } }; + ret alt vals[0] { val(s) { some::<str>(s) } _ { none::<str> } }; } @@ -238,7 +238,7 @@ fn opt_maybe_str(m: &match, nm: str) -> option::t<str> { fn opt_default(m: &match, nm: str, def: str) -> option::t<str> { let vals = opt_vals(m, nm); if vec::len::<optval>(vals) == 0u { ret none::<str>; } - ret alt vals.(0) { val(s) { some::<str>(s) } _ { some::<str>(def) } } + ret alt vals[0] { val(s) { some::<str>(s) } _ { some::<str>(def) } } } // Local Variables: // mode: rust; diff --git a/src/lib/int.rs b/src/lib/int.rs index 52a1cb1cd66..fd4cd09f279 100644 --- a/src/lib/int.rs +++ b/src/lib/int.rs @@ -52,7 +52,7 @@ fn str(i: int) -> str { ret to_str(i, 10u); } fn pow(base: int, exponent: uint) -> int { ret if exponent == 0u { 1 - } else if (base == 0) { + } else if base == 0 { 0 } else { let accum = base; diff --git a/src/lib/io.rs b/src/lib/io.rs index 10a59334f62..454cfd1041f 100644 --- a/src/lib/io.rs +++ b/src/lib/io.rs @@ -15,53 +15,49 @@ tag seek_style { seek_set; seek_end; seek_cur; } // The raw underlying reader class. All readers must implement this. type buf_reader = - // FIXME: Seekable really should be orthogonal. We will need // inheritance. obj { - fn read(uint) -> [u8] ; - fn read_byte() -> int ; - fn unread_byte(int) ; - fn eof() -> bool ; - fn seek(int, seek_style) ; - fn tell() -> uint ; + fn read(uint) -> [u8]; + fn read_byte() -> int; + fn unread_byte(int); + fn eof() -> bool; + fn seek(int, seek_style); + fn tell() -> uint; }; // Convenience methods for reading. type reader = - // FIXME: This should inherit from buf_reader. - // FIXME: eventually u64 + // FIXME: eventually u64 obj { - fn get_buf_reader() -> buf_reader ; - fn read_byte() -> int ; - fn unread_byte(int) ; - fn read_bytes(uint) -> [u8] ; - fn read_char() -> char ; - fn eof() -> bool ; - fn read_line() -> str ; - fn read_c_str() -> str ; - fn read_le_uint(uint) -> uint ; - fn read_le_int(uint) -> int ; - fn read_be_uint(uint) -> uint ; - fn read_whole_stream() -> [u8] ; - fn seek(int, seek_style) ; - fn tell() -> uint ; + fn get_buf_reader() -> buf_reader; + fn read_byte() -> int; + fn unread_byte(int); + fn read_bytes(uint) -> [u8]; + fn read_char() -> char; + fn eof() -> bool; + fn read_line() -> str; + fn read_c_str() -> str; + fn read_le_uint(uint) -> uint; + fn read_le_int(uint) -> int; + fn read_be_uint(uint) -> uint; + fn read_whole_stream() -> [u8]; + fn seek(int, seek_style); + fn tell() -> uint; }; fn convert_whence(whence: seek_style) -> int { ret alt whence { seek_set. { 0 } seek_cur. { 1 } seek_end. { 2 } }; } -resource FILE_res(f: os::libc::FILE) { - os::libc::fclose(f); -} +resource FILE_res(f: os::libc::FILE) { os::libc::fclose(f); } obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) { fn read(len: uint) -> [u8] { - let buf = ~[]; + let buf = []; vec::reserve::<u8>(buf, len); let read = os::libc::fread(vec::to_ptr::<u8>(buf), 1u, len, f); vec::unsafe::set_len::<u8>(buf, read); @@ -73,9 +69,7 @@ obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) { fn seek(offset: int, whence: seek_style) { assert (os::libc::fseek(f, offset, convert_whence(whence)) == 0); } - fn tell() -> uint { - ret os::libc::ftell(f) as uint; - } + fn tell() -> uint { ret os::libc::ftell(f) as uint; } } @@ -111,7 +105,7 @@ obj new_reader(rdr: buf_reader) { } fn eof() -> bool { ret rdr.eof(); } fn read_line() -> str { - let buf: [u8] = ~[]; + let buf: [u8] = []; // No break yet in rustc let go_on = true; @@ -119,16 +113,16 @@ obj new_reader(rdr: buf_reader) { let ch = rdr.read_byte(); if ch == -1 || ch == 10 { go_on = false; - } else { buf += ~[ch as u8]; } + } else { buf += [ch as u8]; } } ret str::unsafe_from_bytes(buf); } fn read_c_str() -> str { - let buf: [u8] = ~[]; + let buf: [u8] = []; let go_on = true; while go_on { let ch = rdr.read_byte(); - if ch < 1 { go_on = false; } else { buf += ~[ch as u8]; } + if ch < 1 { go_on = false; } else { buf += [ch as u8]; } } ret str::unsafe_from_bytes(buf); } @@ -166,7 +160,7 @@ obj new_reader(rdr: buf_reader) { ret val; } fn read_whole_stream() -> [u8] { - let buf: [u8] = ~[]; + let buf: [u8] = []; while !rdr.eof() { buf += rdr.read(2048u); } ret buf; } @@ -205,7 +199,7 @@ obj byte_buf_reader(bbuf: byte_buf) { } fn read_byte() -> int { if bbuf.pos == vec::len::<u8>(bbuf.buf) { ret -1; } - let b = bbuf.buf.(bbuf.pos); + let b = bbuf.buf[bbuf.pos]; bbuf.pos += 1u; ret b as int; } @@ -232,15 +226,14 @@ fn string_reader(s: &str) -> reader { tag fileflag { append; create; truncate; none; } type buf_writer = - // FIXME: Seekable really should be orthogonal. We will need // inheritance. - // FIXME: eventually u64 + // FIXME: eventually u64 obj { - fn write(&[u8]) ; - fn seek(int, seek_style) ; - fn tell() -> uint ; + fn write(&[u8]); + fn seek(int, seek_style); + fn tell() -> uint; }; obj FILE_writer(f: os::libc::FILE, res: option::t<@FILE_res>) { @@ -253,14 +246,10 @@ obj FILE_writer(f: os::libc::FILE, res: option::t<@FILE_res>) { fn seek(offset: int, whence: seek_style) { assert (os::libc::fseek(f, offset, convert_whence(whence)) == 0); } - fn tell() -> uint { - ret os::libc::ftell(f) as uint; - } + fn tell() -> uint { ret os::libc::ftell(f) as uint; } } -resource fd_res(fd: int) { - os::libc::close(fd); -} +resource fd_res(fd: int) { os::libc::close(fd); } obj fd_buf_writer(fd: int, res: option::t<@fd_res>) { fn write(v: &[u8]) { @@ -312,32 +301,31 @@ fn file_buf_writer(path: str, flags: &[fileflag]) -> buf_writer { } type writer = - // write_str will continue to do utf-8 output only. an alternative // function will be provided for general encoded string output obj { - fn get_buf_writer() -> buf_writer ; - fn write_str(str) ; - fn write_line(str) ; - fn write_char(char) ; - fn write_int(int) ; - fn write_uint(uint) ; - fn write_bytes(&[u8]) ; - fn write_le_uint(uint, uint) ; - fn write_le_int(int, uint) ; - fn write_be_uint(uint, uint) ; + fn get_buf_writer() -> buf_writer; + fn write_str(str); + fn write_line(str); + fn write_char(char); + fn write_int(int); + fn write_uint(uint); + fn write_bytes(&[u8]); + fn write_le_uint(uint, uint); + fn write_le_int(int, uint); + fn write_be_uint(uint, uint); }; fn uint_to_le_bytes(n: uint, size: uint) -> [u8] { - let bytes: [u8] = ~[]; - while size > 0u { bytes += ~[n & 255u as u8]; n >>= 8u; size -= 1u; } + let bytes: [u8] = []; + while size > 0u { bytes += [n & 255u as u8]; n >>= 8u; size -= 1u; } ret bytes; } fn uint_to_be_bytes(n: uint, size: uint) -> [u8] { - let bytes: [u8] = ~[]; + let bytes: [u8] = []; let i = size - 1u as int; - while i >= 0 { bytes += ~[n >> (i * 8 as uint) & 255u as u8]; i -= 1; } + while i >= 0 { bytes += [n >> (i * 8 as uint) & 255u as u8]; i -= 1; } ret bytes; } @@ -354,9 +342,7 @@ obj new_writer(out: buf_writer) { out.write(str::bytes(str::from_char(ch))); } fn write_int(n: int) { out.write(str::bytes(int::to_str(n, 10u))); } - fn write_uint(n: uint) { - out.write(str::bytes(uint::to_str(n, 10u))); - } + fn write_uint(n: uint) { out.write(str::bytes(uint::to_str(n, 10u))); } fn write_bytes(bytes: &[u8]) { out.write(bytes); } fn write_le_uint(n: uint, size: uint) { out.write(uint_to_le_bytes(n, size)); @@ -391,8 +377,8 @@ fn stdout() -> writer { ret new_writer(fd_buf_writer(1, option::none)); } type str_writer = obj { - fn get_writer() -> writer ; - fn get_str() -> str ; + fn get_writer() -> writer; + fn get_str() -> str; }; type mutable_byte_buf = @{mutable buf: [mutable u8], mutable pos: uint}; @@ -402,7 +388,7 @@ obj byte_buf_writer(buf: mutable_byte_buf) { // Fast path. if buf.pos == vec::len(buf.buf) { - for b: u8 in v { buf.buf += ~[mutable b]; } + for b: u8 in v { buf.buf += [mutable b]; } buf.pos += vec::len::<u8>(v); ret; } @@ -411,10 +397,10 @@ obj byte_buf_writer(buf: mutable_byte_buf) { let vlen = vec::len::<u8>(v); let vpos = 0u; while vpos < vlen { - let b = v.(vpos); + let b = v[vpos]; if buf.pos == vec::len(buf.buf) { - buf.buf += ~[mutable b]; - } else { buf.buf.(buf.pos) = b; } + buf.buf += [mutable b]; + } else { buf.buf[buf.pos] = b; } buf.pos += 1u; vpos += 1u; } @@ -430,7 +416,7 @@ obj byte_buf_writer(buf: mutable_byte_buf) { fn string_writer() -> str_writer { // FIXME: yikes, this is bad. Needs fixing of mutable syntax. - let b: [mutable u8] = ~[mutable 0u8]; + let b: [mutable u8] = [mutable 0u8]; vec::pop(b); let buf: mutable_byte_buf = @{mutable buf: b, mutable pos: 0u}; obj str_writer_wrap(wr: writer, buf: mutable_byte_buf) { @@ -451,7 +437,7 @@ fn seek_in_buf(offset: int, pos: uint, len: uint, whence: seek_style) -> seek_cur. { bpos += offset; } seek_end. { bpos = blen + offset; } } - if bpos < 0 { bpos = 0; } else if (bpos > blen) { bpos = blen; } + if bpos < 0 { bpos = 0; } else if bpos > blen { bpos = blen; } ret bpos as uint; } @@ -460,6 +446,7 @@ fn read_whole_file_str(file: &str) -> str { } fn read_whole_file(file: &str) -> [u8] { + // FIXME: There's a lot of copying here file_reader(file).read_whole_stream() } diff --git a/src/lib/list.rs b/src/lib/list.rs index ee25f7cd3bb..4f3cc5b2238 100644 --- a/src/lib/list.rs +++ b/src/lib/list.rs @@ -13,7 +13,7 @@ fn from_vec<@T>(v: &[T]) -> list<T> { ret l; } -fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U ) -> U { +fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U) -> U { let accum: U = u; let ls = ls_; while true { @@ -25,8 +25,8 @@ fn foldl<@T, @U>(ls_: &list<T>, u: &U, f: &block(&T, &U) -> U ) -> U { ret accum; } -fn find<@T, @U>(ls_: &list<T>, f: &block(&T) -> option::t<U>) - -> option::t<U> { +fn find<@T, @U>(ls_: &list<T>, f: &block(&T) -> option::t<U>) -> + option::t<U> { let ls = ls_; while true { alt ls { @@ -56,26 +56,17 @@ fn length<@T>(ls: &list<T>) -> uint { } fn cdr<@T>(ls: &list<T>) -> list<T> { - alt ls { - cons(_, tl) { ret *tl; } - nil. { fail "list empty" } - } + alt ls { cons(_, tl) { ret *tl; } nil. { fail "list empty" } } } fn car<@T>(ls: &list<T>) -> T { - alt ls { - cons(hd, _) { ret hd; } - nil. { fail "list empty" } - } + alt ls { cons(hd, _) { ret hd; } nil. { fail "list empty" } } } fn append<@T>(l: &list<T>, m: &list<T>) -> list<T> { alt l { nil. { ret m; } - cons(x, xs) { - let rest = append(*xs, m); - ret cons(x, @rest); - } + cons(x, xs) { let rest = append(*xs, m); ret cons(x, @rest); } } } diff --git a/src/lib/map.rs b/src/lib/map.rs index 4590fd8c63d..d54eae03d10 100644 --- a/src/lib/map.rs +++ b/src/lib/map.rs @@ -1,21 +1,21 @@ /** * Hashmap implementation. */ -type hashfn<K> = fn(&K) -> uint ; +type hashfn<K> = fn(&K) -> uint; -type eqfn<K> = fn(&K, &K) -> bool ; +type eqfn<K> = fn(&K, &K) -> bool; type hashmap<K, V> = obj { - fn size() -> uint ; - fn insert(&K, &V) -> bool ; - fn contains_key(&K) -> bool ; - fn get(&K) -> V ; - fn find(&K) -> option::t<V> ; - fn remove(&K) -> option::t<V> ; - fn rehash() ; - iter items() -> @{key: K, val: V} ; - iter keys() -> K ; + fn size() -> uint; + fn insert(&K, &V) -> bool; + fn contains_key(&K) -> bool; + fn get(&K) -> V; + fn find(&K) -> option::t<V>; + fn remove(&K) -> option::t<V>; + fn rehash(); + iter items() -> @{key: K, val: V}; + iter keys() -> K; }; type hashset<K> = hashmap<K, ()>; @@ -26,7 +26,7 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { let load_factor: util::rational = {num: 3, den: 4}; tag bucket<@K, @V> { nil; deleted; some(K, V); } - fn make_buckets<@K, @V>(nbkts: uint) -> [mutable (bucket<K, V>)] { + fn make_buckets<@K, @V>(nbkts: uint) -> [mutable bucket<K, V>] { ret vec::init_elt_mut::<bucket<K, V>>(nil::<K, V>, nbkts); } // Derive two hash functions from the one given by taking the upper @@ -53,37 +53,36 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { * will fail. */ - fn insert_common<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, - bkts: &[mutable bucket<K, V>], nbkts: uint, - key: &K, val: &V) -> bool { + fn insert_common<@K, + @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, + bkts: &[mutable bucket<K, V>], nbkts: uint, key: &K, + val: &V) -> bool { let i: uint = 0u; let h: uint = hasher(key); while i < nbkts { let j: uint = hash(h, nbkts, i); - alt bkts.(j) { + alt bkts[j] { some(k, _) { // Copy key to please alias analysis. let k_ = k; - if eqer(key, k_) { - bkts.(j) = some(k_, val); - ret false; - } + if eqer(key, k_) { bkts[j] = some(k_, val); ret false; } i += 1u; } - _ { bkts.(j) = some(key, val); ret true; } + _ { bkts[j] = some(key, val); ret true; } } } fail; // full table } - fn find_common<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, - bkts: &[mutable bucket<K, V>], nbkts: uint, - key: &K) -> option::t<V> { + fn find_common<@K, + @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, + bkts: &[mutable bucket<K, V>], nbkts: uint, key: &K) -> + option::t<V> { let i: uint = 0u; let h: uint = hasher(key); while i < nbkts { let j: uint = hash(h, nbkts, i); - alt bkts.(j) { + alt bkts[j] { some(k, v) { // Copy to please alias analysis. let k_ = k; @@ -97,9 +96,10 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { } ret option::none; } - fn rehash<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, - oldbkts: &[mutable bucket<K, V>], _noldbkts: uint, - newbkts: &[mutable bucket<K, V>], nnewbkts: uint) { + fn rehash<@K, + @V>(hasher: &hashfn<K>, eqer: &eqfn<K>, + oldbkts: &[mutable bucket<K, V>], _noldbkts: uint, + newbkts: &[mutable bucket<K, V>], nnewbkts: uint) { for b: bucket<K, V> in oldbkts { alt b { some(k_, v_) { @@ -111,12 +111,13 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { } } } - obj hashmap<@K, @V>(hasher: hashfn<K>, - eqer: eqfn<K>, - mutable bkts: [mutable bucket<K, V>], - mutable nbkts: uint, - mutable nelts: uint, - lf: util::rational) { + obj hashmap<@K, + @V>(hasher: hashfn<K>, + eqer: eqfn<K>, + mutable bkts: [mutable bucket<K, V>], + mutable nbkts: uint, + mutable nelts: uint, + lf: util::rational) { fn size() -> uint { ret nelts; } fn insert(key: &K, val: &V) -> bool { let load: util::rational = @@ -154,12 +155,12 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> { let h: uint = hasher(key); while i < nbkts { let j: uint = hash(h, nbkts, i); - alt bkts.(j) { + alt bkts[j] { some(k, v) { let k_ = k; let vo = option::some(v); if eqer(key, k_) { - bkts.(j) = deleted; + bkts[j] = deleted; nelts -= 1u; ret vo; } diff --git a/src/lib/net.rs b/src/lib/net.rs index 8b8b8113d8d..83923d6b987 100644 --- a/src/lib/net.rs +++ b/src/lib/net.rs @@ -2,29 +2,20 @@ import str; import vec; import uint; -tag ip_addr { - ipv4(u8, u8, u8, u8); -} +tag ip_addr { ipv4(u8, u8, u8, u8); } -fn format_addr(ip : ip_addr) -> str { - alt(ip) { +fn format_addr(ip: ip_addr) -> str { + alt ip { ipv4(a, b, c, d) { - #fmt("%u.%u.%u.%u", - a as uint, - b as uint, - c as uint, - d as uint) + #fmt["%u.%u.%u.%u", a as uint, b as uint, c as uint, d as uint] } _ { fail "Unsupported address type"; } } } -fn parse_addr(ip : str) -> ip_addr { - let parts = vec::map(uint::from_str, str::split(ip, ".".(0))); +fn parse_addr(ip: str) -> ip_addr { + let parts = vec::map(uint::from_str, str::split(ip, "."[0])); if vec::len(parts) != 4u { fail "Too many dots in IP address"; } for i in parts { if i > 255u { fail "Invalid IP Address part."; } } - ipv4(parts.(0) as u8, - parts.(1) as u8, - parts.(2) as u8, - parts.(3) as u8) + ipv4(parts[0] as u8, parts[1] as u8, parts[2] as u8, parts[3] as u8) } diff --git a/src/lib/option.rs b/src/lib/option.rs index e8656b0b77d..ea14ef2b867 100644 --- a/src/lib/option.rs +++ b/src/lib/option.rs @@ -3,10 +3,7 @@ tag t<@T> { none; some(T); } fn get<@T>(opt: &t<T>) -> T { - alt opt { - some(x) { x } - none. { fail "option none" } - } + alt opt { some(x) { x } none. { fail "option none" } } } fn map<@T, @U>(f: &block(&T) -> U, opt: &t<T>) -> t<U> { diff --git a/src/lib/rand.rs b/src/lib/rand.rs index 7b47311b04b..fee8bbe06ba 100644 --- a/src/lib/rand.rs +++ b/src/lib/rand.rs @@ -11,17 +11,16 @@ native "rust" mod rustrt { fn rand_free(c: rctx); } -type rng = obj { fn next() -> u32; }; +type rng = + obj { + fn next() -> u32; + }; -resource rand_res(c: rustrt::rctx) { - rustrt::rand_free(c); -} +resource rand_res(c: rustrt::rctx) { rustrt::rand_free(c); } fn mk_rng() -> rng { obj rt_rng(c: @rand_res) { - fn next() -> u32 { - ret rustrt::rand_next(**c); - } + fn next() -> u32 { ret rustrt::rand_next(**c); } } ret rt_rng(@rand_res(rustrt::rand_new())); } diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs index 5c5f110816b..fb593bca58a 100644 --- a/src/lib/run_program.rs +++ b/src/lib/run_program.rs @@ -13,9 +13,9 @@ native "rust" mod rustrt { } fn arg_vec(prog: str, args: &[str]) -> [sbuf] { - let argptrs = ~[str::buf(prog)]; - for arg: str in args { argptrs += ~[str::buf(arg)]; } - argptrs += ~[0 as sbuf]; + let argptrs = [str::buf(prog)]; + for arg: str in args { argptrs += [str::buf(arg)]; } + argptrs += [0 as sbuf]; ret argptrs; } @@ -24,8 +24,8 @@ fn spawn_process(prog: str, args: &[str], in_fd: int, out_fd: int, // Note: we have to hold on to this vector reference while we hold a // pointer to its buffer let argv = arg_vec(prog, args); - let pid = rustrt::rust_run_program( - vec::to_ptr(argv), in_fd, out_fd, err_fd); + let pid = + rustrt::rust_run_program(vec::to_ptr(argv), in_fd, out_fd, err_fd); ret pid; } @@ -44,16 +44,15 @@ type program = fn destroy(); }; -resource program_res(p: program) { - p.destroy(); -} +resource program_res(p: program) { p.destroy(); } fn start_program(prog: str, args: &[str]) -> @program_res { let pipe_input = os::pipe(); let pipe_output = os::pipe(); let pipe_err = os::pipe(); - let pid = spawn_process(prog, args, pipe_input.in, pipe_output.out, - pipe_err.out); + let pid = + spawn_process(prog, args, pipe_input.in, pipe_output.out, + pipe_err.out); if pid == -1 { fail; } os::libc::close(pipe_input.in); @@ -66,16 +65,13 @@ fn start_program(prog: str, args: &[str]) -> @program_res { mutable finished: bool) { fn get_id() -> int { ret pid; } fn input() -> io::writer { - ret io::new_writer( - io::fd_buf_writer(in_fd, option::none)); + ret io::new_writer(io::fd_buf_writer(in_fd, option::none)); } fn output() -> io::reader { - ret io::new_reader( - io::FILE_buf_reader(out_file, option::none)); + ret io::new_reader(io::FILE_buf_reader(out_file, option::none)); } fn err() -> io::reader { - ret io::new_reader( - io::FILE_buf_reader(err_file, option::none)); + ret io::new_reader(io::FILE_buf_reader(err_file, option::none)); } fn close_input() { let invalid_fd = -1; @@ -96,11 +92,9 @@ fn start_program(prog: str, args: &[str]) -> @program_res { os::libc::fclose(err_file); } } - ret @program_res(new_program(pid, - pipe_input.out, + ret @program_res(new_program(pid, pipe_input.out, os::fd_FILE(pipe_output.in), - os::fd_FILE(pipe_err.in), - false)); + os::fd_FILE(pipe_err.in), false)); } fn read_all(rd: &io::reader) -> str { @@ -112,8 +106,8 @@ fn read_all(rd: &io::reader) -> str { ret buf; } -fn program_output(prog: str, args: [str]) - -> {status: int, out: str, err: str} { +fn program_output(prog: str, args: [str]) -> + {status: int, out: str, err: str} { let pr = start_program(prog, args); pr.close_input(); ret {status: pr.finish(), diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs index 99c0f1276d1..db6fad15784 100644 --- a/src/lib/sha1.rs +++ b/src/lib/sha1.rs @@ -9,7 +9,6 @@ export sha1; export mk_sha1; type sha1 = - // Provide message input as bytes @@ -25,11 +24,11 @@ type sha1 = // Reset the sha1 state for reuse. This is called // automatically during construction obj { - fn input(&[u8]) ; - fn input_str(&str) ; - fn result() -> [u8] ; - fn result_str() -> str ; - fn reset() ; + fn input(&[u8]); + fn input_str(&str); + fn result() -> [u8]; + fn result_str() -> str; + fn reset(); }; @@ -65,7 +64,7 @@ fn mk_sha1() -> sha1 { assert (!st.computed); for element: u8 in msg { - st.msg_block.(st.msg_block_idx) = element; + st.msg_block[st.msg_block_idx] = element; st.msg_block_idx += 1u; st.len_low += 8u32; if st.len_low == 0u32 { @@ -92,30 +91,29 @@ fn mk_sha1() -> sha1 { t = 0; while t < 16 { let tmp; - tmp = (st.msg_block.(t * 4) as u32) << 24u32; - tmp = tmp | (st.msg_block.(t * 4 + 1) as u32) << 16u32; - tmp = tmp | (st.msg_block.(t * 4 + 2) as u32) << 8u32; - tmp = tmp | (st.msg_block.(t * 4 + 3) as u32); - w.(t) = tmp; + tmp = (st.msg_block[t * 4] as u32) << 24u32; + tmp = tmp | (st.msg_block[t * 4 + 1] as u32) << 16u32; + tmp = tmp | (st.msg_block[t * 4 + 2] as u32) << 8u32; + tmp = tmp | (st.msg_block[t * 4 + 3] as u32); + w[t] = tmp; t += 1; } // Initialize the rest of vector w while t < 80 { - let val = w.(t - 3) ^ w.(t - 8) ^ w.(t - 14) ^ w.(t - 16); - w.(t) = circular_shift(1u32, val); + let val = w[t - 3] ^ w[t - 8] ^ w[t - 14] ^ w[t - 16]; + w[t] = circular_shift(1u32, val); t += 1; } - let a = st.h.(0); - let b = st.h.(1); - let c = st.h.(2); - let d = st.h.(3); - let e = st.h.(4); + let a = st.h[0]; + let b = st.h[1]; + let c = st.h[2]; + let d = st.h[3]; + let e = st.h[4]; let temp: u32; t = 0; while t < 20 { - temp = - circular_shift(5u32, a) + (b & c | !b & d) + e + w.(t) + k0; + temp = circular_shift(5u32, a) + (b & c | !b & d) + e + w[t] + k0; e = d; d = c; c = circular_shift(30u32, b); @@ -124,7 +122,7 @@ fn mk_sha1() -> sha1 { t += 1; } while t < 40 { - temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w.(t) + k1; + temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w[t] + k1; e = d; d = c; c = circular_shift(30u32, b); @@ -134,8 +132,8 @@ fn mk_sha1() -> sha1 { } while t < 60 { temp = - circular_shift(5u32, a) + (b & c | b & d | c & d) + e + w.(t) - + k2; + circular_shift(5u32, a) + (b & c | b & d | c & d) + e + w[t] + + k2; e = d; d = c; c = circular_shift(30u32, b); @@ -144,7 +142,7 @@ fn mk_sha1() -> sha1 { t += 1; } while t < 80 { - temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w.(t) + k3; + temp = circular_shift(5u32, a) + (b ^ c ^ d) + e + w[t] + k3; e = d; d = c; c = circular_shift(30u32, b); @@ -152,11 +150,11 @@ fn mk_sha1() -> sha1 { a = temp; t += 1; } - st.h.(0) = st.h.(0) + a; - st.h.(1) = st.h.(1) + b; - st.h.(2) = st.h.(2) + c; - st.h.(3) = st.h.(3) + d; - st.h.(4) = st.h.(4) + e; + st.h[0] = st.h[0] + a; + st.h[1] = st.h[1] + b; + st.h[2] = st.h[2] + c; + st.h[3] = st.h[3] + d; + st.h[4] = st.h[4] + e; st.msg_block_idx = 0u; } fn circular_shift(bits: u32, word: u32) -> u32 { @@ -164,13 +162,13 @@ fn mk_sha1() -> sha1 { } fn mk_result(st: &sha1state) -> [u8] { if !st.computed { pad_msg(st); st.computed = true; } - let rs: [u8] = ~[]; + let rs: [u8] = []; for hpart: u32 in st.h { let a = hpart >> 24u32 & 0xFFu32 as u8; let b = hpart >> 16u32 & 0xFFu32 as u8; let c = hpart >> 8u32 & 0xFFu32 as u8; let d = hpart & 0xFFu32 as u8; - rs += ~[a, b, c, d]; + rs += [a, b, c, d]; } ret rs; } @@ -195,31 +193,31 @@ fn mk_sha1() -> sha1 { */ if st.msg_block_idx > 55u { - st.msg_block.(st.msg_block_idx) = 0x80u8; + st.msg_block[st.msg_block_idx] = 0x80u8; st.msg_block_idx += 1u; while st.msg_block_idx < msg_block_len { - st.msg_block.(st.msg_block_idx) = 0u8; + st.msg_block[st.msg_block_idx] = 0u8; st.msg_block_idx += 1u; } process_msg_block(st); } else { - st.msg_block.(st.msg_block_idx) = 0x80u8; + st.msg_block[st.msg_block_idx] = 0x80u8; st.msg_block_idx += 1u; } while st.msg_block_idx < 56u { - st.msg_block.(st.msg_block_idx) = 0u8; + st.msg_block[st.msg_block_idx] = 0u8; st.msg_block_idx += 1u; } // Store the message length as the last 8 octets - st.msg_block.(56) = st.len_high >> 24u32 & 0xFFu32 as u8; - st.msg_block.(57) = st.len_high >> 16u32 & 0xFFu32 as u8; - st.msg_block.(58) = st.len_high >> 8u32 & 0xFFu32 as u8; - st.msg_block.(59) = st.len_high & 0xFFu32 as u8; - st.msg_block.(60) = st.len_low >> 24u32 & 0xFFu32 as u8; - st.msg_block.(61) = st.len_low >> 16u32 & 0xFFu32 as u8; - st.msg_block.(62) = st.len_low >> 8u32 & 0xFFu32 as u8; - st.msg_block.(63) = st.len_low & 0xFFu32 as u8; + st.msg_block[56] = st.len_high >> 24u32 & 0xFFu32 as u8; + st.msg_block[57] = st.len_high >> 16u32 & 0xFFu32 as u8; + st.msg_block[58] = st.len_high >> 8u32 & 0xFFu32 as u8; + st.msg_block[59] = st.len_high & 0xFFu32 as u8; + st.msg_block[60] = st.len_low >> 24u32 & 0xFFu32 as u8; + st.msg_block[61] = st.len_low >> 16u32 & 0xFFu32 as u8; + st.msg_block[62] = st.len_low >> 8u32 & 0xFFu32 as u8; + st.msg_block[63] = st.len_low & 0xFFu32 as u8; process_msg_block(st); } obj sha1(st: sha1state) { @@ -230,11 +228,11 @@ fn mk_sha1() -> sha1 { st.len_low = 0u32; st.len_high = 0u32; st.msg_block_idx = 0u; - st.h.(0) = 0x67452301u32; - st.h.(1) = 0xEFCDAB89u32; - st.h.(2) = 0x98BADCFEu32; - st.h.(3) = 0x10325476u32; - st.h.(4) = 0xC3D2E1F0u32; + st.h[0] = 0x67452301u32; + st.h[1] = 0xEFCDAB89u32; + st.h[2] = 0x98BADCFEu32; + st.h[3] = 0x10325476u32; + st.h[4] = 0xC3D2E1F0u32; st.computed = false; } fn input(msg: &[u8]) { add_input(st, msg); } diff --git a/src/lib/sio.rs b/src/lib/sio.rs index bd75efa76a5..b506f92a97b 100644 --- a/src/lib/sio.rs +++ b/src/lib/sio.rs @@ -7,25 +7,17 @@ import str; import net; type ctx = aio::ctx; -type client = { ctx: ctx, client: aio::client, - evt: _port<aio::socket_event> }; -type server = { ctx: ctx, server: aio::server, - evt: _port<aio::server_event> }; +type client = {ctx: ctx, client: aio::client, evt: _port<aio::socket_event>}; +type server = {ctx: ctx, server: aio::server, evt: _port<aio::server_event>}; -fn new() -> ctx { - ret aio::new(); -} +fn new() -> ctx { ret aio::new(); } -fn destroy(ctx: ctx) { - send(ctx, aio::quit); -} +fn destroy(ctx: ctx) { send(ctx, aio::quit); } fn make_socket(ctx: ctx, p: _port<aio::socket_event>) -> client { let evt: aio::socket_event = p.recv(); alt evt { - aio::connected(client) { - ret { ctx: ctx, client: client, evt: p }; - } + aio::connected(client) { ret {ctx: ctx, client: client, evt: p}; } _ { fail "Could not connect to client"; } } } @@ -38,22 +30,17 @@ fn connect_to(ctx: ctx, ip: net::ip_addr, portnum: int) -> client { fn read(c: client) -> [u8] { alt c.evt.recv() { - aio::closed. { - ret ~[]; - } - aio::received(buf) { - ret buf; - } + aio::closed. { ret []; } + aio::received(buf) { ret buf; } } } fn create_server(ctx: ctx, ip: net::ip_addr, portnum: int) -> server { let evt: _port<aio::server_event> = mk_port(); let p: _port<aio::server> = mk_port(); - send(ctx, aio::serve(ip, portnum, - evt.mk_chan(), p.mk_chan())); + send(ctx, aio::serve(ip, portnum, evt.mk_chan(), p.mk_chan())); let srv: aio::server = p.recv(); - ret { ctx: ctx, server: srv, evt: evt }; + ret {ctx: ctx, server: srv, evt: evt}; } fn accept_from(server: server) -> client { @@ -85,15 +72,8 @@ fn close_server(server: server) { fn close_client(client: client) { send(client.ctx, aio::close_client(client.client)); let evt: aio::socket_event; - do { - evt = client.evt.recv(); - alt evt { - aio::closed. { - ret; - } - _ {} - } - } while (true); + do { evt = client.evt.recv(); alt evt { aio::closed. { ret; } _ { } } } + while true } // Local Variables: diff --git a/src/lib/smallintmap.rs b/src/lib/smallintmap.rs index 6eca2eccc23..d5dcd6bcc78 100644 --- a/src/lib/smallintmap.rs +++ b/src/lib/smallintmap.rs @@ -10,7 +10,7 @@ import option::some; type smallintmap<T> = @{mutable v: [mutable option::t<T>]}; fn mk<@T>() -> smallintmap<T> { - let v: [mutable option::t<T>] = ~[mutable]; + let v: [mutable option::t<T>] = [mutable]; ret @{mutable v: v}; } @@ -19,7 +19,7 @@ fn insert<@T>(m: &smallintmap<T>, key: uint, val: &T) { } fn find<@T>(m: &smallintmap<T>, key: uint) -> option::t<T> { - if key < vec::len::<option::t<T>>(m.v) { ret m.v.(key); } + if key < vec::len::<option::t<T>>(m.v) { ret m.v[key]; } ret none::<T>; } diff --git a/src/lib/sort.rs b/src/lib/sort.rs index 137cf0495ca..2a43bde42be 100644 --- a/src/lib/sort.rs +++ b/src/lib/sort.rs @@ -6,20 +6,20 @@ export merge_sort; export quick_sort; export quick_sort3; -type lteq<T> = block(&T, &T) -> bool ; +type lteq<T> = block(&T, &T) -> bool; fn merge_sort<@T>(le: <eq<T>, v: &[T]) -> [T] { fn merge<@T>(le: <eq<T>, a: &[T], b: &[T]) -> [T] { - let rs: [T] = ~[]; + let rs: [T] = []; let a_len: uint = len::<T>(a); let a_ix: uint = 0u; let b_len: uint = len::<T>(b); let b_ix: uint = 0u; while a_ix < a_len && b_ix < b_len { - if le(a.(a_ix), b.(b_ix)) { - rs += ~[a.(a_ix)]; + if le(a[a_ix], b[b_ix]) { + rs += [a[a_ix]]; a_ix += 1u; - } else { rs += ~[b.(b_ix)]; b_ix += 1u; } + } else { rs += [b[b_ix]]; b_ix += 1u; } } rs += slice::<T>(a, a_ix, a_len); rs += slice::<T>(b, b_ix, b_len); @@ -34,19 +34,19 @@ fn merge_sort<@T>(le: <eq<T>, v: &[T]) -> [T] { } fn swap<@T>(arr: &[mutable T], x: uint, y: uint) { - let a = arr.(x); - arr.(x) = arr.(y); - arr.(y) = a; + let a = arr[x]; + arr[x] = arr[y]; + arr[y] = a; } fn part<@T>(compare_func: <eq<T>, arr: &[mutable T], left: uint, right: uint, pivot: uint) -> uint { - let pivot_value = arr.(pivot); + let pivot_value = arr[pivot]; swap::<T>(arr, pivot, right); let storage_index: uint = left; let i: uint = left; while i < right { - if compare_func({ arr.(i) }, pivot_value) { + if compare_func({ arr[i] }, pivot_value) { swap::<T>(arr, i, storage_index); storage_index += 1u; } @@ -82,26 +82,26 @@ fn quick_sort<@T>(compare_func: <eq<T>, arr: &[mutable T]) { fn qsort3<@T>(compare_func_lt: <eq<T>, compare_func_eq: <eq<T>, arr: &[mutable T], left: int, right: int) { if right <= left { ret; } - let v: T = arr.(right); + let v: T = arr[right]; let i: int = left - 1; let j: int = right; let p: int = i; let q: int = j; while true { i += 1; - while compare_func_lt({ arr.(i) }, v) { i += 1; } + while compare_func_lt({ arr[i] }, v) { i += 1; } j -= 1; - while compare_func_lt(v, { arr.(j) }) { + while compare_func_lt(v, { arr[j] }) { if j == left { break; } j -= 1; } if i >= j { break; } swap::<T>(arr, i as uint, j as uint); - if compare_func_eq({ arr.(i) }, v) { + if compare_func_eq({ arr[i] }, v) { p += 1; swap::<T>(arr, p as uint, i as uint); } - if compare_func_eq(v, { arr.(j) }) { + if compare_func_eq(v, { arr[j] }) { q -= 1; swap::<T>(arr, j as uint, q as uint); } @@ -131,7 +131,7 @@ fn quick_sort3<@T>(compare_func_lt: <eq<T>, compare_func_eq: <eq<T>, arr: &[mutable T]) { if len::<T>(arr) == 0u { ret; } qsort3::<T>(compare_func_lt, compare_func_eq, arr, 0, - (len::<T>(arr) as int) - 1); + (len::<T>(arr) as int) - 1); } // Local Variables: diff --git a/src/lib/str.rs b/src/lib/str.rs index df9f6817343..98e59f70b4f 100644 --- a/src/lib/str.rs +++ b/src/lib/str.rs @@ -73,8 +73,8 @@ fn eq(a: &str, b: &str) -> bool { if byte_len(b) != i { ret false; } while i > 0u { i -= 1u; - let cha = a.(i); - let chb = b.(i); + let cha = a[i]; + let chb = b[i]; if cha != chb { ret false; } } ret true; @@ -87,9 +87,9 @@ fn lteq(a: &str, b: &str) -> bool { if j < n { n = j; } let x: uint = 0u; while x < n { - let cha = a.(x); - let chb = b.(x); - if cha < chb { ret true; } else if (cha > chb) { ret false; } + let cha = a[x]; + let chb = b[x]; + if cha < chb { ret true; } else if cha > chb { ret false; } x += 1u; } ret i <= j; @@ -134,12 +134,12 @@ fn is_utf8(v: &[u8]) -> bool { let i = 0u; let total = vec::len::<u8>(v); while i < total { - let chsize = utf8_char_width(v.(i)); + let chsize = utf8_char_width(v[i]); if chsize == 0u { ret false; } if i + chsize > total { ret false; } i += 1u; while chsize > 1u { - if v.(i) & 192u8 != tag_cont_u8 { ret false; } + if v[i] & 192u8 != tag_cont_u8 { ret false; } i += 1u; chsize -= 1u; } @@ -149,7 +149,7 @@ fn is_utf8(v: &[u8]) -> bool { fn is_ascii(s: str) -> bool { let i: uint = byte_len(s); - while i > 0u { i -= 1u; if s.(i) & 128u8 != 0u8 { ret false; } } + while i > 0u { i -= 1u; if s[i] & 128u8 != 0u8 { ret false; } } ret true; } @@ -165,9 +165,7 @@ fn is_whitespace(s: str) -> bool { let i = 0u; let len = char_len(s); while i < len { - if !char::is_whitespace(char_at(s, i)) { - ret false; - } + if !char::is_whitespace(char_at(s, i)) { ret false; } i += 1u } ret true; @@ -192,7 +190,7 @@ fn unsafe_from_bytes(v: &[mutable? u8]) -> str { ret rustrt::str_from_ivec(v); } -fn unsafe_from_byte(u: u8) -> str { ret rustrt::str_from_ivec(~[u]); } +fn unsafe_from_byte(u: u8) -> str { ret rustrt::str_from_ivec([u]); } fn str_from_cstr(cstr: sbuf) -> str { ret rustrt::str_from_cstr(cstr); } @@ -204,19 +202,19 @@ fn push_utf8_bytes(s: &mutable str, ch: char) { let code = ch as uint; if code < max_one_b { s = rustrt::str_push_byte(s, code); - } else if (code < max_two_b) { + } else if code < max_two_b { s = rustrt::str_push_byte(s, code >> 6u & 31u | tag_two_b); s = rustrt::str_push_byte(s, code & 63u | tag_cont); - } else if (code < max_three_b) { + } else if code < max_three_b { s = rustrt::str_push_byte(s, code >> 12u & 15u | tag_three_b); s = rustrt::str_push_byte(s, code >> 6u & 63u | tag_cont); s = rustrt::str_push_byte(s, code & 63u | tag_cont); - } else if (code < max_four_b) { + } else if code < max_four_b { s = rustrt::str_push_byte(s, code >> 18u & 7u | tag_four_b); s = rustrt::str_push_byte(s, code >> 12u & 63u | tag_cont); s = rustrt::str_push_byte(s, code >> 6u & 63u | tag_cont); s = rustrt::str_push_byte(s, code & 63u | tag_cont); - } else if (code < max_five_b) { + } else if code < max_five_b { s = rustrt::str_push_byte(s, code >> 24u & 3u | tag_five_b); s = rustrt::str_push_byte(s, code >> 18u & 63u | tag_cont); s = rustrt::str_push_byte(s, code >> 12u & 63u | tag_cont); @@ -259,7 +257,7 @@ fn utf8_char_width(b: u8) -> uint { } fn char_range_at(s: str, i: uint) -> {ch: char, next: uint} { - let b0 = s.(i); + let b0 = s[i]; let w = utf8_char_width(b0); assert (w != 0u); if w == 1u { ret {ch: b0 as char, next: i + 1u}; } @@ -267,7 +265,7 @@ fn char_range_at(s: str, i: uint) -> {ch: char, next: uint} { let end = i + w; i += 1u; while i < end { - let byte = s.(i); + let byte = s[i]; assert (byte & 192u8 == tag_cont_u8); val <<= 6u; val += byte & 63u8 as uint; @@ -288,7 +286,7 @@ fn char_len(s: str) -> uint { let len = 0u; let total = byte_len(s); while i < total { - let chsize = utf8_char_width(s.(i)); + let chsize = utf8_char_width(s[i]); assert (chsize > 0u); len += 1u; i += chsize; @@ -298,12 +296,12 @@ fn char_len(s: str) -> uint { } fn to_chars(s: str) -> [char] { - let buf: [char] = ~[]; + let buf: [char] = []; let i = 0u; let len = byte_len(s); while i < len { let cur = char_range_at(s, i); - buf += ~[cur.ch]; + buf += [cur.ch]; i = cur.next; } ret buf; @@ -313,7 +311,7 @@ fn push_char(s: &mutable str, ch: char) { s += from_char(ch); } fn pop_char(s: &mutable str) -> char { let end = byte_len(s); - while end > 0u && s.(end - 1u) & 192u8 == tag_cont_u8 { end -= 1u; } + while end > 0u && s[end - 1u] & 192u8 == tag_cont_u8 { end -= 1u; } assert (end > 0u); let ch = char_at(s, end - 1u); s = substr(s, 0u, end - 1u); @@ -343,7 +341,7 @@ fn index(s: str, c: u8) -> int { fn rindex(s: str, c: u8) -> int { let n: int = str::byte_len(s) as int; - while n >= 0 { if s.(n) == c { ret n; } n -= 1; } + while n >= 0 { if s[n] == c { ret n; } n -= 1; } ret n; } @@ -353,7 +351,7 @@ fn find(haystack: str, needle: str) -> int { if needle_len == 0 { ret 0; } fn match_at(haystack: &str, needle: &str, i: int) -> bool { let j: int = i; - for c: u8 in needle { if haystack.(j) != c { ret false; } j += 1; } + for c: u8 in needle { if haystack[j] != c { ret false; } j += 1; } ret true; } let i: int = 0; @@ -377,7 +375,7 @@ fn ends_with(haystack: str, needle: str) -> bool { let needle_len: uint = byte_len(needle); ret if needle_len == 0u { true - } else if (needle_len > haystack_len) { + } else if needle_len > haystack_len { false } else { eq(substr(haystack, haystack_len - needle_len, needle_len), @@ -397,18 +395,19 @@ fn slice(s: str, begin: uint, end: uint) -> str { ret rustrt::str_slice(s, begin, end); } -fn safe_slice(s: str, begin: uint, end: uint): le(begin, end) -> str { +fn safe_slice(s: str, begin: uint, end: uint) : le(begin, end) -> str { assert (end <= str::byte_len(s)); // would need some magic to // make this a precondition + ret rustrt::str_slice(s, begin, end); } fn shift_byte(s: &mutable str) -> u8 { let len = byte_len(s); assert (len > 0u); - let b = s.(0); + let b = s[0]; s = substr(s, 1u, len - 1u); ret b; } @@ -416,7 +415,7 @@ fn shift_byte(s: &mutable str) -> u8 { fn pop_byte(s: &mutable str) -> u8 { let len = byte_len(s); assert (len > 0u); - let b = s.(len - 1u); + let b = s[len - 1u]; s = substr(s, 0u, len - 1u); ret b; } @@ -433,17 +432,17 @@ fn unshift_byte(s: &mutable str, b: u8) { } fn split(s: str, sep: u8) -> [str] { - let v: [str] = ~[]; + let v: [str] = []; let accum: str = ""; let ends_with_sep: bool = false; for c: u8 in s { if c == sep { - v += ~[accum]; + v += [accum]; accum = ""; ends_with_sep = true; } else { accum += unsafe_from_byte(c); ends_with_sep = false; } } - if str::byte_len(accum) != 0u || ends_with_sep { v += ~[accum]; } + if str::byte_len(accum) != 0u || ends_with_sep { v += [accum]; } ret v; } @@ -486,10 +485,10 @@ fn replace(s: str, from: str, to: str) : is_not_empty(from) -> str { check (is_not_empty(from)); if byte_len(s) == 0u { ret ""; - } else if (starts_with(s, from)) { + } else if starts_with(s, from) { ret to + replace(slice(s, byte_len(from), byte_len(s)), from, to); } else { - ret unsafe_from_byte(s.(0)) + + ret unsafe_from_byte(s[0]) + replace(slice(s, 1u, byte_len(s)), from, to); } } @@ -503,9 +502,7 @@ fn trim_left(s: &str) -> str { fn count_whities(s: &[char]) -> uint { let i = 0u; while i < vec::len(s) { - if !char::is_whitespace(s.(i)) { - break; - } + if !char::is_whitespace(s[i]) { break; } i += 1u; } ret i; @@ -519,9 +516,7 @@ fn trim_right(s: &str) -> str { fn count_whities(s: &[char]) -> uint { let i = vec::len(s); while 0u < i { - if !char::is_whitespace(s.(i - 1u)) { - break; - } + if !char::is_whitespace(s[i - 1u]) { break; } i -= 1u; } ret i; @@ -531,9 +526,7 @@ fn trim_right(s: &str) -> str { ret from_chars(vec::slice(chars, 0u, whities)); } -fn trim(s: &str) -> str { - trim_left(trim_right(s)) -} +fn trim(s: &str) -> str { trim_left(trim_right(s)) } // Local Variables: // mode: rust; diff --git a/src/lib/task.rs b/src/lib/task.rs index 9ed8e8ecdf0..fd971b27477 100644 --- a/src/lib/task.rs +++ b/src/lib/task.rs @@ -19,43 +19,35 @@ native "rust" mod rustrt { fn set_min_stack(stack_size: uint); fn new_task() -> task_id; - fn drop_task(task : *rust_task); - fn get_task_pointer(id : task_id) -> *rust_task; - fn start_task(id : task_id); + fn drop_task(task: *rust_task); + fn get_task_pointer(id: task_id) -> *rust_task; + fn start_task(id: task_id); fn get_task_trampoline() -> u32; - fn migrate_alloc(alloc : *u8, target : task_id); + fn migrate_alloc(alloc: *u8, target: task_id); - fn leak<@T>(thing : -T); + fn leak<@T>(thing: -T); } -type rust_task = { - id : task, - mutable notify_enabled : u8, - mutable notify_chan : comm::chan_handle<task_notification>, - ctx : task_context, - stack_ptr : *u8 -}; - -type task_context = { - regs : x86_registers, - next : *u8 -}; - -resource rust_task_ptr(task : *rust_task) { - rustrt::drop_task(task); -} +type rust_task = + {id: task, + mutable notify_enabled: u8, + mutable notify_chan: comm::chan_handle<task_notification>, + ctx: task_context, + stack_ptr: *u8}; + +type task_context = {regs: x86_registers, next: *u8}; + +resource rust_task_ptr(task: *rust_task) { rustrt::drop_task(task); } -fn get_task_ptr(id : task) -> rust_task_ptr { +fn get_task_ptr(id: task) -> rust_task_ptr { ret rust_task_ptr(rustrt::get_task_pointer(id)); } type task = int; type task_id = task; -fn get_task_id() -> task_id { - rustrt::get_task_id() -} +fn get_task_id() -> task_id { rustrt::get_task_id() } /** * Hints the scheduler to yield this task for a specified ammount of time. @@ -68,22 +60,20 @@ fn yield() { ret rustrt::task_yield(); } tag task_result { tr_success; tr_failure; } -tag task_notification { - exit(task, task_result); -} +tag task_notification { exit(task, task_result); } -fn join(task_port : (task_id, comm::port<task_notification>)) - -> task_result { +fn join(task_port: (task_id, comm::port<task_notification>)) -> task_result { let (id, port) = task_port; alt comm::recv::<task_notification>(port) { exit(_id, res) { - if _id == id { ret res } - else { fail #fmt("join received id %d, expected %d", _id, id) } + if _id == id { + ret res + } else { fail #fmt["join received id %d, expected %d", _id, id] } } } } -fn join_id(t : task_id) -> task_result { +fn join_id(t: task_id) -> task_result { alt rustrt::task_join(t) { 0 { tr_success } _ { tr_failure } } } @@ -93,33 +83,25 @@ fn pin() { rustrt::pin_task(); } fn unpin() { rustrt::unpin_task(); } -fn set_min_stack(stack_size : uint) { - rustrt::set_min_stack(stack_size); -} +fn set_min_stack(stack_size: uint) { rustrt::set_min_stack(stack_size); } -fn _spawn(thunk : -fn() -> ()) -> task { - spawn(thunk) -} +fn _spawn(thunk: -fn()) -> task { spawn(thunk) } -fn spawn(thunk : -fn() -> ()) -> task { - spawn_inner(thunk, none) -} +fn spawn(thunk: -fn()) -> task { spawn_inner(thunk, none) } -fn spawn_notify(thunk : -fn() -> (), notify : comm::chan<task_notification>) - -> task { +fn spawn_notify(thunk: -fn(), notify: comm::chan<task_notification>) -> task { spawn_inner(thunk, some(notify)) } -fn spawn_joinable(thunk : -fn()) -> (task_id, comm::port<task_notification>) { +fn spawn_joinable(thunk: -fn()) -> (task_id, comm::port<task_notification>) { let p = comm::port::<task_notification>(); let id = spawn_notify(thunk, comm::chan::<task_notification>(p)); ret (id, p); } // FIXME: make this a fn~ once those are supported. -fn spawn_inner(thunk : -fn() -> (), - notify : option<comm::chan<task_notification>>) - -> task_id { +fn spawn_inner(thunk: -fn(), notify: option<comm::chan<task_notification>>) -> + task_id { let id = rustrt::new_task(); // the order of arguments are outptr, taskptr, envptr. @@ -129,21 +111,21 @@ fn spawn_inner(thunk : -fn() -> (), // set up the task pointer let task_ptr = get_task_ptr(id); let regs = ptr::addr_of((**task_ptr).ctx.regs); - (*regs).edx = cast(*task_ptr); + (*regs).edx = cast(*task_ptr);; (*regs).esp = cast((**task_ptr).stack_ptr); - assert ptr::null() != (**task_ptr).stack_ptr; + assert (ptr::null() != (**task_ptr).stack_ptr); - let raw_thunk : { code: u32, env: u32 } = cast(thunk); + let raw_thunk: {code: u32, env: u32} = cast(thunk); (*regs).eip = raw_thunk.code; // set up notifications if they are enabled. alt notify { some(c) { - (**task_ptr).notify_enabled = 1u8; + (**task_ptr).notify_enabled = 1u8;; (**task_ptr).notify_chan = *c; } - none {} + none { } }; // okay, now we align the stack and add the environment pointer and a fake @@ -153,15 +135,15 @@ fn spawn_inner(thunk : -fn() -> (), // -4 for the return address. (*regs).esp = align_down((*regs).esp - 12u32) - 4u32; - let ra : *mutable u32 = cast((*regs).esp); - let env : *mutable u32 = cast((*regs).esp+4u32); - let tptr : *mutable u32 = cast((*regs).esp+12u32); + let ra: *mutable u32 = cast((*regs).esp); + let env: *mutable u32 = cast((*regs).esp + 4u32); + let tptr: *mutable u32 = cast((*regs).esp + 12u32); // put the return pointer in ecx. - (*regs).ecx = (*regs).esp + 8u32; + (*regs).ecx = (*regs).esp + 8u32;; - *tptr = cast(*task_ptr); - *env = raw_thunk.env; + *tptr = cast(*task_ptr);; + *env = raw_thunk.env;; *ra = rustrt::get_task_trampoline(); rustrt::migrate_alloc(cast(raw_thunk.env), id); @@ -173,31 +155,31 @@ fn spawn_inner(thunk : -fn() -> (), } // Who says we can't write an operating system in Rust? -type x86_registers = { +type x86_registers = // This needs to match the structure in context.h - mutable eax : u32, - mutable ebx : u32, - mutable ecx : u32, - mutable edx : u32, - mutable ebp : u32, - mutable esi : u32, - mutable edi : u32, - mutable esp : u32, - - mutable cs : u16, - mutable ds : u16, - mutable ss : u16, - mutable es : u16, - mutable fs : u16, - mutable gs : u16, - - mutable eflags : u32, - mutable eip : u32 -}; - -fn align_down(x : u32) -> u32 { + + + {mutable eax: u32, + mutable ebx: u32, + mutable ecx: u32, + mutable edx: u32, + mutable ebp: u32, + mutable esi: u32, + mutable edi: u32, + mutable esp: u32, + mutable cs: u16, + mutable ds: u16, + mutable ss: u16, + mutable es: u16, + mutable fs: u16, + mutable gs: u16, + mutable eflags: u32, + mutable eip: u32}; + +fn align_down(x: u32) -> u32 { + // Aligns x down to 16 bytes - x & !(15u32) + x & !15u32 } // Local Variables: diff --git a/src/lib/term.rs b/src/lib/term.rs index 8891a9ddadd..cfec5ff6b8f 100644 --- a/src/lib/term.rs +++ b/src/lib/term.rs @@ -40,15 +40,15 @@ const color_bright_cyan: u8 = 14u8; const color_bright_white: u8 = 15u8; -fn esc(writer: io::buf_writer) { writer.write(~[0x1bu8, '[' as u8]); } +fn esc(writer: io::buf_writer) { writer.write([0x1bu8, '[' as u8]); } fn reset(writer: io::buf_writer) { esc(writer); - writer.write(~['0' as u8, 'm' as u8]); + writer.write(['0' as u8, 'm' as u8]); } fn color_supported() -> bool { - let supported_terms = ~["xterm-color", "xterm", "screen-bce"]; + let supported_terms = ["xterm-color", "xterm", "screen-bce"]; ret alt generic_os::getenv("TERM") { option::some(env) { for term: str in supported_terms { @@ -63,8 +63,8 @@ fn color_supported() -> bool { fn set_color(writer: io::buf_writer, first_char: u8, color: u8) { assert (color < 16u8); esc(writer); - if color >= 8u8 { writer.write(~['1' as u8, ';' as u8]); color -= 8u8; } - writer.write(~[first_char, ('0' as u8) + color, 'm' as u8]); + if color >= 8u8 { writer.write(['1' as u8, ';' as u8]); color -= 8u8; } + writer.write([first_char, ('0' as u8) + color, 'm' as u8]); } fn fg(writer: io::buf_writer, color: u8) { diff --git a/src/lib/test.rs b/src/lib/test.rs index b725507502b..72e5eb75597 100644 --- a/src/lib/test.rs +++ b/src/lib/test.rs @@ -41,7 +41,7 @@ type test_name = str; // the test succeeds; if the function fails then the test fails. We // may need to come up with a more clever definition of test in order // to support isolation of tests into tasks. -type test_fn = fn() ; +type test_fn = fn(); // The definition of a single test. A test runner will run a list of // these. @@ -69,7 +69,7 @@ fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res { // FIXME (#649): Shouldn't have to check here check (vec::is_not_empty(args)); let args_ = vec::tail(args); - let opts = ~[getopts::optflag("ignored")]; + let opts = [getopts::optflag("ignored")]; let match = alt getopts::getopts(args_, opts) { getopts::success(m) { m } @@ -78,7 +78,7 @@ fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res { let filter = if vec::len(match.free) > 0u { - option::some(match.free.(0)) + option::some(match.free[0]) } else { option::none }; let run_ignored = getopts::opt_present(match, "ignored"); @@ -106,25 +106,22 @@ fn run_tests_console(opts: &test_opts, tests: &[test_desc]) -> bool { fn run_tests_console_(opts: &test_opts, tests: &[test_desc], to_task: &test_to_task) -> bool { - type test_state = @{ - out: io::writer, - use_color: bool, - mutable total: uint, - mutable passed: uint, - mutable failed: uint, - mutable ignored: uint, - mutable failures: [test_desc] - }; + type test_state = + @{out: io::writer, + use_color: bool, + mutable total: uint, + mutable passed: uint, + mutable failed: uint, + mutable ignored: uint, + mutable failures: [test_desc]}; fn callback(event: testevent, st: test_state) { alt event { te_filtered(filtered_tests) { st.total = vec::len(filtered_tests); - st.out.write_line(#fmt("\nrunning %u tests", st.total)); - } - te_wait(test) { - st.out.write_str(#fmt("test %s ... ", test.name)); + st.out.write_line(#fmt["\nrunning %u tests", st.total]); } + te_wait(test) { st.out.write_str(#fmt["test %s ... ", test.name]); } te_result(test, result) { alt result { tr_ok. { @@ -136,7 +133,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], st.failed += 1u; write_failed(st.out, st.use_color); st.out.write_line(""); - st.failures += ~[test]; + st.failures += [test]; } tr_ignored. { st.ignored += 1u; @@ -148,37 +145,35 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], } } - let st = @{ - out: io::stdout(), - use_color: use_color(), - mutable total: 0u, - mutable passed: 0u, - mutable failed: 0u, - mutable ignored: 0u, - mutable failures: ~[] - }; + let st = + @{out: io::stdout(), + use_color: use_color(), + mutable total: 0u, + mutable passed: 0u, + mutable failed: 0u, + mutable ignored: 0u, + mutable failures: []}; - run_tests(opts, tests, to_task, - bind callback(_, st)); + run_tests(opts, tests, to_task, bind callback(_, st)); - assert st.passed + st.failed + st.ignored == st.total; + assert (st.passed + st.failed + st.ignored == st.total); let success = st.failed == 0u; if !success { st.out.write_line("\nfailures:"); for test: test_desc in st.failures { let testname = test.name; // Satisfy alias analysis - st.out.write_line(#fmt(" %s", testname)); + st.out.write_line(#fmt[" %s", testname]); } } - st.out.write_str(#fmt("\nresult: ")); + st.out.write_str(#fmt["\nresult: "]); if success { // There's no parallelism at this point so it's safe to use color write_ok(st.out, true); } else { write_failed(st.out, true); } - st.out.write_str(#fmt(". %u passed; %u failed; %u ignored\n\n", - st.passed, st.failed, st.ignored)); + st.out.write_str(#fmt[". %u passed; %u failed; %u ignored\n\n", st.passed, + st.failed, st.ignored]); ret success; @@ -206,9 +201,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc], } } -fn use_color() -> bool { - ret get_concurrency() == 1u; -} +fn use_color() -> bool { ret get_concurrency() == 1u; } tag testevent { te_filtered([test_desc]); @@ -216,8 +209,8 @@ tag testevent { te_result(test_desc, test_result); } -fn run_tests(opts: &test_opts, tests: &[test_desc], - to_task: &test_to_task, callback: fn(testevent)) { +fn run_tests(opts: &test_opts, tests: &[test_desc], to_task: &test_to_task, + callback: fn(testevent)) { let filtered_tests = filter_tests(opts, tests); @@ -227,19 +220,19 @@ fn run_tests(opts: &test_opts, tests: &[test_desc], // provide a great user experience because you might sit waiting for the // result of a particular test for an unusually long amount of time. let concurrency = get_concurrency(); - log #fmt("using %u test tasks", concurrency); + log #fmt["using %u test tasks", concurrency]; let total = vec::len(filtered_tests); let run_idx = 0u; let wait_idx = 0u; - let futures = ~[]; + let futures = []; while wait_idx < total { while vec::len(futures) < concurrency && run_idx < total { - futures += ~[run_test(filtered_tests.(run_idx), to_task)]; + futures += [run_test(filtered_tests[run_idx], to_task)]; run_idx += 1u; } - let future = futures.(0); + let future = futures[0]; callback(te_wait(future.test)); let result = future.wait(); callback(te_result(future.test, result)); @@ -306,33 +299,26 @@ fn filter_tests(opts: &test_opts, tests: &[test_desc]) -> [test_desc] { ret filtered; } -type test_future = - {test: test_desc, wait: fn() -> test_result }; +type test_future = {test: test_desc, wait: fn() -> test_result}; fn run_test(test: &test_desc, to_task: &test_to_task) -> test_future { if !test.ignore { let test_task = to_task(test.fn); ret {test: test, wait: - bind fn (test_task: joinable)-> test_result { - alt task::join(test_task) { - task::tr_success. { tr_ok } - task::tr_failure. { tr_failed } - } - }(test_task)}; - } else { - ret {test: test, - wait: fn () -> test_result { tr_ignored }}; - } + bind fn (test_task: joinable) -> test_result { + alt task::join(test_task) { + task::tr_success. { tr_ok } + task::tr_failure. { tr_failed } + } + }(test_task)}; + } else { ret {test: test, wait: fn () -> test_result { tr_ignored }}; } } // We need to run our tests in another task in order to trap test failures. // This function only works with functions that don't contain closures. fn default_test_to_task(f: &fn()) -> joinable { - fn run_task(f: fn()) { - configure_test_task(); - f(); - } + fn run_task(f: fn()) { configure_test_task(); f(); } ret task::spawn_joinable(bind run_task(f)); } diff --git a/src/lib/time.rs b/src/lib/time.rs index cf8ddfc6323..c92bdb61f30 100644 --- a/src/lib/time.rs +++ b/src/lib/time.rs @@ -18,4 +18,4 @@ fn precise_time_ns() -> u64 { let ns = 0u64; rustrt::nano_time(ns); ret ns; } fn precise_time_s() -> float { ret (precise_time_ns() as float) / 1000000000.; -} \ No newline at end of file +} diff --git a/src/lib/u64.rs b/src/lib/u64.rs index 12197adaedf..8082f7aef0d 100644 --- a/src/lib/u64.rs +++ b/src/lib/u64.rs @@ -33,4 +33,4 @@ fn to_str(n: u64, radix: uint) -> str { ret s; } -fn str(n: u64) -> str { ret to_str(n, 10u); } \ No newline at end of file +fn str(n: u64) -> str { ret to_str(n, 10u); } diff --git a/src/lib/ufind.rs b/src/lib/ufind.rs index 12e85a98b7c..f225a2a7ca3 100644 --- a/src/lib/ufind.rs +++ b/src/lib/ufind.rs @@ -10,11 +10,11 @@ type node = option::t<uint>; type ufind = {mutable nodes: [mutable node]}; -fn make() -> ufind { ret {mutable nodes: ~[mutable]}; } +fn make() -> ufind { ret {mutable nodes: [mutable]}; } fn make_set(ufnd: &ufind) -> uint { let idx = vec::len(ufnd.nodes); - ufnd.nodes += ~[mutable none::<uint>]; + ufnd.nodes += [mutable none::<uint>]; ret idx; } @@ -26,7 +26,7 @@ fn grow(ufnd: &ufind, n: uint) { } fn find(ufnd: &ufind, n: uint) -> uint { - alt ufnd.nodes.(n) { + alt ufnd.nodes[n] { none. { ret n; } some(m) { let m_ = m; be find(ufnd, m_); } } @@ -36,10 +36,8 @@ fn union(ufnd: &ufind, m: uint, n: uint) { let m_root = find(ufnd, m); let n_root = find(ufnd, n); if m_root < n_root { - ufnd.nodes.(n_root) = some::<uint>(m_root); - } else if (m_root > n_root) { - ufnd.nodes.(m_root) = some::<uint>(n_root); - } + ufnd.nodes[n_root] = some::<uint>(m_root); + } else if m_root > n_root { ufnd.nodes[m_root] = some::<uint>(n_root); } } fn set_count(ufnd: &ufind) -> uint { ret vec::len::<node>(ufnd.nodes); } diff --git a/src/lib/uint.rs b/src/lib/uint.rs index 8be0df57fd7..94517b29f27 100644 --- a/src/lib/uint.rs +++ b/src/lib/uint.rs @@ -51,7 +51,7 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint { let power = 1u; let n = 0u; while true { - n += (buf.(i) - ('0' as u8) as uint) * power; + n += (buf[i] - ('0' as u8) as uint) * power; power *= radix; if i == 0u { ret n; } i -= 1u; @@ -59,9 +59,7 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint { fail; } -fn from_str(s : &str) -> uint { - parse_buf(str::bytes(s), 10u) -} +fn from_str(s: &str) -> uint { parse_buf(str::bytes(s), 10u) } fn to_str(num: uint, radix: uint) -> str { let n = num; @@ -95,7 +93,7 @@ fn to_str(num: uint, radix: uint) -> str { } let s1: str = ""; let len: uint = str::byte_len(s); - while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s.(len)); } + while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s[len]); } ret s1; } fn str(i: uint) -> str { ret to_str(i, 10u); } diff --git a/src/lib/vec.rs b/src/lib/vec.rs index a2222dfbf21..dde4fc7505b 100644 --- a/src/lib/vec.rs +++ b/src/lib/vec.rs @@ -28,51 +28,51 @@ fn to_ptr<T>(v: &[T]) -> *T { ret rustrt::ivec_to_ptr(v); } fn len<T>(v: &[mutable? T]) -> uint { ret rusti::ivec_len(v); } -type init_op<T> = fn(uint) -> T ; +type init_op<T> = fn(uint) -> T; fn init_fn<@T>(op: &init_op<T>, n_elts: uint) -> [T] { - let v = ~[]; + let v = []; reserve(v, n_elts); let i: uint = 0u; - while i < n_elts { v += ~[op(i)]; i += 1u; } + while i < n_elts { v += [op(i)]; i += 1u; } ret v; } // TODO: Remove me once we have slots. fn init_fn_mut<@T>(op: &init_op<T>, n_elts: uint) -> [mutable T] { - let v = ~[mutable]; + let v = [mutable]; reserve(v, n_elts); let i: uint = 0u; - while i < n_elts { v += ~[mutable op(i)]; i += 1u; } + while i < n_elts { v += [mutable op(i)]; i += 1u; } ret v; } fn init_elt<@T>(t: &T, n_elts: uint) -> [T] { - let v = ~[]; + let v = []; reserve(v, n_elts); let i: uint = 0u; - while i < n_elts { v += ~[t]; i += 1u; } + while i < n_elts { v += [t]; i += 1u; } ret v; } // TODO: Remove me once we have slots. fn init_elt_mut<@T>(t: &T, n_elts: uint) -> [mutable T] { - let v = ~[mutable]; + let v = [mutable]; reserve(v, n_elts); let i: uint = 0u; - while i < n_elts { v += ~[mutable t]; i += 1u; } + while i < n_elts { v += [mutable t]; i += 1u; } ret v; } fn to_mut<@T>(v: &[T]) -> [mutable T] { - let vres = ~[mutable]; - for t: T in v { vres += ~[mutable t]; } + let vres = [mutable]; + for t: T in v { vres += [mutable t]; } ret vres; } fn from_mut<@T>(v: &[mutable T]) -> [T] { - let vres = ~[]; - for t: T in v { vres += ~[t]; } + let vres = []; + for t: T in v { vres += [t]; } ret vres; } @@ -88,7 +88,7 @@ pred is_not_empty<T>(v: &[mutable? T]) -> bool { ret !is_empty(v); } // Accessors /// Returns the first element of a vector -fn head<@T>(v: &[mutable? T]) : is_not_empty(v) -> T { ret v.(0); } +fn head<@T>(v: &[mutable? T]) : is_not_empty(v) -> T { ret v[0]; } /// Returns all but the first element of a vector fn tail<@T>(v: &[mutable? T]) : is_not_empty(v) -> [mutable? T] { @@ -98,17 +98,17 @@ fn tail<@T>(v: &[mutable? T]) : is_not_empty(v) -> [mutable? T] { /// Returns the last element of `v`. fn last<@T>(v: &[mutable? T]) -> option::t<T> { if len(v) == 0u { ret none; } - ret some(v.(len(v) - 1u)); + ret some(v[len(v) - 1u]); } /// Returns a copy of the elements from [`start`..`end`) from `v`. fn slice<@T>(v: &[mutable? T], start: uint, end: uint) -> [T] { assert (start <= end); assert (end <= len(v)); - let result = ~[]; + let result = []; reserve(result, end - start); let i = start; - while i < end { result += ~[v.(i)]; i += 1u; } + while i < end { result += [v[i]]; i += 1u; } ret result; } @@ -116,10 +116,10 @@ fn slice<@T>(v: &[mutable? T], start: uint, end: uint) -> [T] { fn slice_mut<@T>(v: &[mutable? T], start: uint, end: uint) -> [mutable T] { assert (start <= end); assert (end <= len(v)); - let result = ~[mutable]; + let result = [mutable]; reserve(result, end - start); let i = start; - while i < end { result += ~[mutable v.(i)]; i += 1u; } + while i < end { result += [mutable v[i]]; i += 1u; } ret result; } @@ -129,7 +129,7 @@ fn slice_mut<@T>(v: &[mutable? T], start: uint, end: uint) -> [mutable T] { fn shift<@T>(v: &mutable [mutable? T]) -> T { let ln = len::<T>(v); assert (ln > 0u); - let e = v.(0); + let e = v[0]; v = slice::<T>(v, 1u, ln); ret e; } @@ -139,7 +139,7 @@ fn pop<@T>(v: &mutable [mutable? T]) -> T { let ln = len(v); assert (ln > 0u); ln -= 1u; - let e = v.(ln); + let e = v[ln]; v = slice(v, 0u, ln); ret e; } @@ -153,22 +153,22 @@ fn pop<@T>(v: &mutable [mutable? T]) -> T { fn grow<@T>(v: &mutable [T], n: uint, initval: &T) { reserve(v, next_power_of_two(len(v) + n)); let i: uint = 0u; - while i < n { v += ~[initval]; i += 1u; } + while i < n { v += [initval]; i += 1u; } } // TODO: Remove me once we have slots. fn grow_mut<@T>(v: &mutable [mutable T], n: uint, initval: &T) { reserve(v, next_power_of_two(len(v) + n)); let i: uint = 0u; - while i < n { v += ~[mutable initval]; i += 1u; } + while i < n { v += [mutable initval]; i += 1u; } } /// Calls `f` `n` times and appends the results of these calls to the given /// vector. -fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T ) { +fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T) { reserve(v, next_power_of_two(len(v) + n)); let i: uint = 0u; - while i < n { v += ~[init_fn(i)]; i += 1u; } + while i < n { v += [init_fn(i)]; i += 1u; } } /// Sets the element at position `index` to `val`. If `index` is past the end @@ -176,49 +176,48 @@ fn grow_fn<@T>(v: &mutable [T], n: uint, init_fn: fn(uint) -> T ) { /// intervening space. fn grow_set<@T>(v: &mutable [mutable T], index: uint, initval: &T, val: &T) { if index >= len(v) { grow_mut(v, index - len(v) + 1u, initval); } - v.(index) = val; + v[index] = val; } // Functional utilities -fn map<@T, @U>(f: &block(&T) -> U , v: &[mutable? T]) -> [U] { - let result = ~[]; +fn map<@T, @U>(f: &block(&T) -> U, v: &[mutable? T]) -> [U] { + let result = []; reserve(result, len(v)); for elem: T in v { let elem2 = elem; // satisfies alias checker - result += ~[f(elem2)]; + result += [f(elem2)]; } ret result; } -fn map2<@T, @U, @V>(f: &block(&T, &U) -> V, v0: &[T], v1: &[U]) - -> [V] { +fn map2<@T, @U, @V>(f: &block(&T, &U) -> V, v0: &[T], v1: &[U]) -> [V] { let v0_len = len::<T>(v0); if v0_len != len::<U>(v1) { fail; } - let u: [V] = ~[]; + let u: [V] = []; let i = 0u; - while i < v0_len { u += ~[f({ v0.(i) }, { v1.(i) })]; i += 1u; } + while i < v0_len { u += [f({ v0[i] }, { v1[i] })]; i += 1u; } ret u; } -fn filter_map<@T, @U>(f: &block(&T) -> option::t<U>, - v: &[mutable? T]) -> [U] { - let result = ~[]; +fn filter_map<@T, @U>(f: &block(&T) -> option::t<U>, v: &[mutable? T]) -> + [U] { + let result = []; for elem: T in v { let elem2 = elem; // satisfies alias checker alt f(elem2) { none. {/* no-op */ } - some(result_elem) { result += ~[result_elem]; } + some(result_elem) { result += [result_elem]; } } } ret result; } -fn foldl<@T, @U>(p: &block(&U, &T) -> U , z: &U, v: &[mutable? T]) -> U { +fn foldl<@T, @U>(p: &block(&U, &T) -> U, z: &U, v: &[mutable? T]) -> U { let sz = len(v); if sz == 0u { ret z; } - let first = v.(0); + let first = v[0]; let rest = slice(v, 1u, sz); ret p(foldl(p, z, rest), first); } @@ -251,42 +250,36 @@ fn find<@T>(f: &block(&T) -> bool, v: &[T]) -> option::t<T> { fn position<@T>(x: &T, v: &[T]) -> option::t<uint> { let i: uint = 0u; - while i < len(v) { if x == v.(i) { ret some::<uint>(i); } i += 1u; } + while i < len(v) { if x == v[i] { ret some::<uint>(i); } i += 1u; } ret none; } fn position_pred<T>(f: fn(&T) -> bool, v: &[T]) -> option::t<uint> { let i: uint = 0u; - while i < len(v) { if f(v.(i)) { ret some::<uint>(i); } i += 1u; } + while i < len(v) { if f(v[i]) { ret some::<uint>(i); } i += 1u; } ret none; } fn unzip<@T, @U>(v: &[(T, U)]) -> ([T], [U]) { - let as = ~[], bs = ~[]; - for (a, b) in v { - as += ~[a]; - bs += ~[b]; - } + let as = [], bs = []; + for (a, b) in v { as += [a]; bs += [b]; } ret (as, bs); } // FIXME make the lengths being equal a constraint fn zip<@T, @U>(v: &[T], u: &[U]) -> [(T, U)] { - let zipped = ~[]; + let zipped = []; let sz = len(v), i = 0u; assert (sz == len(u)); - while i < sz { - zipped += ~[(v.(i), u.(i))]; - i += 1u; - } + while i < sz { zipped += [(v[i], u[i])]; i += 1u; } ret zipped; } // Swaps two elements in a vector fn swap<@T>(v: &[mutable T], a: uint, b: uint) { - let t: T = v.(a); - v.(a) = v.(b); - v.(b) = t; + let t: T = v[a]; + v[a] = v[b]; + v[b] = t; } // In place vector reversal @@ -299,11 +292,11 @@ fn reverse<@T>(v: &[mutable T]) { // Functional vector reversal. Returns a reversed copy of v. fn reversed<@T>(v: &[T]) -> [T] { - let rs: [T] = ~[]; + let rs: [T] = []; let i = len::<T>(v); if i == 0u { ret rs; } else { i -= 1u; } - while i != 0u { rs += ~[v.(i)]; i -= 1u; } - rs += ~[v.(0)]; + while i != 0u { rs += [v[i]]; i -= 1u; } + rs += [v[0]]; ret rs; } @@ -328,7 +321,7 @@ mod unsafe { } fn from_buf<T>(ptr: *T, bytes: uint) -> [T] { - let v = ~[]; + let v = []; copy_from_buf(v, ptr, bytes); ret v; } diff --git a/src/lib/win32_fs.rs b/src/lib/win32_fs.rs index 6a8fe063251..5890e1f4443 100644 --- a/src/lib/win32_fs.rs +++ b/src/lib/win32_fs.rs @@ -5,9 +5,7 @@ native "rust" mod rustrt { fn rust_file_is_dir(path: str) -> int; } -fn list_dir(path: str) -> [str] { - ret *rustrt::rust_list_files(path + "*"); -} +fn list_dir(path: str) -> [str] { ret *rustrt::rust_list_files(path + "*"); } fn path_is_absolute(p: str) -> bool { ret str::char_at(p, 0u) == '/' || diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs index cfd03dfce85..57944b5ff53 100644 --- a/src/lib/win32_os.rs +++ b/src/lib/win32_os.rs @@ -30,7 +30,7 @@ mod libc_constants { fn O_TRUNC() -> int { ret 512; } fn O_TEXT() -> int { ret 16384; } fn O_BINARY() -> int { ret 32768; } - fn O_NOINHERIT() -> int { ret 0x0080; } + fn O_NOINHERIT() -> int { ret 128; } fn S_IRUSR() -> uint { ret 256u; // really _S_IREAD in win32 @@ -59,12 +59,13 @@ fn pipe() -> {in: int, out: int} { // which means to pass it to a subprocess they need to be duplicated // first, as in rust_run_program. let fds = {mutable in: 0, mutable out: 0}; - let res = os::libc::_pipe(ptr::addr_of(fds.in), 1024u, - libc_constants::O_BINARY() - | libc_constants::O_NOINHERIT()); - assert res == 0; - assert fds.in != -1 && fds.in != 0; - assert fds.out != -1 && fds.in != 0; + let res = + os::libc::_pipe(ptr::addr_of(fds.in), 1024u, + libc_constants::O_BINARY() | + libc_constants::O_NOINHERIT()); + assert (res == 0); + assert (fds.in != -1 && fds.in != 0); + assert (fds.out != -1 && fds.in != 0); ret {in: fds.in, out: fds.out}; } diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs index cf1989ce294..aa79590a246 100644 --- a/src/test/bench/99bob-iter.rs +++ b/src/test/bench/99bob-iter.rs @@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str { _ { ns = int::to_str(n, 10u) + " bottles"; } } while i < str::byte_len(t) { - if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); } + if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); } i += 1u; } ret b; diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs index 4bbea0c34bd..fdfce9dfae5 100644 --- a/src/test/bench/99bob-pattern.rs +++ b/src/test/bench/99bob-pattern.rs @@ -56,4 +56,4 @@ fn main() { let b: bottle = multiple(99); let running: bool = true; while running { show(b); log ""; running = more(b); b = next(b); } -} \ No newline at end of file +} diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs index 205ab67ff9a..2db6321d257 100644 --- a/src/test/bench/99bob-simple.rs +++ b/src/test/bench/99bob-simple.rs @@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str { _ { ns = int::to_str(n, 10u) + " bottles"; } } while i < str::byte_len(t) { - if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); } + if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); } i += 1u; } ret b; @@ -45,4 +45,4 @@ fn main() { while n > 0 { log sub(b1(), n); log sub(b2(), n - 1); log ""; n -= 1; } log b7(); log sub(b8(), 99); -} \ No newline at end of file +} diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs index c68d77fe324..af5e22f48ea 100644 --- a/src/test/bench/99bob-tail.rs +++ b/src/test/bench/99bob-tail.rs @@ -36,4 +36,4 @@ fn main() { log ""; } multiple(99); -} \ No newline at end of file +} diff --git a/src/test/bench/shootout-ackermann.rs b/src/test/bench/shootout-ackermann.rs index 91e524d0d31..46b8cc443bf 100644 --- a/src/test/bench/shootout-ackermann.rs +++ b/src/test/bench/shootout-ackermann.rs @@ -22,4 +22,4 @@ fn main() { // assert (ack(4,1) == 65533); -} \ No newline at end of file +} diff --git a/src/test/bench/shootout-binarytrees.rs b/src/test/bench/shootout-binarytrees.rs index 0fd77456e2a..d6a44e6eb82 100644 --- a/src/test/bench/shootout-binarytrees.rs +++ b/src/test/bench/shootout-binarytrees.rs @@ -28,8 +28,8 @@ fn main() { } else { max_depth = n; } let stretch_depth = max_depth + 1; let stretch_tree = bottom_up_tree(0, stretch_depth); - log #fmt("stretch tree of depth %d\t check: %d", stretch_depth, - item_check(stretch_tree)); + log #fmt["stretch tree of depth %d\t check: %d", stretch_depth, + item_check(stretch_tree)]; let long_lived_tree = bottom_up_tree(0, max_depth); let depth = min_depth; while depth <= max_depth { @@ -43,10 +43,10 @@ fn main() { chk += item_check(temp_tree); i += 1; } - log #fmt("%d\t trees of depth %d\t check: %d", iterations * 2, depth, - chk); + log #fmt["%d\t trees of depth %d\t check: %d", iterations * 2, depth, + chk]; depth += 2; } - log #fmt("long lived trees of depth %d\t check: %d", max_depth, - item_check(long_lived_tree)); -} \ No newline at end of file + log #fmt["long lived trees of depth %d\t check: %d", max_depth, + item_check(long_lived_tree)]; +} diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs index d4bdbc93b35..8e7b2cbe269 100644 --- a/src/test/bench/shootout-fannkuchredux.rs +++ b/src/test/bench/shootout-fannkuchredux.rs @@ -20,21 +20,21 @@ fn fannkuch(n: int) -> int { r = n; while r > 0 { i = 0; - while r != 1 { count.(r - 1) = r; r -= 1; } - while i < n { perm.(i) = perm1.(i); i += 1; } + while r != 1 { count[r - 1] = r; r -= 1; } + while i < n { perm[i] = perm1[i]; i += 1; } // Count flips and update max and checksum f = 0; - k = perm.(0); + k = perm[0]; while k != 0 { i = 0; while 2 * i < k { - let t = perm.(i); - perm.(i) = perm.(k - i); - perm.(k - i) = t; + let t = perm[i]; + perm[i] = perm[k - i]; + perm[k - i] = t; i += 1; } - k = perm.(0); + k = perm[0]; f += 1; } if f > flips { flips = f; } @@ -44,12 +44,12 @@ fn fannkuch(n: int) -> int { let go = true; while go { if r == n { log checksum; ret flips; } - let p0 = perm1.(0); + let p0 = perm1[0]; i = 0; - while i < r { let j = i + 1; perm1.(i) = perm1.(j); i = j; } - perm1.(r) = p0; - count.(r) -= 1; - if count.(r) > 0 { go = false; } else { r += 1; } + while i < r { let j = i + 1; perm1[i] = perm1[j]; i = j; } + perm1[r] = p0; + count[r] -= 1; + if count[r] > 0 { go = false; } else { r += 1; } } nperm += 1; } @@ -58,5 +58,5 @@ fn fannkuch(n: int) -> int { fn main(args: [str]) { let n = 7; - log #fmt("Pfannkuchen(%d) = %d", n, fannkuch(n)); + log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)]; } diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs index 25a3756346a..80e0108867d 100644 --- a/src/test/bench/shootout-fasta.rs +++ b/src/test/bench/shootout-fasta.rs @@ -25,20 +25,20 @@ type aminoacids = {ch: char, prob: u32}; fn make_cumulative(aa: &[aminoacids]) -> [aminoacids] { let cp: u32 = 0u32; - let ans: [aminoacids] = ~[]; - for a: aminoacids in aa { cp += a.prob; ans += ~[{ch: a.ch, prob: cp}]; } + let ans: [aminoacids] = []; + for a: aminoacids in aa { cp += a.prob; ans += [{ch: a.ch, prob: cp}]; } ret ans; } fn select_random(r: u32, genelist: &[aminoacids]) -> char { - if r < genelist.(0).prob { ret genelist.(0).ch; } + if r < genelist[0].prob { ret genelist[0].ch; } fn bisect(v: &[aminoacids], lo: uint, hi: uint, target: u32) -> char { if hi > lo + 1u { let mid: uint = lo + (hi - lo) / 2u; - if target < v.(mid).prob { + if target < v[mid].prob { be bisect(v, lo, mid, target); } else { be bisect(v, mid, hi, target); } - } else { ret v.(hi).ch; } + } else { ret v[hi].ch; } } ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r); } @@ -59,7 +59,7 @@ fn make_repeat_fasta(id: str, desc: str, s: str, n: int) { let op: str = ""; let sl: uint = str::byte_len(s); for each i: uint in uint::range(0u, n as uint) { - str::push_byte(op, s.(i % sl)); + str::push_byte(op, s[i % sl]); if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; } } if str::byte_len(op) > 0u { log op; } @@ -69,16 +69,14 @@ fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; } fn main(args: [str]) { let iub: [aminoacids] = - make_cumulative( - ~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), - acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), - acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), - acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), - acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); + make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), + acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), + acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), + acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), + acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); let homosapiens: [aminoacids] = - make_cumulative( - ~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), - acid('t', 30u32)]); + make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), + acid('t', 30u32)]); let alu: str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + diff --git a/src/test/bench/shootout-fibo.rs b/src/test/bench/shootout-fibo.rs index f0a2009b213..a4b5f2588d4 100644 --- a/src/test/bench/shootout-fibo.rs +++ b/src/test/bench/shootout-fibo.rs @@ -16,4 +16,4 @@ fn main() { assert (fib(15) == 610); log fib(8); log fib(15); -} \ No newline at end of file +} diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs index 7657d058d02..5e888041981 100644 --- a/src/test/bench/shootout-nbody.rs +++ b/src/test/bench/shootout-nbody.rs @@ -12,7 +12,7 @@ fn main() { // during 'make check' under valgrind // 5000000 // 50000000 - let inputs: [int] = ~[50000, 500000]; + let inputs: [int] = [50000, 500000]; let bodies: [Body::props] = NBodySystem::MakeNBodySystem(); @@ -34,7 +34,7 @@ mod NBodySystem { fn MakeNBodySystem() -> [Body::props] { // these each return a Body::props let bodies: [Body::props] = - ~[Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(), + [Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(), Body::neptune()]; let px: float = 0.0; @@ -43,15 +43,15 @@ mod NBodySystem { let i: int = 0; while i < 5 { - px += bodies.(i).vx * bodies.(i).mass; - py += bodies.(i).vy * bodies.(i).mass; - pz += bodies.(i).vz * bodies.(i).mass; + px += bodies[i].vx * bodies[i].mass; + py += bodies[i].vy * bodies[i].mass; + pz += bodies[i].vz * bodies[i].mass; i += 1; } // side-effecting - Body::offsetMomentum(bodies.(0), px, py, pz); + Body::offsetMomentum(bodies[0], px, py, pz); ret bodies; } @@ -61,13 +61,13 @@ mod NBodySystem { let i: int = 0; while i < 5 { let j: int = i + 1; - while j < 5 { advance_one(bodies.(i), bodies.(j), dt); j += 1; } + while j < 5 { advance_one(bodies[i], bodies[j], dt); j += 1; } i += 1; } i = 0; - while i < 5 { move(bodies.(i), dt); i += 1; } + while i < 5 { move(bodies[i], dt); i += 1; } } fn advance_one(bi: &Body::props, bj: &Body::props, dt: float) { @@ -105,19 +105,18 @@ mod NBodySystem { let i: int = 0; while i < 5 { e += - 0.5 * bodies.(i).mass * - (bodies.(i).vx * bodies.(i).vx + - bodies.(i).vy * bodies.(i).vy + - bodies.(i).vz * bodies.(i).vz); + 0.5 * bodies[i].mass * + (bodies[i].vx * bodies[i].vx + bodies[i].vy * bodies[i].vy + + bodies[i].vz * bodies[i].vz); let j: int = i + 1; while j < 5 { - dx = bodies.(i).x - bodies.(j).x; - dy = bodies.(i).y - bodies.(j).y; - dz = bodies.(i).z - bodies.(j).z; + dx = bodies[i].x - bodies[j].x; + dy = bodies[i].y - bodies[j].y; + dz = bodies[i].z - bodies[j].z; distance = llvm::sqrt(dx * dx + dy * dy + dz * dz); - e -= bodies.(i).mass * bodies.(j).mass / distance; + e -= bodies[i].mass * bodies[j].mass / distance; j += 1; } @@ -133,7 +132,7 @@ mod Body { const PI: float = 3.141592653589793; const SOLAR_MASS: float = 39.478417604357432; - // was 4 * PI * PI originally + // was 4 * PI * PI originally const DAYS_PER_YEAR: float = 365.24; type props = diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs index 67cbf77968e..60b54cbe33d 100644 --- a/src/test/bench/shootout-pfib.rs +++ b/src/test/bench/shootout-pfib.rs @@ -30,7 +30,7 @@ fn fib(n: int) -> int { fn pfib(c: _chan<int>, n: int) { if n == 0 { send(c, 0); - } else if (n <= 2) { + } else if n <= 2 { send(c, 1); } else { let p = mk_port::<int>(); @@ -50,7 +50,7 @@ fn fib(n: int) -> int { type config = {stress: bool}; fn parse_opts(argv: [str]) -> config { - let opts = ~[getopts::optflag("stress")]; + let opts = [getopts::optflag("stress")]; let opt_args = vec::slice(argv, 1u, vec::len(argv)); @@ -67,7 +67,7 @@ fn stress_task(id: int) { let n = 15; assert (fib(n) == fib(n)); i += 1; - log_err #fmt("%d: Completed %d iterations", id, i); + log_err #fmt["%d: Completed %d iterations", id, i]; } } @@ -91,7 +91,7 @@ fn main(argv: [str]) { if opts.stress { stress(2); } else { - let max = uint::parse_buf(str::bytes(argv.(1)), 10u) as int; + let max = uint::parse_buf(str::bytes(argv[1]), 10u) as int; let num_trials = 10; @@ -106,8 +106,8 @@ fn main(argv: [str]) { let elapsed = stop - start; - out.write_line(#fmt("%d\t%d\t%s", n, fibn, - u64::str(elapsed))); + out.write_line(#fmt["%d\t%d\t%s", n, fibn, + u64::str(elapsed)]); } } } diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs index 48e1b4d8087..150853e2328 100644 --- a/src/test/bench/task-perf-spawnalot.rs +++ b/src/test/bench/task-perf-spawnalot.rs @@ -6,25 +6,17 @@ import std::str; fn f(n: uint) { let i = 0u; - while i < n { - let thunk = g; - task::join_id(task::spawn(thunk)); - i += 1u; - } + while i < n { let thunk = g; task::join_id(task::spawn(thunk)); i += 1u; } } -fn g() {} +fn g() { } fn main(args: [str]) { - let n = if vec::len(args) < 2u { - 10u - } else { - uint::parse_buf(str::bytes(args.(1)), 10u) - }; + let n = + if vec::len(args) < 2u { + 10u + } else { uint::parse_buf(str::bytes(args[1]), 10u) }; let i = 0u; - while i < n { - task::spawn(bind f(n)); - i += 1u; - } + while i < n { task::spawn(bind f(n)); i += 1u; } } diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs index 54bfae13c23..7d0effb4a7f 100644 --- a/src/test/bench/task-perf-word-count.rs +++ b/src/test/bench/task-perf-word-count.rs @@ -42,14 +42,7 @@ fn reduce(word: str, get: map_reduce::getter) { let count = 0; - while true { - alt get() { - some(_) { - count += 1; - } - none. { break } - } - } + while true { alt get() { some(_) { count += 1; } none. { break } } } } mod map_reduce { @@ -59,13 +52,13 @@ mod map_reduce { export reducer; export map_reduce; - type putter = fn(str, int) ; + type putter = fn(str, int); - type mapper = fn(str, putter) ; + type mapper = fn(str, putter); - type getter = fn() -> option<int> ; + type getter = fn() -> option<int>; - type reducer = fn(str, getter) ; + type reducer = fn(str, getter); tag ctrl_proto { find_reducer([u8], _chan<_chan<reduce_proto>>); @@ -75,9 +68,9 @@ mod map_reduce { tag reduce_proto { emit_val(int); done; ref; release; } fn start_mappers(ctrl: _chan<ctrl_proto>, inputs: &[str]) -> [task_id] { - let tasks = ~[]; + let tasks = []; for i: str in inputs { - tasks += ~[task::spawn(bind map_task(ctrl, i))]; + tasks += [task::spawn(bind map_task(ctrl, i))]; } ret tasks; } @@ -108,7 +101,7 @@ mod map_reduce { map(input, bind emit(intermediates, ctrl, _, _)); - for each kv: @{key: str, val: _chan<reduce_proto>} in + for each kv: @{key: str, val: _chan<reduce_proto>} in intermediates.items() { send(kv.val, release); } @@ -178,8 +171,7 @@ mod map_reduce { none. { // log_err "creating new reducer for " + k; let p = mk_port(); - tasks += - ~[task::spawn(bind reduce_task(k, p.mk_chan()))]; + tasks += [task::spawn(bind reduce_task(k, p.mk_chan()))]; c = p.recv(); reducers.insert(k, c); } @@ -202,7 +194,7 @@ fn main(argv: [str]) { if vec::len(argv) < 2u { let out = io::stdout(); - out.write_line(#fmt("Usage: %s <filename> ...", argv.(0))); + out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]); // TODO: run something just to make sure the code hasn't // broken yet. This is the unit test mode of this program. diff --git a/src/test/compile-fail/alias-mismatch.rs b/src/test/compile-fail/alias-mismatch.rs index c25c7229e22..068e8c65ff5 100644 --- a/src/test/compile-fail/alias-mismatch.rs +++ b/src/test/compile-fail/alias-mismatch.rs @@ -5,5 +5,5 @@ import std::vec::map; fn main() { fn f(i: uint) -> bool { true } - let a = map(f, ~[5u]); -} \ No newline at end of file + let a = map(f, [5u]); +} diff --git a/src/test/compile-fail/aliasness-mismatch.rs b/src/test/compile-fail/aliasness-mismatch.rs index a376508e8b4..8be70d8e29f 100644 --- a/src/test/compile-fail/aliasness-mismatch.rs +++ b/src/test/compile-fail/aliasness-mismatch.rs @@ -3,6 +3,6 @@ fn f(x: &int) { log_err x; } fn h(x: int) { log_err x; } -fn main() { let g: fn(int) = f; g(10); g = h; g(10); } +fn main() { let g: fn(int) = f; g(10); g = h; g(10); } diff --git a/src/test/compile-fail/alt-join.rs b/src/test/compile-fail/alt-join.rs index 613e1e12382..246d186b06c 100644 --- a/src/test/compile-fail/alt-join.rs +++ b/src/test/compile-fail/alt-join.rs @@ -5,11 +5,8 @@ fn my_fail() -> ! { fail; } fn main() { - alt (true) { - false { my_fail(); } - true {} - } + alt true { false { my_fail(); } true { } } log x; - let x:int; -} \ No newline at end of file + let x: int; +} diff --git a/src/test/compile-fail/and-init.rs b/src/test/compile-fail/and-init.rs index 26296dc6faa..75e63ab2cc6 100644 --- a/src/test/compile-fail/and-init.rs +++ b/src/test/compile-fail/and-init.rs @@ -5,4 +5,4 @@ fn main() { log false && { i = 5; true }; log i; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/arg-count-mismatch.rs b/src/test/compile-fail/arg-count-mismatch.rs index 89be0585c34..62aad13d150 100644 --- a/src/test/compile-fail/arg-count-mismatch.rs +++ b/src/test/compile-fail/arg-count-mismatch.rs @@ -2,4 +2,4 @@ fn f(x: int) { } -fn main() { let i: (); i = f(); } \ No newline at end of file +fn main() { let i: (); i = f(); } diff --git a/src/test/compile-fail/arg-type-mismatch.rs b/src/test/compile-fail/arg-type-mismatch.rs index 3fe2e95c294..8934a12b27a 100644 --- a/src/test/compile-fail/arg-type-mismatch.rs +++ b/src/test/compile-fail/arg-type-mismatch.rs @@ -3,4 +3,4 @@ fn f(x: int) { } -fn main() { let i: (); i = f(()); } \ No newline at end of file +fn main() { let i: (); i = f(()); } diff --git a/src/test/compile-fail/assign-alias.rs b/src/test/compile-fail/assign-alias.rs index 66041f08a7a..b291b6d47b6 100644 --- a/src/test/compile-fail/assign-alias.rs +++ b/src/test/compile-fail/assign-alias.rs @@ -2,4 +2,4 @@ fn f(i: &int) { i += 2; } -fn main() { f(1); } \ No newline at end of file +fn main() { f(1); } diff --git a/src/test/compile-fail/auto-deref-bind.rs b/src/test/compile-fail/auto-deref-bind.rs index 9d9b0613bd7..b218ddd122a 100644 --- a/src/test/compile-fail/auto-deref-bind.rs +++ b/src/test/compile-fail/auto-deref-bind.rs @@ -1,4 +1,4 @@ // error-pattern: mismatched types fn add1(i: int) -> int { ret i + 1; } -fn main() { let f = @add1; let g = bind f(5); } \ No newline at end of file +fn main() { let f = @add1; let g = bind f(5); } diff --git a/src/test/compile-fail/bad-bang-ann-2.rs b/src/test/compile-fail/bad-bang-ann-2.rs index 15ba26b0dc0..011358ac10c 100644 --- a/src/test/compile-fail/bad-bang-ann-2.rs +++ b/src/test/compile-fail/bad-bang-ann-2.rs @@ -4,4 +4,4 @@ fn bad_bang(i: uint) -> ! { log 3; } -fn main() { bad_bang(5u); } \ No newline at end of file +fn main() { bad_bang(5u); } diff --git a/src/test/compile-fail/bad-bang-ann-3.rs b/src/test/compile-fail/bad-bang-ann-3.rs index 7077a2e7986..2ba862ff57f 100644 --- a/src/test/compile-fail/bad-bang-ann-3.rs +++ b/src/test/compile-fail/bad-bang-ann-3.rs @@ -4,4 +4,4 @@ fn bad_bang(i: uint) -> ! { ret 7u; } -fn main() { bad_bang(5u); } \ No newline at end of file +fn main() { bad_bang(5u); } diff --git a/src/test/compile-fail/bad-bang-ann.rs b/src/test/compile-fail/bad-bang-ann.rs index 20aed480bfc..e67013998a1 100644 --- a/src/test/compile-fail/bad-bang-ann.rs +++ b/src/test/compile-fail/bad-bang-ann.rs @@ -4,4 +4,4 @@ fn bad_bang(i: uint) -> ! { if i < 0u { } else { fail; } } -fn main() { bad_bang(5u); } \ No newline at end of file +fn main() { bad_bang(5u); } diff --git a/src/test/compile-fail/bad-env-capture.rs b/src/test/compile-fail/bad-env-capture.rs index 2848d185739..8e8441e55ac 100644 --- a/src/test/compile-fail/bad-env-capture.rs +++ b/src/test/compile-fail/bad-env-capture.rs @@ -3,4 +3,4 @@ fn foo() { let x: int; fn bar() { log x; } } -fn main() { foo(); } \ No newline at end of file +fn main() { foo(); } diff --git a/src/test/compile-fail/bad-env-capture2.rs b/src/test/compile-fail/bad-env-capture2.rs index 47e9a4e0ed9..40a0a39e7c6 100644 --- a/src/test/compile-fail/bad-env-capture2.rs +++ b/src/test/compile-fail/bad-env-capture2.rs @@ -2,4 +2,4 @@ fn foo(x: int) { fn bar() { log x; } } -fn main() { foo(2); } \ No newline at end of file +fn main() { foo(2); } diff --git a/src/test/compile-fail/bad-env-capture3.rs b/src/test/compile-fail/bad-env-capture3.rs index 43d9a15665c..1ff3602ee88 100644 --- a/src/test/compile-fail/bad-env-capture3.rs +++ b/src/test/compile-fail/bad-env-capture3.rs @@ -5,4 +5,4 @@ obj foo(x: int) { } } -fn main() { foo(2); } \ No newline at end of file +fn main() { foo(2); } diff --git a/src/test/compile-fail/bad-main.rs b/src/test/compile-fail/bad-main.rs index 40879fae555..725f88129b9 100644 --- a/src/test/compile-fail/bad-main.rs +++ b/src/test/compile-fail/bad-main.rs @@ -1,3 +1,3 @@ // error-pattern:wrong type in main function -fn main(x: int) { } \ No newline at end of file +fn main(x: int) { } diff --git a/src/test/compile-fail/bad-module.rs b/src/test/compile-fail/bad-module.rs index bfb796916a3..c5b67b9401b 100644 --- a/src/test/compile-fail/bad-module.rs +++ b/src/test/compile-fail/bad-module.rs @@ -1,4 +1,4 @@ // error-pattern: unresolved import: vec import vec; -fn main() { let foo = vec::len([]); } \ No newline at end of file +fn main() { let foo = vec::len([]); } diff --git a/src/test/compile-fail/bad-record-pat-2.rs b/src/test/compile-fail/bad-record-pat-2.rs index 125b608e4ed..54ae70a8661 100644 --- a/src/test/compile-fail/bad-record-pat-2.rs +++ b/src/test/compile-fail/bad-record-pat-2.rs @@ -1,3 +1,3 @@ // error-pattern:did not expect a record with a field q -fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } } \ No newline at end of file +fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } } diff --git a/src/test/compile-fail/bad-record-pat.rs b/src/test/compile-fail/bad-record-pat.rs index e8bb2426cd9..1b12d274ce8 100644 --- a/src/test/compile-fail/bad-record-pat.rs +++ b/src/test/compile-fail/bad-record-pat.rs @@ -1,3 +1,3 @@ // error-pattern:expected a record with 2 fields, found one with 1 -fn main() { alt {x: 1, y: 2} { {x: x} { } } } \ No newline at end of file +fn main() { alt {x: 1, y: 2} { {x: x} { } } } diff --git a/src/test/compile-fail/bang-tailexpr.rs b/src/test/compile-fail/bang-tailexpr.rs index 87afc1bd401..d13fca4486c 100644 --- a/src/test/compile-fail/bang-tailexpr.rs +++ b/src/test/compile-fail/bang-tailexpr.rs @@ -1,3 +1,3 @@ // error-pattern: some control paths may return fn f() -> ! { 3 } -fn main(){} +fn main() { } diff --git a/src/test/compile-fail/binop-add-tup-assign.rs b/src/test/compile-fail/binop-add-tup-assign.rs index 6470ae353a8..86515aeea6a 100644 --- a/src/test/compile-fail/binop-add-tup-assign.rs +++ b/src/test/compile-fail/binop-add-tup-assign.rs @@ -1,3 +1,3 @@ // error-pattern:+ cannot be applied to type `{x: bool}` -fn main() { let x = {x: true}; x += {x: false}; } \ No newline at end of file +fn main() { let x = {x: true}; x += {x: false}; } diff --git a/src/test/compile-fail/binop-add-tup.rs b/src/test/compile-fail/binop-add-tup.rs index 96dc63fef01..fadb35503e2 100644 --- a/src/test/compile-fail/binop-add-tup.rs +++ b/src/test/compile-fail/binop-add-tup.rs @@ -1,3 +1,3 @@ // error-pattern:+ cannot be applied to type `{x: bool}` -fn main() { let x = {x: true} + {x: false}; } \ No newline at end of file +fn main() { let x = {x: true} + {x: false}; } diff --git a/src/test/compile-fail/binop-bitxor-str.rs b/src/test/compile-fail/binop-bitxor-str.rs index 0f1e2202419..65e0996fa62 100644 --- a/src/test/compile-fail/binop-bitxor-str.rs +++ b/src/test/compile-fail/binop-bitxor-str.rs @@ -1,3 +1,3 @@ // error-pattern:^ cannot be applied to type `str` -fn main() { let x = "a" ^ "b"; } \ No newline at end of file +fn main() { let x = "a" ^ "b"; } diff --git a/src/test/compile-fail/binop-logic-float.rs b/src/test/compile-fail/binop-logic-float.rs index 900c290b07e..7b7b165d49b 100644 --- a/src/test/compile-fail/binop-logic-float.rs +++ b/src/test/compile-fail/binop-logic-float.rs @@ -1,3 +1,3 @@ // error-pattern:|| cannot be applied to type `f32` -fn main() { let x = 1.0_f32 || 2.0_f32; } \ No newline at end of file +fn main() { let x = 1.0_f32 || 2.0_f32; } diff --git a/src/test/compile-fail/binop-logic-int.rs b/src/test/compile-fail/binop-logic-int.rs index ffe05f1649c..ef8643bd7b4 100644 --- a/src/test/compile-fail/binop-logic-int.rs +++ b/src/test/compile-fail/binop-logic-int.rs @@ -1,3 +1,3 @@ // error-pattern:&& cannot be applied to type `int` -fn main() { let x = 1 && 2; } \ No newline at end of file +fn main() { let x = 1 && 2; } diff --git a/src/test/compile-fail/binop-mul-bool.rs b/src/test/compile-fail/binop-mul-bool.rs index 78e7cbe23b5..7c912f58d1e 100644 --- a/src/test/compile-fail/binop-mul-bool.rs +++ b/src/test/compile-fail/binop-mul-bool.rs @@ -1,3 +1,3 @@ // error-pattern:* cannot be applied to type `bool` -fn main() { let x = true * false; } \ No newline at end of file +fn main() { let x = true * false; } diff --git a/src/test/compile-fail/binop-sub-obj.rs b/src/test/compile-fail/binop-sub-obj.rs index f5010dbbe05..630cd288a49 100644 --- a/src/test/compile-fail/binop-sub-obj.rs +++ b/src/test/compile-fail/binop-sub-obj.rs @@ -1,3 +1,3 @@ // error-pattern:- cannot be applied to type `obj -fn main() { let x = obj () { } - obj () { }; } \ No newline at end of file +fn main() { let x = obj () { } - obj () { }; } diff --git a/src/test/compile-fail/binop-typeck.rs b/src/test/compile-fail/binop-typeck.rs index caa844516fb..9cb6dea5360 100644 --- a/src/test/compile-fail/binop-typeck.rs +++ b/src/test/compile-fail/binop-typeck.rs @@ -1,4 +1,4 @@ // error-pattern:mismatched types // issue #500 -fn main() { let x = true; let y = 1; let z = x + y; } \ No newline at end of file +fn main() { let x = true; let y = 1; let z = x + y; } diff --git a/src/test/compile-fail/block-coerce-no.rs b/src/test/compile-fail/block-coerce-no.rs index 42b1504562a..bb3e53028c2 100644 --- a/src/test/compile-fail/block-coerce-no.rs +++ b/src/test/compile-fail/block-coerce-no.rs @@ -3,11 +3,11 @@ // Make sure that fn-to-block coercion isn't incorrectly lifted over // other tycons. -fn coerce(b: &block() ) -> fn() { - fn lol(f: &fn(&block() ) -> fn() , g: &block() ) -> fn() { ret f(g); } - fn fn_id(f: &fn() ) -> fn() { ret f } +fn coerce(b: &block()) -> fn() { + fn lol(f: &fn(&block()) -> fn(), g: &block()) -> fn() { ret f(g); } + fn fn_id(f: &fn()) -> fn() { ret f } ret lol(fn_id, b); } -fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); } \ No newline at end of file +fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); } diff --git a/src/test/compile-fail/block-copy.rs b/src/test/compile-fail/block-copy.rs index f0e510e87a7..6a6c708cf88 100644 --- a/src/test/compile-fail/block-copy.rs +++ b/src/test/compile-fail/block-copy.rs @@ -1,4 +1,4 @@ // error-pattern: non-copyable -fn lol(f: &block() ) -> block() { ret f; } -fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); } \ No newline at end of file +fn lol(f: &block()) -> block() { ret f; } +fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); } diff --git a/src/test/compile-fail/block-uninit.rs b/src/test/compile-fail/block-uninit.rs index 4fa112762e8..9028d5fa435 100644 --- a/src/test/compile-fail/block-uninit.rs +++ b/src/test/compile-fail/block-uninit.rs @@ -1,4 +1,4 @@ // error-pattern: Unsatisfied precondition constraint -fn force(f: &block() ) { f(); } -fn main() { let x: int; force(block () { log_err x; }); } \ No newline at end of file +fn force(f: &block()) { f(); } +fn main() { let x: int; force(block () { log_err x; }); } diff --git a/src/test/compile-fail/break-outside-loop.rs b/src/test/compile-fail/break-outside-loop.rs index adf6413ed62..3783dc83dd0 100644 --- a/src/test/compile-fail/break-outside-loop.rs +++ b/src/test/compile-fail/break-outside-loop.rs @@ -4,4 +4,4 @@ fn main() { let rs: {t: str} = {t: pth}; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/break-uninit.rs b/src/test/compile-fail/break-uninit.rs index d1c7a90f7f2..9a82a95ade2 100644 --- a/src/test/compile-fail/break-uninit.rs +++ b/src/test/compile-fail/break-uninit.rs @@ -11,4 +11,4 @@ fn foo() -> int { ret 17; } -fn main() { log foo(); } \ No newline at end of file +fn main() { log foo(); } diff --git a/src/test/compile-fail/break-uninit2.rs b/src/test/compile-fail/break-uninit2.rs index 9fb89c5c648..d1fda52fae6 100644 --- a/src/test/compile-fail/break-uninit2.rs +++ b/src/test/compile-fail/break-uninit2.rs @@ -11,4 +11,4 @@ fn foo() -> int { ret 17; } -fn main() { log foo(); } \ No newline at end of file +fn main() { log foo(); } diff --git a/src/test/compile-fail/capture1.rs b/src/test/compile-fail/capture1.rs index 1e8e48aea02..877884bf7f9 100644 --- a/src/test/compile-fail/capture1.rs +++ b/src/test/compile-fail/capture1.rs @@ -5,4 +5,4 @@ fn main() { let bar: int = 5; fn foo() -> int { ret bar; } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/constructor-as-cast.rs b/src/test/compile-fail/constructor-as-cast.rs index 2bee78316f2..85d8c7850cf 100644 --- a/src/test/compile-fail/constructor-as-cast.rs +++ b/src/test/compile-fail/constructor-as-cast.rs @@ -1,10 +1,10 @@ // error-pattern: unresolved name: base type base = obj { - fn foo() ; + fn foo(); }; obj derived() { fn foo() { } fn bar() { } } -fn main() { let d: derived = derived(); let b: base = base(d); } \ No newline at end of file +fn main() { let d: derived = derived(); let b: base = base(d); } diff --git a/src/test/compile-fail/copy-a-resource.rs b/src/test/compile-fail/copy-a-resource.rs index aabacdde27f..9e5e6f81666 100644 --- a/src/test/compile-fail/copy-a-resource.rs +++ b/src/test/compile-fail/copy-a-resource.rs @@ -2,4 +2,4 @@ resource foo(i: int) { } -fn main() { let x <- foo(10); let y = x; } \ No newline at end of file +fn main() { let x <- foo(10); let y = x; } diff --git a/src/test/compile-fail/cross-crate-glob-collision.rs b/src/test/compile-fail/cross-crate-glob-collision.rs index 3771851cfae..490f8ae9b21 100644 --- a/src/test/compile-fail/cross-crate-glob-collision.rs +++ b/src/test/compile-fail/cross-crate-glob-collision.rs @@ -10,4 +10,4 @@ mod alternate_supplier { fn member() { } } -fn main() { member() } \ No newline at end of file +fn main() { member() } diff --git a/src/test/compile-fail/direct-obj-fn-call.rs b/src/test/compile-fail/direct-obj-fn-call.rs index 557b6af1696..01ec855bf7c 100644 --- a/src/test/compile-fail/direct-obj-fn-call.rs +++ b/src/test/compile-fail/direct-obj-fn-call.rs @@ -4,4 +4,4 @@ obj x() { fn hello() { log "hello"; } } -fn main() { x.hello(); } \ No newline at end of file +fn main() { x.hello(); } diff --git a/src/test/compile-fail/do-while-constraints.rs b/src/test/compile-fail/do-while-constraints.rs index cfea71fc7ef..f7d03b89354 100644 --- a/src/test/compile-fail/do-while-constraints.rs +++ b/src/test/compile-fail/do-while-constraints.rs @@ -7,4 +7,4 @@ fn main() { log y; do { do { do { x <- y; } while true } while true } while true } while true -} \ No newline at end of file +} diff --git a/src/test/compile-fail/do-while-pred-constraints.rs b/src/test/compile-fail/do-while-pred-constraints.rs index 31d3e82796e..90fcd26ea9f 100644 --- a/src/test/compile-fail/do-while-pred-constraints.rs +++ b/src/test/compile-fail/do-while-pred-constraints.rs @@ -1,24 +1,14 @@ // error-pattern: Unsatisfied precondition constraint (for example, even(y -fn print_even(y: int) : even(y) { - log y; -} +fn print_even(y: int) : even(y) { log y; } -pred even(y: int) -> bool { - true -} +pred even(y: int) -> bool { true } fn main() { - let y: int = 42; - check even(y); - do { - print_even(y); - do { - do { - do { - y += 1; - } while (true); - } while (true); - } while (true); - } while (true); + let y: int = 42; + check (even(y)); + do { + print_even(y); + do { do { do { y += 1; } while true } while true } while true + } while true } diff --git a/src/test/compile-fail/dup-link-name.rs b/src/test/compile-fail/dup-link-name.rs index 346588392ee..c7f0a12d061 100644 --- a/src/test/compile-fail/dup-link-name.rs +++ b/src/test/compile-fail/dup-link-name.rs @@ -2,4 +2,4 @@ #[link(name = "test", name)]; -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/export-fully-qualified.rs b/src/test/compile-fail/export-fully-qualified.rs index 7413777ee2b..30075a1cadb 100644 --- a/src/test/compile-fail/export-fully-qualified.rs +++ b/src/test/compile-fail/export-fully-qualified.rs @@ -13,4 +13,4 @@ mod foo { fn baz() { } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/export-import.rs b/src/test/compile-fail/export-import.rs index 2608f523220..f5ed4c4f3a7 100644 --- a/src/test/compile-fail/export-import.rs +++ b/src/test/compile-fail/export-import.rs @@ -11,4 +11,4 @@ mod m { } -fn main() { unexported(); } \ No newline at end of file +fn main() { unexported(); } diff --git a/src/test/compile-fail/export-no-tag-variants.rs b/src/test/compile-fail/export-no-tag-variants.rs index a824212ab08..2d10cb49270 100644 --- a/src/test/compile-fail/export-no-tag-variants.rs +++ b/src/test/compile-fail/export-no-tag-variants.rs @@ -9,4 +9,4 @@ mod foo { tag t { t1; } } -fn main() { let x = foo::t1; } \ No newline at end of file +fn main() { let x = foo::t1; } diff --git a/src/test/compile-fail/export-tag-variant.rs b/src/test/compile-fail/export-tag-variant.rs index a31ae5615fb..33496480c02 100644 --- a/src/test/compile-fail/export-tag-variant.rs +++ b/src/test/compile-fail/export-tag-variant.rs @@ -8,4 +8,4 @@ mod foo { tag y { y1; } } -fn main() { let z = foo::y1; } \ No newline at end of file +fn main() { let z = foo::y1; } diff --git a/src/test/compile-fail/export.rs b/src/test/compile-fail/export.rs index 57967838640..55d33160d34 100644 --- a/src/test/compile-fail/export.rs +++ b/src/test/compile-fail/export.rs @@ -5,4 +5,4 @@ mod foo { fn z(y: int) { log y; } } -fn main() { foo::z(10); } \ No newline at end of file +fn main() { foo::z(10); } diff --git a/src/test/compile-fail/export2.rs b/src/test/compile-fail/export2.rs index 47b80014a1c..28919efdd49 100644 --- a/src/test/compile-fail/export2.rs +++ b/src/test/compile-fail/export2.rs @@ -14,4 +14,4 @@ mod bar { fn y() { } } -fn main() { foo::x(); } \ No newline at end of file +fn main() { foo::x(); } diff --git a/src/test/compile-fail/ext-nonexistent.rs b/src/test/compile-fail/ext-nonexistent.rs index f4cb0021be3..ec63c1f07d0 100644 --- a/src/test/compile-fail/ext-nonexistent.rs +++ b/src/test/compile-fail/ext-nonexistent.rs @@ -1,2 +1,2 @@ // error-pattern:macro undefined -fn main() { #iamnotanextensionthatexists(""); } \ No newline at end of file +fn main() { #iamnotanextensionthatexists[""]; } diff --git a/src/test/compile-fail/extend-non-object.rs b/src/test/compile-fail/extend-non-object.rs index 4a957f5fc73..0857ac990c0 100644 --- a/src/test/compile-fail/extend-non-object.rs +++ b/src/test/compile-fail/extend-non-object.rs @@ -10,4 +10,4 @@ fn main() { with x }; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/extenv-no-args.rs b/src/test/compile-fail/extenv-no-args.rs index 5b0be3c9871..ec73f0a7a45 100644 --- a/src/test/compile-fail/extenv-no-args.rs +++ b/src/test/compile-fail/extenv-no-args.rs @@ -1,5 +1,3 @@ // error-pattern:malformed #env call -fn main() { - #env(); -} +fn main() { #env[]; } diff --git a/src/test/compile-fail/extenv-not-string-literal.rs b/src/test/compile-fail/extenv-not-string-literal.rs index 8ab4953c8fa..57d50b2e54d 100644 --- a/src/test/compile-fail/extenv-not-string-literal.rs +++ b/src/test/compile-fail/extenv-not-string-literal.rs @@ -1,3 +1,3 @@ // error-pattern:requires a string -fn main() { #env(10); } \ No newline at end of file +fn main() { #env[10]; } diff --git a/src/test/compile-fail/extenv-too-many-args.rs b/src/test/compile-fail/extenv-too-many-args.rs index 65200e5c116..945546fd6cb 100644 --- a/src/test/compile-fail/extenv-too-many-args.rs +++ b/src/test/compile-fail/extenv-too-many-args.rs @@ -1,3 +1,3 @@ // error-pattern:malformed #env call -fn main() { #env("one", "two"); } \ No newline at end of file +fn main() { #env["one", "two"]; } diff --git a/src/test/compile-fail/extfmt-missing-type.rs b/src/test/compile-fail/extfmt-missing-type.rs index 23deb75e9e7..9e1cbc557d4 100644 --- a/src/test/compile-fail/extfmt-missing-type.rs +++ b/src/test/compile-fail/extfmt-missing-type.rs @@ -1,3 +1,3 @@ // error-pattern:missing type -fn main() { #fmt("%+"); } \ No newline at end of file +fn main() { #fmt["%+"]; } diff --git a/src/test/compile-fail/extfmt-no-args.rs b/src/test/compile-fail/extfmt-no-args.rs index 8bc3f23f2f0..7c13ef99dc5 100644 --- a/src/test/compile-fail/extfmt-no-args.rs +++ b/src/test/compile-fail/extfmt-no-args.rs @@ -1,5 +1,3 @@ // error-pattern:format string -fn main() { - #fmt(); -} \ No newline at end of file +fn main() { #fmt[]; } diff --git a/src/test/compile-fail/extfmt-non-literal.rs b/src/test/compile-fail/extfmt-non-literal.rs index 7b1b4db7378..445455f33d8 100644 --- a/src/test/compile-fail/extfmt-non-literal.rs +++ b/src/test/compile-fail/extfmt-non-literal.rs @@ -4,5 +4,5 @@ fn main() { // #fmt's first argument must be a literal. Hopefully this // restriction can be eased eventually to just require a // compile-time constant. - let x = #fmt("a" + "b"); -} \ No newline at end of file + let x = #fmt["a" + "b"]; +} diff --git a/src/test/compile-fail/extfmt-non-literal2.rs b/src/test/compile-fail/extfmt-non-literal2.rs index 5bb730c8aa6..8a2d7c4bbed 100644 --- a/src/test/compile-fail/extfmt-non-literal2.rs +++ b/src/test/compile-fail/extfmt-non-literal2.rs @@ -4,5 +4,5 @@ fn main() { // #fmt's first argument must be a literal. Hopefully this // restriction can be eased eventually to just require a // compile-time constant. - let x = #fmt(20); -} \ No newline at end of file + let x = #fmt[20]; +} diff --git a/src/test/compile-fail/extfmt-not-enough-args.rs b/src/test/compile-fail/extfmt-not-enough-args.rs index 9e3012bbc49..849a836060d 100644 --- a/src/test/compile-fail/extfmt-not-enough-args.rs +++ b/src/test/compile-fail/extfmt-not-enough-args.rs @@ -2,4 +2,4 @@ use std; -fn main() { let s = #fmt("%s%s%s", "test", "test"); } \ No newline at end of file +fn main() { let s = #fmt["%s%s%s", "test", "test"]; } diff --git a/src/test/compile-fail/extfmt-too-many-args.rs b/src/test/compile-fail/extfmt-too-many-args.rs index 617a1091173..4c91da227e1 100644 --- a/src/test/compile-fail/extfmt-too-many-args.rs +++ b/src/test/compile-fail/extfmt-too-many-args.rs @@ -2,4 +2,4 @@ use std; -fn main() { let s = #fmt("%s", "test", "test"); } \ No newline at end of file +fn main() { let s = #fmt["%s", "test", "test"]; } diff --git a/src/test/compile-fail/extfmt-unknown-type.rs b/src/test/compile-fail/extfmt-unknown-type.rs index 8c272a182a5..3a35a1d727b 100644 --- a/src/test/compile-fail/extfmt-unknown-type.rs +++ b/src/test/compile-fail/extfmt-unknown-type.rs @@ -1,3 +1,3 @@ // error-pattern:unknown type -fn main() { #fmt("%w"); } \ No newline at end of file +fn main() { #fmt["%w"]; } diff --git a/src/test/compile-fail/extfmt-unsigned-plus.rs b/src/test/compile-fail/extfmt-unsigned-plus.rs index 7715305e829..4ac41efb312 100644 --- a/src/test/compile-fail/extfmt-unsigned-plus.rs +++ b/src/test/compile-fail/extfmt-unsigned-plus.rs @@ -2,5 +2,5 @@ fn main() { // Can't use a sign on unsigned conversions - #fmt("%+u", 10u); -} \ No newline at end of file + #fmt["%+u", 10u]; +} diff --git a/src/test/compile-fail/extfmt-unsigned-space.rs b/src/test/compile-fail/extfmt-unsigned-space.rs index 0a99a4b6c5e..6393548eb3d 100644 --- a/src/test/compile-fail/extfmt-unsigned-space.rs +++ b/src/test/compile-fail/extfmt-unsigned-space.rs @@ -2,5 +2,5 @@ fn main() { // Can't use a space on unsigned conversions - #fmt("% u", 10u); -} \ No newline at end of file + #fmt["% u", 10u]; +} diff --git a/src/test/compile-fail/extfmt-unterminated-conv.rs b/src/test/compile-fail/extfmt-unterminated-conv.rs index 44a321f578d..3b7d0ce1767 100644 --- a/src/test/compile-fail/extfmt-unterminated-conv.rs +++ b/src/test/compile-fail/extfmt-unterminated-conv.rs @@ -1,3 +1,3 @@ // error-pattern:unterminated conversion -fn main() { #fmt("%"); } \ No newline at end of file +fn main() { #fmt["%"]; } diff --git a/src/test/compile-fail/fail-expr.rs b/src/test/compile-fail/fail-expr.rs index 13d91ce5cb2..72ae83062eb 100644 --- a/src/test/compile-fail/fail-expr.rs +++ b/src/test/compile-fail/fail-expr.rs @@ -1,3 +1,3 @@ // error-pattern:mismatched types -fn main() { fail 5; } \ No newline at end of file +fn main() { fail 5; } diff --git a/src/test/compile-fail/fail-type-err.rs b/src/test/compile-fail/fail-type-err.rs index e65ad1af413..8ea86d80a7b 100644 --- a/src/test/compile-fail/fail-type-err.rs +++ b/src/test/compile-fail/fail-type-err.rs @@ -1,2 +1,2 @@ // error-pattern:expected str but found [int] -fn main() { fail ~[0]; } \ No newline at end of file +fn main() { fail [0]; } diff --git a/src/test/compile-fail/fn-bad-block-type.rs b/src/test/compile-fail/fn-bad-block-type.rs index ba82efcf750..2349bfe90dc 100644 --- a/src/test/compile-fail/fn-bad-block-type.rs +++ b/src/test/compile-fail/fn-bad-block-type.rs @@ -2,4 +2,4 @@ fn f() -> int { true } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/fn-compare-mismatch.rs b/src/test/compile-fail/fn-compare-mismatch.rs index a2bb326c548..87287edca71 100644 --- a/src/test/compile-fail/fn-compare-mismatch.rs +++ b/src/test/compile-fail/fn-compare-mismatch.rs @@ -4,4 +4,4 @@ fn main() { fn f() { } fn g(i: int) { } let x = f == g; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/fn-constraint.rs b/src/test/compile-fail/fn-constraint.rs index 0be8d79a399..9ace741d836 100644 --- a/src/test/compile-fail/fn-constraint.rs +++ b/src/test/compile-fail/fn-constraint.rs @@ -6,4 +6,4 @@ fn main() { let a: uint = 4u; let b: uint = 1u; log_err safe_slice("kitties", a, b); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/fn-expr-type-state.rs b/src/test/compile-fail/fn-expr-type-state.rs index 02650b45d88..935542e85e7 100644 --- a/src/test/compile-fail/fn-expr-type-state.rs +++ b/src/test/compile-fail/fn-expr-type-state.rs @@ -4,4 +4,4 @@ fn main() { // Typestate should work even in a lambda. we should reject this program. let f = fn () -> int { let i: int; ret i; }; log_err f(); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/fn-expr-typestate-2.rs b/src/test/compile-fail/fn-expr-typestate-2.rs index 299b11cb743..d4f49f96466 100644 --- a/src/test/compile-fail/fn-expr-typestate-2.rs +++ b/src/test/compile-fail/fn-expr-typestate-2.rs @@ -1,3 +1,3 @@ // error-pattern:Unsatisfied precondition -fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; } \ No newline at end of file +fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; } diff --git a/src/test/compile-fail/for-each-over-bs.rs b/src/test/compile-fail/for-each-over-bs.rs index d34c91cd271..0d184978769 100644 --- a/src/test/compile-fail/for-each-over-bs.rs +++ b/src/test/compile-fail/for-each-over-bs.rs @@ -1,2 +1,2 @@ // error-pattern:sequence in for each loop not a call -fn main() { for each p in 1 {} } +fn main() { for each p in 1 { } } diff --git a/src/test/compile-fail/forgot-ret.rs b/src/test/compile-fail/forgot-ret.rs index 1cdc55ffd87..5d91e3212df 100644 --- a/src/test/compile-fail/forgot-ret.rs +++ b/src/test/compile-fail/forgot-ret.rs @@ -5,4 +5,4 @@ fn god_exists(a: int) -> bool { be god_exists(a); } fn f(a: int) -> int { if god_exists(a) { ret 5; } } -fn main() { f(12); } \ No newline at end of file +fn main() { f(12); } diff --git a/src/test/compile-fail/fru-extra-field.rs b/src/test/compile-fail/fru-extra-field.rs index 6957da34956..7d070c47f46 100644 --- a/src/test/compile-fail/fru-extra-field.rs +++ b/src/test/compile-fail/fru-extra-field.rs @@ -8,4 +8,4 @@ fn main() { let origin: point = {x: 0, y: 0}; let origin3d: point = {z: 0 with origin}; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/fru-typestate.rs b/src/test/compile-fail/fru-typestate.rs index ce5102cbf65..447f6f44dc5 100644 --- a/src/test/compile-fail/fru-typestate.rs +++ b/src/test/compile-fail/fru-typestate.rs @@ -9,4 +9,4 @@ fn main() { let right: point = {x: 10 with origin}; origin = {x: 0, y: 0}; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/if-branch-types.rs b/src/test/compile-fail/if-branch-types.rs index 345d2509970..bfb7a277492 100644 --- a/src/test/compile-fail/if-branch-types.rs +++ b/src/test/compile-fail/if-branch-types.rs @@ -1,3 +1,3 @@ // error-pattern:mismatched types -fn main() { let x = if true { 10 } else { 10u }; } \ No newline at end of file +fn main() { let x = if true { 10 } else { 10u }; } diff --git a/src/test/compile-fail/if-check-precond-fail.rs b/src/test/compile-fail/if-check-precond-fail.rs index af7658b4f94..9ce0d6f8ef5 100644 --- a/src/test/compile-fail/if-check-precond-fail.rs +++ b/src/test/compile-fail/if-check-precond-fail.rs @@ -2,11 +2,11 @@ pred even(x: uint) -> bool { if x < 2u { ret false; - } else if (x == 2u) { ret true; } else { ret even(x - 2u); } + } else if x == 2u { ret true; } else { ret even(x - 2u); } } fn print_even(x: uint) : even(x) { log x; } fn foo(x: uint) { if check even(x) { fail; } else { print_even(x); } } -fn main() { foo(3u); } \ No newline at end of file +fn main() { foo(3u); } diff --git a/src/test/compile-fail/if-typeck.rs b/src/test/compile-fail/if-typeck.rs index c88a1c8c9e6..d8c262bd6b3 100644 --- a/src/test/compile-fail/if-typeck.rs +++ b/src/test/compile-fail/if-typeck.rs @@ -7,4 +7,4 @@ fn main() { // f is not a bool if f { } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/import-from-dup.rs b/src/test/compile-fail/import-from-dup.rs index 729622c8b5a..73e14bfc753 100644 --- a/src/test/compile-fail/import-from-dup.rs +++ b/src/test/compile-fail/import-from-dup.rs @@ -4,11 +4,11 @@ import m1::{f}; import m2::{f}; mod m1 { - fn f() {} + fn f() { } } mod m2 { - fn f() {} + fn f() { } } -fn main() {} \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/import-from-missing.rs b/src/test/compile-fail/import-from-missing.rs index 1e0b3869053..bcd9ee7da43 100644 --- a/src/test/compile-fail/import-from-missing.rs +++ b/src/test/compile-fail/import-from-missing.rs @@ -2,10 +2,7 @@ import spam::{ham, eggs}; mod spam { - fn ham() {} + fn ham() { } } -fn main() { - ham(); - eggs(); -} \ No newline at end of file +fn main() { ham(); eggs(); } diff --git a/src/test/compile-fail/import-glob-0.rs b/src/test/compile-fail/import-glob-0.rs index 8d74000ef0b..d0cbcf57ad3 100644 --- a/src/test/compile-fail/import-glob-0.rs +++ b/src/test/compile-fail/import-glob-0.rs @@ -19,4 +19,4 @@ fn main() { f2(); f999(); // 'export' currently doesn't work? f4(); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/import-glob-circular.rs b/src/test/compile-fail/import-glob-circular.rs index 1a937d617c6..c9595777c27 100644 --- a/src/test/compile-fail/import-glob-circular.rs +++ b/src/test/compile-fail/import-glob-circular.rs @@ -22,4 +22,4 @@ mod test { import circ1::*; fn test() { f1066(); } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/import-glob-export.rs b/src/test/compile-fail/import-glob-export.rs index 57f154e104f..3965ad5fc4d 100644 --- a/src/test/compile-fail/import-glob-export.rs +++ b/src/test/compile-fail/import-glob-export.rs @@ -9,4 +9,4 @@ mod m1 { fn f2() { } } -fn main() { f2(); } \ No newline at end of file +fn main() { f2(); } diff --git a/src/test/compile-fail/import-glob-multiple.rs b/src/test/compile-fail/import-glob-multiple.rs index 1abe786ab6b..55a8878381d 100644 --- a/src/test/compile-fail/import-glob-multiple.rs +++ b/src/test/compile-fail/import-glob-multiple.rs @@ -17,4 +17,4 @@ mod mod2 { -fn main() { common2(); } \ No newline at end of file +fn main() { common2(); } diff --git a/src/test/compile-fail/import-loop-2.rs b/src/test/compile-fail/import-loop-2.rs index a21950898fa..4040f8333f9 100644 --- a/src/test/compile-fail/import-loop-2.rs +++ b/src/test/compile-fail/import-loop-2.rs @@ -10,4 +10,4 @@ mod b { export x; fn main() { let y = x; } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/import-loop.rs b/src/test/compile-fail/import-loop.rs index 6e790829ec8..6aa88db603d 100644 --- a/src/test/compile-fail/import-loop.rs +++ b/src/test/compile-fail/import-loop.rs @@ -7,4 +7,4 @@ mod y { export x; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/import5.rs b/src/test/compile-fail/import5.rs index 4910bb5065e..71f17b0c34a 100644 --- a/src/test/compile-fail/import5.rs +++ b/src/test/compile-fail/import5.rs @@ -12,4 +12,4 @@ mod m3 { import m2::foo; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/impure-pred.rs b/src/test/compile-fail/impure-pred.rs index cf775f8d6f1..05433ba17ed 100644 --- a/src/test/compile-fail/impure-pred.rs +++ b/src/test/compile-fail/impure-pred.rs @@ -9,4 +9,4 @@ fn main() { let x = 0; check (f(x)); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/infinite-vec-type-recursion.rs b/src/test/compile-fail/infinite-vec-type-recursion.rs index c41c9fb3881..709c5b628ee 100644 --- a/src/test/compile-fail/infinite-vec-type-recursion.rs +++ b/src/test/compile-fail/infinite-vec-type-recursion.rs @@ -3,4 +3,4 @@ type x = [x]; -fn main() { let b: x = ~[]; } +fn main() { let b: x = []; } diff --git a/src/test/compile-fail/lambda-mutate-nested.rs b/src/test/compile-fail/lambda-mutate-nested.rs index 6da8e3b252e..409b0e59950 100644 --- a/src/test/compile-fail/lambda-mutate-nested.rs +++ b/src/test/compile-fail/lambda-mutate-nested.rs @@ -3,10 +3,7 @@ // mutate upvars from a lambda. fn main() { let i = 0; - let ctr = lambda() -> int { - block() { i = i + 1; }(); - ret i; - }; + let ctr = lambda () -> int { block () { i = i + 1; }(); ret i; }; log_err ctr(); log_err ctr(); log_err ctr(); diff --git a/src/test/compile-fail/lambda-mutate.rs b/src/test/compile-fail/lambda-mutate.rs index 24f4c75a853..cb891aad374 100644 --- a/src/test/compile-fail/lambda-mutate.rs +++ b/src/test/compile-fail/lambda-mutate.rs @@ -2,10 +2,7 @@ // Make sure we can't write to upvars from lambdas fn main() { let i = 0; - let ctr = lambda() -> int { - i = i + 1; - ret i; - }; + let ctr = lambda () -> int { i = i + 1; ret i; }; log_err ctr(); log_err ctr(); log_err ctr(); diff --git a/src/test/compile-fail/let-destruct-refutable.rs b/src/test/compile-fail/let-destruct-refutable.rs index 0217fb9cb40..d1796da9037 100644 --- a/src/test/compile-fail/let-destruct-refutable.rs +++ b/src/test/compile-fail/let-destruct-refutable.rs @@ -1,11 +1,8 @@ // error-pattern:refutable pattern -tag xx { - xx(int); - yy; -} +tag xx { xx(int); yy; } fn main() { - let @{x:xx(x), y} = @{x: xx(10), y: 20}; - assert x + y == 30; + let @{x: xx(x), y: y} = @{x: xx(10), y: 20}; + assert (x + y == 30); } diff --git a/src/test/compile-fail/macro-2.rs b/src/test/compile-fail/macro-2.rs index a11dd1f95f9..a802301756c 100644 --- a/src/test/compile-fail/macro-2.rs +++ b/src/test/compile-fail/macro-2.rs @@ -1,6 +1,10 @@ //error-pattern:is an expr, expected an identifier fn main() { - #macro([#mylambda(x, body), {fn f(x: int) -> int {ret body}; f}]); + #macro[[#mylambda[x, body], + { + fn f(x: int) -> int { ret body } + f + }]]; - assert(#mylambda(y*1, y*2)(8) == 16); -} \ No newline at end of file + assert (#mylambda[y * 1, y * 2](8) == 16); +} diff --git a/src/test/compile-fail/macro.rs b/src/test/compile-fail/macro.rs index a3f2df4f187..5943e575a48 100644 --- a/src/test/compile-fail/macro.rs +++ b/src/test/compile-fail/macro.rs @@ -1,7 +1,8 @@ //error-pattern:no clauses match fn main() { - #macro([#trivial(), 1*2*4*2*1]); + #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]]; - assert(#trivial(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16) == 16); + assert (#trivial[1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16] == + 16); } diff --git a/src/test/compile-fail/main-wrong-type-2.rs b/src/test/compile-fail/main-wrong-type-2.rs index 3e1e1fa1eef..e3d5ca40d08 100644 --- a/src/test/compile-fail/main-wrong-type-2.rs +++ b/src/test/compile-fail/main-wrong-type-2.rs @@ -1,2 +1,2 @@ // error-pattern:wrong type in main function: found fn() -> char -fn main() -> char { } \ No newline at end of file +fn main() -> char { } diff --git a/src/test/compile-fail/main-wrong-type.rs b/src/test/compile-fail/main-wrong-type.rs index 33d5c305204..2be4af77008 100644 --- a/src/test/compile-fail/main-wrong-type.rs +++ b/src/test/compile-fail/main-wrong-type.rs @@ -1,2 +1,2 @@ // error-pattern:wrong type in main function: found fn( -fn main(foo: {x: int, y: int}) { } \ No newline at end of file +fn main(foo: {x: int, y: int}) { } diff --git a/src/test/compile-fail/minus-string.rs b/src/test/compile-fail/minus-string.rs index def6124960e..e30a2dbe7df 100644 --- a/src/test/compile-fail/minus-string.rs +++ b/src/test/compile-fail/minus-string.rs @@ -1,5 +1,3 @@ // error-pattern:applying unary minus to non-numeric type str -fn main() { - -"foo"; -} \ No newline at end of file +fn main() { -"foo"; } diff --git a/src/test/compile-fail/missing-main.rs b/src/test/compile-fail/missing-main.rs index 1c59427fa9c..e531cbdc6cc 100644 --- a/src/test/compile-fail/missing-main.rs +++ b/src/test/compile-fail/missing-main.rs @@ -1,2 +1,2 @@ // error-pattern:main function not found -fn mian() { } \ No newline at end of file +fn mian() { } diff --git a/src/test/compile-fail/missing-return2.rs b/src/test/compile-fail/missing-return2.rs index af1612b1323..0fc48fd950a 100644 --- a/src/test/compile-fail/missing-return2.rs +++ b/src/test/compile-fail/missing-return2.rs @@ -7,4 +7,4 @@ fn f() -> int { alt true { true { } } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/move-arg.rs b/src/test/compile-fail/move-arg.rs index cd348231d91..9b60e5dae9a 100644 --- a/src/test/compile-fail/move-arg.rs +++ b/src/test/compile-fail/move-arg.rs @@ -1,10 +1,4 @@ // error-pattern: Unsatisfied precondition constraint -fn test(foo: -int) { - assert (foo == 10); -} +fn test(foo: -int) { assert (foo == 10); } -fn main() { - let x = 10; - test(x); - log x; -} \ No newline at end of file +fn main() { let x = 10; test(x); log x; } diff --git a/src/test/compile-fail/native-type-mismatch.rs b/src/test/compile-fail/native-type-mismatch.rs index daa2c9fa96b..ddb6375e36d 100644 --- a/src/test/compile-fail/native-type-mismatch.rs +++ b/src/test/compile-fail/native-type-mismatch.rs @@ -4,4 +4,4 @@ use std; fn main() { let f: std::os::libc::FILE = std::io::rustrt::rust_get_stdin(); std::os::libc::fopen(f, f); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/nested-ty-params.rs b/src/test/compile-fail/nested-ty-params.rs index 413ea883618..7a249c657fd 100644 --- a/src/test/compile-fail/nested-ty-params.rs +++ b/src/test/compile-fail/nested-ty-params.rs @@ -1,6 +1,6 @@ // error-pattern:Attempt to use a type argument out of scope fn hd<U>(v: &[U]) -> U { - fn hd1(w: &[U]) -> U { ret w.(0); } + fn hd1(w: &[U]) -> U { ret w[0]; } ret hd1(v); } diff --git a/src/test/compile-fail/no-constraint-prop.rs b/src/test/compile-fail/no-constraint-prop.rs index 2f98c4917b0..65e21baf78b 100644 --- a/src/test/compile-fail/no-constraint-prop.rs +++ b/src/test/compile-fail/no-constraint-prop.rs @@ -17,4 +17,4 @@ fn main() { // prestate. let d <- a; log safe_slice("kitties", b, d); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/no-self-dispatch.rs b/src/test/compile-fail/no-self-dispatch.rs index b23092b6409..876c668e8c6 100644 --- a/src/test/compile-fail/no-self-dispatch.rs +++ b/src/test/compile-fail/no-self-dispatch.rs @@ -3,4 +3,4 @@ obj oT() { fn get() -> int { ret 3; } fn foo() { let c = get(); } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/not-a-pred-2.rs b/src/test/compile-fail/not-a-pred-2.rs index 63aad9b37df..852db46e9df 100644 --- a/src/test/compile-fail/not-a-pred-2.rs +++ b/src/test/compile-fail/not-a-pred-2.rs @@ -7,4 +7,5 @@ fn main() { 2); // should fail to typecheck, as (a == b) // is not a manifest call -} \ No newline at end of file + +} diff --git a/src/test/compile-fail/not-a-pred-3.rs b/src/test/compile-fail/not-a-pred-3.rs index 5ec15e9c653..3ca98a5c1ce 100644 --- a/src/test/compile-fail/not-a-pred-3.rs +++ b/src/test/compile-fail/not-a-pred-3.rs @@ -10,4 +10,4 @@ fn main() { let z = f(); // should fail to typecheck, as z.g isn't an explicit name check (z.g(42)); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/not-a-pred-check.rs b/src/test/compile-fail/not-a-pred-check.rs index 20a0b5a7070..8ba91d0e26e 100644 --- a/src/test/compile-fail/not-a-pred-check.rs +++ b/src/test/compile-fail/not-a-pred-check.rs @@ -7,4 +7,4 @@ fn main() { let x = 0; check (f(x)); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/not-a-pred.rs b/src/test/compile-fail/not-a-pred.rs index 3e76ef9601c..80e227ffb16 100644 --- a/src/test/compile-fail/not-a-pred.rs +++ b/src/test/compile-fail/not-a-pred.rs @@ -1,8 +1,8 @@ // -*- rust -*- // error-pattern: Non-predicate in constraint: lt -fn f(a: int, b: int) : lt(a,b) { } +fn f(a: int, b: int) : lt(a, b) { } obj lt(a: int, b: int) { } -fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); } \ No newline at end of file +fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); } diff --git a/src/test/compile-fail/not-pred-args.rs b/src/test/compile-fail/not-pred-args.rs index e73cd18dac7..6ba399ba00c 100644 --- a/src/test/compile-fail/not-pred-args.rs +++ b/src/test/compile-fail/not-pred-args.rs @@ -8,4 +8,4 @@ fn main() { // should fail to typecheck, as pred args must be slot variables // or literals check (f(42 * 17)); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/occurs-check-2.rs b/src/test/compile-fail/occurs-check-2.rs index 20a4cf314c4..6c600158d21 100644 --- a/src/test/compile-fail/occurs-check-2.rs +++ b/src/test/compile-fail/occurs-check-2.rs @@ -1,6 +1,2 @@ // error-pattern: Type inference failed because I could not find -fn main() { - let f; - f = @f; - f(); -} \ No newline at end of file +fn main() { let f; f = @f; f(); } diff --git a/src/test/compile-fail/occurs-check.rs b/src/test/compile-fail/occurs-check.rs index 16b2f94045e..aba5b5c5928 100644 --- a/src/test/compile-fail/occurs-check.rs +++ b/src/test/compile-fail/occurs-check.rs @@ -1,5 +1,2 @@ // error-pattern: Type inference failed because I could not find -fn main() { - let f; - f = @f; -} +fn main() { let f; f = @f; } diff --git a/src/test/compile-fail/or-init.rs b/src/test/compile-fail/or-init.rs index 8c952b0d93f..8103864c154 100644 --- a/src/test/compile-fail/or-init.rs +++ b/src/test/compile-fail/or-init.rs @@ -5,4 +5,4 @@ fn main() { log false || { i = 5; true }; log i; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/or-patter-mismatch.rs b/src/test/compile-fail/or-patter-mismatch.rs index d7525d7b627..dc71c2c1e42 100644 --- a/src/test/compile-fail/or-patter-mismatch.rs +++ b/src/test/compile-fail/or-patter-mismatch.rs @@ -2,4 +2,4 @@ tag blah { a(int, int, uint); b(int, int); } -fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } } \ No newline at end of file +fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } } diff --git a/src/test/compile-fail/output-type-mismatch.rs b/src/test/compile-fail/output-type-mismatch.rs index 38ee7b5a6be..c4ec5bef8c6 100644 --- a/src/test/compile-fail/output-type-mismatch.rs +++ b/src/test/compile-fail/output-type-mismatch.rs @@ -2,4 +2,4 @@ fn f() { } -fn main() { let i: int; i = f(); } \ No newline at end of file +fn main() { let i: int; i = f(); } diff --git a/src/test/compile-fail/pred-assign.rs b/src/test/compile-fail/pred-assign.rs index 0e5ddf23a47..10c6f1443ec 100644 --- a/src/test/compile-fail/pred-assign.rs +++ b/src/test/compile-fail/pred-assign.rs @@ -2,7 +2,7 @@ // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b) -fn f(a: int, b: int) : lt(a,b) { } +fn f(a: int, b: int) : lt(a, b) { } pred lt(a: int, b: int) -> bool { ret a < b; } @@ -13,4 +13,4 @@ fn main() { check (lt(a, b)); a = 24; f(a, b); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/pred-not-bool.rs b/src/test/compile-fail/pred-not-bool.rs index 024ff5216f9..50344120a98 100644 --- a/src/test/compile-fail/pred-not-bool.rs +++ b/src/test/compile-fail/pred-not-bool.rs @@ -7,4 +7,4 @@ pred bad(a: int) -> int { ret 37; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/pred-on-wrong-slots.rs b/src/test/compile-fail/pred-on-wrong-slots.rs index de0faef653b..9e6c86c0737 100644 --- a/src/test/compile-fail/pred-on-wrong-slots.rs +++ b/src/test/compile-fail/pred-on-wrong-slots.rs @@ -2,7 +2,7 @@ // error-pattern: lt(a, c) -fn f(a: int, b: int) : lt(a,b) { } +fn f(a: int, b: int) : lt(a, b) { } pred lt(a: int, b: int) -> bool { ret a < b; } @@ -14,4 +14,4 @@ fn main() { check (lt(b, c)); f(a, b); f(a, c); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/pred-swap.rs b/src/test/compile-fail/pred-swap.rs index 9e96b74ad69..8fe7b19acf5 100644 --- a/src/test/compile-fail/pred-swap.rs +++ b/src/test/compile-fail/pred-swap.rs @@ -2,7 +2,7 @@ // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b) -fn f(a: int, b: int) : lt(a,b) { } +fn f(a: int, b: int) : lt(a, b) { } pred lt(a: int, b: int) -> bool { ret a < b; } @@ -13,4 +13,4 @@ fn main() { check (lt(a, b)); b <-> a; f(a, b); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/rec-extend.rs b/src/test/compile-fail/rec-extend.rs index 773f06fb205..35f884fbff9 100644 --- a/src/test/compile-fail/rec-extend.rs +++ b/src/test/compile-fail/rec-extend.rs @@ -5,4 +5,4 @@ fn main() { let a = {foo: 0}; let b = {foo: true with a}; -} \ No newline at end of file +} diff --git a/src/test/compile-fail/rec-missing-fields.rs b/src/test/compile-fail/rec-missing-fields.rs index 50bf16c9a20..50bcf32dd7f 100644 --- a/src/test/compile-fail/rec-missing-fields.rs +++ b/src/test/compile-fail/rec-missing-fields.rs @@ -6,4 +6,4 @@ type point = {x: int, y: int}; -fn main() { let p: point = {x: 10}; log p.y; } \ No newline at end of file +fn main() { let p: point = {x: 10}; log p.y; } diff --git a/src/test/compile-fail/ret-non-nil.rs b/src/test/compile-fail/ret-non-nil.rs index 7c483ed4194..71db7e4192f 100644 --- a/src/test/compile-fail/ret-non-nil.rs +++ b/src/test/compile-fail/ret-non-nil.rs @@ -4,4 +4,4 @@ fn f() { ret; } fn g() -> int { ret; } -fn main() { f(); g(); } \ No newline at end of file +fn main() { f(); g(); } diff --git a/src/test/compile-fail/return-uninit.rs b/src/test/compile-fail/return-uninit.rs index 34b7a6b5af0..1978ec5f420 100644 --- a/src/test/compile-fail/return-uninit.rs +++ b/src/test/compile-fail/return-uninit.rs @@ -2,4 +2,4 @@ fn f() -> int { let x: int; ret x; } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/compile-fail/self-call-non-obj.rs b/src/test/compile-fail/self-call-non-obj.rs index 6fd8bee270b..6261fda60ac 100644 --- a/src/test/compile-fail/self-call-non-obj.rs +++ b/src/test/compile-fail/self-call-non-obj.rs @@ -7,4 +7,4 @@ fn main() { self.foo(); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/slot-as-pred.rs b/src/test/compile-fail/slot-as-pred.rs index 0220a16f087..820ebd655f5 100644 --- a/src/test/compile-fail/slot-as-pred.rs +++ b/src/test/compile-fail/slot-as-pred.rs @@ -1,7 +1,7 @@ // -*- rust -*- // error-pattern: unresolved name: lt -fn f(a: int, b: int) : lt(a,b) { } +fn f(a: int, b: int) : lt(a, b) { } fn main() { let lt: int; @@ -9,4 +9,4 @@ fn main() { let b: int = 23; check (lt(a, b)); f(a, b); -} \ No newline at end of file +} diff --git a/src/test/compile-fail/spawn-non-nil-fn.rs b/src/test/compile-fail/spawn-non-nil-fn.rs index dfc5471f4de..4d3d13373dc 100644 --- a/src/test/compile-fail/spawn-non-nil-fn.rs +++ b/src/test/compile-fail/spawn-non-nil-fn.rs @@ -5,4 +5,4 @@ import std::task; fn f(x: int) -> int { ret x; } -fn main() { task::_spawn(bind f(10)); } \ No newline at end of file +fn main() { task::_spawn(bind f(10)); } diff --git a/src/test/compile-fail/swap-no-lval.rs b/src/test/compile-fail/swap-no-lval.rs index a45f524fe09..2bb54464157 100644 --- a/src/test/compile-fail/swap-no-lval.rs +++ b/src/test/compile-fail/swap-no-lval.rs @@ -1,3 +1,3 @@ // error-pattern: assignment to non-lvalue -fn main() { 5 <-> 3; } \ No newline at end of file +fn main() { 5 <-> 3; } diff --git a/src/test/compile-fail/swap-uninit.rs b/src/test/compile-fail/swap-uninit.rs index e06d539702b..27fdc611379 100644 --- a/src/test/compile-fail/swap-uninit.rs +++ b/src/test/compile-fail/swap-uninit.rs @@ -1,3 +1,3 @@ // error-pattern:Unsatisfied precondition -fn main() { let x = 3; let y; x <-> y; } \ No newline at end of file +fn main() { let x = 3; let y; x <-> y; } diff --git a/src/test/compile-fail/tail-typeck.rs b/src/test/compile-fail/tail-typeck.rs index 7dd315b929b..c121458f233 100644 --- a/src/test/compile-fail/tail-typeck.rs +++ b/src/test/compile-fail/tail-typeck.rs @@ -4,4 +4,4 @@ fn f() -> int { be g(); } fn g() -> uint { ret 0u; } -fn main() { let y = f(); } \ No newline at end of file +fn main() { let y = f(); } diff --git a/src/test/compile-fail/type-arg-out-of-scope.rs b/src/test/compile-fail/type-arg-out-of-scope.rs index a3ae6619b3e..19be0933c48 100644 --- a/src/test/compile-fail/type-arg-out-of-scope.rs +++ b/src/test/compile-fail/type-arg-out-of-scope.rs @@ -1,5 +1,5 @@ // error-pattern:Attempt to use a type argument out of scope fn foo<T>(x: &T) { - fn bar(f: fn(&T) -> T ) { } + fn bar(f: fn(&T) -> T) { } } fn main() { foo(1); } diff --git a/src/test/compile-fail/type-mismatch-multiple.rs b/src/test/compile-fail/type-mismatch-multiple.rs index 9a7a4b588a7..363af271986 100644 --- a/src/test/compile-fail/type-mismatch-multiple.rs +++ b/src/test/compile-fail/type-mismatch-multiple.rs @@ -2,4 +2,4 @@ // error-pattern:mismatched types: expected bool // error-pattern:mismatched types: expected int -fn main() { let a: bool = 1; let b: int = true; } \ No newline at end of file +fn main() { let a: bool = 1; let b: int = true; } diff --git a/src/test/compile-fail/type-mismatch.rs b/src/test/compile-fail/type-mismatch.rs index a0e257dcd8f..d2ddf61b0bc 100644 --- a/src/test/compile-fail/type-mismatch.rs +++ b/src/test/compile-fail/type-mismatch.rs @@ -1,4 +1,4 @@ // error-pattern:expected bool but found int // issue #516 -fn main() { let x = true; let y = 1; let z = x + y; } \ No newline at end of file +fn main() { let x = true; let y = 1; let z = x + y; } diff --git a/src/test/compile-fail/type-recursive.rs b/src/test/compile-fail/type-recursive.rs index d7ba8faa288..c38c6f5d244 100644 --- a/src/test/compile-fail/type-recursive.rs +++ b/src/test/compile-fail/type-recursive.rs @@ -1,4 +1,4 @@ // error-pattern:illegal recursive type type t1 = {foo: int, foolish: t1}; -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/type-shadow.rs b/src/test/compile-fail/type-shadow.rs index 52022cf67fc..9f26de765be 100644 --- a/src/test/compile-fail/type-shadow.rs +++ b/src/test/compile-fail/type-shadow.rs @@ -9,4 +9,4 @@ fn main() { type X = str; let y: Y = "hello"; } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/unreachable-arm.rs b/src/test/compile-fail/unreachable-arm.rs index eaf5d75702f..ee637fed666 100644 --- a/src/test/compile-fail/unreachable-arm.rs +++ b/src/test/compile-fail/unreachable-arm.rs @@ -2,4 +2,4 @@ tag foo { a(@foo, int); b(uint); } -fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } } \ No newline at end of file +fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } } diff --git a/src/test/compile-fail/unsafe-alias-2.rs b/src/test/compile-fail/unsafe-alias-2.rs index 3917dd3f883..ad7296ef1b4 100644 --- a/src/test/compile-fail/unsafe-alias-2.rs +++ b/src/test/compile-fail/unsafe-alias-2.rs @@ -5,4 +5,4 @@ fn whoknows(x: @mutable int) { *x = 10; } fn main() { let box = @mutable 1; alt *box { x { whoknows(box); log_err x; } } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/unsafe-alias.rs b/src/test/compile-fail/unsafe-alias.rs index 46fb135b951..80eaa661d1d 100644 --- a/src/test/compile-fail/unsafe-alias.rs +++ b/src/test/compile-fail/unsafe-alias.rs @@ -1,7 +1,7 @@ // error-pattern:may alias with argument -fn foo(x: &int, f: fn() ) { log x; } +fn foo(x: &int, f: fn()) { log x; } fn whoknows(x: @mutable int) { *x = 10; } -fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); } \ No newline at end of file +fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); } diff --git a/src/test/compile-fail/unsafe-alt.rs b/src/test/compile-fail/unsafe-alt.rs index 2e0605fa055..fb42b188a7c 100644 --- a/src/test/compile-fail/unsafe-alt.rs +++ b/src/test/compile-fail/unsafe-alt.rs @@ -5,4 +5,4 @@ tag foo { left(int); right(bool); } fn main() { let x = left(10); alt x { left(i) { x = right(false); log i; } _ { } } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/unsafe-for.rs b/src/test/compile-fail/unsafe-for.rs index 43e8b9cb7c2..22d5396c1cb 100644 --- a/src/test/compile-fail/unsafe-for.rs +++ b/src/test/compile-fail/unsafe-for.rs @@ -1,6 +1,6 @@ // error-pattern:invalidate alias x fn main() { - let v: [mutable int] = ~[mutable 1, 2, 3]; - for x: int in v { v.(0) = 10; log x; } + let v: [mutable int] = [mutable 1, 2, 3]; + for x: int in v { v[0] = 10; log x; } } diff --git a/src/test/compile-fail/unsafe-mutable-alias.rs b/src/test/compile-fail/unsafe-mutable-alias.rs index f438d021a25..2f2a395778e 100644 --- a/src/test/compile-fail/unsafe-mutable-alias.rs +++ b/src/test/compile-fail/unsafe-mutable-alias.rs @@ -2,4 +2,4 @@ fn f(a: &int, b: &mutable int) -> int { b += 1; ret a + b; } -fn main() { let i = 4; log f(i, i); } \ No newline at end of file +fn main() { let i = 4; log f(i, i); } diff --git a/src/test/compile-fail/use-after-move.rs b/src/test/compile-fail/use-after-move.rs index ff20307fece..3fb1827441e 100644 --- a/src/test/compile-fail/use-after-move.rs +++ b/src/test/compile-fail/use-after-move.rs @@ -1,2 +1,2 @@ // error-pattern: Unsatisfied precondition constraint (for example, init(x -fn main() { let x = @5; let y <- x; log *x; } \ No newline at end of file +fn main() { let x = @5; let y <- x; log *x; } diff --git a/src/test/compile-fail/use-after-send.rs b/src/test/compile-fail/use-after-send.rs index 212fa50a506..965c262237d 100644 --- a/src/test/compile-fail/use-after-send.rs +++ b/src/test/compile-fail/use-after-send.rs @@ -1,9 +1,5 @@ // error-pattern: Unsatisfied precondition constraint -fn send<~T>(ch : _chan<T>, data : -T) { - log ch; - log data; - fail; -} +fn send<~T>(ch: _chan<T>, data: -T) { log ch; log data; fail; } type _chan<T> = int; // Tests that "log message;" is flagged as using @@ -13,6 +9,4 @@ fn test00_start(ch: _chan<int>, message: int, count: int) { log message; } -fn main() { - fail; -} \ No newline at end of file +fn main() { fail; } diff --git a/src/test/compile-fail/use-meta-dup.rs b/src/test/compile-fail/use-meta-dup.rs index 5e44999b595..04d67263c36 100644 --- a/src/test/compile-fail/use-meta-dup.rs +++ b/src/test/compile-fail/use-meta-dup.rs @@ -2,4 +2,4 @@ use std(name = "std", name = "nonstd"); -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/use-meta-mismatch.rs b/src/test/compile-fail/use-meta-mismatch.rs index a2adca83cd4..fef50525a1e 100644 --- a/src/test/compile-fail/use-meta-mismatch.rs +++ b/src/test/compile-fail/use-meta-mismatch.rs @@ -2,4 +2,4 @@ use std(complex(meta(item))); -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/use-uninit-2.rs b/src/test/compile-fail/use-uninit-2.rs index d46c340a9df..4d35567ea4f 100644 --- a/src/test/compile-fail/use-uninit-2.rs +++ b/src/test/compile-fail/use-uninit-2.rs @@ -2,4 +2,4 @@ fn foo(x: int) { log x; } -fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); } \ No newline at end of file +fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); } diff --git a/src/test/compile-fail/use-uninit-3.rs b/src/test/compile-fail/use-uninit-3.rs index cf680f0c184..5b7c619f36f 100644 --- a/src/test/compile-fail/use-uninit-3.rs +++ b/src/test/compile-fail/use-uninit-3.rs @@ -2,4 +2,4 @@ fn foo(x: int) { log x; } -fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); } \ No newline at end of file +fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); } diff --git a/src/test/compile-fail/use-uninit.rs b/src/test/compile-fail/use-uninit.rs index b787947fe7b..75e60bdbce3 100644 --- a/src/test/compile-fail/use-uninit.rs +++ b/src/test/compile-fail/use-uninit.rs @@ -2,4 +2,4 @@ fn foo(x: int) { log x; } -fn main() { let x: int; foo(x); } \ No newline at end of file +fn main() { let x: int; foo(x); } diff --git a/src/test/compile-fail/vec-field.rs b/src/test/compile-fail/vec-field.rs index 10a222f5cd0..1ec888670c4 100644 --- a/src/test/compile-fail/vec-field.rs +++ b/src/test/compile-fail/vec-field.rs @@ -2,7 +2,7 @@ // issue #367 fn f() { - let v = ~[1]; + let v = [1]; log v.some_field_name; //type error } diff --git a/src/test/compile-fail/vector-no-ann.rs b/src/test/compile-fail/vector-no-ann.rs index 087fa20d076..80463e3ead3 100644 --- a/src/test/compile-fail/vector-no-ann.rs +++ b/src/test/compile-fail/vector-no-ann.rs @@ -1,2 +1,2 @@ // error-pattern:cannot determine a type -fn main() { let foo = []; } \ No newline at end of file +fn main() { let foo = []; } diff --git a/src/test/compile-fail/while-bypass.rs b/src/test/compile-fail/while-bypass.rs index 7fa5ccb37a5..e70090dd59e 100644 --- a/src/test/compile-fail/while-bypass.rs +++ b/src/test/compile-fail/while-bypass.rs @@ -2,4 +2,4 @@ fn f() -> int { let x: int; while true { x = 10; } ret x; } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/compile-fail/while-expr.rs b/src/test/compile-fail/while-expr.rs index 8da769a29fd..5ff3adf34c3 100644 --- a/src/test/compile-fail/while-expr.rs +++ b/src/test/compile-fail/while-expr.rs @@ -1,3 +1,3 @@ // error-pattern: precondition constraint -fn main() { let x: bool; while x { } } \ No newline at end of file +fn main() { let x: bool; while x { } } diff --git a/src/test/compile-fail/while-loop-constraints.rs b/src/test/compile-fail/while-loop-constraints.rs index 9d936f62fdb..557ff099cbf 100644 --- a/src/test/compile-fail/while-loop-constraints.rs +++ b/src/test/compile-fail/while-loop-constraints.rs @@ -4,4 +4,4 @@ fn main() { let y: int = 42; let x: int; while true { log y; while true { while true { while true { x <- y; } } } } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/while-loop-pred-constraints.rs b/src/test/compile-fail/while-loop-pred-constraints.rs index 43e662d643c..5920d25230f 100644 --- a/src/test/compile-fail/while-loop-pred-constraints.rs +++ b/src/test/compile-fail/while-loop-pred-constraints.rs @@ -13,4 +13,4 @@ fn main() { print_even(y); while true { while true { while true { y += x; } } } } -} \ No newline at end of file +} diff --git a/src/test/compile-fail/writing-through-read-alias.rs b/src/test/compile-fail/writing-through-read-alias.rs index bc3f9037da9..2cfcb31ccbc 100644 --- a/src/test/compile-fail/writing-through-read-alias.rs +++ b/src/test/compile-fail/writing-through-read-alias.rs @@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int}; fn f(p: &point) { p.x = 13; } -fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); } \ No newline at end of file +fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); } diff --git a/src/test/compile-fail/writing-through-uninit-vec.rs b/src/test/compile-fail/writing-through-uninit-vec.rs index 7397773d940..0462824c276 100644 --- a/src/test/compile-fail/writing-through-uninit-vec.rs +++ b/src/test/compile-fail/writing-through-uninit-vec.rs @@ -1,5 +1,5 @@ // error-pattern: Unsatisfied precondition constraint -fn test() { let w: [int]; w.(5) = 0; } +fn test() { let w: [int]; w[5] = 0; } fn main() { test(); } diff --git a/src/test/compile-fail/writing-to-immutable-obj.rs b/src/test/compile-fail/writing-to-immutable-obj.rs index 484afd91a3e..cc35f545120 100644 --- a/src/test/compile-fail/writing-to-immutable-obj.rs +++ b/src/test/compile-fail/writing-to-immutable-obj.rs @@ -2,4 +2,4 @@ obj objy(x: int) { fn foo() { x = 5; } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compile-fail/writing-to-immutable-rec.rs b/src/test/compile-fail/writing-to-immutable-rec.rs index c40c6934f5c..ad0ceed8ee3 100644 --- a/src/test/compile-fail/writing-to-immutable-rec.rs +++ b/src/test/compile-fail/writing-to-immutable-rec.rs @@ -1,2 +1,2 @@ // error-pattern: assignment to immutable field -fn main() { let r: {x: int} = {x: 1}; r.x = 6; } \ No newline at end of file +fn main() { let r: {x: int} = {x: 1}; r.x = 6; } diff --git a/src/test/compile-fail/writing-to-immutable-vec.rs b/src/test/compile-fail/writing-to-immutable-vec.rs index d800288dd92..6f0f7c53504 100644 --- a/src/test/compile-fail/writing-to-immutable-vec.rs +++ b/src/test/compile-fail/writing-to-immutable-vec.rs @@ -1,2 +1,2 @@ // error-pattern:assignment to immutable vec content -fn main() { let v: [int] = ~[1, 2, 3]; v.(1) = 4; } +fn main() { let v: [int] = [1, 2, 3]; v[1] = 4; } diff --git a/src/test/compile-fail/wrong-ret-type.rs b/src/test/compile-fail/wrong-ret-type.rs index b4435086cdd..82293a8f706 100644 --- a/src/test/compile-fail/wrong-ret-type.rs +++ b/src/test/compile-fail/wrong-ret-type.rs @@ -1,3 +1,3 @@ // error-pattern: mismatched types fn mk_int() -> uint { let i: int = 3; ret i; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/compiletest/common.rs b/src/test/compiletest/common.rs index 85b7be9b00f..ab0415fd7c1 100644 --- a/src/test/compiletest/common.rs +++ b/src/test/compiletest/common.rs @@ -1,38 +1,32 @@ import std::option; -tag mode { - mode_compile_fail; - mode_run_fail; - mode_run_pass; - mode_pretty; -} +tag mode { mode_compile_fail; mode_run_fail; mode_run_pass; mode_pretty; } -type config = { +type config = // The library paths required for running the compiler - compile_lib_path: str, // The library paths required for running compiled programs - run_lib_path: str, // The rustc executable - rustc_path: str, // The directory containing the tests to run - src_base: str, // The directory where programs should be built - build_base: str, // The name of the stage being built (stage1, etc) - stage_id: str, // The test mode, compile-fail, run-fail, run-pass - mode: mode, // Run ignored tests - run_ignored: bool, // Only run tests that match this filter - filter: option::t<str>, // A command line to prefix program execution with, // for running under valgrind - runtool: option::t<str>, // Flags to pass to the compiler - rustcflags: option::t<str>, // Explain what's going on - verbose: bool -}; + {compile_lib_path: str, + run_lib_path: str, + rustc_path: str, + src_base: str, + build_base: str, + stage_id: str, + mode: mode, + run_ignored: bool, + filter: option::t<str>, + runtool: option::t<str>, + rustcflags: option::t<str>, + verbose: bool}; type cx = {config: config, procsrv: procsrv::handle}; diff --git a/src/test/compiletest/compiletest.rs b/src/test/compiletest/compiletest.rs index 9bbc30de519..d045875e295 100644 --- a/src/test/compiletest/compiletest.rs +++ b/src/test/compiletest/compiletest.rs @@ -31,12 +31,12 @@ fn main(args: [str]) { fn parse_config(args: &[str]) -> config { let opts = - ~[getopts::reqopt("compile-lib-path"), - getopts::reqopt("run-lib-path"), getopts::reqopt("rustc-path"), - getopts::reqopt("src-base"), getopts::reqopt("build-base"), - getopts::reqopt("stage-id"), getopts::reqopt("mode"), - getopts::optflag("ignored"), getopts::optopt("runtool"), - getopts::optopt("rustcflags"), getopts::optflag("verbose")]; + [getopts::reqopt("compile-lib-path"), getopts::reqopt("run-lib-path"), + getopts::reqopt("rustc-path"), getopts::reqopt("src-base"), + getopts::reqopt("build-base"), getopts::reqopt("stage-id"), + getopts::reqopt("mode"), getopts::optflag("ignored"), + getopts::optopt("runtool"), getopts::optopt("rustcflags"), + getopts::optflag("verbose")]; check (vec::is_not_empty(args)); let args_ = vec::tail(args); @@ -56,7 +56,7 @@ fn parse_config(args: &[str]) -> config { run_ignored: getopts::opt_present(match, "ignored"), filter: if vec::len(match.free) > 0u { - option::some(match.free.(0)) + option::some(match.free[0]) } else { option::none }, runtool: getopts::opt_maybe_str(match, "runtool"), rustcflags: getopts::opt_maybe_str(match, "rustcflags"), @@ -65,20 +65,20 @@ fn parse_config(args: &[str]) -> config { fn log_config(config: &config) { let c = config; - logv(c, #fmt("configuration:")); - logv(c, #fmt("compile_lib_path: %s", config.compile_lib_path)); - logv(c, #fmt("run_lib_path: %s", config.run_lib_path)); - logv(c, #fmt("rustc_path: %s", config.rustc_path)); - logv(c, #fmt("src_base: %s", config.src_base)); - logv(c, #fmt("build_base: %s", config.build_base)); - logv(c, #fmt("stage_id: %s", config.stage_id)); - logv(c, #fmt("mode: %s", mode_str(config.mode))); - logv(c, #fmt("run_ignored: %b", config.run_ignored)); - logv(c, #fmt("filter: %s", opt_str(config.filter))); - logv(c, #fmt("runtool: %s", opt_str(config.runtool))); - logv(c, #fmt("rustcflags: %s", opt_str(config.rustcflags))); - logv(c, #fmt("verbose: %b", config.verbose)); - logv(c, #fmt("\n")); + logv(c, #fmt["configuration:"]); + logv(c, #fmt["compile_lib_path: %s", config.compile_lib_path]); + logv(c, #fmt["run_lib_path: %s", config.run_lib_path]); + logv(c, #fmt["rustc_path: %s", config.rustc_path]); + logv(c, #fmt["src_base: %s", config.src_base]); + logv(c, #fmt["build_base: %s", config.build_base]); + logv(c, #fmt["stage_id: %s", config.stage_id]); + logv(c, #fmt["mode: %s", mode_str(config.mode)]); + logv(c, #fmt["run_ignored: %b", config.run_ignored]); + logv(c, #fmt["filter: %s", opt_str(config.filter)]); + logv(c, #fmt["runtool: %s", opt_str(config.runtool)]); + logv(c, #fmt["rustcflags: %s", opt_str(config.rustcflags)]); + logv(c, #fmt["verbose: %b", config.verbose]); + logv(c, #fmt["\n"]); } fn opt_str(maybestr: option::t<str>) -> str { @@ -121,16 +121,16 @@ fn test_opts(config: &config) -> test::test_opts { } type tests_and_conv_fn = - {tests: [test::test_desc], to_task: fn(&fn() ) -> test::joinable }; + {tests: [test::test_desc], to_task: fn(&fn()) -> test::joinable}; fn make_tests(cx: &cx) -> tests_and_conv_fn { - log #fmt("making tests from %s", cx.config.src_base); + log #fmt["making tests from %s", cx.config.src_base]; let configport = mk_port::<[u8]>(); - let tests = ~[]; + let tests = []; for file: str in fs::list_dir(cx.config.src_base) { - log #fmt("inspecting file %s", file); + log #fmt["inspecting file %s", file]; if is_test(cx.config, file) { - tests += ~[make_test(cx, file, configport)]; + tests += [make_test(cx, file, configport)]; } } ret {tests: tests, to_task: bind closure_to_task(cx, configport, _)}; @@ -138,11 +138,9 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn { fn is_test(config: &config, testfile: &str) -> bool { // Pretty-printer does not work with .rc files yet - let valid_extensions = alt config.mode { - mode_pretty. { ~[".rs"] } - _ { ~[".rc", ".rs"] } - }; - let invalid_prefixes = ~[".", "#", "~"]; + let valid_extensions = + alt config.mode { mode_pretty. { [".rs"] } _ { [".rc", ".rs"] } }; + let invalid_prefixes = [".", "#", "~"]; let name = fs::basename(testfile); let valid = false; @@ -166,7 +164,7 @@ fn make_test(cx: &cx, testfile: &str, configport: &_port<[u8]>) -> } fn make_test_name(config: &config, testfile: &str) -> str { - #fmt("[%s] %s", mode_str(config.mode), testfile) + #fmt["[%s] %s", mode_str(config.mode), testfile] } /* @@ -188,8 +186,8 @@ up. Then we'll spawn that data into another task and return the task. Really convoluted. Need to think up of a better definition for tests. */ -fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) -> test::test_fn -{ +fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) -> + test::test_fn { bind send_config(testfile, configchan) } @@ -207,25 +205,19 @@ break up the config record and pass everything individually to the spawned function. */ -fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn() ) - -> test::joinable -{ +fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn()) -> + test::joinable { testfn(); let testfile = configport.recv(); - let testthunk = bind run_test_task(cx.config.compile_lib_path, - cx.config.run_lib_path, - cx.config.rustc_path, - cx.config.src_base, - cx.config.build_base, - cx.config.stage_id, - mode_str(cx.config.mode), - cx.config.run_ignored, - opt_str(cx.config.filter), - opt_str(cx.config.runtool), - opt_str(cx.config.rustcflags), - cx.config.verbose, - cx.procsrv.chan, - testfile); + let testthunk = + bind run_test_task(cx.config.compile_lib_path, cx.config.run_lib_path, + cx.config.rustc_path, cx.config.src_base, + cx.config.build_base, cx.config.stage_id, + mode_str(cx.config.mode), cx.config.run_ignored, + opt_str(cx.config.filter), + opt_str(cx.config.runtool), + opt_str(cx.config.rustcflags), cx.config.verbose, + cx.procsrv.chan, testfile); ret task::spawn_joinable(testthunk); } diff --git a/src/test/compiletest/procsrv.rs b/src/test/compiletest/procsrv.rs index d434562cf3c..6e464038b18 100644 --- a/src/test/compiletest/procsrv.rs +++ b/src/test/compiletest/procsrv.rs @@ -30,24 +30,20 @@ type reqchan = chan<request>; type handle = {task: option::t<task_id>, chan: reqchan}; -tag request { - exec([u8], [u8], [[u8]], chan<response>); - stop; -} +tag request { exec([u8], [u8], [[u8]], chan<response>); stop; } type response = {pid: int, infd: int, outfd: int, errfd: int}; fn mk() -> handle { let setupport = port(); - let task = task::spawn(bind fn(setupchan: chan<chan<request>>) { - let reqport = port(); - let reqchan = chan(reqport); - send(setupchan, reqchan); - worker(reqport); - } (chan(setupport))); - ret {task: option::some(task), - chan: recv(setupport) - }; + let task = + task::spawn(bind fn (setupchan: chan<chan<request>>) { + let reqport = port(); + let reqchan = chan(reqport); + send(setupchan, reqchan); + worker(reqport); + }(chan(setupport))); + ret {task: option::some(task), chan: recv(setupport)}; } fn from_chan(ch: &reqchan) -> handle { {task: option::none, chan: ch} } @@ -57,15 +53,13 @@ fn close(handle: &handle) { task::join_id(option::get(handle.task)); } -fn run(handle: &handle, lib_path: &str, - prog: &str, args: &[str], input: &option::t<str>) -> -{status: int, out: str, err: str} { +fn run(handle: &handle, lib_path: &str, prog: &str, args: &[str], + input: &option::t<str>) -> {status: int, out: str, err: str} { let p = port(); let ch = chan(p); - send(handle.chan, exec(str::bytes(lib_path), - str::bytes(prog), - clone_vecstr(args), - ch)); + send(handle.chan, + exec(str::bytes(lib_path), str::bytes(prog), clone_vecstr(args), + ch)); let resp = recv(p); writeclose(resp.infd, input); @@ -77,8 +71,7 @@ fn run(handle: &handle, lib_path: &str, fn writeclose(fd: int, s: &option::t<str>) { if option::is_some(s) { - let writer = io::new_writer( - io::fd_buf_writer(fd, option::none)); + let writer = io::new_writer(io::fd_buf_writer(fd, option::none)); writer.write_str(option::get(s)); } @@ -88,8 +81,7 @@ fn writeclose(fd: int, s: &option::t<str>) { fn readclose(fd: int) -> str { // Copied from run::program_output let file = os::fd_FILE(fd); - let reader = io::new_reader( - io::FILE_buf_reader(file, option::none)); + let reader = io::new_reader(io::FILE_buf_reader(file, option::none)); let buf = ""; while !reader.eof() { let bytes = reader.read_bytes(4096u); @@ -112,35 +104,32 @@ fn worker(p: port<request>) { // the receiver's poniters outlive the sender's. Here we clone // everything and let the originals go out of scope before sending // a response. - execparms = { - // FIXME (785): The 'discriminant' of an alt expression has - // the same scope as the alt expression itself, so we have to - // put the entire alt in another block to make sure the exec - // message goes out of scope. Seems like the scoping rules for - // the alt discriminant are wrong. - alt recv(p) { - exec(lib_path, prog, args, respchan) { - { - lib_path: str::unsafe_from_bytes(lib_path), - prog: str::unsafe_from_bytes(prog), - args: clone_vecu8str(args), - respchan: respchan + execparms = + { + + // FIXME (785): The 'discriminant' of an alt expression has + // the same scope as the alt expression itself, so we have to + // put the entire alt in another block to make sure the exec + // message goes out of scope. Seems like the scoping rules for + // the alt discriminant are wrong. + alt recv(p) { + exec(lib_path, prog, args, respchan) { + {lib_path: str::unsafe_from_bytes(lib_path), + prog: str::unsafe_from_bytes(prog), + args: clone_vecu8str(args), + respchan: respchan} + } + stop. { ret } } - } - stop. { ret } - } - }; + }; // This is copied from run::start_program let pipe_in = os::pipe(); let pipe_out = os::pipe(); let pipe_err = os::pipe(); let spawnproc = - bind run::spawn_process(execparms.prog, - execparms.args, - pipe_in.in, - pipe_out.out, - pipe_err.out); + bind run::spawn_process(execparms.prog, execparms.args, + pipe_in.in, pipe_out.out, pipe_err.out); let pid = with_lib_path(execparms.lib_path, spawnproc); os::libc::close(pipe_in.in); @@ -161,7 +150,7 @@ fn worker(p: port<request>) { } } -fn with_lib_path<T>(path: &str, f: fn() -> T ) -> T { +fn with_lib_path<T>(path: &str, f: fn() -> T) -> T { let maybe_oldpath = getenv(util::lib_path_env_var()); append_lib_path(path); let res = f(); @@ -179,17 +168,15 @@ fn append_lib_path(path: &str) { export_lib_path(util::make_new_path(path)); } fn export_lib_path(path: &str) { setenv(util::lib_path_env_var(), path); } fn clone_vecstr(v: &[str]) -> [[u8]] { - let r = ~[]; - for t: str in vec::slice(v, 0u, vec::len(v)) { - r += ~[str::bytes(t)]; - } + let r = []; + for t: str in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; } ret r; } fn clone_vecu8str(v: &[[u8]]) -> [str] { - let r = ~[]; + let r = []; for t in vec::slice(v, 0u, vec::len(v)) { - r += ~[str::unsafe_from_bytes(t)]; + r += [str::unsafe_from_bytes(t)]; } ret r; } diff --git a/src/test/compiletest/runtest.rs b/src/test/compiletest/runtest.rs index c56ec6970ef..c3572e20cba 100644 --- a/src/test/compiletest/runtest.rs +++ b/src/test/compiletest/runtest.rs @@ -20,11 +20,11 @@ export run; fn run(cx: &cx, _testfile: -[u8]) { let testfile = str::unsafe_from_bytes(_testfile); - if (cx.config.verbose) { + if cx.config.verbose { // We're going to be dumping a lot of info. Start on a new line. io::stdout().write_str("\n\n"); } - log #fmt("running %s", testfile); + log #fmt["running %s", testfile]; let props = load_props(testfile); alt cx.config.mode { mode_compile_fail. { run_cfail_test(cx, props, testfile); } @@ -38,8 +38,7 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); if procres.status == 0 { - fatal_procres("compile-fail test compiled successfully!", - procres); + fatal_procres("compile-fail test compiled successfully!", procres); } check_error_patterns(props, testfile, procres); @@ -48,14 +47,12 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) { fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); - if procres.status != 0 { - fatal_procres("compilation failed!", procres); } + if procres.status != 0 { fatal_procres("compilation failed!", procres); } procres = exec_compiled_test(cx, props, testfile); if procres.status == 0 { - fatal_procres("run-fail test didn't produce an error!", - procres); + fatal_procres("run-fail test didn't produce an error!", procres); } // This is the value valgrind returns on failure @@ -73,8 +70,7 @@ fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) { fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) { let procres = compile_test(cx, props, testfile); - if procres.status != 0 { - fatal_procres("compilation failed!", procres); } + if procres.status != 0 { fatal_procres("compilation failed!", procres); } procres = exec_compiled_test(cx, props, testfile); @@ -85,46 +81,41 @@ fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) { fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) { if option::is_some(props.pp_exact) { logv(cx.config, "testing for exact pretty-printing"); - } else { - logv(cx.config, "testing for converging pretty-printing"); - } + } else { logv(cx.config, "testing for converging pretty-printing"); } - let rounds = alt props.pp_exact { - option::some(_) { 1 } - option::none. { 2 } - }; + let rounds = + alt props.pp_exact { option::some(_) { 1 } option::none. { 2 } }; - let srcs = ~[io::read_whole_file_str(testfile)]; + let srcs = [io::read_whole_file_str(testfile)]; let round = 0; while round < rounds { - logv(cx.config, #fmt("pretty-printing round %d", round)); - let procres = print_source(cx, testfile, srcs.(round)); + logv(cx.config, #fmt["pretty-printing round %d", round]); + let procres = print_source(cx, testfile, srcs[round]); if procres.status != 0 { - fatal_procres(#fmt("pretty-printing failed in round %d", round), + fatal_procres(#fmt["pretty-printing failed in round %d", round], procres); } - srcs += ~[procres.stdout]; + srcs += [procres.stdout]; round += 1; } - let expected = alt props.pp_exact { - option::some(file) { - let filepath = fs::connect(fs::dirname(testfile), file); - io::read_whole_file_str(filepath) - } - option::none. { - srcs.(vec::len(srcs) - 2u) - } - }; - let actual = srcs.(vec::len(srcs) - 1u); + let expected = + alt props.pp_exact { + option::some(file) { + let filepath = fs::connect(fs::dirname(testfile), file); + io::read_whole_file_str(filepath) + } + option::none. { srcs[vec::len(srcs) - 2u] } + }; + let actual = srcs[vec::len(srcs) - 1u]; if option::is_some(props.pp_exact) { // Now we have to care about line endings let cr = "\r"; - check str::is_not_empty(cr); + check (str::is_not_empty(cr)); actual = str::replace(actual, cr, ""); expected = str::replace(expected, cr, ""); } @@ -135,8 +126,7 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) { let procres = typecheck_source(cx, testfile, actual); if procres.status != 0 { - fatal_procres("pretty-printed source does not typecheck", - procres); + fatal_procres("pretty-printed source does not typecheck", procres); } ret; @@ -148,14 +138,15 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) { fn make_pp_args(config: &config, testfile: &str) -> procargs { let prog = config.rustc_path; - let args = ~["-", "--pretty", "normal"]; + let args = ["-", "--pretty", "normal"]; ret {prog: prog, args: args}; } fn compare_source(expected: &str, actual: &str) { if expected != actual { error("pretty-printed source does match expected source"); - let msg = #fmt("\n\ + let msg = + #fmt["\n\ expected:\n\ ------------------------------------------\n\ %s\n\ @@ -165,7 +156,7 @@ actual:\n\ %s\n\ ------------------------------------------\n\ \n", - expected, actual); + expected, actual]; io::stdout().write_str(msg); fail; } @@ -178,7 +169,7 @@ actual:\n\ fn make_typecheck_args(config: &config, testfile: &str) -> procargs { let prog = config.rustc_path; - let args = ~["-", "--no-trans", "--lib"]; + let args = ["-", "--no-trans", "--lib"]; ret {prog: prog, args: args}; } } @@ -190,28 +181,28 @@ fn check_error_patterns(props: &test_props, testfile: &str, } let next_err_idx = 0u; - let next_err_pat = props.error_patterns.(next_err_idx); + let next_err_pat = props.error_patterns[next_err_idx]; for line: str in str::split(procres.stdout, '\n' as u8) { if str::find(line, next_err_pat) > 0 { - log #fmt("found error pattern %s", next_err_pat); + log #fmt["found error pattern %s", next_err_pat]; next_err_idx += 1u; if next_err_idx == vec::len(props.error_patterns) { log "found all error patterns"; ret; } - next_err_pat = props.error_patterns.(next_err_idx); + next_err_pat = props.error_patterns[next_err_idx]; } } let missing_patterns = vec::slice(props.error_patterns, next_err_idx, - vec::len(props.error_patterns)); + vec::len(props.error_patterns)); if vec::len(missing_patterns) == 1u { - fatal_procres(#fmt("error pattern '%s' not found!", - missing_patterns.(0)), procres); + fatal_procres(#fmt["error pattern '%s' not found!", + missing_patterns[0]], procres); } else { for pattern: str in missing_patterns { - error(#fmt("error pattern '%s' not found!", pattern)); + error(#fmt["error pattern '%s' not found!", pattern]); } fatal_procres("multiple error patterns not found", procres); } @@ -226,27 +217,24 @@ fn compile_test(cx: &cx, props: &test_props, testfile: &str) -> procres { cx.config.compile_lib_path, option::none) } -fn exec_compiled_test(cx: &cx, props: &test_props, - testfile: &str) -> procres { +fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &str) -> + procres { compose_and_run(cx, testfile, bind make_run_args(_, props, _), cx.config.run_lib_path, option::none) } fn compose_and_run(cx: &cx, testfile: &str, - make_args: fn(&config, &str) -> procargs , - lib_path: &str, + make_args: fn(&config, &str) -> procargs, lib_path: &str, input: option::t<str>) -> procres { let procargs = make_args(cx.config, testfile); - ret program_output(cx, testfile, lib_path, - procargs.prog, procargs.args, + ret program_output(cx, testfile, lib_path, procargs.prog, procargs.args, input); } -fn make_compile_args(config: &config, - props: &test_props, testfile: &str) -> - procargs { +fn make_compile_args(config: &config, props: &test_props, testfile: &str) -> + procargs { let prog = config.rustc_path; - let args = ~[testfile, "-o", make_exe_name(config, testfile)]; + let args = [testfile, "-o", make_exe_name(config, testfile)]; args += split_maybe_args(config.rustcflags); args += split_maybe_args(props.compile_flags); ret {prog: prog, args: args}; @@ -256,35 +244,29 @@ fn make_exe_name(config: &config, testfile: &str) -> str { output_base_name(config, testfile) + os::exec_suffix() } -fn make_run_args(config: &config, - props: &test_props, testfile: &str) -> procargs { - let toolargs = if !props.no_valgrind { - // If we've got another tool to run under (valgrind), - // then split apart its command - split_maybe_args(config.runtool) - } else { - ~[] - }; +fn make_run_args(config: &config, props: &test_props, testfile: &str) -> + procargs { + let toolargs = + if !props.no_valgrind { - let args = toolargs + ~[make_exe_name(config, testfile)]; - ret {prog: args.(0), args: vec::slice(args, 1u, vec::len(args))}; + // If we've got another tool to run under (valgrind), + // then split apart its command + split_maybe_args(config.runtool) + } else { [] }; + + let args = toolargs + [make_exe_name(config, testfile)]; + ret {prog: args[0], args: vec::slice(args, 1u, vec::len(args))}; } fn split_maybe_args(argstr: &option::t<str>) -> [str] { fn rm_whitespace(v: &[str]) -> [str] { fn flt(s: &str) -> option::t<str> { - if !is_whitespace(s) { - option::some(s) - } else { - option::none - } + if !is_whitespace(s) { option::some(s) } else { option::none } } // FIXME: This should be in std fn is_whitespace(s: str) -> bool { - for c: u8 in s { - if c != (' ' as u8) { ret false; } - } + for c: u8 in s { if c != ' ' as u8 { ret false; } } ret true; } vec::filter_map(flt, v) @@ -292,38 +274,38 @@ fn split_maybe_args(argstr: &option::t<str>) -> [str] { alt argstr { option::some(s) { rm_whitespace(str::split(s, ' ' as u8)) } - option::none. { ~[] } + option::none. { [] } } } fn program_output(cx: &cx, testfile: &str, lib_path: &str, prog: &str, args: &[str], input: option::t<str>) -> procres { let cmdline = - { - let cmdline = make_cmdline(lib_path, prog, args); - logv(cx.config, #fmt("executing %s", cmdline)); - cmdline - }; - let res = procsrv::run(cx.procsrv, lib_path, - prog, args, input); + { + let cmdline = make_cmdline(lib_path, prog, args); + logv(cx.config, #fmt["executing %s", cmdline]); + cmdline + }; + let res = procsrv::run(cx.procsrv, lib_path, prog, args, input); dump_output(cx.config, testfile, res.out, res.err); - ret {status: res.status, stdout: res.out, - stderr: res.err, cmdline: cmdline}; + ret {status: res.status, + stdout: res.out, + stderr: res.err, + cmdline: cmdline}; } fn make_cmdline(libpath: &str, prog: &str, args: &[str]) -> str { - #fmt("%s %s %s", lib_path_cmd_prefix(libpath), prog, - str::connect(args, " ")) + #fmt["%s %s %s", lib_path_cmd_prefix(libpath), prog, + str::connect(args, " ")] } // Build the LD_LIBRARY_PATH variable as it would be seen on the command line // for diagnostic purposes fn lib_path_cmd_prefix(path: &str) -> str { - #fmt("%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)) + #fmt["%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)] } -fn dump_output(config: &config, testfile: &str, - out: &str, err: &str) { +fn dump_output(config: &config, testfile: &str, out: &str, err: &str) { dump_output_file(config, testfile, out, "out"); dump_output_file(config, testfile, err, "err"); maybe_dump_to_stdout(config, out, err); @@ -331,22 +313,20 @@ fn dump_output(config: &config, testfile: &str, #[cfg(target_os = "win32")] #[cfg(target_os = "linux")] -fn dump_output_file(config: &config, testfile: &str, - out: &str, extension: &str) { +fn dump_output_file(config: &config, testfile: &str, out: &str, + extension: &str) { let outfile = make_out_name(config, testfile, extension); - let writer = io::file_writer(outfile, - ~[io::create, io::truncate]); + let writer = io::file_writer(outfile, [io::create, io::truncate]); writer.write_str(out); } // FIXME (726): Can't use file_writer on mac #[cfg(target_os = "macos")] -fn dump_output_file(config: &config, testfile: &str, - out: &str, extension: &str) { +fn dump_output_file(config: &config, testfile: &str, out: &str, + extension: &str) { } -fn make_out_name(config: &config, testfile: &str, - extension: &str) -> str { +fn make_out_name(config: &config, testfile: &str, extension: &str) -> str { output_base_name(config, testfile) + "." + extension } @@ -358,16 +338,13 @@ fn output_base_name(config: &config, testfile: &str) -> str { parts = vec::slice(parts, 0u, vec::len(parts) - 1u); str::connect(parts, ".") }; - #fmt("%s%s.%s", base, filename, config.stage_id) + #fmt["%s%s.%s", base, filename, config.stage_id] } -fn maybe_dump_to_stdout(config: &config, - out: &str, err: &str) { +fn maybe_dump_to_stdout(config: &config, out: &str, err: &str) { if config.verbose { - let sep1 = #fmt("------%s------------------------------", - "stdout"); - let sep2 = #fmt("------%s------------------------------", - "stderr"); + let sep1 = #fmt["------%s------------------------------", "stdout"]; + let sep2 = #fmt["------%s------------------------------", "stderr"]; let sep3 = "------------------------------------------"; io::stdout().write_line(sep1); io::stdout().write_line(out); @@ -377,13 +354,13 @@ fn maybe_dump_to_stdout(config: &config, } } -fn error(err: &str) { io::stdout().write_line(#fmt("\nerror: %s", err)); } +fn error(err: &str) { io::stdout().write_line(#fmt["\nerror: %s", err]); } fn fatal(err: &str) -> ! { error(err); fail; } fn fatal_procres(err: &str, procres: procres) -> ! { let msg = - #fmt("\n\ + #fmt["\n\ error: %s\n\ command: %s\n\ stdout:\n\ @@ -395,7 +372,7 @@ stderr:\n\ %s\n\ ------------------------------------------\n\ \n", - err, procres.cmdline, procres.stdout, procres.stderr); + err, procres.cmdline, procres.stdout, procres.stderr]; io::stdout().write_str(msg); fail; } diff --git a/src/test/compiletest/util.rs b/src/test/compiletest/util.rs index 5f971777c75..3dcd8699927 100644 --- a/src/test/compiletest/util.rs +++ b/src/test/compiletest/util.rs @@ -9,7 +9,7 @@ fn make_new_path(path: &str) -> str { // Windows just uses PATH as the library search path, so we have to // maintain the current value while adding our own alt getenv(lib_path_env_var()) { - option::some(curr) { #fmt("%s:%s", path, curr) } + option::some(curr) { #fmt["%s:%s", path, curr] } option::none. { path } } } diff --git a/src/test/pretty/block-disambig.rs b/src/test/pretty/block-disambig.rs index f035b9393c2..252eb0270da 100644 --- a/src/test/pretty/block-disambig.rs +++ b/src/test/pretty/block-disambig.rs @@ -1,40 +1,20 @@ // Tests that the pretty printer correctly disambiguates various scenarios // involving block statements by ending them with a semi-colon -fn test1() { - let val = @0; - {}; - *val; -} +fn test1() { let val = @0; { }; *val; } -fn test2() -> int { - let val = @0; - {}; - *val -} +fn test2() -> int { let val = @0; { }; *val } fn test3() { let regs = @{mutable eax: 0}; - alt true { - true { } - }; + alt true { true { } }; (*regs).eax = 1; } -fn test4() -> bool { - let regs = @true; - if true { }; - *regs || false -} +fn test4() -> bool { let regs = @true; if true { }; *regs || false } -fn test5() -> (int, int) { - {}; - (0, 1) -} +fn test5() -> (int, int) { { }; (0, 1) } -fn test6() -> bool { - {}; - (true || false) && true -} +fn test6() -> bool { { }; (true || false) && true } fn test7() -> uint { let regs = @0; @@ -42,24 +22,12 @@ fn test7() -> uint { (*regs < 2) as uint } -fn test8() -> int { - let val = @0; - alt true { true { } }; - *val < 1 ? 0 : 1 -} +fn test8() -> int { let val = @0; alt true { true { } }; *val < 1 ? 0 : 1 } -fn test9() { - let regs = @mutable 0; - alt true { - true { } - }; - *regs += 1; -} +fn test9() { let regs = @mutable 0; alt true { true { } }; *regs += 1; } fn test10() -> int { let regs = @mutable [0]; - alt true { - true { } - }; - (*regs).(0) + alt true { true { } }; + (*regs)[0] } diff --git a/src/test/pretty/empty-lines.rs b/src/test/pretty/empty-lines.rs index 87de5ff64c2..e598e96db24 100644 --- a/src/test/pretty/empty-lines.rs +++ b/src/test/pretty/empty-lines.rs @@ -4,4 +4,4 @@ fn a() -> uint { 1u -} \ No newline at end of file +} diff --git a/src/test/pretty/example2.rs b/src/test/pretty/example2.rs index ea9ff94112a..852b9f316ce 100644 --- a/src/test/pretty/example2.rs +++ b/src/test/pretty/example2.rs @@ -1,7 +1,3 @@ // pp-exact:example2.pp -fn -main -() -{ -} +fn main() { } diff --git a/src/test/pretty/unary-op-disambig.rs b/src/test/pretty/unary-op-disambig.rs index 79cc24a2f20..0f67570e722 100644 --- a/src/test/pretty/unary-op-disambig.rs +++ b/src/test/pretty/unary-op-disambig.rs @@ -2,34 +2,16 @@ fn f() { } -fn block_semi() -> int { - { f() }; - -1 -} - -fn block_nosemi() -> int { - { 0 } - 1 -} - -fn if_semi() -> int { - if true { f() } else { f() }; - -1 -} - -fn if_nosemi() -> int { - if true { 0 } else { 0 } - 1 -} - -fn alt_semi() -> int { - alt true { true { f() } }; - -1 -} - -fn alt_no_semi() -> int { - alt true { true { 0 } } - 1 -} - -fn stmt() { - { f() }; - -1; -} \ No newline at end of file +fn block_semi() -> int { { f() }; -1 } + +fn block_nosemi() -> int { { 0 } - 1 } + +fn if_semi() -> int { if true { f() } else { f() }; -1 } + +fn if_nosemi() -> int { if true { 0 } else { 0 } - 1 } + +fn alt_semi() -> int { alt true { true { f() } }; -1 } + +fn alt_no_semi() -> int { alt true { true { 0 } } - 1 } + +fn stmt() { { f() }; -1; } diff --git a/src/test/pretty/vec-comments.rs b/src/test/pretty/vec-comments.rs index 48de34972b7..2cd5fffdf75 100644 --- a/src/test/pretty/vec-comments.rs +++ b/src/test/pretty/vec-comments.rs @@ -2,30 +2,28 @@ // Testing that comments are correctly interleaved // pp-exact:vec-comments.pp fn main() { - let v1 = ~[ - // Comment - 0, - // Comment - 1, - // Comment - 2 - ]; - let v2 = ~[ - 0, // Comment - 1, // Comment - 2 // Comment - ]; - let v3 = ~[ - /* Comment */ - 0, - /* Comment */ - 1, - /* Comment */ - 2 - ]; - let v4 = ~[ - 0, /* Comment */ - 1, /* Comment */ - 2 /* Comment */ - ]; + let v1 = + [ + // Comment + 0, + // Comment + 1, + // Comment + 2]; + let v2 = + [0, // Comment + 1, // Comment + 2]; // Comment + let v3 = + [ + /* Comment */ + 0, + /* Comment */ + 1, + /* Comment */ + 2]; + let v4 = + [0, /* Comment */ + 1, /* Comment */ + 2]; /* Comment */ } diff --git a/src/test/pretty/vec-type.rs b/src/test/pretty/vec-type.rs index 010ad755f51..60265eebcf7 100644 --- a/src/test/pretty/vec-type.rs +++ b/src/test/pretty/vec-type.rs @@ -2,4 +2,4 @@ fn f1(x: [int]) { } -fn g1() { f1(~[1, 2, 3]); } +fn g1() { f1([1, 2, 3]); } diff --git a/src/test/run-fail/alt-bot-fail.rs b/src/test/run-fail/alt-bot-fail.rs index 7a414b3ca6a..355892d5a13 100644 --- a/src/test/run-fail/alt-bot-fail.rs +++ b/src/test/run-fail/alt-bot-fail.rs @@ -7,9 +7,7 @@ import std::option::*; fn foo(s: str) { } fn main() { - let i = alt some::<int>(3) { - none::<int>. { fail } - some::<int>(_) { fail } - }; + let i = + alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { fail } }; foo(i); } diff --git a/src/test/run-fail/alt-disc-bot.rs b/src/test/run-fail/alt-disc-bot.rs index 8b4d30ef6ac..2ac519e6419 100644 --- a/src/test/run-fail/alt-disc-bot.rs +++ b/src/test/run-fail/alt-disc-bot.rs @@ -1,4 +1,4 @@ // error-pattern:quux fn f() -> ! { fail "quux" } -fn g() -> int { alt f() { true { 1 } false { 0 } }; } +fn g() -> int { alt f() { true { 1 } false { 0 } } } fn main() { g(); } diff --git a/src/test/run-fail/args-fail.rs b/src/test/run-fail/args-fail.rs index 9dc6ecc7413..afdaa553ba6 100644 --- a/src/test/run-fail/args-fail.rs +++ b/src/test/run-fail/args-fail.rs @@ -1,4 +1,4 @@ // error-pattern:meep fn f(a: int, b: int, c: @int) { fail "moop"; } -fn main() { f(1, fail "meep", @42); } \ No newline at end of file +fn main() { f(1, fail "meep", @42); } diff --git a/src/test/run-fail/bug-811.rs b/src/test/run-fail/bug-811.rs index 176b95343eb..aa4d829a100 100644 --- a/src/test/run-fail/bug-811.rs +++ b/src/test/run-fail/bug-811.rs @@ -1,16 +1,11 @@ // error-pattern:quux -fn test00_start(ch: chan_t<int>, message: int) { - send(ch, message); -} +fn test00_start(ch: chan_t<int>, message: int) { send(ch, message); } type task_id = int; type port_id = int; -type chan_t<~T> = { - task : task_id, - port : port_id -}; +type chan_t<~T> = {task: task_id, port: port_id}; -fn send<~T>(ch : chan_t<T>, data : -T) { fail; } +fn send<~T>(ch: chan_t<T>, data: -T) { fail; } fn main() { fail "quux"; } diff --git a/src/test/run-fail/do-while-body-fails.rs b/src/test/run-fail/do-while-body-fails.rs index 1a6cac5fabc..3ab257de397 100644 --- a/src/test/run-fail/do-while-body-fails.rs +++ b/src/test/run-fail/do-while-body-fails.rs @@ -1,4 +1,2 @@ // error-pattern:quux -fn main() { - let x: int = do { fail "quux" } while (true); -} +fn main() { let x: int = do { fail "quux" } while true; } diff --git a/src/test/run-fail/explicit-fail-msg.rs b/src/test/run-fail/explicit-fail-msg.rs index f238d226b34..b45e443759c 100644 --- a/src/test/run-fail/explicit-fail-msg.rs +++ b/src/test/run-fail/explicit-fail-msg.rs @@ -1,3 +1,3 @@ // error-pattern:wooooo // no-valgrind -fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; } \ No newline at end of file +fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; } diff --git a/src/test/run-fail/explicit-fail.rs b/src/test/run-fail/explicit-fail.rs index a74cf4b36e3..396f12d5caf 100644 --- a/src/test/run-fail/explicit-fail.rs +++ b/src/test/run-fail/explicit-fail.rs @@ -2,4 +2,4 @@ // error-pattern:explicit -fn main() { fail; } \ No newline at end of file +fn main() { fail; } diff --git a/src/test/run-fail/expr-alt-fail-fn.rs b/src/test/run-fail/expr-alt-fail-fn.rs index e9754643ccd..bf6898ed297 100644 --- a/src/test/run-fail/expr-alt-fail-fn.rs +++ b/src/test/run-fail/expr-alt-fail-fn.rs @@ -6,4 +6,4 @@ fn f() -> ! { fail } fn g() -> int { let x = alt true { true { f() } false { 10 } }; ret x; } -fn main() { g(); } \ No newline at end of file +fn main() { g(); } diff --git a/src/test/run-fail/expr-alt-fail.rs b/src/test/run-fail/expr-alt-fail.rs index 50154890bc3..230497135cd 100644 --- a/src/test/run-fail/expr-alt-fail.rs +++ b/src/test/run-fail/expr-alt-fail.rs @@ -2,4 +2,4 @@ // error-pattern:explicit failure -fn main() { let x = alt true { false { 0 } true { fail } }; } \ No newline at end of file +fn main() { let x = alt true { false { 0 } true { fail } }; } diff --git a/src/test/run-fail/expr-fn-fail.rs b/src/test/run-fail/expr-fn-fail.rs index fc716fc1c60..24d0fa4c4aa 100644 --- a/src/test/run-fail/expr-fn-fail.rs +++ b/src/test/run-fail/expr-fn-fail.rs @@ -4,4 +4,4 @@ // error-pattern:explicit failure fn f() -> ! { fail } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/run-fail/expr-if-fail-fn.rs b/src/test/run-fail/expr-if-fail-fn.rs index 6b7b6d64b45..406302532fa 100644 --- a/src/test/run-fail/expr-if-fail-fn.rs +++ b/src/test/run-fail/expr-if-fail-fn.rs @@ -6,4 +6,4 @@ fn f() -> ! { fail } fn g() -> int { let x = if true { f() } else { 10 }; ret x; } -fn main() { g(); } \ No newline at end of file +fn main() { g(); } diff --git a/src/test/run-fail/expr-if-fail.rs b/src/test/run-fail/expr-if-fail.rs index a738bfc7f1e..24cd815c244 100644 --- a/src/test/run-fail/expr-if-fail.rs +++ b/src/test/run-fail/expr-if-fail.rs @@ -2,4 +2,4 @@ // error-pattern:explicit failure -fn main() { let x = if false { 0 } else if (true) { fail } else { 10 }; } \ No newline at end of file +fn main() { let x = if false { 0 } else if true { fail } else { 10 }; } diff --git a/src/test/run-fail/fail-arg.rs b/src/test/run-fail/fail-arg.rs index ef43fea8694..e657bf7d9a6 100644 --- a/src/test/run-fail/fail-arg.rs +++ b/src/test/run-fail/fail-arg.rs @@ -1,4 +1,4 @@ // error-pattern:woe fn f(a: int) { log a; } -fn main() { f(fail "woe"); } \ No newline at end of file +fn main() { f(fail "woe"); } diff --git a/src/test/run-fail/fail-main.rs b/src/test/run-fail/fail-main.rs index 0ac56613439..a8e51009352 100644 --- a/src/test/run-fail/fail-main.rs +++ b/src/test/run-fail/fail-main.rs @@ -1,4 +1,4 @@ // error-pattern:moop use std; import std::uint; -fn main() { fail "moop"; } \ No newline at end of file +fn main() { fail "moop"; } diff --git a/src/test/run-fail/fail.rs b/src/test/run-fail/fail.rs index a0520c288a4..75e6f7e886e 100644 --- a/src/test/run-fail/fail.rs +++ b/src/test/run-fail/fail.rs @@ -2,4 +2,4 @@ // error-pattern:1 == 2 -fn main() { assert (1 == 2); } \ No newline at end of file +fn main() { assert (1 == 2); } diff --git a/src/test/run-fail/fmt-fail.rs b/src/test/run-fail/fmt-fail.rs index d4eb12292a6..2d3e35b41af 100644 --- a/src/test/run-fail/fmt-fail.rs +++ b/src/test/run-fail/fmt-fail.rs @@ -3,4 +3,4 @@ use std; import std::str; -fn main() { let str_var: str = "meh"; fail #fmt("%s", str_var); } \ No newline at end of file +fn main() { let str_var: str = "meh"; fail #fmt["%s", str_var]; } diff --git a/src/test/run-fail/fn-constraint-claim.rs b/src/test/run-fail/fn-constraint-claim.rs index ca243210647..a5309b61627 100644 --- a/src/test/run-fail/fn-constraint-claim.rs +++ b/src/test/run-fail/fn-constraint-claim.rs @@ -5,9 +5,4 @@ import std::uint::*; fn nop(a: uint, b: uint) : le(a, b) { fail "quux"; } -fn main() { - let a: uint = 5u; - let b: uint = 4u; - claim (le(a, b)); - nop(a, b); -} +fn main() { let a: uint = 5u; let b: uint = 4u; claim (le(a, b)); nop(a, b); } diff --git a/src/test/run-fail/fn-constraint.rs b/src/test/run-fail/fn-constraint.rs index 65bcc413498..3499d44ceff 100644 --- a/src/test/run-fail/fn-constraint.rs +++ b/src/test/run-fail/fn-constraint.rs @@ -8,4 +8,4 @@ fn main() { let b: uint = 1u; check (le(a, b)); log_err safe_slice("kitties", a, b); -} \ No newline at end of file +} diff --git a/src/test/run-fail/if-check-fail.rs b/src/test/run-fail/if-check-fail.rs index 677240d0763..885c92deab8 100644 --- a/src/test/run-fail/if-check-fail.rs +++ b/src/test/run-fail/if-check-fail.rs @@ -2,9 +2,9 @@ pred even(x: uint) -> bool { if x < 2u { ret false; - } else if (x == 2u) { ret true; } else { ret even(x - 2u); } + } else if x == 2u { ret true; } else { ret even(x - 2u); } } fn foo(x: uint) { if check even(x) { log x; } else { fail "Number is odd"; } } -fn main() { foo(3u); } \ No newline at end of file +fn main() { foo(3u); } diff --git a/src/test/run-fail/non-exhaustive-match.rs b/src/test/run-fail/non-exhaustive-match.rs index e62d0692d4f..4afd83c1b97 100644 --- a/src/test/run-fail/non-exhaustive-match.rs +++ b/src/test/run-fail/non-exhaustive-match.rs @@ -6,4 +6,4 @@ // error-pattern:non-exhaustive match failure tag t { a; b; } -fn main() { let x = a; alt x { b. { } } } \ No newline at end of file +fn main() { let x = a; alt x { b. { } } } diff --git a/src/test/run-fail/pred.rs b/src/test/run-fail/pred.rs index 14e46976113..a2f9420825c 100644 --- a/src/test/run-fail/pred.rs +++ b/src/test/run-fail/pred.rs @@ -4,4 +4,4 @@ fn f(a: int, b: int) { } pred lt(a: int, b: int) -> bool { ret a < b; } -fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); } \ No newline at end of file +fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); } diff --git a/src/test/run-fail/rhs-type.rs b/src/test/run-fail/rhs-type.rs index 0277d83d393..461b2c65b44 100644 --- a/src/test/run-fail/rhs-type.rs +++ b/src/test/run-fail/rhs-type.rs @@ -1,4 +1,4 @@ // Tests that trans treats the rhs of pth's decl // as a _|_-typed thing, not a str-typed thing // error-pattern:bye -fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; } \ No newline at end of file +fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; } diff --git a/src/test/run-fail/str-overrun.rs b/src/test/run-fail/str-overrun.rs index 1ac862f2405..3d12bce20c9 100644 --- a/src/test/run-fail/str-overrun.rs +++ b/src/test/run-fail/str-overrun.rs @@ -7,12 +7,12 @@ fn main() { let s: str = "hello"; let x: int = 0; - assert (s.(x) == 0x68 as u8); + assert (s[x] == 0x68 as u8); // NB: at the moment a string always has a trailing NULL, // so the largest index value on the string above is 5, not // 4. Possibly change this. // Bounds-check failure. - assert (s.(x + 6) == 0x0 as u8); -} \ No newline at end of file + assert (s[x + 6] == 0x0 as u8); +} diff --git a/src/test/run-fail/vec-overrun.rs b/src/test/run-fail/vec-overrun.rs index 28349f27a50..54329ca63b5 100644 --- a/src/test/run-fail/vec-overrun.rs +++ b/src/test/run-fail/vec-overrun.rs @@ -3,10 +3,10 @@ // error-pattern:bounds check // no-valgrind fn main() { - let v: [int] = ~[10]; + let v: [int] = [10]; let x: int = 0; - assert (v.(x) == 10); + assert (v[x] == 10); // Bounds-check failure. - assert (v.(x + 2) == 20); + assert (v[x + 2] == 20); } diff --git a/src/test/run-fail/vec-underrun.rs b/src/test/run-fail/vec-underrun.rs index 41eb94ca739..87c8295840e 100644 --- a/src/test/run-fail/vec-underrun.rs +++ b/src/test/run-fail/vec-underrun.rs @@ -3,10 +3,10 @@ // error-pattern:bounds check // no-valgrind fn main() { - let v: [int] = ~[10, 20]; + let v: [int] = [10, 20]; let x: int = 0; - assert (v.(x) == 10); + assert (v[x] == 10); // Bounds-check failure. - assert (v.(x - 1) == 20); + assert (v[x - 1] == 20); } diff --git a/src/test/run-pass/alloca-from-derived-tydesc.rs b/src/test/run-pass/alloca-from-derived-tydesc.rs index 00371d3567d..6077bbf6723 100644 --- a/src/test/run-pass/alloca-from-derived-tydesc.rs +++ b/src/test/run-pass/alloca-from-derived-tydesc.rs @@ -2,6 +2,6 @@ tag option<T> { some(T); none; } type r<T> = {mutable v: [option<T>]}; -fn f<T>() -> [T] { ret ~[]; } +fn f<T>() -> [T] { ret []; } -fn main() { let r: r<int> = {mutable v: ~[]}; r.v = f(); } +fn main() { let r: r<int> = {mutable v: []}; r.v = f(); } diff --git a/src/test/run-pass/alt-bot.rs b/src/test/run-pass/alt-bot.rs index a5369804d00..6949d727f59 100644 --- a/src/test/run-pass/alt-bot.rs +++ b/src/test/run-pass/alt-bot.rs @@ -2,9 +2,7 @@ use std; import std::option::*; fn main() { - let i: int = alt some::<int>(3) { - none::<int>. { fail } - some::<int>(_) { 5 } - }; + let i: int = + alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { 5 } }; log i; } diff --git a/src/test/run-pass/alt-join.rs b/src/test/run-pass/alt-join.rs index 423d08fc66a..4d1be53cdf3 100644 --- a/src/test/run-pass/alt-join.rs +++ b/src/test/run-pass/alt-join.rs @@ -7,12 +7,12 @@ import std::option::some; fn foo<T>(y: &option::t<T>) { let x: int; - let rs: [int] = ~[]; + let rs: [int] = []; /* tests that x doesn't get put in the precondition for the entire if expression */ if true { - } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += ~[x]; } + } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += [x]; } ret; } diff --git a/src/test/run-pass/alt-path.rs b/src/test/run-pass/alt-path.rs index 9f37cd2585c..84d79220f90 100644 --- a/src/test/run-pass/alt-path.rs +++ b/src/test/run-pass/alt-path.rs @@ -6,4 +6,4 @@ mod m1 { fn bar(x: m1::foo) { alt x { m1::foo1. { } } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/alt-pattern-drop.rs b/src/test/run-pass/alt-pattern-drop.rs index af0c615f53f..d3fb0715b4d 100644 --- a/src/test/run-pass/alt-pattern-drop.rs +++ b/src/test/run-pass/alt-pattern-drop.rs @@ -32,4 +32,4 @@ fn main() { log str::refcount(s); assert (str::refcount(s) == const_refcount); -} \ No newline at end of file +} diff --git a/src/test/run-pass/alt-pattern-lit.rs b/src/test/run-pass/alt-pattern-lit.rs index 3dc7bae1ea9..1f544495d88 100644 --- a/src/test/run-pass/alt-pattern-lit.rs +++ b/src/test/run-pass/alt-pattern-lit.rs @@ -4,4 +4,4 @@ fn altlit(f: int) -> int { alt f { 10 { log "case 10"; ret 20; } 11 { log "case 11"; ret 22; } } } -fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); } \ No newline at end of file +fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); } diff --git a/src/test/run-pass/alt-pattern-simple.rs b/src/test/run-pass/alt-pattern-simple.rs index 1d02eb64a82..e29cd72ac77 100644 --- a/src/test/run-pass/alt-pattern-simple.rs +++ b/src/test/run-pass/alt-pattern-simple.rs @@ -2,4 +2,4 @@ fn altsimple(f: int) { alt f { x { } } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/alt-str.rs b/src/test/run-pass/alt-str.rs index 8fd15eb76af..fbdf7fdbfe3 100644 --- a/src/test/run-pass/alt-str.rs +++ b/src/test/run-pass/alt-str.rs @@ -12,4 +12,4 @@ fn main() { tag1("test") { } _ { fail; } } -} \ No newline at end of file +} diff --git a/src/test/run-pass/alt-tag.rs b/src/test/run-pass/alt-tag.rs index 3bdc4b3a528..6a3606d6dc3 100644 --- a/src/test/run-pass/alt-tag.rs +++ b/src/test/run-pass/alt-tag.rs @@ -25,4 +25,4 @@ fn main() { assert (process(gray) == 127); assert (process(clear) == 0); assert (process(red) == 255); -} \ No newline at end of file +} diff --git a/src/test/run-pass/anon-obj-backwarding-2.rs b/src/test/run-pass/anon-obj-backwarding-2.rs index 3a806a6e399..039d25be381 100644 --- a/src/test/run-pass/anon-obj-backwarding-2.rs +++ b/src/test/run-pass/anon-obj-backwarding-2.rs @@ -9,15 +9,17 @@ fn main() { let my_a = a(); - let my_b = obj () { - fn baz() -> int { ret self.foo(); } - with my_a - }; + let my_b = + obj () { + fn baz() -> int { ret self.foo(); } + with + my_a + }; - assert my_a.foo() == 2; - assert my_a.bar() == 2; - assert my_b.foo() == 2; - assert my_b.baz() == 2; - assert my_b.bar() == 2; + assert (my_a.foo() == 2); + assert (my_a.bar() == 2); + assert (my_b.foo() == 2); + assert (my_b.baz() == 2); + assert (my_b.bar() == 2); } diff --git a/src/test/run-pass/anon-obj-cats.rs b/src/test/run-pass/anon-obj-cats.rs index ca093f0cb9b..c1024afc6ec 100644 --- a/src/test/run-pass/anon-obj-cats.rs +++ b/src/test/run-pass/anon-obj-cats.rs @@ -3,42 +3,34 @@ fn main() { // The Internet made me do it. obj cat() { - fn ack() -> str { - ret "ack"; - } - fn meow() -> str { - ret "meow"; - } - fn zzz() -> str { - ret self.meow(); - } + fn ack() -> str { ret "ack"; } + fn meow() -> str { ret "meow"; } + fn zzz() -> str { ret self.meow(); } } let shortcat = cat(); - let longcat = obj() { - fn lol() -> str { - ret "lol"; - } - fn nyan() -> str { - ret "nyan"; - } - with shortcat - }; - - let longercat = obj() { - fn meow() -> str { - ret "zzz"; - } - with shortcat - }; - - let evenlongercat = obj() { - fn meow() -> str { - ret "zzzzzz"; - } - with longercat - }; + let longcat = + obj () { + fn lol() -> str { ret "lol"; } + fn nyan() -> str { ret "nyan"; } + with + shortcat + }; + + let longercat = + obj () { + fn meow() -> str { ret "zzz"; } + with + shortcat + }; + + let evenlongercat = + obj () { + fn meow() -> str { ret "zzzzzz"; } + with + longercat + }; // Tests self-call. assert (shortcat.zzz() == "meow"); diff --git a/src/test/run-pass/anon-obj-degenerate.rs b/src/test/run-pass/anon-obj-degenerate.rs index d4870fc3d78..c9c47e29008 100644 --- a/src/test/run-pass/anon-obj-degenerate.rs +++ b/src/test/run-pass/anon-obj-degenerate.rs @@ -17,4 +17,4 @@ fn main() { assert (my_d.foo() == 2); assert (my_d.bar() == 2); -} \ No newline at end of file +} diff --git a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs index 423196dac82..3e782ce56de 100644 --- a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs +++ b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs @@ -3,36 +3,41 @@ use std; fn main() { // Anonymous object that doesn't extend an existing one. - let my_obj = obj() { - fn foo() -> int { ret 2; } - fn bar() -> int { ret 3; } - fn baz() -> str { "hello!" } - }; + let my_obj = + obj () { + fn foo() -> int { ret 2; } + fn bar() -> int { ret 3; } + fn baz() -> str { "hello!" } + }; - assert my_obj.foo() == 2; - assert my_obj.bar() == 3; - assert my_obj.baz() == "hello!"; + assert (my_obj.foo() == 2); + assert (my_obj.bar() == 3); + assert (my_obj.baz() == "hello!"); // Make sure the result is extendable. - let my_ext_obj = obj() { - fn foo() -> int { ret 3; } - fn quux() -> str { ret self.baz(); } - with my_obj - }; + let my_ext_obj = + obj () { + fn foo() -> int { ret 3; } + fn quux() -> str { ret self.baz(); } + with + my_obj + }; - assert my_ext_obj.foo() == 3; - assert my_ext_obj.bar() == 3; - assert my_ext_obj.baz() == "hello!"; - assert my_ext_obj.quux() == "hello!"; + assert (my_ext_obj.foo() == 3); + assert (my_ext_obj.bar() == 3); + assert (my_ext_obj.baz() == "hello!"); + assert (my_ext_obj.quux() == "hello!"); // And again. - let my_ext_ext_obj = obj() { - fn baz() -> str { "world!" } - with my_ext_obj - }; + let my_ext_ext_obj = + obj () { + fn baz() -> str { "world!" } + with + my_ext_obj + }; - assert my_ext_ext_obj.foo() == 3; - assert my_ext_ext_obj.bar() == 3; - assert my_ext_ext_obj.baz() == "world!"; - assert my_ext_ext_obj.quux() == "world!"; + assert (my_ext_ext_obj.foo() == 3); + assert (my_ext_ext_obj.bar() == 3); + assert (my_ext_ext_obj.baz() == "world!"); + assert (my_ext_ext_obj.quux() == "world!"); } diff --git a/src/test/run-pass/anon-obj-overriding-reduced.rs b/src/test/run-pass/anon-obj-overriding-reduced.rs index df1b700de56..3eb7c72d864 100644 --- a/src/test/run-pass/anon-obj-overriding-reduced.rs +++ b/src/test/run-pass/anon-obj-overriding-reduced.rs @@ -15,4 +15,4 @@ fn main() { }; assert (my_b.foo() == 3); -} \ No newline at end of file +} diff --git a/src/test/run-pass/anon-obj-overriding.rs b/src/test/run-pass/anon-obj-overriding.rs index 19860158ce4..e9551900b26 100644 --- a/src/test/run-pass/anon-obj-overriding.rs +++ b/src/test/run-pass/anon-obj-overriding.rs @@ -36,4 +36,4 @@ fn main() { assert (my_c.baz(1, 2) == 6); assert (my_d.baz(1, 2) == 5); -} \ No newline at end of file +} diff --git a/src/test/run-pass/anon-obj-with-self-call-2.rs b/src/test/run-pass/anon-obj-with-self-call-2.rs index 69153ac567b..807f1275d8a 100644 --- a/src/test/run-pass/anon-obj-with-self-call-2.rs +++ b/src/test/run-pass/anon-obj-with-self-call-2.rs @@ -13,4 +13,4 @@ fn main() { }; assert (my_b.baz() == 2); -} \ No newline at end of file +} diff --git a/src/test/run-pass/anon-obj-with-self-call.rs b/src/test/run-pass/anon-obj-with-self-call.rs index 2944bc0b595..76faa9decc4 100644 --- a/src/test/run-pass/anon-obj-with-self-call.rs +++ b/src/test/run-pass/anon-obj-with-self-call.rs @@ -28,4 +28,4 @@ fn main() { assert (my_c.baz() == 3); assert (my_c.bar() == 3); -} \ No newline at end of file +} diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs index b0feeff2232..0bb536086ba 100644 --- a/src/test/run-pass/argv.rs +++ b/src/test/run-pass/argv.rs @@ -1,5 +1,5 @@ fn main(args: [str]) { - let vs: [str] = ~["hi", "there", "this", "is", "a", "vec"]; - let vvs: [[str]] = ~[args, vs]; + let vs: [str] = ["hi", "there", "this", "is", "a", "vec"]; + let vvs: [[str]] = [args, vs]; for vs: [str] in vvs { for s: str in vs { log s; } } } diff --git a/src/test/run-pass/arith-0.rs b/src/test/run-pass/arith-0.rs index 6ad797982e6..7c77d25e4c0 100644 --- a/src/test/run-pass/arith-0.rs +++ b/src/test/run-pass/arith-0.rs @@ -1,3 +1,3 @@ -fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); } \ No newline at end of file +fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); } diff --git a/src/test/run-pass/arith-1.rs b/src/test/run-pass/arith-1.rs index 0f907de0a6f..b9d61493ecf 100644 --- a/src/test/run-pass/arith-1.rs +++ b/src/test/run-pass/arith-1.rs @@ -20,4 +20,4 @@ fn main() { assert (i32_b & i32_b << 1 == 0); log i32_b | i32_b << 1; assert (i32_b | i32_b << 1 == 0x30303030); -} \ No newline at end of file +} diff --git a/src/test/run-pass/arith-2.rs b/src/test/run-pass/arith-2.rs index bb0f67499a2..b55c66f8462 100644 --- a/src/test/run-pass/arith-2.rs +++ b/src/test/run-pass/arith-2.rs @@ -4,4 +4,4 @@ fn main() { let i32_c: int = 0x10101010; assert (i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3) == i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3)); -} \ No newline at end of file +} diff --git a/src/test/run-pass/arith-unsigned.rs b/src/test/run-pass/arith-unsigned.rs index 75f7549b994..24433d49ebc 100644 --- a/src/test/run-pass/arith-unsigned.rs +++ b/src/test/run-pass/arith-unsigned.rs @@ -23,4 +23,4 @@ fn main() { assert (4000000005u32 % 10u32 == 5u32); // 64-bit numbers have some flakiness yet. Not tested -} \ No newline at end of file +} diff --git a/src/test/run-pass/artificial-block.rs b/src/test/run-pass/artificial-block.rs index 3944a0e9da5..87c7cc149f6 100644 --- a/src/test/run-pass/artificial-block.rs +++ b/src/test/run-pass/artificial-block.rs @@ -1,3 +1,3 @@ fn f() -> int { { ret 3; } } -fn main() { assert (f() == 3); } \ No newline at end of file +fn main() { assert (f() == 3); } diff --git a/src/test/run-pass/assign-assign.rs b/src/test/run-pass/assign-assign.rs index cdf5a6f18bd..fffb35e81fb 100644 --- a/src/test/run-pass/assign-assign.rs +++ b/src/test/run-pass/assign-assign.rs @@ -19,4 +19,4 @@ fn test_assign_op() { assert (x == 33); } -fn main() { test_assign(); test_assign_op(); } \ No newline at end of file +fn main() { test_assign(); test_assign_op(); } diff --git a/src/test/run-pass/auto-deref-fn.rs b/src/test/run-pass/auto-deref-fn.rs index 717d79ad18e..caff3f29fbc 100644 --- a/src/test/run-pass/auto-deref-fn.rs +++ b/src/test/run-pass/auto-deref-fn.rs @@ -7,4 +7,4 @@ fn main() { assert (g(8) == 9); assert (h(0x1badd00d) == 0x1badd00e); assert ((@add1)(42) == 43); -} \ No newline at end of file +} diff --git a/src/test/run-pass/auto-loop.rs b/src/test/run-pass/auto-loop.rs index b4ea2f5dedc..6e83d2ca0aa 100644 --- a/src/test/run-pass/auto-loop.rs +++ b/src/test/run-pass/auto-loop.rs @@ -1,5 +1,5 @@ fn main() { let sum = 0; - for x in ~[1, 2, 3, 4, 5] { sum += x; } + for x in [1, 2, 3, 4, 5] { sum += x; } assert (sum == 15); } diff --git a/src/test/run-pass/autobind.rs b/src/test/run-pass/autobind.rs index f8a0f8e3ee7..536db525d5c 100644 --- a/src/test/run-pass/autobind.rs +++ b/src/test/run-pass/autobind.rs @@ -1,9 +1,9 @@ -fn f<T>(x: &[T]) -> T { ret x.(0); } +fn f<T>(x: &[T]) -> T { ret x[0]; } -fn g(act: fn(&[int]) -> int ) -> int { ret act(~[1, 2, 3]); } +fn g(act: fn(&[int]) -> int) -> int { ret act([1, 2, 3]); } fn main() { assert (g(f) == 1); - let f1: fn(&[str]) -> str = f; - assert (f1(~["x", "y", "z"]) == "x"); + let f1: fn(&[str]) -> str = f; + assert (f1(["x", "y", "z"]) == "x"); } diff --git a/src/test/run-pass/autoderef-objfn.rs b/src/test/run-pass/autoderef-objfn.rs index cf7bb394b4c..430293989a0 100644 --- a/src/test/run-pass/autoderef-objfn.rs +++ b/src/test/run-pass/autoderef-objfn.rs @@ -8,4 +8,4 @@ obj clam() { fn foo(c: @clam) { c.chowder(); } -fn main() { let c: clam = clam(); foo(@c); } \ No newline at end of file +fn main() { let c: clam = clam(); foo(@c); } diff --git a/src/test/run-pass/bind-interior.rs b/src/test/run-pass/bind-interior.rs index ab3ce3b5e9f..639077a72c0 100644 --- a/src/test/run-pass/bind-interior.rs +++ b/src/test/run-pass/bind-interior.rs @@ -5,7 +5,7 @@ fn f(n: int) -> int { ret n; } fn main() { - let g: fn() -> int = bind f(10); + let g: fn() -> int = bind f(10); let i: int = g(); assert (i == 10); -} \ No newline at end of file +} diff --git a/src/test/run-pass/bind-obj-ctor.rs b/src/test/run-pass/bind-obj-ctor.rs index 6be4df99abc..a76b17cc10a 100644 --- a/src/test/run-pass/bind-obj-ctor.rs +++ b/src/test/run-pass/bind-obj-ctor.rs @@ -14,4 +14,4 @@ fn main() { assert (obj0.sum() == 3); assert (obj1.sum() == 3); assert (obj2.sum() == 3); -} \ No newline at end of file +} diff --git a/src/test/run-pass/bind-parameterized-args-2.rs b/src/test/run-pass/bind-parameterized-args-2.rs index 3646b8ba691..68d47073413 100644 --- a/src/test/run-pass/bind-parameterized-args-2.rs +++ b/src/test/run-pass/bind-parameterized-args-2.rs @@ -3,5 +3,5 @@ fn main() { let y = bind echo(42, _); - y(fn(i: &str){}); + y(fn (i: &str) { }); } diff --git a/src/test/run-pass/bind-parameterized-args.rs b/src/test/run-pass/bind-parameterized-args.rs index 53b8f85ea49..1f3e8efbf37 100644 --- a/src/test/run-pass/bind-parameterized-args.rs +++ b/src/test/run-pass/bind-parameterized-args.rs @@ -1,7 +1,7 @@ fn main() { fn echo<T>(c: int, x: &[T]) { } - let y: fn(&[int]) = bind echo(42, _); + let y: fn(&[int]) = bind echo(42, _); - y(~[1]); + y([1]); } diff --git a/src/test/run-pass/bind-thunk.rs b/src/test/run-pass/bind-thunk.rs index e70fa6fdd6c..a85c7fc9679 100644 --- a/src/test/run-pass/bind-thunk.rs +++ b/src/test/run-pass/bind-thunk.rs @@ -5,7 +5,7 @@ fn f() -> int { ret 42; } fn main() { - let g: fn() -> int = bind f(); + let g: fn() -> int = bind f(); let i: int = g(); assert (i == 42); -} \ No newline at end of file +} diff --git a/src/test/run-pass/bind-trivial.rs b/src/test/run-pass/bind-trivial.rs index 35ed5d7477f..20b217c1046 100644 --- a/src/test/run-pass/bind-trivial.rs +++ b/src/test/run-pass/bind-trivial.rs @@ -5,7 +5,7 @@ fn f(n: int) -> int { ret n; } fn main() { - let g: fn(int) -> int = bind f(_); + let g: fn(int) -> int = bind f(_); let i: int = g(42); assert (i == 42); -} \ No newline at end of file +} diff --git a/src/test/run-pass/binops.rs b/src/test/run-pass/binops.rs index dfb02f70e7e..f676e6a3b11 100644 --- a/src/test/run-pass/binops.rs +++ b/src/test/run-pass/binops.rs @@ -64,8 +64,8 @@ fn test_port() { let p1 = comm::mk_port::<int>(); let p2 = comm::mk_port::<int>(); - assert p1 == p1; - assert p1 != p2; + assert (p1 == p1); + assert (p1 != p2); } fn test_chan() { @@ -73,9 +73,9 @@ fn test_chan() { let ch1 = p.mk_chan(); let ch2 = p.mk_chan(); - assert ch1 == ch1; + assert (ch1 == ch1); // Chans are equal because they are just task:port addresses. - assert ch1 == ch2; + assert (ch1 == ch2); } fn test_ptr() { @@ -89,8 +89,8 @@ fn test_task() { let t1 = task::spawn(f1); let t2 = task::spawn(f2); - assert t1 == t1; - assert t1 != t2; + assert (t1 == t1); + assert (t1 != t2); } fn test_fn() { @@ -128,8 +128,8 @@ fn test_native_fn() { } fn test_obj() { - let o1 = obj () { }; - let o2 = obj () { }; + let o1 = obj () { }; + let o2 = obj () { }; assert (o1 == o1); diff --git a/src/test/run-pass/bitwise.rs b/src/test/run-pass/bitwise.rs index 0d41cb0c303..afe16cf113f 100644 --- a/src/test/run-pass/bitwise.rs +++ b/src/test/run-pass/bitwise.rs @@ -19,4 +19,4 @@ fn main() { assert (-16 >>> 2 == -4); assert (0b1010_1010 | 0b0101_0101 == 0xff); assert (-1000 >> 3 == 536870787); -} \ No newline at end of file +} diff --git a/src/test/run-pass/block-fn-coerce.rs b/src/test/run-pass/block-fn-coerce.rs index c9dd29f7d00..163d99ee5d6 100644 --- a/src/test/run-pass/block-fn-coerce.rs +++ b/src/test/run-pass/block-fn-coerce.rs @@ -1,7 +1,7 @@ -fn force(f: &block() -> int ) -> int { ret f(); } +fn force(f: &block() -> int) -> int { ret f(); } fn main() { let f = fn () -> int { ret 7 }; assert (force(f) == 7); let g = bind force(f); assert (g() == 7); -} \ No newline at end of file +} diff --git a/src/test/run-pass/block-iter-1.rs b/src/test/run-pass/block-iter-1.rs index 47c728af36d..006d4f18fe4 100644 --- a/src/test/run-pass/block-iter-1.rs +++ b/src/test/run-pass/block-iter-1.rs @@ -1,14 +1,10 @@ -fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } } +fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } } fn main() { - let v = ~[1, 2, 3, 4, 5, 6, 7]; + let v = [1, 2, 3, 4, 5, 6, 7]; let odds = 0; iter_vec(v, - {|&i| - log_err i; - if i % 2 == 1 { odds += 1; } - log_err odds; - }); + {|&i| log_err i; if i % 2 == 1 { odds += 1; } log_err odds; }); log_err odds; assert (odds == 4); } diff --git a/src/test/run-pass/block-iter-2.rs b/src/test/run-pass/block-iter-2.rs index a6d9455e3f1..d49cffbcc72 100644 --- a/src/test/run-pass/block-iter-2.rs +++ b/src/test/run-pass/block-iter-2.rs @@ -1,12 +1,9 @@ -fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } } +fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } } fn main() { - let v = ~[1, 2, 3, 4, 5]; + let v = [1, 2, 3, 4, 5]; let sum = 0; - iter_vec(v, - {|&i| - iter_vec(v, {|&j| log_err i * j; sum += i * j; }); - }); + iter_vec(v, {|&i| iter_vec(v, {|&j| log_err i * j; sum += i * j; }); }); log_err sum; assert (sum == 225); } diff --git a/src/test/run-pass/block-vec-map2.rs b/src/test/run-pass/block-vec-map2.rs index 5153a81d1c7..35b979b3694 100644 --- a/src/test/run-pass/block-vec-map2.rs +++ b/src/test/run-pass/block-vec-map2.rs @@ -2,9 +2,9 @@ use std; import std::vec; fn main() { - let v = std::vec::map2({|&i, &b| if b { -i } else { i }}, - ~[1, 2, 3, 4, 5], - ~[true, false, false, true, true]); + let v = + std::vec::map2({|&i, &b| if b { -i } else { i } }, [1, 2, 3, 4, 5], + [true, false, false, true, true]); log_err v; - assert v == ~[-1, 2, 3, -4, -5]; + assert (v == [-1, 2, 3, -4, -5]); } diff --git a/src/test/run-pass/bool-not.rs b/src/test/run-pass/bool-not.rs index 9d609d44efd..5e38e974c1a 100644 --- a/src/test/run-pass/bool-not.rs +++ b/src/test/run-pass/bool-not.rs @@ -5,4 +5,4 @@ fn main() { if !false { assert (true); } else { assert (false); } if !true { assert (false); } else { assert (true); } -} \ No newline at end of file +} diff --git a/src/test/run-pass/box-compare.rs b/src/test/run-pass/box-compare.rs index e3a93520d4a..51eeb6e8eb7 100644 --- a/src/test/run-pass/box-compare.rs +++ b/src/test/run-pass/box-compare.rs @@ -4,4 +4,4 @@ fn main() { assert (@1 < @3); assert (@@"hello " > @@"hello"); assert (@@@"hello" != @@@"there"); -} \ No newline at end of file +} diff --git a/src/test/run-pass/box-in-tup.rs b/src/test/run-pass/box-in-tup.rs index aa2d6a596e1..0f75897a337 100644 --- a/src/test/run-pass/box-in-tup.rs +++ b/src/test/run-pass/box-in-tup.rs @@ -1,4 +1 @@ -fn main() { - let i: (@int, int) = (@10, 10); - let (a, _) = i; -} \ No newline at end of file +fn main() { let i: (@int, int) = (@10, 10); let (a, _) = i; } diff --git a/src/test/run-pass/box-pattern.rs b/src/test/run-pass/box-pattern.rs index 6c20cdd805d..973d7e303b9 100644 --- a/src/test/run-pass/box-pattern.rs +++ b/src/test/run-pass/box-pattern.rs @@ -6,4 +6,4 @@ fn main() { u(@{a: a, b: b}) { a + (b as int) } _ { 66 } } == 50); -} \ No newline at end of file +} diff --git a/src/test/run-pass/box.rs b/src/test/run-pass/box.rs index c9ef392e347..c3dee8ed5ea 100644 --- a/src/test/run-pass/box.rs +++ b/src/test/run-pass/box.rs @@ -1,3 +1,3 @@ -fn main() { let x: @int = @10; assert (*x == 10); } \ No newline at end of file +fn main() { let x: @int = @10; assert (*x == 10); } diff --git a/src/test/run-pass/break-value.rs b/src/test/run-pass/break-value.rs index 9db96e85782..764d03bdf22 100644 --- a/src/test/run-pass/break-value.rs +++ b/src/test/run-pass/break-value.rs @@ -1,3 +1,3 @@ fn int_id(x: int) -> int { ret x; } -fn main() { while true { int_id(break); } } \ No newline at end of file +fn main() { while true { int_id(break); } } diff --git a/src/test/run-pass/break.rs b/src/test/run-pass/break.rs index d53445ef586..962c360ca7b 100644 --- a/src/test/run-pass/break.rs +++ b/src/test/run-pass/break.rs @@ -6,15 +6,12 @@ fn main() { assert (i == 10); do { i += 1; if i == 20 { break; } } while i < 30 assert (i == 20); - for x: int in ~[1, 2, 3, 4, 5, 6] { - if x == 3 { break; } - assert (x <= 3); - } + for x: int in [1, 2, 3, 4, 5, 6] { if x == 3 { break; } assert (x <= 3); } i = 0; while i < 10 { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); } i = 0; do { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); } while i < 10 - for x: int in ~[1, 2, 3, 4, 5, 6] { + for x: int in [1, 2, 3, 4, 5, 6] { if x % 2 == 0 { cont; } assert (x % 2 != 0); } diff --git a/src/test/run-pass/call-autoderef-tag.rs b/src/test/run-pass/call-autoderef-tag.rs index 6cc87ae7b95..f978092ca95 100644 --- a/src/test/run-pass/call-autoderef-tag.rs +++ b/src/test/run-pass/call-autoderef-tag.rs @@ -1,5 +1,5 @@ -tag int_fn { f(fn(int) -> int ); } -tag int_box_fn { fb(@fn(int) -> int ); } +tag int_fn { f(fn(int) -> int); } +tag int_box_fn { fb(@fn(int) -> int); } fn add1(i: int) -> int { ret i + 1; } fn main() { let g = f(add1); @@ -7,4 +7,4 @@ fn main() { assert (f(add1)(5) == 6); assert ((@f(add1))(5) == 6); assert (fb(@add1)(7) == 8); -} \ No newline at end of file +} diff --git a/src/test/run-pass/cast.rs b/src/test/run-pass/cast.rs index 38a4ca72a1a..6d1560305d6 100644 --- a/src/test/run-pass/cast.rs +++ b/src/test/run-pass/cast.rs @@ -13,4 +13,4 @@ fn main() { assert (0x51 as char == 'Q'); assert (true == 1 as bool); assert (0 as u32 == false as u32); -} \ No newline at end of file +} diff --git a/src/test/run-pass/chan-leak.rs b/src/test/run-pass/chan-leak.rs index 39e445b47ec..e08bfbd28ed 100644 --- a/src/test/run-pass/chan-leak.rs +++ b/src/test/run-pass/chan-leak.rs @@ -7,10 +7,7 @@ import std::comm::send; import std::comm; import std::comm::mk_port; -tag request { - quit; - close(_chan<bool>); -} +tag request { quit; close(_chan<bool>); } type ctx = _chan<request>; diff --git a/src/test/run-pass/char.rs b/src/test/run-pass/char.rs index 8383a3d36fc..2783c05200f 100644 --- a/src/test/run-pass/char.rs +++ b/src/test/run-pass/char.rs @@ -10,4 +10,4 @@ fn main() { assert (d == c); assert (d == 'x'); assert ('x' == d); -} \ No newline at end of file +} diff --git a/src/test/run-pass/child-outlives-parent.rs b/src/test/run-pass/child-outlives-parent.rs index d6b48ccb131..2da34466cdb 100644 --- a/src/test/run-pass/child-outlives-parent.rs +++ b/src/test/run-pass/child-outlives-parent.rs @@ -5,4 +5,4 @@ import std::task; fn child2(s: str) { } -fn main() { let x = task::_spawn(bind child2("hi")); } \ No newline at end of file +fn main() { let x = task::_spawn(bind child2("hi")); } diff --git a/src/test/run-pass/claim-nonterm.rs b/src/test/run-pass/claim-nonterm.rs index 6b555f1bc59..770beeb9fbf 100644 --- a/src/test/run-pass/claim-nonterm.rs +++ b/src/test/run-pass/claim-nonterm.rs @@ -5,4 +5,4 @@ import std::uint::*; pred fails(a: uint) -> bool { fail; } -fn main() { let b: uint = 4u; claim (fails(b)); } \ No newline at end of file +fn main() { let b: uint = 4u; claim (fails(b)); } diff --git a/src/test/run-pass/command-line-args.rs b/src/test/run-pass/command-line-args.rs index 429bea89771..efd5d2bb04c 100644 --- a/src/test/run-pass/command-line-args.rs +++ b/src/test/run-pass/command-line-args.rs @@ -1,3 +1,3 @@ -fn main(args: [str]) { log args.(0); } +fn main(args: [str]) { log args[0]; } diff --git a/src/test/run-pass/complex.rs b/src/test/run-pass/complex.rs index cc5d8d3acb7..1b14e7ab7f5 100644 --- a/src/test/run-pass/complex.rs +++ b/src/test/run-pass/complex.rs @@ -25,4 +25,4 @@ fn foo(x: int) -> int { ret 0; } -fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; } \ No newline at end of file +fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; } diff --git a/src/test/run-pass/const.rs b/src/test/run-pass/const.rs index d181c49484b..b96ae6f7360 100644 --- a/src/test/run-pass/const.rs +++ b/src/test/run-pass/const.rs @@ -2,4 +2,4 @@ const i: int = 10; -fn main() { log i; } \ No newline at end of file +fn main() { log i; } diff --git a/src/test/run-pass/constrained-type.rs b/src/test/run-pass/constrained-type.rs index 96ab84cb53d..d05e4311dbf 100644 --- a/src/test/run-pass/constrained-type.rs +++ b/src/test/run-pass/constrained-type.rs @@ -6,6 +6,6 @@ type bubu = {x: int, y: int}; pred less_than(x: int, y: int) -> bool { ret x < y; } -type ordered_range = {low: int, high: int} : less_than(*.low, *.high); +type ordered_range = {low: int, high: int} : less_than(*.low, *.high); -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/constraint-prop-expr-move.rs b/src/test/run-pass/constraint-prop-expr-move.rs index c9104f3e789..56ebc914b93 100644 --- a/src/test/run-pass/constraint-prop-expr-move.rs +++ b/src/test/run-pass/constraint-prop-expr-move.rs @@ -9,4 +9,4 @@ fn main() { check (le(a, b)); c <- a; log safe_slice("kitties", c, b); -} \ No newline at end of file +} diff --git a/src/test/run-pass/constraint-prop-move.rs b/src/test/run-pass/constraint-prop-move.rs index 9418d3dff7f..97285adae0c 100644 --- a/src/test/run-pass/constraint-prop-move.rs +++ b/src/test/run-pass/constraint-prop-move.rs @@ -8,4 +8,4 @@ fn main() { check (le(a, b)); let c <- a; log safe_slice("kitties", c, b); -} \ No newline at end of file +} diff --git a/src/test/run-pass/constraint-prop-swap.rs b/src/test/run-pass/constraint-prop-swap.rs index 3212ad54e2a..7b96a89bb16 100644 --- a/src/test/run-pass/constraint-prop-swap.rs +++ b/src/test/run-pass/constraint-prop-swap.rs @@ -8,4 +8,4 @@ fn main() { check (le(b, a)); b <-> a; log safe_slice("kitties", a, b); -} \ No newline at end of file +} diff --git a/src/test/run-pass/constraint-prop.rs b/src/test/run-pass/constraint-prop.rs index 720f2ff5631..71f151f5260 100644 --- a/src/test/run-pass/constraint-prop.rs +++ b/src/test/run-pass/constraint-prop.rs @@ -8,4 +8,4 @@ fn main() { check (le(a, b)); let c = b; log safe_slice("kitties", a, c); -} \ No newline at end of file +} diff --git a/src/test/run-pass/crate-attributes-src/foo.rs b/src/test/run-pass/crate-attributes-src/foo.rs index 7decb512ec4..5ab36dfe00d 100644 --- a/src/test/run-pass/crate-attributes-src/foo.rs +++ b/src/test/run-pass/crate-attributes-src/foo.rs @@ -5,4 +5,4 @@ // Attributes of the following function #[attr1 = "val"] #[attr2 = "val"] -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/dead-code-one-arm-if.rs b/src/test/run-pass/dead-code-one-arm-if.rs index 456d8bff367..5aedb18282b 100644 --- a/src/test/run-pass/dead-code-one-arm-if.rs +++ b/src/test/run-pass/dead-code-one-arm-if.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { if 1 == 1 { ret; } log "Paul is dead"; } \ No newline at end of file +fn main() { if 1 == 1 { ret; } log "Paul is dead"; } diff --git a/src/test/run-pass/deep.rs b/src/test/run-pass/deep.rs index c229ff93598..461d3c9ddfd 100644 --- a/src/test/run-pass/deep.rs +++ b/src/test/run-pass/deep.rs @@ -6,4 +6,4 @@ fn f(x: int) -> int { if x == 1 { ret 1; } else { let y: int = 1 + f(x - 1); ret y; } } -fn main() { assert (f(5000) == 5000); } \ No newline at end of file +fn main() { assert (f(5000) == 5000); } diff --git a/src/test/run-pass/deref-lval.rs b/src/test/run-pass/deref-lval.rs index ba5149a7fd8..33d7f48dfe0 100644 --- a/src/test/run-pass/deref-lval.rs +++ b/src/test/run-pass/deref-lval.rs @@ -1,3 +1,3 @@ -fn main() { let x = @mutable 5; *x = 1000; log *x; } \ No newline at end of file +fn main() { let x = @mutable 5; *x = 1000; log *x; } diff --git a/src/test/run-pass/deref.rs b/src/test/run-pass/deref.rs index 71dcfeb81f6..0d7276af659 100644 --- a/src/test/run-pass/deref.rs +++ b/src/test/run-pass/deref.rs @@ -1,3 +1,3 @@ -fn main() { let x: @int = @10; let y: int = *x; } \ No newline at end of file +fn main() { let x: @int = @10; let y: int = *x; } diff --git a/src/test/run-pass/div-mod.rs b/src/test/run-pass/div-mod.rs index 38a5bab5ca7..0e663ef4e09 100644 --- a/src/test/run-pass/div-mod.rs +++ b/src/test/run-pass/div-mod.rs @@ -15,4 +15,4 @@ fn main() { assert (x % 3 == 0); assert (x % y == 0); assert (15 % y == 0); -} \ No newline at end of file +} diff --git a/src/test/run-pass/double-unbox.rs b/src/test/run-pass/double-unbox.rs index 32ecfa628e6..aacfbb91509 100644 --- a/src/test/run-pass/double-unbox.rs +++ b/src/test/run-pass/double-unbox.rs @@ -3,4 +3,4 @@ type quux = {bar: int}; fn g(i: &int) { } fn f(foo: @@quux) { g(foo.bar); } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/drop-bind-thunk-args.rs b/src/test/run-pass/drop-bind-thunk-args.rs index d5eddb77321..2a2d2c5e630 100644 --- a/src/test/run-pass/drop-bind-thunk-args.rs +++ b/src/test/run-pass/drop-bind-thunk-args.rs @@ -2,4 +2,4 @@ fn f(x: @int) { } -fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); } \ No newline at end of file +fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); } diff --git a/src/test/run-pass/drop-on-empty-block-exit.rs b/src/test/run-pass/drop-on-empty-block-exit.rs index 2a4f093f1de..97a161f19e7 100644 --- a/src/test/run-pass/drop-on-empty-block-exit.rs +++ b/src/test/run-pass/drop-on-empty-block-exit.rs @@ -2,4 +2,4 @@ tag t { foo(@int); } -fn main() { let tt = foo(@10); alt tt { foo(z) { } } } \ No newline at end of file +fn main() { let tt = foo(@10); alt tt { foo(z) { } } } diff --git a/src/test/run-pass/drop-on-ret.rs b/src/test/run-pass/drop-on-ret.rs index f1da1a37176..821601baae8 100644 --- a/src/test/run-pass/drop-on-ret.rs +++ b/src/test/run-pass/drop-on-ret.rs @@ -4,4 +4,4 @@ // -*- rust -*- fn f() -> int { if true { let s: str = "should not leak"; ret 1; } ret 0; } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/run-pass/early-ret-binop-add.rs b/src/test/run-pass/early-ret-binop-add.rs index dc847b30fc2..f7719afc591 100644 --- a/src/test/run-pass/early-ret-binop-add.rs +++ b/src/test/run-pass/early-ret-binop-add.rs @@ -1,4 +1,2 @@ -fn wsucc(n: int) -> int { - { ret n + 1 } + 0; -} -fn main() {} +fn wsucc(n: int) -> int { { ret n + 1 } + 0; } +fn main() { } diff --git a/src/test/run-pass/early-ret-binop.rs b/src/test/run-pass/early-ret-binop.rs index 682bf502ce3..ffa6efb4e80 100644 --- a/src/test/run-pass/early-ret-binop.rs +++ b/src/test/run-pass/early-ret-binop.rs @@ -1,4 +1,2 @@ -fn wsucc(n: int) -> int { - { ret n + 1 } == 0; -} -fn main() {} +fn wsucc(n: int) -> int { { ret n + 1 } == 0; } +fn main() { } diff --git a/src/test/run-pass/else-if.rs b/src/test/run-pass/else-if.rs index cf13a53d86a..5f85f13ae80 100644 --- a/src/test/run-pass/else-if.rs +++ b/src/test/run-pass/else-if.rs @@ -3,13 +3,13 @@ fn main() { if 1 == 2 { assert (false); - } else if (2 == 3) { + } else if 2 == 3 { assert (false); - } else if (3 == 4) { assert (false); } else { assert (true); } - if 1 == 2 { assert (false); } else if (2 == 2) { assert (true); } + } else if 3 == 4 { assert (false); } else { assert (true); } + if 1 == 2 { assert (false); } else if 2 == 2 { assert (true); } if 1 == 2 { assert (false); - } else if (2 == 2) { + } else if 2 == 2 { if 1 == 1 { assert (true); } else { if 2 == 1 { assert (false); } else { assert (false); } } @@ -17,4 +17,4 @@ fn main() { if 1 == 2 { assert (false); } else { if 1 == 2 { assert (false); } else { assert (true); } } -} \ No newline at end of file +} diff --git a/src/test/run-pass/empty-mutable-vec.rs b/src/test/run-pass/empty-mutable-vec.rs index de1d84ae134..6dfd5446160 100644 --- a/src/test/run-pass/empty-mutable-vec.rs +++ b/src/test/run-pass/empty-mutable-vec.rs @@ -1,3 +1,3 @@ -fn main() { let v: [mutable int] = ~[mutable ]; } +fn main() { let v: [mutable int] = [mutable]; } diff --git a/src/test/run-pass/export-abstract-tag.rs b/src/test/run-pass/export-abstract-tag.rs index 7ef167c6a0a..f30d128635b 100644 --- a/src/test/run-pass/export-abstract-tag.rs +++ b/src/test/run-pass/export-abstract-tag.rs @@ -10,4 +10,4 @@ mod foo { fn f() -> t { ret t1; } } -fn main() { let v: foo::t = foo::f(); } \ No newline at end of file +fn main() { let v: foo::t = foo::f(); } diff --git a/src/test/run-pass/export-multi.rs b/src/test/run-pass/export-multi.rs index 9f382cb4b77..6229e60532e 100644 --- a/src/test/run-pass/export-multi.rs +++ b/src/test/run-pass/export-multi.rs @@ -4,13 +4,8 @@ import m::g; mod m { export f, g; - fn f() {} - fn g() {} + fn f() { } + fn g() { } } -fn main() { - f(); - g(); - m::f(); - m::g(); -} \ No newline at end of file +fn main() { f(); g(); m::f(); m::g(); } diff --git a/src/test/run-pass/export-non-interference2.rs b/src/test/run-pass/export-non-interference2.rs index b9ffd8e8a58..c32f718c4d1 100644 --- a/src/test/run-pass/export-non-interference2.rs +++ b/src/test/run-pass/export-non-interference2.rs @@ -9,4 +9,4 @@ mod foo { fn x() { log "x"; } } -fn main() { foo::bar::y(); } \ No newline at end of file +fn main() { foo::bar::y(); } diff --git a/src/test/run-pass/export-non-interference3.rs b/src/test/run-pass/export-non-interference3.rs index bfb734525a1..14fba5d40c3 100644 --- a/src/test/run-pass/export-non-interference3.rs +++ b/src/test/run-pass/export-non-interference3.rs @@ -10,4 +10,4 @@ mod bar { fn x() { log "x"; } } -fn main() { foo::x(); } \ No newline at end of file +fn main() { foo::x(); } diff --git a/src/test/run-pass/export-tag-variant.rs b/src/test/run-pass/export-tag-variant.rs index f7599d08728..12eaf63949b 100644 --- a/src/test/run-pass/export-tag-variant.rs +++ b/src/test/run-pass/export-tag-variant.rs @@ -5,4 +5,4 @@ mod foo { tag t { t1; } } -fn main() { let v = foo::t1; } \ No newline at end of file +fn main() { let v = foo::t1; } diff --git a/src/test/run-pass/export-unexported-dep.rs b/src/test/run-pass/export-unexported-dep.rs index 8f1d54ea5a5..bc8451a4854 100644 --- a/src/test/run-pass/export-unexported-dep.rs +++ b/src/test/run-pass/export-unexported-dep.rs @@ -13,4 +13,4 @@ mod foo { fn g(v: t) { assert (v == t1); } } -fn main() { foo::g(foo::f()); } \ No newline at end of file +fn main() { foo::g(foo::f()); } diff --git a/src/test/run-pass/expr-alt-box.rs b/src/test/run-pass/expr-alt-box.rs index a397874dbd9..84c9e424f46 100644 --- a/src/test/run-pass/expr-alt-box.rs +++ b/src/test/run-pass/expr-alt-box.rs @@ -11,4 +11,4 @@ fn test_str() { assert (res == "happy"); } -fn main() { test_box(); test_str(); } \ No newline at end of file +fn main() { test_box(); test_str(); } diff --git a/src/test/run-pass/expr-alt-fail-all.rs b/src/test/run-pass/expr-alt-fail-all.rs index 55f4e69524d..3ff8af3cb97 100644 --- a/src/test/run-pass/expr-alt-fail-all.rs +++ b/src/test/run-pass/expr-alt-fail-all.rs @@ -9,4 +9,4 @@ fn main() { true { 10 } false { alt true { true { fail } false { fail } } } }; -} \ No newline at end of file +} diff --git a/src/test/run-pass/expr-alt-fail.rs b/src/test/run-pass/expr-alt-fail.rs index fb3f0dac014..7dfffcc1120 100644 --- a/src/test/run-pass/expr-alt-fail.rs +++ b/src/test/run-pass/expr-alt-fail.rs @@ -4,8 +4,8 @@ fn test_simple() { } fn test_box() { - let r = alt true { true { ~[10] } false { fail } }; - assert (r.(0) == 10); + let r = alt true { true { [10] } false { fail } }; + assert (r[0] == 10); } -fn main() { test_simple(); test_box(); } \ No newline at end of file +fn main() { test_simple(); test_box(); } diff --git a/src/test/run-pass/expr-alt-generic-box1.rs b/src/test/run-pass/expr-alt-generic-box1.rs index ec299544094..763f303bbd6 100644 --- a/src/test/run-pass/expr-alt-generic-box1.rs +++ b/src/test/run-pass/expr-alt-generic-box1.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(@T, @T) -> bool ; +type compare<T> = fn(@T, @T) -> bool; fn test_generic<T>(expected: @T, eq: &compare<T>) { let actual: @T = alt true { true { expected } }; diff --git a/src/test/run-pass/expr-alt-generic-box2.rs b/src/test/run-pass/expr-alt-generic-box2.rs index f7e96af98d5..046d77cd438 100644 --- a/src/test/run-pass/expr-alt-generic-box2.rs +++ b/src/test/run-pass/expr-alt-generic-box2.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, eq: &compare<T>) { let actual: T = alt true { true { expected } }; diff --git a/src/test/run-pass/expr-alt-generic.rs b/src/test/run-pass/expr-alt-generic.rs index cfecd0302a1..c9990a0c756 100644 --- a/src/test/run-pass/expr-alt-generic.rs +++ b/src/test/run-pass/expr-alt-generic.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, eq: &compare<T>) { let actual: T = alt true { true { expected } }; diff --git a/src/test/run-pass/expr-alt-struct.rs b/src/test/run-pass/expr-alt-struct.rs index 51ef9e09457..e346c9d2a9f 100644 --- a/src/test/run-pass/expr-alt-struct.rs +++ b/src/test/run-pass/expr-alt-struct.rs @@ -15,4 +15,4 @@ fn test_tag() { assert (rs == happy); } -fn main() { test_rec(); test_tag(); } \ No newline at end of file +fn main() { test_rec(); test_tag(); } diff --git a/src/test/run-pass/expr-alt.rs b/src/test/run-pass/expr-alt.rs index 8d4ddd288f6..93495115ba7 100644 --- a/src/test/run-pass/expr-alt.rs +++ b/src/test/run-pass/expr-alt.rs @@ -41,4 +41,4 @@ fn main() { test_inferrence(); test_alt_as_alt_head(); test_alt_as_block_result(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/expr-block-box.rs b/src/test/run-pass/expr-block-box.rs index 62971193037..c434db7a8bf 100644 --- a/src/test/run-pass/expr-block-box.rs +++ b/src/test/run-pass/expr-block-box.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { let x = { @100 }; assert (*x == 100); } \ No newline at end of file +fn main() { let x = { @100 }; assert (*x == 100); } diff --git a/src/test/run-pass/expr-block-fn.rs b/src/test/run-pass/expr-block-fn.rs index dc8690f15ad..8b461bcf863 100644 --- a/src/test/run-pass/expr-block-fn.rs +++ b/src/test/run-pass/expr-block-fn.rs @@ -1,11 +1,11 @@ fn test_fn() { - type t = fn() -> int ; + type t = fn() -> int; fn ten() -> int { ret 10; } let rs: t = { ten }; assert (rs() == 10); } -fn main() { test_fn(); } \ No newline at end of file +fn main() { test_fn(); } diff --git a/src/test/run-pass/expr-block-generic-box1.rs b/src/test/run-pass/expr-block-generic-box1.rs index d68f0cf5d89..5ab310cb309 100644 --- a/src/test/run-pass/expr-block-generic-box1.rs +++ b/src/test/run-pass/expr-block-generic-box1.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(@T, @T) -> bool ; +type compare<T> = fn(@T, @T) -> bool; fn test_generic<T>(expected: @T, eq: &compare<T>) { let actual: @T = { expected }; diff --git a/src/test/run-pass/expr-block-generic-box2.rs b/src/test/run-pass/expr-block-generic-box2.rs index d630b65c822..3f8293490f3 100644 --- a/src/test/run-pass/expr-block-generic-box2.rs +++ b/src/test/run-pass/expr-block-generic-box2.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, eq: &compare<T>) { let actual: T = { expected }; diff --git a/src/test/run-pass/expr-block-generic.rs b/src/test/run-pass/expr-block-generic.rs index d7c17731559..52d463eae2a 100644 --- a/src/test/run-pass/expr-block-generic.rs +++ b/src/test/run-pass/expr-block-generic.rs @@ -4,7 +4,7 @@ // -*- rust -*- // Tests for standalone blocks as expressions with dynamic type sizes -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, eq: &compare<T>) { let actual: T = { expected }; diff --git a/src/test/run-pass/expr-block-ref.rs b/src/test/run-pass/expr-block-ref.rs index 6a0a1700a94..59107298782 100644 --- a/src/test/run-pass/expr-block-ref.rs +++ b/src/test/run-pass/expr-block-ref.rs @@ -1,2 +1,2 @@ // Regression test for issue #388 -fn main() { let x = { { @10 } }; } \ No newline at end of file +fn main() { let x = { { @10 } }; } diff --git a/src/test/run-pass/expr-block-slot.rs b/src/test/run-pass/expr-block-slot.rs index d36330f287f..f2a73836f01 100644 --- a/src/test/run-pass/expr-block-slot.rs +++ b/src/test/run-pass/expr-block-slot.rs @@ -4,4 +4,4 @@ fn main() { assert (a.a == 3); let c = { let d = {v: 3}; d }; assert (c.v == 3); -} \ No newline at end of file +} diff --git a/src/test/run-pass/expr-block.rs b/src/test/run-pass/expr-block.rs index d0fb65c5ffd..3aab0a64744 100644 --- a/src/test/run-pass/expr-block.rs +++ b/src/test/run-pass/expr-block.rs @@ -13,4 +13,4 @@ fn test_filled_with_stuff() { assert (rs == 10); } -fn main() { test_basic(); test_rec(); test_filled_with_stuff(); } \ No newline at end of file +fn main() { test_basic(); test_rec(); test_filled_with_stuff(); } diff --git a/src/test/run-pass/expr-copy.rs b/src/test/run-pass/expr-copy.rs index 6fbaf4f7679..56f7dbb9996 100644 --- a/src/test/run-pass/expr-copy.rs +++ b/src/test/run-pass/expr-copy.rs @@ -1,5 +1 @@ -fn main() { - let x = 10; - let y = copy x; - log y; -} \ No newline at end of file +fn main() { let x = 10; let y = copy x; log y; } diff --git a/src/test/run-pass/expr-elseif-ref.rs b/src/test/run-pass/expr-elseif-ref.rs index 1de7fa6e414..4235c21ac5f 100644 --- a/src/test/run-pass/expr-elseif-ref.rs +++ b/src/test/run-pass/expr-elseif-ref.rs @@ -2,6 +2,6 @@ // values from the else if branch fn main() { let y: @uint = @10u; - let x = if false { y } else if (true) { y } else { y }; + let x = if false { y } else if true { y } else { y }; assert (*y == 10u); } diff --git a/src/test/run-pass/expr-elseif-ref2.rs b/src/test/run-pass/expr-elseif-ref2.rs index ef8559ef062..8a3af93dc90 100644 --- a/src/test/run-pass/expr-elseif-ref2.rs +++ b/src/test/run-pass/expr-elseif-ref2.rs @@ -1,4 +1,2 @@ // Regression test for issue #388 -fn main() { - let x = if false { @0u } else if (true) { @10u } else { @0u }; -} \ No newline at end of file +fn main() { let x = if false { @0u } else if true { @10u } else { @0u }; } diff --git a/src/test/run-pass/expr-empty-ret.rs b/src/test/run-pass/expr-empty-ret.rs index 99ce1fac7b7..6044c6e8ff7 100644 --- a/src/test/run-pass/expr-empty-ret.rs +++ b/src/test/run-pass/expr-empty-ret.rs @@ -2,4 +2,4 @@ fn f() { let x = alt true { true { 10 } false { ret } }; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/expr-fn.rs b/src/test/run-pass/expr-fn.rs index 1bff51000b9..b7070ead5ed 100644 --- a/src/test/run-pass/expr-fn.rs +++ b/src/test/run-pass/expr-fn.rs @@ -4,8 +4,8 @@ fn test_int() { } fn test_vec() { - fn f() -> [int] { ~[10, 11] } - assert (f().(1) == 11); + fn f() -> [int] { [10, 11] } + assert (f()[1] == 11); } fn test_generic() { diff --git a/src/test/run-pass/expr-if-box.rs b/src/test/run-pass/expr-if-box.rs index 32881d23bae..7d9e2320e93 100644 --- a/src/test/run-pass/expr-if-box.rs +++ b/src/test/run-pass/expr-if-box.rs @@ -14,4 +14,4 @@ fn test_str() { assert (rs == "happy"); } -fn main() { test_box(); test_str(); } \ No newline at end of file +fn main() { test_box(); test_str(); } diff --git a/src/test/run-pass/expr-if-fail-all.rs b/src/test/run-pass/expr-if-fail-all.rs index f9ad1075605..347a7f5ce9a 100644 --- a/src/test/run-pass/expr-if-fail-all.rs +++ b/src/test/run-pass/expr-if-fail-all.rs @@ -1,3 +1,3 @@ // When all branches of an if expression result in fail, the entire if // expression results in fail. -fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; } \ No newline at end of file +fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; } diff --git a/src/test/run-pass/expr-if-fail.rs b/src/test/run-pass/expr-if-fail.rs index 4c9c8e07d4c..0a19c446388 100644 --- a/src/test/run-pass/expr-if-fail.rs +++ b/src/test/run-pass/expr-if-fail.rs @@ -6,8 +6,8 @@ fn test_else_fail() { } fn test_elseif_fail() { - let x = if false { 0 } else if (false) { fail } else { 10 }; + let x = if false { 0 } else if false { fail } else { 10 }; assert (x == 10); } -fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); } \ No newline at end of file +fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); } diff --git a/src/test/run-pass/expr-if-generic-box1.rs b/src/test/run-pass/expr-if-generic-box1.rs index 82bbbb840a6..6d69cce9a1b 100644 --- a/src/test/run-pass/expr-if-generic-box1.rs +++ b/src/test/run-pass/expr-if-generic-box1.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(@T, @T) -> bool ; +type compare<T> = fn(@T, @T) -> bool; fn test_generic<T>(expected: @T, not_expected: @T, eq: &compare<T>) { let actual: @T = if true { expected } else { not_expected }; diff --git a/src/test/run-pass/expr-if-generic-box2.rs b/src/test/run-pass/expr-if-generic-box2.rs index 7cf77d61686..b31fb91f229 100644 --- a/src/test/run-pass/expr-if-generic-box2.rs +++ b/src/test/run-pass/expr-if-generic-box2.rs @@ -2,7 +2,7 @@ // -*- rust -*- -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) { let actual: T = if true { expected } else { not_expected }; diff --git a/src/test/run-pass/expr-if-generic.rs b/src/test/run-pass/expr-if-generic.rs index df466051ce4..99709ea396c 100644 --- a/src/test/run-pass/expr-if-generic.rs +++ b/src/test/run-pass/expr-if-generic.rs @@ -4,7 +4,7 @@ // -*- rust -*- // Tests for if as expressions with dynamic type sizes -type compare<T> = fn(&T, &T) -> bool ; +type compare<T> = fn(&T, &T) -> bool; fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) { let actual: T = if true { expected } else { not_expected }; diff --git a/src/test/run-pass/expr-if-struct.rs b/src/test/run-pass/expr-if-struct.rs index 481fbf3b21a..56728c67706 100644 --- a/src/test/run-pass/expr-if-struct.rs +++ b/src/test/run-pass/expr-if-struct.rs @@ -15,4 +15,4 @@ fn test_tag() { assert (rs == happy); } -fn main() { test_rec(); test_tag(); } \ No newline at end of file +fn main() { test_rec(); test_tag(); } diff --git a/src/test/run-pass/expr-if.rs b/src/test/run-pass/expr-if.rs index 74c2a53eda1..43f3083f164 100644 --- a/src/test/run-pass/expr-if.rs +++ b/src/test/run-pass/expr-if.rs @@ -12,17 +12,17 @@ fn test_else() { } fn test_elseif1() { - let rs: bool = if true { true } else if (true) { false } else { false }; + let rs: bool = if true { true } else if true { false } else { false }; assert (rs); } fn test_elseif2() { - let rs: bool = if false { false } else if (true) { true } else { false }; + let rs: bool = if false { false } else if true { true } else { false }; assert (rs); } fn test_elseif3() { - let rs: bool = if false { false } else if (false) { false } else { true }; + let rs: bool = if false { false } else if false { false } else { true }; assert (rs); } @@ -52,4 +52,4 @@ fn main() { test_inferrence(); test_if_as_if_condition(); test_if_as_block_result(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/expr-scope.rs b/src/test/run-pass/expr-scope.rs index d5a2a069f7f..53c8223c778 100644 --- a/src/test/run-pass/expr-scope.rs +++ b/src/test/run-pass/expr-scope.rs @@ -2,4 +2,4 @@ // xfail-fast fn f() { } -fn main() { ret ::f(); } \ No newline at end of file +fn main() { ret ::f(); } diff --git a/src/test/run-pass/exterior.rs b/src/test/run-pass/exterior.rs index ae34d051a2b..228f7dff061 100644 --- a/src/test/run-pass/exterior.rs +++ b/src/test/run-pass/exterior.rs @@ -13,4 +13,4 @@ fn main() { f(b); assert (a.z == 12); assert (b.z == 13); -} \ No newline at end of file +} diff --git a/src/test/run-pass/fact.rs b/src/test/run-pass/fact.rs index f47c2e9ece9..95af3b8a6b6 100644 --- a/src/test/run-pass/fact.rs +++ b/src/test/run-pass/fact.rs @@ -25,4 +25,4 @@ fn main() { assert (f(5) == 120); // log "all done"; -} \ No newline at end of file +} diff --git a/src/test/run-pass/fixed-point-bind-box.rs b/src/test/run-pass/fixed-point-bind-box.rs index f93add461a4..4ca1cdb34c9 100644 --- a/src/test/run-pass/fixed-point-bind-box.rs +++ b/src/test/run-pass/fixed-point-bind-box.rs @@ -1,12 +1,12 @@ -fn fix_help<A, B>(f: @fn(@fn(&A) -> B , &A) -> B , x: &A) -> B { +fn fix_help<A, B>(f: @fn(@fn(&A) -> B, &A) -> B, x: &A) -> B { ret f(@bind fix_help(f, _), x); } -fn fix<A, B>(f: @fn(@fn(&A) -> B , &A) -> B ) -> @fn(&A) -> B { +fn fix<A, B>(f: @fn(@fn(&A) -> B, &A) -> B) -> @fn(&A) -> B { ret @bind fix_help(f, _); } -fn fact_(f: @fn(&int) -> int , n: &int) -> int { +fn fact_(f: @fn(&int) -> int, n: &int) -> int { // fun fact 0 = 1 ret if n == 0 { 1 } else { n * f(n - 1) }; } diff --git a/src/test/run-pass/float-signature.rs b/src/test/run-pass/float-signature.rs index f2e7229623a..8eb940d8883 100644 --- a/src/test/run-pass/float-signature.rs +++ b/src/test/run-pass/float-signature.rs @@ -5,4 +5,4 @@ fn main() { let n: float = 0.1; let m: float = foo(n); log m; -} \ No newline at end of file +} diff --git a/src/test/run-pass/float.rs b/src/test/run-pass/float.rs index b9014c9b085..a0b4a32d41a 100644 --- a/src/test/run-pass/float.rs +++ b/src/test/run-pass/float.rs @@ -7,4 +7,4 @@ fn main() { || pi > 1.0 { log "yes"; } -} \ No newline at end of file +} diff --git a/src/test/run-pass/float2.rs b/src/test/run-pass/float2.rs index 1eed1e37aec..26b5a64ebe5 100644 --- a/src/test/run-pass/float2.rs +++ b/src/test/run-pass/float2.rs @@ -21,4 +21,4 @@ fn main() { assert (h == i); assert (j > k); assert (k < a); -} \ No newline at end of file +} diff --git a/src/test/run-pass/floatlits.rs b/src/test/run-pass/floatlits.rs index 13039f2bf3b..6f43ad9b760 100644 --- a/src/test/run-pass/floatlits.rs +++ b/src/test/run-pass/floatlits.rs @@ -7,4 +7,4 @@ fn main() { let g = 4.90000000001e-10; assert (g > 5e-11); assert (g < 5e-9); -} \ No newline at end of file +} diff --git a/src/test/run-pass/fn-constraint.rs b/src/test/run-pass/fn-constraint.rs index 2f7b81effec..f9ea572a735 100644 --- a/src/test/run-pass/fn-constraint.rs +++ b/src/test/run-pass/fn-constraint.rs @@ -7,4 +7,4 @@ fn main() { let b: uint = 4u; check (le(a, b)); log safe_slice("kitties", a, b); -} \ No newline at end of file +} diff --git a/src/test/run-pass/fn-expr.rs b/src/test/run-pass/fn-expr.rs index dfe4d2bd9a7..64b28e4a289 100644 --- a/src/test/run-pass/fn-expr.rs +++ b/src/test/run-pass/fn-expr.rs @@ -1 +1 @@ -fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); } \ No newline at end of file +fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); } diff --git a/src/test/run-pass/fn-lval.rs b/src/test/run-pass/fn-lval.rs index faa12c8720d..c62ad36052f 100644 --- a/src/test/run-pass/fn-lval.rs +++ b/src/test/run-pass/fn-lval.rs @@ -2,8 +2,8 @@ // -*- rust -*- -fn foo(f: fn(int) -> int ) { } +fn foo(f: fn(int) -> int) { } fn id(x: int) -> int { ret x; } -fn main() { foo(id); } \ No newline at end of file +fn main() { foo(id); } diff --git a/src/test/run-pass/fn-type-infer.rs b/src/test/run-pass/fn-type-infer.rs index c3513bdff8a..d9b6ac60ba3 100644 --- a/src/test/run-pass/fn-type-infer.rs +++ b/src/test/run-pass/fn-type-infer.rs @@ -1,4 +1,4 @@ fn main() { // We should be able to type infer inside of lambdas. let f = fn () { let i = 10; }; -} \ No newline at end of file +} diff --git a/src/test/run-pass/for-destruct.rs b/src/test/run-pass/for-destruct.rs index cc1702d247c..569d596e7b7 100644 --- a/src/test/run-pass/for-destruct.rs +++ b/src/test/run-pass/for-destruct.rs @@ -1,5 +1,5 @@ fn main() { - for {x, y}: {x: int, y: int} in ~[{x: 10, y: 20}, {x: 30, y: 0}] { - assert x + y == 30; + for {x: x, y: y}: {x: int, y: int} in [{x: 10, y: 20}, {x: 30, y: 0}] { + assert (x + y == 30); } } diff --git a/src/test/run-pass/for-each-destruct.rs b/src/test/run-pass/for-each-destruct.rs index 935746473a9..59488f8730d 100644 --- a/src/test/run-pass/for-each-destruct.rs +++ b/src/test/run-pass/for-each-destruct.rs @@ -1,13 +1,8 @@ iter x() -> {x: int, y: int} { let i = 0; - while i < 40 { - put {x: i, y: 30 - i}; - i += 10; - } + while i < 40 { put {x: i, y: 30 - i}; i += 10; } } fn main() { - for each {x, y}: {x: int, y: int} in x() { - assert x + y == 30; - } + for each {x: x, y: y}: {x: int, y: int} in x() { assert (x + y == 30); } } diff --git a/src/test/run-pass/for-loop-fail.rs b/src/test/run-pass/for-loop-fail.rs index 2e52a5ae1f7..d605e1797e1 100644 --- a/src/test/run-pass/for-loop-fail.rs +++ b/src/test/run-pass/for-loop-fail.rs @@ -1 +1 @@ -fn main() { let x: [int] = ~[]; for i: int in x { fail "moop"; } } +fn main() { let x: [int] = []; for i: int in x { fail "moop"; } } diff --git a/src/test/run-pass/foreach-nested-2.rs b/src/test/run-pass/foreach-nested-2.rs index ba42d7a6ac4..472bea23cfe 100644 --- a/src/test/run-pass/foreach-nested-2.rs +++ b/src/test/run-pass/foreach-nested-2.rs @@ -10,20 +10,20 @@ iter range(start: int, stop: int) -> int { } fn main() { - let a: [mutable int] = ~[mutable -1, -1, -1, -1, -1, -1, -1, -1]; + let a: [mutable int] = [mutable -1, -1, -1, -1, -1, -1, -1, -1]; let p: int = 0; for each i: int in two() { for each j: int in range(0, 2) { let tmp: int = 10 * i + j; - for each k: int in range(0, 2) { a.(p) = 10 * tmp + k; p += 1; } + for each k: int in range(0, 2) { a[p] = 10 * tmp + k; p += 1; } } } - assert (a.(0) == 0); - assert (a.(1) == 1); - assert (a.(2) == 10); - assert (a.(3) == 11); - assert (a.(4) == 100); - assert (a.(5) == 101); - assert (a.(6) == 110); - assert (a.(7) == 111); + assert (a[0] == 0); + assert (a[1] == 1); + assert (a[2] == 10); + assert (a[3] == 11); + assert (a[4] == 100); + assert (a[5] == 101); + assert (a[6] == 110); + assert (a[7] == 111); } diff --git a/src/test/run-pass/foreach-nested.rs b/src/test/run-pass/foreach-nested.rs index 4e90818621d..802381006e5 100644 --- a/src/test/run-pass/foreach-nested.rs +++ b/src/test/run-pass/foreach-nested.rs @@ -5,13 +5,13 @@ iter two() -> int { put 0; put 1; } fn main() { - let a: [mutable int] = ~[mutable -1, -1, -1, -1]; + let a: [mutable int] = [mutable -1, -1, -1, -1]; let p: int = 0; for each i: int in two() { - for each j: int in two() { a.(p) = 10 * i + j; p += 1; } + for each j: int in two() { a[p] = 10 * i + j; p += 1; } } - assert (a.(0) == 0); - assert (a.(1) == 1); - assert (a.(2) == 10); - assert (a.(3) == 11); + assert (a[0] == 0); + assert (a[1] == 1); + assert (a[2] == 10); + assert (a[3] == 11); } diff --git a/src/test/run-pass/fun-call-variants.rs b/src/test/run-pass/fun-call-variants.rs index 6409767ab40..0469e804948 100644 --- a/src/test/run-pass/fun-call-variants.rs +++ b/src/test/run-pass/fun-call-variants.rs @@ -1,15 +1,13 @@ // -*- rust -*- -fn ho(f: fn(int) -> int ) -> int { let n: int = f(3); ret n; } +fn ho(f: fn(int) -> int) -> int { let n: int = f(3); ret n; } fn direct(x: int) -> int { ret x + 1; } fn main() { - let a: int = - direct(3); // direct + let a: int = direct(3); // direct let b: int = ho(direct); // indirect unbound - let c: int = - ho(bind direct(_)); // indirect bound + let c: int = ho(bind direct(_)); // indirect bound assert (a == b); assert (b == c); -} \ No newline at end of file +} diff --git a/src/test/run-pass/fun-indirect-call.rs b/src/test/run-pass/fun-indirect-call.rs index 7bbfd7b84e9..8c4068c425c 100644 --- a/src/test/run-pass/fun-indirect-call.rs +++ b/src/test/run-pass/fun-indirect-call.rs @@ -4,4 +4,4 @@ // -*- rust -*- fn f() -> int { ret 42; } -fn main() { let g: fn() -> int = f; let i: int = g(); assert (i == 42); } \ No newline at end of file +fn main() { let g: fn() -> int = f; let i: int = g(); assert (i == 42); } diff --git a/src/test/run-pass/generic-ivec-leak.rs b/src/test/run-pass/generic-ivec-leak.rs index f9755e176b9..4e4508d08e9 100644 --- a/src/test/run-pass/generic-ivec-leak.rs +++ b/src/test/run-pass/generic-ivec-leak.rs @@ -1,4 +1,4 @@ tag wrapper<T> { wrapped(T); } -fn main() { let w = wrapped(~[1, 2, 3, 4, 5]); } +fn main() { let w = wrapped([1, 2, 3, 4, 5]); } diff --git a/src/test/run-pass/generic-ivec.rs b/src/test/run-pass/generic-ivec.rs index 39ba083a5a3..26298de5b94 100644 --- a/src/test/run-pass/generic-ivec.rs +++ b/src/test/run-pass/generic-ivec.rs @@ -1,3 +1,3 @@ fn f<T>(v: @T) { } -fn main() { f(@~[1, 2, 3, 4, 5]); } +fn main() { f(@[1, 2, 3, 4, 5]); } diff --git a/src/test/run-pass/generic-temporary.rs b/src/test/run-pass/generic-temporary.rs index 1abd0f7daf9..afac9e176ee 100644 --- a/src/test/run-pass/generic-temporary.rs +++ b/src/test/run-pass/generic-temporary.rs @@ -4,10 +4,10 @@ fn mk() -> int { ret 1; } fn chk(a: &int) { log a; assert (a == 1); } -fn apply<T>(produce: fn() -> T , consume: fn(&T) ) { consume(produce()); } +fn apply<T>(produce: fn() -> T, consume: fn(&T)) { consume(produce()); } fn main() { - let produce: fn() -> int = mk; - let consume: fn(&int) = chk; + let produce: fn() -> int = mk; + let consume: fn(&int) = chk; apply::<int>(produce, consume); } diff --git a/src/test/run-pass/generic-tup.rs b/src/test/run-pass/generic-tup.rs index bdd8ddf1268..8cacf51e9b5 100644 --- a/src/test/run-pass/generic-tup.rs +++ b/src/test/run-pass/generic-tup.rs @@ -1,7 +1,4 @@ -fn get_third<T>(t: &(T, T, T)) -> T { - let (_, _, x) = t; - ret x; -} +fn get_third<T>(t: &(T, T, T)) -> T { let (_, _, x) = t; ret x; } fn main() { log get_third((1, 2, 3)); diff --git a/src/test/run-pass/hashmap-memory.rs b/src/test/run-pass/hashmap-memory.rs index ecf13f39595..31b34aa1464 100644 --- a/src/test/run-pass/hashmap-memory.rs +++ b/src/test/run-pass/hashmap-memory.rs @@ -26,9 +26,9 @@ mod map_reduce { export mapper; export map_reduce; - type putter = fn(str, str) ; + type putter = fn(str, str); - type mapper = fn(str, putter) ; + type mapper = fn(str, putter); tag ctrl_proto { find_reducer([u8], _chan<int>); mapper_done; } @@ -92,5 +92,5 @@ mod map_reduce { } fn main() { - map_reduce::map_reduce(~["../src/test/run-pass/hashmap-memory.rs"]); + map_reduce::map_reduce(["../src/test/run-pass/hashmap-memory.rs"]); } diff --git a/src/test/run-pass/hello.rs b/src/test/run-pass/hello.rs index 5e442db7fbe..fa917bd4902 100644 --- a/src/test/run-pass/hello.rs +++ b/src/test/run-pass/hello.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { log "hello, world."; } \ No newline at end of file +fn main() { log "hello, world."; } diff --git a/src/test/run-pass/i32-sub.rs b/src/test/run-pass/i32-sub.rs index a83e95a73b8..5dd3ce8de2c 100644 --- a/src/test/run-pass/i32-sub.rs +++ b/src/test/run-pass/i32-sub.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); } \ No newline at end of file +fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); } diff --git a/src/test/run-pass/i8-incr.rs b/src/test/run-pass/i8-incr.rs index f825d54bba1..4a51fd58517 100644 --- a/src/test/run-pass/i8-incr.rs +++ b/src/test/run-pass/i8-incr.rs @@ -8,4 +8,4 @@ fn main() { x = x + 1i8; x = x - 1i8; assert (x == y); -} \ No newline at end of file +} diff --git a/src/test/run-pass/if-bot.rs b/src/test/run-pass/if-bot.rs index 8ef6bab684e..35452a2ba6d 100644 --- a/src/test/run-pass/if-bot.rs +++ b/src/test/run-pass/if-bot.rs @@ -1,3 +1,3 @@ -fn main() { let i: int = if false { fail } else { 5 }; log i; } \ No newline at end of file +fn main() { let i: int = if false { fail } else { 5 }; log i; } diff --git a/src/test/run-pass/if-check-precond.rs b/src/test/run-pass/if-check-precond.rs index 88c744642d0..eadffd7b75a 100644 --- a/src/test/run-pass/if-check-precond.rs +++ b/src/test/run-pass/if-check-precond.rs @@ -1,11 +1,11 @@ pred even(x: uint) -> bool { if x < 2u { ret false; - } else if (x == 2u) { ret true; } else { ret even(x - 2u); } + } else if x == 2u { ret true; } else { ret even(x - 2u); } } fn print_even(x: uint) : even(x) { log x; } fn foo(x: uint) { if check even(x) { print_even(x); } else { fail; } } -fn main() { foo(2u); } \ No newline at end of file +fn main() { foo(2u); } diff --git a/src/test/run-pass/if-check.rs b/src/test/run-pass/if-check.rs index 220b784e12e..090330bef0e 100644 --- a/src/test/run-pass/if-check.rs +++ b/src/test/run-pass/if-check.rs @@ -1,9 +1,9 @@ pred even(x: uint) -> bool { if x < 2u { ret false; - } else if (x == 2u) { ret true; } else { ret even(x - 2u); } + } else if x == 2u { ret true; } else { ret even(x - 2u); } } fn foo(x: uint) { if check even(x) { log x; } else { fail; } } -fn main() { foo(2u); } \ No newline at end of file +fn main() { foo(2u); } diff --git a/src/test/run-pass/if-ret.rs b/src/test/run-pass/if-ret.rs index 3dc897683fc..87cd9647243 100644 --- a/src/test/run-pass/if-ret.rs +++ b/src/test/run-pass/if-ret.rs @@ -1,3 +1,3 @@ fn foo() { if (ret) { } } -fn main() { foo(); } \ No newline at end of file +fn main() { foo(); } diff --git a/src/test/run-pass/import-from-native.rs b/src/test/run-pass/import-from-native.rs index 03c49b2adfe..b8837692c07 100644 --- a/src/test/run-pass/import-from-native.rs +++ b/src/test/run-pass/import-from-native.rs @@ -1,6 +1,6 @@ mod spam { - fn ham() {} - fn eggs() {} + fn ham() { } + fn eggs() { } } native "rust" mod rustrt { @@ -9,7 +9,4 @@ native "rust" mod rustrt { export eggs; } -fn main() { - rustrt::ham(); - rustrt::eggs(); -} \ No newline at end of file +fn main() { rustrt::ham(); rustrt::eggs(); } diff --git a/src/test/run-pass/import-from.rs b/src/test/run-pass/import-from.rs index b42793d16df..d8314e6b0b8 100644 --- a/src/test/run-pass/import-from.rs +++ b/src/test/run-pass/import-from.rs @@ -1,11 +1,8 @@ import spam::{ham, eggs}; mod spam { - fn ham() {} - fn eggs() {} + fn ham() { } + fn eggs() { } } -fn main() { - ham(); - eggs(); -} \ No newline at end of file +fn main() { ham(); eggs(); } diff --git a/src/test/run-pass/import-glob-0.rs b/src/test/run-pass/import-glob-0.rs index e5e9ab90d0d..51144e492ce 100644 --- a/src/test/run-pass/import-glob-0.rs +++ b/src/test/run-pass/import-glob-0.rs @@ -27,4 +27,4 @@ mod dug { } -fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); } \ No newline at end of file +fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); } diff --git a/src/test/run-pass/import-glob-1.rs b/src/test/run-pass/import-glob-1.rs index 64c5a47ec17..d9c1b653217 100644 --- a/src/test/run-pass/import-glob-1.rs +++ b/src/test/run-pass/import-glob-1.rs @@ -1,40 +1,40 @@ import a1::b1::word_traveler; mod a1 { - // + // mod b1 { - // + // import a2::b1::*; - // <-\ + // <-\ export word_traveler; // | } - // | + // | mod b2 { - // | + // | import a2::b2::*; - // <-\ -\ | + // <-\ -\ | export word_traveler; // | | | } // | | | } - // | | | - // | | | - mod a2 { - // | | | - native "cdecl" mod b1 = "" { - // | | | - import a1::b2::*; - // | <-/ -/ - export word_traveler; // | - } - // | - mod b2 { - // | - fn word_traveler() { // | - log "ahoy!"; // -/ - } // - } // - } - // +// | | | +// | | | +mod a2 { + // | | | + native "cdecl" mod b1 = "" { + // | | | + import a1::b2::*; + // | <-/ -/ + export word_traveler; // | + } + // | + mod b2 { + // | + fn word_traveler() { // | + log "ahoy!"; // -/ + } // + } // +} +// -fn main() { word_traveler(); } \ No newline at end of file +fn main() { word_traveler(); } diff --git a/src/test/run-pass/import-glob-circular.rs b/src/test/run-pass/import-glob-circular.rs index bc97c7925eb..4035790b934 100644 --- a/src/test/run-pass/import-glob-circular.rs +++ b/src/test/run-pass/import-glob-circular.rs @@ -47,4 +47,4 @@ mod test2 { -fn main() { test1(); test2(); } \ No newline at end of file +fn main() { test1(); test2(); } diff --git a/src/test/run-pass/import-glob-crate.rs b/src/test/run-pass/import-glob-crate.rs index c32973fa377..fca6c1d61bd 100644 --- a/src/test/run-pass/import-glob-crate.rs +++ b/src/test/run-pass/import-glob-crate.rs @@ -4,6 +4,6 @@ import std::vec::*; fn main() { let v = init_elt(0, 0u); - v += ~[4, 2]; - assert (reversed(v) == ~[2, 4]); + v += [4, 2]; + assert (reversed(v) == [2, 4]); } diff --git a/src/test/run-pass/import.rs b/src/test/run-pass/import.rs index 31622c1fee8..ffd84fda952 100644 --- a/src/test/run-pass/import.rs +++ b/src/test/run-pass/import.rs @@ -8,4 +8,4 @@ mod bar { fn thing() { x(10); z(10); } } -fn main() { bar::thing(); } \ No newline at end of file +fn main() { bar::thing(); } diff --git a/src/test/run-pass/import2.rs b/src/test/run-pass/import2.rs index f8810e1bf4a..5b287cd7ddd 100644 --- a/src/test/run-pass/import2.rs +++ b/src/test/run-pass/import2.rs @@ -5,4 +5,4 @@ mod zed { fn bar() { log "bar"; } } -fn main() { bar(); } \ No newline at end of file +fn main() { bar(); } diff --git a/src/test/run-pass/import3.rs b/src/test/run-pass/import3.rs index 687074d55be..bd38defe405 100644 --- a/src/test/run-pass/import3.rs +++ b/src/test/run-pass/import3.rs @@ -8,4 +8,4 @@ mod baz { } } -fn main() { bar(); } \ No newline at end of file +fn main() { bar(); } diff --git a/src/test/run-pass/import6.rs b/src/test/run-pass/import6.rs index bc57537580f..33898c35a35 100644 --- a/src/test/run-pass/import6.rs +++ b/src/test/run-pass/import6.rs @@ -9,4 +9,4 @@ mod bar { import zed::baz; export baz; } -fn main() { baz(); } \ No newline at end of file +fn main() { baz(); } diff --git a/src/test/run-pass/import8.rs b/src/test/run-pass/import8.rs index ed559347824..884dcebacdf 100644 --- a/src/test/run-pass/import8.rs +++ b/src/test/run-pass/import8.rs @@ -6,4 +6,4 @@ mod foo { fn x(y: int) { log y; } } -fn main() { x(10); z(10); } \ No newline at end of file +fn main() { x(10); z(10); } diff --git a/src/test/run-pass/infer-fn-tail-expr.rs b/src/test/run-pass/infer-fn-tail-expr.rs index 9134f3a78de..4658ea4329c 100644 --- a/src/test/run-pass/infer-fn-tail-expr.rs +++ b/src/test/run-pass/infer-fn-tail-expr.rs @@ -1,5 +1,5 @@ // issue #680 -fn f() -> [int] { ~[] } +fn f() -> [int] { [] } fn main() { } diff --git a/src/test/run-pass/inner-module.rs b/src/test/run-pass/inner-module.rs index f9ef1b040de..6fcc0a79af0 100644 --- a/src/test/run-pass/inner-module.rs +++ b/src/test/run-pass/inner-module.rs @@ -9,4 +9,4 @@ mod inner { fn hello() { inner2::hello(); } } -fn main() { inner::hello(); inner::inner2::hello(); } \ No newline at end of file +fn main() { inner::hello(); inner::inner2::hello(); } diff --git a/src/test/run-pass/int.rs b/src/test/run-pass/int.rs index 2d2422d9f87..2c91b5920b7 100644 --- a/src/test/run-pass/int.rs +++ b/src/test/run-pass/int.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { let x: int = 10; } \ No newline at end of file +fn main() { let x: int = 10; } diff --git a/src/test/run-pass/integral-indexing.rs b/src/test/run-pass/integral-indexing.rs index d03963df2ed..ed17e36bcb2 100644 --- a/src/test/run-pass/integral-indexing.rs +++ b/src/test/run-pass/integral-indexing.rs @@ -3,7 +3,7 @@ // This is a testcase for issue #94. fn main() { - let v: [int] = ~[0, 1, 2, 3, 4, 5]; + let v: [int] = [0, 1, 2, 3, 4, 5]; let s: str = "abcdef"; assert (v[3u] == 3); assert (v[3u8] == 3); diff --git a/src/test/run-pass/interior-vec.rs b/src/test/run-pass/interior-vec.rs index 15186078343..4c722b3cc64 100644 --- a/src/test/run-pass/interior-vec.rs +++ b/src/test/run-pass/interior-vec.rs @@ -5,25 +5,24 @@ native "rust-intrinsic" mod rusti { } fn main() { - let v: [int] = ~[]; + let v: [int] = []; assert (ivec_len(v) == 0u); // zero-length - let x = ~[1, 2]; + let x = [1, 2]; assert (ivec_len(x) == 2u); // on stack - let y = ~[1, 2, 3, 4, 5]; + let y = [1, 2, 3, 4, 5]; assert (ivec_len(y) == 5u); // on heap - v += ~[]; + v += []; assert (ivec_len(v) == 0u); // zero-length append - x += ~[3]; + x += [3]; assert (ivec_len(x) == 3u); // on-stack append - y += ~[6, 7, 8, 9]; + y += [6, 7, 8, 9]; assert (ivec_len(y) == 9u); // on-heap append let vv = v + v; assert (ivec_len(vv) == 0u); // zero-length add - let xx = x + ~[4]; + let xx = x + [4]; assert (ivec_len(xx) == 4u); // on-stack add - let yy = y + ~[10, 11]; + let yy = y + [10, 11]; assert (ivec_len(yy) == 11u); // on-heap add } - diff --git a/src/test/run-pass/issue-506.rs b/src/test/run-pass/issue-506.rs index 3487c1a7f37..1fb76cfd62b 100644 --- a/src/test/run-pass/issue-506.rs +++ b/src/test/run-pass/issue-506.rs @@ -9,11 +9,6 @@ native "rust" mod rustrt { fn task_yield(); } -fn yield_wrap() { - rustrt::task_yield(); -} +fn yield_wrap() { rustrt::task_yield(); } -fn main() { - let f = yield_wrap; - task::_spawn(f); -} +fn main() { let f = yield_wrap; task::_spawn(f); } diff --git a/src/test/run-pass/issue-687.rs b/src/test/run-pass/issue-687.rs index 8b9fef446da..2b6c2d9938b 100644 --- a/src/test/run-pass/issue-687.rs +++ b/src/test/run-pass/issue-687.rs @@ -10,8 +10,8 @@ import std::comm::send; tag msg { closed; received([u8]); } fn producer(c: _chan<[u8]>) { - send(c, ~[1u8, 2u8, 3u8, 4u8]); - let empty: [u8] = ~[]; + send(c, [1u8, 2u8, 3u8, 4u8]); + let empty: [u8] = []; send(c, empty); } @@ -22,10 +22,7 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) { log "waiting for bytes"; let data = p.recv(); log "got bytes"; - if vec::len(data) == 0u { - log "got empty bytes, quitting"; - break; - } + if vec::len(data) == 0u { log "got empty bytes, quitting"; break; } log "sending non-empty buffer of length"; log vec::len(data); send(msg, received(data)); @@ -39,8 +36,8 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) { fn main() { let p: _port<msg> = mk_port(); let recv_reader: _port<_chan<[u8]>> = mk_port(); - let pack = task::_spawn(bind packager(recv_reader.mk_chan(), - p.mk_chan())); + let pack = + task::_spawn(bind packager(recv_reader.mk_chan(), p.mk_chan())); let source_chan: _chan<[u8]> = recv_reader.recv(); let prod = task::_spawn(bind producer(source_chan)); diff --git a/src/test/run-pass/item-attributes.rs b/src/test/run-pass/item-attributes.rs index 8d34414cc07..352fa4ac53e 100644 --- a/src/test/run-pass/item-attributes.rs +++ b/src/test/run-pass/item-attributes.rs @@ -167,7 +167,7 @@ mod test_distinguish_syntax_ext { use std; fn f() { - #fmt("test%s", "s"); + #fmt["test%s", "s"]; #[attr = "val"] fn g() { } } diff --git a/src/test/run-pass/item-name-overload.rs b/src/test/run-pass/item-name-overload.rs index 489fe8c39a3..02930d65cfa 100644 --- a/src/test/run-pass/item-name-overload.rs +++ b/src/test/run-pass/item-name-overload.rs @@ -10,4 +10,4 @@ mod bar { fn baz() { } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/ivec-add.rs b/src/test/run-pass/ivec-add.rs index 8dd2c32f86b..17b0a77d6ad 100644 --- a/src/test/run-pass/ivec-add.rs +++ b/src/test/run-pass/ivec-add.rs @@ -1,14 +1,14 @@ -fn double<T>(a: &T) -> [T] { ret ~[a] + ~[a]; } +fn double<T>(a: &T) -> [T] { ret [a] + [a]; } -fn double_int(a: int) -> [int] { ret ~[a] + ~[a]; } +fn double_int(a: int) -> [int] { ret [a] + [a]; } fn main() { let d = double(1); - assert (d.(0) == 1); - assert (d.(1) == 1); + assert (d[0] == 1); + assert (d[1] == 1); d = double_int(1); - assert (d.(0) == 1); - assert (d.(1) == 1); + assert (d[0] == 1); + assert (d[1] == 1); } diff --git a/src/test/run-pass/ivec-pass-by-value.rs b/src/test/run-pass/ivec-pass-by-value.rs index 213e1384658..557c3dc9b3e 100644 --- a/src/test/run-pass/ivec-pass-by-value.rs +++ b/src/test/run-pass/ivec-pass-by-value.rs @@ -1,3 +1,3 @@ fn f(a: [int]) { } -fn main() { f(~[1, 2, 3, 4, 5]); } +fn main() { f([1, 2, 3, 4, 5]); } diff --git a/src/test/run-pass/ivec-tag.rs b/src/test/run-pass/ivec-tag.rs index 41cc89aed7e..5efe202b66e 100644 --- a/src/test/run-pass/ivec-tag.rs +++ b/src/test/run-pass/ivec-tag.rs @@ -8,8 +8,9 @@ import std::comm::mk_port; import std::comm::send; fn producer(c: _chan<[u8]>) { - send(c, ~[1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8, - 8u8, 9u8, 10u8, 11u8, 12u8, 13u8 ]); + send(c, + [1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8, 8u8, 9u8, 10u8, 11u8, 12u8, + 13u8]); } fn main() { diff --git a/src/test/run-pass/join.rs b/src/test/run-pass/join.rs index 5545aadb1fb..91fba0bad40 100644 --- a/src/test/run-pass/join.rs +++ b/src/test/run-pass/join.rs @@ -13,4 +13,4 @@ fn main() { log_err "3"; } -fn child() { log_err "2"; } \ No newline at end of file +fn child() { log_err "2"; } diff --git a/src/test/run-pass/lambda-infer-unresolved.rs b/src/test/run-pass/lambda-infer-unresolved.rs index 921b5568b0b..7bfba99baac 100644 --- a/src/test/run-pass/lambda-infer-unresolved.rs +++ b/src/test/run-pass/lambda-infer-unresolved.rs @@ -1,7 +1,7 @@ // This should typecheck even though the type of e is not fully // resolved when we finish typechecking the lambda. fn main() { - let e = @{mutable refs: ~[], n: 0}; - let f = lambda() { log_err e.n; }; - e.refs += ~[1]; + let e = @{mutable refs: [], n: 0}; + let f = lambda () { log_err e.n; }; + e.refs += [1]; } diff --git a/src/test/run-pass/lambda-no-leak.rs b/src/test/run-pass/lambda-no-leak.rs index 183c1ae1446..0643de4bcfb 100644 --- a/src/test/run-pass/lambda-no-leak.rs +++ b/src/test/run-pass/lambda-no-leak.rs @@ -2,6 +2,6 @@ fn force(f: &fn()) { f() } fn main() { let x = 7; - lambda() { log_err x; }; - force(lambda() { log_err x; }); + lambda () { log_err x; } + force(lambda () { log_err x; }); } diff --git a/src/test/run-pass/large-records.rs b/src/test/run-pass/large-records.rs index 004e3a8c225..8c5afc031d1 100644 --- a/src/test/run-pass/large-records.rs +++ b/src/test/run-pass/large-records.rs @@ -30,4 +30,4 @@ fn f() { l: 0}; } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/run-pass/lazy-and-or.rs b/src/test/run-pass/lazy-and-or.rs index 348ce5de599..26edb631273 100644 --- a/src/test/run-pass/lazy-and-or.rs +++ b/src/test/run-pass/lazy-and-or.rs @@ -9,4 +9,4 @@ fn main() { log x || incr(y); assert (y == 10); if true && x { assert (true); } else { assert (false); } -} \ No newline at end of file +} diff --git a/src/test/run-pass/lazy-init.rs b/src/test/run-pass/lazy-init.rs index d36ad1b387f..b5f53400229 100644 --- a/src/test/run-pass/lazy-init.rs +++ b/src/test/run-pass/lazy-init.rs @@ -2,4 +2,4 @@ fn foo(x: int) { log x; } -fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); } \ No newline at end of file +fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); } diff --git a/src/test/run-pass/leak-tag-copy.rs b/src/test/run-pass/leak-tag-copy.rs index 48b11174da5..7c5eb538bc2 100644 --- a/src/test/run-pass/leak-tag-copy.rs +++ b/src/test/run-pass/leak-tag-copy.rs @@ -2,4 +2,4 @@ tag t { a; b(@int); } -fn main() { let x = b(@10); x = a; } \ No newline at end of file +fn main() { let x = b(@10); x = a; } diff --git a/src/test/run-pass/let-destruct-fresh-mem.rs b/src/test/run-pass/let-destruct-fresh-mem.rs index fa2798ecc66..9a41ef7f084 100644 --- a/src/test/run-pass/let-destruct-fresh-mem.rs +++ b/src/test/run-pass/let-destruct-fresh-mem.rs @@ -1,10 +1,10 @@ fn main() { let u = {x: 10, y: @{a: 20}}; - let {x, y: @{a}} = u; + let {x: x, y: @{a: a}} = u; x = 100; a = 100; - assert x == 100; - assert a == 100; - assert u.x == 10; - assert u.y.a == 20; + assert (x == 100); + assert (a == 100); + assert (u.x == 10); + assert (u.y.a == 20); } diff --git a/src/test/run-pass/let-destruct.rs b/src/test/run-pass/let-destruct.rs index 7d59645ff04..bdc7c6a798c 100644 --- a/src/test/run-pass/let-destruct.rs +++ b/src/test/run-pass/let-destruct.rs @@ -1,8 +1,6 @@ -tag xx { - xx(int); -} +tag xx = int; fn main() { - let @{x:xx(x), y} = @{x: xx(10), y: 20}; - assert x + y == 30; + let @{x: xx(x), y: y} = @{x: xx(10), y: 20}; + assert (x + y == 30); } diff --git a/src/test/run-pass/linear-for-loop.rs b/src/test/run-pass/linear-for-loop.rs index a36848106f6..319ce032d8d 100644 --- a/src/test/run-pass/linear-for-loop.rs +++ b/src/test/run-pass/linear-for-loop.rs @@ -1,7 +1,7 @@ fn main() { - let x = ~[1, 2, 3]; + let x = [1, 2, 3]; let y = 0; for i: int in x { log i; y += i; } log y; diff --git a/src/test/run-pass/list.rs b/src/test/run-pass/list.rs index e81c0d12fd2..272ec4b3b6f 100644 --- a/src/test/run-pass/list.rs +++ b/src/test/run-pass/list.rs @@ -4,4 +4,4 @@ // -*- rust -*- tag list { cons(int, @list); nil; } -fn main() { cons(10, @cons(11, @cons(12, @nil))); } \ No newline at end of file +fn main() { cons(10, @cons(11, @cons(12, @nil))); } diff --git a/src/test/run-pass/log-err-phi.rs b/src/test/run-pass/log-err-phi.rs index 0623daed212..0317f90573b 100644 --- a/src/test/run-pass/log-err-phi.rs +++ b/src/test/run-pass/log-err-phi.rs @@ -1,3 +1,3 @@ -fn main() { if false { log_err "foo" + "bar"; } } \ No newline at end of file +fn main() { if false { log_err "foo" + "bar"; } } diff --git a/src/test/run-pass/long-while.rs b/src/test/run-pass/long-while.rs index 59cbd10d64a..4e68287b18f 100644 --- a/src/test/run-pass/long-while.rs +++ b/src/test/run-pass/long-while.rs @@ -1,3 +1,3 @@ -fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } } \ No newline at end of file +fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } } diff --git a/src/test/run-pass/loop-scope.rs b/src/test/run-pass/loop-scope.rs index fc5618d823d..85d39ee0bbc 100644 --- a/src/test/run-pass/loop-scope.rs +++ b/src/test/run-pass/loop-scope.rs @@ -1,5 +1,5 @@ fn main() { - let x = ~[10, 20, 30]; + let x = [10, 20, 30]; let sum = 0; for x in x { sum += x; } assert (sum == 60); diff --git a/src/test/run-pass/macro-2.rs b/src/test/run-pass/macro-2.rs index 4aae975a5e9..497742e9e4f 100644 --- a/src/test/run-pass/macro-2.rs +++ b/src/test/run-pass/macro-2.rs @@ -1,5 +1,9 @@ fn main() { - #macro([#mylambda[x,body], {fn f(x: int) -> int { ret body }; f}]); + #macro[[#mylambda[x, body], + { + fn f(x: int) -> int { ret body } + f + }]]; - assert(#mylambda[y,y*2](8) == 16); -} \ No newline at end of file + assert (#mylambda[y, y * 2](8) == 16); +} diff --git a/src/test/run-pass/macro-3.rs b/src/test/run-pass/macro-3.rs index f143c4f058f..3e8de676073 100644 --- a/src/test/run-pass/macro-3.rs +++ b/src/test/run-pass/macro-3.rs @@ -1,5 +1,5 @@ fn main() { - #macro([#trivial[], 1*2*4*2*1]); + #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]]; - assert(#trivial[] == 16); + assert (#trivial[] == 16); } diff --git a/src/test/run-pass/macro-by-example-1.rs b/src/test/run-pass/macro-by-example-1.rs index 08e5c4e249f..520adef92eb 100644 --- a/src/test/run-pass/macro-by-example-1.rs +++ b/src/test/run-pass/macro-by-example-1.rs @@ -1,7 +1,7 @@ fn main() { - #macro([#apply[f, [x, ...]], f(x, ...)]); + #macro[[#apply[f, [x, ...]], f(x, ...)]]; fn add(a: int, b: int) -> int { ret a + b; } assert (#apply[add, [1, 15]] == 16); -} \ No newline at end of file +} diff --git a/src/test/run-pass/macro-by-example-2.rs b/src/test/run-pass/macro-by-example-2.rs index 58da59e2a7c..e1a7b97e888 100644 --- a/src/test/run-pass/macro-by-example-2.rs +++ b/src/test/run-pass/macro-by-example-2.rs @@ -1,6 +1,6 @@ fn main() { - #macro([#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]], - [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]); + #macro[[#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]], + [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]]; assert (#zip_or_unzip[[1, 2, 3, 4], [5, 6, 7, 8]] == @@ -9,41 +9,38 @@ fn main() { [[1, 2, 3, 4], [5, 6, 7, 8]]); - #macro([#nested[[[x, ...], ...], [[y, ...], ...]], - [[[x, y], ...], ...]]); + #macro[[#nested[[[x, ...], ...], [[y, ...], ...]], [[[x, y], ...], ...]]]; assert (#nested[[[1, 2, 3, 4, 5], [7, 8, 9, 10, 11, 12]], [[-1, -2, -3, -4, -5], [-7, -8, -9, -10, -11, -12]]] == [[[1, -1], [2, -2], [3, -3], [4, -4], [5, -5]], [[7, -7], [8, -8], [9, -9], [10, -10], [11, -11], [12, -12]]]); - #macro([#dup[y, [x, ...]], [[y, x], ...]]); + #macro[[#dup[y, [x, ...]], [[y, x], ...]]]; assert (#dup[1, [1, 2, 3, 4]] == [[1, 1], [1, 2], [1, 3], [1, 4]]); - #macro([#lambda[x, #<t>, body, #<s>], + #macro[[#lambda[x, #<t>, body, #<s>], { fn result(x: t) -> s { ret body } result - }]); + }]]; - assert ((#lambda[i, #<uint>, i + 4u, #<uint>])(12u) == 16u); + assert (#lambda[i, #<uint>, i + 4u, #<uint>](12u) == 16u); - #macro[[#sum[x, xs, ...], x + #sum[xs, ...]], - [#sum[], 0]]; + #macro[[#sum[x, xs, ...], x + #sum[xs, ...]], [#sum[], 0]]; - assert (#sum[1,2,3,4] == 10); + assert (#sum[1, 2, 3, 4] == 10); #macro[[#transcr_mixed[a, as, ...], #sum[6, as, ...] * a]]; assert (#transcr_mixed[10, 5, 4, 3, 2, 1] == 210); - #macro[[#surround[pre, [xs, ...], post], - [pre, xs, ..., post]]]; + #macro[[#surround[pre, [xs, ...], post], [pre, xs, ..., post]]]; - assert (#surround[1, [2,3,4], 5] == [1,2,3,4,5]); + assert (#surround[1, [2, 3, 4], 5] == [1, 2, 3, 4, 5]); -} \ No newline at end of file +} diff --git a/src/test/run-pass/macro.rs b/src/test/run-pass/macro.rs index 1b561e3c487..66f2ccc6a89 100644 --- a/src/test/run-pass/macro.rs +++ b/src/test/run-pass/macro.rs @@ -1,4 +1 @@ -fn main() { - #macro[[#m1[a], a*4]]; - assert (#m1[2] == 8); -} +fn main() { #macro[[#m1[a], a * 4]]; assert (#m1[2] == 8); } diff --git a/src/test/run-pass/main-ivec.rs b/src/test/run-pass/main-ivec.rs index e3d1403411b..ec2403a9151 100644 --- a/src/test/run-pass/main-ivec.rs +++ b/src/test/run-pass/main-ivec.rs @@ -1,3 +1 @@ -fn main(args: [str]) { - for s in args { log s } -} \ No newline at end of file +fn main(args: [str]) { for s in args { log s } } diff --git a/src/test/run-pass/many.rs b/src/test/run-pass/many.rs index 3413c6a3147..76cbc9fa19a 100644 --- a/src/test/run-pass/many.rs +++ b/src/test/run-pass/many.rs @@ -5,21 +5,21 @@ import std::task; import std::comm; fn sub(parent: comm::_chan<int>, id: int) { - if (id == 0) { - comm::send(parent, 0); - } else { - let p = comm::mk_port(); - let child = task::_spawn(bind sub(p.mk_chan(), id-1)); - let y = p.recv(); - comm::send(parent, y + 1); - } + if id == 0 { + comm::send(parent, 0); + } else { + let p = comm::mk_port(); + let child = task::_spawn(bind sub(p.mk_chan(), id - 1)); + let y = p.recv(); + comm::send(parent, y + 1); + } } fn main() { - let p = comm::mk_port(); - let child = task::_spawn(bind sub(p.mk_chan(), 200)); - let y = p.recv(); - log "transmission complete"; - log y; - assert (y == 200); + let p = comm::mk_port(); + let child = task::_spawn(bind sub(p.mk_chan(), 200)); + let y = p.recv(); + log "transmission complete"; + log y; + assert (y == 200); } diff --git a/src/test/run-pass/maybe-mutable.rs b/src/test/run-pass/maybe-mutable.rs index 5c941e7c477..f8436fe0717 100644 --- a/src/test/run-pass/maybe-mutable.rs +++ b/src/test/run-pass/maybe-mutable.rs @@ -9,8 +9,8 @@ fn len(v: [mutable? int]) -> uint { } fn main() { - let v0 = ~[1, 2, 3, 4, 5]; + let v0 = [1, 2, 3, 4, 5]; log len(v0); - let v1 = ~[mutable 1, 2, 3, 4, 5]; + let v1 = [mutable 1, 2, 3, 4, 5]; log len(v1); } diff --git a/src/test/run-pass/mlist.rs b/src/test/run-pass/mlist.rs index c6b8de4e400..5b5a2c3fdf0 100644 --- a/src/test/run-pass/mlist.rs +++ b/src/test/run-pass/mlist.rs @@ -1,4 +1,4 @@ // -*- rust -*- tag mlist { cons(int, @mlist); nil; } -fn main() { cons(10, @cons(11, @cons(12, @nil))); } \ No newline at end of file +fn main() { cons(10, @cons(11, @cons(12, @nil))); } diff --git a/src/test/run-pass/move-1.rs b/src/test/run-pass/move-1.rs index d0dcc0b743f..9124bd3e0a9 100644 --- a/src/test/run-pass/move-1.rs +++ b/src/test/run-pass/move-1.rs @@ -11,4 +11,4 @@ fn main() { assert (test(true, x) == 2); assert (test(true, x) == 2); assert (test(false, x) == 5); -} \ No newline at end of file +} diff --git a/src/test/run-pass/move-2.rs b/src/test/run-pass/move-2.rs index 0f36f5f2865..9309d718b15 100644 --- a/src/test/run-pass/move-2.rs +++ b/src/test/run-pass/move-2.rs @@ -1,3 +1,3 @@ -fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); } \ No newline at end of file +fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); } diff --git a/src/test/run-pass/move-4.rs b/src/test/run-pass/move-4.rs index 6fc6c6b65f5..5a104555375 100644 --- a/src/test/run-pass/move-4.rs +++ b/src/test/run-pass/move-4.rs @@ -9,4 +9,4 @@ fn test(foo: @{a: int, b: int, c: int}) -> @{a: int, b: int, c: int} { ret quux; } -fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); } \ No newline at end of file +fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); } diff --git a/src/test/run-pass/move-arg-2.rs b/src/test/run-pass/move-arg-2.rs index 07f40e403ff..9978478f177 100644 --- a/src/test/run-pass/move-arg-2.rs +++ b/src/test/run-pass/move-arg-2.rs @@ -1,12 +1,10 @@ -fn test(foo: -@[int]) { - assert (foo.(0) == 10); -} +fn test(foo: -@[int]) { assert (foo[0] == 10); } fn main() { - let x = @~[10]; + let x = @[10]; // Test forgetting a local by move-in test(x); // Test forgetting a temporary by move-in. - test(@~[10]); + test(@[10]); } diff --git a/src/test/run-pass/move-arg.rs b/src/test/run-pass/move-arg.rs index 131f69558ea..115d89e2bcd 100644 --- a/src/test/run-pass/move-arg.rs +++ b/src/test/run-pass/move-arg.rs @@ -1,8 +1,3 @@ -fn test(foo: -int) { - assert (foo == 10); -} +fn test(foo: -int) { assert (foo == 10); } -fn main() { - let x = 10; - test(x); -} \ No newline at end of file +fn main() { let x = 10; test(x); } diff --git a/src/test/run-pass/move-scalar.rs b/src/test/run-pass/move-scalar.rs index 2a2c805944e..0594ee91fe1 100644 --- a/src/test/run-pass/move-scalar.rs +++ b/src/test/run-pass/move-scalar.rs @@ -4,4 +4,4 @@ fn main() { let x: int; x <- y; assert (x == 42); -} \ No newline at end of file +} diff --git a/src/test/run-pass/multi-let.rs b/src/test/run-pass/multi-let.rs index fbc8db94bd0..ab9e6578fc6 100644 --- a/src/test/run-pass/multi-let.rs +++ b/src/test/run-pass/multi-let.rs @@ -1,4 +1 @@ -fn main() { - let x = 10, y = x; - assert (y == 10); -} \ No newline at end of file +fn main() { let x = 10, y = x; assert (y == 10); } diff --git a/src/test/run-pass/multi-src/bar.rs b/src/test/run-pass/multi-src/bar.rs index 7b52a9e089a..949a34bb1c2 100644 --- a/src/test/run-pass/multi-src/bar.rs +++ b/src/test/run-pass/multi-src/bar.rs @@ -1,3 +1,3 @@ -fn other() { log "yes"; } \ No newline at end of file +fn other() { log "yes"; } diff --git a/src/test/run-pass/multi-src/foo.rs b/src/test/run-pass/multi-src/foo.rs index 63305812ef6..2c38317bf1d 100644 --- a/src/test/run-pass/multi-src/foo.rs +++ b/src/test/run-pass/multi-src/foo.rs @@ -1,3 +1,3 @@ -fn main() { log "hello, multi-file world."; bar::other(); } \ No newline at end of file +fn main() { log "hello, multi-file world."; bar::other(); } diff --git a/src/test/run-pass/multiline-comment.rs b/src/test/run-pass/multiline-comment.rs index 90eaa93fda0..85e80ab201b 100644 --- a/src/test/run-pass/multiline-comment.rs +++ b/src/test/run-pass/multiline-comment.rs @@ -6,4 +6,4 @@ /* * This is a /* depth-balanced */ multi-line comment. */ -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/mutable-alias-vec.rs b/src/test/run-pass/mutable-alias-vec.rs index b620c2236dc..a185dfd0027 100644 --- a/src/test/run-pass/mutable-alias-vec.rs +++ b/src/test/run-pass/mutable-alias-vec.rs @@ -3,10 +3,10 @@ // -*- rust -*- use std; -fn grow(v: &mutable [int]) { v += ~[1]; } +fn grow(v: &mutable [int]) { v += [1]; } fn main() { - let v: [int] = ~[]; + let v: [int] = []; grow(v); grow(v); grow(v); diff --git a/src/test/run-pass/mutable-vec-drop.rs b/src/test/run-pass/mutable-vec-drop.rs index 58dc936083a..625bcb17f97 100644 --- a/src/test/run-pass/mutable-vec-drop.rs +++ b/src/test/run-pass/mutable-vec-drop.rs @@ -2,5 +2,5 @@ fn main() { // This just tests whether the vec leaks its members. let pvec: [mutable @{a: int, b: int}] = - ~[mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}]; + [mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}]; } diff --git a/src/test/run-pass/mutual-recursion-group.rs b/src/test/run-pass/mutual-recursion-group.rs index 732d3a27177..f21bbf1a435 100644 --- a/src/test/run-pass/mutual-recursion-group.rs +++ b/src/test/run-pass/mutual-recursion-group.rs @@ -10,4 +10,4 @@ tag list { cons(@tree, @list); nil; } tag small_list { kons(int, @small_list); neel; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/native-mod-src/inner.rs b/src/test/run-pass/native-mod-src/inner.rs index 0842fcb9f27..bee820cf3be 100644 --- a/src/test/run-pass/native-mod-src/inner.rs +++ b/src/test/run-pass/native-mod-src/inner.rs @@ -11,4 +11,4 @@ fn main() { libc.write(1, buf, 1024); libc.close(fd); libc.free(buf); -} \ No newline at end of file +} diff --git a/src/test/run-pass/native-opaque-type.rs b/src/test/run-pass/native-opaque-type.rs index fa4a5e25e5a..6ec8b4dba6a 100644 --- a/src/test/run-pass/native-opaque-type.rs +++ b/src/test/run-pass/native-opaque-type.rs @@ -4,4 +4,4 @@ native "cdecl" mod libc = "" { type file_handle; } -fn main() { assert (true); } \ No newline at end of file +fn main() { assert (true); } diff --git a/src/test/run-pass/native-src/native.rs b/src/test/run-pass/native-src/native.rs index eac66adb58a..164c55d0e9f 100644 --- a/src/test/run-pass/native-src/native.rs +++ b/src/test/run-pass/native-src/native.rs @@ -6,4 +6,4 @@ fn main() { libc.puts(rustrt.str_buf("hello, native world 1")); libc.puts(rustrt.str_buf("hello, native world 2")); libc.puts(rustrt.str_buf("hello, native world 3")); -} \ No newline at end of file +} diff --git a/src/test/run-pass/nested-obj-self.rs b/src/test/run-pass/nested-obj-self.rs index 3ed72d8d8ef..f664ef50ee2 100644 --- a/src/test/run-pass/nested-obj-self.rs +++ b/src/test/run-pass/nested-obj-self.rs @@ -25,4 +25,4 @@ fn main() { assert (s2 == "foo.m1"); let s3: str = a.m3(); assert (s3 == "bar.m1"); -} \ No newline at end of file +} diff --git a/src/test/run-pass/newtype-polymorphic.rs b/src/test/run-pass/newtype-polymorphic.rs index 637b1b8103b..fc3002ba662 100644 --- a/src/test/run-pass/newtype-polymorphic.rs +++ b/src/test/run-pass/newtype-polymorphic.rs @@ -2,11 +2,11 @@ tag myvec<X> = [X]; fn myvec_deref<X>(mv: &myvec<X>) -> [X] { ret *mv; } -fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv.(0); } +fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv[0]; } fn main() { - let mv = myvec(~[1, 2, 3]); - assert (myvec_deref(mv).(1) == 2); + let mv = myvec([1, 2, 3]); + assert (myvec_deref(mv)[1] == 2); assert (myvec_elt(mv) == 1); - assert (mv.(2) == 3); + assert (mv[2] == 3); } diff --git a/src/test/run-pass/newtype.rs b/src/test/run-pass/newtype.rs index b0e67f4121f..0b0a8c7b2d9 100644 --- a/src/test/run-pass/newtype.rs +++ b/src/test/run-pass/newtype.rs @@ -1,8 +1,8 @@ -tag mytype = {compute: fn(&mytype) -> int , val: int}; +tag mytype = {compute: fn(&mytype) -> int, val: int}; fn compute(i: &mytype) -> int { ret i.val + 20; } fn main() { let myval = mytype({compute: compute, val: 30}); assert (myval.compute(myval) == 50); -} \ No newline at end of file +} diff --git a/src/test/run-pass/nil-pattern.rs b/src/test/run-pass/nil-pattern.rs index af499adee57..927ff5be3e5 100644 --- a/src/test/run-pass/nil-pattern.rs +++ b/src/test/run-pass/nil-pattern.rs @@ -1 +1 @@ -fn main() { let x = (); alt x { () { } } } \ No newline at end of file +fn main() { let x = (); alt x { () { } } } diff --git a/src/test/run-pass/obj-docs.rs b/src/test/run-pass/obj-docs.rs index cdda794acff..de5a91e886b 100644 --- a/src/test/run-pass/obj-docs.rs +++ b/src/test/run-pass/obj-docs.rs @@ -9,55 +9,42 @@ fn main() { // Ref.Item.Obj obj counter(state: @mutable int) { - fn incr() { - *state += 1; - } - fn get() -> int { - ret *state; - } - } + fn incr() { *state += 1; } + fn get() -> int { ret *state; } + } let c: counter = counter(@mutable 1); c.incr(); c.incr(); - assert c.get() == 3; + assert (c.get() == 3); obj my_obj() { - fn get() -> int { - ret 3; - } - fn foo() -> int{ + fn get() -> int { ret 3; } + fn foo() -> int { let c = self.get(); ret c + 2; // returns 5 } } let o = my_obj(); - assert o.foo() == 5; + assert (o.foo() == 5); // Ref.Type.Obj - type taker = obj { - fn take(int); - }; + type taker = + obj { + fn take(int); + }; obj adder(x: @mutable int) { - fn take(y: int) { - *x += y; - } + fn take(y: int) { *x += y; } } obj sender(c: _chan<int>) { - fn take(z: int) { - send(c, z); - } + fn take(z: int) { send(c, z); } } - fn give_ints(t: taker) { - t.take(1); - t.take(2); - t.take(3); - } + fn give_ints(t: taker) { t.take(1); t.take(2); t.take(3); } let p = mk_port::<int>(); diff --git a/src/test/run-pass/obj-drop.rs b/src/test/run-pass/obj-drop.rs index b807fe3dcfc..a823784e1b0 100644 --- a/src/test/run-pass/obj-drop.rs +++ b/src/test/run-pass/obj-drop.rs @@ -5,4 +5,4 @@ fn main() { // This just tests whether the obj leaks its box state members. let ob = handle(@0xf00f00); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-recursion.rs b/src/test/run-pass/obj-recursion.rs index 7110683d9d1..3c4346af32e 100644 --- a/src/test/run-pass/obj-recursion.rs +++ b/src/test/run-pass/obj-recursion.rs @@ -2,7 +2,7 @@ type adder = obj { - fn add() ; + fn add(); }; obj leaf_adder(x: int) { @@ -16,4 +16,4 @@ obj delegate_adder(a: adder) { fn main() { let x = delegate_adder(delegate_adder(delegate_adder(leaf_adder(10)))); x.add(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-self-2.rs b/src/test/run-pass/obj-self-2.rs index 8b0dd4b1595..ca33b382792 100644 --- a/src/test/run-pass/obj-self-2.rs +++ b/src/test/run-pass/obj-self-2.rs @@ -9,4 +9,4 @@ fn main() { let i: int = 0; a.m1(i); a.m2(i); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-self-3.rs b/src/test/run-pass/obj-self-3.rs index fcee2e1a087..29720216bd1 100644 --- a/src/test/run-pass/obj-self-3.rs +++ b/src/test/run-pass/obj-self-3.rs @@ -14,4 +14,4 @@ fn main() { assert (i == 2); i = a.m3(i); assert (i == 4); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-self-4.rs b/src/test/run-pass/obj-self-4.rs index 8c52593faa9..e13a39f0998 100644 --- a/src/test/run-pass/obj-self-4.rs +++ b/src/test/run-pass/obj-self-4.rs @@ -19,4 +19,4 @@ fn main() { assert (rs == 8); rs = o.get(); assert (rs == 8); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-self.rs b/src/test/run-pass/obj-self.rs index 6e293fc344a..c6a1b141558 100644 --- a/src/test/run-pass/obj-self.rs +++ b/src/test/run-pass/obj-self.rs @@ -8,4 +8,4 @@ fn main() { let a = foo(); a.m1(); a.m2(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/obj-with-vec.rs b/src/test/run-pass/obj-with-vec.rs index db4050aaf94..1ce8cbc46bf 100644 --- a/src/test/run-pass/obj-with-vec.rs +++ b/src/test/run-pass/obj-with-vec.rs @@ -2,9 +2,9 @@ fn main() { obj buf(data: [u8]) { - fn get(i: int) -> u8 { ret data.(i); } + fn get(i: int) -> u8 { ret data[i]; } } - let b = buf(~[1 as u8, 2 as u8, 3 as u8]); + let b = buf([1 as u8, 2 as u8, 3 as u8]); log b.get(1); assert (b.get(1) == 2 as u8); } diff --git a/src/test/run-pass/opeq.rs b/src/test/run-pass/opeq.rs index 03576541d47..b38a6313f54 100644 --- a/src/test/run-pass/opeq.rs +++ b/src/test/run-pass/opeq.rs @@ -16,4 +16,4 @@ fn main() { x /= 5; log x; assert (x == 5); -} \ No newline at end of file +} diff --git a/src/test/run-pass/operator-associativity.rs b/src/test/run-pass/operator-associativity.rs index 624d431b45a..af8c3ee6228 100644 --- a/src/test/run-pass/operator-associativity.rs +++ b/src/test/run-pass/operator-associativity.rs @@ -2,4 +2,4 @@ // Testcase for issue #130, operator associativity. -fn main() { assert (3 * 5 / 2 == 7); } \ No newline at end of file +fn main() { assert (3 * 5 / 2 == 7); } diff --git a/src/test/run-pass/or-pattern.rs b/src/test/run-pass/or-pattern.rs index 498a6777d9c..99682e0977a 100644 --- a/src/test/run-pass/or-pattern.rs +++ b/src/test/run-pass/or-pattern.rs @@ -8,4 +8,4 @@ fn main() { assert (or_alt(c) == 0); assert (or_alt(a(10, 100, 0u)) == 110); assert (or_alt(b(20, 200)) == 220); -} \ No newline at end of file +} diff --git a/src/test/run-pass/output-slot-variants.rs b/src/test/run-pass/output-slot-variants.rs index fe318ec539c..41d5b2871b3 100644 --- a/src/test/run-pass/output-slot-variants.rs +++ b/src/test/run-pass/output-slot-variants.rs @@ -55,4 +55,4 @@ fn main() { ext_ext_mem = ret_ext_ext_mem(); // non-initializing -} \ No newline at end of file +} diff --git a/src/test/run-pass/over-constrained-vregs.rs b/src/test/run-pass/over-constrained-vregs.rs index 29840986793..98f4ab7a6d8 100644 --- a/src/test/run-pass/over-constrained-vregs.rs +++ b/src/test/run-pass/over-constrained-vregs.rs @@ -2,4 +2,4 @@ // Regression test for issue #152. -fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } } \ No newline at end of file +fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } } diff --git a/src/test/run-pass/paren-free.rs b/src/test/run-pass/paren-free.rs index cde723b835b..4d48c09175a 100644 --- a/src/test/run-pass/paren-free.rs +++ b/src/test/run-pass/paren-free.rs @@ -2,4 +2,4 @@ fn main() { let x = true; if x { let i = 10; while i > 0 { i -= 1; } } alt x { true { log "right"; } false { log "wrong"; } } -} \ No newline at end of file +} diff --git a/src/test/run-pass/parse-fail.rs b/src/test/run-pass/parse-fail.rs index 3d7b372b9b4..0b4e959c9ee 100644 --- a/src/test/run-pass/parse-fail.rs +++ b/src/test/run-pass/parse-fail.rs @@ -4,4 +4,4 @@ // -*- rust -*- fn dont_call_me() { fail; log 1; } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/polymorphic-iter.rs b/src/test/run-pass/polymorphic-iter.rs index 46d3705649e..4f23b58f268 100644 --- a/src/test/run-pass/polymorphic-iter.rs +++ b/src/test/run-pass/polymorphic-iter.rs @@ -1,4 +1,2 @@ iter iter2<@T>() -> T { } -fn main() { - for each i: int in iter2() { } -} +fn main() { for each i: int in iter2() { } } diff --git a/src/test/run-pass/pred-check.rs b/src/test/run-pass/pred-check.rs index 4f7d6e92ec9..12b1ff5ed73 100644 --- a/src/test/run-pass/pred-check.rs +++ b/src/test/run-pass/pred-check.rs @@ -1,4 +1,4 @@ // -*- rust -*- pred f(q: int) -> bool { ret true; } -fn main() { let x = 0; check (f(x)); } \ No newline at end of file +fn main() { let x = 0; check (f(x)); } diff --git a/src/test/run-pass/pred.rs b/src/test/run-pass/pred.rs index e1ddf1c2ece..5c9a56c904c 100644 --- a/src/test/run-pass/pred.rs +++ b/src/test/run-pass/pred.rs @@ -11,4 +11,4 @@ fn main() { check (lt(a, c)); f(a, b); f(a, c); -} \ No newline at end of file +} diff --git a/src/test/run-pass/readalias.rs b/src/test/run-pass/readalias.rs index 451aa290fa5..93b8b22aef5 100644 --- a/src/test/run-pass/readalias.rs +++ b/src/test/run-pass/readalias.rs @@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int}; fn f(p: &point) { assert (p.z == 12); } -fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); } \ No newline at end of file +fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); } diff --git a/src/test/run-pass/rebind-fn.rs b/src/test/run-pass/rebind-fn.rs index b10054de0cd..62d3ca16d11 100644 --- a/src/test/run-pass/rebind-fn.rs +++ b/src/test/run-pass/rebind-fn.rs @@ -1,11 +1,8 @@ fn add(i: int, j: int) -> int { ret i + j; } -fn binder(n: int) -> fn() -> int { - let f = bind add(n, _); - ret bind f(2); -} +fn binder(n: int) -> fn() -> int { let f = bind add(n, _); ret bind f(2); } fn main() { binder(5); let f = binder(1); - assert(f() == 3); - assert(binder(8)() == 10); + assert (f() == 3); + assert (binder(8)() == 10); } diff --git a/src/test/run-pass/rec-auto.rs b/src/test/run-pass/rec-auto.rs index 4162bebfb92..c23c359d621 100644 --- a/src/test/run-pass/rec-auto.rs +++ b/src/test/run-pass/rec-auto.rs @@ -4,4 +4,4 @@ // -*- rust -*- // Issue #50. -fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; } \ No newline at end of file +fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; } diff --git a/src/test/run-pass/rec-extend.rs b/src/test/run-pass/rec-extend.rs index 6b307107ab0..cd0d089d28a 100644 --- a/src/test/run-pass/rec-extend.rs +++ b/src/test/run-pass/rec-extend.rs @@ -14,4 +14,4 @@ fn main() { assert (right.y == 0); assert (up.x == 0); assert (up.y == 10); -} \ No newline at end of file +} diff --git a/src/test/run-pass/rec-tup.rs b/src/test/run-pass/rec-tup.rs index e1656bf17b8..66cf866de9d 100644 --- a/src/test/run-pass/rec-tup.rs +++ b/src/test/run-pass/rec-tup.rs @@ -3,14 +3,8 @@ type point = {x: int, y: int}; type rect = (point, point); -fn fst(r: &rect) -> point { - let (fst, _) = r; - ret fst; -} -fn snd(r: &rect) -> point { - let (_, snd) = r; - ret snd; -} +fn fst(r: &rect) -> point { let (fst, _) = r; ret fst; } +fn snd(r: &rect) -> point { let (_, snd) = r; ret snd; } fn f(r: rect, x1: int, y1: int, x2: int, y2: int) { assert (fst(r).x == x1); diff --git a/src/test/run-pass/rec.rs b/src/test/run-pass/rec.rs index b7a3f3a6d84..04867f72fa8 100644 --- a/src/test/run-pass/rec.rs +++ b/src/test/run-pass/rec.rs @@ -22,4 +22,4 @@ fn main() { assert (x == 10); f(r, 10, 20, 100, 200); f(r2, 10, 20, 100, 200); -} \ No newline at end of file +} diff --git a/src/test/run-pass/record-pat.rs b/src/test/run-pass/record-pat.rs index 794a1a9ee04..f2f4c6af2c7 100644 --- a/src/test/run-pass/record-pat.rs +++ b/src/test/run-pass/record-pat.rs @@ -12,4 +12,4 @@ fn m(in: &t3) -> int { fn main() { assert (m(c({x: a(10), y: 5}, 4u)) == 10); assert (m(c({x: b(10u), y: 5}, 4u)) == 19); -} \ No newline at end of file +} diff --git a/src/test/run-pass/resource-destruct.rs b/src/test/run-pass/resource-destruct.rs index 8d6d85899b1..25a3c79e1c3 100644 --- a/src/test/run-pass/resource-destruct.rs +++ b/src/test/run-pass/resource-destruct.rs @@ -6,4 +6,4 @@ fn main() { let my_total = @mutable 10; { let pt <- shrinky_pointer(my_total); assert (look_at(pt) == 10); } assert (*my_total == 9); -} \ No newline at end of file +} diff --git a/src/test/run-pass/resource-generic.rs b/src/test/run-pass/resource-generic.rs index 6ab2eb308b6..34ecc55f2e4 100644 --- a/src/test/run-pass/resource-generic.rs +++ b/src/test/run-pass/resource-generic.rs @@ -1,4 +1,4 @@ -resource finish<T>(arg: {val: T, fin: fn(&T) }) { arg.fin(arg.val); } +resource finish<T>(arg: {val: T, fin: fn(&T)}) { arg.fin(arg.val); } fn main() { let box = @mutable 10; diff --git a/src/test/run-pass/resource-in-struct.rs b/src/test/run-pass/resource-in-struct.rs index 6e7e8dc6bfd..758beb3d9e1 100644 --- a/src/test/run-pass/resource-in-struct.rs +++ b/src/test/run-pass/resource-in-struct.rs @@ -3,17 +3,15 @@ type closable = @mutable bool; -resource close_res(i: closable) { - *i = false; -} +resource close_res(i: closable) { *i = false; } tag option<T> { none; some(T); } -fn sink(res: option<close_res>) {} +fn sink(res: option<close_res>) { } fn main() { let c = @mutable true; sink(none); sink(some(close_res(c))); - assert !*c; + assert (!*c); } diff --git a/src/test/run-pass/ret-bang.rs b/src/test/run-pass/ret-bang.rs index e668ff9b0bc..55a4c5922c3 100644 --- a/src/test/run-pass/ret-bang.rs +++ b/src/test/run-pass/ret-bang.rs @@ -8,4 +8,4 @@ fn okay(i: uint) -> int { if i == 3u { my_err("I don't like three"); } else { ret 42; } } -fn main() { okay(4u); } \ No newline at end of file +fn main() { okay(4u); } diff --git a/src/test/run-pass/return-nil.rs b/src/test/run-pass/return-nil.rs index 6e7b9d8b048..a7a55e60971 100644 --- a/src/test/run-pass/return-nil.rs +++ b/src/test/run-pass/return-nil.rs @@ -2,4 +2,4 @@ fn f() { let x: () = (); ret x; } -fn main() { let x = f(); } \ No newline at end of file +fn main() { let x = f(); } diff --git a/src/test/run-pass/rt-circular-buffer.rs b/src/test/run-pass/rt-circular-buffer.rs index 4a6839a8de5..0d84d1abe64 100644 --- a/src/test/run-pass/rt-circular-buffer.rs +++ b/src/test/run-pass/rt-circular-buffer.rs @@ -30,7 +30,7 @@ fn test_init() { fn test_grow() { let myport: comm::_port<record> = comm::mk_port(); let mychan = myport.mk_chan(); - for each i: uint in uint::range(0u, 100u) { + for each i: uint in uint::range(0u, 100u) { let val: record = {val1: 0u32, val2: 0u32, val3: 0u32}; comm::send(mychan, val); } @@ -48,11 +48,11 @@ fn test_shrink1() { fn test_shrink2() { let myport = mk_port::<record>(); let mychan = myport.mk_chan(); - for each i: uint in uint::range(0u, 100u) { + for each i: uint in uint::range(0u, 100u) { let val: record = {val1: 0u32, val2: 0u32, val3: 0u32}; send(mychan, val); } - for each i: uint in uint::range(0u, 100u) { let x = myport.recv(); } + for each i: uint in uint::range(0u, 100u) { let x = myport.recv(); } } @@ -60,7 +60,7 @@ fn test_shrink2() { fn test_rotate() { let myport = mk_port::<record>(); let mychan = myport.mk_chan(); - for each i: uint in uint::range(0u, 100u) { + for each i: uint in uint::range(0u, 100u) { let val = {val1: i as u32, val2: i as u32, val3: i as u32}; send(mychan, val); let x = myport.recv(); @@ -76,13 +76,13 @@ fn test_rotate() { fn test_rotate_grow() { let myport = mk_port::<record>(); let mychan = myport.mk_chan(); - for each j: uint in uint::range(0u, 10u) { - for each i: uint in uint::range(0u, 10u) { + for each j: uint in uint::range(0u, 10u) { + for each i: uint in uint::range(0u, 10u) { let val: record = {val1: i as u32, val2: i as u32, val3: i as u32}; send(mychan, val); } - for each i: uint in uint::range(0u, 10u) { + for each i: uint in uint::range(0u, 10u) { let x = myport.recv(); assert (x.val1 == i as u32); assert (x.val2 == i as u32); diff --git a/src/test/run-pass/self-shadowing-import.rs b/src/test/run-pass/self-shadowing-import.rs index c9b70d35d46..7887990f080 100644 --- a/src/test/run-pass/self-shadowing-import.rs +++ b/src/test/run-pass/self-shadowing-import.rs @@ -11,4 +11,4 @@ mod c { fn bar() { assert (a::foo() == 1); } } -fn main() { c::bar(); } \ No newline at end of file +fn main() { c::bar(); } diff --git a/src/test/run-pass/seq-compare.rs b/src/test/run-pass/seq-compare.rs index 265c45a101d..79a318eefd2 100644 --- a/src/test/run-pass/seq-compare.rs +++ b/src/test/run-pass/seq-compare.rs @@ -4,13 +4,13 @@ fn main() { assert ("hello" < "hellr"); assert ("hello " > "hello"); assert ("hello" != "there"); - assert (~[1, 2, 3, 4] > ~[1, 2, 3]); - assert (~[1, 2, 3] < ~[1, 2, 3, 4]); - assert (~[1, 2, 4, 4] > ~[1, 2, 3, 4]); - assert (~[1, 2, 3, 4] < ~[1, 2, 4, 4]); - assert (~[1, 2, 3] <= ~[1, 2, 3]); - assert (~[1, 2, 3] <= ~[1, 2, 3, 3]); - assert (~[1, 2, 3, 4] > ~[1, 2, 3]); - assert (~[1, 2, 3] == ~[1, 2, 3]); - assert (~[1, 2, 3] != ~[1, 1, 3]); -} \ No newline at end of file + assert ([1, 2, 3, 4] > [1, 2, 3]); + assert ([1, 2, 3] < [1, 2, 3, 4]); + assert ([1, 2, 4, 4] > [1, 2, 3, 4]); + assert ([1, 2, 3, 4] < [1, 2, 4, 4]); + assert ([1, 2, 3] <= [1, 2, 3]); + assert ([1, 2, 3] <= [1, 2, 3, 3]); + assert ([1, 2, 3, 4] > [1, 2, 3]); + assert ([1, 2, 3] == [1, 2, 3]); + assert ([1, 2, 3] != [1, 1, 3]); +} diff --git a/src/test/run-pass/shadow.rs b/src/test/run-pass/shadow.rs index e3f86246594..3fc3a015915 100644 --- a/src/test/run-pass/shadow.rs +++ b/src/test/run-pass/shadow.rs @@ -1,20 +1,15 @@ // -*- rust -*- fn foo(c: [int]) { let a: int = 5; - let b: [int] = ~[]; + let b: [int] = []; alt none::<int> { - some::<int>(_) { for i: int in c { log a; let a = 17; b += ~[a]; } } - _ {} + some::<int>(_) { for i: int in c { log a; let a = 17; b += [a]; } } + _ { } } } tag t<T> { none; some(T); } -fn main() { - let x = 10; - let x = x + 20; - assert x == 30; - foo(~[]); -} +fn main() { let x = 10; let x = x + 20; assert (x == 30); foo([]); } diff --git a/src/test/run-pass/simple-alt-generic-tag.rs b/src/test/run-pass/simple-alt-generic-tag.rs index 39a9619b1c6..ac0e5ed6994 100644 --- a/src/test/run-pass/simple-alt-generic-tag.rs +++ b/src/test/run-pass/simple-alt-generic-tag.rs @@ -3,5 +3,6 @@ tag opt<T> { none; } fn main() { - let x = none::<int>; alt x { none::<int>. { log "hello world"; } } + let x = none::<int>; + alt x { none::<int>. { log "hello world"; } } } diff --git a/src/test/run-pass/simple-anon-objs.rs b/src/test/run-pass/simple-anon-objs.rs index 8525ea8c8a3..5c2315d67d0 100644 --- a/src/test/run-pass/simple-anon-objs.rs +++ b/src/test/run-pass/simple-anon-objs.rs @@ -26,4 +26,4 @@ fn main() { assert (another_anon_obj.baz() == 4); -} \ No newline at end of file +} diff --git a/src/test/run-pass/simple-infer.rs b/src/test/run-pass/simple-infer.rs index 6cf8df90222..03656fc8c1b 100644 --- a/src/test/run-pass/simple-infer.rs +++ b/src/test/run-pass/simple-infer.rs @@ -1,3 +1,3 @@ -fn main() { let n; n = 1; log n; } \ No newline at end of file +fn main() { let n; n = 1; log n; } diff --git a/src/test/run-pass/simple-obj.rs b/src/test/run-pass/simple-obj.rs index 1133cdc7630..6cb4caafe16 100644 --- a/src/test/run-pass/simple-obj.rs +++ b/src/test/run-pass/simple-obj.rs @@ -6,4 +6,4 @@ obj x() { fn hello() { log "hello, object world"; } } -fn main() { let mx = x(); mx.hello(); } \ No newline at end of file +fn main() { let mx = x(); mx.hello(); } diff --git a/src/test/run-pass/size-and-align.rs b/src/test/run-pass/size-and-align.rs index 8628e359ccb..929ce3500f1 100644 --- a/src/test/run-pass/size-and-align.rs +++ b/src/test/run-pass/size-and-align.rs @@ -5,13 +5,13 @@ tag clam<T> { a(T, int); b; } fn uhoh<T>(v: &[clam<T>]) { - alt v.(1) { + alt v[1] { a::<T>(t, u) { log "incorrect"; log u; fail; } b::<T>. { log "correct"; } } } fn main() { - let v: [clam<int>] = ~[b::<int>, b::<int>, a::<int>(42, 17)]; + let v: [clam<int>] = [b::<int>, b::<int>, a::<int>(42, 17)]; uhoh::<int>(v); } diff --git a/src/test/run-pass/spawn-fn.rs b/src/test/run-pass/spawn-fn.rs index 26495c4a085..03d450a9cfa 100644 --- a/src/test/run-pass/spawn-fn.rs +++ b/src/test/run-pass/spawn-fn.rs @@ -12,4 +12,4 @@ fn main() { task::_spawn(bind x("hello from third spawned fn", 67)); let i: int = 30; while i > 0 { i = i - 1; log "parent sleeping"; yield(); } -} \ No newline at end of file +} diff --git a/src/test/run-pass/spawn-module-qualified.rs b/src/test/run-pass/spawn-module-qualified.rs index 46d0dfee616..f1d1a099ef2 100644 --- a/src/test/run-pass/spawn-module-qualified.rs +++ b/src/test/run-pass/spawn-module-qualified.rs @@ -2,12 +2,7 @@ use std; import std::task::join_id; import std::task::_spawn; -fn main() { - let x = _spawn(bind m::child(10)); - join_id(x); -} +fn main() { let x = _spawn(bind m::child(10)); join_id(x); } mod m { - fn child(i: int) { - log i; - } + fn child(i: int) { log i; } } diff --git a/src/test/run-pass/spawn.rs b/src/test/run-pass/spawn.rs index 1ef82f24a2d..29126d85018 100644 --- a/src/test/run-pass/spawn.rs +++ b/src/test/run-pass/spawn.rs @@ -4,10 +4,7 @@ use std; import std::task; -fn main() { - let t = task::_spawn(bind child(10)); - task::join_id(t); -} +fn main() { let t = task::_spawn(bind child(10)); task::join_id(t); } fn child(i: int) { log_err i; assert (i == 10); } diff --git a/src/test/run-pass/standalone-method.rs b/src/test/run-pass/standalone-method.rs index 3fe6763bf97..e9768339433 100644 --- a/src/test/run-pass/standalone-method.rs +++ b/src/test/run-pass/standalone-method.rs @@ -1,22 +1,18 @@ // Test case for issue #435. obj foo() { - fn add5(n: int) -> int { - ret n + 5; - } + fn add5(n: int) -> int { ret n + 5; } } -fn add5(n: int) -> int { - ret n + 5; -} +fn add5(n: int) -> int { ret n + 5; } fn main() { let fiveplusseven = bind add5(7); - assert add5(7) == 12; - assert fiveplusseven() == 12; + assert (add5(7) == 12); + assert (fiveplusseven() == 12); let my_foo = foo(); let fiveplusseven_too = bind my_foo.add5(7); - assert my_foo.add5(7) == 12; - assert fiveplusseven_too() == 12; + assert (my_foo.add5(7) == 12); + assert (fiveplusseven_too() == 12); } diff --git a/src/test/run-pass/stateful-obj.rs b/src/test/run-pass/stateful-obj.rs index 7e3fa5602b4..97160244d16 100644 --- a/src/test/run-pass/stateful-obj.rs +++ b/src/test/run-pass/stateful-obj.rs @@ -16,4 +16,4 @@ fn main() { y.incr(); log y.get(); assert (y.get() == 2); -} \ No newline at end of file +} diff --git a/src/test/run-pass/str-append.rs b/src/test/run-pass/str-append.rs index a27f729fe5d..e1fa92738cb 100644 --- a/src/test/run-pass/str-append.rs +++ b/src/test/run-pass/str-append.rs @@ -8,7 +8,7 @@ fn test1() { let s: str = "hello"; s += "world"; log s; - assert (s.(9) == 'd' as u8); + assert (s[9] == 'd' as u8); } fn test2() { @@ -23,4 +23,4 @@ fn test2() { assert (str::eq(b, "ABCabcABC")); } -fn main() { test1(); test2(); } \ No newline at end of file +fn main() { test1(); test2(); } diff --git a/src/test/run-pass/str-concat.rs b/src/test/run-pass/str-concat.rs index 57c0525cfd3..8fc48725875 100644 --- a/src/test/run-pass/str-concat.rs +++ b/src/test/run-pass/str-concat.rs @@ -7,5 +7,5 @@ fn main() { let b: str = "world"; let s: str = a + b; log s; - assert (s.(9) == 'd' as u8); -} \ No newline at end of file + assert (s[9] == 'd' as u8); +} diff --git a/src/test/run-pass/str-growth.rs b/src/test/run-pass/str-growth.rs index 35d29fec65a..5c0d34b3501 100644 --- a/src/test/run-pass/str-growth.rs +++ b/src/test/run-pass/str-growth.rs @@ -3,12 +3,12 @@ fn main() { let s = "a"; s += "b"; - assert (s.(0) == 'a' as u8); - assert (s.(1) == 'b' as u8); + assert (s[0] == 'a' as u8); + assert (s[1] == 'b' as u8); s += "c"; s += "d"; - assert (s.(0) == 'a' as u8); - assert (s.(1) == 'b' as u8); - assert (s.(2) == 'c' as u8); - assert (s.(3) == 'd' as u8); -} \ No newline at end of file + assert (s[0] == 'a' as u8); + assert (s[1] == 'b' as u8); + assert (s[2] == 'c' as u8); + assert (s[3] == 'd' as u8); +} diff --git a/src/test/run-pass/str-idx.rs b/src/test/run-pass/str-idx.rs index 0c619a213fa..4b5ea5f7961 100644 --- a/src/test/run-pass/str-idx.rs +++ b/src/test/run-pass/str-idx.rs @@ -5,4 +5,4 @@ fn main() { let c: u8 = s[4]; log c; assert (c == 0x6f as u8); -} \ No newline at end of file +} diff --git a/src/test/run-pass/str-multiline.rs b/src/test/run-pass/str-multiline.rs index 45d6ad632ba..15a13083321 100644 --- a/src/test/run-pass/str-multiline.rs +++ b/src/test/run-pass/str-multiline.rs @@ -14,4 +14,4 @@ is a test"; test"; assert (str::eq(a, "this is a test")); assert (str::eq(b, "this is another test")); -} \ No newline at end of file +} diff --git a/src/test/run-pass/string-self-append.rs b/src/test/run-pass/string-self-append.rs index 3b15df94ce4..94a9696adf0 100644 --- a/src/test/run-pass/string-self-append.rs +++ b/src/test/run-pass/string-self-append.rs @@ -13,4 +13,4 @@ fn main() { i -= 1; expected_len *= 2u; } -} \ No newline at end of file +} diff --git a/src/test/run-pass/structured-compare-recursive.rs b/src/test/run-pass/structured-compare-recursive.rs index bc8bb76a480..cee650ed40e 100644 --- a/src/test/run-pass/structured-compare-recursive.rs +++ b/src/test/run-pass/structured-compare-recursive.rs @@ -2,4 +2,4 @@ tag taggy { foo(@taggy); bar; } -fn main() { assert (bar <= bar); } \ No newline at end of file +fn main() { assert (bar <= bar); } diff --git a/src/test/run-pass/structured-compare.rs b/src/test/run-pass/structured-compare.rs index e2d95a54575..04bc1d75da8 100644 --- a/src/test/run-pass/structured-compare.rs +++ b/src/test/run-pass/structured-compare.rs @@ -16,4 +16,4 @@ fn main() { assert (x != y); assert (x == large); assert (x != small); -} \ No newline at end of file +} diff --git a/src/test/run-pass/swap-1.rs b/src/test/run-pass/swap-1.rs index 62b557eba63..c9fc58a93aa 100644 --- a/src/test/run-pass/swap-1.rs +++ b/src/test/run-pass/swap-1.rs @@ -1 +1 @@ -fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); } \ No newline at end of file +fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); } diff --git a/src/test/run-pass/swap-2.rs b/src/test/run-pass/swap-2.rs index 155d71399e5..5caf36f9b92 100644 --- a/src/test/run-pass/swap-2.rs +++ b/src/test/run-pass/swap-2.rs @@ -1,12 +1,12 @@ -fn swap<@T>(v: &[mutable T], i: int, j: int) { v.(i) <-> v.(j); } +fn swap<@T>(v: &[mutable T], i: int, j: int) { v[i] <-> v[j]; } fn main() { - let a: [mutable int] = ~[mutable 0, 1, 2, 3, 4, 5, 6]; + let a: [mutable int] = [mutable 0, 1, 2, 3, 4, 5, 6]; swap(a, 2, 4); - assert (a.(2) == 4); - assert (a.(4) == 2); + assert (a[2] == 4); + assert (a[4] == 2); let n = 42; - n <-> a.(0); - assert (a.(0) == 42); + n <-> a[0]; + assert (a[0] == 42); assert (n == 0); } diff --git a/src/test/run-pass/syntax-extension-fmt.rs b/src/test/run-pass/syntax-extension-fmt.rs index 22033e2acf2..c241a68e7f1 100644 --- a/src/test/run-pass/syntax-extension-fmt.rs +++ b/src/test/run-pass/syntax-extension-fmt.rs @@ -8,10 +8,10 @@ fn test(actual: str, expected: str) { } fn main() { - test(#fmt("hello %d friends and %s things", 10, "formatted"), + test(#fmt["hello %d friends and %s things", 10, "formatted"], "hello 10 friends and formatted things"); - test(#fmt("test"), "test"); + test(#fmt["test"], "test"); // a quadratic optimization in LLVM (jump-threading) makes this test a // bit slow to compile unless we break it up @@ -26,192 +26,192 @@ fn main() { fn part1() { // Simple tests for types - test(#fmt("%d", 1), "1"); - test(#fmt("%i", 2), "2"); - test(#fmt("%i", -1), "-1"); - test(#fmt("%u", 10u), "10"); - test(#fmt("%s", "test"), "test"); - test(#fmt("%b", true), "true"); - test(#fmt("%b", false), "false"); - test(#fmt("%c", 'A'), "A"); - test(#fmt("%x", 0xff_u), "ff"); - test(#fmt("%X", 0x12ab_u), "12AB"); - test(#fmt("%o", 10u), "12"); - test(#fmt("%t", 0b11010101_u), "11010101"); + test(#fmt["%d", 1], "1"); + test(#fmt["%i", 2], "2"); + test(#fmt["%i", -1], "-1"); + test(#fmt["%u", 10u], "10"); + test(#fmt["%s", "test"], "test"); + test(#fmt["%b", true], "true"); + test(#fmt["%b", false], "false"); + test(#fmt["%c", 'A'], "A"); + test(#fmt["%x", 0xff_u], "ff"); + test(#fmt["%X", 0x12ab_u], "12AB"); + test(#fmt["%o", 10u], "12"); + test(#fmt["%t", 0b11010101_u], "11010101"); // 32-bit limits - test(#fmt("%i", -2147483648), "-2147483648"); - test(#fmt("%i", 2147483647), "2147483647"); - test(#fmt("%u", 4294967295u), "4294967295"); - test(#fmt("%x", 0xffffffff_u), "ffffffff"); - test(#fmt("%o", 0xffffffff_u), "37777777777"); - test(#fmt("%t", 0xffffffff_u), "11111111111111111111111111111111"); + test(#fmt["%i", -2147483648], "-2147483648"); + test(#fmt["%i", 2147483647], "2147483647"); + test(#fmt["%u", 4294967295u], "4294967295"); + test(#fmt["%x", 0xffffffff_u], "ffffffff"); + test(#fmt["%o", 0xffffffff_u], "37777777777"); + test(#fmt["%t", 0xffffffff_u], "11111111111111111111111111111111"); } fn part2() { // Widths - test(#fmt("%1d", 500), "500"); - test(#fmt("%10d", 500), " 500"); - test(#fmt("%10d", -500), " -500"); - test(#fmt("%10u", 500u), " 500"); - test(#fmt("%10s", "test"), " test"); - test(#fmt("%10b", true), " true"); - test(#fmt("%10x", 0xff_u), " ff"); - test(#fmt("%10X", 0xff_u), " FF"); - test(#fmt("%10o", 10u), " 12"); - test(#fmt("%10t", 0xff_u), " 11111111"); - test(#fmt("%10c", 'A'), " A"); + test(#fmt["%1d", 500], "500"); + test(#fmt["%10d", 500], " 500"); + test(#fmt["%10d", -500], " -500"); + test(#fmt["%10u", 500u], " 500"); + test(#fmt["%10s", "test"], " test"); + test(#fmt["%10b", true], " true"); + test(#fmt["%10x", 0xff_u], " ff"); + test(#fmt["%10X", 0xff_u], " FF"); + test(#fmt["%10o", 10u], " 12"); + test(#fmt["%10t", 0xff_u], " 11111111"); + test(#fmt["%10c", 'A'], " A"); // Left justify - test(#fmt("%-10d", 500), "500 "); - test(#fmt("%-10d", -500), "-500 "); - test(#fmt("%-10u", 500u), "500 "); - test(#fmt("%-10s", "test"), "test "); - test(#fmt("%-10b", true), "true "); - test(#fmt("%-10x", 0xff_u), "ff "); - test(#fmt("%-10X", 0xff_u), "FF "); - test(#fmt("%-10o", 10u), "12 "); - test(#fmt("%-10t", 0xff_u), "11111111 "); - test(#fmt("%-10c", 'A'), "A "); + test(#fmt["%-10d", 500], "500 "); + test(#fmt["%-10d", -500], "-500 "); + test(#fmt["%-10u", 500u], "500 "); + test(#fmt["%-10s", "test"], "test "); + test(#fmt["%-10b", true], "true "); + test(#fmt["%-10x", 0xff_u], "ff "); + test(#fmt["%-10X", 0xff_u], "FF "); + test(#fmt["%-10o", 10u], "12 "); + test(#fmt["%-10t", 0xff_u], "11111111 "); + test(#fmt["%-10c", 'A'], "A "); } fn part3() { // Precision - test(#fmt("%.d", 0), ""); - test(#fmt("%.u", 0u), ""); - test(#fmt("%.x", 0u), ""); - test(#fmt("%.t", 0u), ""); - test(#fmt("%.d", 10), "10"); - test(#fmt("%.d", -10), "-10"); - test(#fmt("%.u", 10u), "10"); - test(#fmt("%.s", "test"), ""); - test(#fmt("%.x", 127u), "7f"); - test(#fmt("%.o", 10u), "12"); - test(#fmt("%.t", 3u), "11"); - test(#fmt("%.c", 'A'), "A"); - test(#fmt("%.0d", 0), ""); - test(#fmt("%.0u", 0u), ""); - test(#fmt("%.0x", 0u), ""); - test(#fmt("%.0t", 0u), ""); - test(#fmt("%.0d", 10), "10"); - test(#fmt("%.0d", -10), "-10"); - test(#fmt("%.0u", 10u), "10"); - test(#fmt("%.0s", "test"), ""); - test(#fmt("%.0x", 127u), "7f"); - test(#fmt("%.0o", 10u), "12"); - test(#fmt("%.0t", 3u), "11"); - test(#fmt("%.0c", 'A'), "A"); - test(#fmt("%.1d", 0), "0"); - test(#fmt("%.1u", 0u), "0"); - test(#fmt("%.1x", 0u), "0"); - test(#fmt("%.1t", 0u), "0"); - test(#fmt("%.1d", 10), "10"); - test(#fmt("%.1d", -10), "-10"); - test(#fmt("%.1u", 10u), "10"); - test(#fmt("%.1s", "test"), "t"); - test(#fmt("%.1x", 127u), "7f"); - test(#fmt("%.1o", 10u), "12"); - test(#fmt("%.1t", 3u), "11"); - test(#fmt("%.1c", 'A'), "A"); + test(#fmt["%.d", 0], ""); + test(#fmt["%.u", 0u], ""); + test(#fmt["%.x", 0u], ""); + test(#fmt["%.t", 0u], ""); + test(#fmt["%.d", 10], "10"); + test(#fmt["%.d", -10], "-10"); + test(#fmt["%.u", 10u], "10"); + test(#fmt["%.s", "test"], ""); + test(#fmt["%.x", 127u], "7f"); + test(#fmt["%.o", 10u], "12"); + test(#fmt["%.t", 3u], "11"); + test(#fmt["%.c", 'A'], "A"); + test(#fmt["%.0d", 0], ""); + test(#fmt["%.0u", 0u], ""); + test(#fmt["%.0x", 0u], ""); + test(#fmt["%.0t", 0u], ""); + test(#fmt["%.0d", 10], "10"); + test(#fmt["%.0d", -10], "-10"); + test(#fmt["%.0u", 10u], "10"); + test(#fmt["%.0s", "test"], ""); + test(#fmt["%.0x", 127u], "7f"); + test(#fmt["%.0o", 10u], "12"); + test(#fmt["%.0t", 3u], "11"); + test(#fmt["%.0c", 'A'], "A"); + test(#fmt["%.1d", 0], "0"); + test(#fmt["%.1u", 0u], "0"); + test(#fmt["%.1x", 0u], "0"); + test(#fmt["%.1t", 0u], "0"); + test(#fmt["%.1d", 10], "10"); + test(#fmt["%.1d", -10], "-10"); + test(#fmt["%.1u", 10u], "10"); + test(#fmt["%.1s", "test"], "t"); + test(#fmt["%.1x", 127u], "7f"); + test(#fmt["%.1o", 10u], "12"); + test(#fmt["%.1t", 3u], "11"); + test(#fmt["%.1c", 'A'], "A"); } fn part4() { - test(#fmt("%.5d", 0), "00000"); - test(#fmt("%.5u", 0u), "00000"); - test(#fmt("%.5x", 0u), "00000"); - test(#fmt("%.5t", 0u), "00000"); - test(#fmt("%.5d", 10), "00010"); - test(#fmt("%.5d", -10), "-00010"); - test(#fmt("%.5u", 10u), "00010"); - test(#fmt("%.5s", "test"), "test"); - test(#fmt("%.5x", 127u), "0007f"); - test(#fmt("%.5o", 10u), "00012"); - test(#fmt("%.5t", 3u), "00011"); - test(#fmt("%.5c", 'A'), "A"); + test(#fmt["%.5d", 0], "00000"); + test(#fmt["%.5u", 0u], "00000"); + test(#fmt["%.5x", 0u], "00000"); + test(#fmt["%.5t", 0u], "00000"); + test(#fmt["%.5d", 10], "00010"); + test(#fmt["%.5d", -10], "-00010"); + test(#fmt["%.5u", 10u], "00010"); + test(#fmt["%.5s", "test"], "test"); + test(#fmt["%.5x", 127u], "0007f"); + test(#fmt["%.5o", 10u], "00012"); + test(#fmt["%.5t", 3u], "00011"); + test(#fmt["%.5c", 'A'], "A"); // Bool precision. I'm not sure if it's good or bad to have bool // conversions support precision - it's not standard printf so we // can do whatever. For now I'm making it behave the same as string // conversions. - test(#fmt("%.b", true), ""); - test(#fmt("%.0b", true), ""); - test(#fmt("%.1b", true), "t"); + test(#fmt["%.b", true], ""); + test(#fmt["%.0b", true], ""); + test(#fmt["%.1b", true], "t"); } fn part5() { // Explicit + sign. Only for signed conversions - test(#fmt("%+d", 0), "+0"); - test(#fmt("%+d", 1), "+1"); - test(#fmt("%+d", -1), "-1"); + test(#fmt["%+d", 0], "+0"); + test(#fmt["%+d", 1], "+1"); + test(#fmt["%+d", -1], "-1"); // Leave space for sign - test(#fmt("% d", 0), " 0"); - test(#fmt("% d", 1), " 1"); - test(#fmt("% d", -1), "-1"); + test(#fmt["% d", 0], " 0"); + test(#fmt["% d", 1], " 1"); + test(#fmt["% d", -1], "-1"); // Plus overrides space - test(#fmt("% +d", 0), "+0"); - test(#fmt("%+ d", 0), "+0"); + test(#fmt["% +d", 0], "+0"); + test(#fmt["%+ d", 0], "+0"); // 0-padding - test(#fmt("%05d", 0), "00000"); - test(#fmt("%05d", 1), "00001"); - test(#fmt("%05d", -1), "-0001"); - test(#fmt("%05u", 1u), "00001"); - test(#fmt("%05x", 127u), "0007f"); - test(#fmt("%05X", 127u), "0007F"); - test(#fmt("%05o", 10u), "00012"); - test(#fmt("%05t", 3u), "00011"); + test(#fmt["%05d", 0], "00000"); + test(#fmt["%05d", 1], "00001"); + test(#fmt["%05d", -1], "-0001"); + test(#fmt["%05u", 1u], "00001"); + test(#fmt["%05x", 127u], "0007f"); + test(#fmt["%05X", 127u], "0007F"); + test(#fmt["%05o", 10u], "00012"); + test(#fmt["%05t", 3u], "00011"); // 0-padding a string is undefined but glibc does this: - test(#fmt("%05s", "test"), " test"); - test(#fmt("%05c", 'A'), " A"); - test(#fmt("%05b", true), " true"); + test(#fmt["%05s", "test"], " test"); + test(#fmt["%05c", 'A'], " A"); + test(#fmt["%05b", true], " true"); // Left-justify overrides 0-padding - test(#fmt("%-05d", 0), "0 "); - test(#fmt("%-05d", 1), "1 "); - test(#fmt("%-05d", -1), "-1 "); - test(#fmt("%-05u", 1u), "1 "); - test(#fmt("%-05x", 127u), "7f "); - test(#fmt("%-05X", 127u), "7F "); - test(#fmt("%-05o", 10u), "12 "); - test(#fmt("%-05t", 3u), "11 "); - test(#fmt("%-05s", "test"), "test "); - test(#fmt("%-05c", 'A'), "A "); - test(#fmt("%-05b", true), "true "); + test(#fmt["%-05d", 0], "0 "); + test(#fmt["%-05d", 1], "1 "); + test(#fmt["%-05d", -1], "-1 "); + test(#fmt["%-05u", 1u], "1 "); + test(#fmt["%-05x", 127u], "7f "); + test(#fmt["%-05X", 127u], "7F "); + test(#fmt["%-05o", 10u], "12 "); + test(#fmt["%-05t", 3u], "11 "); + test(#fmt["%-05s", "test"], "test "); + test(#fmt["%-05c", 'A'], "A "); + test(#fmt["%-05b", true], "true "); } fn part6() { // Precision overrides 0-padding - test(#fmt("%06.5d", 0), " 00000"); - test(#fmt("%06.5u", 0u), " 00000"); - test(#fmt("%06.5x", 0u), " 00000"); - test(#fmt("%06.5d", 10), " 00010"); - test(#fmt("%06.5d", -10), "-00010"); - test(#fmt("%06.5u", 10u), " 00010"); - test(#fmt("%06.5s", "test"), " test"); - test(#fmt("%06.5c", 'A'), " A"); - test(#fmt("%06.5x", 127u), " 0007f"); - test(#fmt("%06.5X", 127u), " 0007F"); - test(#fmt("%06.5o", 10u), " 00012"); + test(#fmt["%06.5d", 0], " 00000"); + test(#fmt["%06.5u", 0u], " 00000"); + test(#fmt["%06.5x", 0u], " 00000"); + test(#fmt["%06.5d", 10], " 00010"); + test(#fmt["%06.5d", -10], "-00010"); + test(#fmt["%06.5u", 10u], " 00010"); + test(#fmt["%06.5s", "test"], " test"); + test(#fmt["%06.5c", 'A'], " A"); + test(#fmt["%06.5x", 127u], " 0007f"); + test(#fmt["%06.5X", 127u], " 0007F"); + test(#fmt["%06.5o", 10u], " 00012"); // Signed combinations - test(#fmt("% 5d", 1), " 1"); - test(#fmt("% 5d", -1), " -1"); - test(#fmt("%+5d", 1), " +1"); - test(#fmt("%+5d", -1), " -1"); - test(#fmt("% 05d", 1), " 0001"); - test(#fmt("% 05d", -1), "-0001"); - test(#fmt("%+05d", 1), "+0001"); - test(#fmt("%+05d", -1), "-0001"); - test(#fmt("%- 5d", 1), " 1 "); - test(#fmt("%- 5d", -1), "-1 "); - test(#fmt("%-+5d", 1), "+1 "); - test(#fmt("%-+5d", -1), "-1 "); - test(#fmt("%- 05d", 1), " 1 "); - test(#fmt("%- 05d", -1), "-1 "); - test(#fmt("%-+05d", 1), "+1 "); - test(#fmt("%-+05d", -1), "-1 "); -} \ No newline at end of file + test(#fmt["% 5d", 1], " 1"); + test(#fmt["% 5d", -1], " -1"); + test(#fmt["%+5d", 1], " +1"); + test(#fmt["%+5d", -1], " -1"); + test(#fmt["% 05d", 1], " 0001"); + test(#fmt["% 05d", -1], "-0001"); + test(#fmt["%+05d", 1], "+0001"); + test(#fmt["%+05d", -1], "-0001"); + test(#fmt["%- 5d", 1], " 1 "); + test(#fmt["%- 5d", -1], "-1 "); + test(#fmt["%-+5d", 1], "+1 "); + test(#fmt["%-+5d", -1], "-1 "); + test(#fmt["%- 05d", 1], " 1 "); + test(#fmt["%- 05d", -1], "-1 "); + test(#fmt["%-+05d", 1], "+1 "); + test(#fmt["%-+05d", -1], "-1 "); +} diff --git a/src/test/run-pass/syntax-extension-minor.rs b/src/test/run-pass/syntax-extension-minor.rs index f5f7f5564f6..50939997523 100644 --- a/src/test/run-pass/syntax-extension-minor.rs +++ b/src/test/run-pass/syntax-extension-minor.rs @@ -1,8 +1,8 @@ fn main() { let asdf_fdsa = "<.<"; - assert(#concat_idents[asd,f_f,dsa] == "<.<"); + assert (#concat_idents[asd, f_f, dsa] == "<.<"); - assert(#ident_to_str[use_mention_distinction] - == "use_mention_distinction"); + assert (#ident_to_str[use_mention_distinction] == + "use_mention_distinction"); } diff --git a/src/test/run-pass/tag.rs b/src/test/run-pass/tag.rs index 1ea470252f9..534ab1dc395 100644 --- a/src/test/run-pass/tag.rs +++ b/src/test/run-pass/tag.rs @@ -12,4 +12,4 @@ fn f() { } -fn main() { f(); } \ No newline at end of file +fn main() { f(); } diff --git a/src/test/run-pass/tail-call-arg-leak.rs b/src/test/run-pass/tail-call-arg-leak.rs index f771e9efc9b..b208d32009d 100644 --- a/src/test/run-pass/tail-call-arg-leak.rs +++ b/src/test/run-pass/tail-call-arg-leak.rs @@ -4,4 +4,4 @@ // use of tail calls causes arg slot leaks, issue #160. fn inner(dummy: str, b: bool) { if b { be inner(dummy, false); } } -fn main() { inner("hi", true); } \ No newline at end of file +fn main() { inner("hi", true); } diff --git a/src/test/run-pass/tail-cps.rs b/src/test/run-pass/tail-cps.rs index 81efa8f5502..a8a4436a2be 100644 --- a/src/test/run-pass/tail-cps.rs +++ b/src/test/run-pass/tail-cps.rs @@ -6,14 +6,14 @@ fn checktrue(rs: bool) -> bool { assert (rs); ret true; } fn main() { let k = checktrue; evenk(42, k); oddk(45, k); } -fn evenk(n: int, k: fn(bool) -> bool ) -> bool { +fn evenk(n: int, k: fn(bool) -> bool) -> bool { log "evenk"; log n; if n == 0 { be k(true); } else { be oddk(n - 1, k); } } -fn oddk(n: int, k: fn(bool) -> bool ) -> bool { +fn oddk(n: int, k: fn(bool) -> bool) -> bool { log "oddk"; log n; if n == 0 { be k(false); } else { be evenk(n - 1, k); } -} \ No newline at end of file +} diff --git a/src/test/run-pass/tail-direct.rs b/src/test/run-pass/tail-direct.rs index f0b50b07ce1..0bd771e7369 100644 --- a/src/test/run-pass/tail-direct.rs +++ b/src/test/run-pass/tail-direct.rs @@ -6,4 +6,4 @@ fn main() { assert (even(42)); assert (odd(45)); } fn even(n: int) -> bool { if n == 0 { ret true; } else { be odd(n - 1); } } -fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } } \ No newline at end of file +fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } } diff --git a/src/test/run-pass/task-comm-11.rs b/src/test/run-pass/task-comm-11.rs index ab994c7f378..35b30cda1a2 100644 --- a/src/test/run-pass/task-comm-11.rs +++ b/src/test/run-pass/task-comm-11.rs @@ -4,7 +4,7 @@ import std::comm; import std::task; fn start(c: comm::_chan<comm::_chan<int>>) { - let p : comm::_port<int> = comm::mk_port(); + let p: comm::_port<int> = comm::mk_port(); comm::send(c, p.mk_chan()); } diff --git a/src/test/run-pass/task-comm-13.rs b/src/test/run-pass/task-comm-13.rs index 2ae80750f45..7fb31f2d666 100644 --- a/src/test/run-pass/task-comm-13.rs +++ b/src/test/run-pass/task-comm-13.rs @@ -10,7 +10,7 @@ fn start(c: comm::_chan<int>, start: int, number_of_messages: int) { fn main() { log "Check that we don't deadlock."; - let p : comm::_port<int> = comm::mk_port(); + let p: comm::_port<int> = comm::mk_port(); let a = task::_spawn(bind start(p.mk_chan(), 0, 10)); task::join_id(a); log "Joined task"; diff --git a/src/test/run-pass/task-comm-15.rs b/src/test/run-pass/task-comm-15.rs index 84f3abe9b86..4ea320add2c 100644 --- a/src/test/run-pass/task-comm-15.rs +++ b/src/test/run-pass/task-comm-15.rs @@ -2,7 +2,7 @@ use std; import std::comm; import std::task; -fn start(c : comm::chan<int>, n: int) { +fn start(c: comm::chan<int>, n: int) { let i: int = n; while i > 0 { comm::send(c, 0); i = i - 1; } diff --git a/src/test/run-pass/task-comm-16.rs b/src/test/run-pass/task-comm-16.rs index 9b43986e2ed..6ac2df9d94a 100644 --- a/src/test/run-pass/task-comm-16.rs +++ b/src/test/run-pass/task-comm-16.rs @@ -23,29 +23,29 @@ fn test_rec() { fn test_vec() { let po = comm::mk_port(); let ch = po.mk_chan(); - let v0: [int] = ~[0, 1, 2]; + let v0: [int] = [0, 1, 2]; send(ch, v0); let v1: [int]; v1 = po.recv(); - assert (v1.(0) == 0); - assert (v1.(1) == 1); - assert (v1.(2) == 2); + assert (v1[0] == 0); + assert (v1[1] == 1); + assert (v1[2] == 2); } fn test_str() { // FIXME: re-enable this once strings are unique and sendable -/* - let po = comm::mk_port(); - let ch = po.mk_chan(); - let s0: str = "test"; - send(ch, s0); - let s1: str; - s1 = po.recv(); - assert (s1.(0) as u8 == 't' as u8); - assert (s1.(1) as u8 == 'e' as u8); - assert (s1.(2) as u8 == 's' as u8); - assert (s1.(3) as u8 == 't' as u8); -*/ + /* + let po = comm::mk_port(); + let ch = po.mk_chan(); + let s0: str = "test"; + send(ch, s0); + let s1: str; + s1 = po.recv(); + assert (s1.(0) as u8 == 't' as u8); + assert (s1.(1) as u8 == 'e' as u8); + assert (s1.(2) as u8 == 's' as u8); + assert (s1.(3) as u8 == 't' as u8); + */ } fn test_tag() { @@ -80,10 +80,4 @@ fn test_chan() { assert (i == 10); } -fn main() { - test_rec(); - test_vec(); - test_str(); - test_tag(); - test_chan(); -} +fn main() { test_rec(); test_vec(); test_str(); test_tag(); test_chan(); } diff --git a/src/test/run-pass/task-comm-3.rs b/src/test/run-pass/task-comm-3.rs index ac3430aec3f..f8522282800 100644 --- a/src/test/run-pass/task-comm-3.rs +++ b/src/test/run-pass/task-comm-3.rs @@ -14,7 +14,7 @@ fn test00_start(ch: _chan<int>, message: int, count: int) { let i: int = 0; while i < count { log "Sending Message"; - send(ch, message+0); + send(ch, message + 0); i = i + 1; } log "Ending test00_start"; @@ -34,8 +34,7 @@ fn test00() { // Create and spawn tasks... let tasks = []; while i < number_of_tasks { - tasks += - [task::_spawn(bind test00_start(ch, i, number_of_messages))]; + tasks += [task::_spawn(bind test00_start(ch, i, number_of_messages))]; i = i + 1; } diff --git a/src/test/run-pass/task-comm-4.rs b/src/test/run-pass/task-comm-4.rs index 30342d877f0..b54020cbe0f 100644 --- a/src/test/run-pass/task-comm-4.rs +++ b/src/test/run-pass/task-comm-4.rs @@ -42,4 +42,4 @@ fn test00() { sum += r; log r; assert (sum == 1 + 2 + 3 + 4 + 5 + 6 + 7 + 8); -} \ No newline at end of file +} diff --git a/src/test/run-pass/task-comm-5.rs b/src/test/run-pass/task-comm-5.rs index bb3a1e4dc70..dd07023b2e9 100644 --- a/src/test/run-pass/task-comm-5.rs +++ b/src/test/run-pass/task-comm-5.rs @@ -10,8 +10,8 @@ fn test00() { let c = p.mk_chan(); let number_of_messages: int = 1000; let i: int = 0; - while i < number_of_messages { comm::send(c, i+0); i += 1; } + while i < number_of_messages { comm::send(c, i + 0); i += 1; } i = 0; while i < number_of_messages { r = p.recv(); sum += r; i += 1; } assert (sum == number_of_messages * (number_of_messages - 1) / 2); -} \ No newline at end of file +} diff --git a/src/test/run-pass/task-comm-6.rs b/src/test/run-pass/task-comm-6.rs index 41dc6d203ad..036f96981ff 100644 --- a/src/test/run-pass/task-comm-6.rs +++ b/src/test/run-pass/task-comm-6.rs @@ -15,10 +15,10 @@ fn test00() { let number_of_messages: int = 1000; let i: int = 0; while i < number_of_messages { - send(c0, i+0); - send(c1, i+0); - send(c2, i+0); - send(c3, i+0); + send(c0, i + 0); + send(c1, i + 0); + send(c2, i + 0); + send(c3, i + 0); i += 1; } i = 0; @@ -37,4 +37,4 @@ fn test00() { // assert (sum == 4 * ((number_of_messages * // (number_of_messages - 1)) / 2)); -} \ No newline at end of file +} diff --git a/src/test/run-pass/task-comm-8.rs b/src/test/run-pass/task-comm-8.rs index 649e23f9806..0acff8cc022 100644 --- a/src/test/run-pass/task-comm-8.rs +++ b/src/test/run-pass/task-comm-8.rs @@ -4,7 +4,7 @@ import std::comm; fn main() { test00(); } -fn test00_start(c : comm::_chan<int>, start: int, number_of_messages: int) { +fn test00_start(c: comm::_chan<int>, start: int, number_of_messages: int) { let i: int = 0; while i < number_of_messages { comm::send(c, start + i); i += 1; } } diff --git a/src/test/run-pass/task-comm-9.rs b/src/test/run-pass/task-comm-9.rs index a197ebdf507..46dd1d89e51 100644 --- a/src/test/run-pass/task-comm-9.rs +++ b/src/test/run-pass/task-comm-9.rs @@ -6,7 +6,7 @@ fn main() { test00(); } fn test00_start(c: comm::_chan<int>, number_of_messages: int) { let i: int = 0; - while i < number_of_messages { comm::send(c, i+0); i += 1; } + while i < number_of_messages { comm::send(c, i + 0); i += 1; } } fn test00() { @@ -15,8 +15,7 @@ fn test00() { let p = comm::mk_port(); let number_of_messages: int = 10; - let t0 = task::_spawn(bind test00_start(p.mk_chan(), - number_of_messages)); + let t0 = task::_spawn(bind test00_start(p.mk_chan(), number_of_messages)); let i: int = 0; while i < number_of_messages { r = p.recv(); sum += r; log r; i += 1; } diff --git a/src/test/run-pass/task-comm.rs b/src/test/run-pass/task-comm.rs index c468d1c89d6..f5a6a111608 100644 --- a/src/test/run-pass/task-comm.rs +++ b/src/test/run-pass/task-comm.rs @@ -20,7 +20,11 @@ fn main() { fn test00_start(ch: _chan<int>, message: int, count: int) { log "Starting test00_start"; let i: int = 0; - while i < count { log "Sending Message"; send(ch, message+0); i = i + 1; } + while i < count { + log "Sending Message"; + send(ch, message + 0); + i = i + 1; + } log "Ending test00_start"; } @@ -39,22 +43,19 @@ fn test00() { i = i + 1; tasks += [task::spawn(bind test00_start(ch, i, number_of_messages))]; } - let sum: int = 0; for t: task_id in tasks { i = 0; - while i < number_of_messages { - sum += po.recv(); - i = i + 1; - } + while i < number_of_messages { sum += po.recv(); i = i + 1; } } for t: task_id in tasks { task::join_id(t); } log "Completed: Final number is: "; assert (sum == - number_of_messages * - (number_of_tasks * number_of_tasks + number_of_tasks) / 2); + number_of_messages * + (number_of_tasks * number_of_tasks + number_of_tasks) / + 2); } fn test01() { @@ -96,11 +97,7 @@ fn test04_start() { fn test04() { log "Spawning lots of tasks."; let i: int = 4; - while i > 0 { - i = i - 1; - let f = test04_start; - task::spawn(f); - } + while i > 0 { i = i - 1; let f = test04_start; task::spawn(f); } log "Finishing up."; } @@ -138,7 +135,9 @@ fn test06() { let tasks = []; while i < number_of_tasks { - i = i + 1; tasks += [task::spawn(bind test06_start(i))]; } + i = i + 1; + tasks += [task::spawn(bind test06_start(i))]; + } for t: task_id in tasks { task::join_id(t); } diff --git a/src/test/run-pass/task-pin.rs b/src/test/run-pass/task-pin.rs index a6592b885eb..407914dba2d 100644 --- a/src/test/run-pass/task-pin.rs +++ b/src/test/run-pass/task-pin.rs @@ -7,4 +7,4 @@ use std; import std::task; -fn main() { task::pin(); task::unpin(); } \ No newline at end of file +fn main() { task::pin(); task::unpin(); } diff --git a/src/test/run-pass/ternary.rs b/src/test/run-pass/ternary.rs index 9c2aaf4ac4e..6adfada2c90 100644 --- a/src/test/run-pass/ternary.rs +++ b/src/test/run-pass/ternary.rs @@ -40,4 +40,4 @@ fn main() { test_associativity(); test_lval(); test_as_stmt(); -} \ No newline at end of file +} diff --git a/src/test/run-pass/test-runner-hides-main.rs b/src/test/run-pass/test-runner-hides-main.rs index 2edf36d1762..997664aa9c0 100644 --- a/src/test/run-pass/test-runner-hides-main.rs +++ b/src/test/run-pass/test-runner-hides-main.rs @@ -5,4 +5,4 @@ use std; // Building as a test runner means that a synthetic main will be run, // not ours -fn main() { fail; } \ No newline at end of file +fn main() { fail; } diff --git a/src/test/run-pass/threads.rs b/src/test/run-pass/threads.rs index 47982d12b90..aa999eb420d 100644 --- a/src/test/run-pass/threads.rs +++ b/src/test/run-pass/threads.rs @@ -4,15 +4,10 @@ use std; import std::task; fn main() { - let i = 10; - while (i > 0) { - task::_spawn(bind child(i)); - i = i - 1; - } - log "main thread exiting"; + let i = 10; + while i > 0 { task::_spawn(bind child(i)); i = i - 1; } + log "main thread exiting"; } -fn child(x : int) { - log x; -} +fn child(x: int) { log x; } diff --git a/src/test/run-pass/tup.rs b/src/test/run-pass/tup.rs index ab34e75a460..b12099b414a 100644 --- a/src/test/run-pass/tup.rs +++ b/src/test/run-pass/tup.rs @@ -15,4 +15,4 @@ fn main() { let p2: point = p; f(p, 10, 20); f(p2, 10, 20); -} \ No newline at end of file +} diff --git a/src/test/run-pass/type-in-nested-module.rs b/src/test/run-pass/type-in-nested-module.rs index 2c91b35099e..059f22ba15c 100644 --- a/src/test/run-pass/type-in-nested-module.rs +++ b/src/test/run-pass/type-in-nested-module.rs @@ -8,4 +8,4 @@ mod a { } } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/type-namespace.rs b/src/test/run-pass/type-namespace.rs index f173ec0a69d..03c8ce0972a 100644 --- a/src/test/run-pass/type-namespace.rs +++ b/src/test/run-pass/type-namespace.rs @@ -2,4 +2,4 @@ type a = {a: int}; fn a(a: a) -> int { ret a.a; } -fn main() { let x: a = {a: 1}; assert (a(x) == 1); } \ No newline at end of file +fn main() { let x: a = {a: 1}; assert (a(x) == 1); } diff --git a/src/test/run-pass/type-param-constraints.rs b/src/test/run-pass/type-param-constraints.rs index e1c80d31fb7..a5ea4c223d4 100644 --- a/src/test/run-pass/type-param-constraints.rs +++ b/src/test/run-pass/type-param-constraints.rs @@ -1,6 +1,6 @@ -fn p_foo<T>(pinned: &T) { } -fn s_foo<@T>(shared: &T) { } -fn u_foo<~T>(unique: &T) { } +fn p_foo<T>(pinned: &T) { } +fn s_foo<@T>(shared: &T) { } +fn u_foo<~T>(unique: &T) { } resource r(i: int) { } diff --git a/src/test/run-pass/type-param.rs b/src/test/run-pass/type-param.rs index 36ef46420a9..be55ba86cac 100644 --- a/src/test/run-pass/type-param.rs +++ b/src/test/run-pass/type-param.rs @@ -1,5 +1,5 @@ -type lteq<T> = fn(&T) -> bool ; +type lteq<T> = fn(&T) -> bool; fn main(args: [str]) { } diff --git a/src/test/run-pass/type-params-in-for-each.rs b/src/test/run-pass/type-params-in-for-each.rs index b8e2f5fc8a8..760e5dadfa1 100644 --- a/src/test/run-pass/type-params-in-for-each.rs +++ b/src/test/run-pass/type-params-in-for-each.rs @@ -5,8 +5,8 @@ iter range(lo: uint, hi: uint) -> uint { while lo_ < hi { put lo_; lo_ += 1u; } } -fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint ) { - for each i: uint in range(0u, 256u) { let bucket: [T] = ~[]; } +fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint) { + for each i: uint in range(0u, 256u) { let bucket: [T] = []; } } fn main() { } diff --git a/src/test/run-pass/typestate-cfg-nesting.rs b/src/test/run-pass/typestate-cfg-nesting.rs index 52702922764..ccde41545d9 100644 --- a/src/test/run-pass/typestate-cfg-nesting.rs +++ b/src/test/run-pass/typestate-cfg-nesting.rs @@ -6,4 +6,4 @@ fn main() { let x = 10; let y = 11; if true { while false { y = x; } } else { } -} \ No newline at end of file +} diff --git a/src/test/run-pass/typestate-multi-decl.rs b/src/test/run-pass/typestate-multi-decl.rs index b0da5a7b226..18698226379 100644 --- a/src/test/run-pass/typestate-multi-decl.rs +++ b/src/test/run-pass/typestate-multi-decl.rs @@ -1,5 +1 @@ -fn main() { - let x = 10, y = 20; - let z = x + y; - assert (z == 30); -} +fn main() { let x = 10, y = 20; let z = x + y; assert (z == 30); } diff --git a/src/test/run-pass/typestate-transitive.rs b/src/test/run-pass/typestate-transitive.rs index f2eda37e0d0..021dd7554b7 100644 --- a/src/test/run-pass/typestate-transitive.rs +++ b/src/test/run-pass/typestate-transitive.rs @@ -4,4 +4,4 @@ fn f(i: int) : p(i) -> int { i } fn g(i: int) : p(i) -> int { f(i) } -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/u32-decr.rs b/src/test/run-pass/u32-decr.rs index ba7af14dbce..d258effa663 100644 --- a/src/test/run-pass/u32-decr.rs +++ b/src/test/run-pass/u32-decr.rs @@ -6,4 +6,4 @@ fn main() { let word: u32 = 200000u32; word = word - 1u32; assert (word == 199999u32); -} \ No newline at end of file +} diff --git a/src/test/run-pass/u8-incr-decr.rs b/src/test/run-pass/u8-incr-decr.rs index 8562a87c1a0..91bf0f9945e 100644 --- a/src/test/run-pass/u8-incr-decr.rs +++ b/src/test/run-pass/u8-incr-decr.rs @@ -15,4 +15,4 @@ fn main() { y = y - 9u8; // 0x9 assert (x == y); -} \ No newline at end of file +} diff --git a/src/test/run-pass/u8-incr.rs b/src/test/run-pass/u8-incr.rs index c1f0ee37c13..66304d33072 100644 --- a/src/test/run-pass/u8-incr.rs +++ b/src/test/run-pass/u8-incr.rs @@ -11,4 +11,4 @@ fn main() { // x = 14u8; // x = x + 1u8; -} \ No newline at end of file +} diff --git a/src/test/run-pass/uint.rs b/src/test/run-pass/uint.rs index 8e5795e0b6d..2083979b0ac 100644 --- a/src/test/run-pass/uint.rs +++ b/src/test/run-pass/uint.rs @@ -2,4 +2,4 @@ // -*- rust -*- -fn main() { let x: uint = 10 as uint; } \ No newline at end of file +fn main() { let x: uint = 10 as uint; } diff --git a/src/test/run-pass/unify-return-ty.rs b/src/test/run-pass/unify-return-ty.rs index 0538618ff88..5bfdeb33847 100644 --- a/src/test/run-pass/unify-return-ty.rs +++ b/src/test/run-pass/unify-return-ty.rs @@ -6,6 +6,4 @@ import std::unsafe; fn null<T>() -> *T { unsafe::reinterpret_cast(0) } -fn main() { - null::<int>(); -} +fn main() { null::<int>(); } diff --git a/src/test/run-pass/unit.rs b/src/test/run-pass/unit.rs index 6b944d59c5d..815c760dfaa 100644 --- a/src/test/run-pass/unit.rs +++ b/src/test/run-pass/unit.rs @@ -4,4 +4,4 @@ // -*- rust -*- fn f(u: ()) { ret u; } -fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); } \ No newline at end of file +fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); } diff --git a/src/test/run-pass/use-import-export.rs b/src/test/run-pass/use-import-export.rs index 56b99e2c95f..99b87578d8d 100644 --- a/src/test/run-pass/use-import-export.rs +++ b/src/test/run-pass/use-import-export.rs @@ -8,4 +8,4 @@ mod bar { fn y() -> int { ret 1; } } -fn main() { foo::x(); bar::y(); } \ No newline at end of file +fn main() { foo::x(); bar::y(); } diff --git a/src/test/run-pass/utf8.rs b/src/test/run-pass/utf8.rs index e7dc2780612..c27d7a23c0a 100644 --- a/src/test/run-pass/utf8.rs +++ b/src/test/run-pass/utf8.rs @@ -34,7 +34,7 @@ fn main() { for ab: u8 in a { log i; log ab; - let bb: u8 = b.(i); + let bb: u8 = b[i]; log bb; assert (ab == bb); i += 1; diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs index c94cef4bba3..e7f7f9a1524 100644 --- a/src/test/run-pass/utf8_chars.rs +++ b/src/test/run-pass/utf8_chars.rs @@ -4,7 +4,7 @@ import std::vec; fn main() { // Chars of 1, 2, 3, and 4 bytes - let chs: [char] = ~['e', 'é', '€', 0x10000 as char]; + let chs: [char] = ['e', 'é', '€', 0x10000 as char]; let s: str = str::from_chars(chs); assert (str::byte_len(s) == 10u); @@ -15,9 +15,9 @@ fn main() { assert (str::char_at(s, 1u) == 'é'); assert (str::is_utf8(str::bytes(s))); - assert (!str::is_utf8(~[0x80_u8])); - assert (!str::is_utf8(~[0xc0_u8])); - assert (!str::is_utf8(~[0xc0_u8, 0x10_u8])); + assert (!str::is_utf8([0x80_u8])); + assert (!str::is_utf8([0xc0_u8])); + assert (!str::is_utf8([0xc0_u8, 0x10_u8])); let stack = "a×c€"; assert (str::pop_char(stack) == '€'); diff --git a/src/test/run-pass/vec-append.rs b/src/test/run-pass/vec-append.rs index 68076d41287..c045aa1e49f 100644 --- a/src/test/run-pass/vec-append.rs +++ b/src/test/run-pass/vec-append.rs @@ -10,26 +10,26 @@ import std::vec; const const_refcount: uint = 0x7bad_face_u; fn fast_growth() { - let v: [int] = ~[1, 2, 3, 4, 5]; - v += ~[6, 7, 8, 9, 0]; - log v.(9); - assert (v.(0) == 1); - assert (v.(7) == 8); - assert (v.(9) == 0); + let v: [int] = [1, 2, 3, 4, 5]; + v += [6, 7, 8, 9, 0]; + log v[9]; + assert (v[0] == 1); + assert (v[7] == 8); + assert (v[9] == 0); } fn slow_growth() { - let v: [int] = ~[]; + let v: [int] = []; let u: [int] = v; - v += ~[17]; - log v.(0); - assert (v.(0) == 17); + v += [17]; + log v[0]; + assert (v[0] == 17); } fn slow_growth2_helper(s: str) { // ref up: s obj acc(mutable v: [str]) { - fn add(s: &str) { v += ~[s]; } + fn add(s: &str) { v += [s]; } } let ss: str = s; // ref up: s @@ -46,7 +46,7 @@ fn slow_growth2_helper(s: str) { // ref up: s * mumble, the existing str in the originally- shared vec. */ - let v: [str] = ~[mumble]; // ref up: mumble + let v: [str] = [mumble]; // ref up: mumble let a: acc = acc(v); @@ -56,9 +56,9 @@ fn slow_growth2_helper(s: str) { // ref up: s log str::refcount(mumble); assert (str::refcount(s) == const_refcount); assert (str::refcount(mumble) == const_refcount); - log v.(0); + log v[0]; log vec::len::<str>(v); - assert (str::eq(v.(0), mumble)); + assert (str::eq(v[0], mumble)); assert (vec::len::<str>(v) == 1u); } // ref down: mumble, s, diff --git a/src/test/run-pass/vec-concat.rs b/src/test/run-pass/vec-concat.rs index 2804f8c0f10..e107d861a2a 100644 --- a/src/test/run-pass/vec-concat.rs +++ b/src/test/run-pass/vec-concat.rs @@ -3,11 +3,11 @@ // -*- rust -*- fn main() { - let a: [int] = ~[1, 2, 3, 4, 5]; - let b: [int] = ~[6, 7, 8, 9, 0]; + let a: [int] = [1, 2, 3, 4, 5]; + let b: [int] = [6, 7, 8, 9, 0]; let v: [int] = a + b; - log v.(9); - assert (v.(0) == 1); - assert (v.(7) == 8); - assert (v.(9) == 0); + log v[9]; + assert (v[0] == 1); + assert (v[7] == 8); + assert (v[9] == 0); } diff --git a/src/test/run-pass/vec-drop.rs b/src/test/run-pass/vec-drop.rs index dbd0bbcd82c..499b24d43f0 100644 --- a/src/test/run-pass/vec-drop.rs +++ b/src/test/run-pass/vec-drop.rs @@ -4,5 +4,5 @@ fn main() { // This just tests whether the vec leaks its members. let pvec: [@{x: int, y: int}] = - ~[@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}]; + [@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}]; } diff --git a/src/test/run-pass/vec-growth.rs b/src/test/run-pass/vec-growth.rs index c91d360c88b..7835b82c4d7 100644 --- a/src/test/run-pass/vec-growth.rs +++ b/src/test/run-pass/vec-growth.rs @@ -1,14 +1,14 @@ fn main() { - let v = ~[1]; - v += ~[2]; - v += ~[3]; - v += ~[4]; - v += ~[5]; - assert (v.(0) == 1); - assert (v.(1) == 2); - assert (v.(2) == 3); - assert (v.(3) == 4); - assert (v.(4) == 5); -} \ No newline at end of file + let v = [1]; + v += [2]; + v += [3]; + v += [4]; + v += [5]; + assert (v[0] == 1); + assert (v[1] == 2); + assert (v[2] == 3); + assert (v[3] == 4); + assert (v[4] == 5); +} diff --git a/src/test/run-pass/vec-ivec-deadlock.rs b/src/test/run-pass/vec-ivec-deadlock.rs index 2dae6e3fcb4..7c0515ce48b 100644 --- a/src/test/run-pass/vec-ivec-deadlock.rs +++ b/src/test/run-pass/vec-ivec-deadlock.rs @@ -1 +1 @@ -fn main() { let a = ~[1, 2, 3, 4, 5]; let b = ~[a, a]; b += b; } \ No newline at end of file +fn main() { let a = [1, 2, 3, 4, 5]; let b = [a, a]; b += b; } diff --git a/src/test/run-pass/vec-late-init.rs b/src/test/run-pass/vec-late-init.rs index c1f180ed237..6a84317747c 100644 --- a/src/test/run-pass/vec-late-init.rs +++ b/src/test/run-pass/vec-late-init.rs @@ -2,6 +2,6 @@ fn main() { let later: [int]; - if true { later = ~[1]; } else { later = ~[2]; } - log later.(0); + if true { later = [1]; } else { later = [2]; } + log later[0]; } diff --git a/src/test/run-pass/vec-push.rs b/src/test/run-pass/vec-push.rs index 6e54bd7467e..c2f49311b1e 100644 --- a/src/test/run-pass/vec-push.rs +++ b/src/test/run-pass/vec-push.rs @@ -1,5 +1,5 @@ -fn push<T>(v: &mutable [mutable? T], t: &T) { v += ~[t]; } +fn push<T>(v: &mutable [mutable? T], t: &T) { v += [t]; } -fn main() { let v = ~[1, 2, 3]; push(v, 1); } +fn main() { let v = [1, 2, 3]; push(v, 1); } diff --git a/src/test/run-pass/vec.rs b/src/test/run-pass/vec.rs index eef478a372e..95025f5b3cb 100644 --- a/src/test/run-pass/vec.rs +++ b/src/test/run-pass/vec.rs @@ -3,8 +3,8 @@ // -*- rust -*- fn main() { - let v: [int] = ~[10, 20]; - assert (v[0]== 10); + let v: [int] = [10, 20]; + assert (v[0] == 10); assert (v[1] == 20); let x: int = 0; assert (v[x] == 10); diff --git a/src/test/run-pass/vector-no-ann-2.rs b/src/test/run-pass/vector-no-ann-2.rs index d2555618281..10a9cd9c6b8 100644 --- a/src/test/run-pass/vector-no-ann-2.rs +++ b/src/test/run-pass/vector-no-ann-2.rs @@ -1 +1 @@ -fn main() { let quux: @[uint] = @~[]; } +fn main() { let quux: @[uint] = @[]; } diff --git a/src/test/run-pass/while-and-do-while.rs b/src/test/run-pass/while-and-do-while.rs index 3287791a7c0..c5b09cb8149 100644 --- a/src/test/run-pass/while-and-do-while.rs +++ b/src/test/run-pass/while-and-do-while.rs @@ -5,4 +5,4 @@ fn main() { let y: int = 0; while y < x { log y; log "hello"; y = y + 1; } do { log "goodbye"; x = x - 1; log x; } while x > 0 -} \ No newline at end of file +} diff --git a/src/test/run-pass/while-flow-graph.rs b/src/test/run-pass/while-flow-graph.rs index bf1840638de..2813cee0cd0 100644 --- a/src/test/run-pass/while-flow-graph.rs +++ b/src/test/run-pass/while-flow-graph.rs @@ -1,3 +1,3 @@ -fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } } \ No newline at end of file +fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } } diff --git a/src/test/run-pass/while-loop-constraints-2.rs b/src/test/run-pass/while-loop-constraints-2.rs index e124ed58042..29ab411b31b 100644 --- a/src/test/run-pass/while-loop-constraints-2.rs +++ b/src/test/run-pass/while-loop-constraints-2.rs @@ -5,4 +5,4 @@ fn main() { let x: int; while z < 50 { z += 1; while false { x <- y; y = z; } log y; } assert (y == 42 && z == 50); -} \ No newline at end of file +} diff --git a/src/test/run-pass/while-prelude-drop.rs b/src/test/run-pass/while-prelude-drop.rs index badd2ae10bf..9688c436370 100644 --- a/src/test/run-pass/while-prelude-drop.rs +++ b/src/test/run-pass/while-prelude-drop.rs @@ -16,4 +16,4 @@ fn main() { // The auto slot for the result of make(i) should not leak. while make(i) != a { i += 1; } -} \ No newline at end of file +} diff --git a/src/test/run-pass/while-with-break.rs b/src/test/run-pass/while-with-break.rs index 3dcbb96b040..f8050e3d3eb 100644 --- a/src/test/run-pass/while-with-break.rs +++ b/src/test/run-pass/while-with-break.rs @@ -9,7 +9,7 @@ fn main() { i = i + 1; if i == 95 { let v: [int] = - ~[1, 2, 3, 4, 5]; // we check that it is freed by break + [1, 2, 3, 4, 5]; // we check that it is freed by break log "breaking"; break; diff --git a/src/test/run-pass/wierd-exprs.rs b/src/test/run-pass/wierd-exprs.rs index a8276c92bb6..de1613c4363 100644 --- a/src/test/run-pass/wierd-exprs.rs +++ b/src/test/run-pass/wierd-exprs.rs @@ -1,11 +1,9 @@ // Just a grab bug of stuff that you wouldn't want to actualy write -fn strange() -> bool { - let _x = ret true; -} +fn strange() -> bool { let _x = ret true; } fn funny() { - fn f(_x: ()) {} + fn f(_x: ()) { } f(ret); } @@ -15,21 +13,16 @@ fn odd() { } fn what() { - fn the(x: @mutable bool){ - ret while !*x { *x = true }; - } + fn the(x: @mutable bool) { ret while !*x { *x = true }; } let i = @mutable false; let dont = bind the(i); dont(); - assert *i; + assert (*i); } fn zombiejesus() { - do { while (ret) { if (ret) { - alt (ret) { _ { - ret ? ret : ret - }} - }}} while ret; + do { while (ret) { if (ret) { alt (ret) { _ { ret ? ret : ret } } } } } + while ret } fn notsure() { @@ -48,27 +41,18 @@ fn hammertime() -> int { fn canttouchthis() -> uint { pred p() -> bool { true } - let _a = (assert true) == (check p()); - let _c = (check p()) == (); + let _a = (assert (true)) == (check (p())); + let _c = (check (p())) == (); let _b = (log 0) == (ret 0u); } fn angrydome() { - while true { - if (break) { } - } + while true { if break { } } let i = 0; - do { - i += 1; - if i == 1 { - alt cont { _ { } } - } - } while false; + do { i += 1; if i == 1 { alt cont { _ { } } } } while false } -fn evil_lincoln() { - let evil <- log "lincoln"; -} +fn evil_lincoln() { let evil <- log "lincoln"; } fn main() { strange(); diff --git a/src/test/run-pass/writealias.rs b/src/test/run-pass/writealias.rs index 0f779478533..fb7bf4c163a 100644 --- a/src/test/run-pass/writealias.rs +++ b/src/test/run-pass/writealias.rs @@ -10,4 +10,4 @@ fn main() { let x: point = {x: 10, y: 11, mutable z: 12}; f(x); assert (x.z == 13); -} \ No newline at end of file +} diff --git a/src/test/run-pass/x86stdcall.rs b/src/test/run-pass/x86stdcall.rs index dcc525d652f..52f9d47cd78 100644 --- a/src/test/run-pass/x86stdcall.rs +++ b/src/test/run-pass/x86stdcall.rs @@ -14,4 +14,4 @@ fn main() { #[cfg(target_os = "macos")] #[cfg(target_os = "linux")] -fn main() { } \ No newline at end of file +fn main() { } diff --git a/src/test/run-pass/yield.rs b/src/test/run-pass/yield.rs index 8de4b6c411f..dd8d2a046b7 100644 --- a/src/test/run-pass/yield.rs +++ b/src/test/run-pass/yield.rs @@ -14,4 +14,4 @@ fn main() { join_id(other); } -fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; } \ No newline at end of file +fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; } diff --git a/src/test/run-pass/yield1.rs b/src/test/run-pass/yield1.rs index e53591dbe1a..9f5c326cc38 100644 --- a/src/test/run-pass/yield1.rs +++ b/src/test/run-pass/yield1.rs @@ -6,7 +6,8 @@ import std::task::*; fn main() { let c = child; let other = task::spawn(c); - log_err "1"; yield(); + log_err "1"; + yield(); join_id(other); } diff --git a/src/test/stdtest/bitv.rs b/src/test/stdtest/bitv.rs index 7666063239d..249a43be13b 100644 --- a/src/test/stdtest/bitv.rs +++ b/src/test/stdtest/bitv.rs @@ -18,9 +18,9 @@ fn test_0_elements() { fn test_1_element() { let act; act = bitv::create(1u, false); - assert (bitv::eq_vec(act, ~[0u])); + assert (bitv::eq_vec(act, [0u])); act = bitv::create(1u, true); - assert (bitv::eq_vec(act, ~[1u])); + assert (bitv::eq_vec(act, [1u])); } #[test] @@ -29,11 +29,11 @@ fn test_10_elements() { // all 0 act = bitv::create(10u, false); - assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(10u, true); - assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u])); + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(10u, false); @@ -42,7 +42,7 @@ fn test_10_elements() { bitv::set(act, 2u, true); bitv::set(act, 3u, true); bitv::set(act, 4u, true); - assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u])); + assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(10u, false); @@ -51,7 +51,7 @@ fn test_10_elements() { bitv::set(act, 7u, true); bitv::set(act, 8u, true); bitv::set(act, 9u, true); - assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u])); + assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(10u, false); @@ -59,7 +59,7 @@ fn test_10_elements() { bitv::set(act, 3u, true); bitv::set(act, 6u, true); bitv::set(act, 9u, true); - assert (bitv::eq_vec(act, ~[1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u])); + assert (bitv::eq_vec(act, [1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u])); } #[test] @@ -69,16 +69,16 @@ fn test_31_elements() { act = bitv::create(31u, false); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(31u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(31u, false); @@ -91,9 +91,9 @@ fn test_31_elements() { bitv::set(act, 6u, true); bitv::set(act, 7u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(31u, false); @@ -106,9 +106,9 @@ fn test_31_elements() { bitv::set(act, 22u, true); bitv::set(act, 23u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(31u, false); @@ -120,9 +120,9 @@ fn test_31_elements() { bitv::set(act, 29u, true); bitv::set(act, 30u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(31u, false); @@ -130,9 +130,9 @@ fn test_31_elements() { bitv::set(act, 17u, true); bitv::set(act, 30u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u])); + [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u])); } #[test] @@ -142,16 +142,16 @@ fn test_32_elements() { act = bitv::create(32u, false); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(32u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(32u, false); @@ -164,9 +164,9 @@ fn test_32_elements() { bitv::set(act, 6u, true); bitv::set(act, 7u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(32u, false); @@ -179,9 +179,9 @@ fn test_32_elements() { bitv::set(act, 22u, true); bitv::set(act, 23u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(32u, false); @@ -194,9 +194,9 @@ fn test_32_elements() { bitv::set(act, 30u, true); bitv::set(act, 31u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(32u, false); @@ -205,9 +205,9 @@ fn test_32_elements() { bitv::set(act, 30u, true); bitv::set(act, 31u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u, 1u])); + [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u, 1u])); } #[test] @@ -217,16 +217,16 @@ fn test_33_elements() { act = bitv::create(33u, false); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // all 1 act = bitv::create(33u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 1u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u, 1u])); // mixed act = bitv::create(33u, false); @@ -239,9 +239,9 @@ fn test_33_elements() { bitv::set(act, 6u, true); bitv::set(act, 7u, true); assert (bitv::eq_vec(act, - ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u])); + [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(33u, false); @@ -254,9 +254,9 @@ fn test_33_elements() { bitv::set(act, 22u, true); bitv::set(act, 23u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u])); // mixed act = bitv::create(33u, false); @@ -269,9 +269,9 @@ fn test_33_elements() { bitv::set(act, 30u, true); bitv::set(act, 31u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, - 1u, 1u, 1u, 1u, 1u, 1u, 0u])); + [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u, + 1u, 1u, 1u, 1u, 1u, 1u, 0u])); // mixed act = bitv::create(33u, false); @@ -281,8 +281,8 @@ fn test_33_elements() { bitv::set(act, 31u, true); bitv::set(act, 32u, true); assert (bitv::eq_vec(act, - ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, - 0u, 0u, 0u, 0u, 1u, 1u, 1u])); + [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, + 0u, 0u, 0u, 0u, 1u, 1u, 1u])); } diff --git a/src/test/stdtest/comm.rs b/src/test/stdtest/comm.rs index 7d20042e866..6b67acc51ea 100644 --- a/src/test/stdtest/comm.rs +++ b/src/test/stdtest/comm.rs @@ -15,7 +15,7 @@ fn send_recv() { comm::send(c, 42); let v = p.recv(); log_err v; - assert(42 == v); + assert (42 == v); } #[test] @@ -23,7 +23,7 @@ fn send_recv_fn() { let p = comm::port::<int>(); let c = comm::chan::<int>(p); comm::send(c, 42); - assert(comm::recv(p) == 42); + assert (comm::recv(p) == 42); } #[test] @@ -31,7 +31,7 @@ fn send_recv_fn_infer() { let p = comm::port(); let c = comm::chan(p); comm::send(c, 42); - assert(comm::recv(p) == 42); + assert (comm::recv(p) == 42); } #[test] diff --git a/src/test/stdtest/deque.rs b/src/test/stdtest/deque.rs index d751bd5c45d..acdde57b86e 100644 --- a/src/test/stdtest/deque.rs +++ b/src/test/stdtest/deque.rs @@ -79,7 +79,7 @@ fn test_boxes(a: @int, b: @int, c: @int, d: @int) { assert (deq.get(3) == d); } -type eqfn<T> = fn(&T, &T) -> bool ; +type eqfn<T> = fn(&T, &T) -> bool; fn test_parameterized<@T>(e: eqfn<T>, a: &T, b: &T, c: &T, d: &T) { let deq: deque::t<T> = deque::create::<T>(); @@ -175,15 +175,14 @@ fn test() { log "test parameterized: taggy"; let eq3: eqfn<taggy> = taggyeq; test_parameterized::<taggy>(eq3, one(1), two(1, 2), three(1, 2, 3), - two(17, 42)); + two(17, 42)); log "*** test parameterized: taggypar<int>"; let eq4: eqfn<taggypar<int>> = taggypareq::<int>; - test_parameterized::<taggypar<int>>(eq4, - onepar::<int>(1), - twopar::<int>(1, 2), - threepar::<int>(1, 2, 3), - twopar::<int>(17, 42)); + test_parameterized::<taggypar<int>>(eq4, onepar::<int>(1), + twopar::<int>(1, 2), + threepar::<int>(1, 2, 3), + twopar::<int>(17, 42)); log "*** end test parameterized: taggypar::<int>"; log "*** test parameterized: reccy"; diff --git a/src/test/stdtest/either.rs b/src/test/stdtest/either.rs index 21b8184f496..82724b1c09a 100644 --- a/src/test/stdtest/either.rs +++ b/src/test/stdtest/either.rs @@ -20,60 +20,60 @@ fn test_either_right() { #[test] fn test_lefts() { - let input = ~[left(10), right(11), left(12), right(13), left(14)]; + let input = [left(10), right(11), left(12), right(13), left(14)]; let result = lefts(input); - assert (result == ~[10, 12, 14]); + assert (result == [10, 12, 14]); } #[test] fn test_lefts_none() { - let input: [t<int, int>] = ~[right(10), right(10)]; + let input: [t<int, int>] = [right(10), right(10)]; let result = lefts(input); assert (len(result) == 0u); } #[test] fn test_lefts_empty() { - let input: [t<int, int>] = ~[]; + let input: [t<int, int>] = []; let result = lefts(input); assert (len(result) == 0u); } #[test] fn test_rights() { - let input = ~[left(10), right(11), left(12), right(13), left(14)]; + let input = [left(10), right(11), left(12), right(13), left(14)]; let result = rights(input); - assert (result == ~[11, 13]); + assert (result == [11, 13]); } #[test] fn test_rights_none() { - let input: [t<int, int>] = ~[left(10), left(10)]; + let input: [t<int, int>] = [left(10), left(10)]; let result = rights(input); assert (len(result) == 0u); } #[test] fn test_rights_empty() { - let input: [t<int, int>] = ~[]; + let input: [t<int, int>] = []; let result = rights(input); assert (len(result) == 0u); } #[test] fn test_partition() { - let input = ~[left(10), right(11), left(12), right(13), left(14)]; + let input = [left(10), right(11), left(12), right(13), left(14)]; let result = partition(input); - assert (result.lefts.(0) == 10); - assert (result.lefts.(1) == 12); - assert (result.lefts.(2) == 14); - assert (result.rights.(0) == 11); - assert (result.rights.(1) == 13); + assert (result.lefts[0] == 10); + assert (result.lefts[1] == 12); + assert (result.lefts[2] == 14); + assert (result.rights[0] == 11); + assert (result.rights[1] == 13); } #[test] fn test_partition_no_lefts() { - let input: [t<int, int>] = ~[right(10), right(11)]; + let input: [t<int, int>] = [right(10), right(11)]; let result = partition(input); assert (len(result.lefts) == 0u); assert (len(result.rights) == 2u); @@ -81,7 +81,7 @@ fn test_partition_no_lefts() { #[test] fn test_partition_no_rights() { - let input: [t<int, int>] = ~[left(10), left(11)]; + let input: [t<int, int>] = [left(10), left(11)]; let result = partition(input); assert (len(result.lefts) == 2u); assert (len(result.rights) == 0u); @@ -89,7 +89,7 @@ fn test_partition_no_rights() { #[test] fn test_partition_empty() { - let input: [t<int, int>] = ~[]; + let input: [t<int, int>] = []; let result = partition(input); assert (len(result.lefts) == 0u); assert (len(result.rights) == 0u); diff --git a/src/test/stdtest/getopts.rs b/src/test/stdtest/getopts.rs index 10acbafcb12..55d67729129 100644 --- a/src/test/stdtest/getopts.rs +++ b/src/test/stdtest/getopts.rs @@ -27,8 +27,8 @@ fn check_fail_type(f: opt::fail_, ft: fail_type) { // Tests for reqopt #[test] fn test_reqopt_long() { - let args = ~["--test=20"]; - let opts = ~[opt::reqopt("test")]; + let args = ["--test=20"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -41,8 +41,8 @@ fn test_reqopt_long() { #[test] fn test_reqopt_long_missing() { - let args = ~["blah"]; - let opts = ~[opt::reqopt("test")]; + let args = ["blah"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_missing); } @@ -52,8 +52,8 @@ fn test_reqopt_long_missing() { #[test] fn test_reqopt_long_no_arg() { - let args = ~["--test"]; - let opts = ~[opt::reqopt("test")]; + let args = ["--test"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -63,8 +63,8 @@ fn test_reqopt_long_no_arg() { #[test] fn test_reqopt_long_multi() { - let args = ~["--test=20", "--test=30"]; - let opts = ~[opt::reqopt("test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::reqopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -74,8 +74,8 @@ fn test_reqopt_long_multi() { #[test] fn test_reqopt_short() { - let args = ~["-t", "20"]; - let opts = ~[opt::reqopt("t")]; + let args = ["-t", "20"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -88,8 +88,8 @@ fn test_reqopt_short() { #[test] fn test_reqopt_short_missing() { - let args = ~["blah"]; - let opts = ~[opt::reqopt("t")]; + let args = ["blah"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_missing); } @@ -99,8 +99,8 @@ fn test_reqopt_short_missing() { #[test] fn test_reqopt_short_no_arg() { - let args = ~["-t"]; - let opts = ~[opt::reqopt("t")]; + let args = ["-t"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -110,8 +110,8 @@ fn test_reqopt_short_no_arg() { #[test] fn test_reqopt_short_multi() { - let args = ~["-t", "20", "-t", "30"]; - let opts = ~[opt::reqopt("t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::reqopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -123,8 +123,8 @@ fn test_reqopt_short_multi() { // Tests for optopt #[test] fn test_optopt_long() { - let args = ~["--test=20"]; - let opts = ~[opt::optopt("test")]; + let args = ["--test=20"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -137,8 +137,8 @@ fn test_optopt_long() { #[test] fn test_optopt_long_missing() { - let args = ~["blah"]; - let opts = ~[opt::optopt("test")]; + let args = ["blah"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "test")); } @@ -148,8 +148,8 @@ fn test_optopt_long_missing() { #[test] fn test_optopt_long_no_arg() { - let args = ~["--test"]; - let opts = ~[opt::optopt("test")]; + let args = ["--test"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -159,8 +159,8 @@ fn test_optopt_long_no_arg() { #[test] fn test_optopt_long_multi() { - let args = ~["--test=20", "--test=30"]; - let opts = ~[opt::optopt("test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::optopt("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -170,8 +170,8 @@ fn test_optopt_long_multi() { #[test] fn test_optopt_short() { - let args = ~["-t", "20"]; - let opts = ~[opt::optopt("t")]; + let args = ["-t", "20"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -184,8 +184,8 @@ fn test_optopt_short() { #[test] fn test_optopt_short_missing() { - let args = ~["blah"]; - let opts = ~[opt::optopt("t")]; + let args = ["blah"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "t")); } @@ -195,8 +195,8 @@ fn test_optopt_short_missing() { #[test] fn test_optopt_short_no_arg() { - let args = ~["-t"]; - let opts = ~[opt::optopt("t")]; + let args = ["-t"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -206,8 +206,8 @@ fn test_optopt_short_no_arg() { #[test] fn test_optopt_short_multi() { - let args = ~["-t", "20", "-t", "30"]; - let opts = ~[opt::optopt("t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::optopt("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -219,8 +219,8 @@ fn test_optopt_short_multi() { // Tests for optflag #[test] fn test_optflag_long() { - let args = ~["--test"]; - let opts = ~[opt::optflag("test")]; + let args = ["--test"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (opt::opt_present(m, "test")); } @@ -230,8 +230,8 @@ fn test_optflag_long() { #[test] fn test_optflag_long_missing() { - let args = ~["blah"]; - let opts = ~[opt::optflag("test")]; + let args = ["blah"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "test")); } @@ -241,8 +241,8 @@ fn test_optflag_long_missing() { #[test] fn test_optflag_long_arg() { - let args = ~["--test=20"]; - let opts = ~[opt::optflag("test")]; + let args = ["--test=20"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { @@ -255,8 +255,8 @@ fn test_optflag_long_arg() { #[test] fn test_optflag_long_multi() { - let args = ~["--test", "--test"]; - let opts = ~[opt::optflag("test")]; + let args = ["--test", "--test"]; + let opts = [opt::optflag("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -266,8 +266,8 @@ fn test_optflag_long_multi() { #[test] fn test_optflag_short() { - let args = ~["-t"]; - let opts = ~[opt::optflag("t")]; + let args = ["-t"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (opt::opt_present(m, "t")); } @@ -277,8 +277,8 @@ fn test_optflag_short() { #[test] fn test_optflag_short_missing() { - let args = ~["blah"]; - let opts = ~[opt::optflag("t")]; + let args = ["blah"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "t")); } @@ -288,14 +288,14 @@ fn test_optflag_short_missing() { #[test] fn test_optflag_short_arg() { - let args = ~["-t", "20"]; - let opts = ~[opt::optflag("t")]; + let args = ["-t", "20"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { // The next variable after the flag is just a free argument - assert (m.free.(0) == "20"); + assert (m.free[0] == "20"); } _ { fail; } } @@ -303,8 +303,8 @@ fn test_optflag_short_arg() { #[test] fn test_optflag_short_multi() { - let args = ~["-t", "-t"]; - let opts = ~[opt::optflag("t")]; + let args = ["-t", "-t"]; + let opts = [opt::optflag("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, option_duplicated); } @@ -316,8 +316,8 @@ fn test_optflag_short_multi() { // Tests for optmulti #[test] fn test_optmulti_long() { - let args = ~["--test=20"]; - let opts = ~[opt::optmulti("test")]; + let args = ["--test=20"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -330,8 +330,8 @@ fn test_optmulti_long() { #[test] fn test_optmulti_long_missing() { - let args = ~["blah"]; - let opts = ~[opt::optmulti("test")]; + let args = ["blah"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "test")); } @@ -341,8 +341,8 @@ fn test_optmulti_long_missing() { #[test] fn test_optmulti_long_no_arg() { - let args = ~["--test"]; - let opts = ~[opt::optmulti("test")]; + let args = ["--test"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -352,15 +352,15 @@ fn test_optmulti_long_no_arg() { #[test] fn test_optmulti_long_multi() { - let args = ~["--test=20", "--test=30"]; - let opts = ~[opt::optmulti("test")]; + let args = ["--test=20", "--test=30"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (opt::opt_present(m, "test")); assert (opt::opt_str(m, "test") == "20"); - assert (opt::opt_strs(m, "test").(0) == "20"); - assert (opt::opt_strs(m, "test").(1) == "30"); + assert (opt::opt_strs(m, "test")[0] == "20"); + assert (opt::opt_strs(m, "test")[1] == "30"); } _ { fail; } } @@ -368,8 +368,8 @@ fn test_optmulti_long_multi() { #[test] fn test_optmulti_short() { - let args = ~["-t", "20"]; - let opts = ~[opt::optmulti("t")]; + let args = ["-t", "20"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { @@ -382,8 +382,8 @@ fn test_optmulti_short() { #[test] fn test_optmulti_short_missing() { - let args = ~["blah"]; - let opts = ~[opt::optmulti("t")]; + let args = ["blah"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (!opt::opt_present(m, "t")); } @@ -393,8 +393,8 @@ fn test_optmulti_short_missing() { #[test] fn test_optmulti_short_no_arg() { - let args = ~["-t"]; - let opts = ~[opt::optmulti("t")]; + let args = ["-t"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, argument_missing); } @@ -404,15 +404,15 @@ fn test_optmulti_short_no_arg() { #[test] fn test_optmulti_short_multi() { - let args = ~["-t", "20", "-t", "30"]; - let opts = ~[opt::optmulti("t")]; + let args = ["-t", "20", "-t", "30"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { assert (opt::opt_present(m, "t")); assert (opt::opt_str(m, "t") == "20"); - assert (opt::opt_strs(m, "t").(0) == "20"); - assert (opt::opt_strs(m, "t").(1) == "30"); + assert (opt::opt_strs(m, "t")[0] == "20"); + assert (opt::opt_strs(m, "t")[1] == "30"); } _ { fail; } } @@ -420,8 +420,8 @@ fn test_optmulti_short_multi() { #[test] fn test_unrecognized_option_long() { - let args = ~["--untest"]; - let opts = ~[opt::optmulti("t")]; + let args = ["--untest"]; + let opts = [opt::optmulti("t")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, unrecognized_option); } @@ -431,8 +431,8 @@ fn test_unrecognized_option_long() { #[test] fn test_unrecognized_option_short() { - let args = ~["-t"]; - let opts = ~[opt::optmulti("test")]; + let args = ["-t"]; + let opts = [opt::optmulti("test")]; let rs = opt::getopts(args, opts); alt rs { opt::failure(f) { check_fail_type(f, unrecognized_option); } @@ -443,23 +443,23 @@ fn test_unrecognized_option_short() { #[test] fn test_combined() { let args = - ~["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f", + ["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f", "-m", "40", "-m", "50"]; let opts = - ~[opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"), + [opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"), opt::optflag("f"), opt::optmulti("m"), opt::optopt("notpresent")]; let rs = opt::getopts(args, opts); alt rs { opt::success(m) { - assert (m.free.(0) == "prog"); - assert (m.free.(1) == "free1"); + assert (m.free[0] == "prog"); + assert (m.free[1] == "free1"); assert (opt::opt_str(m, "s") == "20"); - assert (m.free.(2) == "free2"); + assert (m.free[2] == "free2"); assert (opt::opt_present(m, "flag")); assert (opt::opt_str(m, "long") == "30"); assert (opt::opt_present(m, "f")); - assert (opt::opt_strs(m, "m").(0) == "40"); - assert (opt::opt_strs(m, "m").(1) == "50"); + assert (opt::opt_strs(m, "m")[0] == "40"); + assert (opt::opt_strs(m, "m")[1] == "50"); assert (!opt::opt_present(m, "notpresent")); } _ { fail; } diff --git a/src/test/stdtest/int.rs b/src/test/stdtest/int.rs index 936b1fa91d3..61d3448a175 100644 --- a/src/test/stdtest/int.rs +++ b/src/test/stdtest/int.rs @@ -22,4 +22,4 @@ fn test_pow() { assert (int::pow(-3, 2u) == 9); assert (int::pow(-3, 3u) == -27); assert (int::pow(4, 9u) == 262144); -} \ No newline at end of file +} diff --git a/src/test/stdtest/io.rs b/src/test/stdtest/io.rs index 002592d9020..08330c619fc 100644 --- a/src/test/stdtest/io.rs +++ b/src/test/stdtest/io.rs @@ -13,7 +13,7 @@ fn test_simple() { log frood; { let out: io::writer = - io::file_writer(tmpfile, ~[io::create, io::truncate]); + io::file_writer(tmpfile, [io::create, io::truncate]); out.write_str(frood); } let inp: io::reader = io::file_reader(tmpfile); diff --git a/src/test/stdtest/list.rs b/src/test/stdtest/list.rs index 4a44508efc4..9e05115a4f8 100644 --- a/src/test/stdtest/list.rs +++ b/src/test/stdtest/list.rs @@ -8,7 +8,7 @@ import std::option; #[test] fn test_from_vec() { - let l = from_vec(~[0, 1, 2]); + let l = from_vec([0, 1, 2]); assert (car(l) == 0); assert (car(cdr(l)) == 1); assert (car(cdr(cdr(l))) == 2); @@ -16,7 +16,7 @@ fn test_from_vec() { #[test] fn test_foldl() { - let l = from_vec(~[0, 1, 2, 3, 4]); + let l = from_vec([0, 1, 2, 3, 4]); fn add(a: &int, b: &uint) -> uint { ret (a as uint) + b; } let rs = list::foldl(l, 0u, add); assert (rs == 10u); @@ -24,7 +24,7 @@ fn test_foldl() { #[test] fn test_find_success() { - let l = from_vec(~[0, 1, 2]); + let l = from_vec([0, 1, 2]); fn match(i: &int) -> option::t<int> { ret if i == 2 { option::some(i) } else { option::none::<int> }; } @@ -34,7 +34,7 @@ fn test_find_success() { #[test] fn test_find_fail() { - let l = from_vec(~[0, 1, 2]); + let l = from_vec([0, 1, 2]); fn match(i: &int) -> option::t<int> { ret option::none::<int>; } let rs = list::find(l, match); assert (rs == option::none::<int>); @@ -42,7 +42,7 @@ fn test_find_fail() { #[test] fn test_has() { - let l = from_vec(~[5, 8, 6]); + let l = from_vec([5, 8, 6]); let empty = list::nil::<int>; assert (list::has(l, 5)); assert (!list::has(l, 7)); @@ -52,7 +52,7 @@ fn test_has() { #[test] fn test_length() { - let l = from_vec(~[0, 1, 2]); + let l = from_vec([0, 1, 2]); assert (list::length(l) == 3u); } diff --git a/src/test/stdtest/net.rs b/src/test/stdtest/net.rs index c1a26cb747d..9da7a12a060 100644 --- a/src/test/stdtest/net.rs +++ b/src/test/stdtest/net.rs @@ -3,10 +3,10 @@ import std::net; #[test] fn test_format_ip() { - assert(net::format_addr(net::ipv4(127u8,0u8,0u8,1u8)) == "127.0.0.1") + assert (net::format_addr(net::ipv4(127u8, 0u8, 0u8, 1u8)) == "127.0.0.1") } #[test] fn test_parse_ip() { - assert(net::parse_addr("127.0.0.1") == net::ipv4(127u8,0u8,0u8,1u8)); + assert (net::parse_addr("127.0.0.1") == net::ipv4(127u8, 0u8, 0u8, 1u8)); } diff --git a/src/test/stdtest/path.rs b/src/test/stdtest/path.rs index 5f7c34c5e05..911bc6b0dd9 100644 --- a/src/test/stdtest/path.rs +++ b/src/test/stdtest/path.rs @@ -14,4 +14,4 @@ fn test() { log fs::make_absolute("test-path"); log fs::make_absolute("/usr/bin"); -} \ No newline at end of file +} diff --git a/src/test/stdtest/ptr.rs b/src/test/stdtest/ptr.rs index 269febfc6b7..ef0ffa54a04 100644 --- a/src/test/stdtest/ptr.rs +++ b/src/test/stdtest/ptr.rs @@ -9,10 +9,10 @@ fn test() { let p = {mutable fst: 10, mutable snd: 20}; let pptr: *mutable pair = ptr::addr_of(p); let iptr: *mutable int = unsafe::reinterpret_cast(pptr); - assert (*iptr == 10); + assert (*iptr == 10);; *iptr = 30; assert (*iptr == 30); - assert (p.fst == 30); + assert (p.fst == 30);; *pptr = {mutable fst: 50, mutable snd: 60}; assert (*iptr == 50); diff --git a/src/test/stdtest/qsort.rs b/src/test/stdtest/qsort.rs index 4e557b533a4..250d77a4593 100644 --- a/src/test/stdtest/qsort.rs +++ b/src/test/stdtest/qsort.rs @@ -11,30 +11,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) { let f = ltequal; std::sort::quick_sort::<int>(f, v1); let i = 0u; - while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; } + while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; } } #[test] fn test() { { - let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8]; - let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9]; + let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8]; + let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9]; check_sort(v1, v2); } { - let v1 = ~[mutable 1, 1, 1]; - let v2 = ~[mutable 1, 1, 1]; + let v1 = [mutable 1, 1, 1]; + let v2 = [mutable 1, 1, 1]; check_sort(v1, v2); } { - let v1: [mutable int] = ~[mutable ]; - let v2: [mutable int] = ~[mutable ]; + let v1: [mutable int] = [mutable]; + let v2: [mutable int] = [mutable]; check_sort(v1, v2); } - { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); } + { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); } { - let v1 = ~[mutable 9, 3, 3, 3, 9]; - let v2 = ~[mutable 3, 3, 3, 9, 9]; + let v1 = [mutable 9, 3, 3, 3, 9]; + let v2 = [mutable 3, 3, 3, 9, 9]; check_sort(v1, v2); } } @@ -42,18 +42,15 @@ fn test() { // Regression test for #705 #[test] fn test_simple() { - let names = ~[mutable 2, 1, 3]; + let names = [mutable 2, 1, 3]; - let expected = ~[1, 2, 3]; + let expected = [1, 2, 3]; fn lteq(a: &int, b: &int) -> bool { int::le(a, b) } sort::quick_sort(lteq, names); let pairs = vec::zip(expected, vec::from_mut(names)); - for (a, b) in pairs { - log #fmt("%d %d", a, b); - assert (a == b); - } + for (a, b) in pairs { log #fmt["%d %d", a, b]; assert (a == b); } } // Local Variables: diff --git a/src/test/stdtest/qsort3.rs b/src/test/stdtest/qsort3.rs index 21f43218806..6c8df212218 100644 --- a/src/test/stdtest/qsort3.rs +++ b/src/test/stdtest/qsort3.rs @@ -9,30 +9,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) { let f2 = equal; std::sort::quick_sort3::<int>(f1, f2, v1); let i = 0u; - while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; } + while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; } } #[test] fn test() { { - let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8]; - let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9]; + let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8]; + let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9]; check_sort(v1, v2); } { - let v1 = ~[mutable 1, 1, 1]; - let v2 = ~[mutable 1, 1, 1]; + let v1 = [mutable 1, 1, 1]; + let v2 = [mutable 1, 1, 1]; check_sort(v1, v2); } { - let v1: [mutable int] = ~[mutable ]; - let v2: [mutable int] = ~[mutable ]; + let v1: [mutable int] = [mutable]; + let v2: [mutable int] = [mutable]; check_sort(v1, v2); } - { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); } + { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); } { - let v1 = ~[mutable 9, 3, 3, 3, 9]; - let v2 = ~[mutable 3, 3, 3, 9, 9]; + let v1 = [mutable 9, 3, 3, 3, 9]; + let v2 = [mutable 3, 3, 3, 9, 9]; check_sort(v1, v2); } } diff --git a/src/test/stdtest/rand.rs b/src/test/stdtest/rand.rs index bf394602fab..a8f13ed6704 100644 --- a/src/test/stdtest/rand.rs +++ b/src/test/stdtest/rand.rs @@ -26,4 +26,4 @@ fn test() { } log r1.next(); log r1.next(); -} \ No newline at end of file +} diff --git a/src/test/stdtest/run.rs b/src/test/stdtest/run.rs index 7476cb6621b..b60a3935500 100644 --- a/src/test/stdtest/run.rs +++ b/src/test/stdtest/run.rs @@ -11,9 +11,9 @@ import std::vec; #[cfg(target_os = "macos")] #[test] fn test_leaks() { - run::run_program("echo", ~[]); - run::start_program("echo", ~[]); - run::program_output("echo", ~[]); + run::run_program("echo", []); + run::start_program("echo", []); + run::program_output("echo", []); } // FIXME @@ -28,8 +28,8 @@ fn test_pipes() { let pipe_out = os::pipe(); let pipe_err = os::pipe(); - let pid = run::spawn_process("cat", ~[], - pipe_in.in, pipe_out.out, pipe_err.out); + let pid = + run::spawn_process("cat", [], pipe_in.in, pipe_out.out, pipe_err.out); os::libc::close(pipe_in.in); os::libc::close(pipe_out.out); os::libc::close(pipe_err.out); @@ -43,11 +43,10 @@ fn test_pipes() { log expected; log actual; - assert expected == actual; + assert (expected == actual); fn writeclose(fd: int, s: &str) { - let writer = io::new_writer( - io::fd_buf_writer(fd, option::none)); + let writer = io::new_writer(io::fd_buf_writer(fd, option::none)); writer.write_str(s); os::libc::close(fd); @@ -56,8 +55,7 @@ fn test_pipes() { fn readclose(fd: int) -> str { // Copied from run::program_output let file = os::fd_FILE(fd); - let reader = io::new_reader( - io::FILE_buf_reader(file, option::none)); + let reader = io::new_reader(io::FILE_buf_reader(file, option::none)); let buf = ""; while !reader.eof() { let bytes = reader.read_bytes(4096u); @@ -66,4 +64,4 @@ fn test_pipes() { os::libc::fclose(file); ret buf; } -} \ No newline at end of file +} diff --git a/src/test/stdtest/sha1.rs b/src/test/stdtest/sha1.rs index 74729fa52ae..6b72be20dd5 100644 --- a/src/test/stdtest/sha1.rs +++ b/src/test/stdtest/sha1.rs @@ -20,53 +20,43 @@ fn test() { // Test messages from FIPS 180-1 let fips_180_1_tests: [test] = - ~[{input: "abc", + [{input: "abc", output: - ~[0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, - 0x47u8, 0x06u8, 0x81u8, 0x6Au8, - 0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, - 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8, - 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]}, + [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8, + 0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8, + 0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]}, {input: "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq", output: - ~[0x84u8, 0x98u8, 0x3Eu8, 0x44u8, - 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8, - 0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, - 0xF9u8, 0x51u8, 0x29u8, 0xE5u8, - 0xE5u8, 0x46u8, 0x70u8, 0xF1u8]}, + [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8, + 0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, 0xE5u8, + 0xE5u8, 0x46u8, 0x70u8, 0xF1u8]}, {input: a_million_letter_a(), output: - ~[0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, - 0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8, - 0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8, - 0xDBu8, 0xADu8, 0x27u8, 0x31u8, - 0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}]; + [0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8, + 0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8, 0xDBu8, 0xADu8, 0x27u8, 0x31u8, + 0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}]; // Examples from wikipedia let wikipedia_tests: [test] = - ~[{input: "The quick brown fox jumps over the lazy dog", + [{input: "The quick brown fox jumps over the lazy dog", output: - ~[0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, - 0x7au8, 0x2du8, 0x28u8, 0xfcu8, - 0xedu8, 0x84u8, 0x9eu8, 0xe1u8, - 0xbbu8, 0x76u8, 0xe7u8, 0x39u8, - 0x1bu8, 0x93u8, 0xebu8, 0x12u8]}, + [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8, + 0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, 0x39u8, + 0x1bu8, 0x93u8, 0xebu8, 0x12u8]}, {input: "The quick brown fox jumps over the lazy cog", output: - ~[0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, - 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8, - 0xfau8, 0xd3u8, 0xe8u8, 0x5au8, - 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8, - 0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}]; + [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8, + 0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8, + 0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}]; let tests = fips_180_1_tests + wikipedia_tests; fn check_vec_eq(v0: &[u8], v1: &[u8]) { assert (vec::len::<u8>(v0) == vec::len::<u8>(v1)); let len = vec::len::<u8>(v0); let i = 0u; while i < len { - let a = v0.(i); - let b = v1.(i); + let a = v0[i]; + let b = v1[i]; assert (a == b); i += 1u; } diff --git a/src/test/stdtest/sort.rs b/src/test/stdtest/sort.rs index be15881e65a..c42f950ce6b 100644 --- a/src/test/stdtest/sort.rs +++ b/src/test/stdtest/sort.rs @@ -7,22 +7,22 @@ fn check_sort(v1: &[int], v2: &[int]) { let f = lteq; let v3 = std::sort::merge_sort::<int>(f, v1); let i = 0u; - while i < len { log v3.(i); assert (v3.(i) == v2.(i)); i += 1u; } + while i < len { log v3[i]; assert (v3[i] == v2[i]); i += 1u; } } #[test] fn test() { { - let v1 = ~[3, 7, 4, 5, 2, 9, 5, 8]; - let v2 = ~[2, 3, 4, 5, 5, 7, 8, 9]; + let v1 = [3, 7, 4, 5, 2, 9, 5, 8]; + let v2 = [2, 3, 4, 5, 5, 7, 8, 9]; check_sort(v1, v2); } - { let v1 = ~[1, 1, 1]; let v2 = ~[1, 1, 1]; check_sort(v1, v2); } - { let v1: [int] = ~[]; let v2: [int] = ~[]; check_sort(v1, v2); } - { let v1 = ~[9]; let v2 = ~[9]; check_sort(v1, v2); } + { let v1 = [1, 1, 1]; let v2 = [1, 1, 1]; check_sort(v1, v2); } + { let v1: [int] = []; let v2: [int] = []; check_sort(v1, v2); } + { let v1 = [9]; let v2 = [9]; check_sort(v1, v2); } { - let v1 = ~[9, 3, 3, 3, 9]; - let v2 = ~[3, 3, 3, 9, 9]; + let v1 = [9, 3, 3, 3, 9]; + let v2 = [3, 3, 3, 9, 9]; check_sort(v1, v2); } } diff --git a/src/test/stdtest/str.rs b/src/test/stdtest/str.rs index 8124e565f6a..ef225c82fd8 100644 --- a/src/test/stdtest/str.rs +++ b/src/test/stdtest/str.rs @@ -30,8 +30,8 @@ fn test_split() { let v = str::split(s, c as u8); log "split to: "; for z: str in v { log z; } - log "comparing: " + v.(i) + " vs. " + k; - assert (str::eq(v.(i), k)); + log "comparing: " + v[i] + " vs. " + k; + assert (str::eq(v[i], k)); } t("abc.hello.there", '.', 0, "abc"); t("abc.hello.there", '.', 1, "hello"); @@ -70,10 +70,10 @@ fn test_substr() { #[test] fn test_concat() { fn t(v: &[str], s: &str) { assert (str::eq(str::concat(v), s)); } - t(~["you", "know", "I'm", "no", "good"], "youknowI'mnogood"); - let v: [str] = ~[]; + t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood"); + let v: [str] = []; t(v, ""); - t(~["hi"], "hi"); + t(["hi"], "hi"); } #[test] @@ -81,10 +81,10 @@ fn test_connect() { fn t(v: &[str], sep: &str, s: &str) { assert (str::eq(str::connect(v, sep), s)); } - t(~["you", "know", "I'm", "no", "good"], " ", "you know I'm no good"); - let v: [str] = ~[]; + t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good"); + let v: [str] = []; t(v, " ", ""); - t(~["hi"], " ", "hi"); + t(["hi"], " ", "hi"); } #[test] @@ -164,41 +164,41 @@ fn test_char_slice() { #[test] fn trim_left() { - assert str::trim_left("") == ""; - assert str::trim_left("a") == "a"; - assert str::trim_left(" ") == ""; - assert str::trim_left(" blah") == "blah"; - assert str::trim_left(" \u3000 wut") == "wut"; - assert str::trim_left("hey ") == "hey "; + assert (str::trim_left("") == ""); + assert (str::trim_left("a") == "a"); + assert (str::trim_left(" ") == ""); + assert (str::trim_left(" blah") == "blah"); + assert (str::trim_left(" \u3000 wut") == "wut"); + assert (str::trim_left("hey ") == "hey "); } #[test] fn trim_right() { - assert str::trim_right("") == ""; - assert str::trim_right("a") == "a"; - assert str::trim_right(" ") == ""; - assert str::trim_right("blah ") == "blah"; - assert str::trim_right("wut \u3000 ") == "wut"; - assert str::trim_right(" hey") == " hey"; + assert (str::trim_right("") == ""); + assert (str::trim_right("a") == "a"); + assert (str::trim_right(" ") == ""); + assert (str::trim_right("blah ") == "blah"); + assert (str::trim_right("wut \u3000 ") == "wut"); + assert (str::trim_right(" hey") == " hey"); } #[test] fn trim() { - assert str::trim("") == ""; - assert str::trim("a") == "a"; - assert str::trim(" ") == ""; - assert str::trim(" blah ") == "blah"; - assert str::trim("\nwut \u3000 ") == "wut"; - assert str::trim(" hey dude ") == "hey dude"; + assert (str::trim("") == ""); + assert (str::trim("a") == "a"); + assert (str::trim(" ") == ""); + assert (str::trim(" blah ") == "blah"); + assert (str::trim("\nwut \u3000 ") == "wut"); + assert (str::trim(" hey dude ") == "hey dude"); } #[test] fn is_whitespace() { - assert str::is_whitespace(""); - assert str::is_whitespace(" "); - assert str::is_whitespace("\u2009"); // Thin space - assert str::is_whitespace(" \n\t "); - assert !str::is_whitespace(" _ "); + assert (str::is_whitespace("")); + assert (str::is_whitespace(" ")); + assert (str::is_whitespace("\u2009")); // Thin space + assert (str::is_whitespace(" \n\t ")); + assert (!str::is_whitespace(" _ ")); } // Local Variables: diff --git a/src/test/stdtest/str_buf.rs b/src/test/stdtest/str_buf.rs index 6b013ed8db2..8bb040dde9c 100644 --- a/src/test/stdtest/str_buf.rs +++ b/src/test/stdtest/str_buf.rs @@ -12,4 +12,4 @@ fn test() { assert (str::eq(s_cstr, s)); let s_buf = str::str_from_buf(sb, 5u); assert (str::eq(s_buf, s)); -} \ No newline at end of file +} diff --git a/src/test/stdtest/task.rs b/src/test/stdtest/task.rs index 517210b9c56..d30d6addd0b 100644 --- a/src/test/stdtest/task.rs +++ b/src/test/stdtest/task.rs @@ -37,7 +37,7 @@ fn test_lib_spawn() { #[test] fn test_lib_spawn2() { - fn foo(x : int) { assert(x == 42); } + fn foo(x: int) { assert (x == 42); } task::_spawn(bind foo(42)); } @@ -52,7 +52,7 @@ fn test_join_chan() { log_err "received task status message"; log_err s; alt s { - task::exit(_, task::tr_success.) { /* yay! */ } + task::exit(_, task::tr_success.) {/* yay! */ } _ { fail "invalid task status received" } } } @@ -68,7 +68,7 @@ fn test_join_chan_fail() { log_err "received task status message"; log_err s; alt s { - task::exit(_, task::tr_failure.) { /* yay! */ } + task::exit(_, task::tr_failure.) {/* yay! */ } _ { fail "invalid task status received" } } } @@ -78,5 +78,5 @@ fn test_join_convenient() { fn winner() { } let f = winner; let handle = task::spawn_joinable(f); - assert(task::tr_success == task::join(handle)); + assert (task::tr_success == task::join(handle)); } diff --git a/src/test/stdtest/test.rs b/src/test/stdtest/test.rs index e85829b4477..e32105c2f0a 100644 --- a/src/test/stdtest/test.rs +++ b/src/test/stdtest/test.rs @@ -26,7 +26,7 @@ fn ignored_tests_result_in_ignored() { #[test] fn first_free_arg_should_be_a_filter() { - let args = ~["progname", "filter"]; + let args = ["progname", "filter"]; check (vec::is_not_empty(args)); let opts = alt test::parse_opts(args) { either::left(o) { o } }; assert (str::eq("filter", option::get(opts.filter))); @@ -34,7 +34,7 @@ fn first_free_arg_should_be_a_filter() { #[test] fn parse_ignored_flag() { - let args = ~["progname", "filter", "--ignored"]; + let args = ["progname", "filter", "--ignored"]; check (vec::is_not_empty(args)); let opts = alt test::parse_opts(args) { either::left(o) { o } }; assert (opts.run_ignored); @@ -47,13 +47,13 @@ fn filter_for_ignored_option() { let opts = {filter: option::none, run_ignored: true}; let tests = - ~[{name: "1", fn: fn () { }, ignore: true}, - {name: "2", fn: fn () { }, ignore: false}]; + [{name: "1", fn: fn () { }, ignore: true}, + {name: "2", fn: fn () { }, ignore: false}]; let filtered = test::filter_tests(opts, tests); assert (vec::len(filtered) == 1u); - assert (filtered.(0).name == "1"); - assert (filtered.(0).ignore == false); + assert (filtered[0].name == "1"); + assert (filtered[0].ignore == false); } #[test] @@ -61,37 +61,35 @@ fn sort_tests() { let opts = {filter: option::none, run_ignored: false}; let names = - ~["sha1::test", "int::test_to_str", "int::test_pow", - "test::do_not_run_ignored_tests", - "test::ignored_tests_result_in_ignored", - "test::first_free_arg_should_be_a_filter", - "test::parse_ignored_flag", "test::filter_for_ignored_option", - "test::sort_tests"]; + ["sha1::test", "int::test_to_str", "int::test_pow", + "test::do_not_run_ignored_tests", + "test::ignored_tests_result_in_ignored", + "test::first_free_arg_should_be_a_filter", + "test::parse_ignored_flag", "test::filter_for_ignored_option", + "test::sort_tests"]; let tests = { let testfn = fn () { }; - let tests = ~[]; + let tests = []; for name: str in names { let test = {name: name, fn: testfn, ignore: false}; - tests += ~[test]; + tests += [test]; } tests }; let filtered = test::filter_tests(opts, tests); let expected = - ~["int::test_pow", "int::test_to_str", "sha1::test", - "test::do_not_run_ignored_tests", "test::filter_for_ignored_option", - "test::first_free_arg_should_be_a_filter", - "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag", - "test::sort_tests"]; + ["int::test_pow", "int::test_to_str", "sha1::test", + "test::do_not_run_ignored_tests", "test::filter_for_ignored_option", + "test::first_free_arg_should_be_a_filter", + "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag", + "test::sort_tests"]; let pairs = vec::zip(expected, filtered); - for (a, b) in pairs { - assert (a == b.name); - } + for (a, b) in pairs { assert (a == b.name); } } // Local Variables: diff --git a/src/test/stdtest/uint.rs b/src/test/stdtest/uint.rs index 8b450b8a5ff..7361c76b70b 100644 --- a/src/test/stdtest/uint.rs +++ b/src/test/stdtest/uint.rs @@ -46,4 +46,4 @@ fn test_next_power_of_two() { assert (uint::next_power_of_two(37u) == 64u); assert (uint::next_power_of_two(38u) == 64u); assert (uint::next_power_of_two(39u) == 64u); -} \ No newline at end of file +} diff --git a/src/test/stdtest/vec.rs b/src/test/stdtest/vec.rs index 75b3998e28c..1ffe3982cd2 100644 --- a/src/test/stdtest/vec.rs +++ b/src/test/stdtest/vec.rs @@ -20,7 +20,7 @@ fn add(x: &uint, y: &uint) -> uint { ret x + y; } #[test] fn test_reserve_and_on_heap() { - let v: [int] = ~[1, 2]; + let v: [int] = [1, 2]; assert (!vec::on_heap(v)); vec::reserve(v, 8u); assert (vec::on_heap(v)); @@ -29,26 +29,26 @@ fn test_reserve_and_on_heap() { #[test] fn test_unsafe_ptrs() { // Test on-stack copy-from-buf. - let a = ~[1, 2, 3]; + let a = [1, 2, 3]; let ptr = vec::to_ptr(a); - let b = ~[]; + let b = []; vec::unsafe::copy_from_buf(b, ptr, 3u); assert (vec::len(b) == 3u); - assert (b.(0) == 1); - assert (b.(1) == 2); - assert (b.(2) == 3); + assert (b[0] == 1); + assert (b[1] == 2); + assert (b[2] == 3); // Test on-heap copy-from-buf. - let c = ~[1, 2, 3, 4, 5]; + let c = [1, 2, 3, 4, 5]; ptr = vec::to_ptr(c); - let d = ~[]; + let d = []; vec::unsafe::copy_from_buf(d, ptr, 5u); assert (vec::len(d) == 5u); - assert (d.(0) == 1); - assert (d.(1) == 2); - assert (d.(2) == 3); - assert (d.(3) == 4); - assert (d.(4) == 5); + assert (d[0] == 1); + assert (d[1] == 2); + assert (d[2] == 3); + assert (d[3] == 4); + assert (d[4] == 5); } #[test] @@ -56,18 +56,18 @@ fn test_init_fn() { // Test on-stack init_fn. let v = vec::init_fn(square, 3u); assert (vec::len(v) == 3u); - assert (v.(0) == 0u); - assert (v.(1) == 1u); - assert (v.(2) == 4u); + assert (v[0] == 0u); + assert (v[1] == 1u); + assert (v[2] == 4u); // Test on-heap init_fn. v = vec::init_fn(square, 5u); assert (vec::len(v) == 5u); - assert (v.(0) == 0u); - assert (v.(1) == 1u); - assert (v.(2) == 4u); - assert (v.(3) == 9u); - assert (v.(4) == 16u); + assert (v[0] == 0u); + assert (v[1] == 1u); + assert (v[2] == 4u); + assert (v[3] == 9u); + assert (v[4] == 16u); } #[test] @@ -75,194 +75,194 @@ fn test_init_elt() { // Test on-stack init_elt. let v = vec::init_elt(10u, 2u); assert (vec::len(v) == 2u); - assert (v.(0) == 10u); - assert (v.(1) == 10u); + assert (v[0] == 10u); + assert (v[1] == 10u); // Test on-heap init_elt. v = vec::init_elt(20u, 6u); - assert (v.(0) == 20u); - assert (v.(1) == 20u); - assert (v.(2) == 20u); - assert (v.(3) == 20u); - assert (v.(4) == 20u); - assert (v.(5) == 20u); + assert (v[0] == 20u); + assert (v[1] == 20u); + assert (v[2] == 20u); + assert (v[3] == 20u); + assert (v[4] == 20u); + assert (v[5] == 20u); } #[test] fn test_is_empty() { - assert (vec::is_empty::<int>(~[])); - assert (!vec::is_empty(~[0])); + assert (vec::is_empty::<int>([])); + assert (!vec::is_empty([0])); } #[test] fn test_is_not_empty() { - assert (vec::is_not_empty(~[0])); - assert (!vec::is_not_empty::<int>(~[])); + assert (vec::is_not_empty([0])); + assert (!vec::is_not_empty::<int>([])); } #[test] fn test_head() { - let a = ~[11, 12]; + let a = [11, 12]; check (vec::is_not_empty(a)); assert (vec::head(a) == 11); } #[test] fn test_tail() { - let a = ~[11]; + let a = [11]; check (vec::is_not_empty(a)); - assert (vec::tail(a) == ~[]); + assert (vec::tail(a) == []); - a = ~[11, 12]; + a = [11, 12]; check (vec::is_not_empty(a)); - assert (vec::tail(a) == ~[12]); + assert (vec::tail(a) == [12]); } #[test] fn test_last() { - let n = vec::last(~[]); + let n = vec::last([]); assert (n == none); - n = vec::last(~[1, 2, 3]); + n = vec::last([1, 2, 3]); assert (n == some(3)); - n = vec::last(~[1, 2, 3, 4, 5]); + n = vec::last([1, 2, 3, 4, 5]); assert (n == some(5)); } #[test] fn test_slice() { // Test on-stack -> on-stack slice. - let v = vec::slice(~[1, 2, 3], 1u, 3u); + let v = vec::slice([1, 2, 3], 1u, 3u); assert (vec::len(v) == 2u); - assert (v.(0) == 2); - assert (v.(1) == 3); + assert (v[0] == 2); + assert (v[1] == 3); // Test on-heap -> on-stack slice. - v = vec::slice(~[1, 2, 3, 4, 5], 0u, 3u); + v = vec::slice([1, 2, 3, 4, 5], 0u, 3u); assert (vec::len(v) == 3u); - assert (v.(0) == 1); - assert (v.(1) == 2); - assert (v.(2) == 3); + assert (v[0] == 1); + assert (v[1] == 2); + assert (v[2] == 3); // Test on-heap -> on-heap slice. - v = vec::slice(~[1, 2, 3, 4, 5, 6], 1u, 6u); + v = vec::slice([1, 2, 3, 4, 5, 6], 1u, 6u); assert (vec::len(v) == 5u); - assert (v.(0) == 2); - assert (v.(1) == 3); - assert (v.(2) == 4); - assert (v.(3) == 5); - assert (v.(4) == 6); + assert (v[0] == 2); + assert (v[1] == 3); + assert (v[2] == 4); + assert (v[3] == 5); + assert (v[4] == 6); } #[test] fn test_pop() { // Test on-stack pop. - let v = ~[1, 2, 3]; + let v = [1, 2, 3]; let e = vec::pop(v); assert (vec::len(v) == 2u); - assert (v.(0) == 1); - assert (v.(1) == 2); + assert (v[0] == 1); + assert (v[1] == 2); assert (e == 3); // Test on-heap pop. - v = ~[1, 2, 3, 4, 5]; + v = [1, 2, 3, 4, 5]; e = vec::pop(v); assert (vec::len(v) == 4u); - assert (v.(0) == 1); - assert (v.(1) == 2); - assert (v.(2) == 3); - assert (v.(3) == 4); + assert (v[0] == 1); + assert (v[1] == 2); + assert (v[2] == 3); + assert (v[3] == 4); assert (e == 5); } #[test] fn test_grow() { // Test on-stack grow(). - let v = ~[]; + let v = []; vec::grow(v, 2u, 1); assert (vec::len(v) == 2u); - assert (v.(0) == 1); - assert (v.(1) == 1); + assert (v[0] == 1); + assert (v[1] == 1); // Test on-heap grow(). vec::grow(v, 3u, 2); assert (vec::len(v) == 5u); - assert (v.(0) == 1); - assert (v.(1) == 1); - assert (v.(2) == 2); - assert (v.(3) == 2); - assert (v.(4) == 2); + assert (v[0] == 1); + assert (v[1] == 1); + assert (v[2] == 2); + assert (v[3] == 2); + assert (v[4] == 2); } #[test] fn test_grow_fn() { - let v = ~[]; + let v = []; vec::grow_fn(v, 3u, square); assert (vec::len(v) == 3u); - assert (v.(0) == 0u); - assert (v.(1) == 1u); - assert (v.(2) == 4u); + assert (v[0] == 0u); + assert (v[1] == 1u); + assert (v[2] == 4u); } #[test] fn test_grow_set() { - let v = ~[mutable 1, 2, 3]; + let v = [mutable 1, 2, 3]; vec::grow_set(v, 4u, 4, 5); assert (vec::len(v) == 5u); - assert (v.(0) == 1); - assert (v.(1) == 2); - assert (v.(2) == 3); - assert (v.(3) == 4); - assert (v.(4) == 5); + assert (v[0] == 1); + assert (v[1] == 2); + assert (v[2] == 3); + assert (v[3] == 4); + assert (v[4] == 5); } #[test] fn test_map() { // Test on-stack map. - let v = ~[1u, 2u, 3u]; + let v = [1u, 2u, 3u]; let w = vec::map(square_alias, v); assert (vec::len(w) == 3u); - assert (w.(0) == 1u); - assert (w.(1) == 4u); - assert (w.(2) == 9u); + assert (w[0] == 1u); + assert (w[1] == 4u); + assert (w[2] == 9u); // Test on-heap map. - v = ~[1u, 2u, 3u, 4u, 5u]; + v = [1u, 2u, 3u, 4u, 5u]; w = vec::map(square_alias, v); assert (vec::len(w) == 5u); - assert (w.(0) == 1u); - assert (w.(1) == 4u); - assert (w.(2) == 9u); - assert (w.(3) == 16u); - assert (w.(4) == 25u); + assert (w[0] == 1u); + assert (w[1] == 4u); + assert (w[2] == 9u); + assert (w[3] == 16u); + assert (w[4] == 25u); } #[test] fn test_map2() { fn times(x: &int, y: &int) -> int { ret x * y; } let f = times; - let v0 = ~[1, 2, 3, 4, 5]; - let v1 = ~[5, 4, 3, 2, 1]; + let v0 = [1, 2, 3, 4, 5]; + let v1 = [5, 4, 3, 2, 1]; let u = vec::map2::<int, int, int>(f, v0, v1); let i = 0; - while i < 5 { assert (v0.(i) * v1.(i) == u.(i)); i += 1; } + while i < 5 { assert (v0[i] * v1[i] == u[i]); i += 1; } } #[test] fn test_filter_map() { // Test on-stack filter-map. - let v = ~[1u, 2u, 3u]; + let v = [1u, 2u, 3u]; let w = vec::filter_map(square_if_odd, v); assert (vec::len(w) == 2u); - assert (w.(0) == 1u); - assert (w.(1) == 9u); + assert (w[0] == 1u); + assert (w[1] == 9u); // Test on-heap filter-map. - v = ~[1u, 2u, 3u, 4u, 5u]; + v = [1u, 2u, 3u, 4u, 5u]; w = vec::filter_map(square_if_odd, v); assert (vec::len(w) == 3u); - assert (w.(0) == 1u); - assert (w.(1) == 9u); - assert (w.(2) == 25u); + assert (w[0] == 1u); + assert (w[1] == 9u); + assert (w[2] == 25u); fn halve(i: &int) -> option::t<int> { if i % 2 == 0 { @@ -270,14 +270,14 @@ fn test_filter_map() { } else { ret option::none::<int>; } } fn halve_for_sure(i: &int) -> int { ret i / 2; } - let all_even: [int] = ~[0, 2, 8, 6]; - let all_odd1: [int] = ~[1, 7, 3]; - let all_odd2: [int] = ~[]; - let mix: [int] = ~[9, 2, 6, 7, 1, 0, 0, 3]; - let mix_dest: [int] = ~[1, 3, 0, 0]; + let all_even: [int] = [0, 2, 8, 6]; + let all_odd1: [int] = [1, 7, 3]; + let all_odd2: [int] = []; + let mix: [int] = [9, 2, 6, 7, 1, 0, 0, 3]; + let mix_dest: [int] = [1, 3, 0, 0]; assert (filter_map(halve, all_even) == map(halve_for_sure, all_even)); - assert (filter_map(halve, all_odd1) == ~[]); - assert (filter_map(halve, all_odd2) == ~[]); + assert (filter_map(halve, all_odd1) == []); + assert (filter_map(halve, all_odd2) == []); assert (filter_map(halve, mix) == mix_dest); } @@ -285,49 +285,49 @@ fn test_filter_map() { #[test] fn test_foldl() { // Test on-stack fold. - let v = ~[1u, 2u, 3u]; + let v = [1u, 2u, 3u]; let sum = vec::foldl(add, 0u, v); assert (sum == 6u); // Test on-heap fold. - v = ~[1u, 2u, 3u, 4u, 5u]; + v = [1u, 2u, 3u, 4u, 5u]; sum = vec::foldl(add, 0u, v); assert (sum == 15u); } #[test] fn test_any_and_all() { - assert (vec::any(is_three, ~[1u, 2u, 3u])); - assert (!vec::any(is_three, ~[0u, 1u, 2u])); - assert (vec::any(is_three, ~[1u, 2u, 3u, 4u, 5u])); - assert (!vec::any(is_three, ~[1u, 2u, 4u, 5u, 6u])); - - assert (vec::all(is_three, ~[3u, 3u, 3u])); - assert (!vec::all(is_three, ~[3u, 3u, 2u])); - assert (vec::all(is_three, ~[3u, 3u, 3u, 3u, 3u])); - assert (!vec::all(is_three, ~[3u, 3u, 0u, 1u, 2u])); + assert (vec::any(is_three, [1u, 2u, 3u])); + assert (!vec::any(is_three, [0u, 1u, 2u])); + assert (vec::any(is_three, [1u, 2u, 3u, 4u, 5u])); + assert (!vec::any(is_three, [1u, 2u, 4u, 5u, 6u])); + + assert (vec::all(is_three, [3u, 3u, 3u])); + assert (!vec::all(is_three, [3u, 3u, 2u])); + assert (vec::all(is_three, [3u, 3u, 3u, 3u, 3u])); + assert (!vec::all(is_three, [3u, 3u, 0u, 1u, 2u])); } #[test] fn test_zip_unzip() { - let v1 = ~[1, 2, 3]; - let v2 = ~[4, 5, 6]; + let v1 = [1, 2, 3]; + let v2 = [4, 5, 6]; let z1 = vec::zip(v1, v2); - assert ((1, 4) == z1.(0)); - assert ((2, 5) == z1.(1)); - assert ((3, 6) == z1.(2)); + assert ((1, 4) == z1[0]); + assert ((2, 5) == z1[1]); + assert ((3, 6) == z1[2]); let (left, right) = vec::unzip(z1); - assert ((1, 4) == (left.(0), right.(0))); - assert ((2, 5) == (left.(1), right.(1))); - assert ((3, 6) == (left.(2), right.(2))); + assert ((1, 4) == (left[0], right[0])); + assert ((2, 5) == (left[1], right[1])); + assert ((3, 6) == (left[2], right[2])); } #[test] fn test_position() { - let v1: [int] = ~[1, 2, 3, 3, 2, 5]; + let v1: [int] = [1, 2, 3, 3, 2, 5]; assert (position(1, v1) == option::some::<uint>(0u)); assert (position(2, v1) == option::some::<uint>(1u)); assert (position(5, v1) == option::some::<uint>(5u)); @@ -338,28 +338,28 @@ fn test_position() { fn test_position_pred() { fn less_than_three(i: &int) -> bool { ret i < 3; } fn is_eighteen(i: &int) -> bool { ret i == 18; } - let v1: [int] = ~[5, 4, 3, 2, 1]; + let v1: [int] = [5, 4, 3, 2, 1]; assert (position_pred(less_than_three, v1) == option::some::<uint>(3u)); assert (position_pred(is_eighteen, v1) == option::none::<uint>); } #[test] fn reverse_and_reversed() { - let v: [mutable int] = ~[mutable 10, 20]; - assert (v.(0) == 10); - assert (v.(1) == 20); + let v: [mutable int] = [mutable 10, 20]; + assert (v[0] == 10); + assert (v[1] == 20); vec::reverse(v); - assert (v.(0) == 20); - assert (v.(1) == 10); - let v2 = vec::reversed::<int>(~[10, 20]); - assert (v2.(0) == 20); - assert (v2.(1) == 10); - v.(0) = 30; - assert (v2.(0) == 20); + assert (v[0] == 20); + assert (v[1] == 10); + let v2 = vec::reversed::<int>([10, 20]); + assert (v2[0] == 20); + assert (v2[1] == 10); + v[0] = 30; + assert (v2[0] == 20); // Make sure they work with 0-length vectors too. - let v4 = vec::reversed::<int>(~[]); - let v3: [mutable int] = ~[mutable]; + let v4 = vec::reversed::<int>([]); + let v3: [mutable int] = [mutable]; vec::reverse::<int>(v3); } diff --git a/src/test/stdtest/vec_str_conversions.rs b/src/test/stdtest/vec_str_conversions.rs index cc52ec80e95..8e245db256f 100644 --- a/src/test/stdtest/vec_str_conversions.rs +++ b/src/test/stdtest/vec_str_conversions.rs @@ -16,8 +16,8 @@ fn test_simple() { let n2: uint = vec::len::<u8>(v); assert (n1 == n2); while i < n1 { - let a: u8 = s1.(i); - let b: u8 = s2.(i); + let a: u8 = s1[i]; + let b: u8 = s2[i]; log a; log b; assert (a == b); |
