Rewrite everything to use [] instead of vec() in value position.

2 files changed, 10 insertions, 10 deletions

diff --git a/src/test/bench/shootout/fasta.rs b/src/test/bench/shootout/fasta.rs
index ec962e38a48..b7a890971e3 100644
--- a/src/test/bench/shootout/fasta.rs
+++ b/src/test/bench/shootout/fasta.rs
@@ -28,10 +28,10 @@ type aminoacids = tup(char, u32);
 
 fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
   let u32 cp = 0u32;
-  let vec[aminoacids] ans = vec();
+  let vec[aminoacids] ans = [];
   for (aminoacids a in aa) {
     cp += a._1;
-    ans += vec(tup(a._0, cp));
+    ans += [tup(a._0, cp)];
   }
   ret ans;
 }
@@ -91,7 +91,7 @@ fn make_repeat_fasta(str id, str desc, str s, int n) {
 }
 
 fn main(vec[str] args) {
-  let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ),
+  let vec[aminoacids] iub = make_cumulative([tup( 'a', 27u32 ),
                                                 tup( 'c', 12u32 ),
                                                 tup( 'g', 12u32 ),
                                                 tup( 't', 27u32 ),
@@ -106,12 +106,12 @@ fn main(vec[str] args) {
                                                 tup( 'S', 2u32 ),
                                                 tup( 'V', 2u32 ),
                                                 tup( 'W', 2u32 ),
-                                                tup( 'Y', 2u32 )));
+                                                tup( 'Y', 2u32 )]);
 
-  let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ),
+  let vec[aminoacids] homosapiens = make_cumulative([tup( 'a', 30u32 ),
                                                         tup( 'c', 20u32 ),
                                                         tup( 'g', 20u32 ),
-                                                        tup( 't', 30u32 )));
+                                                        tup( 't', 30u32 )]);
 
   let str alu =
     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
diff --git a/src/test/bench/shootout/nbody.rs b/src/test/bench/shootout/nbody.rs
index 4b3e9044d92..152291c7145 100644
--- a/src/test/bench/shootout/nbody.rs
+++ b/src/test/bench/shootout/nbody.rs
@@ -7,7 +7,7 @@ native "llvm" mod llvm {
 
 fn main() {
 
-    let vec[int] inputs = vec(
+    let vec[int] inputs = [
                               50000,
                               500000
                               //
@@ -16,7 +16,7 @@ fn main() {
                               // during 'make check' under valgrind
                               // 5000000
                               // 50000000
-        );
+        ];
 
     let vec[Body::props] bodies = NBodySystem::MakeNBodySystem();
 
@@ -38,13 +38,13 @@ fn main() {
 mod NBodySystem {
 
     fn MakeNBodySystem() -> vec[Body::props] {
-        let vec[Body::props] bodies = vec(
+        let vec[Body::props] bodies = [
             // these each return a Body::props
             Body::sun(), 
             Body::jupiter(), 
             Body::saturn(), 
             Body::uranus(), 
-            Body::neptune());
+            Body::neptune()];
 
         let float px = 0.0;
         let float py = 0.0;