about summary refs log tree commit diff
path: root/src/test
diff options
context:
space:
mode:
authorBrian Anderson <banderson@mozilla.com>2011-08-19 15:16:48 -0700
committerBrian Anderson <banderson@mozilla.com>2011-08-20 11:04:00 -0700
commit518dc52f85c2efb67aaa1208c02e9a7e0bdaca49 (patch)
tree9af4f631455ff5ba42b233819fe4bb9f3b9ac194 /src/test
parent4aa165553bfb2a74e2e54f08fd9507e23bc24708 (diff)
Reformat
This changes the indexing syntax from .() to [], the vector syntax from ~[] to
[] and the extension syntax from #fmt() to #fmt[]
Diffstat (limited to 'src/test')
-rw-r--r--src/test/bench/99bob-iter.rs2
-rw-r--r--src/test/bench/99bob-pattern.rs2
-rw-r--r--src/test/bench/99bob-simple.rs4
-rw-r--r--src/test/bench/99bob-tail.rs2
-rw-r--r--src/test/bench/shootout-ackermann.rs2
-rw-r--r--src/test/bench/shootout-binarytrees.rs14
-rw-r--r--src/test/bench/shootout-fannkuchredux.rs26
-rw-r--r--src/test/bench/shootout-fasta.rs28
-rw-r--r--src/test/bench/shootout-fibo.rs2
-rw-r--r--src/test/bench/shootout-nbody.rs33
-rw-r--r--src/test/bench/shootout-pfib.rs12
-rw-r--r--src/test/bench/task-perf-spawnalot.rs22
-rw-r--r--src/test/bench/task-perf-word-count.rs28
-rw-r--r--src/test/compile-fail/alias-mismatch.rs4
-rw-r--r--src/test/compile-fail/aliasness-mismatch.rs2
-rw-r--r--src/test/compile-fail/alt-join.rs9
-rw-r--r--src/test/compile-fail/and-init.rs2
-rw-r--r--src/test/compile-fail/arg-count-mismatch.rs2
-rw-r--r--src/test/compile-fail/arg-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/assign-alias.rs2
-rw-r--r--src/test/compile-fail/auto-deref-bind.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann-2.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann-3.rs2
-rw-r--r--src/test/compile-fail/bad-bang-ann.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture2.rs2
-rw-r--r--src/test/compile-fail/bad-env-capture3.rs2
-rw-r--r--src/test/compile-fail/bad-main.rs2
-rw-r--r--src/test/compile-fail/bad-module.rs2
-rw-r--r--src/test/compile-fail/bad-record-pat-2.rs2
-rw-r--r--src/test/compile-fail/bad-record-pat.rs2
-rw-r--r--src/test/compile-fail/bang-tailexpr.rs2
-rw-r--r--src/test/compile-fail/binop-add-tup-assign.rs2
-rw-r--r--src/test/compile-fail/binop-add-tup.rs2
-rw-r--r--src/test/compile-fail/binop-bitxor-str.rs2
-rw-r--r--src/test/compile-fail/binop-logic-float.rs2
-rw-r--r--src/test/compile-fail/binop-logic-int.rs2
-rw-r--r--src/test/compile-fail/binop-mul-bool.rs2
-rw-r--r--src/test/compile-fail/binop-sub-obj.rs2
-rw-r--r--src/test/compile-fail/binop-typeck.rs2
-rw-r--r--src/test/compile-fail/block-coerce-no.rs8
-rw-r--r--src/test/compile-fail/block-copy.rs4
-rw-r--r--src/test/compile-fail/block-uninit.rs4
-rw-r--r--src/test/compile-fail/break-outside-loop.rs2
-rw-r--r--src/test/compile-fail/break-uninit.rs2
-rw-r--r--src/test/compile-fail/break-uninit2.rs2
-rw-r--r--src/test/compile-fail/capture1.rs2
-rw-r--r--src/test/compile-fail/constructor-as-cast.rs4
-rw-r--r--src/test/compile-fail/copy-a-resource.rs2
-rw-r--r--src/test/compile-fail/cross-crate-glob-collision.rs2
-rw-r--r--src/test/compile-fail/direct-obj-fn-call.rs2
-rw-r--r--src/test/compile-fail/do-while-constraints.rs2
-rw-r--r--src/test/compile-fail/do-while-pred-constraints.rs26
-rw-r--r--src/test/compile-fail/dup-link-name.rs2
-rw-r--r--src/test/compile-fail/export-fully-qualified.rs2
-rw-r--r--src/test/compile-fail/export-import.rs2
-rw-r--r--src/test/compile-fail/export-no-tag-variants.rs2
-rw-r--r--src/test/compile-fail/export-tag-variant.rs2
-rw-r--r--src/test/compile-fail/export.rs2
-rw-r--r--src/test/compile-fail/export2.rs2
-rw-r--r--src/test/compile-fail/ext-nonexistent.rs2
-rw-r--r--src/test/compile-fail/extend-non-object.rs2
-rw-r--r--src/test/compile-fail/extenv-no-args.rs4
-rw-r--r--src/test/compile-fail/extenv-not-string-literal.rs2
-rw-r--r--src/test/compile-fail/extenv-too-many-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-missing-type.rs2
-rw-r--r--src/test/compile-fail/extfmt-no-args.rs4
-rw-r--r--src/test/compile-fail/extfmt-non-literal.rs4
-rw-r--r--src/test/compile-fail/extfmt-non-literal2.rs4
-rw-r--r--src/test/compile-fail/extfmt-not-enough-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-too-many-args.rs2
-rw-r--r--src/test/compile-fail/extfmt-unknown-type.rs2
-rw-r--r--src/test/compile-fail/extfmt-unsigned-plus.rs4
-rw-r--r--src/test/compile-fail/extfmt-unsigned-space.rs4
-rw-r--r--src/test/compile-fail/extfmt-unterminated-conv.rs2
-rw-r--r--src/test/compile-fail/fail-expr.rs2
-rw-r--r--src/test/compile-fail/fail-type-err.rs2
-rw-r--r--src/test/compile-fail/fn-bad-block-type.rs2
-rw-r--r--src/test/compile-fail/fn-compare-mismatch.rs2
-rw-r--r--src/test/compile-fail/fn-constraint.rs2
-rw-r--r--src/test/compile-fail/fn-expr-type-state.rs2
-rw-r--r--src/test/compile-fail/fn-expr-typestate-2.rs2
-rw-r--r--src/test/compile-fail/for-each-over-bs.rs2
-rw-r--r--src/test/compile-fail/forgot-ret.rs2
-rw-r--r--src/test/compile-fail/fru-extra-field.rs2
-rw-r--r--src/test/compile-fail/fru-typestate.rs2
-rw-r--r--src/test/compile-fail/if-branch-types.rs2
-rw-r--r--src/test/compile-fail/if-check-precond-fail.rs4
-rw-r--r--src/test/compile-fail/if-typeck.rs2
-rw-r--r--src/test/compile-fail/import-from-dup.rs6
-rw-r--r--src/test/compile-fail/import-from-missing.rs7
-rw-r--r--src/test/compile-fail/import-glob-0.rs2
-rw-r--r--src/test/compile-fail/import-glob-circular.rs2
-rw-r--r--src/test/compile-fail/import-glob-export.rs2
-rw-r--r--src/test/compile-fail/import-glob-multiple.rs2
-rw-r--r--src/test/compile-fail/import-loop-2.rs2
-rw-r--r--src/test/compile-fail/import-loop.rs2
-rw-r--r--src/test/compile-fail/import5.rs2
-rw-r--r--src/test/compile-fail/impure-pred.rs2
-rw-r--r--src/test/compile-fail/infinite-vec-type-recursion.rs2
-rw-r--r--src/test/compile-fail/lambda-mutate-nested.rs5
-rw-r--r--src/test/compile-fail/lambda-mutate.rs5
-rw-r--r--src/test/compile-fail/let-destruct-refutable.rs9
-rw-r--r--src/test/compile-fail/macro-2.rs10
-rw-r--r--src/test/compile-fail/macro.rs5
-rw-r--r--src/test/compile-fail/main-wrong-type-2.rs2
-rw-r--r--src/test/compile-fail/main-wrong-type.rs2
-rw-r--r--src/test/compile-fail/minus-string.rs4
-rw-r--r--src/test/compile-fail/missing-main.rs2
-rw-r--r--src/test/compile-fail/missing-return2.rs2
-rw-r--r--src/test/compile-fail/move-arg.rs10
-rw-r--r--src/test/compile-fail/native-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/nested-ty-params.rs2
-rw-r--r--src/test/compile-fail/no-constraint-prop.rs2
-rw-r--r--src/test/compile-fail/no-self-dispatch.rs2
-rw-r--r--src/test/compile-fail/not-a-pred-2.rs3
-rw-r--r--src/test/compile-fail/not-a-pred-3.rs2
-rw-r--r--src/test/compile-fail/not-a-pred-check.rs2
-rw-r--r--src/test/compile-fail/not-a-pred.rs4
-rw-r--r--src/test/compile-fail/not-pred-args.rs2
-rw-r--r--src/test/compile-fail/occurs-check-2.rs6
-rw-r--r--src/test/compile-fail/occurs-check.rs5
-rw-r--r--src/test/compile-fail/or-init.rs2
-rw-r--r--src/test/compile-fail/or-patter-mismatch.rs2
-rw-r--r--src/test/compile-fail/output-type-mismatch.rs2
-rw-r--r--src/test/compile-fail/pred-assign.rs4
-rw-r--r--src/test/compile-fail/pred-not-bool.rs2
-rw-r--r--src/test/compile-fail/pred-on-wrong-slots.rs4
-rw-r--r--src/test/compile-fail/pred-swap.rs4
-rw-r--r--src/test/compile-fail/rec-extend.rs2
-rw-r--r--src/test/compile-fail/rec-missing-fields.rs2
-rw-r--r--src/test/compile-fail/ret-non-nil.rs2
-rw-r--r--src/test/compile-fail/return-uninit.rs2
-rw-r--r--src/test/compile-fail/self-call-non-obj.rs2
-rw-r--r--src/test/compile-fail/slot-as-pred.rs4
-rw-r--r--src/test/compile-fail/spawn-non-nil-fn.rs2
-rw-r--r--src/test/compile-fail/swap-no-lval.rs2
-rw-r--r--src/test/compile-fail/swap-uninit.rs2
-rw-r--r--src/test/compile-fail/tail-typeck.rs2
-rw-r--r--src/test/compile-fail/type-arg-out-of-scope.rs2
-rw-r--r--src/test/compile-fail/type-mismatch-multiple.rs2
-rw-r--r--src/test/compile-fail/type-mismatch.rs2
-rw-r--r--src/test/compile-fail/type-recursive.rs2
-rw-r--r--src/test/compile-fail/type-shadow.rs2
-rw-r--r--src/test/compile-fail/unreachable-arm.rs2
-rw-r--r--src/test/compile-fail/unsafe-alias-2.rs2
-rw-r--r--src/test/compile-fail/unsafe-alias.rs4
-rw-r--r--src/test/compile-fail/unsafe-alt.rs2
-rw-r--r--src/test/compile-fail/unsafe-for.rs4
-rw-r--r--src/test/compile-fail/unsafe-mutable-alias.rs2
-rw-r--r--src/test/compile-fail/use-after-move.rs2
-rw-r--r--src/test/compile-fail/use-after-send.rs10
-rw-r--r--src/test/compile-fail/use-meta-dup.rs2
-rw-r--r--src/test/compile-fail/use-meta-mismatch.rs2
-rw-r--r--src/test/compile-fail/use-uninit-2.rs2
-rw-r--r--src/test/compile-fail/use-uninit-3.rs2
-rw-r--r--src/test/compile-fail/use-uninit.rs2
-rw-r--r--src/test/compile-fail/vec-field.rs2
-rw-r--r--src/test/compile-fail/vector-no-ann.rs2
-rw-r--r--src/test/compile-fail/while-bypass.rs2
-rw-r--r--src/test/compile-fail/while-expr.rs2
-rw-r--r--src/test/compile-fail/while-loop-constraints.rs2
-rw-r--r--src/test/compile-fail/while-loop-pred-constraints.rs2
-rw-r--r--src/test/compile-fail/writing-through-read-alias.rs2
-rw-r--r--src/test/compile-fail/writing-through-uninit-vec.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-obj.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-rec.rs2
-rw-r--r--src/test/compile-fail/writing-to-immutable-vec.rs2
-rw-r--r--src/test/compile-fail/wrong-ret-type.rs2
-rw-r--r--src/test/compiletest/common.rs34
-rw-r--r--src/test/compiletest/compiletest.rs94
-rw-r--r--src/test/compiletest/procsrv.rs93
-rw-r--r--src/test/compiletest/runtest.rs193
-rw-r--r--src/test/compiletest/util.rs2
-rw-r--r--src/test/pretty/block-disambig.rs52
-rw-r--r--src/test/pretty/empty-lines.rs2
-rw-r--r--src/test/pretty/example2.rs6
-rw-r--r--src/test/pretty/unary-op-disambig.rs44
-rw-r--r--src/test/pretty/vec-comments.rs50
-rw-r--r--src/test/pretty/vec-type.rs2
-rw-r--r--src/test/run-fail/alt-bot-fail.rs6
-rw-r--r--src/test/run-fail/alt-disc-bot.rs2
-rw-r--r--src/test/run-fail/args-fail.rs2
-rw-r--r--src/test/run-fail/bug-811.rs11
-rw-r--r--src/test/run-fail/do-while-body-fails.rs4
-rw-r--r--src/test/run-fail/explicit-fail-msg.rs2
-rw-r--r--src/test/run-fail/explicit-fail.rs2
-rw-r--r--src/test/run-fail/expr-alt-fail-fn.rs2
-rw-r--r--src/test/run-fail/expr-alt-fail.rs2
-rw-r--r--src/test/run-fail/expr-fn-fail.rs2
-rw-r--r--src/test/run-fail/expr-if-fail-fn.rs2
-rw-r--r--src/test/run-fail/expr-if-fail.rs2
-rw-r--r--src/test/run-fail/fail-arg.rs2
-rw-r--r--src/test/run-fail/fail-main.rs2
-rw-r--r--src/test/run-fail/fail.rs2
-rw-r--r--src/test/run-fail/fmt-fail.rs2
-rw-r--r--src/test/run-fail/fn-constraint-claim.rs7
-rw-r--r--src/test/run-fail/fn-constraint.rs2
-rw-r--r--src/test/run-fail/if-check-fail.rs4
-rw-r--r--src/test/run-fail/non-exhaustive-match.rs2
-rw-r--r--src/test/run-fail/pred.rs2
-rw-r--r--src/test/run-fail/rhs-type.rs2
-rw-r--r--src/test/run-fail/str-overrun.rs6
-rw-r--r--src/test/run-fail/vec-overrun.rs6
-rw-r--r--src/test/run-fail/vec-underrun.rs6
-rw-r--r--src/test/run-pass/alloca-from-derived-tydesc.rs4
-rw-r--r--src/test/run-pass/alt-bot.rs6
-rw-r--r--src/test/run-pass/alt-join.rs4
-rw-r--r--src/test/run-pass/alt-path.rs2
-rw-r--r--src/test/run-pass/alt-pattern-drop.rs2
-rw-r--r--src/test/run-pass/alt-pattern-lit.rs2
-rw-r--r--src/test/run-pass/alt-pattern-simple.rs2
-rw-r--r--src/test/run-pass/alt-str.rs2
-rw-r--r--src/test/run-pass/alt-tag.rs2
-rw-r--r--src/test/run-pass/anon-obj-backwarding-2.rs20
-rw-r--r--src/test/run-pass/anon-obj-cats.rs56
-rw-r--r--src/test/run-pass/anon-obj-degenerate.rs2
-rw-r--r--src/test/run-pass/anon-obj-no-inner-obj-simple.rs55
-rw-r--r--src/test/run-pass/anon-obj-overriding-reduced.rs2
-rw-r--r--src/test/run-pass/anon-obj-overriding.rs2
-rw-r--r--src/test/run-pass/anon-obj-with-self-call-2.rs2
-rw-r--r--src/test/run-pass/anon-obj-with-self-call.rs2
-rw-r--r--src/test/run-pass/argv.rs4
-rw-r--r--src/test/run-pass/arith-0.rs2
-rw-r--r--src/test/run-pass/arith-1.rs2
-rw-r--r--src/test/run-pass/arith-2.rs2
-rw-r--r--src/test/run-pass/arith-unsigned.rs2
-rw-r--r--src/test/run-pass/artificial-block.rs2
-rw-r--r--src/test/run-pass/assign-assign.rs2
-rw-r--r--src/test/run-pass/auto-deref-fn.rs2
-rw-r--r--src/test/run-pass/auto-loop.rs2
-rw-r--r--src/test/run-pass/autobind.rs8
-rw-r--r--src/test/run-pass/autoderef-objfn.rs2
-rw-r--r--src/test/run-pass/bind-interior.rs4
-rw-r--r--src/test/run-pass/bind-obj-ctor.rs2
-rw-r--r--src/test/run-pass/bind-parameterized-args-2.rs2
-rw-r--r--src/test/run-pass/bind-parameterized-args.rs4
-rw-r--r--src/test/run-pass/bind-thunk.rs4
-rw-r--r--src/test/run-pass/bind-trivial.rs4
-rw-r--r--src/test/run-pass/binops.rs16
-rw-r--r--src/test/run-pass/bitwise.rs2
-rw-r--r--src/test/run-pass/block-fn-coerce.rs4
-rw-r--r--src/test/run-pass/block-iter-1.rs10
-rw-r--r--src/test/run-pass/block-iter-2.rs9
-rw-r--r--src/test/run-pass/block-vec-map2.rs8
-rw-r--r--src/test/run-pass/bool-not.rs2
-rw-r--r--src/test/run-pass/box-compare.rs2
-rw-r--r--src/test/run-pass/box-in-tup.rs5
-rw-r--r--src/test/run-pass/box-pattern.rs2
-rw-r--r--src/test/run-pass/box.rs2
-rw-r--r--src/test/run-pass/break-value.rs2
-rw-r--r--src/test/run-pass/break.rs7
-rw-r--r--src/test/run-pass/call-autoderef-tag.rs6
-rw-r--r--src/test/run-pass/cast.rs2
-rw-r--r--src/test/run-pass/chan-leak.rs5
-rw-r--r--src/test/run-pass/char.rs2
-rw-r--r--src/test/run-pass/child-outlives-parent.rs2
-rw-r--r--src/test/run-pass/claim-nonterm.rs2
-rw-r--r--src/test/run-pass/command-line-args.rs2
-rw-r--r--src/test/run-pass/complex.rs2
-rw-r--r--src/test/run-pass/const.rs2
-rw-r--r--src/test/run-pass/constrained-type.rs4
-rw-r--r--src/test/run-pass/constraint-prop-expr-move.rs2
-rw-r--r--src/test/run-pass/constraint-prop-move.rs2
-rw-r--r--src/test/run-pass/constraint-prop-swap.rs2
-rw-r--r--src/test/run-pass/constraint-prop.rs2
-rw-r--r--src/test/run-pass/crate-attributes-src/foo.rs2
-rw-r--r--src/test/run-pass/dead-code-one-arm-if.rs2
-rw-r--r--src/test/run-pass/deep.rs2
-rw-r--r--src/test/run-pass/deref-lval.rs2
-rw-r--r--src/test/run-pass/deref.rs2
-rw-r--r--src/test/run-pass/div-mod.rs2
-rw-r--r--src/test/run-pass/double-unbox.rs2
-rw-r--r--src/test/run-pass/drop-bind-thunk-args.rs2
-rw-r--r--src/test/run-pass/drop-on-empty-block-exit.rs2
-rw-r--r--src/test/run-pass/drop-on-ret.rs2
-rw-r--r--src/test/run-pass/early-ret-binop-add.rs6
-rw-r--r--src/test/run-pass/early-ret-binop.rs6
-rw-r--r--src/test/run-pass/else-if.rs10
-rw-r--r--src/test/run-pass/empty-mutable-vec.rs2
-rw-r--r--src/test/run-pass/export-abstract-tag.rs2
-rw-r--r--src/test/run-pass/export-multi.rs11
-rw-r--r--src/test/run-pass/export-non-interference2.rs2
-rw-r--r--src/test/run-pass/export-non-interference3.rs2
-rw-r--r--src/test/run-pass/export-tag-variant.rs2
-rw-r--r--src/test/run-pass/export-unexported-dep.rs2
-rw-r--r--src/test/run-pass/expr-alt-box.rs2
-rw-r--r--src/test/run-pass/expr-alt-fail-all.rs2
-rw-r--r--src/test/run-pass/expr-alt-fail.rs6
-rw-r--r--src/test/run-pass/expr-alt-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-alt-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-alt-generic.rs2
-rw-r--r--src/test/run-pass/expr-alt-struct.rs2
-rw-r--r--src/test/run-pass/expr-alt.rs2
-rw-r--r--src/test/run-pass/expr-block-box.rs2
-rw-r--r--src/test/run-pass/expr-block-fn.rs4
-rw-r--r--src/test/run-pass/expr-block-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-block-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-block-generic.rs2
-rw-r--r--src/test/run-pass/expr-block-ref.rs2
-rw-r--r--src/test/run-pass/expr-block-slot.rs2
-rw-r--r--src/test/run-pass/expr-block.rs2
-rw-r--r--src/test/run-pass/expr-copy.rs6
-rw-r--r--src/test/run-pass/expr-elseif-ref.rs2
-rw-r--r--src/test/run-pass/expr-elseif-ref2.rs4
-rw-r--r--src/test/run-pass/expr-empty-ret.rs2
-rw-r--r--src/test/run-pass/expr-fn.rs4
-rw-r--r--src/test/run-pass/expr-if-box.rs2
-rw-r--r--src/test/run-pass/expr-if-fail-all.rs2
-rw-r--r--src/test/run-pass/expr-if-fail.rs4
-rw-r--r--src/test/run-pass/expr-if-generic-box1.rs2
-rw-r--r--src/test/run-pass/expr-if-generic-box2.rs2
-rw-r--r--src/test/run-pass/expr-if-generic.rs2
-rw-r--r--src/test/run-pass/expr-if-struct.rs2
-rw-r--r--src/test/run-pass/expr-if.rs8
-rw-r--r--src/test/run-pass/expr-scope.rs2
-rw-r--r--src/test/run-pass/exterior.rs2
-rw-r--r--src/test/run-pass/fact.rs2
-rw-r--r--src/test/run-pass/fixed-point-bind-box.rs6
-rw-r--r--src/test/run-pass/float-signature.rs2
-rw-r--r--src/test/run-pass/float.rs2
-rw-r--r--src/test/run-pass/float2.rs2
-rw-r--r--src/test/run-pass/floatlits.rs2
-rw-r--r--src/test/run-pass/fn-constraint.rs2
-rw-r--r--src/test/run-pass/fn-expr.rs2
-rw-r--r--src/test/run-pass/fn-lval.rs4
-rw-r--r--src/test/run-pass/fn-type-infer.rs2
-rw-r--r--src/test/run-pass/for-destruct.rs4
-rw-r--r--src/test/run-pass/for-each-destruct.rs9
-rw-r--r--src/test/run-pass/for-loop-fail.rs2
-rw-r--r--src/test/run-pass/foreach-nested-2.rs20
-rw-r--r--src/test/run-pass/foreach-nested.rs12
-rw-r--r--src/test/run-pass/fun-call-variants.rs10
-rw-r--r--src/test/run-pass/fun-indirect-call.rs2
-rw-r--r--src/test/run-pass/generic-ivec-leak.rs2
-rw-r--r--src/test/run-pass/generic-ivec.rs2
-rw-r--r--src/test/run-pass/generic-temporary.rs6
-rw-r--r--src/test/run-pass/generic-tup.rs5
-rw-r--r--src/test/run-pass/hashmap-memory.rs6
-rw-r--r--src/test/run-pass/hello.rs2
-rw-r--r--src/test/run-pass/i32-sub.rs2
-rw-r--r--src/test/run-pass/i8-incr.rs2
-rw-r--r--src/test/run-pass/if-bot.rs2
-rw-r--r--src/test/run-pass/if-check-precond.rs4
-rw-r--r--src/test/run-pass/if-check.rs4
-rw-r--r--src/test/run-pass/if-ret.rs2
-rw-r--r--src/test/run-pass/import-from-native.rs9
-rw-r--r--src/test/run-pass/import-from.rs9
-rw-r--r--src/test/run-pass/import-glob-0.rs2
-rw-r--r--src/test/run-pass/import-glob-1.rs52
-rw-r--r--src/test/run-pass/import-glob-circular.rs2
-rw-r--r--src/test/run-pass/import-glob-crate.rs4
-rw-r--r--src/test/run-pass/import.rs2
-rw-r--r--src/test/run-pass/import2.rs2
-rw-r--r--src/test/run-pass/import3.rs2
-rw-r--r--src/test/run-pass/import6.rs2
-rw-r--r--src/test/run-pass/import8.rs2
-rw-r--r--src/test/run-pass/infer-fn-tail-expr.rs2
-rw-r--r--src/test/run-pass/inner-module.rs2
-rw-r--r--src/test/run-pass/int.rs2
-rw-r--r--src/test/run-pass/integral-indexing.rs2
-rw-r--r--src/test/run-pass/interior-vec.rs17
-rw-r--r--src/test/run-pass/issue-506.rs9
-rw-r--r--src/test/run-pass/issue-687.rs13
-rw-r--r--src/test/run-pass/item-attributes.rs2
-rw-r--r--src/test/run-pass/item-name-overload.rs2
-rw-r--r--src/test/run-pass/ivec-add.rs12
-rw-r--r--src/test/run-pass/ivec-pass-by-value.rs2
-rw-r--r--src/test/run-pass/ivec-tag.rs5
-rw-r--r--src/test/run-pass/join.rs2
-rw-r--r--src/test/run-pass/lambda-infer-unresolved.rs6
-rw-r--r--src/test/run-pass/lambda-no-leak.rs4
-rw-r--r--src/test/run-pass/large-records.rs2
-rw-r--r--src/test/run-pass/lazy-and-or.rs2
-rw-r--r--src/test/run-pass/lazy-init.rs2
-rw-r--r--src/test/run-pass/leak-tag-copy.rs2
-rw-r--r--src/test/run-pass/let-destruct-fresh-mem.rs10
-rw-r--r--src/test/run-pass/let-destruct.rs8
-rw-r--r--src/test/run-pass/linear-for-loop.rs2
-rw-r--r--src/test/run-pass/list.rs2
-rw-r--r--src/test/run-pass/log-err-phi.rs2
-rw-r--r--src/test/run-pass/long-while.rs2
-rw-r--r--src/test/run-pass/loop-scope.rs2
-rw-r--r--src/test/run-pass/macro-2.rs10
-rw-r--r--src/test/run-pass/macro-3.rs4
-rw-r--r--src/test/run-pass/macro-by-example-1.rs4
-rw-r--r--src/test/run-pass/macro-by-example-2.rs27
-rw-r--r--src/test/run-pass/macro.rs5
-rw-r--r--src/test/run-pass/main-ivec.rs4
-rw-r--r--src/test/run-pass/many.rs28
-rw-r--r--src/test/run-pass/maybe-mutable.rs4
-rw-r--r--src/test/run-pass/mlist.rs2
-rw-r--r--src/test/run-pass/move-1.rs2
-rw-r--r--src/test/run-pass/move-2.rs2
-rw-r--r--src/test/run-pass/move-4.rs2
-rw-r--r--src/test/run-pass/move-arg-2.rs8
-rw-r--r--src/test/run-pass/move-arg.rs9
-rw-r--r--src/test/run-pass/move-scalar.rs2
-rw-r--r--src/test/run-pass/multi-let.rs5
-rw-r--r--src/test/run-pass/multi-src/bar.rs2
-rw-r--r--src/test/run-pass/multi-src/foo.rs2
-rw-r--r--src/test/run-pass/multiline-comment.rs2
-rw-r--r--src/test/run-pass/mutable-alias-vec.rs4
-rw-r--r--src/test/run-pass/mutable-vec-drop.rs2
-rw-r--r--src/test/run-pass/mutual-recursion-group.rs2
-rw-r--r--src/test/run-pass/native-mod-src/inner.rs2
-rw-r--r--src/test/run-pass/native-opaque-type.rs2
-rw-r--r--src/test/run-pass/native-src/native.rs2
-rw-r--r--src/test/run-pass/nested-obj-self.rs2
-rw-r--r--src/test/run-pass/newtype-polymorphic.rs8
-rw-r--r--src/test/run-pass/newtype.rs4
-rw-r--r--src/test/run-pass/nil-pattern.rs2
-rw-r--r--src/test/run-pass/obj-docs.rs41
-rw-r--r--src/test/run-pass/obj-drop.rs2
-rw-r--r--src/test/run-pass/obj-recursion.rs4
-rw-r--r--src/test/run-pass/obj-self-2.rs2
-rw-r--r--src/test/run-pass/obj-self-3.rs2
-rw-r--r--src/test/run-pass/obj-self-4.rs2
-rw-r--r--src/test/run-pass/obj-self.rs2
-rw-r--r--src/test/run-pass/obj-with-vec.rs4
-rw-r--r--src/test/run-pass/opeq.rs2
-rw-r--r--src/test/run-pass/operator-associativity.rs2
-rw-r--r--src/test/run-pass/or-pattern.rs2
-rw-r--r--src/test/run-pass/output-slot-variants.rs2
-rw-r--r--src/test/run-pass/over-constrained-vregs.rs2
-rw-r--r--src/test/run-pass/paren-free.rs2
-rw-r--r--src/test/run-pass/parse-fail.rs2
-rw-r--r--src/test/run-pass/polymorphic-iter.rs4
-rw-r--r--src/test/run-pass/pred-check.rs2
-rw-r--r--src/test/run-pass/pred.rs2
-rw-r--r--src/test/run-pass/readalias.rs2
-rw-r--r--src/test/run-pass/rebind-fn.rs9
-rw-r--r--src/test/run-pass/rec-auto.rs2
-rw-r--r--src/test/run-pass/rec-extend.rs2
-rw-r--r--src/test/run-pass/rec-tup.rs10
-rw-r--r--src/test/run-pass/rec.rs2
-rw-r--r--src/test/run-pass/record-pat.rs2
-rw-r--r--src/test/run-pass/resource-destruct.rs2
-rw-r--r--src/test/run-pass/resource-generic.rs2
-rw-r--r--src/test/run-pass/resource-in-struct.rs8
-rw-r--r--src/test/run-pass/ret-bang.rs2
-rw-r--r--src/test/run-pass/return-nil.rs2
-rw-r--r--src/test/run-pass/rt-circular-buffer.rs14
-rw-r--r--src/test/run-pass/self-shadowing-import.rs2
-rw-r--r--src/test/run-pass/seq-compare.rs20
-rw-r--r--src/test/run-pass/shadow.rs13
-rw-r--r--src/test/run-pass/simple-alt-generic-tag.rs3
-rw-r--r--src/test/run-pass/simple-anon-objs.rs2
-rw-r--r--src/test/run-pass/simple-infer.rs2
-rw-r--r--src/test/run-pass/simple-obj.rs2
-rw-r--r--src/test/run-pass/size-and-align.rs4
-rw-r--r--src/test/run-pass/spawn-fn.rs2
-rw-r--r--src/test/run-pass/spawn-module-qualified.rs9
-rw-r--r--src/test/run-pass/spawn.rs5
-rw-r--r--src/test/run-pass/standalone-method.rs16
-rw-r--r--src/test/run-pass/stateful-obj.rs2
-rw-r--r--src/test/run-pass/str-append.rs4
-rw-r--r--src/test/run-pass/str-concat.rs4
-rw-r--r--src/test/run-pass/str-growth.rs14
-rw-r--r--src/test/run-pass/str-idx.rs2
-rw-r--r--src/test/run-pass/str-multiline.rs2
-rw-r--r--src/test/run-pass/string-self-append.rs2
-rw-r--r--src/test/run-pass/structured-compare-recursive.rs2
-rw-r--r--src/test/run-pass/structured-compare.rs2
-rw-r--r--src/test/run-pass/swap-1.rs2
-rw-r--r--src/test/run-pass/swap-2.rs12
-rw-r--r--src/test/run-pass/syntax-extension-fmt.rs300
-rw-r--r--src/test/run-pass/syntax-extension-minor.rs6
-rw-r--r--src/test/run-pass/tag.rs2
-rw-r--r--src/test/run-pass/tail-call-arg-leak.rs2
-rw-r--r--src/test/run-pass/tail-cps.rs6
-rw-r--r--src/test/run-pass/tail-direct.rs2
-rw-r--r--src/test/run-pass/task-comm-11.rs2
-rw-r--r--src/test/run-pass/task-comm-13.rs2
-rw-r--r--src/test/run-pass/task-comm-15.rs2
-rw-r--r--src/test/run-pass/task-comm-16.rs40
-rw-r--r--src/test/run-pass/task-comm-3.rs5
-rw-r--r--src/test/run-pass/task-comm-4.rs2
-rw-r--r--src/test/run-pass/task-comm-5.rs4
-rw-r--r--src/test/run-pass/task-comm-6.rs10
-rw-r--r--src/test/run-pass/task-comm-8.rs2
-rw-r--r--src/test/run-pass/task-comm-9.rs5
-rw-r--r--src/test/run-pass/task-comm.rs27
-rw-r--r--src/test/run-pass/task-pin.rs2
-rw-r--r--src/test/run-pass/ternary.rs2
-rw-r--r--src/test/run-pass/test-runner-hides-main.rs2
-rw-r--r--src/test/run-pass/threads.rs13
-rw-r--r--src/test/run-pass/tup.rs2
-rw-r--r--src/test/run-pass/type-in-nested-module.rs2
-rw-r--r--src/test/run-pass/type-namespace.rs2
-rw-r--r--src/test/run-pass/type-param-constraints.rs6
-rw-r--r--src/test/run-pass/type-param.rs2
-rw-r--r--src/test/run-pass/type-params-in-for-each.rs4
-rw-r--r--src/test/run-pass/typestate-cfg-nesting.rs2
-rw-r--r--src/test/run-pass/typestate-multi-decl.rs6
-rw-r--r--src/test/run-pass/typestate-transitive.rs2
-rw-r--r--src/test/run-pass/u32-decr.rs2
-rw-r--r--src/test/run-pass/u8-incr-decr.rs2
-rw-r--r--src/test/run-pass/u8-incr.rs2
-rw-r--r--src/test/run-pass/uint.rs2
-rw-r--r--src/test/run-pass/unify-return-ty.rs4
-rw-r--r--src/test/run-pass/unit.rs2
-rw-r--r--src/test/run-pass/use-import-export.rs2
-rw-r--r--src/test/run-pass/utf8.rs2
-rw-r--r--src/test/run-pass/utf8_chars.rs8
-rw-r--r--src/test/run-pass/vec-append.rs28
-rw-r--r--src/test/run-pass/vec-concat.rs12
-rw-r--r--src/test/run-pass/vec-drop.rs2
-rw-r--r--src/test/run-pass/vec-growth.rs22
-rw-r--r--src/test/run-pass/vec-ivec-deadlock.rs2
-rw-r--r--src/test/run-pass/vec-late-init.rs4
-rw-r--r--src/test/run-pass/vec-push.rs4
-rw-r--r--src/test/run-pass/vec.rs4
-rw-r--r--src/test/run-pass/vector-no-ann-2.rs2
-rw-r--r--src/test/run-pass/while-and-do-while.rs2
-rw-r--r--src/test/run-pass/while-flow-graph.rs2
-rw-r--r--src/test/run-pass/while-loop-constraints-2.rs2
-rw-r--r--src/test/run-pass/while-prelude-drop.rs2
-rw-r--r--src/test/run-pass/while-with-break.rs2
-rw-r--r--src/test/run-pass/wierd-exprs.rs38
-rw-r--r--src/test/run-pass/writealias.rs2
-rw-r--r--src/test/run-pass/x86stdcall.rs2
-rw-r--r--src/test/run-pass/yield.rs2
-rw-r--r--src/test/run-pass/yield1.rs3
-rw-r--r--src/test/stdtest/bitv.rs122
-rw-r--r--src/test/stdtest/comm.rs6
-rw-r--r--src/test/stdtest/deque.rs13
-rw-r--r--src/test/stdtest/either.rs34
-rw-r--r--src/test/stdtest/getopts.rs160
-rw-r--r--src/test/stdtest/int.rs2
-rw-r--r--src/test/stdtest/io.rs2
-rw-r--r--src/test/stdtest/list.rs12
-rw-r--r--src/test/stdtest/net.rs4
-rw-r--r--src/test/stdtest/path.rs2
-rw-r--r--src/test/stdtest/ptr.rs4
-rw-r--r--src/test/stdtest/qsort.rs29
-rw-r--r--src/test/stdtest/qsort3.rs20
-rw-r--r--src/test/stdtest/rand.rs2
-rw-r--r--src/test/stdtest/run.rs20
-rw-r--r--src/test/stdtest/sha1.rs48
-rw-r--r--src/test/stdtest/sort.rs16
-rw-r--r--src/test/stdtest/str.rs62
-rw-r--r--src/test/stdtest/str_buf.rs2
-rw-r--r--src/test/stdtest/task.rs8
-rw-r--r--src/test/stdtest/test.rs42
-rw-r--r--src/test/stdtest/uint.rs2
-rw-r--r--src/test/stdtest/vec.rs280
-rw-r--r--src/test/stdtest/vec_str_conversions.rs4
548 files changed, 1838 insertions, 2190 deletions
diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs
index cf1989ce294..aa79590a246 100644
--- a/src/test/bench/99bob-iter.rs
+++ b/src/test/bench/99bob-iter.rs
@@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str {
       _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
-        if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); }
+        if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
         i += 1u;
     }
     ret b;
diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs
index 4bbea0c34bd..fdfce9dfae5 100644
--- a/src/test/bench/99bob-pattern.rs
+++ b/src/test/bench/99bob-pattern.rs
@@ -56,4 +56,4 @@ fn main() {
     let b: bottle = multiple(99);
     let running: bool = true;
     while running { show(b); log ""; running = more(b); b = next(b); }
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs
index 205ab67ff9a..2db6321d257 100644
--- a/src/test/bench/99bob-simple.rs
+++ b/src/test/bench/99bob-simple.rs
@@ -32,7 +32,7 @@ fn sub(t: str, n: int) -> str {
       _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
-        if t.(i) == '#' as u8 { b += ns; } else { str::push_byte(b, t.(i)); }
+        if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
         i += 1u;
     }
     ret b;
@@ -45,4 +45,4 @@ fn main() {
     while n > 0 { log sub(b1(), n); log sub(b2(), n - 1); log ""; n -= 1; }
     log b7();
     log sub(b8(), 99);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs
index c68d77fe324..af5e22f48ea 100644
--- a/src/test/bench/99bob-tail.rs
+++ b/src/test/bench/99bob-tail.rs
@@ -36,4 +36,4 @@ fn main() {
         log "";
     }
     multiple(99);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-ackermann.rs b/src/test/bench/shootout-ackermann.rs
index 91e524d0d31..46b8cc443bf 100644
--- a/src/test/bench/shootout-ackermann.rs
+++ b/src/test/bench/shootout-ackermann.rs
@@ -22,4 +22,4 @@ fn main() {
 
     // assert (ack(4,1) == 65533);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-binarytrees.rs b/src/test/bench/shootout-binarytrees.rs
index 0fd77456e2a..d6a44e6eb82 100644
--- a/src/test/bench/shootout-binarytrees.rs
+++ b/src/test/bench/shootout-binarytrees.rs
@@ -28,8 +28,8 @@ fn main() {
     } else { max_depth = n; }
     let stretch_depth = max_depth + 1;
     let stretch_tree = bottom_up_tree(0, stretch_depth);
-    log #fmt("stretch tree of depth %d\t check: %d", stretch_depth,
-             item_check(stretch_tree));
+    log #fmt["stretch tree of depth %d\t check: %d", stretch_depth,
+             item_check(stretch_tree)];
     let long_lived_tree = bottom_up_tree(0, max_depth);
     let depth = min_depth;
     while depth <= max_depth {
@@ -43,10 +43,10 @@ fn main() {
             chk += item_check(temp_tree);
             i += 1;
         }
-        log #fmt("%d\t trees of depth %d\t check: %d", iterations * 2, depth,
-                 chk);
+        log #fmt["%d\t trees of depth %d\t check: %d", iterations * 2, depth,
+                 chk];
         depth += 2;
     }
-    log #fmt("long lived trees of depth %d\t check: %d", max_depth,
-             item_check(long_lived_tree));
-}
\ No newline at end of file
+    log #fmt["long lived trees of depth %d\t check: %d", max_depth,
+             item_check(long_lived_tree)];
+}
diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs
index d4bdbc93b35..8e7b2cbe269 100644
--- a/src/test/bench/shootout-fannkuchredux.rs
+++ b/src/test/bench/shootout-fannkuchredux.rs
@@ -20,21 +20,21 @@ fn fannkuch(n: int) -> int {
     r = n;
     while r > 0 {
         i = 0;
-        while r != 1 { count.(r - 1) = r; r -= 1; }
-        while i < n { perm.(i) = perm1.(i); i += 1; }
+        while r != 1 { count[r - 1] = r; r -= 1; }
+        while i < n { perm[i] = perm1[i]; i += 1; }
         // Count flips and update max and checksum
 
         f = 0;
-        k = perm.(0);
+        k = perm[0];
         while k != 0 {
             i = 0;
             while 2 * i < k {
-                let t = perm.(i);
-                perm.(i) = perm.(k - i);
-                perm.(k - i) = t;
+                let t = perm[i];
+                perm[i] = perm[k - i];
+                perm[k - i] = t;
                 i += 1;
             }
-            k = perm.(0);
+            k = perm[0];
             f += 1;
         }
         if f > flips { flips = f; }
@@ -44,12 +44,12 @@ fn fannkuch(n: int) -> int {
         let go = true;
         while go {
             if r == n { log checksum; ret flips; }
-            let p0 = perm1.(0);
+            let p0 = perm1[0];
             i = 0;
-            while i < r { let j = i + 1; perm1.(i) = perm1.(j); i = j; }
-            perm1.(r) = p0;
-            count.(r) -= 1;
-            if count.(r) > 0 { go = false; } else { r += 1; }
+            while i < r { let j = i + 1; perm1[i] = perm1[j]; i = j; }
+            perm1[r] = p0;
+            count[r] -= 1;
+            if count[r] > 0 { go = false; } else { r += 1; }
         }
         nperm += 1;
     }
@@ -58,5 +58,5 @@ fn fannkuch(n: int) -> int {
 
 fn main(args: [str]) {
     let n = 7;
-    log #fmt("Pfannkuchen(%d) = %d", n, fannkuch(n));
+    log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)];
 }
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index 25a3756346a..80e0108867d 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -25,20 +25,20 @@ type aminoacids = {ch: char, prob: u32};
 
 fn make_cumulative(aa: &[aminoacids]) -> [aminoacids] {
     let cp: u32 = 0u32;
-    let ans: [aminoacids] = ~[];
-    for a: aminoacids in aa { cp += a.prob; ans += ~[{ch: a.ch, prob: cp}]; }
+    let ans: [aminoacids] = [];
+    for a: aminoacids in aa { cp += a.prob; ans += [{ch: a.ch, prob: cp}]; }
     ret ans;
 }
 
 fn select_random(r: u32, genelist: &[aminoacids]) -> char {
-    if r < genelist.(0).prob { ret genelist.(0).ch; }
+    if r < genelist[0].prob { ret genelist[0].ch; }
     fn bisect(v: &[aminoacids], lo: uint, hi: uint, target: u32) -> char {
         if hi > lo + 1u {
             let mid: uint = lo + (hi - lo) / 2u;
-            if target < v.(mid).prob {
+            if target < v[mid].prob {
                 be bisect(v, lo, mid, target);
             } else { be bisect(v, mid, hi, target); }
-        } else { ret v.(hi).ch; }
+        } else { ret v[hi].ch; }
     }
     ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r);
 }
@@ -59,7 +59,7 @@ fn make_repeat_fasta(id: str, desc: str, s: str, n: int) {
     let op: str = "";
     let sl: uint = str::byte_len(s);
     for each i: uint in uint::range(0u, n as uint) {
-        str::push_byte(op, s.(i % sl));
+        str::push_byte(op, s[i % sl]);
         if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
@@ -69,16 +69,14 @@ fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; }
 
 fn main(args: [str]) {
     let iub: [aminoacids] =
-        make_cumulative(
-            ~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
-              acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
-              acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
-              acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
-              acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
+        make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
+                         acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
+                         acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
+                         acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
+                         acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
     let homosapiens: [aminoacids] =
-        make_cumulative(
-            ~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
-              acid('t', 30u32)]);
+        make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
+                         acid('t', 30u32)]);
     let alu: str =
         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
             "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
diff --git a/src/test/bench/shootout-fibo.rs b/src/test/bench/shootout-fibo.rs
index f0a2009b213..a4b5f2588d4 100644
--- a/src/test/bench/shootout-fibo.rs
+++ b/src/test/bench/shootout-fibo.rs
@@ -16,4 +16,4 @@ fn main() {
     assert (fib(15) == 610);
     log fib(8);
     log fib(15);
-}
\ No newline at end of file
+}
diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs
index 7657d058d02..5e888041981 100644
--- a/src/test/bench/shootout-nbody.rs
+++ b/src/test/bench/shootout-nbody.rs
@@ -12,7 +12,7 @@ fn main() {
     // during 'make check' under valgrind
     // 5000000
     // 50000000
-    let inputs: [int] = ~[50000, 500000];
+    let inputs: [int] = [50000, 500000];
 
     let bodies: [Body::props] = NBodySystem::MakeNBodySystem();
 
@@ -34,7 +34,7 @@ mod NBodySystem {
     fn MakeNBodySystem() -> [Body::props] {
         // these each return a Body::props
         let bodies: [Body::props] =
-            ~[Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(),
+            [Body::sun(), Body::jupiter(), Body::saturn(), Body::uranus(),
              Body::neptune()];
 
         let px: float = 0.0;
@@ -43,15 +43,15 @@ mod NBodySystem {
 
         let i: int = 0;
         while i < 5 {
-            px += bodies.(i).vx * bodies.(i).mass;
-            py += bodies.(i).vy * bodies.(i).mass;
-            pz += bodies.(i).vz * bodies.(i).mass;
+            px += bodies[i].vx * bodies[i].mass;
+            py += bodies[i].vy * bodies[i].mass;
+            pz += bodies[i].vz * bodies[i].mass;
 
             i += 1;
         }
 
         // side-effecting
-        Body::offsetMomentum(bodies.(0), px, py, pz);
+        Body::offsetMomentum(bodies[0], px, py, pz);
 
         ret bodies;
     }
@@ -61,13 +61,13 @@ mod NBodySystem {
         let i: int = 0;
         while i < 5 {
             let j: int = i + 1;
-            while j < 5 { advance_one(bodies.(i), bodies.(j), dt); j += 1; }
+            while j < 5 { advance_one(bodies[i], bodies[j], dt); j += 1; }
 
             i += 1;
         }
 
         i = 0;
-        while i < 5 { move(bodies.(i), dt); i += 1; }
+        while i < 5 { move(bodies[i], dt); i += 1; }
     }
 
     fn advance_one(bi: &Body::props, bj: &Body::props, dt: float) {
@@ -105,19 +105,18 @@ mod NBodySystem {
         let i: int = 0;
         while i < 5 {
             e +=
-                0.5 * bodies.(i).mass *
-                    (bodies.(i).vx * bodies.(i).vx +
-                         bodies.(i).vy * bodies.(i).vy +
-                         bodies.(i).vz * bodies.(i).vz);
+                0.5 * bodies[i].mass *
+                    (bodies[i].vx * bodies[i].vx + bodies[i].vy * bodies[i].vy
+                         + bodies[i].vz * bodies[i].vz);
 
             let j: int = i + 1;
             while j < 5 {
-                dx = bodies.(i).x - bodies.(j).x;
-                dy = bodies.(i).y - bodies.(j).y;
-                dz = bodies.(i).z - bodies.(j).z;
+                dx = bodies[i].x - bodies[j].x;
+                dy = bodies[i].y - bodies[j].y;
+                dz = bodies[i].z - bodies[j].z;
 
                 distance = llvm::sqrt(dx * dx + dy * dy + dz * dz);
-                e -= bodies.(i).mass * bodies.(j).mass / distance;
+                e -= bodies[i].mass * bodies[j].mass / distance;
 
                 j += 1;
             }
@@ -133,7 +132,7 @@ mod Body {
 
     const PI: float = 3.141592653589793;
     const SOLAR_MASS: float = 39.478417604357432;
-     // was 4 * PI * PI originally
+    // was 4 * PI * PI originally
     const DAYS_PER_YEAR: float = 365.24;
 
     type props =
diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs
index 67cbf77968e..60b54cbe33d 100644
--- a/src/test/bench/shootout-pfib.rs
+++ b/src/test/bench/shootout-pfib.rs
@@ -30,7 +30,7 @@ fn fib(n: int) -> int {
     fn pfib(c: _chan<int>, n: int) {
         if n == 0 {
             send(c, 0);
-        } else if (n <= 2) {
+        } else if n <= 2 {
             send(c, 1);
         } else {
             let p = mk_port::<int>();
@@ -50,7 +50,7 @@ fn fib(n: int) -> int {
 type config = {stress: bool};
 
 fn parse_opts(argv: [str]) -> config {
-    let opts = ~[getopts::optflag("stress")];
+    let opts = [getopts::optflag("stress")];
 
     let opt_args = vec::slice(argv, 1u, vec::len(argv));
 
@@ -67,7 +67,7 @@ fn stress_task(id: int) {
         let n = 15;
         assert (fib(n) == fib(n));
         i += 1;
-        log_err #fmt("%d: Completed %d iterations", id, i);
+        log_err #fmt["%d: Completed %d iterations", id, i];
     }
 }
 
@@ -91,7 +91,7 @@ fn main(argv: [str]) {
         if opts.stress {
             stress(2);
         } else {
-            let max = uint::parse_buf(str::bytes(argv.(1)), 10u) as int;
+            let max = uint::parse_buf(str::bytes(argv[1]), 10u) as int;
 
             let num_trials = 10;
 
@@ -106,8 +106,8 @@ fn main(argv: [str]) {
 
                     let elapsed = stop - start;
 
-                    out.write_line(#fmt("%d\t%d\t%s", n, fibn,
-                                        u64::str(elapsed)));
+                    out.write_line(#fmt["%d\t%d\t%s", n, fibn,
+                                        u64::str(elapsed)]);
                 }
             }
         }
diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs
index 48e1b4d8087..150853e2328 100644
--- a/src/test/bench/task-perf-spawnalot.rs
+++ b/src/test/bench/task-perf-spawnalot.rs
@@ -6,25 +6,17 @@ import std::str;
 
 fn f(n: uint) {
     let i = 0u;
-    while i < n {
-        let thunk = g;
-        task::join_id(task::spawn(thunk));
-        i += 1u;
-    }
+    while i < n { let thunk = g; task::join_id(task::spawn(thunk)); i += 1u; }
 }
 
-fn g() {}
+fn g() { }
 
 fn main(args: [str]) {
 
-    let n = if vec::len(args) < 2u {
-        10u
-    } else {
-        uint::parse_buf(str::bytes(args.(1)), 10u)
-    };
+    let n =
+        if vec::len(args) < 2u {
+            10u
+        } else { uint::parse_buf(str::bytes(args[1]), 10u) };
     let i = 0u;
-    while i < n {
-        task::spawn(bind f(n));
-        i += 1u;
-    }
+    while i < n { task::spawn(bind f(n)); i += 1u; }
 }
diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs
index 54bfae13c23..7d0effb4a7f 100644
--- a/src/test/bench/task-perf-word-count.rs
+++ b/src/test/bench/task-perf-word-count.rs
@@ -42,14 +42,7 @@ fn reduce(word: str, get: map_reduce::getter) {
     let count = 0;
 
 
-    while true {
-        alt get() {
-          some(_) {
-            count += 1;
-          }
-          none. { break }
-        }
-    }
+    while true { alt get() { some(_) { count += 1; } none. { break } } }
 }
 
 mod map_reduce {
@@ -59,13 +52,13 @@ mod map_reduce {
     export reducer;
     export map_reduce;
 
-    type putter = fn(str, int) ;
+    type putter = fn(str, int);
 
-    type mapper = fn(str, putter) ;
+    type mapper = fn(str, putter);
 
-    type getter = fn() -> option<int> ;
+    type getter = fn() -> option<int>;
 
-    type reducer = fn(str, getter) ;
+    type reducer = fn(str, getter);
 
     tag ctrl_proto {
         find_reducer([u8], _chan<_chan<reduce_proto>>);
@@ -75,9 +68,9 @@ mod map_reduce {
     tag reduce_proto { emit_val(int); done; ref; release; }
 
     fn start_mappers(ctrl: _chan<ctrl_proto>, inputs: &[str]) -> [task_id] {
-        let tasks = ~[];
+        let tasks = [];
         for i: str in inputs {
-            tasks += ~[task::spawn(bind map_task(ctrl, i))];
+            tasks += [task::spawn(bind map_task(ctrl, i))];
         }
         ret tasks;
     }
@@ -108,7 +101,7 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        for each kv: @{key: str, val: _chan<reduce_proto>}  in
+        for each kv: @{key: str, val: _chan<reduce_proto>} in
                  intermediates.items() {
             send(kv.val, release);
         }
@@ -178,8 +171,7 @@ mod map_reduce {
                   none. {
                     // log_err "creating new reducer for " + k;
                     let p = mk_port();
-                    tasks +=
-                        ~[task::spawn(bind reduce_task(k, p.mk_chan()))];
+                    tasks += [task::spawn(bind reduce_task(k, p.mk_chan()))];
                     c = p.recv();
                     reducers.insert(k, c);
                   }
@@ -202,7 +194,7 @@ fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(#fmt("Usage: %s <filename> ...", argv.(0)));
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
diff --git a/src/test/compile-fail/alias-mismatch.rs b/src/test/compile-fail/alias-mismatch.rs
index c25c7229e22..068e8c65ff5 100644
--- a/src/test/compile-fail/alias-mismatch.rs
+++ b/src/test/compile-fail/alias-mismatch.rs
@@ -5,5 +5,5 @@ import std::vec::map;
 fn main() {
     fn f(i: uint) -> bool { true }
 
-    let a = map(f, ~[5u]);
-}
\ No newline at end of file
+    let a = map(f, [5u]);
+}
diff --git a/src/test/compile-fail/aliasness-mismatch.rs b/src/test/compile-fail/aliasness-mismatch.rs
index a376508e8b4..8be70d8e29f 100644
--- a/src/test/compile-fail/aliasness-mismatch.rs
+++ b/src/test/compile-fail/aliasness-mismatch.rs
@@ -3,6 +3,6 @@
 
 fn f(x: &int) { log_err x; }
 fn h(x: int) { log_err x; }
-fn main() { let g: fn(int)  = f; g(10); g = h; g(10); }
+fn main() { let g: fn(int) = f; g(10); g = h; g(10); }
 
 
diff --git a/src/test/compile-fail/alt-join.rs b/src/test/compile-fail/alt-join.rs
index 613e1e12382..246d186b06c 100644
--- a/src/test/compile-fail/alt-join.rs
+++ b/src/test/compile-fail/alt-join.rs
@@ -5,11 +5,8 @@
 fn my_fail() -> ! { fail; }
 
 fn main() {
-    alt (true) {
-      false { my_fail(); }
-      true {}
-    }
+    alt true { false { my_fail(); } true { } }
 
     log x;
-    let x:int;
-}
\ No newline at end of file
+    let x: int;
+}
diff --git a/src/test/compile-fail/and-init.rs b/src/test/compile-fail/and-init.rs
index 26296dc6faa..75e63ab2cc6 100644
--- a/src/test/compile-fail/and-init.rs
+++ b/src/test/compile-fail/and-init.rs
@@ -5,4 +5,4 @@ fn main() {
 
     log false && { i = 5; true };
     log i;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/arg-count-mismatch.rs b/src/test/compile-fail/arg-count-mismatch.rs
index 89be0585c34..62aad13d150 100644
--- a/src/test/compile-fail/arg-count-mismatch.rs
+++ b/src/test/compile-fail/arg-count-mismatch.rs
@@ -2,4 +2,4 @@
 
 fn f(x: int) { }
 
-fn main() { let i: (); i = f(); }
\ No newline at end of file
+fn main() { let i: (); i = f(); }
diff --git a/src/test/compile-fail/arg-type-mismatch.rs b/src/test/compile-fail/arg-type-mismatch.rs
index 3fe2e95c294..8934a12b27a 100644
--- a/src/test/compile-fail/arg-type-mismatch.rs
+++ b/src/test/compile-fail/arg-type-mismatch.rs
@@ -3,4 +3,4 @@
 
 fn f(x: int) { }
 
-fn main() { let i: (); i = f(()); }
\ No newline at end of file
+fn main() { let i: (); i = f(()); }
diff --git a/src/test/compile-fail/assign-alias.rs b/src/test/compile-fail/assign-alias.rs
index 66041f08a7a..b291b6d47b6 100644
--- a/src/test/compile-fail/assign-alias.rs
+++ b/src/test/compile-fail/assign-alias.rs
@@ -2,4 +2,4 @@
 
 fn f(i: &int) { i += 2; }
 
-fn main() { f(1); }
\ No newline at end of file
+fn main() { f(1); }
diff --git a/src/test/compile-fail/auto-deref-bind.rs b/src/test/compile-fail/auto-deref-bind.rs
index 9d9b0613bd7..b218ddd122a 100644
--- a/src/test/compile-fail/auto-deref-bind.rs
+++ b/src/test/compile-fail/auto-deref-bind.rs
@@ -1,4 +1,4 @@
 // error-pattern: mismatched types
 
 fn add1(i: int) -> int { ret i + 1; }
-fn main() { let f = @add1; let g = bind f(5); }
\ No newline at end of file
+fn main() { let f = @add1; let g = bind f(5); }
diff --git a/src/test/compile-fail/bad-bang-ann-2.rs b/src/test/compile-fail/bad-bang-ann-2.rs
index 15ba26b0dc0..011358ac10c 100644
--- a/src/test/compile-fail/bad-bang-ann-2.rs
+++ b/src/test/compile-fail/bad-bang-ann-2.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { log 3; }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-bang-ann-3.rs b/src/test/compile-fail/bad-bang-ann-3.rs
index 7077a2e7986..2ba862ff57f 100644
--- a/src/test/compile-fail/bad-bang-ann-3.rs
+++ b/src/test/compile-fail/bad-bang-ann-3.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { ret 7u; }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-bang-ann.rs b/src/test/compile-fail/bad-bang-ann.rs
index 20aed480bfc..e67013998a1 100644
--- a/src/test/compile-fail/bad-bang-ann.rs
+++ b/src/test/compile-fail/bad-bang-ann.rs
@@ -4,4 +4,4 @@
 
 fn bad_bang(i: uint) -> ! { if i < 0u { } else { fail; } }
 
-fn main() { bad_bang(5u); }
\ No newline at end of file
+fn main() { bad_bang(5u); }
diff --git a/src/test/compile-fail/bad-env-capture.rs b/src/test/compile-fail/bad-env-capture.rs
index 2848d185739..8e8441e55ac 100644
--- a/src/test/compile-fail/bad-env-capture.rs
+++ b/src/test/compile-fail/bad-env-capture.rs
@@ -3,4 +3,4 @@ fn foo() {
     let x: int;
     fn bar() { log x; }
 }
-fn main() { foo(); }
\ No newline at end of file
+fn main() { foo(); }
diff --git a/src/test/compile-fail/bad-env-capture2.rs b/src/test/compile-fail/bad-env-capture2.rs
index 47e9a4e0ed9..40a0a39e7c6 100644
--- a/src/test/compile-fail/bad-env-capture2.rs
+++ b/src/test/compile-fail/bad-env-capture2.rs
@@ -2,4 +2,4 @@
 fn foo(x: int) {
     fn bar() { log x; }
 }
-fn main() { foo(2); }
\ No newline at end of file
+fn main() { foo(2); }
diff --git a/src/test/compile-fail/bad-env-capture3.rs b/src/test/compile-fail/bad-env-capture3.rs
index 43d9a15665c..1ff3602ee88 100644
--- a/src/test/compile-fail/bad-env-capture3.rs
+++ b/src/test/compile-fail/bad-env-capture3.rs
@@ -5,4 +5,4 @@ obj foo(x: int) {
     }
 }
 
-fn main() { foo(2); }
\ No newline at end of file
+fn main() { foo(2); }
diff --git a/src/test/compile-fail/bad-main.rs b/src/test/compile-fail/bad-main.rs
index 40879fae555..725f88129b9 100644
--- a/src/test/compile-fail/bad-main.rs
+++ b/src/test/compile-fail/bad-main.rs
@@ -1,3 +1,3 @@
 // error-pattern:wrong type in main function
 
-fn main(x: int) { }
\ No newline at end of file
+fn main(x: int) { }
diff --git a/src/test/compile-fail/bad-module.rs b/src/test/compile-fail/bad-module.rs
index bfb796916a3..c5b67b9401b 100644
--- a/src/test/compile-fail/bad-module.rs
+++ b/src/test/compile-fail/bad-module.rs
@@ -1,4 +1,4 @@
 // error-pattern: unresolved import: vec
 import vec;
 
-fn main() { let foo = vec::len([]); }
\ No newline at end of file
+fn main() { let foo = vec::len([]); }
diff --git a/src/test/compile-fail/bad-record-pat-2.rs b/src/test/compile-fail/bad-record-pat-2.rs
index 125b608e4ed..54ae70a8661 100644
--- a/src/test/compile-fail/bad-record-pat-2.rs
+++ b/src/test/compile-fail/bad-record-pat-2.rs
@@ -1,3 +1,3 @@
 // error-pattern:did not expect a record with a field q
 
-fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } }
\ No newline at end of file
+fn main() { alt {x: 1, y: 2} { {x: x, q: q} { } } }
diff --git a/src/test/compile-fail/bad-record-pat.rs b/src/test/compile-fail/bad-record-pat.rs
index e8bb2426cd9..1b12d274ce8 100644
--- a/src/test/compile-fail/bad-record-pat.rs
+++ b/src/test/compile-fail/bad-record-pat.rs
@@ -1,3 +1,3 @@
 // error-pattern:expected a record with 2 fields, found one with 1
 
-fn main() { alt {x: 1, y: 2} { {x: x} { } } }
\ No newline at end of file
+fn main() { alt {x: 1, y: 2} { {x: x} { } } }
diff --git a/src/test/compile-fail/bang-tailexpr.rs b/src/test/compile-fail/bang-tailexpr.rs
index 87afc1bd401..d13fca4486c 100644
--- a/src/test/compile-fail/bang-tailexpr.rs
+++ b/src/test/compile-fail/bang-tailexpr.rs
@@ -1,3 +1,3 @@
 // error-pattern: some control paths may return
 fn f() -> ! { 3 }
-fn main(){}
+fn main() { }
diff --git a/src/test/compile-fail/binop-add-tup-assign.rs b/src/test/compile-fail/binop-add-tup-assign.rs
index 6470ae353a8..86515aeea6a 100644
--- a/src/test/compile-fail/binop-add-tup-assign.rs
+++ b/src/test/compile-fail/binop-add-tup-assign.rs
@@ -1,3 +1,3 @@
 // error-pattern:+ cannot be applied to type `{x: bool}`
 
-fn main() { let x = {x: true}; x += {x: false}; }
\ No newline at end of file
+fn main() { let x = {x: true}; x += {x: false}; }
diff --git a/src/test/compile-fail/binop-add-tup.rs b/src/test/compile-fail/binop-add-tup.rs
index 96dc63fef01..fadb35503e2 100644
--- a/src/test/compile-fail/binop-add-tup.rs
+++ b/src/test/compile-fail/binop-add-tup.rs
@@ -1,3 +1,3 @@
 // error-pattern:+ cannot be applied to type `{x: bool}`
 
-fn main() { let x = {x: true} + {x: false}; }
\ No newline at end of file
+fn main() { let x = {x: true} + {x: false}; }
diff --git a/src/test/compile-fail/binop-bitxor-str.rs b/src/test/compile-fail/binop-bitxor-str.rs
index 0f1e2202419..65e0996fa62 100644
--- a/src/test/compile-fail/binop-bitxor-str.rs
+++ b/src/test/compile-fail/binop-bitxor-str.rs
@@ -1,3 +1,3 @@
 // error-pattern:^ cannot be applied to type `str`
 
-fn main() { let x = "a" ^ "b"; }
\ No newline at end of file
+fn main() { let x = "a" ^ "b"; }
diff --git a/src/test/compile-fail/binop-logic-float.rs b/src/test/compile-fail/binop-logic-float.rs
index 900c290b07e..7b7b165d49b 100644
--- a/src/test/compile-fail/binop-logic-float.rs
+++ b/src/test/compile-fail/binop-logic-float.rs
@@ -1,3 +1,3 @@
 // error-pattern:|| cannot be applied to type `f32`
 
-fn main() { let x = 1.0_f32 || 2.0_f32; }
\ No newline at end of file
+fn main() { let x = 1.0_f32 || 2.0_f32; }
diff --git a/src/test/compile-fail/binop-logic-int.rs b/src/test/compile-fail/binop-logic-int.rs
index ffe05f1649c..ef8643bd7b4 100644
--- a/src/test/compile-fail/binop-logic-int.rs
+++ b/src/test/compile-fail/binop-logic-int.rs
@@ -1,3 +1,3 @@
 // error-pattern:&& cannot be applied to type `int`
 
-fn main() { let x = 1 && 2; }
\ No newline at end of file
+fn main() { let x = 1 && 2; }
diff --git a/src/test/compile-fail/binop-mul-bool.rs b/src/test/compile-fail/binop-mul-bool.rs
index 78e7cbe23b5..7c912f58d1e 100644
--- a/src/test/compile-fail/binop-mul-bool.rs
+++ b/src/test/compile-fail/binop-mul-bool.rs
@@ -1,3 +1,3 @@
 // error-pattern:* cannot be applied to type `bool`
 
-fn main() { let x = true * false; }
\ No newline at end of file
+fn main() { let x = true * false; }
diff --git a/src/test/compile-fail/binop-sub-obj.rs b/src/test/compile-fail/binop-sub-obj.rs
index f5010dbbe05..630cd288a49 100644
--- a/src/test/compile-fail/binop-sub-obj.rs
+++ b/src/test/compile-fail/binop-sub-obj.rs
@@ -1,3 +1,3 @@
 // error-pattern:- cannot be applied to type `obj
 
-fn main() { let x = obj () {  } - obj () {  }; }
\ No newline at end of file
+fn main() { let x = obj () { } - obj () { }; }
diff --git a/src/test/compile-fail/binop-typeck.rs b/src/test/compile-fail/binop-typeck.rs
index caa844516fb..9cb6dea5360 100644
--- a/src/test/compile-fail/binop-typeck.rs
+++ b/src/test/compile-fail/binop-typeck.rs
@@ -1,4 +1,4 @@
 // error-pattern:mismatched types
 // issue #500
 
-fn main() { let x = true; let y = 1; let z = x + y; }
\ No newline at end of file
+fn main() { let x = true; let y = 1; let z = x + y; }
diff --git a/src/test/compile-fail/block-coerce-no.rs b/src/test/compile-fail/block-coerce-no.rs
index 42b1504562a..bb3e53028c2 100644
--- a/src/test/compile-fail/block-coerce-no.rs
+++ b/src/test/compile-fail/block-coerce-no.rs
@@ -3,11 +3,11 @@
 // Make sure that fn-to-block coercion isn't incorrectly lifted over
 // other tycons.
 
-fn coerce(b: &block() ) -> fn()  {
-    fn lol(f: &fn(&block() ) -> fn()  , g: &block() ) -> fn()  { ret f(g); }
-    fn fn_id(f: &fn() ) -> fn()  { ret f }
+fn coerce(b: &block()) -> fn() {
+    fn lol(f: &fn(&block()) -> fn(), g: &block()) -> fn() { ret f(g); }
+    fn fn_id(f: &fn()) -> fn() { ret f }
     ret lol(fn_id, b);
 }
 
 
-fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); }
\ No newline at end of file
+fn main() { let i = 8; let f = coerce(block () { log_err i; }); f(); }
diff --git a/src/test/compile-fail/block-copy.rs b/src/test/compile-fail/block-copy.rs
index f0e510e87a7..6a6c708cf88 100644
--- a/src/test/compile-fail/block-copy.rs
+++ b/src/test/compile-fail/block-copy.rs
@@ -1,4 +1,4 @@
 // error-pattern: non-copyable
 
-fn lol(f: &block() ) -> block()  { ret f; }
-fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); }
\ No newline at end of file
+fn lol(f: &block()) -> block() { ret f; }
+fn main() { let i = 8; let f = lol(block () { log_err i; }); f(); }
diff --git a/src/test/compile-fail/block-uninit.rs b/src/test/compile-fail/block-uninit.rs
index 4fa112762e8..9028d5fa435 100644
--- a/src/test/compile-fail/block-uninit.rs
+++ b/src/test/compile-fail/block-uninit.rs
@@ -1,4 +1,4 @@
 // error-pattern: Unsatisfied precondition constraint
 
-fn force(f: &block() ) { f(); }
-fn main() { let x: int; force(block () { log_err x; }); }
\ No newline at end of file
+fn force(f: &block()) { f(); }
+fn main() { let x: int; force(block () { log_err x; }); }
diff --git a/src/test/compile-fail/break-outside-loop.rs b/src/test/compile-fail/break-outside-loop.rs
index adf6413ed62..3783dc83dd0 100644
--- a/src/test/compile-fail/break-outside-loop.rs
+++ b/src/test/compile-fail/break-outside-loop.rs
@@ -4,4 +4,4 @@ fn main() {
 
     let rs: {t: str} = {t: pth};
 
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/break-uninit.rs b/src/test/compile-fail/break-uninit.rs
index d1c7a90f7f2..9a82a95ade2 100644
--- a/src/test/compile-fail/break-uninit.rs
+++ b/src/test/compile-fail/break-uninit.rs
@@ -11,4 +11,4 @@ fn foo() -> int {
     ret 17;
 }
 
-fn main() { log foo(); }
\ No newline at end of file
+fn main() { log foo(); }
diff --git a/src/test/compile-fail/break-uninit2.rs b/src/test/compile-fail/break-uninit2.rs
index 9fb89c5c648..d1fda52fae6 100644
--- a/src/test/compile-fail/break-uninit2.rs
+++ b/src/test/compile-fail/break-uninit2.rs
@@ -11,4 +11,4 @@ fn foo() -> int {
     ret 17;
 }
 
-fn main() { log foo(); }
\ No newline at end of file
+fn main() { log foo(); }
diff --git a/src/test/compile-fail/capture1.rs b/src/test/compile-fail/capture1.rs
index 1e8e48aea02..877884bf7f9 100644
--- a/src/test/compile-fail/capture1.rs
+++ b/src/test/compile-fail/capture1.rs
@@ -5,4 +5,4 @@
 fn main() {
     let bar: int = 5;
     fn foo() -> int { ret bar; }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/constructor-as-cast.rs b/src/test/compile-fail/constructor-as-cast.rs
index 2bee78316f2..85d8c7850cf 100644
--- a/src/test/compile-fail/constructor-as-cast.rs
+++ b/src/test/compile-fail/constructor-as-cast.rs
@@ -1,10 +1,10 @@
 // error-pattern: unresolved name: base
 type base =
     obj {
-        fn foo() ;
+        fn foo();
     };
 obj derived() {
     fn foo() { }
     fn bar() { }
 }
-fn main() { let d: derived = derived(); let b: base = base(d); }
\ No newline at end of file
+fn main() { let d: derived = derived(); let b: base = base(d); }
diff --git a/src/test/compile-fail/copy-a-resource.rs b/src/test/compile-fail/copy-a-resource.rs
index aabacdde27f..9e5e6f81666 100644
--- a/src/test/compile-fail/copy-a-resource.rs
+++ b/src/test/compile-fail/copy-a-resource.rs
@@ -2,4 +2,4 @@
 
 resource foo(i: int) { }
 
-fn main() { let x <- foo(10); let y = x; }
\ No newline at end of file
+fn main() { let x <- foo(10); let y = x; }
diff --git a/src/test/compile-fail/cross-crate-glob-collision.rs b/src/test/compile-fail/cross-crate-glob-collision.rs
index 3771851cfae..490f8ae9b21 100644
--- a/src/test/compile-fail/cross-crate-glob-collision.rs
+++ b/src/test/compile-fail/cross-crate-glob-collision.rs
@@ -10,4 +10,4 @@ mod alternate_supplier {
     fn member() { }
 }
 
-fn main() { member() }
\ No newline at end of file
+fn main() { member() }
diff --git a/src/test/compile-fail/direct-obj-fn-call.rs b/src/test/compile-fail/direct-obj-fn-call.rs
index 557b6af1696..01ec855bf7c 100644
--- a/src/test/compile-fail/direct-obj-fn-call.rs
+++ b/src/test/compile-fail/direct-obj-fn-call.rs
@@ -4,4 +4,4 @@ obj x() {
     fn hello() { log "hello"; }
 }
 
-fn main() { x.hello(); }
\ No newline at end of file
+fn main() { x.hello(); }
diff --git a/src/test/compile-fail/do-while-constraints.rs b/src/test/compile-fail/do-while-constraints.rs
index cfea71fc7ef..f7d03b89354 100644
--- a/src/test/compile-fail/do-while-constraints.rs
+++ b/src/test/compile-fail/do-while-constraints.rs
@@ -7,4 +7,4 @@ fn main() {
         log y;
         do  { do  { do  { x <- y; } while true } while true } while true
     } while true
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/do-while-pred-constraints.rs b/src/test/compile-fail/do-while-pred-constraints.rs
index 31d3e82796e..90fcd26ea9f 100644
--- a/src/test/compile-fail/do-while-pred-constraints.rs
+++ b/src/test/compile-fail/do-while-pred-constraints.rs
@@ -1,24 +1,14 @@
 // error-pattern: Unsatisfied precondition constraint (for example, even(y
 
-fn print_even(y: int) : even(y) {
-  log y;
-}
+fn print_even(y: int) : even(y) { log y; }
 
-pred even(y: int) -> bool {
-  true
-}
+pred even(y: int) -> bool { true }
 
 fn main() {
-  let y: int = 42;
-  check even(y);
-  do {
-    print_even(y);
-    do {
-      do {
-    do {
-      y += 1;
-    } while (true);
-      } while (true);
-    } while (true);
-  } while (true);
+    let y: int = 42;
+    check (even(y));
+    do  {
+        print_even(y);
+        do  { do  { do  { y += 1; } while true } while true } while true
+    } while true
 }
diff --git a/src/test/compile-fail/dup-link-name.rs b/src/test/compile-fail/dup-link-name.rs
index 346588392ee..c7f0a12d061 100644
--- a/src/test/compile-fail/dup-link-name.rs
+++ b/src/test/compile-fail/dup-link-name.rs
@@ -2,4 +2,4 @@
 
 #[link(name = "test", name)];
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/export-fully-qualified.rs b/src/test/compile-fail/export-fully-qualified.rs
index 7413777ee2b..30075a1cadb 100644
--- a/src/test/compile-fail/export-fully-qualified.rs
+++ b/src/test/compile-fail/export-fully-qualified.rs
@@ -13,4 +13,4 @@ mod foo {
     fn baz() { }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/export-import.rs b/src/test/compile-fail/export-import.rs
index 2608f523220..f5ed4c4f3a7 100644
--- a/src/test/compile-fail/export-import.rs
+++ b/src/test/compile-fail/export-import.rs
@@ -11,4 +11,4 @@ mod m {
 }
 
 
-fn main() { unexported(); }
\ No newline at end of file
+fn main() { unexported(); }
diff --git a/src/test/compile-fail/export-no-tag-variants.rs b/src/test/compile-fail/export-no-tag-variants.rs
index a824212ab08..2d10cb49270 100644
--- a/src/test/compile-fail/export-no-tag-variants.rs
+++ b/src/test/compile-fail/export-no-tag-variants.rs
@@ -9,4 +9,4 @@ mod foo {
     tag t { t1; }
 }
 
-fn main() { let x = foo::t1; }
\ No newline at end of file
+fn main() { let x = foo::t1; }
diff --git a/src/test/compile-fail/export-tag-variant.rs b/src/test/compile-fail/export-tag-variant.rs
index a31ae5615fb..33496480c02 100644
--- a/src/test/compile-fail/export-tag-variant.rs
+++ b/src/test/compile-fail/export-tag-variant.rs
@@ -8,4 +8,4 @@ mod foo {
     tag y { y1; }
 }
 
-fn main() { let z = foo::y1; }
\ No newline at end of file
+fn main() { let z = foo::y1; }
diff --git a/src/test/compile-fail/export.rs b/src/test/compile-fail/export.rs
index 57967838640..55d33160d34 100644
--- a/src/test/compile-fail/export.rs
+++ b/src/test/compile-fail/export.rs
@@ -5,4 +5,4 @@ mod foo {
     fn z(y: int) { log y; }
 }
 
-fn main() { foo::z(10); }
\ No newline at end of file
+fn main() { foo::z(10); }
diff --git a/src/test/compile-fail/export2.rs b/src/test/compile-fail/export2.rs
index 47b80014a1c..28919efdd49 100644
--- a/src/test/compile-fail/export2.rs
+++ b/src/test/compile-fail/export2.rs
@@ -14,4 +14,4 @@ mod bar {
     fn y() { }
 }
 
-fn main() { foo::x(); }
\ No newline at end of file
+fn main() { foo::x(); }
diff --git a/src/test/compile-fail/ext-nonexistent.rs b/src/test/compile-fail/ext-nonexistent.rs
index f4cb0021be3..ec63c1f07d0 100644
--- a/src/test/compile-fail/ext-nonexistent.rs
+++ b/src/test/compile-fail/ext-nonexistent.rs
@@ -1,2 +1,2 @@
 // error-pattern:macro undefined
-fn main() { #iamnotanextensionthatexists(""); }
\ No newline at end of file
+fn main() { #iamnotanextensionthatexists[""]; }
diff --git a/src/test/compile-fail/extend-non-object.rs b/src/test/compile-fail/extend-non-object.rs
index 4a957f5fc73..0857ac990c0 100644
--- a/src/test/compile-fail/extend-non-object.rs
+++ b/src/test/compile-fail/extend-non-object.rs
@@ -10,4 +10,4 @@ fn main() {
             with
             x
         };
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/extenv-no-args.rs b/src/test/compile-fail/extenv-no-args.rs
index 5b0be3c9871..ec73f0a7a45 100644
--- a/src/test/compile-fail/extenv-no-args.rs
+++ b/src/test/compile-fail/extenv-no-args.rs
@@ -1,5 +1,3 @@
 // error-pattern:malformed #env call
 
-fn main() {
-    #env();
-}
+fn main() { #env[]; }
diff --git a/src/test/compile-fail/extenv-not-string-literal.rs b/src/test/compile-fail/extenv-not-string-literal.rs
index 8ab4953c8fa..57d50b2e54d 100644
--- a/src/test/compile-fail/extenv-not-string-literal.rs
+++ b/src/test/compile-fail/extenv-not-string-literal.rs
@@ -1,3 +1,3 @@
 // error-pattern:requires a string
 
-fn main() { #env(10); }
\ No newline at end of file
+fn main() { #env[10]; }
diff --git a/src/test/compile-fail/extenv-too-many-args.rs b/src/test/compile-fail/extenv-too-many-args.rs
index 65200e5c116..945546fd6cb 100644
--- a/src/test/compile-fail/extenv-too-many-args.rs
+++ b/src/test/compile-fail/extenv-too-many-args.rs
@@ -1,3 +1,3 @@
 // error-pattern:malformed #env call
 
-fn main() { #env("one", "two"); }
\ No newline at end of file
+fn main() { #env["one", "two"]; }
diff --git a/src/test/compile-fail/extfmt-missing-type.rs b/src/test/compile-fail/extfmt-missing-type.rs
index 23deb75e9e7..9e1cbc557d4 100644
--- a/src/test/compile-fail/extfmt-missing-type.rs
+++ b/src/test/compile-fail/extfmt-missing-type.rs
@@ -1,3 +1,3 @@
 // error-pattern:missing type
 
-fn main() { #fmt("%+"); }
\ No newline at end of file
+fn main() { #fmt["%+"]; }
diff --git a/src/test/compile-fail/extfmt-no-args.rs b/src/test/compile-fail/extfmt-no-args.rs
index 8bc3f23f2f0..7c13ef99dc5 100644
--- a/src/test/compile-fail/extfmt-no-args.rs
+++ b/src/test/compile-fail/extfmt-no-args.rs
@@ -1,5 +1,3 @@
 // error-pattern:format string
 
-fn main() {
-    #fmt();
-}
\ No newline at end of file
+fn main() { #fmt[]; }
diff --git a/src/test/compile-fail/extfmt-non-literal.rs b/src/test/compile-fail/extfmt-non-literal.rs
index 7b1b4db7378..445455f33d8 100644
--- a/src/test/compile-fail/extfmt-non-literal.rs
+++ b/src/test/compile-fail/extfmt-non-literal.rs
@@ -4,5 +4,5 @@ fn main() {
     // #fmt's first argument must be a literal.  Hopefully this
     // restriction can be eased eventually to just require a
     // compile-time constant.
-    let x = #fmt("a" + "b");
-}
\ No newline at end of file
+    let x = #fmt["a" + "b"];
+}
diff --git a/src/test/compile-fail/extfmt-non-literal2.rs b/src/test/compile-fail/extfmt-non-literal2.rs
index 5bb730c8aa6..8a2d7c4bbed 100644
--- a/src/test/compile-fail/extfmt-non-literal2.rs
+++ b/src/test/compile-fail/extfmt-non-literal2.rs
@@ -4,5 +4,5 @@ fn main() {
     // #fmt's first argument must be a literal.  Hopefully this
     // restriction can be eased eventually to just require a
     // compile-time constant.
-    let x = #fmt(20);
-}
\ No newline at end of file
+    let x = #fmt[20];
+}
diff --git a/src/test/compile-fail/extfmt-not-enough-args.rs b/src/test/compile-fail/extfmt-not-enough-args.rs
index 9e3012bbc49..849a836060d 100644
--- a/src/test/compile-fail/extfmt-not-enough-args.rs
+++ b/src/test/compile-fail/extfmt-not-enough-args.rs
@@ -2,4 +2,4 @@
 
 use std;
 
-fn main() { let s = #fmt("%s%s%s", "test", "test"); }
\ No newline at end of file
+fn main() { let s = #fmt["%s%s%s", "test", "test"]; }
diff --git a/src/test/compile-fail/extfmt-too-many-args.rs b/src/test/compile-fail/extfmt-too-many-args.rs
index 617a1091173..4c91da227e1 100644
--- a/src/test/compile-fail/extfmt-too-many-args.rs
+++ b/src/test/compile-fail/extfmt-too-many-args.rs
@@ -2,4 +2,4 @@
 
 use std;
 
-fn main() { let s = #fmt("%s", "test", "test"); }
\ No newline at end of file
+fn main() { let s = #fmt["%s", "test", "test"]; }
diff --git a/src/test/compile-fail/extfmt-unknown-type.rs b/src/test/compile-fail/extfmt-unknown-type.rs
index 8c272a182a5..3a35a1d727b 100644
--- a/src/test/compile-fail/extfmt-unknown-type.rs
+++ b/src/test/compile-fail/extfmt-unknown-type.rs
@@ -1,3 +1,3 @@
 // error-pattern:unknown type
 
-fn main() { #fmt("%w"); }
\ No newline at end of file
+fn main() { #fmt["%w"]; }
diff --git a/src/test/compile-fail/extfmt-unsigned-plus.rs b/src/test/compile-fail/extfmt-unsigned-plus.rs
index 7715305e829..4ac41efb312 100644
--- a/src/test/compile-fail/extfmt-unsigned-plus.rs
+++ b/src/test/compile-fail/extfmt-unsigned-plus.rs
@@ -2,5 +2,5 @@
 
 fn main() {
     // Can't use a sign on unsigned conversions
-    #fmt("%+u", 10u);
-}
\ No newline at end of file
+    #fmt["%+u", 10u];
+}
diff --git a/src/test/compile-fail/extfmt-unsigned-space.rs b/src/test/compile-fail/extfmt-unsigned-space.rs
index 0a99a4b6c5e..6393548eb3d 100644
--- a/src/test/compile-fail/extfmt-unsigned-space.rs
+++ b/src/test/compile-fail/extfmt-unsigned-space.rs
@@ -2,5 +2,5 @@
 
 fn main() {
     // Can't use a space on unsigned conversions
-    #fmt("% u", 10u);
-}
\ No newline at end of file
+    #fmt["% u", 10u];
+}
diff --git a/src/test/compile-fail/extfmt-unterminated-conv.rs b/src/test/compile-fail/extfmt-unterminated-conv.rs
index 44a321f578d..3b7d0ce1767 100644
--- a/src/test/compile-fail/extfmt-unterminated-conv.rs
+++ b/src/test/compile-fail/extfmt-unterminated-conv.rs
@@ -1,3 +1,3 @@
 // error-pattern:unterminated conversion
 
-fn main() { #fmt("%"); }
\ No newline at end of file
+fn main() { #fmt["%"]; }
diff --git a/src/test/compile-fail/fail-expr.rs b/src/test/compile-fail/fail-expr.rs
index 13d91ce5cb2..72ae83062eb 100644
--- a/src/test/compile-fail/fail-expr.rs
+++ b/src/test/compile-fail/fail-expr.rs
@@ -1,3 +1,3 @@
 // error-pattern:mismatched types
 
-fn main() { fail 5; }
\ No newline at end of file
+fn main() { fail 5; }
diff --git a/src/test/compile-fail/fail-type-err.rs b/src/test/compile-fail/fail-type-err.rs
index e65ad1af413..8ea86d80a7b 100644
--- a/src/test/compile-fail/fail-type-err.rs
+++ b/src/test/compile-fail/fail-type-err.rs
@@ -1,2 +1,2 @@
 // error-pattern:expected str but found [int]
-fn main() { fail ~[0]; }
\ No newline at end of file
+fn main() { fail [0]; }
diff --git a/src/test/compile-fail/fn-bad-block-type.rs b/src/test/compile-fail/fn-bad-block-type.rs
index ba82efcf750..2349bfe90dc 100644
--- a/src/test/compile-fail/fn-bad-block-type.rs
+++ b/src/test/compile-fail/fn-bad-block-type.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { true }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/fn-compare-mismatch.rs b/src/test/compile-fail/fn-compare-mismatch.rs
index a2bb326c548..87287edca71 100644
--- a/src/test/compile-fail/fn-compare-mismatch.rs
+++ b/src/test/compile-fail/fn-compare-mismatch.rs
@@ -4,4 +4,4 @@ fn main() {
     fn f() { }
     fn g(i: int) { }
     let x = f == g;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-constraint.rs b/src/test/compile-fail/fn-constraint.rs
index 0be8d79a399..9ace741d836 100644
--- a/src/test/compile-fail/fn-constraint.rs
+++ b/src/test/compile-fail/fn-constraint.rs
@@ -6,4 +6,4 @@ fn main() {
     let a: uint = 4u;
     let b: uint = 1u;
     log_err safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-expr-type-state.rs b/src/test/compile-fail/fn-expr-type-state.rs
index 02650b45d88..935542e85e7 100644
--- a/src/test/compile-fail/fn-expr-type-state.rs
+++ b/src/test/compile-fail/fn-expr-type-state.rs
@@ -4,4 +4,4 @@ fn main() {
     // Typestate should work even in a lambda. we should reject this program.
     let f = fn () -> int { let i: int; ret i; };
     log_err f();
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fn-expr-typestate-2.rs b/src/test/compile-fail/fn-expr-typestate-2.rs
index 299b11cb743..d4f49f96466 100644
--- a/src/test/compile-fail/fn-expr-typestate-2.rs
+++ b/src/test/compile-fail/fn-expr-typestate-2.rs
@@ -1,3 +1,3 @@
 // error-pattern:Unsatisfied precondition
 
-fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; }
\ No newline at end of file
+fn main() { let j = fn () -> int { let i: int; ret i; }(); log_err j; }
diff --git a/src/test/compile-fail/for-each-over-bs.rs b/src/test/compile-fail/for-each-over-bs.rs
index d34c91cd271..0d184978769 100644
--- a/src/test/compile-fail/for-each-over-bs.rs
+++ b/src/test/compile-fail/for-each-over-bs.rs
@@ -1,2 +1,2 @@
 // error-pattern:sequence in for each loop not a call
-fn main() { for each p in 1 {} }
+fn main() { for each p in 1 { } }
diff --git a/src/test/compile-fail/forgot-ret.rs b/src/test/compile-fail/forgot-ret.rs
index 1cdc55ffd87..5d91e3212df 100644
--- a/src/test/compile-fail/forgot-ret.rs
+++ b/src/test/compile-fail/forgot-ret.rs
@@ -5,4 +5,4 @@ fn god_exists(a: int) -> bool { be god_exists(a); }
 
 fn f(a: int) -> int { if god_exists(a) { ret 5; } }
 
-fn main() { f(12); }
\ No newline at end of file
+fn main() { f(12); }
diff --git a/src/test/compile-fail/fru-extra-field.rs b/src/test/compile-fail/fru-extra-field.rs
index 6957da34956..7d070c47f46 100644
--- a/src/test/compile-fail/fru-extra-field.rs
+++ b/src/test/compile-fail/fru-extra-field.rs
@@ -8,4 +8,4 @@ fn main() {
     let origin: point = {x: 0, y: 0};
 
     let origin3d: point = {z: 0 with origin};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/fru-typestate.rs b/src/test/compile-fail/fru-typestate.rs
index ce5102cbf65..447f6f44dc5 100644
--- a/src/test/compile-fail/fru-typestate.rs
+++ b/src/test/compile-fail/fru-typestate.rs
@@ -9,4 +9,4 @@ fn main() {
 
     let right: point = {x: 10 with origin};
     origin = {x: 0, y: 0};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/if-branch-types.rs b/src/test/compile-fail/if-branch-types.rs
index 345d2509970..bfb7a277492 100644
--- a/src/test/compile-fail/if-branch-types.rs
+++ b/src/test/compile-fail/if-branch-types.rs
@@ -1,3 +1,3 @@
 // error-pattern:mismatched types
 
-fn main() { let x = if true { 10 } else { 10u }; }
\ No newline at end of file
+fn main() { let x = if true { 10 } else { 10u }; }
diff --git a/src/test/compile-fail/if-check-precond-fail.rs b/src/test/compile-fail/if-check-precond-fail.rs
index af7658b4f94..9ce0d6f8ef5 100644
--- a/src/test/compile-fail/if-check-precond-fail.rs
+++ b/src/test/compile-fail/if-check-precond-fail.rs
@@ -2,11 +2,11 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn print_even(x: uint) : even(x) { log x; }
 
 fn foo(x: uint) { if check even(x) { fail; } else { print_even(x); } }
 
-fn main() { foo(3u); }
\ No newline at end of file
+fn main() { foo(3u); }
diff --git a/src/test/compile-fail/if-typeck.rs b/src/test/compile-fail/if-typeck.rs
index c88a1c8c9e6..d8c262bd6b3 100644
--- a/src/test/compile-fail/if-typeck.rs
+++ b/src/test/compile-fail/if-typeck.rs
@@ -7,4 +7,4 @@ fn main() {
 
     // f is not a bool
     if f { }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-from-dup.rs b/src/test/compile-fail/import-from-dup.rs
index 729622c8b5a..73e14bfc753 100644
--- a/src/test/compile-fail/import-from-dup.rs
+++ b/src/test/compile-fail/import-from-dup.rs
@@ -4,11 +4,11 @@ import m1::{f};
 import m2::{f};
 
 mod m1 {
-    fn f() {}
+    fn f() { }
 }
 
 mod m2 {
-    fn f() {}
+    fn f() { }
 }
 
-fn main() {}
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/import-from-missing.rs b/src/test/compile-fail/import-from-missing.rs
index 1e0b3869053..bcd9ee7da43 100644
--- a/src/test/compile-fail/import-from-missing.rs
+++ b/src/test/compile-fail/import-from-missing.rs
@@ -2,10 +2,7 @@
 import spam::{ham, eggs};
 
 mod spam {
-    fn ham() {}
+    fn ham() { }
 }
 
-fn main() {
-    ham();
-    eggs();
-}
\ No newline at end of file
+fn main() { ham(); eggs(); }
diff --git a/src/test/compile-fail/import-glob-0.rs b/src/test/compile-fail/import-glob-0.rs
index 8d74000ef0b..d0cbcf57ad3 100644
--- a/src/test/compile-fail/import-glob-0.rs
+++ b/src/test/compile-fail/import-glob-0.rs
@@ -19,4 +19,4 @@ fn main() {
     f2();
     f999(); // 'export' currently doesn't work?
     f4();
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-glob-circular.rs b/src/test/compile-fail/import-glob-circular.rs
index 1a937d617c6..c9595777c27 100644
--- a/src/test/compile-fail/import-glob-circular.rs
+++ b/src/test/compile-fail/import-glob-circular.rs
@@ -22,4 +22,4 @@ mod test {
     import circ1::*;
 
     fn test() { f1066(); }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-glob-export.rs b/src/test/compile-fail/import-glob-export.rs
index 57f154e104f..3965ad5fc4d 100644
--- a/src/test/compile-fail/import-glob-export.rs
+++ b/src/test/compile-fail/import-glob-export.rs
@@ -9,4 +9,4 @@ mod m1 {
     fn f2() { }
 }
 
-fn main() { f2(); }
\ No newline at end of file
+fn main() { f2(); }
diff --git a/src/test/compile-fail/import-glob-multiple.rs b/src/test/compile-fail/import-glob-multiple.rs
index 1abe786ab6b..55a8878381d 100644
--- a/src/test/compile-fail/import-glob-multiple.rs
+++ b/src/test/compile-fail/import-glob-multiple.rs
@@ -17,4 +17,4 @@ mod mod2 {
 
 
 
-fn main() { common2(); }
\ No newline at end of file
+fn main() { common2(); }
diff --git a/src/test/compile-fail/import-loop-2.rs b/src/test/compile-fail/import-loop-2.rs
index a21950898fa..4040f8333f9 100644
--- a/src/test/compile-fail/import-loop-2.rs
+++ b/src/test/compile-fail/import-loop-2.rs
@@ -10,4 +10,4 @@ mod b {
     export x;
 
     fn main() { let y = x; }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/import-loop.rs b/src/test/compile-fail/import-loop.rs
index 6e790829ec8..6aa88db603d 100644
--- a/src/test/compile-fail/import-loop.rs
+++ b/src/test/compile-fail/import-loop.rs
@@ -7,4 +7,4 @@ mod y {
     export x;
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/import5.rs b/src/test/compile-fail/import5.rs
index 4910bb5065e..71f17b0c34a 100644
--- a/src/test/compile-fail/import5.rs
+++ b/src/test/compile-fail/import5.rs
@@ -12,4 +12,4 @@ mod m3 {
     import m2::foo;
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/impure-pred.rs b/src/test/compile-fail/impure-pred.rs
index cf775f8d6f1..05433ba17ed 100644
--- a/src/test/compile-fail/impure-pred.rs
+++ b/src/test/compile-fail/impure-pred.rs
@@ -9,4 +9,4 @@ fn main() {
     let x = 0;
 
     check (f(x));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/infinite-vec-type-recursion.rs b/src/test/compile-fail/infinite-vec-type-recursion.rs
index c41c9fb3881..709c5b628ee 100644
--- a/src/test/compile-fail/infinite-vec-type-recursion.rs
+++ b/src/test/compile-fail/infinite-vec-type-recursion.rs
@@ -3,4 +3,4 @@
 
 type x = [x];
 
-fn main() { let b: x = ~[]; }
+fn main() { let b: x = []; }
diff --git a/src/test/compile-fail/lambda-mutate-nested.rs b/src/test/compile-fail/lambda-mutate-nested.rs
index 6da8e3b252e..409b0e59950 100644
--- a/src/test/compile-fail/lambda-mutate-nested.rs
+++ b/src/test/compile-fail/lambda-mutate-nested.rs
@@ -3,10 +3,7 @@
 // mutate upvars from a lambda.
 fn main() {
     let i = 0;
-    let ctr = lambda() -> int {
-        block() { i = i + 1; }();
-        ret i;
-    };
+    let ctr = lambda () -> int { block () { i = i + 1; }(); ret i; };
     log_err ctr();
     log_err ctr();
     log_err ctr();
diff --git a/src/test/compile-fail/lambda-mutate.rs b/src/test/compile-fail/lambda-mutate.rs
index 24f4c75a853..cb891aad374 100644
--- a/src/test/compile-fail/lambda-mutate.rs
+++ b/src/test/compile-fail/lambda-mutate.rs
@@ -2,10 +2,7 @@
 // Make sure we can't write to upvars from lambdas
 fn main() {
     let i = 0;
-    let ctr = lambda() -> int {
-        i = i + 1;
-        ret i;
-    };
+    let ctr = lambda () -> int { i = i + 1; ret i; };
     log_err ctr();
     log_err ctr();
     log_err ctr();
diff --git a/src/test/compile-fail/let-destruct-refutable.rs b/src/test/compile-fail/let-destruct-refutable.rs
index 0217fb9cb40..d1796da9037 100644
--- a/src/test/compile-fail/let-destruct-refutable.rs
+++ b/src/test/compile-fail/let-destruct-refutable.rs
@@ -1,11 +1,8 @@
 // error-pattern:refutable pattern
 
-tag xx {
-    xx(int);
-    yy;
-}
+tag xx { xx(int); yy; }
 
 fn main() {
-    let @{x:xx(x), y} = @{x: xx(10), y: 20};
-    assert x + y == 30;
+    let @{x: xx(x), y: y} = @{x: xx(10), y: 20};
+    assert (x + y == 30);
 }
diff --git a/src/test/compile-fail/macro-2.rs b/src/test/compile-fail/macro-2.rs
index a11dd1f95f9..a802301756c 100644
--- a/src/test/compile-fail/macro-2.rs
+++ b/src/test/compile-fail/macro-2.rs
@@ -1,6 +1,10 @@
 //error-pattern:is an expr, expected an identifier
 fn main() {
-  #macro([#mylambda(x, body), {fn f(x: int) -> int {ret body}; f}]);
+    #macro[[#mylambda[x, body],
+            {
+                fn f(x: int) -> int { ret body }
+                f
+            }]];
 
-  assert(#mylambda(y*1, y*2)(8) == 16);
-}
\ No newline at end of file
+    assert (#mylambda[y * 1, y * 2](8) == 16);
+}
diff --git a/src/test/compile-fail/macro.rs b/src/test/compile-fail/macro.rs
index a3f2df4f187..5943e575a48 100644
--- a/src/test/compile-fail/macro.rs
+++ b/src/test/compile-fail/macro.rs
@@ -1,7 +1,8 @@
 //error-pattern:no clauses match
 
 fn main() {
-  #macro([#trivial(), 1*2*4*2*1]);
+    #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]];
 
-  assert(#trivial(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16) == 16);
+    assert (#trivial[1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16] ==
+                16);
 }
diff --git a/src/test/compile-fail/main-wrong-type-2.rs b/src/test/compile-fail/main-wrong-type-2.rs
index 3e1e1fa1eef..e3d5ca40d08 100644
--- a/src/test/compile-fail/main-wrong-type-2.rs
+++ b/src/test/compile-fail/main-wrong-type-2.rs
@@ -1,2 +1,2 @@
 // error-pattern:wrong type in main function: found fn() -> char
-fn main() -> char { }
\ No newline at end of file
+fn main() -> char { }
diff --git a/src/test/compile-fail/main-wrong-type.rs b/src/test/compile-fail/main-wrong-type.rs
index 33d5c305204..2be4af77008 100644
--- a/src/test/compile-fail/main-wrong-type.rs
+++ b/src/test/compile-fail/main-wrong-type.rs
@@ -1,2 +1,2 @@
 // error-pattern:wrong type in main function: found fn(
-fn main(foo: {x: int, y: int}) { }
\ No newline at end of file
+fn main(foo: {x: int, y: int}) { }
diff --git a/src/test/compile-fail/minus-string.rs b/src/test/compile-fail/minus-string.rs
index def6124960e..e30a2dbe7df 100644
--- a/src/test/compile-fail/minus-string.rs
+++ b/src/test/compile-fail/minus-string.rs
@@ -1,5 +1,3 @@
 // error-pattern:applying unary minus to non-numeric type str
 
-fn main() {
-    -"foo";
-}
\ No newline at end of file
+fn main() { -"foo"; }
diff --git a/src/test/compile-fail/missing-main.rs b/src/test/compile-fail/missing-main.rs
index 1c59427fa9c..e531cbdc6cc 100644
--- a/src/test/compile-fail/missing-main.rs
+++ b/src/test/compile-fail/missing-main.rs
@@ -1,2 +1,2 @@
 // error-pattern:main function not found
-fn mian() { }
\ No newline at end of file
+fn mian() { }
diff --git a/src/test/compile-fail/missing-return2.rs b/src/test/compile-fail/missing-return2.rs
index af1612b1323..0fc48fd950a 100644
--- a/src/test/compile-fail/missing-return2.rs
+++ b/src/test/compile-fail/missing-return2.rs
@@ -7,4 +7,4 @@ fn f() -> int {
     alt true { true { } }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/move-arg.rs b/src/test/compile-fail/move-arg.rs
index cd348231d91..9b60e5dae9a 100644
--- a/src/test/compile-fail/move-arg.rs
+++ b/src/test/compile-fail/move-arg.rs
@@ -1,10 +1,4 @@
 // error-pattern: Unsatisfied precondition constraint
-fn test(foo: -int) {
-    assert (foo == 10);
-}
+fn test(foo: -int) { assert (foo == 10); }
 
-fn main() {
-    let x = 10;
-    test(x);
-    log x;
-}
\ No newline at end of file
+fn main() { let x = 10; test(x); log x; }
diff --git a/src/test/compile-fail/native-type-mismatch.rs b/src/test/compile-fail/native-type-mismatch.rs
index daa2c9fa96b..ddb6375e36d 100644
--- a/src/test/compile-fail/native-type-mismatch.rs
+++ b/src/test/compile-fail/native-type-mismatch.rs
@@ -4,4 +4,4 @@ use std;
 fn main() {
     let f: std::os::libc::FILE = std::io::rustrt::rust_get_stdin();
     std::os::libc::fopen(f, f);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/nested-ty-params.rs b/src/test/compile-fail/nested-ty-params.rs
index 413ea883618..7a249c657fd 100644
--- a/src/test/compile-fail/nested-ty-params.rs
+++ b/src/test/compile-fail/nested-ty-params.rs
@@ -1,6 +1,6 @@
 // error-pattern:Attempt to use a type argument out of scope
 fn hd<U>(v: &[U]) -> U {
-    fn hd1(w: &[U]) -> U { ret w.(0); }
+    fn hd1(w: &[U]) -> U { ret w[0]; }
 
     ret hd1(v);
 }
diff --git a/src/test/compile-fail/no-constraint-prop.rs b/src/test/compile-fail/no-constraint-prop.rs
index 2f98c4917b0..65e21baf78b 100644
--- a/src/test/compile-fail/no-constraint-prop.rs
+++ b/src/test/compile-fail/no-constraint-prop.rs
@@ -17,4 +17,4 @@ fn main() {
     // prestate.
     let d <- a;
     log safe_slice("kitties", b, d);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/no-self-dispatch.rs b/src/test/compile-fail/no-self-dispatch.rs
index b23092b6409..876c668e8c6 100644
--- a/src/test/compile-fail/no-self-dispatch.rs
+++ b/src/test/compile-fail/no-self-dispatch.rs
@@ -3,4 +3,4 @@ obj oT() {
     fn get() -> int { ret 3; }
     fn foo() { let c = get(); }
 }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/not-a-pred-2.rs b/src/test/compile-fail/not-a-pred-2.rs
index 63aad9b37df..852db46e9df 100644
--- a/src/test/compile-fail/not-a-pred-2.rs
+++ b/src/test/compile-fail/not-a-pred-2.rs
@@ -7,4 +7,5 @@ fn main() {
                2); // should fail to typecheck, as (a == b)
                    // is not a manifest call
 
-}
\ No newline at end of file
+
+}
diff --git a/src/test/compile-fail/not-a-pred-3.rs b/src/test/compile-fail/not-a-pred-3.rs
index 5ec15e9c653..3ca98a5c1ce 100644
--- a/src/test/compile-fail/not-a-pred-3.rs
+++ b/src/test/compile-fail/not-a-pred-3.rs
@@ -10,4 +10,4 @@ fn main() {
     let z = f();
     // should fail to typecheck, as z.g isn't an explicit name
     check (z.g(42));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/not-a-pred-check.rs b/src/test/compile-fail/not-a-pred-check.rs
index 20a0b5a7070..8ba91d0e26e 100644
--- a/src/test/compile-fail/not-a-pred-check.rs
+++ b/src/test/compile-fail/not-a-pred-check.rs
@@ -7,4 +7,4 @@ fn main() {
     let x = 0;
 
     check (f(x));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/not-a-pred.rs b/src/test/compile-fail/not-a-pred.rs
index 3e76ef9601c..80e227ffb16 100644
--- a/src/test/compile-fail/not-a-pred.rs
+++ b/src/test/compile-fail/not-a-pred.rs
@@ -1,8 +1,8 @@
 // -*- rust -*-
 // error-pattern: Non-predicate in constraint: lt
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 obj lt(a: int, b: int) { }
 
-fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); }
\ No newline at end of file
+fn main() { let a: int = 10; let b: int = 23; check (lt(a, b)); f(a, b); }
diff --git a/src/test/compile-fail/not-pred-args.rs b/src/test/compile-fail/not-pred-args.rs
index e73cd18dac7..6ba399ba00c 100644
--- a/src/test/compile-fail/not-pred-args.rs
+++ b/src/test/compile-fail/not-pred-args.rs
@@ -8,4 +8,4 @@ fn main() {
     // should fail to typecheck, as pred args must be slot variables
     // or literals
     check (f(42 * 17));
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/occurs-check-2.rs b/src/test/compile-fail/occurs-check-2.rs
index 20a4cf314c4..6c600158d21 100644
--- a/src/test/compile-fail/occurs-check-2.rs
+++ b/src/test/compile-fail/occurs-check-2.rs
@@ -1,6 +1,2 @@
 // error-pattern: Type inference failed because I could not find
-fn main() {
-    let f;
-    f = @f;
-    f();
-}
\ No newline at end of file
+fn main() { let f; f = @f; f(); }
diff --git a/src/test/compile-fail/occurs-check.rs b/src/test/compile-fail/occurs-check.rs
index 16b2f94045e..aba5b5c5928 100644
--- a/src/test/compile-fail/occurs-check.rs
+++ b/src/test/compile-fail/occurs-check.rs
@@ -1,5 +1,2 @@
 // error-pattern: Type inference failed because I could not find
-fn main() {
-    let f;
-    f = @f;
-}
+fn main() { let f; f = @f; }
diff --git a/src/test/compile-fail/or-init.rs b/src/test/compile-fail/or-init.rs
index 8c952b0d93f..8103864c154 100644
--- a/src/test/compile-fail/or-init.rs
+++ b/src/test/compile-fail/or-init.rs
@@ -5,4 +5,4 @@ fn main() {
 
     log false || { i = 5; true };
     log i;
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/or-patter-mismatch.rs b/src/test/compile-fail/or-patter-mismatch.rs
index d7525d7b627..dc71c2c1e42 100644
--- a/src/test/compile-fail/or-patter-mismatch.rs
+++ b/src/test/compile-fail/or-patter-mismatch.rs
@@ -2,4 +2,4 @@
 
 tag blah { a(int, int, uint); b(int, int); }
 
-fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } }
\ No newline at end of file
+fn main() { alt a(1, 1, 2u) { a(_, x, y) | b(x, y) { } } }
diff --git a/src/test/compile-fail/output-type-mismatch.rs b/src/test/compile-fail/output-type-mismatch.rs
index 38ee7b5a6be..c4ec5bef8c6 100644
--- a/src/test/compile-fail/output-type-mismatch.rs
+++ b/src/test/compile-fail/output-type-mismatch.rs
@@ -2,4 +2,4 @@
 
 fn f() { }
 
-fn main() { let i: int; i = f(); }
\ No newline at end of file
+fn main() { let i: int; i = f(); }
diff --git a/src/test/compile-fail/pred-assign.rs b/src/test/compile-fail/pred-assign.rs
index 0e5ddf23a47..10c6f1443ec 100644
--- a/src/test/compile-fail/pred-assign.rs
+++ b/src/test/compile-fail/pred-assign.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -13,4 +13,4 @@ fn main() {
     check (lt(a, b));
     a = 24;
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/pred-not-bool.rs b/src/test/compile-fail/pred-not-bool.rs
index 024ff5216f9..50344120a98 100644
--- a/src/test/compile-fail/pred-not-bool.rs
+++ b/src/test/compile-fail/pred-not-bool.rs
@@ -7,4 +7,4 @@
 
 pred bad(a: int) -> int { ret 37; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/pred-on-wrong-slots.rs b/src/test/compile-fail/pred-on-wrong-slots.rs
index de0faef653b..9e6c86c0737 100644
--- a/src/test/compile-fail/pred-on-wrong-slots.rs
+++ b/src/test/compile-fail/pred-on-wrong-slots.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: lt(a, c)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -14,4 +14,4 @@ fn main() {
     check (lt(b, c));
     f(a, b);
     f(a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/pred-swap.rs b/src/test/compile-fail/pred-swap.rs
index 9e96b74ad69..8fe7b19acf5 100644
--- a/src/test/compile-fail/pred-swap.rs
+++ b/src/test/compile-fail/pred-swap.rs
@@ -2,7 +2,7 @@
 
 // error-pattern: Unsatisfied precondition constraint (for example, lt(a, b)
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
@@ -13,4 +13,4 @@ fn main() {
     check (lt(a, b));
     b <-> a;
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/rec-extend.rs b/src/test/compile-fail/rec-extend.rs
index 773f06fb205..35f884fbff9 100644
--- a/src/test/compile-fail/rec-extend.rs
+++ b/src/test/compile-fail/rec-extend.rs
@@ -5,4 +5,4 @@ fn main() {
     let a = {foo: 0};
 
     let b = {foo: true with a};
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/rec-missing-fields.rs b/src/test/compile-fail/rec-missing-fields.rs
index 50bf16c9a20..50bcf32dd7f 100644
--- a/src/test/compile-fail/rec-missing-fields.rs
+++ b/src/test/compile-fail/rec-missing-fields.rs
@@ -6,4 +6,4 @@
 
 type point = {x: int, y: int};
 
-fn main() { let p: point = {x: 10}; log p.y; }
\ No newline at end of file
+fn main() { let p: point = {x: 10}; log p.y; }
diff --git a/src/test/compile-fail/ret-non-nil.rs b/src/test/compile-fail/ret-non-nil.rs
index 7c483ed4194..71db7e4192f 100644
--- a/src/test/compile-fail/ret-non-nil.rs
+++ b/src/test/compile-fail/ret-non-nil.rs
@@ -4,4 +4,4 @@ fn f() { ret; }
 
 fn g() -> int { ret; }
 
-fn main() { f(); g(); }
\ No newline at end of file
+fn main() { f(); g(); }
diff --git a/src/test/compile-fail/return-uninit.rs b/src/test/compile-fail/return-uninit.rs
index 34b7a6b5af0..1978ec5f420 100644
--- a/src/test/compile-fail/return-uninit.rs
+++ b/src/test/compile-fail/return-uninit.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { let x: int; ret x; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/compile-fail/self-call-non-obj.rs b/src/test/compile-fail/self-call-non-obj.rs
index 6fd8bee270b..6261fda60ac 100644
--- a/src/test/compile-fail/self-call-non-obj.rs
+++ b/src/test/compile-fail/self-call-non-obj.rs
@@ -7,4 +7,4 @@ fn main() {
 
     self.foo();
 
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/slot-as-pred.rs b/src/test/compile-fail/slot-as-pred.rs
index 0220a16f087..820ebd655f5 100644
--- a/src/test/compile-fail/slot-as-pred.rs
+++ b/src/test/compile-fail/slot-as-pred.rs
@@ -1,7 +1,7 @@
 // -*- rust -*-
 // error-pattern: unresolved name: lt
 
-fn f(a: int, b: int) : lt(a,b) { }
+fn f(a: int, b: int) : lt(a, b) { }
 
 fn main() {
     let lt: int;
@@ -9,4 +9,4 @@ fn main() {
     let b: int = 23;
     check (lt(a, b));
     f(a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/spawn-non-nil-fn.rs b/src/test/compile-fail/spawn-non-nil-fn.rs
index dfc5471f4de..4d3d13373dc 100644
--- a/src/test/compile-fail/spawn-non-nil-fn.rs
+++ b/src/test/compile-fail/spawn-non-nil-fn.rs
@@ -5,4 +5,4 @@ import std::task;
 
 fn f(x: int) -> int { ret x; }
 
-fn main() { task::_spawn(bind f(10)); }
\ No newline at end of file
+fn main() { task::_spawn(bind f(10)); }
diff --git a/src/test/compile-fail/swap-no-lval.rs b/src/test/compile-fail/swap-no-lval.rs
index a45f524fe09..2bb54464157 100644
--- a/src/test/compile-fail/swap-no-lval.rs
+++ b/src/test/compile-fail/swap-no-lval.rs
@@ -1,3 +1,3 @@
 // error-pattern: assignment to non-lvalue
 
-fn main() { 5 <-> 3; }
\ No newline at end of file
+fn main() { 5 <-> 3; }
diff --git a/src/test/compile-fail/swap-uninit.rs b/src/test/compile-fail/swap-uninit.rs
index e06d539702b..27fdc611379 100644
--- a/src/test/compile-fail/swap-uninit.rs
+++ b/src/test/compile-fail/swap-uninit.rs
@@ -1,3 +1,3 @@
 // error-pattern:Unsatisfied precondition
 
-fn main() { let x = 3; let y; x <-> y; }
\ No newline at end of file
+fn main() { let x = 3; let y; x <-> y; }
diff --git a/src/test/compile-fail/tail-typeck.rs b/src/test/compile-fail/tail-typeck.rs
index 7dd315b929b..c121458f233 100644
--- a/src/test/compile-fail/tail-typeck.rs
+++ b/src/test/compile-fail/tail-typeck.rs
@@ -4,4 +4,4 @@ fn f() -> int { be g(); }
 
 fn g() -> uint { ret 0u; }
 
-fn main() { let y = f(); }
\ No newline at end of file
+fn main() { let y = f(); }
diff --git a/src/test/compile-fail/type-arg-out-of-scope.rs b/src/test/compile-fail/type-arg-out-of-scope.rs
index a3ae6619b3e..19be0933c48 100644
--- a/src/test/compile-fail/type-arg-out-of-scope.rs
+++ b/src/test/compile-fail/type-arg-out-of-scope.rs
@@ -1,5 +1,5 @@
 // error-pattern:Attempt to use a type argument out of scope
 fn foo<T>(x: &T) {
-    fn bar(f: fn(&T) -> T ) { }
+    fn bar(f: fn(&T) -> T) { }
 }
 fn main() { foo(1); }
diff --git a/src/test/compile-fail/type-mismatch-multiple.rs b/src/test/compile-fail/type-mismatch-multiple.rs
index 9a7a4b588a7..363af271986 100644
--- a/src/test/compile-fail/type-mismatch-multiple.rs
+++ b/src/test/compile-fail/type-mismatch-multiple.rs
@@ -2,4 +2,4 @@
 // error-pattern:mismatched types: expected bool
 // error-pattern:mismatched types: expected int
 
-fn main() { let a: bool = 1; let b: int = true; }
\ No newline at end of file
+fn main() { let a: bool = 1; let b: int = true; }
diff --git a/src/test/compile-fail/type-mismatch.rs b/src/test/compile-fail/type-mismatch.rs
index a0e257dcd8f..d2ddf61b0bc 100644
--- a/src/test/compile-fail/type-mismatch.rs
+++ b/src/test/compile-fail/type-mismatch.rs
@@ -1,4 +1,4 @@
 // error-pattern:expected bool but found int
 // issue #516
 
-fn main() { let x = true; let y = 1; let z = x + y; }
\ No newline at end of file
+fn main() { let x = true; let y = 1; let z = x + y; }
diff --git a/src/test/compile-fail/type-recursive.rs b/src/test/compile-fail/type-recursive.rs
index d7ba8faa288..c38c6f5d244 100644
--- a/src/test/compile-fail/type-recursive.rs
+++ b/src/test/compile-fail/type-recursive.rs
@@ -1,4 +1,4 @@
 // error-pattern:illegal recursive type
 type t1 = {foo: int, foolish: t1};
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/type-shadow.rs b/src/test/compile-fail/type-shadow.rs
index 52022cf67fc..9f26de765be 100644
--- a/src/test/compile-fail/type-shadow.rs
+++ b/src/test/compile-fail/type-shadow.rs
@@ -9,4 +9,4 @@ fn main() {
         type X = str;
         let y: Y = "hello";
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unreachable-arm.rs b/src/test/compile-fail/unreachable-arm.rs
index eaf5d75702f..ee637fed666 100644
--- a/src/test/compile-fail/unreachable-arm.rs
+++ b/src/test/compile-fail/unreachable-arm.rs
@@ -2,4 +2,4 @@
 
 tag foo { a(@foo, int); b(uint); }
 
-fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } }
\ No newline at end of file
+fn main() { alt b(1u) { b(_) | a(@_, 1) { } a(_, 1) { } } }
diff --git a/src/test/compile-fail/unsafe-alias-2.rs b/src/test/compile-fail/unsafe-alias-2.rs
index 3917dd3f883..ad7296ef1b4 100644
--- a/src/test/compile-fail/unsafe-alias-2.rs
+++ b/src/test/compile-fail/unsafe-alias-2.rs
@@ -5,4 +5,4 @@ fn whoknows(x: @mutable int) { *x = 10; }
 fn main() {
     let box = @mutable 1;
     alt *box { x { whoknows(box); log_err x; } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unsafe-alias.rs b/src/test/compile-fail/unsafe-alias.rs
index 46fb135b951..80eaa661d1d 100644
--- a/src/test/compile-fail/unsafe-alias.rs
+++ b/src/test/compile-fail/unsafe-alias.rs
@@ -1,7 +1,7 @@
 // error-pattern:may alias with argument
 
-fn foo(x: &int, f: fn() ) { log x; }
+fn foo(x: &int, f: fn()) { log x; }
 
 fn whoknows(x: @mutable int) { *x = 10; }
 
-fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); }
\ No newline at end of file
+fn main() { let box = @mutable 1; foo(*box, bind whoknows(box)); }
diff --git a/src/test/compile-fail/unsafe-alt.rs b/src/test/compile-fail/unsafe-alt.rs
index 2e0605fa055..fb42b188a7c 100644
--- a/src/test/compile-fail/unsafe-alt.rs
+++ b/src/test/compile-fail/unsafe-alt.rs
@@ -5,4 +5,4 @@ tag foo { left(int); right(bool); }
 fn main() {
     let x = left(10);
     alt x { left(i) { x = right(false); log i; } _ { } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/unsafe-for.rs b/src/test/compile-fail/unsafe-for.rs
index 43e8b9cb7c2..22d5396c1cb 100644
--- a/src/test/compile-fail/unsafe-for.rs
+++ b/src/test/compile-fail/unsafe-for.rs
@@ -1,6 +1,6 @@
 // error-pattern:invalidate alias x
 
 fn main() {
-    let v: [mutable int] = ~[mutable 1, 2, 3];
-    for x: int in v { v.(0) = 10; log x; }
+    let v: [mutable int] = [mutable 1, 2, 3];
+    for x: int in v { v[0] = 10; log x; }
 }
diff --git a/src/test/compile-fail/unsafe-mutable-alias.rs b/src/test/compile-fail/unsafe-mutable-alias.rs
index f438d021a25..2f2a395778e 100644
--- a/src/test/compile-fail/unsafe-mutable-alias.rs
+++ b/src/test/compile-fail/unsafe-mutable-alias.rs
@@ -2,4 +2,4 @@
 
 fn f(a: &int, b: &mutable int) -> int { b += 1; ret a + b; }
 
-fn main() { let i = 4; log f(i, i); }
\ No newline at end of file
+fn main() { let i = 4; log f(i, i); }
diff --git a/src/test/compile-fail/use-after-move.rs b/src/test/compile-fail/use-after-move.rs
index ff20307fece..3fb1827441e 100644
--- a/src/test/compile-fail/use-after-move.rs
+++ b/src/test/compile-fail/use-after-move.rs
@@ -1,2 +1,2 @@
 // error-pattern: Unsatisfied precondition constraint (for example, init(x
-fn main() { let x = @5; let y <- x; log *x; }
\ No newline at end of file
+fn main() { let x = @5; let y <- x; log *x; }
diff --git a/src/test/compile-fail/use-after-send.rs b/src/test/compile-fail/use-after-send.rs
index 212fa50a506..965c262237d 100644
--- a/src/test/compile-fail/use-after-send.rs
+++ b/src/test/compile-fail/use-after-send.rs
@@ -1,9 +1,5 @@
 // error-pattern: Unsatisfied precondition constraint
-fn send<~T>(ch : _chan<T>, data : -T) {
-    log ch;
-    log data;
-    fail;
-}
+fn send<~T>(ch: _chan<T>, data: -T) { log ch; log data; fail; }
 type _chan<T> = int;
 
 // Tests that "log message;" is flagged as using
@@ -13,6 +9,4 @@ fn test00_start(ch: _chan<int>, message: int, count: int) {
     log message;
 }
 
-fn main() {
-    fail;
-}
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/compile-fail/use-meta-dup.rs b/src/test/compile-fail/use-meta-dup.rs
index 5e44999b595..04d67263c36 100644
--- a/src/test/compile-fail/use-meta-dup.rs
+++ b/src/test/compile-fail/use-meta-dup.rs
@@ -2,4 +2,4 @@
 
 use std(name = "std", name = "nonstd");
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/use-meta-mismatch.rs b/src/test/compile-fail/use-meta-mismatch.rs
index a2adca83cd4..fef50525a1e 100644
--- a/src/test/compile-fail/use-meta-mismatch.rs
+++ b/src/test/compile-fail/use-meta-mismatch.rs
@@ -2,4 +2,4 @@
 
 use std(complex(meta(item)));
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/use-uninit-2.rs b/src/test/compile-fail/use-uninit-2.rs
index d46c340a9df..4d35567ea4f 100644
--- a/src/test/compile-fail/use-uninit-2.rs
+++ b/src/test/compile-fail/use-uninit-2.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { x = 10; } foo(x); }
diff --git a/src/test/compile-fail/use-uninit-3.rs b/src/test/compile-fail/use-uninit-3.rs
index cf680f0c184..5b7c619f36f 100644
--- a/src/test/compile-fail/use-uninit-3.rs
+++ b/src/test/compile-fail/use-uninit-3.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { log "whoops"; } else { x = 10; } foo(x); }
diff --git a/src/test/compile-fail/use-uninit.rs b/src/test/compile-fail/use-uninit.rs
index b787947fe7b..75e60bdbce3 100644
--- a/src/test/compile-fail/use-uninit.rs
+++ b/src/test/compile-fail/use-uninit.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; foo(x); }
\ No newline at end of file
+fn main() { let x: int; foo(x); }
diff --git a/src/test/compile-fail/vec-field.rs b/src/test/compile-fail/vec-field.rs
index 10a222f5cd0..1ec888670c4 100644
--- a/src/test/compile-fail/vec-field.rs
+++ b/src/test/compile-fail/vec-field.rs
@@ -2,7 +2,7 @@
 // issue #367
 
 fn f() {
-    let v = ~[1];
+    let v = [1];
     log v.some_field_name; //type error
 }
 
diff --git a/src/test/compile-fail/vector-no-ann.rs b/src/test/compile-fail/vector-no-ann.rs
index 087fa20d076..80463e3ead3 100644
--- a/src/test/compile-fail/vector-no-ann.rs
+++ b/src/test/compile-fail/vector-no-ann.rs
@@ -1,2 +1,2 @@
 // error-pattern:cannot determine a type
-fn main() { let foo = []; }
\ No newline at end of file
+fn main() { let foo = []; }
diff --git a/src/test/compile-fail/while-bypass.rs b/src/test/compile-fail/while-bypass.rs
index 7fa5ccb37a5..e70090dd59e 100644
--- a/src/test/compile-fail/while-bypass.rs
+++ b/src/test/compile-fail/while-bypass.rs
@@ -2,4 +2,4 @@
 
 fn f() -> int { let x: int; while true { x = 10; } ret x; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/compile-fail/while-expr.rs b/src/test/compile-fail/while-expr.rs
index 8da769a29fd..5ff3adf34c3 100644
--- a/src/test/compile-fail/while-expr.rs
+++ b/src/test/compile-fail/while-expr.rs
@@ -1,3 +1,3 @@
 // error-pattern: precondition constraint
 
-fn main() { let x: bool; while x { } }
\ No newline at end of file
+fn main() { let x: bool; while x { } }
diff --git a/src/test/compile-fail/while-loop-constraints.rs b/src/test/compile-fail/while-loop-constraints.rs
index 9d936f62fdb..557ff099cbf 100644
--- a/src/test/compile-fail/while-loop-constraints.rs
+++ b/src/test/compile-fail/while-loop-constraints.rs
@@ -4,4 +4,4 @@ fn main() {
     let y: int = 42;
     let x: int;
     while true { log y; while true { while true { while true { x <- y; } } } }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/while-loop-pred-constraints.rs b/src/test/compile-fail/while-loop-pred-constraints.rs
index 43e662d643c..5920d25230f 100644
--- a/src/test/compile-fail/while-loop-pred-constraints.rs
+++ b/src/test/compile-fail/while-loop-pred-constraints.rs
@@ -13,4 +13,4 @@ fn main() {
         print_even(y);
         while true { while true { while true { y += x; } } }
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/compile-fail/writing-through-read-alias.rs b/src/test/compile-fail/writing-through-read-alias.rs
index bc3f9037da9..2cfcb31ccbc 100644
--- a/src/test/compile-fail/writing-through-read-alias.rs
+++ b/src/test/compile-fail/writing-through-read-alias.rs
@@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int};
 
 fn f(p: &point) { p.x = 13; }
 
-fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
\ No newline at end of file
+fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
diff --git a/src/test/compile-fail/writing-through-uninit-vec.rs b/src/test/compile-fail/writing-through-uninit-vec.rs
index 7397773d940..0462824c276 100644
--- a/src/test/compile-fail/writing-through-uninit-vec.rs
+++ b/src/test/compile-fail/writing-through-uninit-vec.rs
@@ -1,5 +1,5 @@
 // error-pattern: Unsatisfied precondition constraint
 
-fn test() { let w: [int]; w.(5) = 0; }
+fn test() { let w: [int]; w[5] = 0; }
 
 fn main() { test(); }
diff --git a/src/test/compile-fail/writing-to-immutable-obj.rs b/src/test/compile-fail/writing-to-immutable-obj.rs
index 484afd91a3e..cc35f545120 100644
--- a/src/test/compile-fail/writing-to-immutable-obj.rs
+++ b/src/test/compile-fail/writing-to-immutable-obj.rs
@@ -2,4 +2,4 @@
 obj objy(x: int) {
     fn foo() { x = 5; }
 }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compile-fail/writing-to-immutable-rec.rs b/src/test/compile-fail/writing-to-immutable-rec.rs
index c40c6934f5c..ad0ceed8ee3 100644
--- a/src/test/compile-fail/writing-to-immutable-rec.rs
+++ b/src/test/compile-fail/writing-to-immutable-rec.rs
@@ -1,2 +1,2 @@
 // error-pattern: assignment to immutable field
-fn main() { let r: {x: int} = {x: 1}; r.x = 6; }
\ No newline at end of file
+fn main() { let r: {x: int} = {x: 1}; r.x = 6; }
diff --git a/src/test/compile-fail/writing-to-immutable-vec.rs b/src/test/compile-fail/writing-to-immutable-vec.rs
index d800288dd92..6f0f7c53504 100644
--- a/src/test/compile-fail/writing-to-immutable-vec.rs
+++ b/src/test/compile-fail/writing-to-immutable-vec.rs
@@ -1,2 +1,2 @@
 // error-pattern:assignment to immutable vec content
-fn main() { let v: [int] = ~[1, 2, 3]; v.(1) = 4; }
+fn main() { let v: [int] = [1, 2, 3]; v[1] = 4; }
diff --git a/src/test/compile-fail/wrong-ret-type.rs b/src/test/compile-fail/wrong-ret-type.rs
index b4435086cdd..82293a8f706 100644
--- a/src/test/compile-fail/wrong-ret-type.rs
+++ b/src/test/compile-fail/wrong-ret-type.rs
@@ -1,3 +1,3 @@
 // error-pattern: mismatched types
 fn mk_int() -> uint { let i: int = 3; ret i; }
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/compiletest/common.rs b/src/test/compiletest/common.rs
index 85b7be9b00f..ab0415fd7c1 100644
--- a/src/test/compiletest/common.rs
+++ b/src/test/compiletest/common.rs
@@ -1,38 +1,32 @@
 import std::option;
 
-tag mode {
-    mode_compile_fail;
-    mode_run_fail;
-    mode_run_pass;
-    mode_pretty;
-}
+tag mode { mode_compile_fail; mode_run_fail; mode_run_pass; mode_pretty; }
 
-type config = {
+type config =
     // The library paths required for running the compiler
-    compile_lib_path: str,
     // The library paths required for running compiled programs
-    run_lib_path: str,
     // The rustc executable
-    rustc_path: str,
     // The directory containing the tests to run
-    src_base: str,
     // The directory where programs should be built
-    build_base: str,
     // The name of the stage being built (stage1, etc)
-    stage_id: str,
     // The test mode, compile-fail, run-fail, run-pass
-    mode: mode,
     // Run ignored tests
-    run_ignored: bool,
     // Only run tests that match this filter
-    filter: option::t<str>,
     // A command line to prefix program execution with,
     // for running under valgrind
-    runtool: option::t<str>,
     // Flags to pass to the compiler
-    rustcflags: option::t<str>,
     // Explain what's going on
-    verbose: bool
-};
+    {compile_lib_path: str,
+     run_lib_path: str,
+     rustc_path: str,
+     src_base: str,
+     build_base: str,
+     stage_id: str,
+     mode: mode,
+     run_ignored: bool,
+     filter: option::t<str>,
+     runtool: option::t<str>,
+     rustcflags: option::t<str>,
+     verbose: bool};
 
 type cx = {config: config, procsrv: procsrv::handle};
diff --git a/src/test/compiletest/compiletest.rs b/src/test/compiletest/compiletest.rs
index 9bbc30de519..d045875e295 100644
--- a/src/test/compiletest/compiletest.rs
+++ b/src/test/compiletest/compiletest.rs
@@ -31,12 +31,12 @@ fn main(args: [str]) {
 
 fn parse_config(args: &[str]) -> config {
     let opts =
-        ~[getopts::reqopt("compile-lib-path"),
-          getopts::reqopt("run-lib-path"), getopts::reqopt("rustc-path"),
-          getopts::reqopt("src-base"), getopts::reqopt("build-base"),
-          getopts::reqopt("stage-id"), getopts::reqopt("mode"),
-          getopts::optflag("ignored"), getopts::optopt("runtool"),
-          getopts::optopt("rustcflags"), getopts::optflag("verbose")];
+        [getopts::reqopt("compile-lib-path"), getopts::reqopt("run-lib-path"),
+         getopts::reqopt("rustc-path"), getopts::reqopt("src-base"),
+         getopts::reqopt("build-base"), getopts::reqopt("stage-id"),
+         getopts::reqopt("mode"), getopts::optflag("ignored"),
+         getopts::optopt("runtool"), getopts::optopt("rustcflags"),
+         getopts::optflag("verbose")];
 
     check (vec::is_not_empty(args));
     let args_ = vec::tail(args);
@@ -56,7 +56,7 @@ fn parse_config(args: &[str]) -> config {
          run_ignored: getopts::opt_present(match, "ignored"),
          filter:
              if vec::len(match.free) > 0u {
-                 option::some(match.free.(0))
+                 option::some(match.free[0])
              } else { option::none },
          runtool: getopts::opt_maybe_str(match, "runtool"),
          rustcflags: getopts::opt_maybe_str(match, "rustcflags"),
@@ -65,20 +65,20 @@ fn parse_config(args: &[str]) -> config {
 
 fn log_config(config: &config) {
     let c = config;
-    logv(c, #fmt("configuration:"));
-    logv(c, #fmt("compile_lib_path: %s", config.compile_lib_path));
-    logv(c, #fmt("run_lib_path: %s", config.run_lib_path));
-    logv(c, #fmt("rustc_path: %s", config.rustc_path));
-    logv(c, #fmt("src_base: %s", config.src_base));
-    logv(c, #fmt("build_base: %s", config.build_base));
-    logv(c, #fmt("stage_id: %s", config.stage_id));
-    logv(c, #fmt("mode: %s", mode_str(config.mode)));
-    logv(c, #fmt("run_ignored: %b", config.run_ignored));
-    logv(c, #fmt("filter: %s", opt_str(config.filter)));
-    logv(c, #fmt("runtool: %s", opt_str(config.runtool)));
-    logv(c, #fmt("rustcflags: %s", opt_str(config.rustcflags)));
-    logv(c, #fmt("verbose: %b", config.verbose));
-    logv(c, #fmt("\n"));
+    logv(c, #fmt["configuration:"]);
+    logv(c, #fmt["compile_lib_path: %s", config.compile_lib_path]);
+    logv(c, #fmt["run_lib_path: %s", config.run_lib_path]);
+    logv(c, #fmt["rustc_path: %s", config.rustc_path]);
+    logv(c, #fmt["src_base: %s", config.src_base]);
+    logv(c, #fmt["build_base: %s", config.build_base]);
+    logv(c, #fmt["stage_id: %s", config.stage_id]);
+    logv(c, #fmt["mode: %s", mode_str(config.mode)]);
+    logv(c, #fmt["run_ignored: %b", config.run_ignored]);
+    logv(c, #fmt["filter: %s", opt_str(config.filter)]);
+    logv(c, #fmt["runtool: %s", opt_str(config.runtool)]);
+    logv(c, #fmt["rustcflags: %s", opt_str(config.rustcflags)]);
+    logv(c, #fmt["verbose: %b", config.verbose]);
+    logv(c, #fmt["\n"]);
 }
 
 fn opt_str(maybestr: option::t<str>) -> str {
@@ -121,16 +121,16 @@ fn test_opts(config: &config) -> test::test_opts {
 }
 
 type tests_and_conv_fn =
-    {tests: [test::test_desc], to_task: fn(&fn() ) -> test::joinable };
+    {tests: [test::test_desc], to_task: fn(&fn()) -> test::joinable};
 
 fn make_tests(cx: &cx) -> tests_and_conv_fn {
-    log #fmt("making tests from %s", cx.config.src_base);
+    log #fmt["making tests from %s", cx.config.src_base];
     let configport = mk_port::<[u8]>();
-    let tests = ~[];
+    let tests = [];
     for file: str in fs::list_dir(cx.config.src_base) {
-        log #fmt("inspecting file %s", file);
+        log #fmt["inspecting file %s", file];
         if is_test(cx.config, file) {
-            tests += ~[make_test(cx, file, configport)];
+            tests += [make_test(cx, file, configport)];
         }
     }
     ret {tests: tests, to_task: bind closure_to_task(cx, configport, _)};
@@ -138,11 +138,9 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn {
 
 fn is_test(config: &config, testfile: &str) -> bool {
     // Pretty-printer does not work with .rc files yet
-    let valid_extensions = alt config.mode {
-      mode_pretty. { ~[".rs"] }
-      _ { ~[".rc", ".rs"] }
-    };
-    let invalid_prefixes = ~[".", "#", "~"];
+    let valid_extensions =
+        alt config.mode { mode_pretty. { [".rs"] } _ { [".rc", ".rs"] } };
+    let invalid_prefixes = [".", "#", "~"];
     let name = fs::basename(testfile);
 
     let valid = false;
@@ -166,7 +164,7 @@ fn make_test(cx: &cx, testfile: &str, configport: &_port<[u8]>) ->
 }
 
 fn make_test_name(config: &config, testfile: &str) -> str {
-    #fmt("[%s] %s", mode_str(config.mode), testfile)
+    #fmt["[%s] %s", mode_str(config.mode), testfile]
 }
 
 /*
@@ -188,8 +186,8 @@ up. Then we'll spawn that data into another task and return the task.
 Really convoluted. Need to think up of a better definition for tests.
 */
 
-fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) -> test::test_fn
-{
+fn make_test_closure(testfile: &str, configchan: _chan<[u8]>) ->
+   test::test_fn {
     bind send_config(testfile, configchan)
 }
 
@@ -207,25 +205,19 @@ break up the config record and pass everything individually to the spawned
 function.
 */
 
-fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn() )
-    -> test::joinable
-{
+fn closure_to_task(cx: cx, configport: _port<[u8]>, testfn: &fn()) ->
+   test::joinable {
     testfn();
     let testfile = configport.recv();
-    let testthunk = bind run_test_task(cx.config.compile_lib_path,
-                                       cx.config.run_lib_path,
-                                       cx.config.rustc_path,
-                                       cx.config.src_base,
-                                       cx.config.build_base,
-                                       cx.config.stage_id,
-                                       mode_str(cx.config.mode),
-                                       cx.config.run_ignored,
-                                       opt_str(cx.config.filter),
-                                       opt_str(cx.config.runtool),
-                                       opt_str(cx.config.rustcflags),
-                                       cx.config.verbose,
-                                       cx.procsrv.chan,
-                                       testfile);
+    let testthunk =
+        bind run_test_task(cx.config.compile_lib_path, cx.config.run_lib_path,
+                           cx.config.rustc_path, cx.config.src_base,
+                           cx.config.build_base, cx.config.stage_id,
+                           mode_str(cx.config.mode), cx.config.run_ignored,
+                           opt_str(cx.config.filter),
+                           opt_str(cx.config.runtool),
+                           opt_str(cx.config.rustcflags), cx.config.verbose,
+                           cx.procsrv.chan, testfile);
     ret task::spawn_joinable(testthunk);
 }
 
diff --git a/src/test/compiletest/procsrv.rs b/src/test/compiletest/procsrv.rs
index d434562cf3c..6e464038b18 100644
--- a/src/test/compiletest/procsrv.rs
+++ b/src/test/compiletest/procsrv.rs
@@ -30,24 +30,20 @@ type reqchan = chan<request>;
 
 type handle = {task: option::t<task_id>, chan: reqchan};
 
-tag request {
-    exec([u8], [u8], [[u8]], chan<response>);
-    stop;
-}
+tag request { exec([u8], [u8], [[u8]], chan<response>); stop; }
 
 type response = {pid: int, infd: int, outfd: int, errfd: int};
 
 fn mk() -> handle {
     let setupport = port();
-    let task = task::spawn(bind fn(setupchan: chan<chan<request>>) {
-        let reqport = port();
-        let reqchan = chan(reqport);
-        send(setupchan, reqchan);
-        worker(reqport);
-    } (chan(setupport)));
-    ret {task: option::some(task),
-         chan: recv(setupport)
-        };
+    let task =
+        task::spawn(bind fn (setupchan: chan<chan<request>>) {
+                             let reqport = port();
+                             let reqchan = chan(reqport);
+                             send(setupchan, reqchan);
+                             worker(reqport);
+                         }(chan(setupport)));
+    ret {task: option::some(task), chan: recv(setupport)};
 }
 
 fn from_chan(ch: &reqchan) -> handle { {task: option::none, chan: ch} }
@@ -57,15 +53,13 @@ fn close(handle: &handle) {
     task::join_id(option::get(handle.task));
 }
 
-fn run(handle: &handle, lib_path: &str,
-       prog: &str, args: &[str], input: &option::t<str>) ->
-{status: int, out: str, err: str} {
+fn run(handle: &handle, lib_path: &str, prog: &str, args: &[str],
+       input: &option::t<str>) -> {status: int, out: str, err: str} {
     let p = port();
     let ch = chan(p);
-    send(handle.chan, exec(str::bytes(lib_path),
-                           str::bytes(prog),
-                           clone_vecstr(args),
-                           ch));
+    send(handle.chan,
+         exec(str::bytes(lib_path), str::bytes(prog), clone_vecstr(args),
+              ch));
     let resp = recv(p);
 
     writeclose(resp.infd, input);
@@ -77,8 +71,7 @@ fn run(handle: &handle, lib_path: &str,
 
 fn writeclose(fd: int, s: &option::t<str>) {
     if option::is_some(s) {
-        let writer = io::new_writer(
-            io::fd_buf_writer(fd, option::none));
+        let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(option::get(s));
     }
 
@@ -88,8 +81,7 @@ fn writeclose(fd: int, s: &option::t<str>) {
 fn readclose(fd: int) -> str {
     // Copied from run::program_output
     let file = os::fd_FILE(fd);
-    let reader = io::new_reader(
-        io::FILE_buf_reader(file, option::none));
+    let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
     let buf = "";
     while !reader.eof() {
         let bytes = reader.read_bytes(4096u);
@@ -112,35 +104,32 @@ fn worker(p: port<request>) {
         // the receiver's poniters outlive the sender's. Here we clone
         // everything and let the originals go out of scope before sending
         // a response.
-        execparms = {
-            // FIXME (785): The 'discriminant' of an alt expression has
-            // the same scope as the alt expression itself, so we have to
-            // put the entire alt in another block to make sure the exec
-            // message goes out of scope. Seems like the scoping rules for
-            // the alt discriminant are wrong.
-            alt recv(p) {
-              exec(lib_path, prog, args, respchan) {
-                {
-                    lib_path: str::unsafe_from_bytes(lib_path),
-                    prog: str::unsafe_from_bytes(prog),
-                    args: clone_vecu8str(args),
-                    respchan: respchan
+        execparms =
+            {
+
+                // FIXME (785): The 'discriminant' of an alt expression has
+                // the same scope as the alt expression itself, so we have to
+                // put the entire alt in another block to make sure the exec
+                // message goes out of scope. Seems like the scoping rules for
+                // the alt discriminant are wrong.
+                alt recv(p) {
+                  exec(lib_path, prog, args, respchan) {
+                    {lib_path: str::unsafe_from_bytes(lib_path),
+                     prog: str::unsafe_from_bytes(prog),
+                     args: clone_vecu8str(args),
+                     respchan: respchan}
+                  }
+                  stop. { ret }
                 }
-              }
-              stop. { ret }
-            }
-        };
+            };
 
         // This is copied from run::start_program
         let pipe_in = os::pipe();
         let pipe_out = os::pipe();
         let pipe_err = os::pipe();
         let spawnproc =
-            bind run::spawn_process(execparms.prog,
-                                    execparms.args,
-                                    pipe_in.in,
-                                    pipe_out.out,
-                                    pipe_err.out);
+            bind run::spawn_process(execparms.prog, execparms.args,
+                                    pipe_in.in, pipe_out.out, pipe_err.out);
         let pid = with_lib_path(execparms.lib_path, spawnproc);
 
         os::libc::close(pipe_in.in);
@@ -161,7 +150,7 @@ fn worker(p: port<request>) {
     }
 }
 
-fn with_lib_path<T>(path: &str, f: fn() -> T ) -> T {
+fn with_lib_path<T>(path: &str, f: fn() -> T) -> T {
     let maybe_oldpath = getenv(util::lib_path_env_var());
     append_lib_path(path);
     let res = f();
@@ -179,17 +168,15 @@ fn append_lib_path(path: &str) { export_lib_path(util::make_new_path(path)); }
 fn export_lib_path(path: &str) { setenv(util::lib_path_env_var(), path); }
 
 fn clone_vecstr(v: &[str]) -> [[u8]] {
-    let r = ~[];
-    for t: str in vec::slice(v, 0u, vec::len(v)) {
-        r += ~[str::bytes(t)];
-    }
+    let r = [];
+    for t: str in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; }
     ret r;
 }
 
 fn clone_vecu8str(v: &[[u8]]) -> [str] {
-    let r = ~[];
+    let r = [];
     for t in vec::slice(v, 0u, vec::len(v)) {
-        r += ~[str::unsafe_from_bytes(t)];
+        r += [str::unsafe_from_bytes(t)];
     }
     ret r;
 }
diff --git a/src/test/compiletest/runtest.rs b/src/test/compiletest/runtest.rs
index c56ec6970ef..c3572e20cba 100644
--- a/src/test/compiletest/runtest.rs
+++ b/src/test/compiletest/runtest.rs
@@ -20,11 +20,11 @@ export run;
 
 fn run(cx: &cx, _testfile: -[u8]) {
     let testfile = str::unsafe_from_bytes(_testfile);
-    if (cx.config.verbose) {
+    if cx.config.verbose {
         // We're going to be dumping a lot of info. Start on a new line.
         io::stdout().write_str("\n\n");
     }
-    log #fmt("running %s", testfile);
+    log #fmt["running %s", testfile];
     let props = load_props(testfile);
     alt cx.config.mode {
       mode_compile_fail. { run_cfail_test(cx, props, testfile); }
@@ -38,8 +38,7 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres("compile-fail test compiled successfully!",
-                      procres);
+        fatal_procres("compile-fail test compiled successfully!", procres);
     }
 
     check_error_patterns(props, testfile, procres);
@@ -48,14 +47,12 @@ fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 {
-        fatal_procres("compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres("run-fail test didn't produce an error!",
-                      procres);
+        fatal_procres("run-fail test didn't produce an error!", procres);
     }
 
     // This is the value valgrind returns on failure
@@ -73,8 +70,7 @@ fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 {
-        fatal_procres("compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
@@ -85,46 +81,41 @@ fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) {
 fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
     if option::is_some(props.pp_exact) {
         logv(cx.config, "testing for exact pretty-printing");
-    } else {
-        logv(cx.config, "testing for converging pretty-printing");
-    }
+    } else { logv(cx.config, "testing for converging pretty-printing"); }
 
-    let rounds = alt props.pp_exact {
-      option::some(_) { 1 }
-      option::none. { 2 }
-    };
+    let rounds =
+        alt props.pp_exact { option::some(_) { 1 } option::none. { 2 } };
 
-    let srcs = ~[io::read_whole_file_str(testfile)];
+    let srcs = [io::read_whole_file_str(testfile)];
 
     let round = 0;
     while round < rounds {
-        logv(cx.config, #fmt("pretty-printing round %d", round));
-        let procres = print_source(cx, testfile, srcs.(round));
+        logv(cx.config, #fmt["pretty-printing round %d", round]);
+        let procres = print_source(cx, testfile, srcs[round]);
 
         if procres.status != 0 {
-            fatal_procres(#fmt("pretty-printing failed in round %d", round),
+            fatal_procres(#fmt["pretty-printing failed in round %d", round],
                           procres);
         }
 
-        srcs += ~[procres.stdout];
+        srcs += [procres.stdout];
         round += 1;
     }
 
-    let expected = alt props.pp_exact {
-      option::some(file) {
-        let filepath = fs::connect(fs::dirname(testfile), file);
-        io::read_whole_file_str(filepath)
-      }
-      option::none. {
-        srcs.(vec::len(srcs) - 2u)
-      }
-    };
-    let actual = srcs.(vec::len(srcs) - 1u);
+    let expected =
+        alt props.pp_exact {
+          option::some(file) {
+            let filepath = fs::connect(fs::dirname(testfile), file);
+            io::read_whole_file_str(filepath)
+          }
+          option::none. { srcs[vec::len(srcs) - 2u] }
+        };
+    let actual = srcs[vec::len(srcs) - 1u];
 
     if option::is_some(props.pp_exact) {
         // Now we have to care about line endings
         let cr = "\r";
-        check str::is_not_empty(cr);
+        check (str::is_not_empty(cr));
         actual = str::replace(actual, cr, "");
         expected = str::replace(expected, cr, "");
     }
@@ -135,8 +126,7 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = typecheck_source(cx, testfile, actual);
 
     if procres.status != 0 {
-        fatal_procres("pretty-printed source does not typecheck",
-                      procres);
+        fatal_procres("pretty-printed source does not typecheck", procres);
     }
 
     ret;
@@ -148,14 +138,15 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
 
     fn make_pp_args(config: &config, testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = ~["-", "--pretty", "normal"];
+        let args = ["-", "--pretty", "normal"];
         ret {prog: prog, args: args};
     }
 
     fn compare_source(expected: &str, actual: &str) {
         if expected != actual {
             error("pretty-printed source does match expected source");
-            let msg = #fmt("\n\
+            let msg =
+                #fmt["\n\
 expected:\n\
 ------------------------------------------\n\
 %s\n\
@@ -165,7 +156,7 @@ actual:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-                          expected, actual);
+                     expected, actual];
             io::stdout().write_str(msg);
             fail;
         }
@@ -178,7 +169,7 @@ actual:\n\
 
     fn make_typecheck_args(config: &config, testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = ~["-", "--no-trans", "--lib"];
+        let args = ["-", "--no-trans", "--lib"];
         ret {prog: prog, args: args};
     }
 }
@@ -190,28 +181,28 @@ fn check_error_patterns(props: &test_props, testfile: &str,
     }
 
     let next_err_idx = 0u;
-    let next_err_pat = props.error_patterns.(next_err_idx);
+    let next_err_pat = props.error_patterns[next_err_idx];
     for line: str in str::split(procres.stdout, '\n' as u8) {
         if str::find(line, next_err_pat) > 0 {
-            log #fmt("found error pattern %s", next_err_pat);
+            log #fmt["found error pattern %s", next_err_pat];
             next_err_idx += 1u;
             if next_err_idx == vec::len(props.error_patterns) {
                 log "found all error patterns";
                 ret;
             }
-            next_err_pat = props.error_patterns.(next_err_idx);
+            next_err_pat = props.error_patterns[next_err_idx];
         }
     }
 
     let missing_patterns =
         vec::slice(props.error_patterns, next_err_idx,
-                    vec::len(props.error_patterns));
+                   vec::len(props.error_patterns));
     if vec::len(missing_patterns) == 1u {
-        fatal_procres(#fmt("error pattern '%s' not found!",
-                           missing_patterns.(0)), procres);
+        fatal_procres(#fmt["error pattern '%s' not found!",
+                           missing_patterns[0]], procres);
     } else {
         for pattern: str in missing_patterns {
-            error(#fmt("error pattern '%s' not found!", pattern));
+            error(#fmt["error pattern '%s' not found!", pattern]);
         }
         fatal_procres("multiple error patterns not found", procres);
     }
@@ -226,27 +217,24 @@ fn compile_test(cx: &cx, props: &test_props, testfile: &str) -> procres {
                     cx.config.compile_lib_path, option::none)
 }
 
-fn exec_compiled_test(cx: &cx, props: &test_props,
-                      testfile: &str) -> procres {
+fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &str) ->
+   procres {
     compose_and_run(cx, testfile, bind make_run_args(_, props, _),
                     cx.config.run_lib_path, option::none)
 }
 
 fn compose_and_run(cx: &cx, testfile: &str,
-                   make_args: fn(&config, &str) -> procargs ,
-                   lib_path: &str,
+                   make_args: fn(&config, &str) -> procargs, lib_path: &str,
                    input: option::t<str>) -> procres {
     let procargs = make_args(cx.config, testfile);
-    ret program_output(cx, testfile, lib_path,
-                       procargs.prog, procargs.args,
+    ret program_output(cx, testfile, lib_path, procargs.prog, procargs.args,
                        input);
 }
 
-fn make_compile_args(config: &config,
-                     props: &test_props, testfile: &str) ->
-    procargs {
+fn make_compile_args(config: &config, props: &test_props, testfile: &str) ->
+   procargs {
     let prog = config.rustc_path;
-    let args = ~[testfile, "-o", make_exe_name(config, testfile)];
+    let args = [testfile, "-o", make_exe_name(config, testfile)];
     args += split_maybe_args(config.rustcflags);
     args += split_maybe_args(props.compile_flags);
     ret {prog: prog, args: args};
@@ -256,35 +244,29 @@ fn make_exe_name(config: &config, testfile: &str) -> str {
     output_base_name(config, testfile) + os::exec_suffix()
 }
 
-fn make_run_args(config: &config,
-                 props: &test_props, testfile: &str) -> procargs {
-    let toolargs = if !props.no_valgrind {
-        // If we've got another tool to run under (valgrind),
-        // then split apart its command
-        split_maybe_args(config.runtool)
-    } else {
-        ~[]
-    };
+fn make_run_args(config: &config, props: &test_props, testfile: &str) ->
+   procargs {
+    let toolargs =
+        if !props.no_valgrind {
 
-    let args = toolargs + ~[make_exe_name(config, testfile)];
-    ret {prog: args.(0), args: vec::slice(args, 1u, vec::len(args))};
+            // If we've got another tool to run under (valgrind),
+            // then split apart its command
+            split_maybe_args(config.runtool)
+        } else { [] };
+
+    let args = toolargs + [make_exe_name(config, testfile)];
+    ret {prog: args[0], args: vec::slice(args, 1u, vec::len(args))};
 }
 
 fn split_maybe_args(argstr: &option::t<str>) -> [str] {
     fn rm_whitespace(v: &[str]) -> [str] {
         fn flt(s: &str) -> option::t<str> {
-            if !is_whitespace(s) {
-                option::some(s)
-            } else {
-                option::none
-            }
+            if !is_whitespace(s) { option::some(s) } else { option::none }
         }
 
         // FIXME: This should be in std
         fn is_whitespace(s: str) -> bool {
-            for c: u8 in s {
-                if c != (' ' as u8) { ret false; }
-            }
+            for c: u8 in s { if c != ' ' as u8 { ret false; } }
             ret true;
         }
         vec::filter_map(flt, v)
@@ -292,38 +274,38 @@ fn split_maybe_args(argstr: &option::t<str>) -> [str] {
 
     alt argstr {
       option::some(s) { rm_whitespace(str::split(s, ' ' as u8)) }
-      option::none. { ~[] }
+      option::none. { [] }
     }
 }
 
 fn program_output(cx: &cx, testfile: &str, lib_path: &str, prog: &str,
                   args: &[str], input: option::t<str>) -> procres {
     let cmdline =
-    {
-        let cmdline = make_cmdline(lib_path, prog, args);
-        logv(cx.config, #fmt("executing %s", cmdline));
-        cmdline
-    };
-    let res = procsrv::run(cx.procsrv, lib_path,
-                           prog, args, input);
+        {
+            let cmdline = make_cmdline(lib_path, prog, args);
+            logv(cx.config, #fmt["executing %s", cmdline]);
+            cmdline
+        };
+    let res = procsrv::run(cx.procsrv, lib_path, prog, args, input);
     dump_output(cx.config, testfile, res.out, res.err);
-    ret {status: res.status, stdout: res.out,
-         stderr: res.err, cmdline: cmdline};
+    ret {status: res.status,
+         stdout: res.out,
+         stderr: res.err,
+         cmdline: cmdline};
 }
 
 fn make_cmdline(libpath: &str, prog: &str, args: &[str]) -> str {
-    #fmt("%s %s %s", lib_path_cmd_prefix(libpath), prog,
-         str::connect(args, " "))
+    #fmt["%s %s %s", lib_path_cmd_prefix(libpath), prog,
+         str::connect(args, " ")]
 }
 
 // Build the LD_LIBRARY_PATH variable as it would be seen on the command line
 // for diagnostic purposes
 fn lib_path_cmd_prefix(path: &str) -> str {
-    #fmt("%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path))
+    #fmt["%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)]
 }
 
-fn dump_output(config: &config, testfile: &str,
-               out: &str, err: &str) {
+fn dump_output(config: &config, testfile: &str, out: &str, err: &str) {
     dump_output_file(config, testfile, out, "out");
     dump_output_file(config, testfile, err, "err");
     maybe_dump_to_stdout(config, out, err);
@@ -331,22 +313,20 @@ fn dump_output(config: &config, testfile: &str,
 
 #[cfg(target_os = "win32")]
 #[cfg(target_os = "linux")]
-fn dump_output_file(config: &config, testfile: &str,
-                    out: &str, extension: &str) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
     let outfile = make_out_name(config, testfile, extension);
-    let writer = io::file_writer(outfile,
-                                     ~[io::create, io::truncate]);
+    let writer = io::file_writer(outfile, [io::create, io::truncate]);
     writer.write_str(out);
 }
 
 // FIXME (726): Can't use file_writer on mac
 #[cfg(target_os = "macos")]
-fn dump_output_file(config: &config, testfile: &str,
-                    out: &str, extension: &str) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
 }
 
-fn make_out_name(config: &config, testfile: &str,
-                 extension: &str) -> str {
+fn make_out_name(config: &config, testfile: &str, extension: &str) -> str {
     output_base_name(config, testfile) + "." + extension
 }
 
@@ -358,16 +338,13 @@ fn output_base_name(config: &config, testfile: &str) -> str {
             parts = vec::slice(parts, 0u, vec::len(parts) - 1u);
             str::connect(parts, ".")
         };
-    #fmt("%s%s.%s", base, filename, config.stage_id)
+    #fmt["%s%s.%s", base, filename, config.stage_id]
 }
 
-fn maybe_dump_to_stdout(config: &config,
-                        out: &str, err: &str) {
+fn maybe_dump_to_stdout(config: &config, out: &str, err: &str) {
     if config.verbose {
-        let sep1 = #fmt("------%s------------------------------",
-                        "stdout");
-        let sep2 = #fmt("------%s------------------------------",
-                        "stderr");
+        let sep1 = #fmt["------%s------------------------------", "stdout"];
+        let sep2 = #fmt["------%s------------------------------", "stderr"];
         let sep3 = "------------------------------------------";
         io::stdout().write_line(sep1);
         io::stdout().write_line(out);
@@ -377,13 +354,13 @@ fn maybe_dump_to_stdout(config: &config,
     }
 }
 
-fn error(err: &str) { io::stdout().write_line(#fmt("\nerror: %s", err)); }
+fn error(err: &str) { io::stdout().write_line(#fmt["\nerror: %s", err]); }
 
 fn fatal(err: &str) -> ! { error(err); fail; }
 
 fn fatal_procres(err: &str, procres: procres) -> ! {
     let msg =
-        #fmt("\n\
+        #fmt["\n\
 error: %s\n\
 command: %s\n\
 stdout:\n\
@@ -395,7 +372,7 @@ stderr:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-             err, procres.cmdline, procres.stdout, procres.stderr);
+             err, procres.cmdline, procres.stdout, procres.stderr];
     io::stdout().write_str(msg);
     fail;
 }
diff --git a/src/test/compiletest/util.rs b/src/test/compiletest/util.rs
index 5f971777c75..3dcd8699927 100644
--- a/src/test/compiletest/util.rs
+++ b/src/test/compiletest/util.rs
@@ -9,7 +9,7 @@ fn make_new_path(path: &str) -> str {
     // Windows just uses PATH as the library search path, so we have to
     // maintain the current value while adding our own
     alt getenv(lib_path_env_var()) {
-      option::some(curr) { #fmt("%s:%s", path, curr) }
+      option::some(curr) { #fmt["%s:%s", path, curr] }
       option::none. { path }
     }
 }
diff --git a/src/test/pretty/block-disambig.rs b/src/test/pretty/block-disambig.rs
index f035b9393c2..252eb0270da 100644
--- a/src/test/pretty/block-disambig.rs
+++ b/src/test/pretty/block-disambig.rs
@@ -1,40 +1,20 @@
 // Tests that the pretty printer correctly disambiguates various scenarios
 // involving block statements by ending them with a semi-colon
-fn test1() {
-    let val = @0;
-    {};
-    *val;
-}
+fn test1() { let val = @0; { }; *val; }
 
-fn test2() -> int {
-    let val = @0;
-    {};
-    *val
-}
+fn test2() -> int { let val = @0; { }; *val }
 
 fn test3() {
     let regs = @{mutable eax: 0};
-    alt true {
-      true { }
-    };
+    alt true { true { } };
     (*regs).eax = 1;
 }
 
-fn test4() -> bool {
-    let regs = @true;
-    if true { };
-    *regs || false
-}
+fn test4() -> bool { let regs = @true; if true { }; *regs || false }
 
-fn test5() -> (int, int) {
-    {};
-    (0, 1)
-}
+fn test5() -> (int, int) { { }; (0, 1) }
 
-fn test6() -> bool {
-    {};
-    (true || false) && true
-}
+fn test6() -> bool { { }; (true || false) && true }
 
 fn test7() -> uint {
     let regs = @0;
@@ -42,24 +22,12 @@ fn test7() -> uint {
     (*regs < 2) as uint
 }
 
-fn test8() -> int {
-    let val = @0;
-    alt true { true { } };
-    *val < 1 ? 0 : 1
-}
+fn test8() -> int { let val = @0; alt true { true { } }; *val < 1 ? 0 : 1 }
 
-fn test9() {
-    let regs = @mutable 0;
-    alt true {
-      true { }
-    };
-    *regs += 1;
-}
+fn test9() { let regs = @mutable 0; alt true { true { } }; *regs += 1; }
 
 fn test10() -> int {
     let regs = @mutable [0];
-    alt true {
-      true { }
-    };
-    (*regs).(0)
+    alt true { true { } };
+    (*regs)[0]
 }
diff --git a/src/test/pretty/empty-lines.rs b/src/test/pretty/empty-lines.rs
index 87de5ff64c2..e598e96db24 100644
--- a/src/test/pretty/empty-lines.rs
+++ b/src/test/pretty/empty-lines.rs
@@ -4,4 +4,4 @@
 fn a() -> uint {
 
     1u
-}
\ No newline at end of file
+}
diff --git a/src/test/pretty/example2.rs b/src/test/pretty/example2.rs
index ea9ff94112a..852b9f316ce 100644
--- a/src/test/pretty/example2.rs
+++ b/src/test/pretty/example2.rs
@@ -1,7 +1,3 @@
 // pp-exact:example2.pp
 
-fn
-main
-()
-{
-}
+fn main() { }
diff --git a/src/test/pretty/unary-op-disambig.rs b/src/test/pretty/unary-op-disambig.rs
index 79cc24a2f20..0f67570e722 100644
--- a/src/test/pretty/unary-op-disambig.rs
+++ b/src/test/pretty/unary-op-disambig.rs
@@ -2,34 +2,16 @@
 
 fn f() { }
 
-fn block_semi() -> int {
-    { f() };
-    -1
-}
-
-fn block_nosemi() -> int {
-    { 0 } - 1
-}
-
-fn if_semi() -> int {
-    if true { f() } else { f() };
-    -1
-}
-
-fn if_nosemi() -> int {
-    if true { 0 } else { 0 } - 1
-}
-
-fn alt_semi() -> int {
-    alt true { true { f() } };
-    -1
-}
-
-fn alt_no_semi() -> int {
-    alt true { true { 0 } } - 1
-}
-
-fn stmt() {
-    { f() };
-    -1;
-}
\ No newline at end of file
+fn block_semi() -> int { { f() }; -1 }
+
+fn block_nosemi() -> int { { 0 } - 1 }
+
+fn if_semi() -> int { if true { f() } else { f() }; -1 }
+
+fn if_nosemi() -> int { if true { 0 } else { 0 } - 1 }
+
+fn alt_semi() -> int { alt true { true { f() } }; -1 }
+
+fn alt_no_semi() -> int { alt true { true { 0 } } - 1 }
+
+fn stmt() { { f() }; -1; }
diff --git a/src/test/pretty/vec-comments.rs b/src/test/pretty/vec-comments.rs
index 48de34972b7..2cd5fffdf75 100644
--- a/src/test/pretty/vec-comments.rs
+++ b/src/test/pretty/vec-comments.rs
@@ -2,30 +2,28 @@
 // Testing that comments are correctly interleaved
 // pp-exact:vec-comments.pp
 fn main() {
-    let v1 = ~[
-        // Comment
-        0,
-        // Comment
-        1,
-        // Comment
-        2
-    ];
-    let v2 = ~[
-        0, // Comment
-        1, // Comment
-        2  // Comment
-    ];
-    let v3 = ~[
-        /* Comment */
-        0,
-        /* Comment */
-        1,
-        /* Comment */
-        2
-    ];
-    let v4 = ~[
-        0, /* Comment */
-        1, /* Comment */
-        2  /* Comment */
-    ];
+    let v1 =
+        [
+         // Comment
+         0,
+         // Comment
+         1,
+         // Comment
+         2];
+    let v2 =
+        [0, // Comment
+         1, // Comment
+         2]; // Comment
+    let v3 =
+        [
+         /* Comment */
+         0,
+         /* Comment */
+         1,
+         /* Comment */
+         2];
+    let v4 =
+        [0, /* Comment */
+         1, /* Comment */
+         2]; /* Comment */
 }
diff --git a/src/test/pretty/vec-type.rs b/src/test/pretty/vec-type.rs
index 010ad755f51..60265eebcf7 100644
--- a/src/test/pretty/vec-type.rs
+++ b/src/test/pretty/vec-type.rs
@@ -2,4 +2,4 @@
 
 fn f1(x: [int]) { }
 
-fn g1() { f1(~[1, 2, 3]); }
+fn g1() { f1([1, 2, 3]); }
diff --git a/src/test/run-fail/alt-bot-fail.rs b/src/test/run-fail/alt-bot-fail.rs
index 7a414b3ca6a..355892d5a13 100644
--- a/src/test/run-fail/alt-bot-fail.rs
+++ b/src/test/run-fail/alt-bot-fail.rs
@@ -7,9 +7,7 @@ import std::option::*;
 fn foo(s: str) { }
 
 fn main() {
-    let i = alt some::<int>(3) {
-        none::<int>. { fail }
-        some::<int>(_) { fail }
-    };
+    let i =
+        alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { fail } };
     foo(i);
 }
diff --git a/src/test/run-fail/alt-disc-bot.rs b/src/test/run-fail/alt-disc-bot.rs
index 8b4d30ef6ac..2ac519e6419 100644
--- a/src/test/run-fail/alt-disc-bot.rs
+++ b/src/test/run-fail/alt-disc-bot.rs
@@ -1,4 +1,4 @@
 // error-pattern:quux
 fn f() -> ! { fail "quux" }
-fn g() -> int { alt f() { true { 1 } false { 0 } }; }
+fn g() -> int { alt f() { true { 1 } false { 0 } } }
 fn main() { g(); }
diff --git a/src/test/run-fail/args-fail.rs b/src/test/run-fail/args-fail.rs
index 9dc6ecc7413..afdaa553ba6 100644
--- a/src/test/run-fail/args-fail.rs
+++ b/src/test/run-fail/args-fail.rs
@@ -1,4 +1,4 @@
 // error-pattern:meep
 fn f(a: int, b: int, c: @int) { fail "moop"; }
 
-fn main() { f(1, fail "meep", @42); }
\ No newline at end of file
+fn main() { f(1, fail "meep", @42); }
diff --git a/src/test/run-fail/bug-811.rs b/src/test/run-fail/bug-811.rs
index 176b95343eb..aa4d829a100 100644
--- a/src/test/run-fail/bug-811.rs
+++ b/src/test/run-fail/bug-811.rs
@@ -1,16 +1,11 @@
 // error-pattern:quux
-fn test00_start(ch: chan_t<int>, message: int) {
-    send(ch, message);
-}
+fn test00_start(ch: chan_t<int>, message: int) { send(ch, message); }
 
 type task_id = int;
 type port_id = int;
 
-type chan_t<~T> = {
-    task : task_id,
-    port : port_id
-};
+type chan_t<~T> = {task: task_id, port: port_id};
 
-fn send<~T>(ch : chan_t<T>, data : -T) { fail; }
+fn send<~T>(ch: chan_t<T>, data: -T) { fail; }
 
 fn main() { fail "quux"; }
diff --git a/src/test/run-fail/do-while-body-fails.rs b/src/test/run-fail/do-while-body-fails.rs
index 1a6cac5fabc..3ab257de397 100644
--- a/src/test/run-fail/do-while-body-fails.rs
+++ b/src/test/run-fail/do-while-body-fails.rs
@@ -1,4 +1,2 @@
 // error-pattern:quux
-fn main() {
-    let x: int = do { fail "quux" } while (true);
-}
+fn main() { let x: int = do  { fail "quux" } while true; }
diff --git a/src/test/run-fail/explicit-fail-msg.rs b/src/test/run-fail/explicit-fail-msg.rs
index f238d226b34..b45e443759c 100644
--- a/src/test/run-fail/explicit-fail-msg.rs
+++ b/src/test/run-fail/explicit-fail-msg.rs
@@ -1,3 +1,3 @@
 // error-pattern:wooooo
 // no-valgrind
-fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; }
\ No newline at end of file
+fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; }
diff --git a/src/test/run-fail/explicit-fail.rs b/src/test/run-fail/explicit-fail.rs
index a74cf4b36e3..396f12d5caf 100644
--- a/src/test/run-fail/explicit-fail.rs
+++ b/src/test/run-fail/explicit-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit
-fn main() { fail; }
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/run-fail/expr-alt-fail-fn.rs b/src/test/run-fail/expr-alt-fail-fn.rs
index e9754643ccd..bf6898ed297 100644
--- a/src/test/run-fail/expr-alt-fail-fn.rs
+++ b/src/test/run-fail/expr-alt-fail-fn.rs
@@ -6,4 +6,4 @@ fn f() -> ! { fail }
 
 fn g() -> int { let x = alt true { true { f() } false { 10 } }; ret x; }
 
-fn main() { g(); }
\ No newline at end of file
+fn main() { g(); }
diff --git a/src/test/run-fail/expr-alt-fail.rs b/src/test/run-fail/expr-alt-fail.rs
index 50154890bc3..230497135cd 100644
--- a/src/test/run-fail/expr-alt-fail.rs
+++ b/src/test/run-fail/expr-alt-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit failure
-fn main() { let x = alt true { false { 0 } true { fail } }; }
\ No newline at end of file
+fn main() { let x = alt true { false { 0 } true { fail } }; }
diff --git a/src/test/run-fail/expr-fn-fail.rs b/src/test/run-fail/expr-fn-fail.rs
index fc716fc1c60..24d0fa4c4aa 100644
--- a/src/test/run-fail/expr-fn-fail.rs
+++ b/src/test/run-fail/expr-fn-fail.rs
@@ -4,4 +4,4 @@
 // error-pattern:explicit failure
 fn f() -> ! { fail }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-fail/expr-if-fail-fn.rs b/src/test/run-fail/expr-if-fail-fn.rs
index 6b7b6d64b45..406302532fa 100644
--- a/src/test/run-fail/expr-if-fail-fn.rs
+++ b/src/test/run-fail/expr-if-fail-fn.rs
@@ -6,4 +6,4 @@ fn f() -> ! { fail }
 
 fn g() -> int { let x = if true { f() } else { 10 }; ret x; }
 
-fn main() { g(); }
\ No newline at end of file
+fn main() { g(); }
diff --git a/src/test/run-fail/expr-if-fail.rs b/src/test/run-fail/expr-if-fail.rs
index a738bfc7f1e..24cd815c244 100644
--- a/src/test/run-fail/expr-if-fail.rs
+++ b/src/test/run-fail/expr-if-fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:explicit failure
-fn main() { let x = if false { 0 } else if (true) { fail } else { 10 }; }
\ No newline at end of file
+fn main() { let x = if false { 0 } else if true { fail } else { 10 }; }
diff --git a/src/test/run-fail/fail-arg.rs b/src/test/run-fail/fail-arg.rs
index ef43fea8694..e657bf7d9a6 100644
--- a/src/test/run-fail/fail-arg.rs
+++ b/src/test/run-fail/fail-arg.rs
@@ -1,4 +1,4 @@
 // error-pattern:woe
 fn f(a: int) { log a; }
 
-fn main() { f(fail "woe"); }
\ No newline at end of file
+fn main() { f(fail "woe"); }
diff --git a/src/test/run-fail/fail-main.rs b/src/test/run-fail/fail-main.rs
index 0ac56613439..a8e51009352 100644
--- a/src/test/run-fail/fail-main.rs
+++ b/src/test/run-fail/fail-main.rs
@@ -1,4 +1,4 @@
 // error-pattern:moop
 use std;
 import std::uint;
-fn main() { fail "moop"; }
\ No newline at end of file
+fn main() { fail "moop"; }
diff --git a/src/test/run-fail/fail.rs b/src/test/run-fail/fail.rs
index a0520c288a4..75e6f7e886e 100644
--- a/src/test/run-fail/fail.rs
+++ b/src/test/run-fail/fail.rs
@@ -2,4 +2,4 @@
 
 
 // error-pattern:1 == 2
-fn main() { assert (1 == 2); }
\ No newline at end of file
+fn main() { assert (1 == 2); }
diff --git a/src/test/run-fail/fmt-fail.rs b/src/test/run-fail/fmt-fail.rs
index d4eb12292a6..2d3e35b41af 100644
--- a/src/test/run-fail/fmt-fail.rs
+++ b/src/test/run-fail/fmt-fail.rs
@@ -3,4 +3,4 @@
 use std;
 import std::str;
 
-fn main() { let str_var: str = "meh"; fail #fmt("%s", str_var); }
\ No newline at end of file
+fn main() { let str_var: str = "meh"; fail #fmt["%s", str_var]; }
diff --git a/src/test/run-fail/fn-constraint-claim.rs b/src/test/run-fail/fn-constraint-claim.rs
index ca243210647..a5309b61627 100644
--- a/src/test/run-fail/fn-constraint-claim.rs
+++ b/src/test/run-fail/fn-constraint-claim.rs
@@ -5,9 +5,4 @@ import std::uint::*;
 
 fn nop(a: uint, b: uint) : le(a, b) { fail "quux"; }
 
-fn main() {
-    let a: uint = 5u;
-    let b: uint = 4u;
-    claim (le(a, b));
-    nop(a, b);
-}
+fn main() { let a: uint = 5u; let b: uint = 4u; claim (le(a, b)); nop(a, b); }
diff --git a/src/test/run-fail/fn-constraint.rs b/src/test/run-fail/fn-constraint.rs
index 65bcc413498..3499d44ceff 100644
--- a/src/test/run-fail/fn-constraint.rs
+++ b/src/test/run-fail/fn-constraint.rs
@@ -8,4 +8,4 @@ fn main() {
     let b: uint = 1u;
     check (le(a, b));
     log_err safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-fail/if-check-fail.rs b/src/test/run-fail/if-check-fail.rs
index 677240d0763..885c92deab8 100644
--- a/src/test/run-fail/if-check-fail.rs
+++ b/src/test/run-fail/if-check-fail.rs
@@ -2,9 +2,9 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn foo(x: uint) { if check even(x) { log x; } else { fail "Number is odd"; } }
 
-fn main() { foo(3u); }
\ No newline at end of file
+fn main() { foo(3u); }
diff --git a/src/test/run-fail/non-exhaustive-match.rs b/src/test/run-fail/non-exhaustive-match.rs
index e62d0692d4f..4afd83c1b97 100644
--- a/src/test/run-fail/non-exhaustive-match.rs
+++ b/src/test/run-fail/non-exhaustive-match.rs
@@ -6,4 +6,4 @@
 // error-pattern:non-exhaustive match failure
 tag t { a; b; }
 
-fn main() { let x = a; alt x { b. { } } }
\ No newline at end of file
+fn main() { let x = a; alt x { b. { } } }
diff --git a/src/test/run-fail/pred.rs b/src/test/run-fail/pred.rs
index 14e46976113..a2f9420825c 100644
--- a/src/test/run-fail/pred.rs
+++ b/src/test/run-fail/pred.rs
@@ -4,4 +4,4 @@ fn f(a: int, b: int) { }
 
 pred lt(a: int, b: int) -> bool { ret a < b; }
 
-fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); }
\ No newline at end of file
+fn main() { let a: int = 10; let b: int = 23; check (lt(b, a)); f(b, a); }
diff --git a/src/test/run-fail/rhs-type.rs b/src/test/run-fail/rhs-type.rs
index 0277d83d393..461b2c65b44 100644
--- a/src/test/run-fail/rhs-type.rs
+++ b/src/test/run-fail/rhs-type.rs
@@ -1,4 +1,4 @@
 // Tests that trans treats the rhs of pth's decl
 // as a _|_-typed thing, not a str-typed thing
 // error-pattern:bye
-fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; }
\ No newline at end of file
+fn main() { let pth = fail "bye"; let rs: {t: str} = {t: pth}; }
diff --git a/src/test/run-fail/str-overrun.rs b/src/test/run-fail/str-overrun.rs
index 1ac862f2405..3d12bce20c9 100644
--- a/src/test/run-fail/str-overrun.rs
+++ b/src/test/run-fail/str-overrun.rs
@@ -7,12 +7,12 @@
 fn main() {
     let s: str = "hello";
     let x: int = 0;
-    assert (s.(x) == 0x68 as u8);
+    assert (s[x] == 0x68 as u8);
     // NB: at the moment a string always has a trailing NULL,
     // so the largest index value on the string above is 5, not
     // 4. Possibly change this.
 
     // Bounds-check failure.
 
-    assert (s.(x + 6) == 0x0 as u8);
-}
\ No newline at end of file
+    assert (s[x + 6] == 0x0 as u8);
+}
diff --git a/src/test/run-fail/vec-overrun.rs b/src/test/run-fail/vec-overrun.rs
index 28349f27a50..54329ca63b5 100644
--- a/src/test/run-fail/vec-overrun.rs
+++ b/src/test/run-fail/vec-overrun.rs
@@ -3,10 +3,10 @@
 // error-pattern:bounds check
 // no-valgrind
 fn main() {
-    let v: [int] = ~[10];
+    let v: [int] = [10];
     let x: int = 0;
-    assert (v.(x) == 10);
+    assert (v[x] == 10);
     // Bounds-check failure.
 
-    assert (v.(x + 2) == 20);
+    assert (v[x + 2] == 20);
 }
diff --git a/src/test/run-fail/vec-underrun.rs b/src/test/run-fail/vec-underrun.rs
index 41eb94ca739..87c8295840e 100644
--- a/src/test/run-fail/vec-underrun.rs
+++ b/src/test/run-fail/vec-underrun.rs
@@ -3,10 +3,10 @@
 // error-pattern:bounds check
 // no-valgrind
 fn main() {
-    let v: [int] = ~[10, 20];
+    let v: [int] = [10, 20];
     let x: int = 0;
-    assert (v.(x) == 10);
+    assert (v[x] == 10);
     // Bounds-check failure.
 
-    assert (v.(x - 1) == 20);
+    assert (v[x - 1] == 20);
 }
diff --git a/src/test/run-pass/alloca-from-derived-tydesc.rs b/src/test/run-pass/alloca-from-derived-tydesc.rs
index 00371d3567d..6077bbf6723 100644
--- a/src/test/run-pass/alloca-from-derived-tydesc.rs
+++ b/src/test/run-pass/alloca-from-derived-tydesc.rs
@@ -2,6 +2,6 @@ tag option<T> { some(T); none; }
 
 type r<T> = {mutable v: [option<T>]};
 
-fn f<T>() -> [T] { ret ~[]; }
+fn f<T>() -> [T] { ret []; }
 
-fn main() { let r: r<int> = {mutable v: ~[]}; r.v = f(); }
+fn main() { let r: r<int> = {mutable v: []}; r.v = f(); }
diff --git a/src/test/run-pass/alt-bot.rs b/src/test/run-pass/alt-bot.rs
index a5369804d00..6949d727f59 100644
--- a/src/test/run-pass/alt-bot.rs
+++ b/src/test/run-pass/alt-bot.rs
@@ -2,9 +2,7 @@ use std;
 import std::option::*;
 
 fn main() {
-    let i: int = alt some::<int>(3) {
-        none::<int>. { fail }
-        some::<int>(_) { 5 }
-    };
+    let i: int =
+        alt some::<int>(3) { none::<int>. { fail } some::<int>(_) { 5 } };
     log i;
 }
diff --git a/src/test/run-pass/alt-join.rs b/src/test/run-pass/alt-join.rs
index 423d08fc66a..4d1be53cdf3 100644
--- a/src/test/run-pass/alt-join.rs
+++ b/src/test/run-pass/alt-join.rs
@@ -7,12 +7,12 @@ import std::option::some;
 
 fn foo<T>(y: &option::t<T>) {
     let x: int;
-    let rs: [int] = ~[];
+    let rs: [int] = [];
     /* tests that x doesn't get put in the precondition for the
        entire if expression */
 
     if true {
-    } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += ~[x]; }
+    } else { alt y { none::<T>. { x = 17; } _ { x = 42; } } rs += [x]; }
     ret;
 }
 
diff --git a/src/test/run-pass/alt-path.rs b/src/test/run-pass/alt-path.rs
index 9f37cd2585c..84d79220f90 100644
--- a/src/test/run-pass/alt-path.rs
+++ b/src/test/run-pass/alt-path.rs
@@ -6,4 +6,4 @@ mod m1 {
 
 fn bar(x: m1::foo) { alt x { m1::foo1. { } } }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/alt-pattern-drop.rs b/src/test/run-pass/alt-pattern-drop.rs
index af0c615f53f..d3fb0715b4d 100644
--- a/src/test/run-pass/alt-pattern-drop.rs
+++ b/src/test/run-pass/alt-pattern-drop.rs
@@ -32,4 +32,4 @@ fn main() {
 
     log str::refcount(s);
     assert (str::refcount(s) == const_refcount);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/alt-pattern-lit.rs b/src/test/run-pass/alt-pattern-lit.rs
index 3dc7bae1ea9..1f544495d88 100644
--- a/src/test/run-pass/alt-pattern-lit.rs
+++ b/src/test/run-pass/alt-pattern-lit.rs
@@ -4,4 +4,4 @@ fn altlit(f: int) -> int {
     alt f { 10 { log "case 10"; ret 20; } 11 { log "case 11"; ret 22; } }
 }
 
-fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); }
\ No newline at end of file
+fn main() { assert (altlit(10) == 20); assert (altlit(11) == 22); }
diff --git a/src/test/run-pass/alt-pattern-simple.rs b/src/test/run-pass/alt-pattern-simple.rs
index 1d02eb64a82..e29cd72ac77 100644
--- a/src/test/run-pass/alt-pattern-simple.rs
+++ b/src/test/run-pass/alt-pattern-simple.rs
@@ -2,4 +2,4 @@
 
 fn altsimple(f: int) { alt f { x { } } }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/alt-str.rs b/src/test/run-pass/alt-str.rs
index 8fd15eb76af..fbdf7fdbfe3 100644
--- a/src/test/run-pass/alt-str.rs
+++ b/src/test/run-pass/alt-str.rs
@@ -12,4 +12,4 @@ fn main() {
       tag1("test") { }
       _ { fail; }
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/alt-tag.rs b/src/test/run-pass/alt-tag.rs
index 3bdc4b3a528..6a3606d6dc3 100644
--- a/src/test/run-pass/alt-tag.rs
+++ b/src/test/run-pass/alt-tag.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (process(gray) == 127);
     assert (process(clear) == 0);
     assert (process(red) == 255);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-backwarding-2.rs b/src/test/run-pass/anon-obj-backwarding-2.rs
index 3a806a6e399..039d25be381 100644
--- a/src/test/run-pass/anon-obj-backwarding-2.rs
+++ b/src/test/run-pass/anon-obj-backwarding-2.rs
@@ -9,15 +9,17 @@ fn main() {
 
     let my_a = a();
 
-    let my_b = obj () {
-        fn baz() -> int { ret self.foo(); }
-        with my_a
-    };
+    let my_b =
+        obj () {
+            fn baz() -> int { ret self.foo(); }
+            with
+            my_a
+        };
 
-    assert my_a.foo() == 2;
-    assert my_a.bar() == 2;
-    assert my_b.foo() == 2;
-    assert my_b.baz() == 2;
-    assert my_b.bar() == 2;
+    assert (my_a.foo() == 2);
+    assert (my_a.bar() == 2);
+    assert (my_b.foo() == 2);
+    assert (my_b.baz() == 2);
+    assert (my_b.bar() == 2);
 
 }
diff --git a/src/test/run-pass/anon-obj-cats.rs b/src/test/run-pass/anon-obj-cats.rs
index ca093f0cb9b..c1024afc6ec 100644
--- a/src/test/run-pass/anon-obj-cats.rs
+++ b/src/test/run-pass/anon-obj-cats.rs
@@ -3,42 +3,34 @@ fn main() {
     // The Internet made me do it.
 
     obj cat() {
-        fn ack() -> str {
-            ret "ack";
-        }
-        fn meow() -> str {
-            ret "meow";
-        }
-        fn zzz() -> str {
-            ret self.meow();
-        }
+        fn ack() -> str { ret "ack"; }
+        fn meow() -> str { ret "meow"; }
+        fn zzz() -> str { ret self.meow(); }
     }
 
     let shortcat = cat();
 
-    let longcat = obj() {
-        fn lol() -> str {
-            ret "lol";
-        }
-        fn nyan() -> str {
-            ret "nyan";
-        }
-        with shortcat
-    };
-
-    let longercat = obj() {
-        fn meow() -> str {
-            ret "zzz";
-        }
-        with shortcat
-    };
-
-    let evenlongercat = obj() {
-        fn meow() -> str {
-            ret "zzzzzz";
-        }
-        with longercat
-    };
+    let longcat =
+        obj () {
+            fn lol() -> str { ret "lol"; }
+            fn nyan() -> str { ret "nyan"; }
+            with
+            shortcat
+        };
+
+    let longercat =
+        obj () {
+            fn meow() -> str { ret "zzz"; }
+            with
+            shortcat
+        };
+
+    let evenlongercat =
+        obj () {
+            fn meow() -> str { ret "zzzzzz"; }
+            with
+            longercat
+        };
 
     // Tests self-call.
     assert (shortcat.zzz() == "meow");
diff --git a/src/test/run-pass/anon-obj-degenerate.rs b/src/test/run-pass/anon-obj-degenerate.rs
index d4870fc3d78..c9c47e29008 100644
--- a/src/test/run-pass/anon-obj-degenerate.rs
+++ b/src/test/run-pass/anon-obj-degenerate.rs
@@ -17,4 +17,4 @@ fn main() {
     assert (my_d.foo() == 2);
     assert (my_d.bar() == 2);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
index 423196dac82..3e782ce56de 100644
--- a/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
+++ b/src/test/run-pass/anon-obj-no-inner-obj-simple.rs
@@ -3,36 +3,41 @@ use std;
 fn main() {
 
     // Anonymous object that doesn't extend an existing one.
-    let my_obj = obj() {
-        fn foo() -> int { ret 2; }
-        fn bar() -> int { ret 3; }
-        fn baz() -> str { "hello!" }
-    };
+    let my_obj =
+        obj () {
+            fn foo() -> int { ret 2; }
+            fn bar() -> int { ret 3; }
+            fn baz() -> str { "hello!" }
+        };
 
-    assert my_obj.foo() == 2;
-    assert my_obj.bar() == 3;
-    assert my_obj.baz() == "hello!";
+    assert (my_obj.foo() == 2);
+    assert (my_obj.bar() == 3);
+    assert (my_obj.baz() == "hello!");
 
     // Make sure the result is extendable.
-    let my_ext_obj = obj() {
-        fn foo() -> int { ret 3; }
-        fn quux() -> str { ret self.baz(); }
-        with my_obj
-    };
+    let my_ext_obj =
+        obj () {
+            fn foo() -> int { ret 3; }
+            fn quux() -> str { ret self.baz(); }
+            with
+            my_obj
+        };
 
-    assert my_ext_obj.foo() == 3;
-    assert my_ext_obj.bar() == 3;
-    assert my_ext_obj.baz() == "hello!";
-    assert my_ext_obj.quux() == "hello!";
+    assert (my_ext_obj.foo() == 3);
+    assert (my_ext_obj.bar() == 3);
+    assert (my_ext_obj.baz() == "hello!");
+    assert (my_ext_obj.quux() == "hello!");
 
     // And again.
-    let my_ext_ext_obj = obj() {
-        fn baz() -> str { "world!" }
-        with my_ext_obj
-    };
+    let my_ext_ext_obj =
+        obj () {
+            fn baz() -> str { "world!" }
+            with
+            my_ext_obj
+        };
 
-    assert my_ext_ext_obj.foo() == 3;
-    assert my_ext_ext_obj.bar() == 3;
-    assert my_ext_ext_obj.baz() == "world!";
-    assert my_ext_ext_obj.quux() == "world!";
+    assert (my_ext_ext_obj.foo() == 3);
+    assert (my_ext_ext_obj.bar() == 3);
+    assert (my_ext_ext_obj.baz() == "world!");
+    assert (my_ext_ext_obj.quux() == "world!");
 }
diff --git a/src/test/run-pass/anon-obj-overriding-reduced.rs b/src/test/run-pass/anon-obj-overriding-reduced.rs
index df1b700de56..3eb7c72d864 100644
--- a/src/test/run-pass/anon-obj-overriding-reduced.rs
+++ b/src/test/run-pass/anon-obj-overriding-reduced.rs
@@ -15,4 +15,4 @@ fn main() {
         };
 
     assert (my_b.foo() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-overriding.rs b/src/test/run-pass/anon-obj-overriding.rs
index 19860158ce4..e9551900b26 100644
--- a/src/test/run-pass/anon-obj-overriding.rs
+++ b/src/test/run-pass/anon-obj-overriding.rs
@@ -36,4 +36,4 @@ fn main() {
 
     assert (my_c.baz(1, 2) == 6);
     assert (my_d.baz(1, 2) == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-with-self-call-2.rs b/src/test/run-pass/anon-obj-with-self-call-2.rs
index 69153ac567b..807f1275d8a 100644
--- a/src/test/run-pass/anon-obj-with-self-call-2.rs
+++ b/src/test/run-pass/anon-obj-with-self-call-2.rs
@@ -13,4 +13,4 @@ fn main() {
         };
 
     assert (my_b.baz() == 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/anon-obj-with-self-call.rs b/src/test/run-pass/anon-obj-with-self-call.rs
index 2944bc0b595..76faa9decc4 100644
--- a/src/test/run-pass/anon-obj-with-self-call.rs
+++ b/src/test/run-pass/anon-obj-with-self-call.rs
@@ -28,4 +28,4 @@ fn main() {
 
     assert (my_c.baz() == 3);
     assert (my_c.bar() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs
index b0feeff2232..0bb536086ba 100644
--- a/src/test/run-pass/argv.rs
+++ b/src/test/run-pass/argv.rs
@@ -1,5 +1,5 @@
 fn main(args: [str]) {
-    let vs: [str] = ~["hi", "there", "this", "is", "a", "vec"];
-    let vvs: [[str]] = ~[args, vs];
+    let vs: [str] = ["hi", "there", "this", "is", "a", "vec"];
+    let vvs: [[str]] = [args, vs];
     for vs: [str] in vvs { for s: str in vs { log s; } }
 }
diff --git a/src/test/run-pass/arith-0.rs b/src/test/run-pass/arith-0.rs
index 6ad797982e6..7c77d25e4c0 100644
--- a/src/test/run-pass/arith-0.rs
+++ b/src/test/run-pass/arith-0.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); }
\ No newline at end of file
+fn main() { let a: int = 10; log a; assert (a * (a - 1) == 90); }
diff --git a/src/test/run-pass/arith-1.rs b/src/test/run-pass/arith-1.rs
index 0f907de0a6f..b9d61493ecf 100644
--- a/src/test/run-pass/arith-1.rs
+++ b/src/test/run-pass/arith-1.rs
@@ -20,4 +20,4 @@ fn main() {
     assert (i32_b & i32_b << 1 == 0);
     log i32_b | i32_b << 1;
     assert (i32_b | i32_b << 1 == 0x30303030);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/arith-2.rs b/src/test/run-pass/arith-2.rs
index bb0f67499a2..b55c66f8462 100644
--- a/src/test/run-pass/arith-2.rs
+++ b/src/test/run-pass/arith-2.rs
@@ -4,4 +4,4 @@ fn main() {
     let i32_c: int = 0x10101010;
     assert (i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3) ==
                 i32_c + i32_c * 2 / 3 * 2 + (i32_c - 7 % 3));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/arith-unsigned.rs b/src/test/run-pass/arith-unsigned.rs
index 75f7549b994..24433d49ebc 100644
--- a/src/test/run-pass/arith-unsigned.rs
+++ b/src/test/run-pass/arith-unsigned.rs
@@ -23,4 +23,4 @@ fn main() {
     assert (4000000005u32 % 10u32 == 5u32);
     // 64-bit numbers have some flakiness yet. Not tested
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/artificial-block.rs b/src/test/run-pass/artificial-block.rs
index 3944a0e9da5..87c7cc149f6 100644
--- a/src/test/run-pass/artificial-block.rs
+++ b/src/test/run-pass/artificial-block.rs
@@ -1,3 +1,3 @@
 fn f() -> int { { ret 3; } }
 
-fn main() { assert (f() == 3); }
\ No newline at end of file
+fn main() { assert (f() == 3); }
diff --git a/src/test/run-pass/assign-assign.rs b/src/test/run-pass/assign-assign.rs
index cdf5a6f18bd..fffb35e81fb 100644
--- a/src/test/run-pass/assign-assign.rs
+++ b/src/test/run-pass/assign-assign.rs
@@ -19,4 +19,4 @@ fn test_assign_op() {
     assert (x == 33);
 }
 
-fn main() { test_assign(); test_assign_op(); }
\ No newline at end of file
+fn main() { test_assign(); test_assign_op(); }
diff --git a/src/test/run-pass/auto-deref-fn.rs b/src/test/run-pass/auto-deref-fn.rs
index 717d79ad18e..caff3f29fbc 100644
--- a/src/test/run-pass/auto-deref-fn.rs
+++ b/src/test/run-pass/auto-deref-fn.rs
@@ -7,4 +7,4 @@ fn main() {
     assert (g(8) == 9);
     assert (h(0x1badd00d) == 0x1badd00e);
     assert ((@add1)(42) == 43);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/auto-loop.rs b/src/test/run-pass/auto-loop.rs
index b4ea2f5dedc..6e83d2ca0aa 100644
--- a/src/test/run-pass/auto-loop.rs
+++ b/src/test/run-pass/auto-loop.rs
@@ -1,5 +1,5 @@
 fn main() {
     let sum = 0;
-    for x in ~[1, 2, 3, 4, 5] { sum += x; }
+    for x in [1, 2, 3, 4, 5] { sum += x; }
     assert (sum == 15);
 }
diff --git a/src/test/run-pass/autobind.rs b/src/test/run-pass/autobind.rs
index f8a0f8e3ee7..536db525d5c 100644
--- a/src/test/run-pass/autobind.rs
+++ b/src/test/run-pass/autobind.rs
@@ -1,9 +1,9 @@
-fn f<T>(x: &[T]) -> T { ret x.(0); }
+fn f<T>(x: &[T]) -> T { ret x[0]; }
 
-fn g(act: fn(&[int]) -> int ) -> int { ret act(~[1, 2, 3]); }
+fn g(act: fn(&[int]) -> int) -> int { ret act([1, 2, 3]); }
 
 fn main() {
     assert (g(f) == 1);
-    let f1: fn(&[str]) -> str  = f;
-    assert (f1(~["x", "y", "z"]) == "x");
+    let f1: fn(&[str]) -> str = f;
+    assert (f1(["x", "y", "z"]) == "x");
 }
diff --git a/src/test/run-pass/autoderef-objfn.rs b/src/test/run-pass/autoderef-objfn.rs
index cf7bb394b4c..430293989a0 100644
--- a/src/test/run-pass/autoderef-objfn.rs
+++ b/src/test/run-pass/autoderef-objfn.rs
@@ -8,4 +8,4 @@ obj clam() {
 
 fn foo(c: @clam) { c.chowder(); }
 
-fn main() { let c: clam = clam(); foo(@c); }
\ No newline at end of file
+fn main() { let c: clam = clam(); foo(@c); }
diff --git a/src/test/run-pass/bind-interior.rs b/src/test/run-pass/bind-interior.rs
index ab3ce3b5e9f..639077a72c0 100644
--- a/src/test/run-pass/bind-interior.rs
+++ b/src/test/run-pass/bind-interior.rs
@@ -5,7 +5,7 @@
 fn f(n: int) -> int { ret n; }
 
 fn main() {
-    let g: fn() -> int  = bind f(10);
+    let g: fn() -> int = bind f(10);
     let i: int = g();
     assert (i == 10);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-obj-ctor.rs b/src/test/run-pass/bind-obj-ctor.rs
index 6be4df99abc..a76b17cc10a 100644
--- a/src/test/run-pass/bind-obj-ctor.rs
+++ b/src/test/run-pass/bind-obj-ctor.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (obj0.sum() == 3);
     assert (obj1.sum() == 3);
     assert (obj2.sum() == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-parameterized-args-2.rs b/src/test/run-pass/bind-parameterized-args-2.rs
index 3646b8ba691..68d47073413 100644
--- a/src/test/run-pass/bind-parameterized-args-2.rs
+++ b/src/test/run-pass/bind-parameterized-args-2.rs
@@ -3,5 +3,5 @@ fn main() {
 
     let y = bind echo(42, _);
 
-    y(fn(i: &str){});
+    y(fn (i: &str) { });
 }
diff --git a/src/test/run-pass/bind-parameterized-args.rs b/src/test/run-pass/bind-parameterized-args.rs
index 53b8f85ea49..1f3e8efbf37 100644
--- a/src/test/run-pass/bind-parameterized-args.rs
+++ b/src/test/run-pass/bind-parameterized-args.rs
@@ -1,7 +1,7 @@
 fn main() {
     fn echo<T>(c: int, x: &[T]) { }
 
-    let y: fn(&[int])  = bind echo(42, _);
+    let y: fn(&[int]) = bind echo(42, _);
 
-    y(~[1]);
+    y([1]);
 }
diff --git a/src/test/run-pass/bind-thunk.rs b/src/test/run-pass/bind-thunk.rs
index e70fa6fdd6c..a85c7fc9679 100644
--- a/src/test/run-pass/bind-thunk.rs
+++ b/src/test/run-pass/bind-thunk.rs
@@ -5,7 +5,7 @@
 fn f() -> int { ret 42; }
 
 fn main() {
-    let g: fn() -> int  = bind f();
+    let g: fn() -> int = bind f();
     let i: int = g();
     assert (i == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/bind-trivial.rs b/src/test/run-pass/bind-trivial.rs
index 35ed5d7477f..20b217c1046 100644
--- a/src/test/run-pass/bind-trivial.rs
+++ b/src/test/run-pass/bind-trivial.rs
@@ -5,7 +5,7 @@
 fn f(n: int) -> int { ret n; }
 
 fn main() {
-    let g: fn(int) -> int  = bind f(_);
+    let g: fn(int) -> int = bind f(_);
     let i: int = g(42);
     assert (i == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/binops.rs b/src/test/run-pass/binops.rs
index dfb02f70e7e..f676e6a3b11 100644
--- a/src/test/run-pass/binops.rs
+++ b/src/test/run-pass/binops.rs
@@ -64,8 +64,8 @@ fn test_port() {
     let p1 = comm::mk_port::<int>();
     let p2 = comm::mk_port::<int>();
 
-    assert p1 == p1;
-    assert p1 != p2;
+    assert (p1 == p1);
+    assert (p1 != p2);
 }
 
 fn test_chan() {
@@ -73,9 +73,9 @@ fn test_chan() {
     let ch1 = p.mk_chan();
     let ch2 = p.mk_chan();
 
-    assert ch1 == ch1;
+    assert (ch1 == ch1);
     // Chans are equal because they are just task:port addresses.
-    assert ch1 == ch2;
+    assert (ch1 == ch2);
 }
 
 fn test_ptr() {
@@ -89,8 +89,8 @@ fn test_task() {
     let t1 = task::spawn(f1);
     let t2 = task::spawn(f2);
 
-    assert t1 == t1;
-    assert t1 != t2;
+    assert (t1 == t1);
+    assert (t1 != t2);
 }
 
 fn test_fn() {
@@ -128,8 +128,8 @@ fn test_native_fn() {
 }
 
 fn test_obj() {
-    let o1 = obj () {  };
-    let o2 = obj () {  };
+    let o1 = obj () { };
+    let o2 = obj () { };
 
     assert (o1 == o1);
 
diff --git a/src/test/run-pass/bitwise.rs b/src/test/run-pass/bitwise.rs
index 0d41cb0c303..afe16cf113f 100644
--- a/src/test/run-pass/bitwise.rs
+++ b/src/test/run-pass/bitwise.rs
@@ -19,4 +19,4 @@ fn main() {
     assert (-16 >>> 2 == -4);
     assert (0b1010_1010 | 0b0101_0101 == 0xff);
     assert (-1000 >> 3 == 536870787);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/block-fn-coerce.rs b/src/test/run-pass/block-fn-coerce.rs
index c9dd29f7d00..163d99ee5d6 100644
--- a/src/test/run-pass/block-fn-coerce.rs
+++ b/src/test/run-pass/block-fn-coerce.rs
@@ -1,7 +1,7 @@
-fn force(f: &block() -> int ) -> int { ret f(); }
+fn force(f: &block() -> int) -> int { ret f(); }
 fn main() {
     let f = fn () -> int { ret 7 };
     assert (force(f) == 7);
     let g = bind force(f);
     assert (g() == 7);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/block-iter-1.rs b/src/test/run-pass/block-iter-1.rs
index 47c728af36d..006d4f18fe4 100644
--- a/src/test/run-pass/block-iter-1.rs
+++ b/src/test/run-pass/block-iter-1.rs
@@ -1,14 +1,10 @@
-fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } }
+fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } }
 
 fn main() {
-    let v = ~[1, 2, 3, 4, 5, 6, 7];
+    let v = [1, 2, 3, 4, 5, 6, 7];
     let odds = 0;
     iter_vec(v,
-             {|&i|
-                 log_err i;
-                 if i % 2 == 1 { odds += 1; }
-                 log_err odds;
-             });
+             {|&i| log_err i; if i % 2 == 1 { odds += 1; } log_err odds; });
     log_err odds;
     assert (odds == 4);
 }
diff --git a/src/test/run-pass/block-iter-2.rs b/src/test/run-pass/block-iter-2.rs
index a6d9455e3f1..d49cffbcc72 100644
--- a/src/test/run-pass/block-iter-2.rs
+++ b/src/test/run-pass/block-iter-2.rs
@@ -1,12 +1,9 @@
-fn iter_vec<T>(v: &[T], f: &block(&T) ) { for x: T in v { f(x); } }
+fn iter_vec<T>(v: &[T], f: &block(&T)) { for x: T in v { f(x); } }
 
 fn main() {
-    let v = ~[1, 2, 3, 4, 5];
+    let v = [1, 2, 3, 4, 5];
     let sum = 0;
-    iter_vec(v,
-             {|&i|
-                 iter_vec(v, {|&j| log_err i * j; sum += i * j; });
-             });
+    iter_vec(v, {|&i| iter_vec(v, {|&j| log_err i * j; sum += i * j; }); });
     log_err sum;
     assert (sum == 225);
 }
diff --git a/src/test/run-pass/block-vec-map2.rs b/src/test/run-pass/block-vec-map2.rs
index 5153a81d1c7..35b979b3694 100644
--- a/src/test/run-pass/block-vec-map2.rs
+++ b/src/test/run-pass/block-vec-map2.rs
@@ -2,9 +2,9 @@ use std;
 import std::vec;
 
 fn main() {
-    let v = std::vec::map2({|&i, &b| if b { -i } else { i }},
-                           ~[1, 2, 3, 4, 5],
-                           ~[true, false, false, true, true]);
+    let v =
+        std::vec::map2({|&i, &b| if b { -i } else { i } }, [1, 2, 3, 4, 5],
+                       [true, false, false, true, true]);
     log_err v;
-    assert v == ~[-1, 2, 3, -4, -5];
+    assert (v == [-1, 2, 3, -4, -5]);
 }
diff --git a/src/test/run-pass/bool-not.rs b/src/test/run-pass/bool-not.rs
index 9d609d44efd..5e38e974c1a 100644
--- a/src/test/run-pass/bool-not.rs
+++ b/src/test/run-pass/bool-not.rs
@@ -5,4 +5,4 @@
 fn main() {
     if !false { assert (true); } else { assert (false); }
     if !true { assert (false); } else { assert (true); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box-compare.rs b/src/test/run-pass/box-compare.rs
index e3a93520d4a..51eeb6e8eb7 100644
--- a/src/test/run-pass/box-compare.rs
+++ b/src/test/run-pass/box-compare.rs
@@ -4,4 +4,4 @@ fn main() {
     assert (@1 < @3);
     assert (@@"hello " > @@"hello");
     assert (@@@"hello" != @@@"there");
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box-in-tup.rs b/src/test/run-pass/box-in-tup.rs
index aa2d6a596e1..0f75897a337 100644
--- a/src/test/run-pass/box-in-tup.rs
+++ b/src/test/run-pass/box-in-tup.rs
@@ -1,4 +1 @@
-fn main() {
-    let i: (@int, int) = (@10, 10);
-    let (a, _) = i;
-}
\ No newline at end of file
+fn main() { let i: (@int, int) = (@10, 10); let (a, _) = i; }
diff --git a/src/test/run-pass/box-pattern.rs b/src/test/run-pass/box-pattern.rs
index 6c20cdd805d..973d7e303b9 100644
--- a/src/test/run-pass/box-pattern.rs
+++ b/src/test/run-pass/box-pattern.rs
@@ -6,4 +6,4 @@ fn main() {
               u(@{a: a, b: b}) { a + (b as int) }
               _ { 66 }
             } == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/box.rs b/src/test/run-pass/box.rs
index c9ef392e347..c3dee8ed5ea 100644
--- a/src/test/run-pass/box.rs
+++ b/src/test/run-pass/box.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: @int = @10; assert (*x == 10); }
\ No newline at end of file
+fn main() { let x: @int = @10; assert (*x == 10); }
diff --git a/src/test/run-pass/break-value.rs b/src/test/run-pass/break-value.rs
index 9db96e85782..764d03bdf22 100644
--- a/src/test/run-pass/break-value.rs
+++ b/src/test/run-pass/break-value.rs
@@ -1,3 +1,3 @@
 fn int_id(x: int) -> int { ret x; }
 
-fn main() { while true { int_id(break); } }
\ No newline at end of file
+fn main() { while true { int_id(break); } }
diff --git a/src/test/run-pass/break.rs b/src/test/run-pass/break.rs
index d53445ef586..962c360ca7b 100644
--- a/src/test/run-pass/break.rs
+++ b/src/test/run-pass/break.rs
@@ -6,15 +6,12 @@ fn main() {
     assert (i == 10);
     do  { i += 1; if i == 20 { break; } } while i < 30
     assert (i == 20);
-    for x: int in ~[1, 2, 3, 4, 5, 6] {
-        if x == 3 { break; }
-        assert (x <= 3);
-    }
+    for x: int in [1, 2, 3, 4, 5, 6] { if x == 3 { break; } assert (x <= 3); }
     i = 0;
     while i < 10 { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); }
     i = 0;
     do  { i += 1; if i % 2 == 0 { cont; } assert (i % 2 != 0); } while i < 10
-    for x: int in ~[1, 2, 3, 4, 5, 6] {
+    for x: int in [1, 2, 3, 4, 5, 6] {
         if x % 2 == 0 { cont; }
         assert (x % 2 != 0);
     }
diff --git a/src/test/run-pass/call-autoderef-tag.rs b/src/test/run-pass/call-autoderef-tag.rs
index 6cc87ae7b95..f978092ca95 100644
--- a/src/test/run-pass/call-autoderef-tag.rs
+++ b/src/test/run-pass/call-autoderef-tag.rs
@@ -1,5 +1,5 @@
-tag int_fn { f(fn(int) -> int ); }
-tag int_box_fn { fb(@fn(int) -> int ); }
+tag int_fn { f(fn(int) -> int); }
+tag int_box_fn { fb(@fn(int) -> int); }
 fn add1(i: int) -> int { ret i + 1; }
 fn main() {
     let g = f(add1);
@@ -7,4 +7,4 @@ fn main() {
     assert (f(add1)(5) == 6);
     assert ((@f(add1))(5) == 6);
     assert (fb(@add1)(7) == 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/cast.rs b/src/test/run-pass/cast.rs
index 38a4ca72a1a..6d1560305d6 100644
--- a/src/test/run-pass/cast.rs
+++ b/src/test/run-pass/cast.rs
@@ -13,4 +13,4 @@ fn main() {
     assert (0x51 as char == 'Q');
     assert (true == 1 as bool);
     assert (0 as u32 == false as u32);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/chan-leak.rs b/src/test/run-pass/chan-leak.rs
index 39e445b47ec..e08bfbd28ed 100644
--- a/src/test/run-pass/chan-leak.rs
+++ b/src/test/run-pass/chan-leak.rs
@@ -7,10 +7,7 @@ import std::comm::send;
 import std::comm;
 import std::comm::mk_port;
 
-tag request {
-  quit;
-  close(_chan<bool>);
-}
+tag request { quit; close(_chan<bool>); }
 
 type ctx = _chan<request>;
 
diff --git a/src/test/run-pass/char.rs b/src/test/run-pass/char.rs
index 8383a3d36fc..2783c05200f 100644
--- a/src/test/run-pass/char.rs
+++ b/src/test/run-pass/char.rs
@@ -10,4 +10,4 @@ fn main() {
     assert (d == c);
     assert (d == 'x');
     assert ('x' == d);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/child-outlives-parent.rs b/src/test/run-pass/child-outlives-parent.rs
index d6b48ccb131..2da34466cdb 100644
--- a/src/test/run-pass/child-outlives-parent.rs
+++ b/src/test/run-pass/child-outlives-parent.rs
@@ -5,4 +5,4 @@ import std::task;
 
 fn child2(s: str) { }
 
-fn main() { let x = task::_spawn(bind child2("hi")); }
\ No newline at end of file
+fn main() { let x = task::_spawn(bind child2("hi")); }
diff --git a/src/test/run-pass/claim-nonterm.rs b/src/test/run-pass/claim-nonterm.rs
index 6b555f1bc59..770beeb9fbf 100644
--- a/src/test/run-pass/claim-nonterm.rs
+++ b/src/test/run-pass/claim-nonterm.rs
@@ -5,4 +5,4 @@ import std::uint::*;
 
 pred fails(a: uint) -> bool { fail; }
 
-fn main() { let b: uint = 4u; claim (fails(b)); }
\ No newline at end of file
+fn main() { let b: uint = 4u; claim (fails(b)); }
diff --git a/src/test/run-pass/command-line-args.rs b/src/test/run-pass/command-line-args.rs
index 429bea89771..efd5d2bb04c 100644
--- a/src/test/run-pass/command-line-args.rs
+++ b/src/test/run-pass/command-line-args.rs
@@ -1,3 +1,3 @@
 
 
-fn main(args: [str]) { log args.(0); }
+fn main(args: [str]) { log args[0]; }
diff --git a/src/test/run-pass/complex.rs b/src/test/run-pass/complex.rs
index cc5d8d3acb7..1b14e7ab7f5 100644
--- a/src/test/run-pass/complex.rs
+++ b/src/test/run-pass/complex.rs
@@ -25,4 +25,4 @@ fn foo(x: int) -> int {
     ret 0;
 }
 
-fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; }
\ No newline at end of file
+fn main() { let x: int = 2 + 2; log x; log "hello, world"; log 10; }
diff --git a/src/test/run-pass/const.rs b/src/test/run-pass/const.rs
index d181c49484b..b96ae6f7360 100644
--- a/src/test/run-pass/const.rs
+++ b/src/test/run-pass/const.rs
@@ -2,4 +2,4 @@
 
 const i: int = 10;
 
-fn main() { log i; }
\ No newline at end of file
+fn main() { log i; }
diff --git a/src/test/run-pass/constrained-type.rs b/src/test/run-pass/constrained-type.rs
index 96ab84cb53d..d05e4311dbf 100644
--- a/src/test/run-pass/constrained-type.rs
+++ b/src/test/run-pass/constrained-type.rs
@@ -6,6 +6,6 @@ type bubu = {x: int, y: int};
 
 pred less_than(x: int, y: int) -> bool { ret x < y; }
 
-type ordered_range = {low: int, high: int} : less_than(*.low, *.high);
+type ordered_range = {low: int, high: int}  : less_than(*.low, *.high);
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/constraint-prop-expr-move.rs b/src/test/run-pass/constraint-prop-expr-move.rs
index c9104f3e789..56ebc914b93 100644
--- a/src/test/run-pass/constraint-prop-expr-move.rs
+++ b/src/test/run-pass/constraint-prop-expr-move.rs
@@ -9,4 +9,4 @@ fn main() {
     check (le(a, b));
     c <- a;
     log safe_slice("kitties", c, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop-move.rs b/src/test/run-pass/constraint-prop-move.rs
index 9418d3dff7f..97285adae0c 100644
--- a/src/test/run-pass/constraint-prop-move.rs
+++ b/src/test/run-pass/constraint-prop-move.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(a, b));
     let c <- a;
     log safe_slice("kitties", c, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop-swap.rs b/src/test/run-pass/constraint-prop-swap.rs
index 3212ad54e2a..7b96a89bb16 100644
--- a/src/test/run-pass/constraint-prop-swap.rs
+++ b/src/test/run-pass/constraint-prop-swap.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(b, a));
     b <-> a;
     log safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/constraint-prop.rs b/src/test/run-pass/constraint-prop.rs
index 720f2ff5631..71f151f5260 100644
--- a/src/test/run-pass/constraint-prop.rs
+++ b/src/test/run-pass/constraint-prop.rs
@@ -8,4 +8,4 @@ fn main() {
     check (le(a, b));
     let c = b;
     log safe_slice("kitties", a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/crate-attributes-src/foo.rs b/src/test/run-pass/crate-attributes-src/foo.rs
index 7decb512ec4..5ab36dfe00d 100644
--- a/src/test/run-pass/crate-attributes-src/foo.rs
+++ b/src/test/run-pass/crate-attributes-src/foo.rs
@@ -5,4 +5,4 @@
 // Attributes of the following function
 #[attr1 = "val"]
 #[attr2 = "val"]
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/dead-code-one-arm-if.rs b/src/test/run-pass/dead-code-one-arm-if.rs
index 456d8bff367..5aedb18282b 100644
--- a/src/test/run-pass/dead-code-one-arm-if.rs
+++ b/src/test/run-pass/dead-code-one-arm-if.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { if 1 == 1 { ret; } log "Paul is dead"; }
\ No newline at end of file
+fn main() { if 1 == 1 { ret; } log "Paul is dead"; }
diff --git a/src/test/run-pass/deep.rs b/src/test/run-pass/deep.rs
index c229ff93598..461d3c9ddfd 100644
--- a/src/test/run-pass/deep.rs
+++ b/src/test/run-pass/deep.rs
@@ -6,4 +6,4 @@ fn f(x: int) -> int {
     if x == 1 { ret 1; } else { let y: int = 1 + f(x - 1); ret y; }
 }
 
-fn main() { assert (f(5000) == 5000); }
\ No newline at end of file
+fn main() { assert (f(5000) == 5000); }
diff --git a/src/test/run-pass/deref-lval.rs b/src/test/run-pass/deref-lval.rs
index ba5149a7fd8..33d7f48dfe0 100644
--- a/src/test/run-pass/deref-lval.rs
+++ b/src/test/run-pass/deref-lval.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x = @mutable 5; *x = 1000; log *x; }
\ No newline at end of file
+fn main() { let x = @mutable 5; *x = 1000; log *x; }
diff --git a/src/test/run-pass/deref.rs b/src/test/run-pass/deref.rs
index 71dcfeb81f6..0d7276af659 100644
--- a/src/test/run-pass/deref.rs
+++ b/src/test/run-pass/deref.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: @int = @10; let y: int = *x; }
\ No newline at end of file
+fn main() { let x: @int = @10; let y: int = *x; }
diff --git a/src/test/run-pass/div-mod.rs b/src/test/run-pass/div-mod.rs
index 38a5bab5ca7..0e663ef4e09 100644
--- a/src/test/run-pass/div-mod.rs
+++ b/src/test/run-pass/div-mod.rs
@@ -15,4 +15,4 @@ fn main() {
     assert (x % 3 == 0);
     assert (x % y == 0);
     assert (15 % y == 0);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/double-unbox.rs b/src/test/run-pass/double-unbox.rs
index 32ecfa628e6..aacfbb91509 100644
--- a/src/test/run-pass/double-unbox.rs
+++ b/src/test/run-pass/double-unbox.rs
@@ -3,4 +3,4 @@ type quux = {bar: int};
 fn g(i: &int) { }
 fn f(foo: @@quux) { g(foo.bar); }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/drop-bind-thunk-args.rs b/src/test/run-pass/drop-bind-thunk-args.rs
index d5eddb77321..2a2d2c5e630 100644
--- a/src/test/run-pass/drop-bind-thunk-args.rs
+++ b/src/test/run-pass/drop-bind-thunk-args.rs
@@ -2,4 +2,4 @@
 
 fn f(x: @int) { }
 
-fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); }
\ No newline at end of file
+fn main() { let x = @10; let ff = bind f(_); ff(x); ff(x); }
diff --git a/src/test/run-pass/drop-on-empty-block-exit.rs b/src/test/run-pass/drop-on-empty-block-exit.rs
index 2a4f093f1de..97a161f19e7 100644
--- a/src/test/run-pass/drop-on-empty-block-exit.rs
+++ b/src/test/run-pass/drop-on-empty-block-exit.rs
@@ -2,4 +2,4 @@
 
 tag t { foo(@int); }
 
-fn main() { let tt = foo(@10); alt tt { foo(z) { } } }
\ No newline at end of file
+fn main() { let tt = foo(@10); alt tt { foo(z) { } } }
diff --git a/src/test/run-pass/drop-on-ret.rs b/src/test/run-pass/drop-on-ret.rs
index f1da1a37176..821601baae8 100644
--- a/src/test/run-pass/drop-on-ret.rs
+++ b/src/test/run-pass/drop-on-ret.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f() -> int { if true { let s: str = "should not leak"; ret 1; } ret 0; }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/early-ret-binop-add.rs b/src/test/run-pass/early-ret-binop-add.rs
index dc847b30fc2..f7719afc591 100644
--- a/src/test/run-pass/early-ret-binop-add.rs
+++ b/src/test/run-pass/early-ret-binop-add.rs
@@ -1,4 +1,2 @@
-fn wsucc(n: int) -> int {
-    { ret n + 1 } + 0;
-}
-fn main() {}
+fn wsucc(n: int) -> int { { ret n + 1 } + 0; }
+fn main() { }
diff --git a/src/test/run-pass/early-ret-binop.rs b/src/test/run-pass/early-ret-binop.rs
index 682bf502ce3..ffa6efb4e80 100644
--- a/src/test/run-pass/early-ret-binop.rs
+++ b/src/test/run-pass/early-ret-binop.rs
@@ -1,4 +1,2 @@
-fn wsucc(n: int) -> int {
-    { ret n + 1 } == 0;
-}
-fn main() {}
+fn wsucc(n: int) -> int { { ret n + 1 } == 0; }
+fn main() { }
diff --git a/src/test/run-pass/else-if.rs b/src/test/run-pass/else-if.rs
index cf13a53d86a..5f85f13ae80 100644
--- a/src/test/run-pass/else-if.rs
+++ b/src/test/run-pass/else-if.rs
@@ -3,13 +3,13 @@
 fn main() {
     if 1 == 2 {
         assert (false);
-    } else if (2 == 3) {
+    } else if 2 == 3 {
         assert (false);
-    } else if (3 == 4) { assert (false); } else { assert (true); }
-    if 1 == 2 { assert (false); } else if (2 == 2) { assert (true); }
+    } else if 3 == 4 { assert (false); } else { assert (true); }
+    if 1 == 2 { assert (false); } else if 2 == 2 { assert (true); }
     if 1 == 2 {
         assert (false);
-    } else if (2 == 2) {
+    } else if 2 == 2 {
         if 1 == 1 {
             assert (true);
         } else { if 2 == 1 { assert (false); } else { assert (false); } }
@@ -17,4 +17,4 @@ fn main() {
     if 1 == 2 {
         assert (false);
     } else { if 1 == 2 { assert (false); } else { assert (true); } }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/empty-mutable-vec.rs b/src/test/run-pass/empty-mutable-vec.rs
index de1d84ae134..6dfd5446160 100644
--- a/src/test/run-pass/empty-mutable-vec.rs
+++ b/src/test/run-pass/empty-mutable-vec.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let v: [mutable int] = ~[mutable ]; }
+fn main() { let v: [mutable int] = [mutable]; }
diff --git a/src/test/run-pass/export-abstract-tag.rs b/src/test/run-pass/export-abstract-tag.rs
index 7ef167c6a0a..f30d128635b 100644
--- a/src/test/run-pass/export-abstract-tag.rs
+++ b/src/test/run-pass/export-abstract-tag.rs
@@ -10,4 +10,4 @@ mod foo {
     fn f() -> t { ret t1; }
 }
 
-fn main() { let v: foo::t = foo::f(); }
\ No newline at end of file
+fn main() { let v: foo::t = foo::f(); }
diff --git a/src/test/run-pass/export-multi.rs b/src/test/run-pass/export-multi.rs
index 9f382cb4b77..6229e60532e 100644
--- a/src/test/run-pass/export-multi.rs
+++ b/src/test/run-pass/export-multi.rs
@@ -4,13 +4,8 @@ import m::g;
 mod m {
     export f, g;
 
-    fn f() {}
-    fn g() {}
+    fn f() { }
+    fn g() { }
 }
 
-fn main() {
-    f();
-    g();
-    m::f();
-    m::g();
-}
\ No newline at end of file
+fn main() { f(); g(); m::f(); m::g(); }
diff --git a/src/test/run-pass/export-non-interference2.rs b/src/test/run-pass/export-non-interference2.rs
index b9ffd8e8a58..c32f718c4d1 100644
--- a/src/test/run-pass/export-non-interference2.rs
+++ b/src/test/run-pass/export-non-interference2.rs
@@ -9,4 +9,4 @@ mod foo {
     fn x() { log "x"; }
 }
 
-fn main() { foo::bar::y(); }
\ No newline at end of file
+fn main() { foo::bar::y(); }
diff --git a/src/test/run-pass/export-non-interference3.rs b/src/test/run-pass/export-non-interference3.rs
index bfb734525a1..14fba5d40c3 100644
--- a/src/test/run-pass/export-non-interference3.rs
+++ b/src/test/run-pass/export-non-interference3.rs
@@ -10,4 +10,4 @@ mod bar {
     fn x() { log "x"; }
 }
 
-fn main() { foo::x(); }
\ No newline at end of file
+fn main() { foo::x(); }
diff --git a/src/test/run-pass/export-tag-variant.rs b/src/test/run-pass/export-tag-variant.rs
index f7599d08728..12eaf63949b 100644
--- a/src/test/run-pass/export-tag-variant.rs
+++ b/src/test/run-pass/export-tag-variant.rs
@@ -5,4 +5,4 @@ mod foo {
     tag t { t1; }
 }
 
-fn main() { let v = foo::t1; }
\ No newline at end of file
+fn main() { let v = foo::t1; }
diff --git a/src/test/run-pass/export-unexported-dep.rs b/src/test/run-pass/export-unexported-dep.rs
index 8f1d54ea5a5..bc8451a4854 100644
--- a/src/test/run-pass/export-unexported-dep.rs
+++ b/src/test/run-pass/export-unexported-dep.rs
@@ -13,4 +13,4 @@ mod foo {
     fn g(v: t) { assert (v == t1); }
 }
 
-fn main() { foo::g(foo::f()); }
\ No newline at end of file
+fn main() { foo::g(foo::f()); }
diff --git a/src/test/run-pass/expr-alt-box.rs b/src/test/run-pass/expr-alt-box.rs
index a397874dbd9..84c9e424f46 100644
--- a/src/test/run-pass/expr-alt-box.rs
+++ b/src/test/run-pass/expr-alt-box.rs
@@ -11,4 +11,4 @@ fn test_str() {
     assert (res == "happy");
 }
 
-fn main() { test_box(); test_str(); }
\ No newline at end of file
+fn main() { test_box(); test_str(); }
diff --git a/src/test/run-pass/expr-alt-fail-all.rs b/src/test/run-pass/expr-alt-fail-all.rs
index 55f4e69524d..3ff8af3cb97 100644
--- a/src/test/run-pass/expr-alt-fail-all.rs
+++ b/src/test/run-pass/expr-alt-fail-all.rs
@@ -9,4 +9,4 @@ fn main() {
           true { 10 }
           false { alt true { true { fail } false { fail } } }
         };
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-alt-fail.rs b/src/test/run-pass/expr-alt-fail.rs
index fb3f0dac014..7dfffcc1120 100644
--- a/src/test/run-pass/expr-alt-fail.rs
+++ b/src/test/run-pass/expr-alt-fail.rs
@@ -4,8 +4,8 @@ fn test_simple() {
 }
 
 fn test_box() {
-    let r = alt true { true { ~[10] } false { fail } };
-    assert (r.(0) == 10);
+    let r = alt true { true { [10] } false { fail } };
+    assert (r[0] == 10);
 }
 
-fn main() { test_simple(); test_box(); }
\ No newline at end of file
+fn main() { test_simple(); test_box(); }
diff --git a/src/test/run-pass/expr-alt-generic-box1.rs b/src/test/run-pass/expr-alt-generic-box1.rs
index ec299544094..763f303bbd6 100644
--- a/src/test/run-pass/expr-alt-generic-box1.rs
+++ b/src/test/run-pass/expr-alt-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, eq: &compare<T>) {
     let actual: @T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-generic-box2.rs b/src/test/run-pass/expr-alt-generic-box2.rs
index f7e96af98d5..046d77cd438 100644
--- a/src/test/run-pass/expr-alt-generic-box2.rs
+++ b/src/test/run-pass/expr-alt-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-generic.rs b/src/test/run-pass/expr-alt-generic.rs
index cfecd0302a1..c9990a0c756 100644
--- a/src/test/run-pass/expr-alt-generic.rs
+++ b/src/test/run-pass/expr-alt-generic.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = alt true { true { expected } };
diff --git a/src/test/run-pass/expr-alt-struct.rs b/src/test/run-pass/expr-alt-struct.rs
index 51ef9e09457..e346c9d2a9f 100644
--- a/src/test/run-pass/expr-alt-struct.rs
+++ b/src/test/run-pass/expr-alt-struct.rs
@@ -15,4 +15,4 @@ fn test_tag() {
     assert (rs == happy);
 }
 
-fn main() { test_rec(); test_tag(); }
\ No newline at end of file
+fn main() { test_rec(); test_tag(); }
diff --git a/src/test/run-pass/expr-alt.rs b/src/test/run-pass/expr-alt.rs
index 8d4ddd288f6..93495115ba7 100644
--- a/src/test/run-pass/expr-alt.rs
+++ b/src/test/run-pass/expr-alt.rs
@@ -41,4 +41,4 @@ fn main() {
     test_inferrence();
     test_alt_as_alt_head();
     test_alt_as_block_result();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-block-box.rs b/src/test/run-pass/expr-block-box.rs
index 62971193037..c434db7a8bf 100644
--- a/src/test/run-pass/expr-block-box.rs
+++ b/src/test/run-pass/expr-block-box.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x = { @100 }; assert (*x == 100); }
\ No newline at end of file
+fn main() { let x = { @100 }; assert (*x == 100); }
diff --git a/src/test/run-pass/expr-block-fn.rs b/src/test/run-pass/expr-block-fn.rs
index dc8690f15ad..8b461bcf863 100644
--- a/src/test/run-pass/expr-block-fn.rs
+++ b/src/test/run-pass/expr-block-fn.rs
@@ -1,11 +1,11 @@
 
 
 fn test_fn() {
-    type t = fn() -> int ;
+    type t = fn() -> int;
 
     fn ten() -> int { ret 10; }
     let rs: t = { ten };
     assert (rs() == 10);
 }
 
-fn main() { test_fn(); }
\ No newline at end of file
+fn main() { test_fn(); }
diff --git a/src/test/run-pass/expr-block-generic-box1.rs b/src/test/run-pass/expr-block-generic-box1.rs
index d68f0cf5d89..5ab310cb309 100644
--- a/src/test/run-pass/expr-block-generic-box1.rs
+++ b/src/test/run-pass/expr-block-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, eq: &compare<T>) {
     let actual: @T = { expected };
diff --git a/src/test/run-pass/expr-block-generic-box2.rs b/src/test/run-pass/expr-block-generic-box2.rs
index d630b65c822..3f8293490f3 100644
--- a/src/test/run-pass/expr-block-generic-box2.rs
+++ b/src/test/run-pass/expr-block-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = { expected };
diff --git a/src/test/run-pass/expr-block-generic.rs b/src/test/run-pass/expr-block-generic.rs
index d7c17731559..52d463eae2a 100644
--- a/src/test/run-pass/expr-block-generic.rs
+++ b/src/test/run-pass/expr-block-generic.rs
@@ -4,7 +4,7 @@
 // -*- rust -*-
 
 // Tests for standalone blocks as expressions with dynamic type sizes
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, eq: &compare<T>) {
     let actual: T = { expected };
diff --git a/src/test/run-pass/expr-block-ref.rs b/src/test/run-pass/expr-block-ref.rs
index 6a0a1700a94..59107298782 100644
--- a/src/test/run-pass/expr-block-ref.rs
+++ b/src/test/run-pass/expr-block-ref.rs
@@ -1,2 +1,2 @@
 // Regression test for issue #388
-fn main() { let x = { { @10 } }; }
\ No newline at end of file
+fn main() { let x = { { @10 } }; }
diff --git a/src/test/run-pass/expr-block-slot.rs b/src/test/run-pass/expr-block-slot.rs
index d36330f287f..f2a73836f01 100644
--- a/src/test/run-pass/expr-block-slot.rs
+++ b/src/test/run-pass/expr-block-slot.rs
@@ -4,4 +4,4 @@ fn main() {
     assert (a.a == 3);
     let c = { let d = {v: 3}; d };
     assert (c.v == 3);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-block.rs b/src/test/run-pass/expr-block.rs
index d0fb65c5ffd..3aab0a64744 100644
--- a/src/test/run-pass/expr-block.rs
+++ b/src/test/run-pass/expr-block.rs
@@ -13,4 +13,4 @@ fn test_filled_with_stuff() {
     assert (rs == 10);
 }
 
-fn main() { test_basic(); test_rec(); test_filled_with_stuff(); }
\ No newline at end of file
+fn main() { test_basic(); test_rec(); test_filled_with_stuff(); }
diff --git a/src/test/run-pass/expr-copy.rs b/src/test/run-pass/expr-copy.rs
index 6fbaf4f7679..56f7dbb9996 100644
--- a/src/test/run-pass/expr-copy.rs
+++ b/src/test/run-pass/expr-copy.rs
@@ -1,5 +1 @@
-fn main() {
-    let x = 10;
-    let y = copy x;
-    log y;
-}
\ No newline at end of file
+fn main() { let x = 10; let y = copy x; log y; }
diff --git a/src/test/run-pass/expr-elseif-ref.rs b/src/test/run-pass/expr-elseif-ref.rs
index 1de7fa6e414..4235c21ac5f 100644
--- a/src/test/run-pass/expr-elseif-ref.rs
+++ b/src/test/run-pass/expr-elseif-ref.rs
@@ -2,6 +2,6 @@
 // values from the else if branch
 fn main() {
     let y: @uint = @10u;
-    let x = if false { y } else if (true) { y } else { y };
+    let x = if false { y } else if true { y } else { y };
     assert (*y == 10u);
 }
diff --git a/src/test/run-pass/expr-elseif-ref2.rs b/src/test/run-pass/expr-elseif-ref2.rs
index ef8559ef062..8a3af93dc90 100644
--- a/src/test/run-pass/expr-elseif-ref2.rs
+++ b/src/test/run-pass/expr-elseif-ref2.rs
@@ -1,4 +1,2 @@
 // Regression test for issue #388
-fn main() {
-    let x = if false { @0u } else if (true) { @10u } else { @0u };
-}
\ No newline at end of file
+fn main() { let x = if false { @0u } else if true { @10u } else { @0u }; }
diff --git a/src/test/run-pass/expr-empty-ret.rs b/src/test/run-pass/expr-empty-ret.rs
index 99ce1fac7b7..6044c6e8ff7 100644
--- a/src/test/run-pass/expr-empty-ret.rs
+++ b/src/test/run-pass/expr-empty-ret.rs
@@ -2,4 +2,4 @@
 
 fn f() { let x = alt true { true { 10 } false { ret } }; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/expr-fn.rs b/src/test/run-pass/expr-fn.rs
index 1bff51000b9..b7070ead5ed 100644
--- a/src/test/run-pass/expr-fn.rs
+++ b/src/test/run-pass/expr-fn.rs
@@ -4,8 +4,8 @@ fn test_int() {
 }
 
 fn test_vec() {
-    fn f() -> [int] { ~[10, 11] }
-    assert (f().(1) == 11);
+    fn f() -> [int] { [10, 11] }
+    assert (f()[1] == 11);
 }
 
 fn test_generic() {
diff --git a/src/test/run-pass/expr-if-box.rs b/src/test/run-pass/expr-if-box.rs
index 32881d23bae..7d9e2320e93 100644
--- a/src/test/run-pass/expr-if-box.rs
+++ b/src/test/run-pass/expr-if-box.rs
@@ -14,4 +14,4 @@ fn test_str() {
     assert (rs == "happy");
 }
 
-fn main() { test_box(); test_str(); }
\ No newline at end of file
+fn main() { test_box(); test_str(); }
diff --git a/src/test/run-pass/expr-if-fail-all.rs b/src/test/run-pass/expr-if-fail-all.rs
index f9ad1075605..347a7f5ce9a 100644
--- a/src/test/run-pass/expr-if-fail-all.rs
+++ b/src/test/run-pass/expr-if-fail-all.rs
@@ -1,3 +1,3 @@
 // When all branches of an if expression result in fail, the entire if
 // expression results in fail.
-fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; }
\ No newline at end of file
+fn main() { let x = if true { 10 } else { if true { fail } else { fail } }; }
diff --git a/src/test/run-pass/expr-if-fail.rs b/src/test/run-pass/expr-if-fail.rs
index 4c9c8e07d4c..0a19c446388 100644
--- a/src/test/run-pass/expr-if-fail.rs
+++ b/src/test/run-pass/expr-if-fail.rs
@@ -6,8 +6,8 @@ fn test_else_fail() {
 }
 
 fn test_elseif_fail() {
-    let x = if false { 0 } else if (false) { fail } else { 10 };
+    let x = if false { 0 } else if false { fail } else { 10 };
     assert (x == 10);
 }
 
-fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); }
\ No newline at end of file
+fn main() { test_if_fail(); test_else_fail(); test_elseif_fail(); }
diff --git a/src/test/run-pass/expr-if-generic-box1.rs b/src/test/run-pass/expr-if-generic-box1.rs
index 82bbbb840a6..6d69cce9a1b 100644
--- a/src/test/run-pass/expr-if-generic-box1.rs
+++ b/src/test/run-pass/expr-if-generic-box1.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(@T, @T) -> bool ;
+type compare<T> = fn(@T, @T) -> bool;
 
 fn test_generic<T>(expected: @T, not_expected: @T, eq: &compare<T>) {
     let actual: @T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-generic-box2.rs b/src/test/run-pass/expr-if-generic-box2.rs
index 7cf77d61686..b31fb91f229 100644
--- a/src/test/run-pass/expr-if-generic-box2.rs
+++ b/src/test/run-pass/expr-if-generic-box2.rs
@@ -2,7 +2,7 @@
 
 
 // -*- rust -*-
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) {
     let actual: T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-generic.rs b/src/test/run-pass/expr-if-generic.rs
index df466051ce4..99709ea396c 100644
--- a/src/test/run-pass/expr-if-generic.rs
+++ b/src/test/run-pass/expr-if-generic.rs
@@ -4,7 +4,7 @@
 // -*- rust -*-
 
 // Tests for if as expressions with dynamic type sizes
-type compare<T> = fn(&T, &T) -> bool ;
+type compare<T> = fn(&T, &T) -> bool;
 
 fn test_generic<T>(expected: &T, not_expected: &T, eq: &compare<T>) {
     let actual: T = if true { expected } else { not_expected };
diff --git a/src/test/run-pass/expr-if-struct.rs b/src/test/run-pass/expr-if-struct.rs
index 481fbf3b21a..56728c67706 100644
--- a/src/test/run-pass/expr-if-struct.rs
+++ b/src/test/run-pass/expr-if-struct.rs
@@ -15,4 +15,4 @@ fn test_tag() {
     assert (rs == happy);
 }
 
-fn main() { test_rec(); test_tag(); }
\ No newline at end of file
+fn main() { test_rec(); test_tag(); }
diff --git a/src/test/run-pass/expr-if.rs b/src/test/run-pass/expr-if.rs
index 74c2a53eda1..43f3083f164 100644
--- a/src/test/run-pass/expr-if.rs
+++ b/src/test/run-pass/expr-if.rs
@@ -12,17 +12,17 @@ fn test_else() {
 }
 
 fn test_elseif1() {
-    let rs: bool = if true { true } else if (true) { false } else { false };
+    let rs: bool = if true { true } else if true { false } else { false };
     assert (rs);
 }
 
 fn test_elseif2() {
-    let rs: bool = if false { false } else if (true) { true } else { false };
+    let rs: bool = if false { false } else if true { true } else { false };
     assert (rs);
 }
 
 fn test_elseif3() {
-    let rs: bool = if false { false } else if (false) { false } else { true };
+    let rs: bool = if false { false } else if false { false } else { true };
     assert (rs);
 }
 
@@ -52,4 +52,4 @@ fn main() {
     test_inferrence();
     test_if_as_if_condition();
     test_if_as_block_result();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/expr-scope.rs b/src/test/run-pass/expr-scope.rs
index d5a2a069f7f..53c8223c778 100644
--- a/src/test/run-pass/expr-scope.rs
+++ b/src/test/run-pass/expr-scope.rs
@@ -2,4 +2,4 @@
 // xfail-fast
 
 fn f() { }
-fn main() { ret ::f(); }
\ No newline at end of file
+fn main() { ret ::f(); }
diff --git a/src/test/run-pass/exterior.rs b/src/test/run-pass/exterior.rs
index ae34d051a2b..228f7dff061 100644
--- a/src/test/run-pass/exterior.rs
+++ b/src/test/run-pass/exterior.rs
@@ -13,4 +13,4 @@ fn main() {
     f(b);
     assert (a.z == 12);
     assert (b.z == 13);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fact.rs b/src/test/run-pass/fact.rs
index f47c2e9ece9..95af3b8a6b6 100644
--- a/src/test/run-pass/fact.rs
+++ b/src/test/run-pass/fact.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (f(5) == 120);
     // log "all done";
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fixed-point-bind-box.rs b/src/test/run-pass/fixed-point-bind-box.rs
index f93add461a4..4ca1cdb34c9 100644
--- a/src/test/run-pass/fixed-point-bind-box.rs
+++ b/src/test/run-pass/fixed-point-bind-box.rs
@@ -1,12 +1,12 @@
-fn fix_help<A, B>(f: @fn(@fn(&A) -> B , &A) -> B , x: &A) -> B {
+fn fix_help<A, B>(f: @fn(@fn(&A) -> B, &A) -> B, x: &A) -> B {
     ret f(@bind fix_help(f, _), x);
 }
 
-fn fix<A, B>(f: @fn(@fn(&A) -> B , &A) -> B ) -> @fn(&A) -> B  {
+fn fix<A, B>(f: @fn(@fn(&A) -> B, &A) -> B) -> @fn(&A) -> B {
     ret @bind fix_help(f, _);
 }
 
-fn fact_(f: @fn(&int) -> int , n: &int) -> int {
+fn fact_(f: @fn(&int) -> int, n: &int) -> int {
     // fun fact 0 = 1
     ret if n == 0 { 1 } else { n * f(n - 1) };
 }
diff --git a/src/test/run-pass/float-signature.rs b/src/test/run-pass/float-signature.rs
index f2e7229623a..8eb940d8883 100644
--- a/src/test/run-pass/float-signature.rs
+++ b/src/test/run-pass/float-signature.rs
@@ -5,4 +5,4 @@ fn main() {
     let n: float = 0.1;
     let m: float = foo(n);
     log m;
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/float.rs b/src/test/run-pass/float.rs
index b9014c9b085..a0b4a32d41a 100644
--- a/src/test/run-pass/float.rs
+++ b/src/test/run-pass/float.rs
@@ -7,4 +7,4 @@ fn main() {
            || pi > 1.0 {
         log "yes";
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/float2.rs b/src/test/run-pass/float2.rs
index 1eed1e37aec..26b5a64ebe5 100644
--- a/src/test/run-pass/float2.rs
+++ b/src/test/run-pass/float2.rs
@@ -21,4 +21,4 @@ fn main() {
     assert (h == i);
     assert (j > k);
     assert (k < a);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/floatlits.rs b/src/test/run-pass/floatlits.rs
index 13039f2bf3b..6f43ad9b760 100644
--- a/src/test/run-pass/floatlits.rs
+++ b/src/test/run-pass/floatlits.rs
@@ -7,4 +7,4 @@ fn main() {
     let g = 4.90000000001e-10;
     assert (g > 5e-11);
     assert (g < 5e-9);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fn-constraint.rs b/src/test/run-pass/fn-constraint.rs
index 2f7b81effec..f9ea572a735 100644
--- a/src/test/run-pass/fn-constraint.rs
+++ b/src/test/run-pass/fn-constraint.rs
@@ -7,4 +7,4 @@ fn main() {
     let b: uint = 4u;
     check (le(a, b));
     log safe_slice("kitties", a, b);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fn-expr.rs b/src/test/run-pass/fn-expr.rs
index dfe4d2bd9a7..64b28e4a289 100644
--- a/src/test/run-pass/fn-expr.rs
+++ b/src/test/run-pass/fn-expr.rs
@@ -1 +1 @@
-fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); }
\ No newline at end of file
+fn main() { let x = fn (a: int) -> int { ret a + 1; }; assert (x(4) == 5); }
diff --git a/src/test/run-pass/fn-lval.rs b/src/test/run-pass/fn-lval.rs
index faa12c8720d..c62ad36052f 100644
--- a/src/test/run-pass/fn-lval.rs
+++ b/src/test/run-pass/fn-lval.rs
@@ -2,8 +2,8 @@
 
 
 // -*- rust -*-
-fn foo(f: fn(int) -> int ) { }
+fn foo(f: fn(int) -> int) { }
 
 fn id(x: int) -> int { ret x; }
 
-fn main() { foo(id); }
\ No newline at end of file
+fn main() { foo(id); }
diff --git a/src/test/run-pass/fn-type-infer.rs b/src/test/run-pass/fn-type-infer.rs
index c3513bdff8a..d9b6ac60ba3 100644
--- a/src/test/run-pass/fn-type-infer.rs
+++ b/src/test/run-pass/fn-type-infer.rs
@@ -1,4 +1,4 @@
 fn main() {
     // We should be able to type infer inside of lambdas.
     let f = fn () { let i = 10; };
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/for-destruct.rs b/src/test/run-pass/for-destruct.rs
index cc1702d247c..569d596e7b7 100644
--- a/src/test/run-pass/for-destruct.rs
+++ b/src/test/run-pass/for-destruct.rs
@@ -1,5 +1,5 @@
 fn main() {
-    for {x, y}: {x: int, y: int} in ~[{x: 10, y: 20}, {x: 30, y: 0}] {
-        assert x + y == 30;
+    for {x: x, y: y}: {x: int, y: int} in [{x: 10, y: 20}, {x: 30, y: 0}] {
+        assert (x + y == 30);
     }
 }
diff --git a/src/test/run-pass/for-each-destruct.rs b/src/test/run-pass/for-each-destruct.rs
index 935746473a9..59488f8730d 100644
--- a/src/test/run-pass/for-each-destruct.rs
+++ b/src/test/run-pass/for-each-destruct.rs
@@ -1,13 +1,8 @@
 iter x() -> {x: int, y: int} {
     let i = 0;
-    while i < 40 {
-        put {x: i, y: 30 - i};
-        i += 10;
-    }
+    while i < 40 { put {x: i, y: 30 - i}; i += 10; }
 }
 
 fn main() {
-    for each {x, y}: {x: int, y: int} in x() {
-        assert x + y == 30;
-    }
+    for each {x: x, y: y}: {x: int, y: int} in x() { assert (x + y == 30); }
 }
diff --git a/src/test/run-pass/for-loop-fail.rs b/src/test/run-pass/for-loop-fail.rs
index 2e52a5ae1f7..d605e1797e1 100644
--- a/src/test/run-pass/for-loop-fail.rs
+++ b/src/test/run-pass/for-loop-fail.rs
@@ -1 +1 @@
-fn main() { let x: [int] = ~[]; for i: int in x { fail "moop"; } }
+fn main() { let x: [int] = []; for i: int in x { fail "moop"; } }
diff --git a/src/test/run-pass/foreach-nested-2.rs b/src/test/run-pass/foreach-nested-2.rs
index ba42d7a6ac4..472bea23cfe 100644
--- a/src/test/run-pass/foreach-nested-2.rs
+++ b/src/test/run-pass/foreach-nested-2.rs
@@ -10,20 +10,20 @@ iter range(start: int, stop: int) -> int {
 }
 
 fn main() {
-    let a: [mutable int] = ~[mutable -1, -1, -1, -1, -1, -1, -1, -1];
+    let a: [mutable int] = [mutable -1, -1, -1, -1, -1, -1, -1, -1];
     let p: int = 0;
     for each i: int in two() {
         for each j: int in range(0, 2) {
             let tmp: int = 10 * i + j;
-            for each k: int in range(0, 2) { a.(p) = 10 * tmp + k; p += 1; }
+            for each k: int in range(0, 2) { a[p] = 10 * tmp + k; p += 1; }
         }
     }
-    assert (a.(0) == 0);
-    assert (a.(1) == 1);
-    assert (a.(2) == 10);
-    assert (a.(3) == 11);
-    assert (a.(4) == 100);
-    assert (a.(5) == 101);
-    assert (a.(6) == 110);
-    assert (a.(7) == 111);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 10);
+    assert (a[3] == 11);
+    assert (a[4] == 100);
+    assert (a[5] == 101);
+    assert (a[6] == 110);
+    assert (a[7] == 111);
 }
diff --git a/src/test/run-pass/foreach-nested.rs b/src/test/run-pass/foreach-nested.rs
index 4e90818621d..802381006e5 100644
--- a/src/test/run-pass/foreach-nested.rs
+++ b/src/test/run-pass/foreach-nested.rs
@@ -5,13 +5,13 @@
 iter two() -> int { put 0; put 1; }
 
 fn main() {
-    let a: [mutable int] = ~[mutable -1, -1, -1, -1];
+    let a: [mutable int] = [mutable -1, -1, -1, -1];
     let p: int = 0;
     for each i: int in two() {
-        for each j: int in two() { a.(p) = 10 * i + j; p += 1; }
+        for each j: int in two() { a[p] = 10 * i + j; p += 1; }
     }
-    assert (a.(0) == 0);
-    assert (a.(1) == 1);
-    assert (a.(2) == 10);
-    assert (a.(3) == 11);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 10);
+    assert (a[3] == 11);
 }
diff --git a/src/test/run-pass/fun-call-variants.rs b/src/test/run-pass/fun-call-variants.rs
index 6409767ab40..0469e804948 100644
--- a/src/test/run-pass/fun-call-variants.rs
+++ b/src/test/run-pass/fun-call-variants.rs
@@ -1,15 +1,13 @@
 // -*- rust -*-
-fn ho(f: fn(int) -> int ) -> int { let n: int = f(3); ret n; }
+fn ho(f: fn(int) -> int) -> int { let n: int = f(3); ret n; }
 
 fn direct(x: int) -> int { ret x + 1; }
 
 fn main() {
-    let a: int =
-        direct(3); // direct
+    let a: int = direct(3); // direct
     let b: int = ho(direct); // indirect unbound
 
-    let c: int =
-        ho(bind direct(_)); // indirect bound
+    let c: int = ho(bind direct(_)); // indirect bound
     assert (a == b);
     assert (b == c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/fun-indirect-call.rs b/src/test/run-pass/fun-indirect-call.rs
index 7bbfd7b84e9..8c4068c425c 100644
--- a/src/test/run-pass/fun-indirect-call.rs
+++ b/src/test/run-pass/fun-indirect-call.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f() -> int { ret 42; }
 
-fn main() { let g: fn() -> int  = f; let i: int = g(); assert (i == 42); }
\ No newline at end of file
+fn main() { let g: fn() -> int = f; let i: int = g(); assert (i == 42); }
diff --git a/src/test/run-pass/generic-ivec-leak.rs b/src/test/run-pass/generic-ivec-leak.rs
index f9755e176b9..4e4508d08e9 100644
--- a/src/test/run-pass/generic-ivec-leak.rs
+++ b/src/test/run-pass/generic-ivec-leak.rs
@@ -1,4 +1,4 @@
 tag wrapper<T> { wrapped(T); }
 
-fn main() { let w = wrapped(~[1, 2, 3, 4, 5]); }
+fn main() { let w = wrapped([1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/generic-ivec.rs b/src/test/run-pass/generic-ivec.rs
index 39ba083a5a3..26298de5b94 100644
--- a/src/test/run-pass/generic-ivec.rs
+++ b/src/test/run-pass/generic-ivec.rs
@@ -1,3 +1,3 @@
 fn f<T>(v: @T) { }
-fn main() { f(@~[1, 2, 3, 4, 5]); }
+fn main() { f(@[1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/generic-temporary.rs b/src/test/run-pass/generic-temporary.rs
index 1abd0f7daf9..afac9e176ee 100644
--- a/src/test/run-pass/generic-temporary.rs
+++ b/src/test/run-pass/generic-temporary.rs
@@ -4,10 +4,10 @@ fn mk() -> int { ret 1; }
 
 fn chk(a: &int) { log a; assert (a == 1); }
 
-fn apply<T>(produce: fn() -> T , consume: fn(&T) ) { consume(produce()); }
+fn apply<T>(produce: fn() -> T, consume: fn(&T)) { consume(produce()); }
 
 fn main() {
-    let produce: fn() -> int  = mk;
-    let consume: fn(&int)  = chk;
+    let produce: fn() -> int = mk;
+    let consume: fn(&int) = chk;
     apply::<int>(produce, consume);
 }
diff --git a/src/test/run-pass/generic-tup.rs b/src/test/run-pass/generic-tup.rs
index bdd8ddf1268..8cacf51e9b5 100644
--- a/src/test/run-pass/generic-tup.rs
+++ b/src/test/run-pass/generic-tup.rs
@@ -1,7 +1,4 @@
-fn get_third<T>(t: &(T, T, T)) -> T {
-    let (_, _, x) = t;
-    ret x;
-}
+fn get_third<T>(t: &(T, T, T)) -> T { let (_, _, x) = t; ret x; }
 
 fn main() {
     log get_third((1, 2, 3));
diff --git a/src/test/run-pass/hashmap-memory.rs b/src/test/run-pass/hashmap-memory.rs
index ecf13f39595..31b34aa1464 100644
--- a/src/test/run-pass/hashmap-memory.rs
+++ b/src/test/run-pass/hashmap-memory.rs
@@ -26,9 +26,9 @@ mod map_reduce {
     export mapper;
     export map_reduce;
 
-    type putter = fn(str, str) ;
+    type putter = fn(str, str);
 
-    type mapper = fn(str, putter) ;
+    type mapper = fn(str, putter);
 
     tag ctrl_proto { find_reducer([u8], _chan<int>); mapper_done; }
 
@@ -92,5 +92,5 @@ mod map_reduce {
 }
 
 fn main() {
-    map_reduce::map_reduce(~["../src/test/run-pass/hashmap-memory.rs"]);
+    map_reduce::map_reduce(["../src/test/run-pass/hashmap-memory.rs"]);
 }
diff --git a/src/test/run-pass/hello.rs b/src/test/run-pass/hello.rs
index 5e442db7fbe..fa917bd4902 100644
--- a/src/test/run-pass/hello.rs
+++ b/src/test/run-pass/hello.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { log "hello, world."; }
\ No newline at end of file
+fn main() { log "hello, world."; }
diff --git a/src/test/run-pass/i32-sub.rs b/src/test/run-pass/i32-sub.rs
index a83e95a73b8..5dd3ce8de2c 100644
--- a/src/test/run-pass/i32-sub.rs
+++ b/src/test/run-pass/i32-sub.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); }
\ No newline at end of file
+fn main() { let x: i32 = -400_i32; x = 0_i32 - x; assert (x == 400_i32); }
diff --git a/src/test/run-pass/i8-incr.rs b/src/test/run-pass/i8-incr.rs
index f825d54bba1..4a51fd58517 100644
--- a/src/test/run-pass/i8-incr.rs
+++ b/src/test/run-pass/i8-incr.rs
@@ -8,4 +8,4 @@ fn main() {
     x = x + 1i8;
     x = x - 1i8;
     assert (x == y);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/if-bot.rs b/src/test/run-pass/if-bot.rs
index 8ef6bab684e..35452a2ba6d 100644
--- a/src/test/run-pass/if-bot.rs
+++ b/src/test/run-pass/if-bot.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let i: int = if false { fail } else { 5 }; log i; }
\ No newline at end of file
+fn main() { let i: int = if false { fail } else { 5 }; log i; }
diff --git a/src/test/run-pass/if-check-precond.rs b/src/test/run-pass/if-check-precond.rs
index 88c744642d0..eadffd7b75a 100644
--- a/src/test/run-pass/if-check-precond.rs
+++ b/src/test/run-pass/if-check-precond.rs
@@ -1,11 +1,11 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn print_even(x: uint) : even(x) { log x; }
 
 fn foo(x: uint) { if check even(x) { print_even(x); } else { fail; } }
 
-fn main() { foo(2u); }
\ No newline at end of file
+fn main() { foo(2u); }
diff --git a/src/test/run-pass/if-check.rs b/src/test/run-pass/if-check.rs
index 220b784e12e..090330bef0e 100644
--- a/src/test/run-pass/if-check.rs
+++ b/src/test/run-pass/if-check.rs
@@ -1,9 +1,9 @@
 pred even(x: uint) -> bool {
     if x < 2u {
         ret false;
-    } else if (x == 2u) { ret true; } else { ret even(x - 2u); }
+    } else if x == 2u { ret true; } else { ret even(x - 2u); }
 }
 
 fn foo(x: uint) { if check even(x) { log x; } else { fail; } }
 
-fn main() { foo(2u); }
\ No newline at end of file
+fn main() { foo(2u); }
diff --git a/src/test/run-pass/if-ret.rs b/src/test/run-pass/if-ret.rs
index 3dc897683fc..87cd9647243 100644
--- a/src/test/run-pass/if-ret.rs
+++ b/src/test/run-pass/if-ret.rs
@@ -1,3 +1,3 @@
 fn foo() { if (ret) { } }
 
-fn main() { foo(); }
\ No newline at end of file
+fn main() { foo(); }
diff --git a/src/test/run-pass/import-from-native.rs b/src/test/run-pass/import-from-native.rs
index 03c49b2adfe..b8837692c07 100644
--- a/src/test/run-pass/import-from-native.rs
+++ b/src/test/run-pass/import-from-native.rs
@@ -1,6 +1,6 @@
 mod spam {
-    fn ham() {}
-    fn eggs() {}
+    fn ham() { }
+    fn eggs() { }
 }
 
 native "rust" mod rustrt {
@@ -9,7 +9,4 @@ native "rust" mod rustrt {
     export eggs;
 }
 
-fn main() {
-    rustrt::ham();
-    rustrt::eggs();
-}
\ No newline at end of file
+fn main() { rustrt::ham(); rustrt::eggs(); }
diff --git a/src/test/run-pass/import-from.rs b/src/test/run-pass/import-from.rs
index b42793d16df..d8314e6b0b8 100644
--- a/src/test/run-pass/import-from.rs
+++ b/src/test/run-pass/import-from.rs
@@ -1,11 +1,8 @@
 import spam::{ham, eggs};
 
 mod spam {
-    fn ham() {}
-    fn eggs() {}
+    fn ham() { }
+    fn eggs() { }
 }
 
-fn main() {
-    ham();
-    eggs();
-}
\ No newline at end of file
+fn main() { ham(); eggs(); }
diff --git a/src/test/run-pass/import-glob-0.rs b/src/test/run-pass/import-glob-0.rs
index e5e9ab90d0d..51144e492ce 100644
--- a/src/test/run-pass/import-glob-0.rs
+++ b/src/test/run-pass/import-glob-0.rs
@@ -27,4 +27,4 @@ mod dug {
 }
 
 
-fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); }
\ No newline at end of file
+fn main() { f1(); f2(); f4(); nameless_fear(); also_redstone(); }
diff --git a/src/test/run-pass/import-glob-1.rs b/src/test/run-pass/import-glob-1.rs
index 64c5a47ec17..d9c1b653217 100644
--- a/src/test/run-pass/import-glob-1.rs
+++ b/src/test/run-pass/import-glob-1.rs
@@ -1,40 +1,40 @@
 import a1::b1::word_traveler;
 
 mod a1 {
-     //
+    //
     mod b1 {
-         //
+        //
         import a2::b1::*;
-         //         <-\
+        //         <-\
         export word_traveler; //           |
     }
-     //           |
+    //           |
     mod b2 {
-         //           |
+        //           |
         import a2::b2::*;
-         // <-\  -\   |
+        // <-\  -\   |
         export word_traveler; //   |   |   |
     } //   |   |   |
 }
- //   |   |   |
- //   |   |   |
- mod a2 {
-      //   |   |   |
-     native "cdecl" mod b1 = "" {
-          //   |   |   |
-         import a1::b2::*;
-          //   | <-/  -/
-         export word_traveler; //   |
-     }
-      //   |
-     mod b2 {
-          //   |
-         fn word_traveler() { //   |
-             log "ahoy!"; //  -/
-         } //
-     } //
- }
- //
+//   |   |   |
+//   |   |   |
+mod a2 {
+    //   |   |   |
+    native "cdecl" mod b1 = "" {
+        //   |   |   |
+        import a1::b2::*;
+        //   | <-/  -/
+        export word_traveler; //   |
+    }
+    //   |
+    mod b2 {
+        //   |
+        fn word_traveler() { //   |
+            log "ahoy!"; //  -/
+        } //
+    } //
+}
+//
 
 
-fn main() { word_traveler(); }
\ No newline at end of file
+fn main() { word_traveler(); }
diff --git a/src/test/run-pass/import-glob-circular.rs b/src/test/run-pass/import-glob-circular.rs
index bc97c7925eb..4035790b934 100644
--- a/src/test/run-pass/import-glob-circular.rs
+++ b/src/test/run-pass/import-glob-circular.rs
@@ -47,4 +47,4 @@ mod test2 {
 
 
 
-fn main() { test1(); test2(); }
\ No newline at end of file
+fn main() { test1(); test2(); }
diff --git a/src/test/run-pass/import-glob-crate.rs b/src/test/run-pass/import-glob-crate.rs
index c32973fa377..fca6c1d61bd 100644
--- a/src/test/run-pass/import-glob-crate.rs
+++ b/src/test/run-pass/import-glob-crate.rs
@@ -4,6 +4,6 @@ import std::vec::*;
 
 fn main() {
     let v = init_elt(0, 0u);
-    v += ~[4, 2];
-    assert (reversed(v) == ~[2, 4]);
+    v += [4, 2];
+    assert (reversed(v) == [2, 4]);
 }
diff --git a/src/test/run-pass/import.rs b/src/test/run-pass/import.rs
index 31622c1fee8..ffd84fda952 100644
--- a/src/test/run-pass/import.rs
+++ b/src/test/run-pass/import.rs
@@ -8,4 +8,4 @@ mod bar {
     fn thing() { x(10); z(10); }
 }
 
-fn main() { bar::thing(); }
\ No newline at end of file
+fn main() { bar::thing(); }
diff --git a/src/test/run-pass/import2.rs b/src/test/run-pass/import2.rs
index f8810e1bf4a..5b287cd7ddd 100644
--- a/src/test/run-pass/import2.rs
+++ b/src/test/run-pass/import2.rs
@@ -5,4 +5,4 @@ mod zed {
     fn bar() { log "bar"; }
 }
 
-fn main() { bar(); }
\ No newline at end of file
+fn main() { bar(); }
diff --git a/src/test/run-pass/import3.rs b/src/test/run-pass/import3.rs
index 687074d55be..bd38defe405 100644
--- a/src/test/run-pass/import3.rs
+++ b/src/test/run-pass/import3.rs
@@ -8,4 +8,4 @@ mod baz {
     }
 }
 
-fn main() { bar(); }
\ No newline at end of file
+fn main() { bar(); }
diff --git a/src/test/run-pass/import6.rs b/src/test/run-pass/import6.rs
index bc57537580f..33898c35a35 100644
--- a/src/test/run-pass/import6.rs
+++ b/src/test/run-pass/import6.rs
@@ -9,4 +9,4 @@ mod bar {
     import zed::baz;
     export baz;
 }
-fn main() { baz(); }
\ No newline at end of file
+fn main() { baz(); }
diff --git a/src/test/run-pass/import8.rs b/src/test/run-pass/import8.rs
index ed559347824..884dcebacdf 100644
--- a/src/test/run-pass/import8.rs
+++ b/src/test/run-pass/import8.rs
@@ -6,4 +6,4 @@ mod foo {
     fn x(y: int) { log y; }
 }
 
-fn main() { x(10); z(10); }
\ No newline at end of file
+fn main() { x(10); z(10); }
diff --git a/src/test/run-pass/infer-fn-tail-expr.rs b/src/test/run-pass/infer-fn-tail-expr.rs
index 9134f3a78de..4658ea4329c 100644
--- a/src/test/run-pass/infer-fn-tail-expr.rs
+++ b/src/test/run-pass/infer-fn-tail-expr.rs
@@ -1,5 +1,5 @@
 // issue #680
 
-fn f() -> [int] { ~[] }
+fn f() -> [int] { [] }
 
 fn main() { }
diff --git a/src/test/run-pass/inner-module.rs b/src/test/run-pass/inner-module.rs
index f9ef1b040de..6fcc0a79af0 100644
--- a/src/test/run-pass/inner-module.rs
+++ b/src/test/run-pass/inner-module.rs
@@ -9,4 +9,4 @@ mod inner {
     fn hello() { inner2::hello(); }
 }
 
-fn main() { inner::hello(); inner::inner2::hello(); }
\ No newline at end of file
+fn main() { inner::hello(); inner::inner2::hello(); }
diff --git a/src/test/run-pass/int.rs b/src/test/run-pass/int.rs
index 2d2422d9f87..2c91b5920b7 100644
--- a/src/test/run-pass/int.rs
+++ b/src/test/run-pass/int.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: int = 10; }
\ No newline at end of file
+fn main() { let x: int = 10; }
diff --git a/src/test/run-pass/integral-indexing.rs b/src/test/run-pass/integral-indexing.rs
index d03963df2ed..ed17e36bcb2 100644
--- a/src/test/run-pass/integral-indexing.rs
+++ b/src/test/run-pass/integral-indexing.rs
@@ -3,7 +3,7 @@
 
 // This is a testcase for issue #94.
 fn main() {
-    let v: [int] = ~[0, 1, 2, 3, 4, 5];
+    let v: [int] = [0, 1, 2, 3, 4, 5];
     let s: str = "abcdef";
     assert (v[3u] == 3);
     assert (v[3u8] == 3);
diff --git a/src/test/run-pass/interior-vec.rs b/src/test/run-pass/interior-vec.rs
index 15186078343..4c722b3cc64 100644
--- a/src/test/run-pass/interior-vec.rs
+++ b/src/test/run-pass/interior-vec.rs
@@ -5,25 +5,24 @@ native "rust-intrinsic" mod rusti {
 }
 
 fn main() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     assert (ivec_len(v) == 0u); // zero-length
-    let x = ~[1, 2];
+    let x = [1, 2];
     assert (ivec_len(x) == 2u); // on stack
-    let y = ~[1, 2, 3, 4, 5];
+    let y = [1, 2, 3, 4, 5];
     assert (ivec_len(y) == 5u); // on heap
 
-    v += ~[];
+    v += [];
     assert (ivec_len(v) == 0u); // zero-length append
-    x += ~[3];
+    x += [3];
     assert (ivec_len(x) == 3u); // on-stack append
-    y += ~[6, 7, 8, 9];
+    y += [6, 7, 8, 9];
     assert (ivec_len(y) == 9u); // on-heap append
 
     let vv = v + v;
     assert (ivec_len(vv) == 0u); // zero-length add
-    let xx = x + ~[4];
+    let xx = x + [4];
     assert (ivec_len(xx) == 4u); // on-stack add
-    let yy = y + ~[10, 11];
+    let yy = y + [10, 11];
     assert (ivec_len(yy) == 11u); // on-heap add
 }
-
diff --git a/src/test/run-pass/issue-506.rs b/src/test/run-pass/issue-506.rs
index 3487c1a7f37..1fb76cfd62b 100644
--- a/src/test/run-pass/issue-506.rs
+++ b/src/test/run-pass/issue-506.rs
@@ -9,11 +9,6 @@ native "rust" mod rustrt {
     fn task_yield();
 }
 
-fn yield_wrap() {
-    rustrt::task_yield();
-}
+fn yield_wrap() { rustrt::task_yield(); }
 
-fn main() {
-    let f = yield_wrap;
-    task::_spawn(f);
-}
+fn main() { let f = yield_wrap; task::_spawn(f); }
diff --git a/src/test/run-pass/issue-687.rs b/src/test/run-pass/issue-687.rs
index 8b9fef446da..2b6c2d9938b 100644
--- a/src/test/run-pass/issue-687.rs
+++ b/src/test/run-pass/issue-687.rs
@@ -10,8 +10,8 @@ import std::comm::send;
 tag msg { closed; received([u8]); }
 
 fn producer(c: _chan<[u8]>) {
-    send(c, ~[1u8, 2u8, 3u8, 4u8]);
-    let empty: [u8] = ~[];
+    send(c, [1u8, 2u8, 3u8, 4u8]);
+    let empty: [u8] = [];
     send(c, empty);
 }
 
@@ -22,10 +22,7 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) {
         log "waiting for bytes";
         let data = p.recv();
         log "got bytes";
-        if vec::len(data) == 0u {
-            log "got empty bytes, quitting";
-            break;
-        }
+        if vec::len(data) == 0u { log "got empty bytes, quitting"; break; }
         log "sending non-empty buffer of length";
         log vec::len(data);
         send(msg, received(data));
@@ -39,8 +36,8 @@ fn packager(cb: _chan<_chan<[u8]>>, msg: _chan<msg>) {
 fn main() {
     let p: _port<msg> = mk_port();
     let recv_reader: _port<_chan<[u8]>> = mk_port();
-    let pack = task::_spawn(bind packager(recv_reader.mk_chan(),
-                                          p.mk_chan()));
+    let pack =
+        task::_spawn(bind packager(recv_reader.mk_chan(), p.mk_chan()));
 
     let source_chan: _chan<[u8]> = recv_reader.recv();
     let prod = task::_spawn(bind producer(source_chan));
diff --git a/src/test/run-pass/item-attributes.rs b/src/test/run-pass/item-attributes.rs
index 8d34414cc07..352fa4ac53e 100644
--- a/src/test/run-pass/item-attributes.rs
+++ b/src/test/run-pass/item-attributes.rs
@@ -167,7 +167,7 @@ mod test_distinguish_syntax_ext {
     use std;
 
     fn f() {
-        #fmt("test%s", "s");
+        #fmt["test%s", "s"];
         #[attr = "val"]
         fn g() { }
     }
diff --git a/src/test/run-pass/item-name-overload.rs b/src/test/run-pass/item-name-overload.rs
index 489fe8c39a3..02930d65cfa 100644
--- a/src/test/run-pass/item-name-overload.rs
+++ b/src/test/run-pass/item-name-overload.rs
@@ -10,4 +10,4 @@ mod bar {
     fn baz() { }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/ivec-add.rs b/src/test/run-pass/ivec-add.rs
index 8dd2c32f86b..17b0a77d6ad 100644
--- a/src/test/run-pass/ivec-add.rs
+++ b/src/test/run-pass/ivec-add.rs
@@ -1,14 +1,14 @@
-fn double<T>(a: &T) -> [T] { ret ~[a] + ~[a]; }
+fn double<T>(a: &T) -> [T] { ret [a] + [a]; }
 
-fn double_int(a: int) -> [int] { ret ~[a] + ~[a]; }
+fn double_int(a: int) -> [int] { ret [a] + [a]; }
 
 fn main() {
     let d = double(1);
-    assert (d.(0) == 1);
-    assert (d.(1) == 1);
+    assert (d[0] == 1);
+    assert (d[1] == 1);
 
     d = double_int(1);
-    assert (d.(0) == 1);
-    assert (d.(1) == 1);
+    assert (d[0] == 1);
+    assert (d[1] == 1);
 }
 
diff --git a/src/test/run-pass/ivec-pass-by-value.rs b/src/test/run-pass/ivec-pass-by-value.rs
index 213e1384658..557c3dc9b3e 100644
--- a/src/test/run-pass/ivec-pass-by-value.rs
+++ b/src/test/run-pass/ivec-pass-by-value.rs
@@ -1,3 +1,3 @@
 fn f(a: [int]) { }
-fn main() { f(~[1, 2, 3, 4, 5]); }
+fn main() { f([1, 2, 3, 4, 5]); }
 
diff --git a/src/test/run-pass/ivec-tag.rs b/src/test/run-pass/ivec-tag.rs
index 41cc89aed7e..5efe202b66e 100644
--- a/src/test/run-pass/ivec-tag.rs
+++ b/src/test/run-pass/ivec-tag.rs
@@ -8,8 +8,9 @@ import std::comm::mk_port;
 import std::comm::send;
 
 fn producer(c: _chan<[u8]>) {
-    send(c, ~[1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8,
-              8u8, 9u8, 10u8, 11u8, 12u8, 13u8 ]);
+    send(c,
+         [1u8, 2u8, 3u8, 4u8, 5u8, 6u8, 7u8, 8u8, 9u8, 10u8, 11u8, 12u8,
+          13u8]);
 }
 
 fn main() {
diff --git a/src/test/run-pass/join.rs b/src/test/run-pass/join.rs
index 5545aadb1fb..91fba0bad40 100644
--- a/src/test/run-pass/join.rs
+++ b/src/test/run-pass/join.rs
@@ -13,4 +13,4 @@ fn main() {
     log_err "3";
 }
 
-fn child() { log_err "2"; }
\ No newline at end of file
+fn child() { log_err "2"; }
diff --git a/src/test/run-pass/lambda-infer-unresolved.rs b/src/test/run-pass/lambda-infer-unresolved.rs
index 921b5568b0b..7bfba99baac 100644
--- a/src/test/run-pass/lambda-infer-unresolved.rs
+++ b/src/test/run-pass/lambda-infer-unresolved.rs
@@ -1,7 +1,7 @@
 // This should typecheck even though the type of e is not fully
 // resolved when we finish typechecking the lambda.
 fn main() {
-    let e = @{mutable refs: ~[], n: 0};
-    let f = lambda() { log_err e.n; };
-    e.refs += ~[1];
+    let e = @{mutable refs: [], n: 0};
+    let f = lambda () { log_err e.n; };
+    e.refs += [1];
 }
diff --git a/src/test/run-pass/lambda-no-leak.rs b/src/test/run-pass/lambda-no-leak.rs
index 183c1ae1446..0643de4bcfb 100644
--- a/src/test/run-pass/lambda-no-leak.rs
+++ b/src/test/run-pass/lambda-no-leak.rs
@@ -2,6 +2,6 @@
 fn force(f: &fn()) { f() }
 fn main() {
     let x = 7;
-    lambda() { log_err x; };
-    force(lambda() { log_err x; });
+    lambda () { log_err x; }
+    force(lambda () { log_err x; });
 }
diff --git a/src/test/run-pass/large-records.rs b/src/test/run-pass/large-records.rs
index 004e3a8c225..8c5afc031d1 100644
--- a/src/test/run-pass/large-records.rs
+++ b/src/test/run-pass/large-records.rs
@@ -30,4 +30,4 @@ fn f() {
          l: 0};
 }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/lazy-and-or.rs b/src/test/run-pass/lazy-and-or.rs
index 348ce5de599..26edb631273 100644
--- a/src/test/run-pass/lazy-and-or.rs
+++ b/src/test/run-pass/lazy-and-or.rs
@@ -9,4 +9,4 @@ fn main() {
     log x || incr(y);
     assert (y == 10);
     if true && x { assert (true); } else { assert (false); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/lazy-init.rs b/src/test/run-pass/lazy-init.rs
index d36ad1b387f..b5f53400229 100644
--- a/src/test/run-pass/lazy-init.rs
+++ b/src/test/run-pass/lazy-init.rs
@@ -2,4 +2,4 @@
 
 fn foo(x: int) { log x; }
 
-fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); }
\ No newline at end of file
+fn main() { let x: int; if 1 > 2 { x = 12; } else { x = 10; } foo(x); }
diff --git a/src/test/run-pass/leak-tag-copy.rs b/src/test/run-pass/leak-tag-copy.rs
index 48b11174da5..7c5eb538bc2 100644
--- a/src/test/run-pass/leak-tag-copy.rs
+++ b/src/test/run-pass/leak-tag-copy.rs
@@ -2,4 +2,4 @@
 
 tag t { a; b(@int); }
 
-fn main() { let x = b(@10); x = a; }
\ No newline at end of file
+fn main() { let x = b(@10); x = a; }
diff --git a/src/test/run-pass/let-destruct-fresh-mem.rs b/src/test/run-pass/let-destruct-fresh-mem.rs
index fa2798ecc66..9a41ef7f084 100644
--- a/src/test/run-pass/let-destruct-fresh-mem.rs
+++ b/src/test/run-pass/let-destruct-fresh-mem.rs
@@ -1,10 +1,10 @@
 fn main() {
     let u = {x: 10, y: @{a: 20}};
-    let {x, y: @{a}} = u;
+    let {x: x, y: @{a: a}} = u;
     x = 100;
     a = 100;
-    assert x == 100;
-    assert a == 100;
-    assert u.x == 10;
-    assert u.y.a == 20;
+    assert (x == 100);
+    assert (a == 100);
+    assert (u.x == 10);
+    assert (u.y.a == 20);
 }
diff --git a/src/test/run-pass/let-destruct.rs b/src/test/run-pass/let-destruct.rs
index 7d59645ff04..bdc7c6a798c 100644
--- a/src/test/run-pass/let-destruct.rs
+++ b/src/test/run-pass/let-destruct.rs
@@ -1,8 +1,6 @@
-tag xx {
-    xx(int);
-}
+tag xx = int;
 
 fn main() {
-    let @{x:xx(x), y} = @{x: xx(10), y: 20};
-    assert x + y == 30;
+    let @{x: xx(x), y: y} = @{x: xx(10), y: 20};
+    assert (x + y == 30);
 }
diff --git a/src/test/run-pass/linear-for-loop.rs b/src/test/run-pass/linear-for-loop.rs
index a36848106f6..319ce032d8d 100644
--- a/src/test/run-pass/linear-for-loop.rs
+++ b/src/test/run-pass/linear-for-loop.rs
@@ -1,7 +1,7 @@
 
 
 fn main() {
-    let x = ~[1, 2, 3];
+    let x = [1, 2, 3];
     let y = 0;
     for i: int in x { log i; y += i; }
     log y;
diff --git a/src/test/run-pass/list.rs b/src/test/run-pass/list.rs
index e81c0d12fd2..272ec4b3b6f 100644
--- a/src/test/run-pass/list.rs
+++ b/src/test/run-pass/list.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 tag list { cons(int, @list); nil; }
 
-fn main() { cons(10, @cons(11, @cons(12, @nil))); }
\ No newline at end of file
+fn main() { cons(10, @cons(11, @cons(12, @nil))); }
diff --git a/src/test/run-pass/log-err-phi.rs b/src/test/run-pass/log-err-phi.rs
index 0623daed212..0317f90573b 100644
--- a/src/test/run-pass/log-err-phi.rs
+++ b/src/test/run-pass/log-err-phi.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { if false { log_err "foo" + "bar"; } }
\ No newline at end of file
+fn main() { if false { log_err "foo" + "bar"; } }
diff --git a/src/test/run-pass/long-while.rs b/src/test/run-pass/long-while.rs
index 59cbd10d64a..4e68287b18f 100644
--- a/src/test/run-pass/long-while.rs
+++ b/src/test/run-pass/long-while.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } }
\ No newline at end of file
+fn main() { let i: int = 0; while i < 1000000 { i += 1; let x = 3; } }
diff --git a/src/test/run-pass/loop-scope.rs b/src/test/run-pass/loop-scope.rs
index fc5618d823d..85d39ee0bbc 100644
--- a/src/test/run-pass/loop-scope.rs
+++ b/src/test/run-pass/loop-scope.rs
@@ -1,5 +1,5 @@
 fn main() {
-    let x = ~[10, 20, 30];
+    let x = [10, 20, 30];
     let sum = 0;
     for x in x { sum += x; }
     assert (sum == 60);
diff --git a/src/test/run-pass/macro-2.rs b/src/test/run-pass/macro-2.rs
index 4aae975a5e9..497742e9e4f 100644
--- a/src/test/run-pass/macro-2.rs
+++ b/src/test/run-pass/macro-2.rs
@@ -1,5 +1,9 @@
 fn main() {
-  #macro([#mylambda[x,body], {fn f(x: int) -> int { ret body }; f}]);
+    #macro[[#mylambda[x, body],
+            {
+                fn f(x: int) -> int { ret body }
+                f
+            }]];
 
-  assert(#mylambda[y,y*2](8) == 16);
-}
\ No newline at end of file
+    assert (#mylambda[y, y * 2](8) == 16);
+}
diff --git a/src/test/run-pass/macro-3.rs b/src/test/run-pass/macro-3.rs
index f143c4f058f..3e8de676073 100644
--- a/src/test/run-pass/macro-3.rs
+++ b/src/test/run-pass/macro-3.rs
@@ -1,5 +1,5 @@
 fn main() {
-  #macro([#trivial[], 1*2*4*2*1]);
+    #macro[[#trivial[], 1 * 2 * 4 * 2 * 1]];
 
-  assert(#trivial[] == 16);
+    assert (#trivial[] == 16);
 }
diff --git a/src/test/run-pass/macro-by-example-1.rs b/src/test/run-pass/macro-by-example-1.rs
index 08e5c4e249f..520adef92eb 100644
--- a/src/test/run-pass/macro-by-example-1.rs
+++ b/src/test/run-pass/macro-by-example-1.rs
@@ -1,7 +1,7 @@
 fn main() {
-    #macro([#apply[f, [x, ...]], f(x, ...)]);
+    #macro[[#apply[f, [x, ...]], f(x, ...)]];
 
     fn add(a: int, b: int) -> int { ret a + b; }
 
     assert (#apply[add, [1, 15]] == 16);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/macro-by-example-2.rs b/src/test/run-pass/macro-by-example-2.rs
index 58da59e2a7c..e1a7b97e888 100644
--- a/src/test/run-pass/macro-by-example-2.rs
+++ b/src/test/run-pass/macro-by-example-2.rs
@@ -1,6 +1,6 @@
 fn main() {
-    #macro([#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]],
-           [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]);
+    #macro[[#zip_or_unzip[[x, ...], [y, ...]], [[x, y], ...]],
+           [#zip_or_unzip[[xx, yy], ...], [[xx, ...], [yy, ...]]]];
 
 
     assert (#zip_or_unzip[[1, 2, 3, 4], [5, 6, 7, 8]] ==
@@ -9,41 +9,38 @@ fn main() {
                 [[1, 2, 3, 4], [5, 6, 7, 8]]);
 
 
-    #macro([#nested[[[x, ...], ...], [[y, ...], ...]],
-            [[[x, y], ...], ...]]);
+    #macro[[#nested[[[x, ...], ...], [[y, ...], ...]], [[[x, y], ...], ...]]];
     assert (#nested[[[1, 2, 3, 4, 5], [7, 8, 9, 10, 11, 12]],
                     [[-1, -2, -3, -4, -5], [-7, -8, -9, -10, -11, -12]]] ==
                 [[[1, -1], [2, -2], [3, -3], [4, -4], [5, -5]],
                  [[7, -7], [8, -8], [9, -9], [10, -10], [11, -11],
                   [12, -12]]]);
 
-    #macro([#dup[y, [x, ...]], [[y, x], ...]]);
+    #macro[[#dup[y, [x, ...]], [[y, x], ...]]];
 
     assert (#dup[1, [1, 2, 3, 4]] == [[1, 1], [1, 2], [1, 3], [1, 4]]);
 
 
-    #macro([#lambda[x, #<t>, body, #<s>],
+    #macro[[#lambda[x, #<t>, body, #<s>],
             {
                 fn result(x: t) -> s { ret body }
                 result
-            }]);
+            }]];
 
 
-    assert ((#lambda[i, #<uint>, i + 4u, #<uint>])(12u) == 16u);
+    assert (#lambda[i, #<uint>, i + 4u, #<uint>](12u) == 16u);
 
-    #macro[[#sum[x, xs, ...], x + #sum[xs, ...]],
-           [#sum[], 0]];
+    #macro[[#sum[x, xs, ...], x + #sum[xs, ...]], [#sum[], 0]];
 
-    assert (#sum[1,2,3,4] == 10);
+    assert (#sum[1, 2, 3, 4] == 10);
 
 
     #macro[[#transcr_mixed[a, as, ...], #sum[6, as, ...] * a]];
 
     assert (#transcr_mixed[10, 5, 4, 3, 2, 1] == 210);
 
-    #macro[[#surround[pre, [xs, ...], post],
-            [pre, xs, ..., post]]];
+    #macro[[#surround[pre, [xs, ...], post], [pre, xs, ..., post]]];
 
-    assert (#surround[1, [2,3,4], 5] == [1,2,3,4,5]);
+    assert (#surround[1, [2, 3, 4], 5] == [1, 2, 3, 4, 5]);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/macro.rs b/src/test/run-pass/macro.rs
index 1b561e3c487..66f2ccc6a89 100644
--- a/src/test/run-pass/macro.rs
+++ b/src/test/run-pass/macro.rs
@@ -1,4 +1 @@
-fn main() {
-  #macro[[#m1[a], a*4]];
-  assert (#m1[2] == 8);
-}
+fn main() { #macro[[#m1[a], a * 4]]; assert (#m1[2] == 8); }
diff --git a/src/test/run-pass/main-ivec.rs b/src/test/run-pass/main-ivec.rs
index e3d1403411b..ec2403a9151 100644
--- a/src/test/run-pass/main-ivec.rs
+++ b/src/test/run-pass/main-ivec.rs
@@ -1,3 +1 @@
-fn main(args: [str]) {
-    for s in args { log s }
-}
\ No newline at end of file
+fn main(args: [str]) { for s in args { log s } }
diff --git a/src/test/run-pass/many.rs b/src/test/run-pass/many.rs
index 3413c6a3147..76cbc9fa19a 100644
--- a/src/test/run-pass/many.rs
+++ b/src/test/run-pass/many.rs
@@ -5,21 +5,21 @@ import std::task;
 import std::comm;
 
 fn sub(parent: comm::_chan<int>, id: int) {
-  if (id == 0) {
-      comm::send(parent, 0);
-  } else {
-      let p = comm::mk_port();
-      let child = task::_spawn(bind sub(p.mk_chan(), id-1));
-      let y = p.recv();
-      comm::send(parent, y + 1);
-  }
+    if id == 0 {
+        comm::send(parent, 0);
+    } else {
+        let p = comm::mk_port();
+        let child = task::_spawn(bind sub(p.mk_chan(), id - 1));
+        let y = p.recv();
+        comm::send(parent, y + 1);
+    }
 }
 
 fn main() {
-  let p = comm::mk_port();
-  let child = task::_spawn(bind sub(p.mk_chan(), 200));
-  let y = p.recv();
-  log "transmission complete";
-  log y;
-  assert (y == 200);
+    let p = comm::mk_port();
+    let child = task::_spawn(bind sub(p.mk_chan(), 200));
+    let y = p.recv();
+    log "transmission complete";
+    log y;
+    assert (y == 200);
 }
diff --git a/src/test/run-pass/maybe-mutable.rs b/src/test/run-pass/maybe-mutable.rs
index 5c941e7c477..f8436fe0717 100644
--- a/src/test/run-pass/maybe-mutable.rs
+++ b/src/test/run-pass/maybe-mutable.rs
@@ -9,8 +9,8 @@ fn len(v: [mutable? int]) -> uint {
 }
 
 fn main() {
-    let v0 = ~[1, 2, 3, 4, 5];
+    let v0 = [1, 2, 3, 4, 5];
     log len(v0);
-    let v1 = ~[mutable 1, 2, 3, 4, 5];
+    let v1 = [mutable 1, 2, 3, 4, 5];
     log len(v1);
 }
diff --git a/src/test/run-pass/mlist.rs b/src/test/run-pass/mlist.rs
index c6b8de4e400..5b5a2c3fdf0 100644
--- a/src/test/run-pass/mlist.rs
+++ b/src/test/run-pass/mlist.rs
@@ -1,4 +1,4 @@
 // -*- rust -*-
 tag mlist { cons(int, @mlist); nil; }
 
-fn main() { cons(10, @cons(11, @cons(12, @nil))); }
\ No newline at end of file
+fn main() { cons(10, @cons(11, @cons(12, @nil))); }
diff --git a/src/test/run-pass/move-1.rs b/src/test/run-pass/move-1.rs
index d0dcc0b743f..9124bd3e0a9 100644
--- a/src/test/run-pass/move-1.rs
+++ b/src/test/run-pass/move-1.rs
@@ -11,4 +11,4 @@ fn main() {
     assert (test(true, x) == 2);
     assert (test(true, x) == 2);
     assert (test(false, x) == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/move-2.rs b/src/test/run-pass/move-2.rs
index 0f36f5f2865..9309d718b15 100644
--- a/src/test/run-pass/move-2.rs
+++ b/src/test/run-pass/move-2.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); }
\ No newline at end of file
+fn main() { let x = @{x: 1, y: 2, z: 3}; let y <- x; assert (y.y == 2); }
diff --git a/src/test/run-pass/move-4.rs b/src/test/run-pass/move-4.rs
index 6fc6c6b65f5..5a104555375 100644
--- a/src/test/run-pass/move-4.rs
+++ b/src/test/run-pass/move-4.rs
@@ -9,4 +9,4 @@ fn test(foo: @{a: int, b: int, c: int}) -> @{a: int, b: int, c: int} {
     ret quux;
 }
 
-fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); }
\ No newline at end of file
+fn main() { let x = @{a: 1, b: 2, c: 3}; let y = test(x); assert (y.c == 3); }
diff --git a/src/test/run-pass/move-arg-2.rs b/src/test/run-pass/move-arg-2.rs
index 07f40e403ff..9978478f177 100644
--- a/src/test/run-pass/move-arg-2.rs
+++ b/src/test/run-pass/move-arg-2.rs
@@ -1,12 +1,10 @@
-fn test(foo: -@[int]) {
-    assert (foo.(0) == 10);
-}
+fn test(foo: -@[int]) { assert (foo[0] == 10); }
 
 fn main() {
-    let x = @~[10];
+    let x = @[10];
     // Test forgetting a local by move-in
     test(x);
 
     // Test forgetting a temporary by move-in.
-    test(@~[10]);
+    test(@[10]);
 }
diff --git a/src/test/run-pass/move-arg.rs b/src/test/run-pass/move-arg.rs
index 131f69558ea..115d89e2bcd 100644
--- a/src/test/run-pass/move-arg.rs
+++ b/src/test/run-pass/move-arg.rs
@@ -1,8 +1,3 @@
-fn test(foo: -int) {
-    assert (foo == 10);
-}
+fn test(foo: -int) { assert (foo == 10); }
 
-fn main() {
-    let x = 10;
-    test(x);
-}
\ No newline at end of file
+fn main() { let x = 10; test(x); }
diff --git a/src/test/run-pass/move-scalar.rs b/src/test/run-pass/move-scalar.rs
index 2a2c805944e..0594ee91fe1 100644
--- a/src/test/run-pass/move-scalar.rs
+++ b/src/test/run-pass/move-scalar.rs
@@ -4,4 +4,4 @@ fn main() {
     let x: int;
     x <- y;
     assert (x == 42);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/multi-let.rs b/src/test/run-pass/multi-let.rs
index fbc8db94bd0..ab9e6578fc6 100644
--- a/src/test/run-pass/multi-let.rs
+++ b/src/test/run-pass/multi-let.rs
@@ -1,4 +1 @@
-fn main() {
-    let x = 10, y = x;
-    assert (y == 10);
-}
\ No newline at end of file
+fn main() { let x = 10, y = x; assert (y == 10); }
diff --git a/src/test/run-pass/multi-src/bar.rs b/src/test/run-pass/multi-src/bar.rs
index 7b52a9e089a..949a34bb1c2 100644
--- a/src/test/run-pass/multi-src/bar.rs
+++ b/src/test/run-pass/multi-src/bar.rs
@@ -1,3 +1,3 @@
 
 
-fn other() { log "yes"; }
\ No newline at end of file
+fn other() { log "yes"; }
diff --git a/src/test/run-pass/multi-src/foo.rs b/src/test/run-pass/multi-src/foo.rs
index 63305812ef6..2c38317bf1d 100644
--- a/src/test/run-pass/multi-src/foo.rs
+++ b/src/test/run-pass/multi-src/foo.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { log "hello, multi-file world."; bar::other(); }
\ No newline at end of file
+fn main() { log "hello, multi-file world."; bar::other(); }
diff --git a/src/test/run-pass/multiline-comment.rs b/src/test/run-pass/multiline-comment.rs
index 90eaa93fda0..85e80ab201b 100644
--- a/src/test/run-pass/multiline-comment.rs
+++ b/src/test/run-pass/multiline-comment.rs
@@ -6,4 +6,4 @@
 /*
  * This is a /* depth-balanced */ multi-line comment.
  */
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/mutable-alias-vec.rs b/src/test/run-pass/mutable-alias-vec.rs
index b620c2236dc..a185dfd0027 100644
--- a/src/test/run-pass/mutable-alias-vec.rs
+++ b/src/test/run-pass/mutable-alias-vec.rs
@@ -3,10 +3,10 @@
 // -*- rust -*-
 use std;
 
-fn grow(v: &mutable [int]) { v += ~[1]; }
+fn grow(v: &mutable [int]) { v += [1]; }
 
 fn main() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     grow(v);
     grow(v);
     grow(v);
diff --git a/src/test/run-pass/mutable-vec-drop.rs b/src/test/run-pass/mutable-vec-drop.rs
index 58dc936083a..625bcb17f97 100644
--- a/src/test/run-pass/mutable-vec-drop.rs
+++ b/src/test/run-pass/mutable-vec-drop.rs
@@ -2,5 +2,5 @@
 fn main() {
     // This just tests whether the vec leaks its members.
     let pvec: [mutable @{a: int, b: int}] =
-        ~[mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}];
+        [mutable @{a: 1, b: 2}, @{a: 3, b: 4}, @{a: 5, b: 6}];
 }
diff --git a/src/test/run-pass/mutual-recursion-group.rs b/src/test/run-pass/mutual-recursion-group.rs
index 732d3a27177..f21bbf1a435 100644
--- a/src/test/run-pass/mutual-recursion-group.rs
+++ b/src/test/run-pass/mutual-recursion-group.rs
@@ -10,4 +10,4 @@ tag list { cons(@tree, @list); nil; }
 
 tag small_list { kons(int, @small_list); neel; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/native-mod-src/inner.rs b/src/test/run-pass/native-mod-src/inner.rs
index 0842fcb9f27..bee820cf3be 100644
--- a/src/test/run-pass/native-mod-src/inner.rs
+++ b/src/test/run-pass/native-mod-src/inner.rs
@@ -11,4 +11,4 @@ fn main() {
     libc.write(1, buf, 1024);
     libc.close(fd);
     libc.free(buf);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/native-opaque-type.rs b/src/test/run-pass/native-opaque-type.rs
index fa4a5e25e5a..6ec8b4dba6a 100644
--- a/src/test/run-pass/native-opaque-type.rs
+++ b/src/test/run-pass/native-opaque-type.rs
@@ -4,4 +4,4 @@ native "cdecl" mod libc = "" {
     type file_handle;
 }
 
-fn main() { assert (true); }
\ No newline at end of file
+fn main() { assert (true); }
diff --git a/src/test/run-pass/native-src/native.rs b/src/test/run-pass/native-src/native.rs
index eac66adb58a..164c55d0e9f 100644
--- a/src/test/run-pass/native-src/native.rs
+++ b/src/test/run-pass/native-src/native.rs
@@ -6,4 +6,4 @@ fn main() {
     libc.puts(rustrt.str_buf("hello, native world 1"));
     libc.puts(rustrt.str_buf("hello, native world 2"));
     libc.puts(rustrt.str_buf("hello, native world 3"));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/nested-obj-self.rs b/src/test/run-pass/nested-obj-self.rs
index 3ed72d8d8ef..f664ef50ee2 100644
--- a/src/test/run-pass/nested-obj-self.rs
+++ b/src/test/run-pass/nested-obj-self.rs
@@ -25,4 +25,4 @@ fn main() {
     assert (s2 == "foo.m1");
     let s3: str = a.m3();
     assert (s3 == "bar.m1");
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/newtype-polymorphic.rs b/src/test/run-pass/newtype-polymorphic.rs
index 637b1b8103b..fc3002ba662 100644
--- a/src/test/run-pass/newtype-polymorphic.rs
+++ b/src/test/run-pass/newtype-polymorphic.rs
@@ -2,11 +2,11 @@ tag myvec<X> = [X];
 
 fn myvec_deref<X>(mv: &myvec<X>) -> [X] { ret *mv; }
 
-fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv.(0); }
+fn myvec_elt<X>(mv: &myvec<X>) -> X { ret mv[0]; }
 
 fn main() {
-    let mv = myvec(~[1, 2, 3]);
-    assert (myvec_deref(mv).(1) == 2);
+    let mv = myvec([1, 2, 3]);
+    assert (myvec_deref(mv)[1] == 2);
     assert (myvec_elt(mv) == 1);
-    assert (mv.(2) == 3);
+    assert (mv[2] == 3);
 }
diff --git a/src/test/run-pass/newtype.rs b/src/test/run-pass/newtype.rs
index b0e67f4121f..0b0a8c7b2d9 100644
--- a/src/test/run-pass/newtype.rs
+++ b/src/test/run-pass/newtype.rs
@@ -1,8 +1,8 @@
-tag mytype = {compute: fn(&mytype) -> int , val: int};
+tag mytype = {compute: fn(&mytype) -> int, val: int};
 
 fn compute(i: &mytype) -> int { ret i.val + 20; }
 
 fn main() {
     let myval = mytype({compute: compute, val: 30});
     assert (myval.compute(myval) == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/nil-pattern.rs b/src/test/run-pass/nil-pattern.rs
index af499adee57..927ff5be3e5 100644
--- a/src/test/run-pass/nil-pattern.rs
+++ b/src/test/run-pass/nil-pattern.rs
@@ -1 +1 @@
-fn main() { let x = (); alt x { () { } } }
\ No newline at end of file
+fn main() { let x = (); alt x { () { } } }
diff --git a/src/test/run-pass/obj-docs.rs b/src/test/run-pass/obj-docs.rs
index cdda794acff..de5a91e886b 100644
--- a/src/test/run-pass/obj-docs.rs
+++ b/src/test/run-pass/obj-docs.rs
@@ -9,55 +9,42 @@ fn main() {
 
     // Ref.Item.Obj
     obj counter(state: @mutable int) {
-        fn incr() {
-            *state += 1;
-            }
-        fn get() -> int {
-            ret *state;
-            }
-        }
+        fn incr() { *state += 1; }
+        fn get() -> int { ret *state; }
+    }
 
     let c: counter = counter(@mutable 1);
 
     c.incr();
     c.incr();
-    assert c.get() == 3;
+    assert (c.get() == 3);
 
     obj my_obj() {
-        fn get() -> int {
-            ret 3;
-        }
-        fn foo() -> int{
+        fn get() -> int { ret 3; }
+        fn foo() -> int {
             let c = self.get();
             ret c + 2; // returns 5
         }
     }
 
     let o = my_obj();
-    assert o.foo() == 5;
+    assert (o.foo() == 5);
 
     // Ref.Type.Obj
-    type taker = obj {
-        fn take(int);
-    };
+    type taker =
+        obj {
+            fn take(int);
+        };
 
     obj adder(x: @mutable int) {
-        fn take(y: int) {
-            *x += y;
-        }
+        fn take(y: int) { *x += y; }
     }
 
     obj sender(c: _chan<int>) {
-        fn take(z: int) {
-            send(c, z);
-        }
+        fn take(z: int) { send(c, z); }
     }
 
-    fn give_ints(t: taker) {
-        t.take(1);
-        t.take(2);
-        t.take(3);
-    }
+    fn give_ints(t: taker) { t.take(1); t.take(2); t.take(3); }
 
     let p = mk_port::<int>();
 
diff --git a/src/test/run-pass/obj-drop.rs b/src/test/run-pass/obj-drop.rs
index b807fe3dcfc..a823784e1b0 100644
--- a/src/test/run-pass/obj-drop.rs
+++ b/src/test/run-pass/obj-drop.rs
@@ -5,4 +5,4 @@ fn main() {
     // This just tests whether the obj leaks its box state members.
 
     let ob = handle(@0xf00f00);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-recursion.rs b/src/test/run-pass/obj-recursion.rs
index 7110683d9d1..3c4346af32e 100644
--- a/src/test/run-pass/obj-recursion.rs
+++ b/src/test/run-pass/obj-recursion.rs
@@ -2,7 +2,7 @@
 
 type adder =
     obj {
-        fn add() ;
+        fn add();
     };
 
 obj leaf_adder(x: int) {
@@ -16,4 +16,4 @@ obj delegate_adder(a: adder) {
 fn main() {
     let x = delegate_adder(delegate_adder(delegate_adder(leaf_adder(10))));
     x.add();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-2.rs b/src/test/run-pass/obj-self-2.rs
index 8b0dd4b1595..ca33b382792 100644
--- a/src/test/run-pass/obj-self-2.rs
+++ b/src/test/run-pass/obj-self-2.rs
@@ -9,4 +9,4 @@ fn main() {
     let i: int = 0;
     a.m1(i);
     a.m2(i);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-3.rs b/src/test/run-pass/obj-self-3.rs
index fcee2e1a087..29720216bd1 100644
--- a/src/test/run-pass/obj-self-3.rs
+++ b/src/test/run-pass/obj-self-3.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (i == 2);
     i = a.m3(i);
     assert (i == 4);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self-4.rs b/src/test/run-pass/obj-self-4.rs
index 8c52593faa9..e13a39f0998 100644
--- a/src/test/run-pass/obj-self-4.rs
+++ b/src/test/run-pass/obj-self-4.rs
@@ -19,4 +19,4 @@ fn main() {
     assert (rs == 8);
     rs = o.get();
     assert (rs == 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-self.rs b/src/test/run-pass/obj-self.rs
index 6e293fc344a..c6a1b141558 100644
--- a/src/test/run-pass/obj-self.rs
+++ b/src/test/run-pass/obj-self.rs
@@ -8,4 +8,4 @@ fn main() {
     let a = foo();
     a.m1();
     a.m2();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/obj-with-vec.rs b/src/test/run-pass/obj-with-vec.rs
index db4050aaf94..1ce8cbc46bf 100644
--- a/src/test/run-pass/obj-with-vec.rs
+++ b/src/test/run-pass/obj-with-vec.rs
@@ -2,9 +2,9 @@
 
 fn main() {
     obj buf(data: [u8]) {
-        fn get(i: int) -> u8 { ret data.(i); }
+        fn get(i: int) -> u8 { ret data[i]; }
     }
-    let b = buf(~[1 as u8, 2 as u8, 3 as u8]);
+    let b = buf([1 as u8, 2 as u8, 3 as u8]);
     log b.get(1);
     assert (b.get(1) == 2 as u8);
 }
diff --git a/src/test/run-pass/opeq.rs b/src/test/run-pass/opeq.rs
index 03576541d47..b38a6313f54 100644
--- a/src/test/run-pass/opeq.rs
+++ b/src/test/run-pass/opeq.rs
@@ -16,4 +16,4 @@ fn main() {
     x /= 5;
     log x;
     assert (x == 5);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/operator-associativity.rs b/src/test/run-pass/operator-associativity.rs
index 624d431b45a..af8c3ee6228 100644
--- a/src/test/run-pass/operator-associativity.rs
+++ b/src/test/run-pass/operator-associativity.rs
@@ -2,4 +2,4 @@
 
 
 // Testcase for issue #130, operator associativity.
-fn main() { assert (3 * 5 / 2 == 7); }
\ No newline at end of file
+fn main() { assert (3 * 5 / 2 == 7); }
diff --git a/src/test/run-pass/or-pattern.rs b/src/test/run-pass/or-pattern.rs
index 498a6777d9c..99682e0977a 100644
--- a/src/test/run-pass/or-pattern.rs
+++ b/src/test/run-pass/or-pattern.rs
@@ -8,4 +8,4 @@ fn main() {
     assert (or_alt(c) == 0);
     assert (or_alt(a(10, 100, 0u)) == 110);
     assert (or_alt(b(20, 200)) == 220);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/output-slot-variants.rs b/src/test/run-pass/output-slot-variants.rs
index fe318ec539c..41d5b2871b3 100644
--- a/src/test/run-pass/output-slot-variants.rs
+++ b/src/test/run-pass/output-slot-variants.rs
@@ -55,4 +55,4 @@ fn main() {
 
     ext_ext_mem = ret_ext_ext_mem(); // non-initializing
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/over-constrained-vregs.rs b/src/test/run-pass/over-constrained-vregs.rs
index 29840986793..98f4ab7a6d8 100644
--- a/src/test/run-pass/over-constrained-vregs.rs
+++ b/src/test/run-pass/over-constrained-vregs.rs
@@ -2,4 +2,4 @@
 
 
 // Regression test for issue #152.
-fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } }
\ No newline at end of file
+fn main() { let b: uint = 1u; while b <= 32u { 0u << b; b <<= 1u; log b; } }
diff --git a/src/test/run-pass/paren-free.rs b/src/test/run-pass/paren-free.rs
index cde723b835b..4d48c09175a 100644
--- a/src/test/run-pass/paren-free.rs
+++ b/src/test/run-pass/paren-free.rs
@@ -2,4 +2,4 @@ fn main() {
     let x = true;
     if x { let i = 10; while i > 0 { i -= 1; } }
     alt x { true { log "right"; } false { log "wrong"; } }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/parse-fail.rs b/src/test/run-pass/parse-fail.rs
index 3d7b372b9b4..0b4e959c9ee 100644
--- a/src/test/run-pass/parse-fail.rs
+++ b/src/test/run-pass/parse-fail.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn dont_call_me() { fail; log 1; }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/polymorphic-iter.rs b/src/test/run-pass/polymorphic-iter.rs
index 46d3705649e..4f23b58f268 100644
--- a/src/test/run-pass/polymorphic-iter.rs
+++ b/src/test/run-pass/polymorphic-iter.rs
@@ -1,4 +1,2 @@
 iter iter2<@T>() -> T { }
-fn main() {
-    for each i: int in iter2() { }
-}
+fn main() { for each i: int in iter2() { } }
diff --git a/src/test/run-pass/pred-check.rs b/src/test/run-pass/pred-check.rs
index 4f7d6e92ec9..12b1ff5ed73 100644
--- a/src/test/run-pass/pred-check.rs
+++ b/src/test/run-pass/pred-check.rs
@@ -1,4 +1,4 @@
 // -*- rust -*-
 pred f(q: int) -> bool { ret true; }
 
-fn main() { let x = 0; check (f(x)); }
\ No newline at end of file
+fn main() { let x = 0; check (f(x)); }
diff --git a/src/test/run-pass/pred.rs b/src/test/run-pass/pred.rs
index e1ddf1c2ece..5c9a56c904c 100644
--- a/src/test/run-pass/pred.rs
+++ b/src/test/run-pass/pred.rs
@@ -11,4 +11,4 @@ fn main() {
     check (lt(a, c));
     f(a, b);
     f(a, c);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/readalias.rs b/src/test/run-pass/readalias.rs
index 451aa290fa5..93b8b22aef5 100644
--- a/src/test/run-pass/readalias.rs
+++ b/src/test/run-pass/readalias.rs
@@ -6,4 +6,4 @@ type point = {x: int, y: int, z: int};
 
 fn f(p: &point) { assert (p.z == 12); }
 
-fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
\ No newline at end of file
+fn main() { let x: point = {x: 10, y: 11, z: 12}; f(x); }
diff --git a/src/test/run-pass/rebind-fn.rs b/src/test/run-pass/rebind-fn.rs
index b10054de0cd..62d3ca16d11 100644
--- a/src/test/run-pass/rebind-fn.rs
+++ b/src/test/run-pass/rebind-fn.rs
@@ -1,11 +1,8 @@
 fn add(i: int, j: int) -> int { ret i + j; }
-fn binder(n: int) -> fn() -> int {
-    let f = bind add(n, _);
-    ret bind f(2);
-}
+fn binder(n: int) -> fn() -> int { let f = bind add(n, _); ret bind f(2); }
 fn main() {
     binder(5);
     let f = binder(1);
-    assert(f() == 3);
-    assert(binder(8)() == 10);
+    assert (f() == 3);
+    assert (binder(8)() == 10);
 }
diff --git a/src/test/run-pass/rec-auto.rs b/src/test/run-pass/rec-auto.rs
index 4162bebfb92..c23c359d621 100644
--- a/src/test/run-pass/rec-auto.rs
+++ b/src/test/run-pass/rec-auto.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 
 // Issue #50.
-fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; }
\ No newline at end of file
+fn main() { let x = {foo: "hello", bar: "world"}; log x.foo; log x.bar; }
diff --git a/src/test/run-pass/rec-extend.rs b/src/test/run-pass/rec-extend.rs
index 6b307107ab0..cd0d089d28a 100644
--- a/src/test/run-pass/rec-extend.rs
+++ b/src/test/run-pass/rec-extend.rs
@@ -14,4 +14,4 @@ fn main() {
     assert (right.y == 0);
     assert (up.x == 0);
     assert (up.y == 10);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/rec-tup.rs b/src/test/run-pass/rec-tup.rs
index e1656bf17b8..66cf866de9d 100644
--- a/src/test/run-pass/rec-tup.rs
+++ b/src/test/run-pass/rec-tup.rs
@@ -3,14 +3,8 @@ type point = {x: int, y: int};
 
 type rect = (point, point);
 
-fn fst(r: &rect) -> point {
-    let (fst, _) = r;
-    ret fst;
-}
-fn snd(r: &rect) -> point {
-    let (_, snd) = r;
-    ret snd;
-}
+fn fst(r: &rect) -> point { let (fst, _) = r; ret fst; }
+fn snd(r: &rect) -> point { let (_, snd) = r; ret snd; }
 
 fn f(r: rect, x1: int, y1: int, x2: int, y2: int) {
     assert (fst(r).x == x1);
diff --git a/src/test/run-pass/rec.rs b/src/test/run-pass/rec.rs
index b7a3f3a6d84..04867f72fa8 100644
--- a/src/test/run-pass/rec.rs
+++ b/src/test/run-pass/rec.rs
@@ -22,4 +22,4 @@ fn main() {
     assert (x == 10);
     f(r, 10, 20, 100, 200);
     f(r2, 10, 20, 100, 200);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/record-pat.rs b/src/test/run-pass/record-pat.rs
index 794a1a9ee04..f2f4c6af2c7 100644
--- a/src/test/run-pass/record-pat.rs
+++ b/src/test/run-pass/record-pat.rs
@@ -12,4 +12,4 @@ fn m(in: &t3) -> int {
 fn main() {
     assert (m(c({x: a(10), y: 5}, 4u)) == 10);
     assert (m(c({x: b(10u), y: 5}, 4u)) == 19);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/resource-destruct.rs b/src/test/run-pass/resource-destruct.rs
index 8d6d85899b1..25a3c79e1c3 100644
--- a/src/test/run-pass/resource-destruct.rs
+++ b/src/test/run-pass/resource-destruct.rs
@@ -6,4 +6,4 @@ fn main() {
     let my_total = @mutable 10;
     { let pt <- shrinky_pointer(my_total); assert (look_at(pt) == 10); }
     assert (*my_total == 9);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/resource-generic.rs b/src/test/run-pass/resource-generic.rs
index 6ab2eb308b6..34ecc55f2e4 100644
--- a/src/test/run-pass/resource-generic.rs
+++ b/src/test/run-pass/resource-generic.rs
@@ -1,4 +1,4 @@
-resource finish<T>(arg: {val: T, fin: fn(&T) }) { arg.fin(arg.val); }
+resource finish<T>(arg: {val: T, fin: fn(&T)}) { arg.fin(arg.val); }
 
 fn main() {
     let box = @mutable 10;
diff --git a/src/test/run-pass/resource-in-struct.rs b/src/test/run-pass/resource-in-struct.rs
index 6e7e8dc6bfd..758beb3d9e1 100644
--- a/src/test/run-pass/resource-in-struct.rs
+++ b/src/test/run-pass/resource-in-struct.rs
@@ -3,17 +3,15 @@
 
 type closable = @mutable bool;
 
-resource close_res(i: closable) {
-    *i = false;
-}
+resource close_res(i: closable) { *i = false; }
 
 tag option<T> { none; some(T); }
 
-fn sink(res: option<close_res>) {}
+fn sink(res: option<close_res>) { }
 
 fn main() {
     let c = @mutable true;
     sink(none);
     sink(some(close_res(c)));
-    assert !*c;
+    assert (!*c);
 }
diff --git a/src/test/run-pass/ret-bang.rs b/src/test/run-pass/ret-bang.rs
index e668ff9b0bc..55a4c5922c3 100644
--- a/src/test/run-pass/ret-bang.rs
+++ b/src/test/run-pass/ret-bang.rs
@@ -8,4 +8,4 @@ fn okay(i: uint) -> int {
     if i == 3u { my_err("I don't like three"); } else { ret 42; }
 }
 
-fn main() { okay(4u); }
\ No newline at end of file
+fn main() { okay(4u); }
diff --git a/src/test/run-pass/return-nil.rs b/src/test/run-pass/return-nil.rs
index 6e7b9d8b048..a7a55e60971 100644
--- a/src/test/run-pass/return-nil.rs
+++ b/src/test/run-pass/return-nil.rs
@@ -2,4 +2,4 @@
 
 fn f() { let x: () = (); ret x; }
 
-fn main() { let x = f(); }
\ No newline at end of file
+fn main() { let x = f(); }
diff --git a/src/test/run-pass/rt-circular-buffer.rs b/src/test/run-pass/rt-circular-buffer.rs
index 4a6839a8de5..0d84d1abe64 100644
--- a/src/test/run-pass/rt-circular-buffer.rs
+++ b/src/test/run-pass/rt-circular-buffer.rs
@@ -30,7 +30,7 @@ fn test_init() {
 fn test_grow() {
     let myport: comm::_port<record> = comm::mk_port();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val: record = {val1: 0u32, val2: 0u32, val3: 0u32};
         comm::send(mychan, val);
     }
@@ -48,11 +48,11 @@ fn test_shrink1() {
 fn test_shrink2() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val: record = {val1: 0u32, val2: 0u32, val3: 0u32};
         send(mychan, val);
     }
-    for each i: uint  in uint::range(0u, 100u) { let x = myport.recv(); }
+    for each i: uint in uint::range(0u, 100u) { let x = myport.recv(); }
 }
 
 
@@ -60,7 +60,7 @@ fn test_shrink2() {
 fn test_rotate() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each i: uint  in uint::range(0u, 100u) {
+    for each i: uint in uint::range(0u, 100u) {
         let val = {val1: i as u32, val2: i as u32, val3: i as u32};
         send(mychan, val);
         let x = myport.recv();
@@ -76,13 +76,13 @@ fn test_rotate() {
 fn test_rotate_grow() {
     let myport = mk_port::<record>();
     let mychan = myport.mk_chan();
-    for each j: uint  in uint::range(0u, 10u) {
-        for each i: uint  in uint::range(0u, 10u) {
+    for each j: uint in uint::range(0u, 10u) {
+        for each i: uint in uint::range(0u, 10u) {
             let val: record =
                 {val1: i as u32, val2: i as u32, val3: i as u32};
             send(mychan, val);
         }
-        for each i: uint  in uint::range(0u, 10u) {
+        for each i: uint in uint::range(0u, 10u) {
             let x = myport.recv();
             assert (x.val1 == i as u32);
             assert (x.val2 == i as u32);
diff --git a/src/test/run-pass/self-shadowing-import.rs b/src/test/run-pass/self-shadowing-import.rs
index c9b70d35d46..7887990f080 100644
--- a/src/test/run-pass/self-shadowing-import.rs
+++ b/src/test/run-pass/self-shadowing-import.rs
@@ -11,4 +11,4 @@ mod c {
     fn bar() { assert (a::foo() == 1); }
 }
 
-fn main() { c::bar(); }
\ No newline at end of file
+fn main() { c::bar(); }
diff --git a/src/test/run-pass/seq-compare.rs b/src/test/run-pass/seq-compare.rs
index 265c45a101d..79a318eefd2 100644
--- a/src/test/run-pass/seq-compare.rs
+++ b/src/test/run-pass/seq-compare.rs
@@ -4,13 +4,13 @@ fn main() {
     assert ("hello" < "hellr");
     assert ("hello " > "hello");
     assert ("hello" != "there");
-    assert (~[1, 2, 3, 4] > ~[1, 2, 3]);
-    assert (~[1, 2, 3] < ~[1, 2, 3, 4]);
-    assert (~[1, 2, 4, 4] > ~[1, 2, 3, 4]);
-    assert (~[1, 2, 3, 4] < ~[1, 2, 4, 4]);
-    assert (~[1, 2, 3] <= ~[1, 2, 3]);
-    assert (~[1, 2, 3] <= ~[1, 2, 3, 3]);
-    assert (~[1, 2, 3, 4] > ~[1, 2, 3]);
-    assert (~[1, 2, 3] == ~[1, 2, 3]);
-    assert (~[1, 2, 3] != ~[1, 1, 3]);
-}
\ No newline at end of file
+    assert ([1, 2, 3, 4] > [1, 2, 3]);
+    assert ([1, 2, 3] < [1, 2, 3, 4]);
+    assert ([1, 2, 4, 4] > [1, 2, 3, 4]);
+    assert ([1, 2, 3, 4] < [1, 2, 4, 4]);
+    assert ([1, 2, 3] <= [1, 2, 3]);
+    assert ([1, 2, 3] <= [1, 2, 3, 3]);
+    assert ([1, 2, 3, 4] > [1, 2, 3]);
+    assert ([1, 2, 3] == [1, 2, 3]);
+    assert ([1, 2, 3] != [1, 1, 3]);
+}
diff --git a/src/test/run-pass/shadow.rs b/src/test/run-pass/shadow.rs
index e3f86246594..3fc3a015915 100644
--- a/src/test/run-pass/shadow.rs
+++ b/src/test/run-pass/shadow.rs
@@ -1,20 +1,15 @@
 // -*- rust -*-
 fn foo(c: [int]) {
     let a: int = 5;
-    let b: [int] = ~[];
+    let b: [int] = [];
 
 
     alt none::<int> {
-        some::<int>(_) { for i: int in c { log a; let a = 17; b += ~[a]; } }
-      _ {}
+      some::<int>(_) { for i: int in c { log a; let a = 17; b += [a]; } }
+      _ { }
     }
 }
 
 tag t<T> { none; some(T); }
 
-fn main() {
-    let x = 10;
-    let x = x + 20;
-    assert x == 30;
-    foo(~[]);
-}
+fn main() { let x = 10; let x = x + 20; assert (x == 30); foo([]); }
diff --git a/src/test/run-pass/simple-alt-generic-tag.rs b/src/test/run-pass/simple-alt-generic-tag.rs
index 39a9619b1c6..ac0e5ed6994 100644
--- a/src/test/run-pass/simple-alt-generic-tag.rs
+++ b/src/test/run-pass/simple-alt-generic-tag.rs
@@ -3,5 +3,6 @@
 tag opt<T> { none; }
 
 fn main() {
-    let x = none::<int>; alt x { none::<int>. { log "hello world"; } }
+    let x = none::<int>;
+    alt x { none::<int>. { log "hello world"; } }
 }
diff --git a/src/test/run-pass/simple-anon-objs.rs b/src/test/run-pass/simple-anon-objs.rs
index 8525ea8c8a3..5c2315d67d0 100644
--- a/src/test/run-pass/simple-anon-objs.rs
+++ b/src/test/run-pass/simple-anon-objs.rs
@@ -26,4 +26,4 @@ fn main() {
 
     assert (another_anon_obj.baz() == 4);
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/simple-infer.rs b/src/test/run-pass/simple-infer.rs
index 6cf8df90222..03656fc8c1b 100644
--- a/src/test/run-pass/simple-infer.rs
+++ b/src/test/run-pass/simple-infer.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let n; n = 1; log n; }
\ No newline at end of file
+fn main() { let n; n = 1; log n; }
diff --git a/src/test/run-pass/simple-obj.rs b/src/test/run-pass/simple-obj.rs
index 1133cdc7630..6cb4caafe16 100644
--- a/src/test/run-pass/simple-obj.rs
+++ b/src/test/run-pass/simple-obj.rs
@@ -6,4 +6,4 @@ obj x() {
     fn hello() { log "hello, object world"; }
 }
 
-fn main() { let mx = x(); mx.hello(); }
\ No newline at end of file
+fn main() { let mx = x(); mx.hello(); }
diff --git a/src/test/run-pass/size-and-align.rs b/src/test/run-pass/size-and-align.rs
index 8628e359ccb..929ce3500f1 100644
--- a/src/test/run-pass/size-and-align.rs
+++ b/src/test/run-pass/size-and-align.rs
@@ -5,13 +5,13 @@
 tag clam<T> { a(T, int); b; }
 
 fn uhoh<T>(v: &[clam<T>]) {
-    alt v.(1) {
+    alt v[1] {
       a::<T>(t, u) { log "incorrect"; log u; fail; }
       b::<T>. { log "correct"; }
     }
 }
 
 fn main() {
-    let v: [clam<int>] = ~[b::<int>, b::<int>, a::<int>(42, 17)];
+    let v: [clam<int>] = [b::<int>, b::<int>, a::<int>(42, 17)];
     uhoh::<int>(v);
 }
diff --git a/src/test/run-pass/spawn-fn.rs b/src/test/run-pass/spawn-fn.rs
index 26495c4a085..03d450a9cfa 100644
--- a/src/test/run-pass/spawn-fn.rs
+++ b/src/test/run-pass/spawn-fn.rs
@@ -12,4 +12,4 @@ fn main() {
     task::_spawn(bind x("hello from third spawned fn", 67));
     let i: int = 30;
     while i > 0 { i = i - 1; log "parent sleeping"; yield(); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/spawn-module-qualified.rs b/src/test/run-pass/spawn-module-qualified.rs
index 46d0dfee616..f1d1a099ef2 100644
--- a/src/test/run-pass/spawn-module-qualified.rs
+++ b/src/test/run-pass/spawn-module-qualified.rs
@@ -2,12 +2,7 @@ use std;
 import std::task::join_id;
 import std::task::_spawn;
 
-fn main() {
-  let x = _spawn(bind m::child(10));
-  join_id(x);
-}
+fn main() { let x = _spawn(bind m::child(10)); join_id(x); }
 mod m {
-  fn child(i: int) {
-    log i;
-  }
+    fn child(i: int) { log i; }
 }
diff --git a/src/test/run-pass/spawn.rs b/src/test/run-pass/spawn.rs
index 1ef82f24a2d..29126d85018 100644
--- a/src/test/run-pass/spawn.rs
+++ b/src/test/run-pass/spawn.rs
@@ -4,10 +4,7 @@ use std;
 
 import std::task;
 
-fn main() {
-    let t = task::_spawn(bind child(10));
-    task::join_id(t);
-}
+fn main() { let t = task::_spawn(bind child(10)); task::join_id(t); }
 
 fn child(i: int) { log_err i; assert (i == 10); }
 
diff --git a/src/test/run-pass/standalone-method.rs b/src/test/run-pass/standalone-method.rs
index 3fe6763bf97..e9768339433 100644
--- a/src/test/run-pass/standalone-method.rs
+++ b/src/test/run-pass/standalone-method.rs
@@ -1,22 +1,18 @@
 // Test case for issue #435.
 obj foo() {
-    fn add5(n: int) -> int {
-        ret n + 5;
-    }
+    fn add5(n: int) -> int { ret n + 5; }
 }
 
-fn add5(n: int) -> int {
-    ret n + 5;
-}
+fn add5(n: int) -> int { ret n + 5; }
 
 fn main() {
     let fiveplusseven = bind add5(7);
-    assert add5(7) == 12;
-    assert fiveplusseven() == 12;
+    assert (add5(7) == 12);
+    assert (fiveplusseven() == 12);
 
     let my_foo = foo();
     let fiveplusseven_too = bind my_foo.add5(7);
-    assert my_foo.add5(7) == 12;
-    assert fiveplusseven_too() == 12;
+    assert (my_foo.add5(7) == 12);
+    assert (fiveplusseven_too() == 12);
 }
 
diff --git a/src/test/run-pass/stateful-obj.rs b/src/test/run-pass/stateful-obj.rs
index 7e3fa5602b4..97160244d16 100644
--- a/src/test/run-pass/stateful-obj.rs
+++ b/src/test/run-pass/stateful-obj.rs
@@ -16,4 +16,4 @@ fn main() {
     y.incr();
     log y.get();
     assert (y.get() == 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/str-append.rs b/src/test/run-pass/str-append.rs
index a27f729fe5d..e1fa92738cb 100644
--- a/src/test/run-pass/str-append.rs
+++ b/src/test/run-pass/str-append.rs
@@ -8,7 +8,7 @@ fn test1() {
     let s: str = "hello";
     s += "world";
     log s;
-    assert (s.(9) == 'd' as u8);
+    assert (s[9] == 'd' as u8);
 }
 
 fn test2() {
@@ -23,4 +23,4 @@ fn test2() {
     assert (str::eq(b, "ABCabcABC"));
 }
 
-fn main() { test1(); test2(); }
\ No newline at end of file
+fn main() { test1(); test2(); }
diff --git a/src/test/run-pass/str-concat.rs b/src/test/run-pass/str-concat.rs
index 57c0525cfd3..8fc48725875 100644
--- a/src/test/run-pass/str-concat.rs
+++ b/src/test/run-pass/str-concat.rs
@@ -7,5 +7,5 @@ fn main() {
     let b: str = "world";
     let s: str = a + b;
     log s;
-    assert (s.(9) == 'd' as u8);
-}
\ No newline at end of file
+    assert (s[9] == 'd' as u8);
+}
diff --git a/src/test/run-pass/str-growth.rs b/src/test/run-pass/str-growth.rs
index 35d29fec65a..5c0d34b3501 100644
--- a/src/test/run-pass/str-growth.rs
+++ b/src/test/run-pass/str-growth.rs
@@ -3,12 +3,12 @@
 fn main() {
     let s = "a";
     s += "b";
-    assert (s.(0) == 'a' as u8);
-    assert (s.(1) == 'b' as u8);
+    assert (s[0] == 'a' as u8);
+    assert (s[1] == 'b' as u8);
     s += "c";
     s += "d";
-    assert (s.(0) == 'a' as u8);
-    assert (s.(1) == 'b' as u8);
-    assert (s.(2) == 'c' as u8);
-    assert (s.(3) == 'd' as u8);
-}
\ No newline at end of file
+    assert (s[0] == 'a' as u8);
+    assert (s[1] == 'b' as u8);
+    assert (s[2] == 'c' as u8);
+    assert (s[3] == 'd' as u8);
+}
diff --git a/src/test/run-pass/str-idx.rs b/src/test/run-pass/str-idx.rs
index 0c619a213fa..4b5ea5f7961 100644
--- a/src/test/run-pass/str-idx.rs
+++ b/src/test/run-pass/str-idx.rs
@@ -5,4 +5,4 @@ fn main() {
     let c: u8 = s[4];
     log c;
     assert (c == 0x6f as u8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/str-multiline.rs b/src/test/run-pass/str-multiline.rs
index 45d6ad632ba..15a13083321 100644
--- a/src/test/run-pass/str-multiline.rs
+++ b/src/test/run-pass/str-multiline.rs
@@ -14,4 +14,4 @@ is a test";
                test";
     assert (str::eq(a, "this is a test"));
     assert (str::eq(b, "this is another test"));
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/string-self-append.rs b/src/test/run-pass/string-self-append.rs
index 3b15df94ce4..94a9696adf0 100644
--- a/src/test/run-pass/string-self-append.rs
+++ b/src/test/run-pass/string-self-append.rs
@@ -13,4 +13,4 @@ fn main() {
         i -= 1;
         expected_len *= 2u;
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/structured-compare-recursive.rs b/src/test/run-pass/structured-compare-recursive.rs
index bc8bb76a480..cee650ed40e 100644
--- a/src/test/run-pass/structured-compare-recursive.rs
+++ b/src/test/run-pass/structured-compare-recursive.rs
@@ -2,4 +2,4 @@
 
 tag taggy { foo(@taggy); bar; }
 
-fn main() { assert (bar <= bar); }
\ No newline at end of file
+fn main() { assert (bar <= bar); }
diff --git a/src/test/run-pass/structured-compare.rs b/src/test/run-pass/structured-compare.rs
index e2d95a54575..04bc1d75da8 100644
--- a/src/test/run-pass/structured-compare.rs
+++ b/src/test/run-pass/structured-compare.rs
@@ -16,4 +16,4 @@ fn main() {
     assert (x != y);
     assert (x == large);
     assert (x != small);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/swap-1.rs b/src/test/run-pass/swap-1.rs
index 62b557eba63..c9fc58a93aa 100644
--- a/src/test/run-pass/swap-1.rs
+++ b/src/test/run-pass/swap-1.rs
@@ -1 +1 @@
-fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); }
\ No newline at end of file
+fn main() { let x = 3; let y = 7; x <-> y; assert (x == 7); assert (y == 3); }
diff --git a/src/test/run-pass/swap-2.rs b/src/test/run-pass/swap-2.rs
index 155d71399e5..5caf36f9b92 100644
--- a/src/test/run-pass/swap-2.rs
+++ b/src/test/run-pass/swap-2.rs
@@ -1,12 +1,12 @@
-fn swap<@T>(v: &[mutable T], i: int, j: int) { v.(i) <-> v.(j); }
+fn swap<@T>(v: &[mutable T], i: int, j: int) { v[i] <-> v[j]; }
 
 fn main() {
-    let a: [mutable int] = ~[mutable 0, 1, 2, 3, 4, 5, 6];
+    let a: [mutable int] = [mutable 0, 1, 2, 3, 4, 5, 6];
     swap(a, 2, 4);
-    assert (a.(2) == 4);
-    assert (a.(4) == 2);
+    assert (a[2] == 4);
+    assert (a[4] == 2);
     let n = 42;
-    n <-> a.(0);
-    assert (a.(0) == 42);
+    n <-> a[0];
+    assert (a[0] == 42);
     assert (n == 0);
 }
diff --git a/src/test/run-pass/syntax-extension-fmt.rs b/src/test/run-pass/syntax-extension-fmt.rs
index 22033e2acf2..c241a68e7f1 100644
--- a/src/test/run-pass/syntax-extension-fmt.rs
+++ b/src/test/run-pass/syntax-extension-fmt.rs
@@ -8,10 +8,10 @@ fn test(actual: str, expected: str) {
 }
 
 fn main() {
-    test(#fmt("hello %d friends and %s things", 10, "formatted"),
+    test(#fmt["hello %d friends and %s things", 10, "formatted"],
          "hello 10 friends and formatted things");
 
-    test(#fmt("test"), "test");
+    test(#fmt["test"], "test");
 
     // a quadratic optimization in LLVM (jump-threading) makes this test a
     // bit slow to compile unless we break it up
@@ -26,192 +26,192 @@ fn main() {
 fn part1() {
     // Simple tests for types
 
-    test(#fmt("%d", 1), "1");
-    test(#fmt("%i", 2), "2");
-    test(#fmt("%i", -1), "-1");
-    test(#fmt("%u", 10u), "10");
-    test(#fmt("%s", "test"), "test");
-    test(#fmt("%b", true), "true");
-    test(#fmt("%b", false), "false");
-    test(#fmt("%c", 'A'), "A");
-    test(#fmt("%x", 0xff_u), "ff");
-    test(#fmt("%X", 0x12ab_u), "12AB");
-    test(#fmt("%o", 10u), "12");
-    test(#fmt("%t", 0b11010101_u), "11010101");
+    test(#fmt["%d", 1], "1");
+    test(#fmt["%i", 2], "2");
+    test(#fmt["%i", -1], "-1");
+    test(#fmt["%u", 10u], "10");
+    test(#fmt["%s", "test"], "test");
+    test(#fmt["%b", true], "true");
+    test(#fmt["%b", false], "false");
+    test(#fmt["%c", 'A'], "A");
+    test(#fmt["%x", 0xff_u], "ff");
+    test(#fmt["%X", 0x12ab_u], "12AB");
+    test(#fmt["%o", 10u], "12");
+    test(#fmt["%t", 0b11010101_u], "11010101");
     // 32-bit limits
 
-    test(#fmt("%i", -2147483648), "-2147483648");
-    test(#fmt("%i", 2147483647), "2147483647");
-    test(#fmt("%u", 4294967295u), "4294967295");
-    test(#fmt("%x", 0xffffffff_u), "ffffffff");
-    test(#fmt("%o", 0xffffffff_u), "37777777777");
-    test(#fmt("%t", 0xffffffff_u), "11111111111111111111111111111111");
+    test(#fmt["%i", -2147483648], "-2147483648");
+    test(#fmt["%i", 2147483647], "2147483647");
+    test(#fmt["%u", 4294967295u], "4294967295");
+    test(#fmt["%x", 0xffffffff_u], "ffffffff");
+    test(#fmt["%o", 0xffffffff_u], "37777777777");
+    test(#fmt["%t", 0xffffffff_u], "11111111111111111111111111111111");
 }
 fn part2() {
     // Widths
 
-    test(#fmt("%1d", 500), "500");
-    test(#fmt("%10d", 500), "       500");
-    test(#fmt("%10d", -500), "      -500");
-    test(#fmt("%10u", 500u), "       500");
-    test(#fmt("%10s", "test"), "      test");
-    test(#fmt("%10b", true), "      true");
-    test(#fmt("%10x", 0xff_u), "        ff");
-    test(#fmt("%10X", 0xff_u), "        FF");
-    test(#fmt("%10o", 10u), "        12");
-    test(#fmt("%10t", 0xff_u), "  11111111");
-    test(#fmt("%10c", 'A'), "         A");
+    test(#fmt["%1d", 500], "500");
+    test(#fmt["%10d", 500], "       500");
+    test(#fmt["%10d", -500], "      -500");
+    test(#fmt["%10u", 500u], "       500");
+    test(#fmt["%10s", "test"], "      test");
+    test(#fmt["%10b", true], "      true");
+    test(#fmt["%10x", 0xff_u], "        ff");
+    test(#fmt["%10X", 0xff_u], "        FF");
+    test(#fmt["%10o", 10u], "        12");
+    test(#fmt["%10t", 0xff_u], "  11111111");
+    test(#fmt["%10c", 'A'], "         A");
     // Left justify
 
-    test(#fmt("%-10d", 500), "500       ");
-    test(#fmt("%-10d", -500), "-500      ");
-    test(#fmt("%-10u", 500u), "500       ");
-    test(#fmt("%-10s", "test"), "test      ");
-    test(#fmt("%-10b", true), "true      ");
-    test(#fmt("%-10x", 0xff_u), "ff        ");
-    test(#fmt("%-10X", 0xff_u), "FF        ");
-    test(#fmt("%-10o", 10u), "12        ");
-    test(#fmt("%-10t", 0xff_u), "11111111  ");
-    test(#fmt("%-10c", 'A'), "A         ");
+    test(#fmt["%-10d", 500], "500       ");
+    test(#fmt["%-10d", -500], "-500      ");
+    test(#fmt["%-10u", 500u], "500       ");
+    test(#fmt["%-10s", "test"], "test      ");
+    test(#fmt["%-10b", true], "true      ");
+    test(#fmt["%-10x", 0xff_u], "ff        ");
+    test(#fmt["%-10X", 0xff_u], "FF        ");
+    test(#fmt["%-10o", 10u], "12        ");
+    test(#fmt["%-10t", 0xff_u], "11111111  ");
+    test(#fmt["%-10c", 'A'], "A         ");
 }
 
 fn part3() {
     // Precision
 
-    test(#fmt("%.d", 0), "");
-    test(#fmt("%.u", 0u), "");
-    test(#fmt("%.x", 0u), "");
-    test(#fmt("%.t", 0u), "");
-    test(#fmt("%.d", 10), "10");
-    test(#fmt("%.d", -10), "-10");
-    test(#fmt("%.u", 10u), "10");
-    test(#fmt("%.s", "test"), "");
-    test(#fmt("%.x", 127u), "7f");
-    test(#fmt("%.o", 10u), "12");
-    test(#fmt("%.t", 3u), "11");
-    test(#fmt("%.c", 'A'), "A");
-    test(#fmt("%.0d", 0), "");
-    test(#fmt("%.0u", 0u), "");
-    test(#fmt("%.0x", 0u), "");
-    test(#fmt("%.0t", 0u), "");
-    test(#fmt("%.0d", 10), "10");
-    test(#fmt("%.0d", -10), "-10");
-    test(#fmt("%.0u", 10u), "10");
-    test(#fmt("%.0s", "test"), "");
-    test(#fmt("%.0x", 127u), "7f");
-    test(#fmt("%.0o", 10u), "12");
-    test(#fmt("%.0t", 3u), "11");
-    test(#fmt("%.0c", 'A'), "A");
-    test(#fmt("%.1d", 0), "0");
-    test(#fmt("%.1u", 0u), "0");
-    test(#fmt("%.1x", 0u), "0");
-    test(#fmt("%.1t", 0u), "0");
-    test(#fmt("%.1d", 10), "10");
-    test(#fmt("%.1d", -10), "-10");
-    test(#fmt("%.1u", 10u), "10");
-    test(#fmt("%.1s", "test"), "t");
-    test(#fmt("%.1x", 127u), "7f");
-    test(#fmt("%.1o", 10u), "12");
-    test(#fmt("%.1t", 3u), "11");
-    test(#fmt("%.1c", 'A'), "A");
+    test(#fmt["%.d", 0], "");
+    test(#fmt["%.u", 0u], "");
+    test(#fmt["%.x", 0u], "");
+    test(#fmt["%.t", 0u], "");
+    test(#fmt["%.d", 10], "10");
+    test(#fmt["%.d", -10], "-10");
+    test(#fmt["%.u", 10u], "10");
+    test(#fmt["%.s", "test"], "");
+    test(#fmt["%.x", 127u], "7f");
+    test(#fmt["%.o", 10u], "12");
+    test(#fmt["%.t", 3u], "11");
+    test(#fmt["%.c", 'A'], "A");
+    test(#fmt["%.0d", 0], "");
+    test(#fmt["%.0u", 0u], "");
+    test(#fmt["%.0x", 0u], "");
+    test(#fmt["%.0t", 0u], "");
+    test(#fmt["%.0d", 10], "10");
+    test(#fmt["%.0d", -10], "-10");
+    test(#fmt["%.0u", 10u], "10");
+    test(#fmt["%.0s", "test"], "");
+    test(#fmt["%.0x", 127u], "7f");
+    test(#fmt["%.0o", 10u], "12");
+    test(#fmt["%.0t", 3u], "11");
+    test(#fmt["%.0c", 'A'], "A");
+    test(#fmt["%.1d", 0], "0");
+    test(#fmt["%.1u", 0u], "0");
+    test(#fmt["%.1x", 0u], "0");
+    test(#fmt["%.1t", 0u], "0");
+    test(#fmt["%.1d", 10], "10");
+    test(#fmt["%.1d", -10], "-10");
+    test(#fmt["%.1u", 10u], "10");
+    test(#fmt["%.1s", "test"], "t");
+    test(#fmt["%.1x", 127u], "7f");
+    test(#fmt["%.1o", 10u], "12");
+    test(#fmt["%.1t", 3u], "11");
+    test(#fmt["%.1c", 'A'], "A");
 }
 fn part4() {
-    test(#fmt("%.5d", 0), "00000");
-    test(#fmt("%.5u", 0u), "00000");
-    test(#fmt("%.5x", 0u), "00000");
-    test(#fmt("%.5t", 0u), "00000");
-    test(#fmt("%.5d", 10), "00010");
-    test(#fmt("%.5d", -10), "-00010");
-    test(#fmt("%.5u", 10u), "00010");
-    test(#fmt("%.5s", "test"), "test");
-    test(#fmt("%.5x", 127u), "0007f");
-    test(#fmt("%.5o", 10u), "00012");
-    test(#fmt("%.5t", 3u), "00011");
-    test(#fmt("%.5c", 'A'), "A");
+    test(#fmt["%.5d", 0], "00000");
+    test(#fmt["%.5u", 0u], "00000");
+    test(#fmt["%.5x", 0u], "00000");
+    test(#fmt["%.5t", 0u], "00000");
+    test(#fmt["%.5d", 10], "00010");
+    test(#fmt["%.5d", -10], "-00010");
+    test(#fmt["%.5u", 10u], "00010");
+    test(#fmt["%.5s", "test"], "test");
+    test(#fmt["%.5x", 127u], "0007f");
+    test(#fmt["%.5o", 10u], "00012");
+    test(#fmt["%.5t", 3u], "00011");
+    test(#fmt["%.5c", 'A'], "A");
     // Bool precision. I'm not sure if it's good or bad to have bool
     // conversions support precision - it's not standard printf so we
     // can do whatever. For now I'm making it behave the same as string
     // conversions.
 
-    test(#fmt("%.b", true), "");
-    test(#fmt("%.0b", true), "");
-    test(#fmt("%.1b", true), "t");
+    test(#fmt["%.b", true], "");
+    test(#fmt["%.0b", true], "");
+    test(#fmt["%.1b", true], "t");
 }
 
 fn part5() {
     // Explicit + sign. Only for signed conversions
 
-    test(#fmt("%+d", 0), "+0");
-    test(#fmt("%+d", 1), "+1");
-    test(#fmt("%+d", -1), "-1");
+    test(#fmt["%+d", 0], "+0");
+    test(#fmt["%+d", 1], "+1");
+    test(#fmt["%+d", -1], "-1");
     // Leave space for sign
 
-    test(#fmt("% d", 0), " 0");
-    test(#fmt("% d", 1), " 1");
-    test(#fmt("% d", -1), "-1");
+    test(#fmt["% d", 0], " 0");
+    test(#fmt["% d", 1], " 1");
+    test(#fmt["% d", -1], "-1");
     // Plus overrides space
 
-    test(#fmt("% +d", 0), "+0");
-    test(#fmt("%+ d", 0), "+0");
+    test(#fmt["% +d", 0], "+0");
+    test(#fmt["%+ d", 0], "+0");
     // 0-padding
 
-    test(#fmt("%05d", 0), "00000");
-    test(#fmt("%05d", 1), "00001");
-    test(#fmt("%05d", -1), "-0001");
-    test(#fmt("%05u", 1u), "00001");
-    test(#fmt("%05x", 127u), "0007f");
-    test(#fmt("%05X", 127u), "0007F");
-    test(#fmt("%05o", 10u), "00012");
-    test(#fmt("%05t", 3u), "00011");
+    test(#fmt["%05d", 0], "00000");
+    test(#fmt["%05d", 1], "00001");
+    test(#fmt["%05d", -1], "-0001");
+    test(#fmt["%05u", 1u], "00001");
+    test(#fmt["%05x", 127u], "0007f");
+    test(#fmt["%05X", 127u], "0007F");
+    test(#fmt["%05o", 10u], "00012");
+    test(#fmt["%05t", 3u], "00011");
     // 0-padding a string is undefined but glibc does this:
 
-    test(#fmt("%05s", "test"), " test");
-    test(#fmt("%05c", 'A'), "    A");
-    test(#fmt("%05b", true), " true");
+    test(#fmt["%05s", "test"], " test");
+    test(#fmt["%05c", 'A'], "    A");
+    test(#fmt["%05b", true], " true");
     // Left-justify overrides 0-padding
 
-    test(#fmt("%-05d", 0), "0    ");
-    test(#fmt("%-05d", 1), "1    ");
-    test(#fmt("%-05d", -1), "-1   ");
-    test(#fmt("%-05u", 1u), "1    ");
-    test(#fmt("%-05x", 127u), "7f   ");
-    test(#fmt("%-05X", 127u), "7F   ");
-    test(#fmt("%-05o", 10u), "12   ");
-    test(#fmt("%-05t", 3u), "11   ");
-    test(#fmt("%-05s", "test"), "test ");
-    test(#fmt("%-05c", 'A'), "A    ");
-    test(#fmt("%-05b", true), "true ");
+    test(#fmt["%-05d", 0], "0    ");
+    test(#fmt["%-05d", 1], "1    ");
+    test(#fmt["%-05d", -1], "-1   ");
+    test(#fmt["%-05u", 1u], "1    ");
+    test(#fmt["%-05x", 127u], "7f   ");
+    test(#fmt["%-05X", 127u], "7F   ");
+    test(#fmt["%-05o", 10u], "12   ");
+    test(#fmt["%-05t", 3u], "11   ");
+    test(#fmt["%-05s", "test"], "test ");
+    test(#fmt["%-05c", 'A'], "A    ");
+    test(#fmt["%-05b", true], "true ");
 }
 fn part6() {
     // Precision overrides 0-padding
 
-    test(#fmt("%06.5d", 0), " 00000");
-    test(#fmt("%06.5u", 0u), " 00000");
-    test(#fmt("%06.5x", 0u), " 00000");
-    test(#fmt("%06.5d", 10), " 00010");
-    test(#fmt("%06.5d", -10), "-00010");
-    test(#fmt("%06.5u", 10u), " 00010");
-    test(#fmt("%06.5s", "test"), "  test");
-    test(#fmt("%06.5c", 'A'), "     A");
-    test(#fmt("%06.5x", 127u), " 0007f");
-    test(#fmt("%06.5X", 127u), " 0007F");
-    test(#fmt("%06.5o", 10u), " 00012");
+    test(#fmt["%06.5d", 0], " 00000");
+    test(#fmt["%06.5u", 0u], " 00000");
+    test(#fmt["%06.5x", 0u], " 00000");
+    test(#fmt["%06.5d", 10], " 00010");
+    test(#fmt["%06.5d", -10], "-00010");
+    test(#fmt["%06.5u", 10u], " 00010");
+    test(#fmt["%06.5s", "test"], "  test");
+    test(#fmt["%06.5c", 'A'], "     A");
+    test(#fmt["%06.5x", 127u], " 0007f");
+    test(#fmt["%06.5X", 127u], " 0007F");
+    test(#fmt["%06.5o", 10u], " 00012");
     // Signed combinations
 
-    test(#fmt("% 5d", 1), "    1");
-    test(#fmt("% 5d", -1), "   -1");
-    test(#fmt("%+5d", 1), "   +1");
-    test(#fmt("%+5d", -1), "   -1");
-    test(#fmt("% 05d", 1), " 0001");
-    test(#fmt("% 05d", -1), "-0001");
-    test(#fmt("%+05d", 1), "+0001");
-    test(#fmt("%+05d", -1), "-0001");
-    test(#fmt("%- 5d", 1), " 1   ");
-    test(#fmt("%- 5d", -1), "-1   ");
-    test(#fmt("%-+5d", 1), "+1   ");
-    test(#fmt("%-+5d", -1), "-1   ");
-    test(#fmt("%- 05d", 1), " 1   ");
-    test(#fmt("%- 05d", -1), "-1   ");
-    test(#fmt("%-+05d", 1), "+1   ");
-    test(#fmt("%-+05d", -1), "-1   ");
-}
\ No newline at end of file
+    test(#fmt["% 5d", 1], "    1");
+    test(#fmt["% 5d", -1], "   -1");
+    test(#fmt["%+5d", 1], "   +1");
+    test(#fmt["%+5d", -1], "   -1");
+    test(#fmt["% 05d", 1], " 0001");
+    test(#fmt["% 05d", -1], "-0001");
+    test(#fmt["%+05d", 1], "+0001");
+    test(#fmt["%+05d", -1], "-0001");
+    test(#fmt["%- 5d", 1], " 1   ");
+    test(#fmt["%- 5d", -1], "-1   ");
+    test(#fmt["%-+5d", 1], "+1   ");
+    test(#fmt["%-+5d", -1], "-1   ");
+    test(#fmt["%- 05d", 1], " 1   ");
+    test(#fmt["%- 05d", -1], "-1   ");
+    test(#fmt["%-+05d", 1], "+1   ");
+    test(#fmt["%-+05d", -1], "-1   ");
+}
diff --git a/src/test/run-pass/syntax-extension-minor.rs b/src/test/run-pass/syntax-extension-minor.rs
index f5f7f5564f6..50939997523 100644
--- a/src/test/run-pass/syntax-extension-minor.rs
+++ b/src/test/run-pass/syntax-extension-minor.rs
@@ -1,8 +1,8 @@
 
 fn main() {
     let asdf_fdsa = "<.<";
-    assert(#concat_idents[asd,f_f,dsa] == "<.<");
+    assert (#concat_idents[asd, f_f, dsa] == "<.<");
 
-    assert(#ident_to_str[use_mention_distinction]
-           == "use_mention_distinction");
+    assert (#ident_to_str[use_mention_distinction] ==
+                "use_mention_distinction");
 }
diff --git a/src/test/run-pass/tag.rs b/src/test/run-pass/tag.rs
index 1ea470252f9..534ab1dc395 100644
--- a/src/test/run-pass/tag.rs
+++ b/src/test/run-pass/tag.rs
@@ -12,4 +12,4 @@ fn f() {
 
 }
 
-fn main() { f(); }
\ No newline at end of file
+fn main() { f(); }
diff --git a/src/test/run-pass/tail-call-arg-leak.rs b/src/test/run-pass/tail-call-arg-leak.rs
index f771e9efc9b..b208d32009d 100644
--- a/src/test/run-pass/tail-call-arg-leak.rs
+++ b/src/test/run-pass/tail-call-arg-leak.rs
@@ -4,4 +4,4 @@
 // use of tail calls causes arg slot leaks, issue #160.
 fn inner(dummy: str, b: bool) { if b { be inner(dummy, false); } }
 
-fn main() { inner("hi", true); }
\ No newline at end of file
+fn main() { inner("hi", true); }
diff --git a/src/test/run-pass/tail-cps.rs b/src/test/run-pass/tail-cps.rs
index 81efa8f5502..a8a4436a2be 100644
--- a/src/test/run-pass/tail-cps.rs
+++ b/src/test/run-pass/tail-cps.rs
@@ -6,14 +6,14 @@ fn checktrue(rs: bool) -> bool { assert (rs); ret true; }
 
 fn main() { let k = checktrue; evenk(42, k); oddk(45, k); }
 
-fn evenk(n: int, k: fn(bool) -> bool ) -> bool {
+fn evenk(n: int, k: fn(bool) -> bool) -> bool {
     log "evenk";
     log n;
     if n == 0 { be k(true); } else { be oddk(n - 1, k); }
 }
 
-fn oddk(n: int, k: fn(bool) -> bool ) -> bool {
+fn oddk(n: int, k: fn(bool) -> bool) -> bool {
     log "oddk";
     log n;
     if n == 0 { be k(false); } else { be evenk(n - 1, k); }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/tail-direct.rs b/src/test/run-pass/tail-direct.rs
index f0b50b07ce1..0bd771e7369 100644
--- a/src/test/run-pass/tail-direct.rs
+++ b/src/test/run-pass/tail-direct.rs
@@ -6,4 +6,4 @@ fn main() { assert (even(42)); assert (odd(45)); }
 
 fn even(n: int) -> bool { if n == 0 { ret true; } else { be odd(n - 1); } }
 
-fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } }
\ No newline at end of file
+fn odd(n: int) -> bool { if n == 0 { ret false; } else { be even(n - 1); } }
diff --git a/src/test/run-pass/task-comm-11.rs b/src/test/run-pass/task-comm-11.rs
index ab994c7f378..35b30cda1a2 100644
--- a/src/test/run-pass/task-comm-11.rs
+++ b/src/test/run-pass/task-comm-11.rs
@@ -4,7 +4,7 @@ import std::comm;
 import std::task;
 
 fn start(c: comm::_chan<comm::_chan<int>>) {
-    let p : comm::_port<int> = comm::mk_port();
+    let p: comm::_port<int> = comm::mk_port();
     comm::send(c, p.mk_chan());
 }
 
diff --git a/src/test/run-pass/task-comm-13.rs b/src/test/run-pass/task-comm-13.rs
index 2ae80750f45..7fb31f2d666 100644
--- a/src/test/run-pass/task-comm-13.rs
+++ b/src/test/run-pass/task-comm-13.rs
@@ -10,7 +10,7 @@ fn start(c: comm::_chan<int>, start: int, number_of_messages: int) {
 
 fn main() {
     log "Check that we don't deadlock.";
-    let p : comm::_port<int> = comm::mk_port();
+    let p: comm::_port<int> = comm::mk_port();
     let a = task::_spawn(bind start(p.mk_chan(), 0, 10));
     task::join_id(a);
     log "Joined task";
diff --git a/src/test/run-pass/task-comm-15.rs b/src/test/run-pass/task-comm-15.rs
index 84f3abe9b86..4ea320add2c 100644
--- a/src/test/run-pass/task-comm-15.rs
+++ b/src/test/run-pass/task-comm-15.rs
@@ -2,7 +2,7 @@ use std;
 import std::comm;
 import std::task;
 
-fn start(c : comm::chan<int>, n: int) {
+fn start(c: comm::chan<int>, n: int) {
     let i: int = n;
 
     while i > 0 { comm::send(c, 0); i = i - 1; }
diff --git a/src/test/run-pass/task-comm-16.rs b/src/test/run-pass/task-comm-16.rs
index 9b43986e2ed..6ac2df9d94a 100644
--- a/src/test/run-pass/task-comm-16.rs
+++ b/src/test/run-pass/task-comm-16.rs
@@ -23,29 +23,29 @@ fn test_rec() {
 fn test_vec() {
     let po = comm::mk_port();
     let ch = po.mk_chan();
-    let v0: [int] = ~[0, 1, 2];
+    let v0: [int] = [0, 1, 2];
     send(ch, v0);
     let v1: [int];
     v1 = po.recv();
-    assert (v1.(0) == 0);
-    assert (v1.(1) == 1);
-    assert (v1.(2) == 2);
+    assert (v1[0] == 0);
+    assert (v1[1] == 1);
+    assert (v1[2] == 2);
 }
 
 fn test_str() {
     // FIXME: re-enable this once strings are unique and sendable
-/*
-    let po = comm::mk_port();
-    let ch = po.mk_chan();
-    let s0: str = "test";
-    send(ch, s0);
-    let s1: str;
-    s1 = po.recv();
-    assert (s1.(0) as u8 == 't' as u8);
-    assert (s1.(1) as u8 == 'e' as u8);
-    assert (s1.(2) as u8 == 's' as u8);
-    assert (s1.(3) as u8 == 't' as u8);
-*/
+    /*
+        let po = comm::mk_port();
+        let ch = po.mk_chan();
+        let s0: str = "test";
+        send(ch, s0);
+        let s1: str;
+        s1 = po.recv();
+        assert (s1.(0) as u8 == 't' as u8);
+        assert (s1.(1) as u8 == 'e' as u8);
+        assert (s1.(2) as u8 == 's' as u8);
+        assert (s1.(3) as u8 == 't' as u8);
+    */
 }
 
 fn test_tag() {
@@ -80,10 +80,4 @@ fn test_chan() {
     assert (i == 10);
 }
 
-fn main() {
-    test_rec();
-    test_vec();
-    test_str();
-    test_tag();
-    test_chan();
-}
+fn main() { test_rec(); test_vec(); test_str(); test_tag(); test_chan(); }
diff --git a/src/test/run-pass/task-comm-3.rs b/src/test/run-pass/task-comm-3.rs
index ac3430aec3f..f8522282800 100644
--- a/src/test/run-pass/task-comm-3.rs
+++ b/src/test/run-pass/task-comm-3.rs
@@ -14,7 +14,7 @@ fn test00_start(ch: _chan<int>, message: int, count: int) {
     let i: int = 0;
     while i < count {
         log "Sending Message";
-        send(ch, message+0);
+        send(ch, message + 0);
         i = i + 1;
     }
     log "Ending test00_start";
@@ -34,8 +34,7 @@ fn test00() {
     // Create and spawn tasks...
     let tasks = [];
     while i < number_of_tasks {
-        tasks +=
-            [task::_spawn(bind test00_start(ch, i, number_of_messages))];
+        tasks += [task::_spawn(bind test00_start(ch, i, number_of_messages))];
         i = i + 1;
     }
 
diff --git a/src/test/run-pass/task-comm-4.rs b/src/test/run-pass/task-comm-4.rs
index 30342d877f0..b54020cbe0f 100644
--- a/src/test/run-pass/task-comm-4.rs
+++ b/src/test/run-pass/task-comm-4.rs
@@ -42,4 +42,4 @@ fn test00() {
     sum += r;
     log r;
     assert (sum == 1 + 2 + 3 + 4 + 5 + 6 + 7 + 8);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-5.rs b/src/test/run-pass/task-comm-5.rs
index bb3a1e4dc70..dd07023b2e9 100644
--- a/src/test/run-pass/task-comm-5.rs
+++ b/src/test/run-pass/task-comm-5.rs
@@ -10,8 +10,8 @@ fn test00() {
     let c = p.mk_chan();
     let number_of_messages: int = 1000;
     let i: int = 0;
-    while i < number_of_messages { comm::send(c, i+0); i += 1; }
+    while i < number_of_messages { comm::send(c, i + 0); i += 1; }
     i = 0;
     while i < number_of_messages { r = p.recv(); sum += r; i += 1; }
     assert (sum == number_of_messages * (number_of_messages - 1) / 2);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-6.rs b/src/test/run-pass/task-comm-6.rs
index 41dc6d203ad..036f96981ff 100644
--- a/src/test/run-pass/task-comm-6.rs
+++ b/src/test/run-pass/task-comm-6.rs
@@ -15,10 +15,10 @@ fn test00() {
     let number_of_messages: int = 1000;
     let i: int = 0;
     while i < number_of_messages {
-        send(c0, i+0);
-        send(c1, i+0);
-        send(c2, i+0);
-        send(c3, i+0);
+        send(c0, i + 0);
+        send(c1, i + 0);
+        send(c2, i + 0);
+        send(c3, i + 0);
         i += 1;
     }
     i = 0;
@@ -37,4 +37,4 @@ fn test00() {
     // assert (sum == 4 * ((number_of_messages *
     //                   (number_of_messages - 1)) / 2));
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/task-comm-8.rs b/src/test/run-pass/task-comm-8.rs
index 649e23f9806..0acff8cc022 100644
--- a/src/test/run-pass/task-comm-8.rs
+++ b/src/test/run-pass/task-comm-8.rs
@@ -4,7 +4,7 @@ import std::comm;
 
 fn main() { test00(); }
 
-fn test00_start(c : comm::_chan<int>, start: int, number_of_messages: int) {
+fn test00_start(c: comm::_chan<int>, start: int, number_of_messages: int) {
     let i: int = 0;
     while i < number_of_messages { comm::send(c, start + i); i += 1; }
 }
diff --git a/src/test/run-pass/task-comm-9.rs b/src/test/run-pass/task-comm-9.rs
index a197ebdf507..46dd1d89e51 100644
--- a/src/test/run-pass/task-comm-9.rs
+++ b/src/test/run-pass/task-comm-9.rs
@@ -6,7 +6,7 @@ fn main() { test00(); }
 
 fn test00_start(c: comm::_chan<int>, number_of_messages: int) {
     let i: int = 0;
-    while i < number_of_messages { comm::send(c, i+0); i += 1; }
+    while i < number_of_messages { comm::send(c, i + 0); i += 1; }
 }
 
 fn test00() {
@@ -15,8 +15,7 @@ fn test00() {
     let p = comm::mk_port();
     let number_of_messages: int = 10;
 
-    let t0 = task::_spawn(bind test00_start(p.mk_chan(),
-                                            number_of_messages));
+    let t0 = task::_spawn(bind test00_start(p.mk_chan(), number_of_messages));
 
     let i: int = 0;
     while i < number_of_messages { r = p.recv(); sum += r; log r; i += 1; }
diff --git a/src/test/run-pass/task-comm.rs b/src/test/run-pass/task-comm.rs
index c468d1c89d6..f5a6a111608 100644
--- a/src/test/run-pass/task-comm.rs
+++ b/src/test/run-pass/task-comm.rs
@@ -20,7 +20,11 @@ fn main() {
 fn test00_start(ch: _chan<int>, message: int, count: int) {
     log "Starting test00_start";
     let i: int = 0;
-    while i < count { log "Sending Message"; send(ch, message+0); i = i + 1; }
+    while i < count {
+        log "Sending Message";
+        send(ch, message + 0);
+        i = i + 1;
+    }
     log "Ending test00_start";
 }
 
@@ -39,22 +43,19 @@ fn test00() {
         i = i + 1;
         tasks += [task::spawn(bind test00_start(ch, i, number_of_messages))];
     }
-
     let sum: int = 0;
     for t: task_id in tasks {
         i = 0;
-        while i < number_of_messages {
-            sum += po.recv();
-            i = i + 1;
-        }
+        while i < number_of_messages { sum += po.recv(); i = i + 1; }
     }
 
     for t: task_id in tasks { task::join_id(t); }
 
     log "Completed: Final number is: ";
     assert (sum ==
-            number_of_messages *
-            (number_of_tasks * number_of_tasks + number_of_tasks) / 2);
+                number_of_messages *
+                    (number_of_tasks * number_of_tasks + number_of_tasks) /
+                    2);
 }
 
 fn test01() {
@@ -96,11 +97,7 @@ fn test04_start() {
 fn test04() {
     log "Spawning lots of tasks.";
     let i: int = 4;
-    while i > 0 {
-        i = i - 1;
-        let f = test04_start;
-        task::spawn(f);
-    }
+    while i > 0 { i = i - 1; let f = test04_start; task::spawn(f); }
     log "Finishing up.";
 }
 
@@ -138,7 +135,9 @@ fn test06() {
 
     let tasks = [];
     while i < number_of_tasks {
-        i = i + 1; tasks += [task::spawn(bind test06_start(i))]; }
+        i = i + 1;
+        tasks += [task::spawn(bind test06_start(i))];
+    }
 
 
     for t: task_id in tasks { task::join_id(t); }
diff --git a/src/test/run-pass/task-pin.rs b/src/test/run-pass/task-pin.rs
index a6592b885eb..407914dba2d 100644
--- a/src/test/run-pass/task-pin.rs
+++ b/src/test/run-pass/task-pin.rs
@@ -7,4 +7,4 @@ use std;
 
 import std::task;
 
-fn main() { task::pin(); task::unpin(); }
\ No newline at end of file
+fn main() { task::pin(); task::unpin(); }
diff --git a/src/test/run-pass/ternary.rs b/src/test/run-pass/ternary.rs
index 9c2aaf4ac4e..6adfada2c90 100644
--- a/src/test/run-pass/ternary.rs
+++ b/src/test/run-pass/ternary.rs
@@ -40,4 +40,4 @@ fn main() {
     test_associativity();
     test_lval();
     test_as_stmt();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/test-runner-hides-main.rs b/src/test/run-pass/test-runner-hides-main.rs
index 2edf36d1762..997664aa9c0 100644
--- a/src/test/run-pass/test-runner-hides-main.rs
+++ b/src/test/run-pass/test-runner-hides-main.rs
@@ -5,4 +5,4 @@ use std;
 
 // Building as a test runner means that a synthetic main will be run,
 // not ours
-fn main() { fail; }
\ No newline at end of file
+fn main() { fail; }
diff --git a/src/test/run-pass/threads.rs b/src/test/run-pass/threads.rs
index 47982d12b90..aa999eb420d 100644
--- a/src/test/run-pass/threads.rs
+++ b/src/test/run-pass/threads.rs
@@ -4,15 +4,10 @@ use std;
 import std::task;
 
 fn main() {
-  let i = 10;
-  while (i > 0) {
-    task::_spawn(bind child(i));
-    i = i - 1;
-  }
-  log "main thread exiting";
+    let i = 10;
+    while i > 0 { task::_spawn(bind child(i)); i = i - 1; }
+    log "main thread exiting";
 }
 
-fn child(x : int) {
-  log x;
-}
+fn child(x: int) { log x; }
 
diff --git a/src/test/run-pass/tup.rs b/src/test/run-pass/tup.rs
index ab34e75a460..b12099b414a 100644
--- a/src/test/run-pass/tup.rs
+++ b/src/test/run-pass/tup.rs
@@ -15,4 +15,4 @@ fn main() {
     let p2: point = p;
     f(p, 10, 20);
     f(p2, 10, 20);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/type-in-nested-module.rs b/src/test/run-pass/type-in-nested-module.rs
index 2c91b35099e..059f22ba15c 100644
--- a/src/test/run-pass/type-in-nested-module.rs
+++ b/src/test/run-pass/type-in-nested-module.rs
@@ -8,4 +8,4 @@ mod a {
     }
 }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/type-namespace.rs b/src/test/run-pass/type-namespace.rs
index f173ec0a69d..03c8ce0972a 100644
--- a/src/test/run-pass/type-namespace.rs
+++ b/src/test/run-pass/type-namespace.rs
@@ -2,4 +2,4 @@ type a = {a: int};
 
 fn a(a: a) -> int { ret a.a; }
 
-fn main() { let x: a = {a: 1}; assert (a(x) == 1); }
\ No newline at end of file
+fn main() { let x: a = {a: 1}; assert (a(x) == 1); }
diff --git a/src/test/run-pass/type-param-constraints.rs b/src/test/run-pass/type-param-constraints.rs
index e1c80d31fb7..a5ea4c223d4 100644
--- a/src/test/run-pass/type-param-constraints.rs
+++ b/src/test/run-pass/type-param-constraints.rs
@@ -1,6 +1,6 @@
-fn p_foo<T>(pinned: &T) {  }
-fn s_foo<@T>(shared: &T) {  }
-fn u_foo<~T>(unique: &T) {  }
+fn p_foo<T>(pinned: &T) { }
+fn s_foo<@T>(shared: &T) { }
+fn u_foo<~T>(unique: &T) { }
 
 resource r(i: int) { }
 
diff --git a/src/test/run-pass/type-param.rs b/src/test/run-pass/type-param.rs
index 36ef46420a9..be55ba86cac 100644
--- a/src/test/run-pass/type-param.rs
+++ b/src/test/run-pass/type-param.rs
@@ -1,5 +1,5 @@
 
 
-type lteq<T> = fn(&T) -> bool ;
+type lteq<T> = fn(&T) -> bool;
 
 fn main(args: [str]) { }
diff --git a/src/test/run-pass/type-params-in-for-each.rs b/src/test/run-pass/type-params-in-for-each.rs
index b8e2f5fc8a8..760e5dadfa1 100644
--- a/src/test/run-pass/type-params-in-for-each.rs
+++ b/src/test/run-pass/type-params-in-for-each.rs
@@ -5,8 +5,8 @@ iter range(lo: uint, hi: uint) -> uint {
     while lo_ < hi { put lo_; lo_ += 1u; }
 }
 
-fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint ) {
-    for each i: uint in range(0u, 256u) { let bucket: [T] = ~[]; }
+fn create_index<T>(index: &[{a: T, b: uint}], hash_fn: fn(&T) -> uint) {
+    for each i: uint in range(0u, 256u) { let bucket: [T] = []; }
 }
 
 fn main() { }
diff --git a/src/test/run-pass/typestate-cfg-nesting.rs b/src/test/run-pass/typestate-cfg-nesting.rs
index 52702922764..ccde41545d9 100644
--- a/src/test/run-pass/typestate-cfg-nesting.rs
+++ b/src/test/run-pass/typestate-cfg-nesting.rs
@@ -6,4 +6,4 @@ fn main() {
     let x = 10;
     let y = 11;
     if true { while false { y = x; } } else { }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/typestate-multi-decl.rs b/src/test/run-pass/typestate-multi-decl.rs
index b0da5a7b226..18698226379 100644
--- a/src/test/run-pass/typestate-multi-decl.rs
+++ b/src/test/run-pass/typestate-multi-decl.rs
@@ -1,5 +1 @@
-fn main() {
- let x = 10, y = 20;
- let z = x + y;
- assert (z == 30);
-}
+fn main() { let x = 10, y = 20; let z = x + y; assert (z == 30); }
diff --git a/src/test/run-pass/typestate-transitive.rs b/src/test/run-pass/typestate-transitive.rs
index f2eda37e0d0..021dd7554b7 100644
--- a/src/test/run-pass/typestate-transitive.rs
+++ b/src/test/run-pass/typestate-transitive.rs
@@ -4,4 +4,4 @@ fn f(i: int) : p(i) -> int { i }
 
 fn g(i: int) : p(i) -> int { f(i) }
 
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/u32-decr.rs b/src/test/run-pass/u32-decr.rs
index ba7af14dbce..d258effa663 100644
--- a/src/test/run-pass/u32-decr.rs
+++ b/src/test/run-pass/u32-decr.rs
@@ -6,4 +6,4 @@ fn main() {
     let word: u32 = 200000u32;
     word = word - 1u32;
     assert (word == 199999u32);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/u8-incr-decr.rs b/src/test/run-pass/u8-incr-decr.rs
index 8562a87c1a0..91bf0f9945e 100644
--- a/src/test/run-pass/u8-incr-decr.rs
+++ b/src/test/run-pass/u8-incr-decr.rs
@@ -15,4 +15,4 @@ fn main() {
     y = y - 9u8; // 0x9
 
     assert (x == y);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/u8-incr.rs b/src/test/run-pass/u8-incr.rs
index c1f0ee37c13..66304d33072 100644
--- a/src/test/run-pass/u8-incr.rs
+++ b/src/test/run-pass/u8-incr.rs
@@ -11,4 +11,4 @@ fn main() {
     // x = 14u8;
     // x = x + 1u8;
 
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/uint.rs b/src/test/run-pass/uint.rs
index 8e5795e0b6d..2083979b0ac 100644
--- a/src/test/run-pass/uint.rs
+++ b/src/test/run-pass/uint.rs
@@ -2,4 +2,4 @@
 
 
 // -*- rust -*-
-fn main() { let x: uint = 10 as uint; }
\ No newline at end of file
+fn main() { let x: uint = 10 as uint; }
diff --git a/src/test/run-pass/unify-return-ty.rs b/src/test/run-pass/unify-return-ty.rs
index 0538618ff88..5bfdeb33847 100644
--- a/src/test/run-pass/unify-return-ty.rs
+++ b/src/test/run-pass/unify-return-ty.rs
@@ -6,6 +6,4 @@ import std::unsafe;
 
 fn null<T>() -> *T { unsafe::reinterpret_cast(0) }
 
-fn main() {
-    null::<int>();
-}
+fn main() { null::<int>(); }
diff --git a/src/test/run-pass/unit.rs b/src/test/run-pass/unit.rs
index 6b944d59c5d..815c760dfaa 100644
--- a/src/test/run-pass/unit.rs
+++ b/src/test/run-pass/unit.rs
@@ -4,4 +4,4 @@
 // -*- rust -*-
 fn f(u: ()) { ret u; }
 
-fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); }
\ No newline at end of file
+fn main() { let u1: () = (); let u2: () = f(u1); u2 = (); ret (); }
diff --git a/src/test/run-pass/use-import-export.rs b/src/test/run-pass/use-import-export.rs
index 56b99e2c95f..99b87578d8d 100644
--- a/src/test/run-pass/use-import-export.rs
+++ b/src/test/run-pass/use-import-export.rs
@@ -8,4 +8,4 @@ mod bar {
     fn y() -> int { ret 1; }
 }
 
-fn main() { foo::x(); bar::y(); }
\ No newline at end of file
+fn main() { foo::x(); bar::y(); }
diff --git a/src/test/run-pass/utf8.rs b/src/test/run-pass/utf8.rs
index e7dc2780612..c27d7a23c0a 100644
--- a/src/test/run-pass/utf8.rs
+++ b/src/test/run-pass/utf8.rs
@@ -34,7 +34,7 @@ fn main() {
         for ab: u8 in a {
             log i;
             log ab;
-            let bb: u8 = b.(i);
+            let bb: u8 = b[i];
             log bb;
             assert (ab == bb);
             i += 1;
diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs
index c94cef4bba3..e7f7f9a1524 100644
--- a/src/test/run-pass/utf8_chars.rs
+++ b/src/test/run-pass/utf8_chars.rs
@@ -4,7 +4,7 @@ import std::vec;
 
 fn main() {
     // Chars of 1, 2, 3, and 4 bytes
-    let chs: [char] = ~['e', 'é', '€', 0x10000 as char];
+    let chs: [char] = ['e', 'é', '€', 0x10000 as char];
     let s: str = str::from_chars(chs);
 
     assert (str::byte_len(s) == 10u);
@@ -15,9 +15,9 @@ fn main() {
     assert (str::char_at(s, 1u) == 'é');
 
     assert (str::is_utf8(str::bytes(s)));
-    assert (!str::is_utf8(~[0x80_u8]));
-    assert (!str::is_utf8(~[0xc0_u8]));
-    assert (!str::is_utf8(~[0xc0_u8, 0x10_u8]));
+    assert (!str::is_utf8([0x80_u8]));
+    assert (!str::is_utf8([0xc0_u8]));
+    assert (!str::is_utf8([0xc0_u8, 0x10_u8]));
 
     let stack = "a×c€";
     assert (str::pop_char(stack) == '€');
diff --git a/src/test/run-pass/vec-append.rs b/src/test/run-pass/vec-append.rs
index 68076d41287..c045aa1e49f 100644
--- a/src/test/run-pass/vec-append.rs
+++ b/src/test/run-pass/vec-append.rs
@@ -10,26 +10,26 @@ import std::vec;
 const const_refcount: uint = 0x7bad_face_u;
 
 fn fast_growth() {
-    let v: [int] = ~[1, 2, 3, 4, 5];
-    v += ~[6, 7, 8, 9, 0];
-    log v.(9);
-    assert (v.(0) == 1);
-    assert (v.(7) == 8);
-    assert (v.(9) == 0);
+    let v: [int] = [1, 2, 3, 4, 5];
+    v += [6, 7, 8, 9, 0];
+    log v[9];
+    assert (v[0] == 1);
+    assert (v[7] == 8);
+    assert (v[9] == 0);
 }
 
 fn slow_growth() {
-    let v: [int] = ~[];
+    let v: [int] = [];
     let u: [int] = v;
-    v += ~[17];
-    log v.(0);
-    assert (v.(0) == 17);
+    v += [17];
+    log v[0];
+    assert (v[0] == 17);
 }
 
 fn slow_growth2_helper(s: str) { // ref up: s
 
     obj acc(mutable v: [str]) {
-        fn add(s: &str) { v += ~[s]; }
+        fn add(s: &str) { v += [s]; }
     }
     let ss: str = s; // ref up: s
 
@@ -46,7 +46,7 @@ fn slow_growth2_helper(s: str) { // ref up: s
          * mumble, the existing str in the originally- shared vec.
          */
 
-        let v: [str] = ~[mumble]; // ref up: mumble
+        let v: [str] = [mumble]; // ref up: mumble
 
         let a: acc = acc(v);
 
@@ -56,9 +56,9 @@ fn slow_growth2_helper(s: str) { // ref up: s
         log str::refcount(mumble);
         assert (str::refcount(s) == const_refcount);
         assert (str::refcount(mumble) == const_refcount);
-        log v.(0);
+        log v[0];
         log vec::len::<str>(v);
-        assert (str::eq(v.(0), mumble));
+        assert (str::eq(v[0], mumble));
         assert (vec::len::<str>(v) == 1u);
     } // ref down: mumble, s,
 
diff --git a/src/test/run-pass/vec-concat.rs b/src/test/run-pass/vec-concat.rs
index 2804f8c0f10..e107d861a2a 100644
--- a/src/test/run-pass/vec-concat.rs
+++ b/src/test/run-pass/vec-concat.rs
@@ -3,11 +3,11 @@
 
 // -*- rust -*-
 fn main() {
-    let a: [int] = ~[1, 2, 3, 4, 5];
-    let b: [int] = ~[6, 7, 8, 9, 0];
+    let a: [int] = [1, 2, 3, 4, 5];
+    let b: [int] = [6, 7, 8, 9, 0];
     let v: [int] = a + b;
-    log v.(9);
-    assert (v.(0) == 1);
-    assert (v.(7) == 8);
-    assert (v.(9) == 0);
+    log v[9];
+    assert (v[0] == 1);
+    assert (v[7] == 8);
+    assert (v[9] == 0);
 }
diff --git a/src/test/run-pass/vec-drop.rs b/src/test/run-pass/vec-drop.rs
index dbd0bbcd82c..499b24d43f0 100644
--- a/src/test/run-pass/vec-drop.rs
+++ b/src/test/run-pass/vec-drop.rs
@@ -4,5 +4,5 @@ fn main() {
     // This just tests whether the vec leaks its members.
 
     let pvec: [@{x: int, y: int}] =
-        ~[@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}];
+        [@{x: 1, y: 2}, @{x: 3, y: 4}, @{x: 5, y: 6}];
 }
diff --git a/src/test/run-pass/vec-growth.rs b/src/test/run-pass/vec-growth.rs
index c91d360c88b..7835b82c4d7 100644
--- a/src/test/run-pass/vec-growth.rs
+++ b/src/test/run-pass/vec-growth.rs
@@ -1,14 +1,14 @@
 
 
 fn main() {
-    let v = ~[1];
-    v += ~[2];
-    v += ~[3];
-    v += ~[4];
-    v += ~[5];
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
-    assert (v.(4) == 5);
-}
\ No newline at end of file
+    let v = [1];
+    v += [2];
+    v += [3];
+    v += [4];
+    v += [5];
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
+    assert (v[4] == 5);
+}
diff --git a/src/test/run-pass/vec-ivec-deadlock.rs b/src/test/run-pass/vec-ivec-deadlock.rs
index 2dae6e3fcb4..7c0515ce48b 100644
--- a/src/test/run-pass/vec-ivec-deadlock.rs
+++ b/src/test/run-pass/vec-ivec-deadlock.rs
@@ -1 +1 @@
-fn main() { let a = ~[1, 2, 3, 4, 5]; let b = ~[a, a]; b += b; }
\ No newline at end of file
+fn main() { let a = [1, 2, 3, 4, 5]; let b = [a, a]; b += b; }
diff --git a/src/test/run-pass/vec-late-init.rs b/src/test/run-pass/vec-late-init.rs
index c1f180ed237..6a84317747c 100644
--- a/src/test/run-pass/vec-late-init.rs
+++ b/src/test/run-pass/vec-late-init.rs
@@ -2,6 +2,6 @@
 
 fn main() {
     let later: [int];
-    if true { later = ~[1]; } else { later = ~[2]; }
-    log later.(0);
+    if true { later = [1]; } else { later = [2]; }
+    log later[0];
 }
diff --git a/src/test/run-pass/vec-push.rs b/src/test/run-pass/vec-push.rs
index 6e54bd7467e..c2f49311b1e 100644
--- a/src/test/run-pass/vec-push.rs
+++ b/src/test/run-pass/vec-push.rs
@@ -1,5 +1,5 @@
 
 
-fn push<T>(v: &mutable [mutable? T], t: &T) { v += ~[t]; }
+fn push<T>(v: &mutable [mutable? T], t: &T) { v += [t]; }
 
-fn main() { let v = ~[1, 2, 3]; push(v, 1); }
+fn main() { let v = [1, 2, 3]; push(v, 1); }
diff --git a/src/test/run-pass/vec.rs b/src/test/run-pass/vec.rs
index eef478a372e..95025f5b3cb 100644
--- a/src/test/run-pass/vec.rs
+++ b/src/test/run-pass/vec.rs
@@ -3,8 +3,8 @@
 
 // -*- rust -*-
 fn main() {
-    let v: [int] = ~[10, 20];
-    assert (v[0]== 10);
+    let v: [int] = [10, 20];
+    assert (v[0] == 10);
     assert (v[1] == 20);
     let x: int = 0;
     assert (v[x] == 10);
diff --git a/src/test/run-pass/vector-no-ann-2.rs b/src/test/run-pass/vector-no-ann-2.rs
index d2555618281..10a9cd9c6b8 100644
--- a/src/test/run-pass/vector-no-ann-2.rs
+++ b/src/test/run-pass/vector-no-ann-2.rs
@@ -1 +1 @@
-fn main() { let quux: @[uint] = @~[]; }
+fn main() { let quux: @[uint] = @[]; }
diff --git a/src/test/run-pass/while-and-do-while.rs b/src/test/run-pass/while-and-do-while.rs
index 3287791a7c0..c5b09cb8149 100644
--- a/src/test/run-pass/while-and-do-while.rs
+++ b/src/test/run-pass/while-and-do-while.rs
@@ -5,4 +5,4 @@ fn main() {
     let y: int = 0;
     while y < x { log y; log "hello"; y = y + 1; }
     do  { log "goodbye"; x = x - 1; log x; } while x > 0
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-flow-graph.rs b/src/test/run-pass/while-flow-graph.rs
index bf1840638de..2813cee0cd0 100644
--- a/src/test/run-pass/while-flow-graph.rs
+++ b/src/test/run-pass/while-flow-graph.rs
@@ -1,3 +1,3 @@
 
 
-fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } }
\ No newline at end of file
+fn main() { let x: int = 10; while x == 10 && x == 11 { let y = 0xf00; } }
diff --git a/src/test/run-pass/while-loop-constraints-2.rs b/src/test/run-pass/while-loop-constraints-2.rs
index e124ed58042..29ab411b31b 100644
--- a/src/test/run-pass/while-loop-constraints-2.rs
+++ b/src/test/run-pass/while-loop-constraints-2.rs
@@ -5,4 +5,4 @@ fn main() {
     let x: int;
     while z < 50 { z += 1; while false { x <- y; y = z; } log y; }
     assert (y == 42 && z == 50);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-prelude-drop.rs b/src/test/run-pass/while-prelude-drop.rs
index badd2ae10bf..9688c436370 100644
--- a/src/test/run-pass/while-prelude-drop.rs
+++ b/src/test/run-pass/while-prelude-drop.rs
@@ -16,4 +16,4 @@ fn main() {
 
     // The auto slot for the result of make(i) should not leak.
     while make(i) != a { i += 1; }
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/while-with-break.rs b/src/test/run-pass/while-with-break.rs
index 3dcbb96b040..f8050e3d3eb 100644
--- a/src/test/run-pass/while-with-break.rs
+++ b/src/test/run-pass/while-with-break.rs
@@ -9,7 +9,7 @@ fn main() {
         i = i + 1;
         if i == 95 {
             let v: [int] =
-                ~[1, 2, 3, 4, 5]; // we check that it is freed by break
+                [1, 2, 3, 4, 5]; // we check that it is freed by break
 
             log "breaking";
             break;
diff --git a/src/test/run-pass/wierd-exprs.rs b/src/test/run-pass/wierd-exprs.rs
index a8276c92bb6..de1613c4363 100644
--- a/src/test/run-pass/wierd-exprs.rs
+++ b/src/test/run-pass/wierd-exprs.rs
@@ -1,11 +1,9 @@
 // Just a grab bug of stuff that you wouldn't want to actualy write
 
-fn strange() -> bool {
-    let _x = ret true;
-}
+fn strange() -> bool { let _x = ret true; }
 
 fn funny() {
-    fn f(_x: ()) {}
+    fn f(_x: ()) { }
     f(ret);
 }
 
@@ -15,21 +13,16 @@ fn odd() {
 }
 
 fn what() {
-    fn the(x: @mutable bool){
-        ret while !*x { *x = true };
-    }
+    fn the(x: @mutable bool) { ret while !*x { *x = true }; }
     let i = @mutable false;
     let dont = bind the(i);
     dont();
-    assert *i;
+    assert (*i);
 }
 
 fn zombiejesus() {
-    do { while (ret) { if (ret) {
-        alt (ret) { _ {
-          ret ? ret : ret
-        }}
-    }}} while ret;
+    do  { while (ret) { if (ret) { alt (ret) { _ { ret ? ret : ret } } } } }
+        while ret
 }
 
 fn notsure() {
@@ -48,27 +41,18 @@ fn hammertime() -> int {
 
 fn canttouchthis() -> uint {
     pred p() -> bool { true }
-    let _a = (assert true) == (check p());
-    let _c = (check p()) == ();
+    let _a = (assert (true)) == (check (p()));
+    let _c = (check (p())) == ();
     let _b = (log 0) == (ret 0u);
 }
 
 fn angrydome() {
-    while true {
-        if (break) { }
-    }
+    while true { if break { } }
     let i = 0;
-    do {
-        i += 1;
-        if i == 1 {
-            alt cont { _ { } }
-        }
-    } while false;
+    do  { i += 1; if i == 1 { alt cont { _ { } } } } while false
 }
 
-fn evil_lincoln() {
-    let evil <- log "lincoln";
-}
+fn evil_lincoln() { let evil <- log "lincoln"; }
 
 fn main() {
     strange();
diff --git a/src/test/run-pass/writealias.rs b/src/test/run-pass/writealias.rs
index 0f779478533..fb7bf4c163a 100644
--- a/src/test/run-pass/writealias.rs
+++ b/src/test/run-pass/writealias.rs
@@ -10,4 +10,4 @@ fn main() {
     let x: point = {x: 10, y: 11, mutable z: 12};
     f(x);
     assert (x.z == 13);
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/x86stdcall.rs b/src/test/run-pass/x86stdcall.rs
index dcc525d652f..52f9d47cd78 100644
--- a/src/test/run-pass/x86stdcall.rs
+++ b/src/test/run-pass/x86stdcall.rs
@@ -14,4 +14,4 @@ fn main() {
 
 #[cfg(target_os = "macos")]
 #[cfg(target_os = "linux")]
-fn main() { }
\ No newline at end of file
+fn main() { }
diff --git a/src/test/run-pass/yield.rs b/src/test/run-pass/yield.rs
index 8de4b6c411f..dd8d2a046b7 100644
--- a/src/test/run-pass/yield.rs
+++ b/src/test/run-pass/yield.rs
@@ -14,4 +14,4 @@ fn main() {
     join_id(other);
 }
 
-fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; }
\ No newline at end of file
+fn child() { log_err "4"; yield(); log_err "5"; yield(); log_err "6"; }
diff --git a/src/test/run-pass/yield1.rs b/src/test/run-pass/yield1.rs
index e53591dbe1a..9f5c326cc38 100644
--- a/src/test/run-pass/yield1.rs
+++ b/src/test/run-pass/yield1.rs
@@ -6,7 +6,8 @@ import std::task::*;
 fn main() {
     let c = child;
     let other = task::spawn(c);
-    log_err "1"; yield();
+    log_err "1";
+    yield();
     join_id(other);
 }
 
diff --git a/src/test/stdtest/bitv.rs b/src/test/stdtest/bitv.rs
index 7666063239d..249a43be13b 100644
--- a/src/test/stdtest/bitv.rs
+++ b/src/test/stdtest/bitv.rs
@@ -18,9 +18,9 @@ fn test_0_elements() {
 fn test_1_element() {
     let act;
     act = bitv::create(1u, false);
-    assert (bitv::eq_vec(act, ~[0u]));
+    assert (bitv::eq_vec(act, [0u]));
     act = bitv::create(1u, true);
-    assert (bitv::eq_vec(act, ~[1u]));
+    assert (bitv::eq_vec(act, [1u]));
 }
 
 #[test]
@@ -29,11 +29,11 @@ fn test_10_elements() {
     // all 0
 
     act = bitv::create(10u, false);
-    assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+    assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(10u, true);
-    assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
+    assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -42,7 +42,7 @@ fn test_10_elements() {
     bitv::set(act, 2u, true);
     bitv::set(act, 3u, true);
     bitv::set(act, 4u, true);
-    assert (bitv::eq_vec(act, ~[1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u]));
+    assert (bitv::eq_vec(act, [1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -51,7 +51,7 @@ fn test_10_elements() {
     bitv::set(act, 7u, true);
     bitv::set(act, 8u, true);
     bitv::set(act, 9u, true);
-    assert (bitv::eq_vec(act, ~[0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u]));
+    assert (bitv::eq_vec(act, [0u, 0u, 0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(10u, false);
@@ -59,7 +59,7 @@ fn test_10_elements() {
     bitv::set(act, 3u, true);
     bitv::set(act, 6u, true);
     bitv::set(act, 9u, true);
-    assert (bitv::eq_vec(act, ~[1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u]));
+    assert (bitv::eq_vec(act, [1u, 0u, 0u, 1u, 0u, 0u, 1u, 0u, 0u, 1u]));
 }
 
 #[test]
@@ -69,16 +69,16 @@ fn test_31_elements() {
 
     act = bitv::create(31u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(31u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -91,9 +91,9 @@ fn test_31_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -106,9 +106,9 @@ fn test_31_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -120,9 +120,9 @@ fn test_31_elements() {
     bitv::set(act, 29u, true);
     bitv::set(act, 30u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(31u, false);
@@ -130,9 +130,9 @@ fn test_31_elements() {
     bitv::set(act, 17u, true);
     bitv::set(act, 30u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u]));
 }
 
 #[test]
@@ -142,16 +142,16 @@ fn test_32_elements() {
 
     act = bitv::create(32u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(32u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -164,9 +164,9 @@ fn test_32_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -179,9 +179,9 @@ fn test_32_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -194,9 +194,9 @@ fn test_32_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(32u, false);
@@ -205,9 +205,9 @@ fn test_32_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 1u]));
 }
 
 #[test]
@@ -217,16 +217,16 @@ fn test_33_elements() {
 
     act = bitv::create(33u, false);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // all 1
 
     act = bitv::create(33u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 1u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 1u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -239,9 +239,9 @@ fn test_33_elements() {
     bitv::set(act, 6u, true);
     bitv::set(act, 7u, true);
     assert (bitv::eq_vec(act,
-                         ~[1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -254,9 +254,9 @@ fn test_33_elements() {
     bitv::set(act, 22u, true);
     bitv::set(act, 23u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 1u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -269,9 +269,9 @@ fn test_33_elements() {
     bitv::set(act, 30u, true);
     bitv::set(act, 31u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
-                           1u, 1u, 1u, 1u, 1u, 1u, 0u]));
+                         [0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 1u, 1u,
+                          1u, 1u, 1u, 1u, 1u, 1u, 0u]));
     // mixed
 
     act = bitv::create(33u, false);
@@ -281,8 +281,8 @@ fn test_33_elements() {
     bitv::set(act, 31u, true);
     bitv::set(act, 32u, true);
     assert (bitv::eq_vec(act,
-                         ~[0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
-                           0u, 0u, 0u, 0u, 1u, 1u, 1u]));
+                         [0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 0u, 0u, 0u, 0u, 0u, 0u, 0u, 0u,
+                          0u, 0u, 0u, 0u, 1u, 1u, 1u]));
 }
 
diff --git a/src/test/stdtest/comm.rs b/src/test/stdtest/comm.rs
index 7d20042e866..6b67acc51ea 100644
--- a/src/test/stdtest/comm.rs
+++ b/src/test/stdtest/comm.rs
@@ -15,7 +15,7 @@ fn send_recv() {
     comm::send(c, 42);
     let v = p.recv();
     log_err v;
-    assert(42 == v);
+    assert (42 == v);
 }
 
 #[test]
@@ -23,7 +23,7 @@ fn send_recv_fn() {
     let p = comm::port::<int>();
     let c = comm::chan::<int>(p);
     comm::send(c, 42);
-    assert(comm::recv(p) == 42);
+    assert (comm::recv(p) == 42);
 }
 
 #[test]
@@ -31,7 +31,7 @@ fn send_recv_fn_infer() {
     let p = comm::port();
     let c = comm::chan(p);
     comm::send(c, 42);
-    assert(comm::recv(p) == 42);
+    assert (comm::recv(p) == 42);
 }
 
 #[test]
diff --git a/src/test/stdtest/deque.rs b/src/test/stdtest/deque.rs
index d751bd5c45d..acdde57b86e 100644
--- a/src/test/stdtest/deque.rs
+++ b/src/test/stdtest/deque.rs
@@ -79,7 +79,7 @@ fn test_boxes(a: @int, b: @int, c: @int, d: @int) {
     assert (deq.get(3) == d);
 }
 
-type eqfn<T> = fn(&T, &T) -> bool ;
+type eqfn<T> = fn(&T, &T) -> bool;
 
 fn test_parameterized<@T>(e: eqfn<T>, a: &T, b: &T, c: &T, d: &T) {
     let deq: deque::t<T> = deque::create::<T>();
@@ -175,15 +175,14 @@ fn test() {
     log "test parameterized: taggy";
     let eq3: eqfn<taggy> = taggyeq;
     test_parameterized::<taggy>(eq3, one(1), two(1, 2), three(1, 2, 3),
-                              two(17, 42));
+                                two(17, 42));
 
     log "*** test parameterized: taggypar<int>";
     let eq4: eqfn<taggypar<int>> = taggypareq::<int>;
-    test_parameterized::<taggypar<int>>(eq4,
-                                      onepar::<int>(1),
-                                      twopar::<int>(1, 2),
-                                      threepar::<int>(1, 2, 3),
-                                      twopar::<int>(17, 42));
+    test_parameterized::<taggypar<int>>(eq4, onepar::<int>(1),
+                                        twopar::<int>(1, 2),
+                                        threepar::<int>(1, 2, 3),
+                                        twopar::<int>(17, 42));
     log "*** end test parameterized: taggypar::<int>";
 
     log "*** test parameterized: reccy";
diff --git a/src/test/stdtest/either.rs b/src/test/stdtest/either.rs
index 21b8184f496..82724b1c09a 100644
--- a/src/test/stdtest/either.rs
+++ b/src/test/stdtest/either.rs
@@ -20,60 +20,60 @@ fn test_either_right() {
 
 #[test]
 fn test_lefts() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = lefts(input);
-    assert (result == ~[10, 12, 14]);
+    assert (result == [10, 12, 14]);
 }
 
 #[test]
 fn test_lefts_none() {
-    let input: [t<int, int>] = ~[right(10), right(10)];
+    let input: [t<int, int>] = [right(10), right(10)];
     let result = lefts(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_lefts_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = lefts(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_rights() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = rights(input);
-    assert (result == ~[11, 13]);
+    assert (result == [11, 13]);
 }
 
 #[test]
 fn test_rights_none() {
-    let input: [t<int, int>] = ~[left(10), left(10)];
+    let input: [t<int, int>] = [left(10), left(10)];
     let result = rights(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_rights_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = rights(input);
     assert (len(result) == 0u);
 }
 
 #[test]
 fn test_partition() {
-    let input = ~[left(10), right(11), left(12), right(13), left(14)];
+    let input = [left(10), right(11), left(12), right(13), left(14)];
     let result = partition(input);
-    assert (result.lefts.(0) == 10);
-    assert (result.lefts.(1) == 12);
-    assert (result.lefts.(2) == 14);
-    assert (result.rights.(0) == 11);
-    assert (result.rights.(1) == 13);
+    assert (result.lefts[0] == 10);
+    assert (result.lefts[1] == 12);
+    assert (result.lefts[2] == 14);
+    assert (result.rights[0] == 11);
+    assert (result.rights[1] == 13);
 }
 
 #[test]
 fn test_partition_no_lefts() {
-    let input: [t<int, int>] = ~[right(10), right(11)];
+    let input: [t<int, int>] = [right(10), right(11)];
     let result = partition(input);
     assert (len(result.lefts) == 0u);
     assert (len(result.rights) == 2u);
@@ -81,7 +81,7 @@ fn test_partition_no_lefts() {
 
 #[test]
 fn test_partition_no_rights() {
-    let input: [t<int, int>] = ~[left(10), left(11)];
+    let input: [t<int, int>] = [left(10), left(11)];
     let result = partition(input);
     assert (len(result.lefts) == 2u);
     assert (len(result.rights) == 0u);
@@ -89,7 +89,7 @@ fn test_partition_no_rights() {
 
 #[test]
 fn test_partition_empty() {
-    let input: [t<int, int>] = ~[];
+    let input: [t<int, int>] = [];
     let result = partition(input);
     assert (len(result.lefts) == 0u);
     assert (len(result.rights) == 0u);
diff --git a/src/test/stdtest/getopts.rs b/src/test/stdtest/getopts.rs
index 10acbafcb12..55d67729129 100644
--- a/src/test/stdtest/getopts.rs
+++ b/src/test/stdtest/getopts.rs
@@ -27,8 +27,8 @@ fn check_fail_type(f: opt::fail_, ft: fail_type) {
 // Tests for reqopt
 #[test]
 fn test_reqopt_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test=20"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -41,8 +41,8 @@ fn test_reqopt_long() {
 
 #[test]
 fn test_reqopt_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -52,8 +52,8 @@ fn test_reqopt_long_missing() {
 
 #[test]
 fn test_reqopt_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -63,8 +63,8 @@ fn test_reqopt_long_no_arg() {
 
 #[test]
 fn test_reqopt_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::reqopt("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -74,8 +74,8 @@ fn test_reqopt_long_multi() {
 
 #[test]
 fn test_reqopt_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -88,8 +88,8 @@ fn test_reqopt_short() {
 
 #[test]
 fn test_reqopt_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -99,8 +99,8 @@ fn test_reqopt_short_missing() {
 
 #[test]
 fn test_reqopt_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -110,8 +110,8 @@ fn test_reqopt_short_no_arg() {
 
 #[test]
 fn test_reqopt_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::reqopt("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -123,8 +123,8 @@ fn test_reqopt_short_multi() {
 // Tests for optopt
 #[test]
 fn test_optopt_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -137,8 +137,8 @@ fn test_optopt_long() {
 
 #[test]
 fn test_optopt_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["blah"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -148,8 +148,8 @@ fn test_optopt_long_missing() {
 
 #[test]
 fn test_optopt_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -159,8 +159,8 @@ fn test_optopt_long_no_arg() {
 
 #[test]
 fn test_optopt_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::optopt("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -170,8 +170,8 @@ fn test_optopt_long_multi() {
 
 #[test]
 fn test_optopt_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -184,8 +184,8 @@ fn test_optopt_short() {
 
 #[test]
 fn test_optopt_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["blah"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -195,8 +195,8 @@ fn test_optopt_short_missing() {
 
 #[test]
 fn test_optopt_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -206,8 +206,8 @@ fn test_optopt_short_no_arg() {
 
 #[test]
 fn test_optopt_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::optopt("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -219,8 +219,8 @@ fn test_optopt_short_multi() {
 // Tests for optflag
 #[test]
 fn test_optflag_long() {
-    let args = ~["--test"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (opt::opt_present(m, "test")); }
@@ -230,8 +230,8 @@ fn test_optflag_long() {
 
 #[test]
 fn test_optflag_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["blah"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -241,8 +241,8 @@ fn test_optflag_long_missing() {
 
 #[test]
 fn test_optflag_long_arg() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) {
@@ -255,8 +255,8 @@ fn test_optflag_long_arg() {
 
 #[test]
 fn test_optflag_long_multi() {
-    let args = ~["--test", "--test"];
-    let opts = ~[opt::optflag("test")];
+    let args = ["--test", "--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -266,8 +266,8 @@ fn test_optflag_long_multi() {
 
 #[test]
 fn test_optflag_short() {
-    let args = ~["-t"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (opt::opt_present(m, "t")); }
@@ -277,8 +277,8 @@ fn test_optflag_short() {
 
 #[test]
 fn test_optflag_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["blah"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -288,14 +288,14 @@ fn test_optflag_short_missing() {
 
 #[test]
 fn test_optflag_short_arg() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         // The next variable after the flag is just a free argument
 
-        assert (m.free.(0) == "20");
+        assert (m.free[0] == "20");
       }
       _ { fail; }
     }
@@ -303,8 +303,8 @@ fn test_optflag_short_arg() {
 
 #[test]
 fn test_optflag_short_multi() {
-    let args = ~["-t", "-t"];
-    let opts = ~[opt::optflag("t")];
+    let args = ["-t", "-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -316,8 +316,8 @@ fn test_optflag_short_multi() {
 // Tests for optmulti
 #[test]
 fn test_optmulti_long() {
-    let args = ~["--test=20"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test=20"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -330,8 +330,8 @@ fn test_optmulti_long() {
 
 #[test]
 fn test_optmulti_long_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "test")); }
@@ -341,8 +341,8 @@ fn test_optmulti_long_missing() {
 
 #[test]
 fn test_optmulti_long_no_arg() {
-    let args = ~["--test"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -352,15 +352,15 @@ fn test_optmulti_long_no_arg() {
 
 #[test]
 fn test_optmulti_long_multi() {
-    let args = ~["--test=20", "--test=30"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         assert (opt::opt_present(m, "test"));
         assert (opt::opt_str(m, "test") == "20");
-        assert (opt::opt_strs(m, "test").(0) == "20");
-        assert (opt::opt_strs(m, "test").(1) == "30");
+        assert (opt::opt_strs(m, "test")[0] == "20");
+        assert (opt::opt_strs(m, "test")[1] == "30");
       }
       _ { fail; }
     }
@@ -368,8 +368,8 @@ fn test_optmulti_long_multi() {
 
 #[test]
 fn test_optmulti_short() {
-    let args = ~["-t", "20"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
@@ -382,8 +382,8 @@ fn test_optmulti_short() {
 
 #[test]
 fn test_optmulti_short_missing() {
-    let args = ~["blah"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) { assert (!opt::opt_present(m, "t")); }
@@ -393,8 +393,8 @@ fn test_optmulti_short_missing() {
 
 #[test]
 fn test_optmulti_short_no_arg() {
-    let args = ~["-t"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -404,15 +404,15 @@ fn test_optmulti_short_no_arg() {
 
 #[test]
 fn test_optmulti_short_multi() {
-    let args = ~["-t", "20", "-t", "30"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         assert (opt::opt_present(m, "t"));
         assert (opt::opt_str(m, "t") == "20");
-        assert (opt::opt_strs(m, "t").(0) == "20");
-        assert (opt::opt_strs(m, "t").(1) == "30");
+        assert (opt::opt_strs(m, "t")[0] == "20");
+        assert (opt::opt_strs(m, "t")[1] == "30");
       }
       _ { fail; }
     }
@@ -420,8 +420,8 @@ fn test_optmulti_short_multi() {
 
 #[test]
 fn test_unrecognized_option_long() {
-    let args = ~["--untest"];
-    let opts = ~[opt::optmulti("t")];
+    let args = ["--untest"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -431,8 +431,8 @@ fn test_unrecognized_option_long() {
 
 #[test]
 fn test_unrecognized_option_short() {
-    let args = ~["-t"];
-    let opts = ~[opt::optmulti("test")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -443,23 +443,23 @@ fn test_unrecognized_option_short() {
 #[test]
 fn test_combined() {
     let args =
-        ~["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f",
+        ["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f",
          "-m", "40", "-m", "50"];
     let opts =
-        ~[opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"),
+        [opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"),
          opt::optflag("f"), opt::optmulti("m"), opt::optopt("notpresent")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (m.free.(0) == "prog");
-        assert (m.free.(1) == "free1");
+        assert (m.free[0] == "prog");
+        assert (m.free[1] == "free1");
         assert (opt::opt_str(m, "s") == "20");
-        assert (m.free.(2) == "free2");
+        assert (m.free[2] == "free2");
         assert (opt::opt_present(m, "flag"));
         assert (opt::opt_str(m, "long") == "30");
         assert (opt::opt_present(m, "f"));
-        assert (opt::opt_strs(m, "m").(0) == "40");
-        assert (opt::opt_strs(m, "m").(1) == "50");
+        assert (opt::opt_strs(m, "m")[0] == "40");
+        assert (opt::opt_strs(m, "m")[1] == "50");
         assert (!opt::opt_present(m, "notpresent"));
       }
       _ { fail; }
diff --git a/src/test/stdtest/int.rs b/src/test/stdtest/int.rs
index 936b1fa91d3..61d3448a175 100644
--- a/src/test/stdtest/int.rs
+++ b/src/test/stdtest/int.rs
@@ -22,4 +22,4 @@ fn test_pow() {
     assert (int::pow(-3, 2u) == 9);
     assert (int::pow(-3, 3u) == -27);
     assert (int::pow(4, 9u) == 262144);
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/io.rs b/src/test/stdtest/io.rs
index 002592d9020..08330c619fc 100644
--- a/src/test/stdtest/io.rs
+++ b/src/test/stdtest/io.rs
@@ -13,7 +13,7 @@ fn test_simple() {
     log frood;
     {
         let out: io::writer =
-            io::file_writer(tmpfile, ~[io::create, io::truncate]);
+            io::file_writer(tmpfile, [io::create, io::truncate]);
         out.write_str(frood);
     }
     let inp: io::reader = io::file_reader(tmpfile);
diff --git a/src/test/stdtest/list.rs b/src/test/stdtest/list.rs
index 4a44508efc4..9e05115a4f8 100644
--- a/src/test/stdtest/list.rs
+++ b/src/test/stdtest/list.rs
@@ -8,7 +8,7 @@ import std::option;
 
 #[test]
 fn test_from_vec() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     assert (car(l) == 0);
     assert (car(cdr(l)) == 1);
     assert (car(cdr(cdr(l))) == 2);
@@ -16,7 +16,7 @@ fn test_from_vec() {
 
 #[test]
 fn test_foldl() {
-    let l = from_vec(~[0, 1, 2, 3, 4]);
+    let l = from_vec([0, 1, 2, 3, 4]);
     fn add(a: &int, b: &uint) -> uint { ret (a as uint) + b; }
     let rs = list::foldl(l, 0u, add);
     assert (rs == 10u);
@@ -24,7 +24,7 @@ fn test_foldl() {
 
 #[test]
 fn test_find_success() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     fn match(i: &int) -> option::t<int> {
         ret if i == 2 { option::some(i) } else { option::none::<int> };
     }
@@ -34,7 +34,7 @@ fn test_find_success() {
 
 #[test]
 fn test_find_fail() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     fn match(i: &int) -> option::t<int> { ret option::none::<int>; }
     let rs = list::find(l, match);
     assert (rs == option::none::<int>);
@@ -42,7 +42,7 @@ fn test_find_fail() {
 
 #[test]
 fn test_has() {
-    let l = from_vec(~[5, 8, 6]);
+    let l = from_vec([5, 8, 6]);
     let empty = list::nil::<int>;
     assert (list::has(l, 5));
     assert (!list::has(l, 7));
@@ -52,7 +52,7 @@ fn test_has() {
 
 #[test]
 fn test_length() {
-    let l = from_vec(~[0, 1, 2]);
+    let l = from_vec([0, 1, 2]);
     assert (list::length(l) == 3u);
 }
 
diff --git a/src/test/stdtest/net.rs b/src/test/stdtest/net.rs
index c1a26cb747d..9da7a12a060 100644
--- a/src/test/stdtest/net.rs
+++ b/src/test/stdtest/net.rs
@@ -3,10 +3,10 @@ import std::net;
 
 #[test]
 fn test_format_ip() {
-    assert(net::format_addr(net::ipv4(127u8,0u8,0u8,1u8)) == "127.0.0.1")
+    assert (net::format_addr(net::ipv4(127u8, 0u8, 0u8, 1u8)) == "127.0.0.1")
 }
 
 #[test]
 fn test_parse_ip() {
-    assert(net::parse_addr("127.0.0.1") == net::ipv4(127u8,0u8,0u8,1u8));
+    assert (net::parse_addr("127.0.0.1") == net::ipv4(127u8, 0u8, 0u8, 1u8));
 }
diff --git a/src/test/stdtest/path.rs b/src/test/stdtest/path.rs
index 5f7c34c5e05..911bc6b0dd9 100644
--- a/src/test/stdtest/path.rs
+++ b/src/test/stdtest/path.rs
@@ -14,4 +14,4 @@ fn test() {
 
     log fs::make_absolute("test-path");
     log fs::make_absolute("/usr/bin");
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/ptr.rs b/src/test/stdtest/ptr.rs
index 269febfc6b7..ef0ffa54a04 100644
--- a/src/test/stdtest/ptr.rs
+++ b/src/test/stdtest/ptr.rs
@@ -9,10 +9,10 @@ fn test() {
     let p = {mutable fst: 10, mutable snd: 20};
     let pptr: *mutable pair = ptr::addr_of(p);
     let iptr: *mutable int = unsafe::reinterpret_cast(pptr);
-    assert (*iptr == 10);
+    assert (*iptr == 10);;
     *iptr = 30;
     assert (*iptr == 30);
-    assert (p.fst == 30);
+    assert (p.fst == 30);;
 
     *pptr = {mutable fst: 50, mutable snd: 60};
     assert (*iptr == 50);
diff --git a/src/test/stdtest/qsort.rs b/src/test/stdtest/qsort.rs
index 4e557b533a4..250d77a4593 100644
--- a/src/test/stdtest/qsort.rs
+++ b/src/test/stdtest/qsort.rs
@@ -11,30 +11,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) {
     let f = ltequal;
     std::sort::quick_sort::<int>(f, v1);
     let i = 0u;
-    while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; }
+    while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
     {
-        let v1 = ~[mutable 1, 1, 1];
-        let v2 = ~[mutable 1, 1, 1];
+        let v1 = [mutable 1, 1, 1];
+        let v2 = [mutable 1, 1, 1];
         check_sort(v1, v2);
     }
     {
-        let v1: [mutable int] = ~[mutable ];
-        let v2: [mutable int] = ~[mutable ];
+        let v1: [mutable int] = [mutable];
+        let v2: [mutable int] = [mutable];
         check_sort(v1, v2);
     }
-    { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); }
+    { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); }
     {
-        let v1 = ~[mutable 9, 3, 3, 3, 9];
-        let v2 = ~[mutable 3, 3, 3, 9, 9];
+        let v1 = [mutable 9, 3, 3, 3, 9];
+        let v2 = [mutable 3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
@@ -42,18 +42,15 @@ fn test() {
 // Regression test for #705
 #[test]
 fn test_simple() {
-    let names = ~[mutable 2, 1, 3];
+    let names = [mutable 2, 1, 3];
 
-    let expected = ~[1, 2, 3];
+    let expected = [1, 2, 3];
 
     fn lteq(a: &int, b: &int) -> bool { int::le(a, b) }
     sort::quick_sort(lteq, names);
 
     let pairs = vec::zip(expected, vec::from_mut(names));
-    for (a, b) in pairs {
-        log #fmt("%d %d", a, b);
-        assert (a == b);
-    }
+    for (a, b) in pairs { log #fmt["%d %d", a, b]; assert (a == b); }
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/qsort3.rs b/src/test/stdtest/qsort3.rs
index 21f43218806..6c8df212218 100644
--- a/src/test/stdtest/qsort3.rs
+++ b/src/test/stdtest/qsort3.rs
@@ -9,30 +9,30 @@ fn check_sort(v1: &[mutable int], v2: &[mutable int]) {
     let f2 = equal;
     std::sort::quick_sort3::<int>(f1, f2, v1);
     let i = 0u;
-    while i < len { log v2.(i); assert (v2.(i) == v1.(i)); i += 1u; }
+    while i < len { log v2[i]; assert (v2[i] == v1[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[mutable 3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[mutable 2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [mutable 3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [mutable 2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
     {
-        let v1 = ~[mutable 1, 1, 1];
-        let v2 = ~[mutable 1, 1, 1];
+        let v1 = [mutable 1, 1, 1];
+        let v2 = [mutable 1, 1, 1];
         check_sort(v1, v2);
     }
     {
-        let v1: [mutable int] = ~[mutable ];
-        let v2: [mutable int] = ~[mutable ];
+        let v1: [mutable int] = [mutable];
+        let v2: [mutable int] = [mutable];
         check_sort(v1, v2);
     }
-    { let v1 = ~[mutable 9]; let v2 = ~[mutable 9]; check_sort(v1, v2); }
+    { let v1 = [mutable 9]; let v2 = [mutable 9]; check_sort(v1, v2); }
     {
-        let v1 = ~[mutable 9, 3, 3, 3, 9];
-        let v2 = ~[mutable 3, 3, 3, 9, 9];
+        let v1 = [mutable 9, 3, 3, 3, 9];
+        let v2 = [mutable 3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
diff --git a/src/test/stdtest/rand.rs b/src/test/stdtest/rand.rs
index bf394602fab..a8f13ed6704 100644
--- a/src/test/stdtest/rand.rs
+++ b/src/test/stdtest/rand.rs
@@ -26,4 +26,4 @@ fn test() {
     }
     log r1.next();
     log r1.next();
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/run.rs b/src/test/stdtest/run.rs
index 7476cb6621b..b60a3935500 100644
--- a/src/test/stdtest/run.rs
+++ b/src/test/stdtest/run.rs
@@ -11,9 +11,9 @@ import std::vec;
 #[cfg(target_os = "macos")]
 #[test]
 fn test_leaks() {
-    run::run_program("echo", ~[]);
-    run::start_program("echo", ~[]);
-    run::program_output("echo", ~[]);
+    run::run_program("echo", []);
+    run::start_program("echo", []);
+    run::program_output("echo", []);
 }
 
 // FIXME
@@ -28,8 +28,8 @@ fn test_pipes() {
     let pipe_out = os::pipe();
     let pipe_err = os::pipe();
 
-    let pid = run::spawn_process("cat", ~[],
-       pipe_in.in, pipe_out.out, pipe_err.out);
+    let pid =
+        run::spawn_process("cat", [], pipe_in.in, pipe_out.out, pipe_err.out);
     os::libc::close(pipe_in.in);
     os::libc::close(pipe_out.out);
     os::libc::close(pipe_err.out);
@@ -43,11 +43,10 @@ fn test_pipes() {
 
     log expected;
     log actual;
-    assert expected == actual;
+    assert (expected == actual);
 
     fn writeclose(fd: int, s: &str) {
-        let writer = io::new_writer(
-            io::fd_buf_writer(fd, option::none));
+        let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(s);
 
         os::libc::close(fd);
@@ -56,8 +55,7 @@ fn test_pipes() {
     fn readclose(fd: int) -> str {
         // Copied from run::program_output
         let file = os::fd_FILE(fd);
-        let reader = io::new_reader(
-            io::FILE_buf_reader(file, option::none));
+        let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
         let buf = "";
         while !reader.eof() {
             let bytes = reader.read_bytes(4096u);
@@ -66,4 +64,4 @@ fn test_pipes() {
         os::libc::fclose(file);
         ret buf;
     }
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/sha1.rs b/src/test/stdtest/sha1.rs
index 74729fa52ae..6b72be20dd5 100644
--- a/src/test/stdtest/sha1.rs
+++ b/src/test/stdtest/sha1.rs
@@ -20,53 +20,43 @@ fn test() {
     // Test messages from FIPS 180-1
 
     let fips_180_1_tests: [test] =
-        ~[{input: "abc",
+        [{input: "abc",
           output:
-              ~[0xA9u8, 0x99u8, 0x3Eu8, 0x36u8,
-                0x47u8, 0x06u8, 0x81u8, 0x6Au8,
-                0xBAu8, 0x3Eu8, 0x25u8, 0x71u8,
-                0x78u8, 0x50u8, 0xC2u8, 0x6Cu8,
-                0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]},
+              [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8,
+               0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8,
+               0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]},
          {input:
               "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq",
           output:
-              ~[0x84u8, 0x98u8, 0x3Eu8, 0x44u8,
-                0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8,
-                0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8,
-                0xF9u8, 0x51u8, 0x29u8, 0xE5u8,
-                0xE5u8, 0x46u8, 0x70u8, 0xF1u8]},
+              [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8,
+               0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, 0xE5u8,
+               0xE5u8, 0x46u8, 0x70u8, 0xF1u8]},
          {input: a_million_letter_a(),
           output:
-              ~[0x34u8, 0xAAu8, 0x97u8, 0x3Cu8,
-                0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8,
-                0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8,
-                0xDBu8, 0xADu8, 0x27u8, 0x31u8,
-                0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}];
+              [0x34u8, 0xAAu8, 0x97u8, 0x3Cu8, 0xD4u8, 0xC4u8, 0xDAu8, 0xA4u8,
+               0xF6u8, 0x1Eu8, 0xEBu8, 0x2Bu8, 0xDBu8, 0xADu8, 0x27u8, 0x31u8,
+               0x65u8, 0x34u8, 0x01u8, 0x6Fu8]}];
     // Examples from wikipedia
 
     let wikipedia_tests: [test] =
-        ~[{input: "The quick brown fox jumps over the lazy dog",
+        [{input: "The quick brown fox jumps over the lazy dog",
           output:
-              ~[0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8,
-                0x7au8, 0x2du8, 0x28u8, 0xfcu8,
-                0xedu8, 0x84u8, 0x9eu8, 0xe1u8,
-                0xbbu8, 0x76u8, 0xe7u8, 0x39u8,
-                0x1bu8, 0x93u8, 0xebu8, 0x12u8]},
+              [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8,
+               0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, 0x39u8,
+               0x1bu8, 0x93u8, 0xebu8, 0x12u8]},
          {input: "The quick brown fox jumps over the lazy cog",
           output:
-              ~[0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8,
-                0xd2u8, 0x5eu8, 0x1bu8, 0x3au8,
-                0xfau8, 0xd3u8, 0xe8u8, 0x5au8,
-                0x0bu8, 0xd1u8, 0x7du8, 0x9bu8,
-                0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}];
+              [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8,
+               0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8,
+               0x10u8, 0x0du8, 0xb4u8, 0xb3u8]}];
     let tests = fips_180_1_tests + wikipedia_tests;
     fn check_vec_eq(v0: &[u8], v1: &[u8]) {
         assert (vec::len::<u8>(v0) == vec::len::<u8>(v1));
         let len = vec::len::<u8>(v0);
         let i = 0u;
         while i < len {
-            let a = v0.(i);
-            let b = v1.(i);
+            let a = v0[i];
+            let b = v1[i];
             assert (a == b);
             i += 1u;
         }
diff --git a/src/test/stdtest/sort.rs b/src/test/stdtest/sort.rs
index be15881e65a..c42f950ce6b 100644
--- a/src/test/stdtest/sort.rs
+++ b/src/test/stdtest/sort.rs
@@ -7,22 +7,22 @@ fn check_sort(v1: &[int], v2: &[int]) {
     let f = lteq;
     let v3 = std::sort::merge_sort::<int>(f, v1);
     let i = 0u;
-    while i < len { log v3.(i); assert (v3.(i) == v2.(i)); i += 1u; }
+    while i < len { log v3[i]; assert (v3[i] == v2[i]); i += 1u; }
 }
 
 #[test]
 fn test() {
     {
-        let v1 = ~[3, 7, 4, 5, 2, 9, 5, 8];
-        let v2 = ~[2, 3, 4, 5, 5, 7, 8, 9];
+        let v1 = [3, 7, 4, 5, 2, 9, 5, 8];
+        let v2 = [2, 3, 4, 5, 5, 7, 8, 9];
         check_sort(v1, v2);
     }
-    { let v1 = ~[1, 1, 1]; let v2 = ~[1, 1, 1]; check_sort(v1, v2); }
-    { let v1: [int] = ~[]; let v2: [int] = ~[]; check_sort(v1, v2); }
-    { let v1 = ~[9]; let v2 = ~[9]; check_sort(v1, v2); }
+    { let v1 = [1, 1, 1]; let v2 = [1, 1, 1]; check_sort(v1, v2); }
+    { let v1: [int] = []; let v2: [int] = []; check_sort(v1, v2); }
+    { let v1 = [9]; let v2 = [9]; check_sort(v1, v2); }
     {
-        let v1 = ~[9, 3, 3, 3, 9];
-        let v2 = ~[3, 3, 3, 9, 9];
+        let v1 = [9, 3, 3, 3, 9];
+        let v2 = [3, 3, 3, 9, 9];
         check_sort(v1, v2);
     }
 }
diff --git a/src/test/stdtest/str.rs b/src/test/stdtest/str.rs
index 8124e565f6a..ef225c82fd8 100644
--- a/src/test/stdtest/str.rs
+++ b/src/test/stdtest/str.rs
@@ -30,8 +30,8 @@ fn test_split() {
         let v = str::split(s, c as u8);
         log "split to: ";
         for z: str in v { log z; }
-        log "comparing: " + v.(i) + " vs. " + k;
-        assert (str::eq(v.(i), k));
+        log "comparing: " + v[i] + " vs. " + k;
+        assert (str::eq(v[i], k));
     }
     t("abc.hello.there", '.', 0, "abc");
     t("abc.hello.there", '.', 1, "hello");
@@ -70,10 +70,10 @@ fn test_substr() {
 #[test]
 fn test_concat() {
     fn t(v: &[str], s: &str) { assert (str::eq(str::concat(v), s)); }
-    t(~["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
-    let v: [str] = ~[];
+    t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
+    let v: [str] = [];
     t(v, "");
-    t(~["hi"], "hi");
+    t(["hi"], "hi");
 }
 
 #[test]
@@ -81,10 +81,10 @@ fn test_connect() {
     fn t(v: &[str], sep: &str, s: &str) {
         assert (str::eq(str::connect(v, sep), s));
     }
-    t(~["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
-    let v: [str] = ~[];
+    t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
+    let v: [str] = [];
     t(v, " ", "");
-    t(~["hi"], " ", "hi");
+    t(["hi"], " ", "hi");
 }
 
 #[test]
@@ -164,41 +164,41 @@ fn test_char_slice() {
 
 #[test]
 fn trim_left() {
-    assert str::trim_left("") == "";
-    assert str::trim_left("a") == "a";
-    assert str::trim_left("    ") == "";
-    assert str::trim_left("     blah") == "blah";
-    assert str::trim_left("   \u3000  wut") == "wut";
-    assert str::trim_left("hey ") == "hey ";
+    assert (str::trim_left("") == "");
+    assert (str::trim_left("a") == "a");
+    assert (str::trim_left("    ") == "");
+    assert (str::trim_left("     blah") == "blah");
+    assert (str::trim_left("   \u3000  wut") == "wut");
+    assert (str::trim_left("hey ") == "hey ");
 }
 
 #[test]
 fn trim_right() {
-    assert str::trim_right("") == "";
-    assert str::trim_right("a") == "a";
-    assert str::trim_right("    ") == "";
-    assert str::trim_right("blah     ") == "blah";
-    assert str::trim_right("wut   \u3000  ") == "wut";
-    assert str::trim_right(" hey") == " hey";
+    assert (str::trim_right("") == "");
+    assert (str::trim_right("a") == "a");
+    assert (str::trim_right("    ") == "");
+    assert (str::trim_right("blah     ") == "blah");
+    assert (str::trim_right("wut   \u3000  ") == "wut");
+    assert (str::trim_right(" hey") == " hey");
 }
 
 #[test]
 fn trim() {
-    assert str::trim("") == "";
-    assert str::trim("a") == "a";
-    assert str::trim("    ") == "";
-    assert str::trim("    blah     ") == "blah";
-    assert str::trim("\nwut   \u3000  ") == "wut";
-    assert str::trim(" hey dude ") == "hey dude";
+    assert (str::trim("") == "");
+    assert (str::trim("a") == "a");
+    assert (str::trim("    ") == "");
+    assert (str::trim("    blah     ") == "blah");
+    assert (str::trim("\nwut   \u3000  ") == "wut");
+    assert (str::trim(" hey dude ") == "hey dude");
 }
 
 #[test]
 fn is_whitespace() {
-    assert str::is_whitespace("");
-    assert str::is_whitespace(" ");
-    assert str::is_whitespace("\u2009"); // Thin space
-    assert str::is_whitespace("  \n\t   ");
-    assert !str::is_whitespace("   _   ");
+    assert (str::is_whitespace(""));
+    assert (str::is_whitespace(" "));
+    assert (str::is_whitespace("\u2009")); // Thin space
+    assert (str::is_whitespace("  \n\t   "));
+    assert (!str::is_whitespace("   _   "));
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/str_buf.rs b/src/test/stdtest/str_buf.rs
index 6b013ed8db2..8bb040dde9c 100644
--- a/src/test/stdtest/str_buf.rs
+++ b/src/test/stdtest/str_buf.rs
@@ -12,4 +12,4 @@ fn test() {
     assert (str::eq(s_cstr, s));
     let s_buf = str::str_from_buf(sb, 5u);
     assert (str::eq(s_buf, s));
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/task.rs b/src/test/stdtest/task.rs
index 517210b9c56..d30d6addd0b 100644
--- a/src/test/stdtest/task.rs
+++ b/src/test/stdtest/task.rs
@@ -37,7 +37,7 @@ fn test_lib_spawn() {
 
 #[test]
 fn test_lib_spawn2() {
-    fn foo(x : int) { assert(x == 42); }
+    fn foo(x: int) { assert (x == 42); }
     task::_spawn(bind foo(42));
 }
 
@@ -52,7 +52,7 @@ fn test_join_chan() {
     log_err "received task status message";
     log_err s;
     alt s {
-      task::exit(_, task::tr_success.) { /* yay! */ }
+      task::exit(_, task::tr_success.) {/* yay! */ }
       _ { fail "invalid task status received" }
     }
 }
@@ -68,7 +68,7 @@ fn test_join_chan_fail() {
     log_err "received task status message";
     log_err s;
     alt s {
-      task::exit(_, task::tr_failure.) { /* yay! */ }
+      task::exit(_, task::tr_failure.) {/* yay! */ }
       _ { fail "invalid task status received" }
     }
 }
@@ -78,5 +78,5 @@ fn test_join_convenient() {
     fn winner() { }
     let f = winner;
     let handle = task::spawn_joinable(f);
-    assert(task::tr_success == task::join(handle));
+    assert (task::tr_success == task::join(handle));
 }
diff --git a/src/test/stdtest/test.rs b/src/test/stdtest/test.rs
index e85829b4477..e32105c2f0a 100644
--- a/src/test/stdtest/test.rs
+++ b/src/test/stdtest/test.rs
@@ -26,7 +26,7 @@ fn ignored_tests_result_in_ignored() {
 
 #[test]
 fn first_free_arg_should_be_a_filter() {
-    let args = ~["progname", "filter"];
+    let args = ["progname", "filter"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
     assert (str::eq("filter", option::get(opts.filter)));
@@ -34,7 +34,7 @@ fn first_free_arg_should_be_a_filter() {
 
 #[test]
 fn parse_ignored_flag() {
-    let args = ~["progname", "filter", "--ignored"];
+    let args = ["progname", "filter", "--ignored"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
     assert (opts.run_ignored);
@@ -47,13 +47,13 @@ fn filter_for_ignored_option() {
 
     let opts = {filter: option::none, run_ignored: true};
     let tests =
-        ~[{name: "1", fn: fn () { }, ignore: true},
-          {name: "2", fn: fn () { }, ignore: false}];
+        [{name: "1", fn: fn () { }, ignore: true},
+         {name: "2", fn: fn () { }, ignore: false}];
     let filtered = test::filter_tests(opts, tests);
 
     assert (vec::len(filtered) == 1u);
-    assert (filtered.(0).name == "1");
-    assert (filtered.(0).ignore == false);
+    assert (filtered[0].name == "1");
+    assert (filtered[0].ignore == false);
 }
 
 #[test]
@@ -61,37 +61,35 @@ fn sort_tests() {
     let opts = {filter: option::none, run_ignored: false};
 
     let names =
-        ~["sha1::test", "int::test_to_str", "int::test_pow",
-          "test::do_not_run_ignored_tests",
-          "test::ignored_tests_result_in_ignored",
-          "test::first_free_arg_should_be_a_filter",
-          "test::parse_ignored_flag", "test::filter_for_ignored_option",
-          "test::sort_tests"];
+        ["sha1::test", "int::test_to_str", "int::test_pow",
+         "test::do_not_run_ignored_tests",
+         "test::ignored_tests_result_in_ignored",
+         "test::first_free_arg_should_be_a_filter",
+         "test::parse_ignored_flag", "test::filter_for_ignored_option",
+         "test::sort_tests"];
     let tests =
         {
             let testfn = fn () { };
-            let tests = ~[];
+            let tests = [];
             for name: str in names {
                 let test = {name: name, fn: testfn, ignore: false};
-                tests += ~[test];
+                tests += [test];
             }
             tests
         };
     let filtered = test::filter_tests(opts, tests);
 
     let expected =
-        ~["int::test_pow", "int::test_to_str", "sha1::test",
-          "test::do_not_run_ignored_tests", "test::filter_for_ignored_option",
-          "test::first_free_arg_should_be_a_filter",
-          "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag",
-          "test::sort_tests"];
+        ["int::test_pow", "int::test_to_str", "sha1::test",
+         "test::do_not_run_ignored_tests", "test::filter_for_ignored_option",
+         "test::first_free_arg_should_be_a_filter",
+         "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag",
+         "test::sort_tests"];
 
     let pairs = vec::zip(expected, filtered);
 
 
-    for (a, b) in pairs {
-        assert (a == b.name);
-    }
+    for (a, b) in pairs { assert (a == b.name); }
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/uint.rs b/src/test/stdtest/uint.rs
index 8b450b8a5ff..7361c76b70b 100644
--- a/src/test/stdtest/uint.rs
+++ b/src/test/stdtest/uint.rs
@@ -46,4 +46,4 @@ fn test_next_power_of_two() {
     assert (uint::next_power_of_two(37u) == 64u);
     assert (uint::next_power_of_two(38u) == 64u);
     assert (uint::next_power_of_two(39u) == 64u);
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/vec.rs b/src/test/stdtest/vec.rs
index 75b3998e28c..1ffe3982cd2 100644
--- a/src/test/stdtest/vec.rs
+++ b/src/test/stdtest/vec.rs
@@ -20,7 +20,7 @@ fn add(x: &uint, y: &uint) -> uint { ret x + y; }
 
 #[test]
 fn test_reserve_and_on_heap() {
-    let v: [int] = ~[1, 2];
+    let v: [int] = [1, 2];
     assert (!vec::on_heap(v));
     vec::reserve(v, 8u);
     assert (vec::on_heap(v));
@@ -29,26 +29,26 @@ fn test_reserve_and_on_heap() {
 #[test]
 fn test_unsafe_ptrs() {
     // Test on-stack copy-from-buf.
-    let a = ~[1, 2, 3];
+    let a = [1, 2, 3];
     let ptr = vec::to_ptr(a);
-    let b = ~[];
+    let b = [];
     vec::unsafe::copy_from_buf(b, ptr, 3u);
     assert (vec::len(b) == 3u);
-    assert (b.(0) == 1);
-    assert (b.(1) == 2);
-    assert (b.(2) == 3);
+    assert (b[0] == 1);
+    assert (b[1] == 2);
+    assert (b[2] == 3);
 
     // Test on-heap copy-from-buf.
-    let c = ~[1, 2, 3, 4, 5];
+    let c = [1, 2, 3, 4, 5];
     ptr = vec::to_ptr(c);
-    let d = ~[];
+    let d = [];
     vec::unsafe::copy_from_buf(d, ptr, 5u);
     assert (vec::len(d) == 5u);
-    assert (d.(0) == 1);
-    assert (d.(1) == 2);
-    assert (d.(2) == 3);
-    assert (d.(3) == 4);
-    assert (d.(4) == 5);
+    assert (d[0] == 1);
+    assert (d[1] == 2);
+    assert (d[2] == 3);
+    assert (d[3] == 4);
+    assert (d[4] == 5);
 }
 
 #[test]
@@ -56,18 +56,18 @@ fn test_init_fn() {
     // Test on-stack init_fn.
     let v = vec::init_fn(square, 3u);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
 
     // Test on-heap init_fn.
     v = vec::init_fn(square, 5u);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
-    assert (v.(3) == 9u);
-    assert (v.(4) == 16u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
+    assert (v[3] == 9u);
+    assert (v[4] == 16u);
 }
 
 #[test]
@@ -75,194 +75,194 @@ fn test_init_elt() {
     // Test on-stack init_elt.
     let v = vec::init_elt(10u, 2u);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 10u);
-    assert (v.(1) == 10u);
+    assert (v[0] == 10u);
+    assert (v[1] == 10u);
 
     // Test on-heap init_elt.
     v = vec::init_elt(20u, 6u);
-    assert (v.(0) == 20u);
-    assert (v.(1) == 20u);
-    assert (v.(2) == 20u);
-    assert (v.(3) == 20u);
-    assert (v.(4) == 20u);
-    assert (v.(5) == 20u);
+    assert (v[0] == 20u);
+    assert (v[1] == 20u);
+    assert (v[2] == 20u);
+    assert (v[3] == 20u);
+    assert (v[4] == 20u);
+    assert (v[5] == 20u);
 }
 
 #[test]
 fn test_is_empty() {
-    assert (vec::is_empty::<int>(~[]));
-    assert (!vec::is_empty(~[0]));
+    assert (vec::is_empty::<int>([]));
+    assert (!vec::is_empty([0]));
 }
 
 #[test]
 fn test_is_not_empty() {
-    assert (vec::is_not_empty(~[0]));
-    assert (!vec::is_not_empty::<int>(~[]));
+    assert (vec::is_not_empty([0]));
+    assert (!vec::is_not_empty::<int>([]));
 }
 
 #[test]
 fn test_head() {
-    let a = ~[11, 12];
+    let a = [11, 12];
     check (vec::is_not_empty(a));
     assert (vec::head(a) == 11);
 }
 
 #[test]
 fn test_tail() {
-    let a = ~[11];
+    let a = [11];
     check (vec::is_not_empty(a));
-    assert (vec::tail(a) == ~[]);
+    assert (vec::tail(a) == []);
 
-    a = ~[11, 12];
+    a = [11, 12];
     check (vec::is_not_empty(a));
-    assert (vec::tail(a) == ~[12]);
+    assert (vec::tail(a) == [12]);
 }
 
 #[test]
 fn test_last() {
-    let n = vec::last(~[]);
+    let n = vec::last([]);
     assert (n == none);
-    n = vec::last(~[1, 2, 3]);
+    n = vec::last([1, 2, 3]);
     assert (n == some(3));
-    n = vec::last(~[1, 2, 3, 4, 5]);
+    n = vec::last([1, 2, 3, 4, 5]);
     assert (n == some(5));
 }
 
 #[test]
 fn test_slice() {
     // Test on-stack -> on-stack slice.
-    let v = vec::slice(~[1, 2, 3], 1u, 3u);
+    let v = vec::slice([1, 2, 3], 1u, 3u);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 2);
-    assert (v.(1) == 3);
+    assert (v[0] == 2);
+    assert (v[1] == 3);
 
     // Test on-heap -> on-stack slice.
-    v = vec::slice(~[1, 2, 3, 4, 5], 0u, 3u);
+    v = vec::slice([1, 2, 3, 4, 5], 0u, 3u);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
 
     // Test on-heap -> on-heap slice.
-    v = vec::slice(~[1, 2, 3, 4, 5, 6], 1u, 6u);
+    v = vec::slice([1, 2, 3, 4, 5, 6], 1u, 6u);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 2);
-    assert (v.(1) == 3);
-    assert (v.(2) == 4);
-    assert (v.(3) == 5);
-    assert (v.(4) == 6);
+    assert (v[0] == 2);
+    assert (v[1] == 3);
+    assert (v[2] == 4);
+    assert (v[3] == 5);
+    assert (v[4] == 6);
 }
 
 #[test]
 fn test_pop() {
     // Test on-stack pop.
-    let v = ~[1, 2, 3];
+    let v = [1, 2, 3];
     let e = vec::pop(v);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
     assert (e == 3);
 
     // Test on-heap pop.
-    v = ~[1, 2, 3, 4, 5];
+    v = [1, 2, 3, 4, 5];
     e = vec::pop(v);
     assert (vec::len(v) == 4u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
     assert (e == 5);
 }
 
 #[test]
 fn test_grow() {
     // Test on-stack grow().
-    let v = ~[];
+    let v = [];
     vec::grow(v, 2u, 1);
     assert (vec::len(v) == 2u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 1);
+    assert (v[0] == 1);
+    assert (v[1] == 1);
 
     // Test on-heap grow().
     vec::grow(v, 3u, 2);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 1);
-    assert (v.(2) == 2);
-    assert (v.(3) == 2);
-    assert (v.(4) == 2);
+    assert (v[0] == 1);
+    assert (v[1] == 1);
+    assert (v[2] == 2);
+    assert (v[3] == 2);
+    assert (v[4] == 2);
 }
 
 #[test]
 fn test_grow_fn() {
-    let v = ~[];
+    let v = [];
     vec::grow_fn(v, 3u, square);
     assert (vec::len(v) == 3u);
-    assert (v.(0) == 0u);
-    assert (v.(1) == 1u);
-    assert (v.(2) == 4u);
+    assert (v[0] == 0u);
+    assert (v[1] == 1u);
+    assert (v[2] == 4u);
 }
 
 #[test]
 fn test_grow_set() {
-    let v = ~[mutable 1, 2, 3];
+    let v = [mutable 1, 2, 3];
     vec::grow_set(v, 4u, 4, 5);
     assert (vec::len(v) == 5u);
-    assert (v.(0) == 1);
-    assert (v.(1) == 2);
-    assert (v.(2) == 3);
-    assert (v.(3) == 4);
-    assert (v.(4) == 5);
+    assert (v[0] == 1);
+    assert (v[1] == 2);
+    assert (v[2] == 3);
+    assert (v[3] == 4);
+    assert (v[4] == 5);
 }
 
 #[test]
 fn test_map() {
     // Test on-stack map.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let w = vec::map(square_alias, v);
     assert (vec::len(w) == 3u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 4u);
-    assert (w.(2) == 9u);
+    assert (w[0] == 1u);
+    assert (w[1] == 4u);
+    assert (w[2] == 9u);
 
     // Test on-heap map.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     w = vec::map(square_alias, v);
     assert (vec::len(w) == 5u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 4u);
-    assert (w.(2) == 9u);
-    assert (w.(3) == 16u);
-    assert (w.(4) == 25u);
+    assert (w[0] == 1u);
+    assert (w[1] == 4u);
+    assert (w[2] == 9u);
+    assert (w[3] == 16u);
+    assert (w[4] == 25u);
 }
 
 #[test]
 fn test_map2() {
     fn times(x: &int, y: &int) -> int { ret x * y; }
     let f = times;
-    let v0 = ~[1, 2, 3, 4, 5];
-    let v1 = ~[5, 4, 3, 2, 1];
+    let v0 = [1, 2, 3, 4, 5];
+    let v1 = [5, 4, 3, 2, 1];
     let u = vec::map2::<int, int, int>(f, v0, v1);
     let i = 0;
-    while i < 5 { assert (v0.(i) * v1.(i) == u.(i)); i += 1; }
+    while i < 5 { assert (v0[i] * v1[i] == u[i]); i += 1; }
 }
 
 #[test]
 fn test_filter_map() {
     // Test on-stack filter-map.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let w = vec::filter_map(square_if_odd, v);
     assert (vec::len(w) == 2u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 9u);
+    assert (w[0] == 1u);
+    assert (w[1] == 9u);
 
     // Test on-heap filter-map.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     w = vec::filter_map(square_if_odd, v);
     assert (vec::len(w) == 3u);
-    assert (w.(0) == 1u);
-    assert (w.(1) == 9u);
-    assert (w.(2) == 25u);
+    assert (w[0] == 1u);
+    assert (w[1] == 9u);
+    assert (w[2] == 25u);
 
     fn halve(i: &int) -> option::t<int> {
         if i % 2 == 0 {
@@ -270,14 +270,14 @@ fn test_filter_map() {
         } else { ret option::none::<int>; }
     }
     fn halve_for_sure(i: &int) -> int { ret i / 2; }
-    let all_even: [int] = ~[0, 2, 8, 6];
-    let all_odd1: [int] = ~[1, 7, 3];
-    let all_odd2: [int] = ~[];
-    let mix: [int] = ~[9, 2, 6, 7, 1, 0, 0, 3];
-    let mix_dest: [int] = ~[1, 3, 0, 0];
+    let all_even: [int] = [0, 2, 8, 6];
+    let all_odd1: [int] = [1, 7, 3];
+    let all_odd2: [int] = [];
+    let mix: [int] = [9, 2, 6, 7, 1, 0, 0, 3];
+    let mix_dest: [int] = [1, 3, 0, 0];
     assert (filter_map(halve, all_even) == map(halve_for_sure, all_even));
-    assert (filter_map(halve, all_odd1) == ~[]);
-    assert (filter_map(halve, all_odd2) == ~[]);
+    assert (filter_map(halve, all_odd1) == []);
+    assert (filter_map(halve, all_odd2) == []);
     assert (filter_map(halve, mix) == mix_dest);
 
 }
@@ -285,49 +285,49 @@ fn test_filter_map() {
 #[test]
 fn test_foldl() {
     // Test on-stack fold.
-    let v = ~[1u, 2u, 3u];
+    let v = [1u, 2u, 3u];
     let sum = vec::foldl(add, 0u, v);
     assert (sum == 6u);
 
     // Test on-heap fold.
-    v = ~[1u, 2u, 3u, 4u, 5u];
+    v = [1u, 2u, 3u, 4u, 5u];
     sum = vec::foldl(add, 0u, v);
     assert (sum == 15u);
 }
 
 #[test]
 fn test_any_and_all() {
-    assert (vec::any(is_three, ~[1u, 2u, 3u]));
-    assert (!vec::any(is_three, ~[0u, 1u, 2u]));
-    assert (vec::any(is_three, ~[1u, 2u, 3u, 4u, 5u]));
-    assert (!vec::any(is_three, ~[1u, 2u, 4u, 5u, 6u]));
-
-    assert (vec::all(is_three, ~[3u, 3u, 3u]));
-    assert (!vec::all(is_three, ~[3u, 3u, 2u]));
-    assert (vec::all(is_three, ~[3u, 3u, 3u, 3u, 3u]));
-    assert (!vec::all(is_three, ~[3u, 3u, 0u, 1u, 2u]));
+    assert (vec::any(is_three, [1u, 2u, 3u]));
+    assert (!vec::any(is_three, [0u, 1u, 2u]));
+    assert (vec::any(is_three, [1u, 2u, 3u, 4u, 5u]));
+    assert (!vec::any(is_three, [1u, 2u, 4u, 5u, 6u]));
+
+    assert (vec::all(is_three, [3u, 3u, 3u]));
+    assert (!vec::all(is_three, [3u, 3u, 2u]));
+    assert (vec::all(is_three, [3u, 3u, 3u, 3u, 3u]));
+    assert (!vec::all(is_three, [3u, 3u, 0u, 1u, 2u]));
 }
 
 #[test]
 fn test_zip_unzip() {
-    let v1 = ~[1, 2, 3];
-    let v2 = ~[4, 5, 6];
+    let v1 = [1, 2, 3];
+    let v2 = [4, 5, 6];
     let z1 = vec::zip(v1, v2);
 
-    assert ((1, 4) == z1.(0));
-    assert ((2, 5) == z1.(1));
-    assert ((3, 6) == z1.(2));
+    assert ((1, 4) == z1[0]);
+    assert ((2, 5) == z1[1]);
+    assert ((3, 6) == z1[2]);
 
     let (left, right) = vec::unzip(z1);
 
-    assert ((1, 4) == (left.(0), right.(0)));
-    assert ((2, 5) == (left.(1), right.(1)));
-    assert ((3, 6) == (left.(2), right.(2)));
+    assert ((1, 4) == (left[0], right[0]));
+    assert ((2, 5) == (left[1], right[1]));
+    assert ((3, 6) == (left[2], right[2]));
 }
 
 #[test]
 fn test_position() {
-    let v1: [int] = ~[1, 2, 3, 3, 2, 5];
+    let v1: [int] = [1, 2, 3, 3, 2, 5];
     assert (position(1, v1) == option::some::<uint>(0u));
     assert (position(2, v1) == option::some::<uint>(1u));
     assert (position(5, v1) == option::some::<uint>(5u));
@@ -338,28 +338,28 @@ fn test_position() {
 fn test_position_pred() {
     fn less_than_three(i: &int) -> bool { ret i < 3; }
     fn is_eighteen(i: &int) -> bool { ret i == 18; }
-    let v1: [int] = ~[5, 4, 3, 2, 1];
+    let v1: [int] = [5, 4, 3, 2, 1];
     assert (position_pred(less_than_three, v1) == option::some::<uint>(3u));
     assert (position_pred(is_eighteen, v1) == option::none::<uint>);
 }
 
 #[test]
 fn reverse_and_reversed() {
-    let v: [mutable int] = ~[mutable 10, 20];
-    assert (v.(0) == 10);
-    assert (v.(1) == 20);
+    let v: [mutable int] = [mutable 10, 20];
+    assert (v[0] == 10);
+    assert (v[1] == 20);
     vec::reverse(v);
-    assert (v.(0) == 20);
-    assert (v.(1) == 10);
-    let v2 = vec::reversed::<int>(~[10, 20]);
-    assert (v2.(0) == 20);
-    assert (v2.(1) == 10);
-    v.(0) = 30;
-    assert (v2.(0) == 20);
+    assert (v[0] == 20);
+    assert (v[1] == 10);
+    let v2 = vec::reversed::<int>([10, 20]);
+    assert (v2[0] == 20);
+    assert (v2[1] == 10);
+    v[0] = 30;
+    assert (v2[0] == 20);
     // Make sure they work with 0-length vectors too.
 
-    let v4 = vec::reversed::<int>(~[]);
-    let v3: [mutable int] = ~[mutable];
+    let v4 = vec::reversed::<int>([]);
+    let v3: [mutable int] = [mutable];
     vec::reverse::<int>(v3);
 }
 
diff --git a/src/test/stdtest/vec_str_conversions.rs b/src/test/stdtest/vec_str_conversions.rs
index cc52ec80e95..8e245db256f 100644
--- a/src/test/stdtest/vec_str_conversions.rs
+++ b/src/test/stdtest/vec_str_conversions.rs
@@ -16,8 +16,8 @@ fn test_simple() {
     let n2: uint = vec::len::<u8>(v);
     assert (n1 == n2);
     while i < n1 {
-        let a: u8 = s1.(i);
-        let b: u8 = s2.(i);
+        let a: u8 = s1[i];
+        let b: u8 = s2[i];
         log a;
         log b;
         assert (a == b);