Reformat. Issue #855

194 files changed, 5106 insertions, 5789 deletions

diff --git a/src/comp/back/abi.rs b/src/comp/back/abi.rs
index e71ed2eeff9..3d0a1ba8c09 100644
--- a/src/comp/back/abi.rs
+++ b/src/comp/back/abi.rs
@@ -88,13 +88,13 @@ const worst_case_glue_call_args: int = 7;
 
 const abi_version: uint = 1u;
 
-fn memcpy_glue_name() -> istr { ret ~"rust_memcpy_glue"; }
+fn memcpy_glue_name() -> str { ret "rust_memcpy_glue"; }
 
-fn bzero_glue_name() -> istr { ret ~"rust_bzero_glue"; }
+fn bzero_glue_name() -> str { ret "rust_bzero_glue"; }
 
-fn yield_glue_name() -> istr { ret ~"rust_yield_glue"; }
+fn yield_glue_name() -> str { ret "rust_yield_glue"; }
 
-fn no_op_type_glue_name() -> istr { ret ~"rust_no_op_type_glue"; }
+fn no_op_type_glue_name() -> str { ret "rust_no_op_type_glue"; }
 //
 // Local Variables:
 // mode: rust
diff --git a/src/comp/back/link.rs b/src/comp/back/link.rs
index 553478d7ed1..0bbdafd1e6b 100644
--- a/src/comp/back/link.rs
+++ b/src/comp/back/link.rs
@@ -31,37 +31,35 @@ tag output_type {
     output_type_exe;
 }
 
-fn llvm_err(sess: session::session, msg: &istr) {
+fn llvm_err(sess: session::session, msg: &str) {
     let buf = llvm::LLVMRustGetLastError();
     if buf == std::ptr::null() {
         sess.fatal(msg);
-    } else {
-        sess.fatal(
-            msg + ~": " + str::str_from_cstr(buf));
-    }
+    } else { sess.fatal(msg + ": " + str::str_from_cstr(buf)); }
 }
 
 fn link_intrinsics(sess: session::session, llmod: ModuleRef) {
-    let path =
-        fs::connect(sess.get_opts().sysroot,
-                    ~"lib/intrinsics.bc");
-    let membuf = str::as_buf(path, { |buf|
-        llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf)
-    });
+    let path = fs::connect(sess.get_opts().sysroot, "lib/intrinsics.bc");
+    let membuf =
+        str::as_buf(
+            path,
+            {|buf|
+                llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf)
+            });
     if membuf as uint == 0u {
-        llvm_err(sess, ~"installation problem: couldn't open " + path);
+        llvm_err(sess, "installation problem: couldn't open " + path);
         fail;
     }
     let llintrinsicsmod = llvm::LLVMRustParseBitcode(membuf);
     llvm::LLVMDisposeMemoryBuffer(membuf);
     if llintrinsicsmod as uint == 0u {
-        llvm_err(sess, ~"installation problem: couldn't parse intrinsics.bc");
+        llvm_err(sess, "installation problem: couldn't parse intrinsics.bc");
         fail;
     }
     let linkres = llvm::LLVMLinkModules(llmod, llintrinsicsmod);
     llvm::LLVMDisposeModule(llintrinsicsmod);
     if linkres == False {
-        llvm_err(sess, ~"couldn't link the module with the intrinsics");
+        llvm_err(sess, "couldn't link the module with the intrinsics");
         fail;
     }
 }
@@ -77,15 +75,15 @@ mod write {
 
     // Decides what to call an intermediate file, given the name of the output
     // and the extension to use.
-    fn mk_intermediate_name(output_path: &istr, extension: &istr) -> istr {
+    fn mk_intermediate_name(output_path: &str, extension: &str) -> str {
         let dot_pos = str::index(output_path, '.' as u8);
         let stem;
         if dot_pos < 0 {
             stem = output_path;
         } else { stem = str::substr(output_path, 0u, dot_pos as uint); }
-        ret stem + ~"." + extension;
+        ret stem + "." + extension;
     }
-    fn run_passes(sess: session::session, llmod: ModuleRef, output: &istr) {
+    fn run_passes(sess: session::session, llmod: ModuleRef, output: &str) {
         let opts = sess.get_opts();
         if opts.time_llvm_passes { llvm::LLVMRustEnableTimePasses(); }
         link_intrinsics(sess, llmod);
@@ -102,17 +100,19 @@ mod write {
             alt opts.output_type {
               output_type_bitcode. {
                 if opts.optimize != 0u {
-                    let filename = mk_intermediate_name(output, ~"no-opt.bc");
-                    str::as_buf(filename, { |buf|
-                        llvm::LLVMWriteBitcodeToFile(llmod, buf)
-                    });
+                    let filename = mk_intermediate_name(output, "no-opt.bc");
+                    str::as_buf(filename,
+                                {|buf|
+                                    llvm::LLVMWriteBitcodeToFile(llmod, buf)
+                                });
                 }
               }
               _ {
-                let filename = mk_intermediate_name(output, ~"bc");
-                str::as_buf(filename, { |buf|
-                    llvm::LLVMWriteBitcodeToFile(llmod, buf)
-                });
+                let filename = mk_intermediate_name(output, "bc");
+                str::as_buf(filename,
+                            {|buf|
+                                llvm::LLVMWriteBitcodeToFile(llmod, buf)
+                            });
               }
             }
         }
@@ -183,25 +183,28 @@ mod write {
             if opts.save_temps {
                 // Always output the bitcode file with --save-temps
 
-                let filename = mk_intermediate_name(output, ~"opt.bc");
+                let filename = mk_intermediate_name(output, "opt.bc");
                 llvm::LLVMRunPassManager(pm.llpm, llmod);
-                str::as_buf(filename, { |buf|
-                    llvm::LLVMWriteBitcodeToFile(llmod, buf)
-                });
+                str::as_buf(filename,
+                            {|buf|
+                                llvm::LLVMWriteBitcodeToFile(llmod, buf)
+                            });
                 pm = mk_pass_manager();
                 // Save the assembly file if -S is used
 
                 if opts.output_type == output_type_assembly {
                     let _: () =
-                        str::as_buf(x86::get_target_triple(), { |buf_t|
-                            str::as_buf(output, { |buf_o|
+                        str::as_buf(x86::get_target_triple(), {|buf_t|
+                            str::as_buf(output, {|buf_o|
                                 llvm::LLVMRustWriteOutputFile(
-                                    pm.llpm, llmod,
+                                    pm.llpm,
+                                    llmod,
                                     buf_t,
                                     buf_o,
                                     LLVMAssemblyFile,
                                     CodeGenOptLevel)
-                                                 })});
+                            })
+                        });
                 }
 
 
@@ -210,28 +213,32 @@ mod write {
                 if opts.output_type == output_type_object ||
                        opts.output_type == output_type_exe {
                     let _: () =
-                        str::as_buf(x86::get_target_triple(), { |buf_t|
-                            str::as_buf(output, { |buf_o|
-                                llvm::LLVMRustWriteOutputFile(
-                                    pm.llpm, llmod,
-                                    buf_t,
-                                    buf_o,
-                                    LLVMObjectFile,
-                                    CodeGenOptLevel)
-                                                 })});
+                        str::as_buf(x86::get_target_triple(), {|buf_t|
+                            str::as_buf(output, {|buf_o|
+                                llvm::LLVMRustWriteOutputFile(pm.llpm,
+                                                              llmod,
+                                                              buf_t,
+                                                              buf_o,
+                                                              LLVMObjectFile,
+                                                              CodeGenOptLevel)
+                            })
+                    });
                 }
             } else {
                 // If we aren't saving temps then just output the file
                 // type corresponding to the '-c' or '-S' flag used
 
-                let _: () = str::as_buf(x86::get_target_triple(), { |buf_t|
-                    str::as_buf(output, { |buf_o|
-                        llvm::LLVMRustWriteOutputFile(pm.llpm, llmod,
-                                                      buf_t,
-                                                      buf_o,
-                                                      FileType,
-                                                      CodeGenOptLevel)
-                                         })});
+                let _: () =
+                    str::as_buf(x86::get_target_triple(), {|buf_t|
+                        str::as_buf(output, {|buf_o|
+                            llvm::LLVMRustWriteOutputFile(pm.llpm,
+                                                          llmod,
+                                                          buf_t,
+                                                          buf_o,
+                                                          FileType,
+                                                          CodeGenOptLevel)
+                            })
+                    });
             }
             // Clean up and return
 
@@ -243,9 +250,8 @@ mod write {
         // flag, then output it here
 
         llvm::LLVMRunPassManager(pm.llpm, llmod);
-        str::as_buf(output, { |buf|
-            llvm::LLVMWriteBitcodeToFile(llmod, buf)
-        });
+        str::as_buf(output,
+                    {|buf| llvm::LLVMWriteBitcodeToFile(llmod, buf) });
         llvm::LLVMDisposeModule(llmod);
         if opts.time_llvm_passes { llvm::LLVMRustPrintPassTimings(); }
     }
@@ -303,30 +309,30 @@ mod write {
  *
  */
 
-type link_meta = {name: istr, vers: istr, extras_hash: istr};
+type link_meta = {name: str, vers: str, extras_hash: str};
 
-fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr,
+fn build_link_meta(sess: &session::session, c: &ast::crate, output: &str,
                    sha: sha1) -> link_meta {
 
     type provided_metas =
-        {name: option::t<istr>,
-         vers: option::t<istr>,
+        {name: option::t<str>,
+         vers: option::t<str>,
          cmh_items: [@ast::meta_item]};
 
     fn provided_link_metas(sess: &session::session, c: &ast::crate) ->
        provided_metas {
-        let name: option::t<istr> = none;
-        let vers: option::t<istr> = none;
+        let name: option::t<str> = none;
+        let vers: option::t<str> = none;
         let cmh_items: [@ast::meta_item] = [];
         let linkage_metas = attr::find_linkage_metas(c.node.attrs);
         attr::require_unique_names(sess, linkage_metas);
         for meta: @ast::meta_item in linkage_metas {
-            if attr::get_meta_item_name(meta) == ~"name" {
+            if attr::get_meta_item_name(meta) == "name" {
                 alt attr::get_meta_item_value_str(meta) {
                   some(v) { name = some(v); }
                   none. { cmh_items += [meta]; }
                 }
-            } else if attr::get_meta_item_name(meta) == ~"vers" {
+            } else if attr::get_meta_item_name(meta) == "vers" {
                 alt attr::get_meta_item_value_str(meta) {
                   some(v) { vers = some(v); }
                   none. { cmh_items += [meta]; }
@@ -338,12 +344,12 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr,
 
     // This calculates CMH as defined above
     fn crate_meta_extras_hash(sha: sha1, _crate: &ast::crate,
-                              metas: &provided_metas) -> istr {
-        fn len_and_str(s: &istr) -> istr {
+                              metas: &provided_metas) -> str {
+        fn len_and_str(s: &str) -> str {
             ret #fmt["%u_%s", str::byte_len(s), s];
         }
 
-        fn len_and_str_lit(l: &ast::lit) -> istr {
+        fn len_and_str_lit(l: &ast::lit) -> str {
             ret len_and_str(pprust::lit_to_str(@l));
         }
 
@@ -357,9 +363,7 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr,
                 sha.input_str(len_and_str(key));
                 sha.input_str(len_and_str_lit(value));
               }
-              ast::meta_word(name) {
-                sha.input_str(len_and_str(name));
-              }
+              ast::meta_word(name) { sha.input_str(len_and_str(name)); }
               ast::meta_list(_, _) {
                 // FIXME (#607): Implement this
                 fail "unimplemented meta_item variant";
@@ -369,40 +373,37 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr,
         ret truncated_sha1_result(sha);
     }
 
-    fn warn_missing(sess: &session::session, name: &istr, default: &istr) {
+    fn warn_missing(sess: &session::session, name: &str, default: &str) {
         if !sess.get_opts().library { ret; }
-        sess.warn(
-            #fmt["missing crate link meta '%s', using '%s' as default",
+        sess.warn(#fmt["missing crate link meta '%s', using '%s' as default",
                        name, default]);
     }
 
     fn crate_meta_name(sess: &session::session, _crate: &ast::crate,
-                       output: &istr, metas: &provided_metas) -> istr {
+                       output: &str, metas: &provided_metas) -> str {
         ret alt metas.name {
               some(v) { v }
               none. {
                 let name =
                     {
-                        let os = str::split(
-                            fs::basename(output),
-                            '.' as u8);
+                        let os = str::split(fs::basename(output), '.' as u8);
                         assert (vec::len(os) >= 2u);
                         vec::pop(os);
-                        str::connect(os, ~".")
+                        str::connect(os, ".")
                     };
-                warn_missing(sess, ~"name", name);
+                warn_missing(sess, "name", name);
                 name
               }
             };
     }
 
     fn crate_meta_vers(sess: &session::session, _crate: &ast::crate,
-                       metas: &provided_metas) -> istr {
+                       metas: &provided_metas) -> str {
         ret alt metas.vers {
               some(v) { v }
               none. {
-                let vers = ~"0.0";
-                warn_missing(sess, ~"vers", vers);
+                let vers = "0.0";
+                warn_missing(sess, "vers", vers);
                 vers
               }
             };
@@ -416,32 +417,32 @@ fn build_link_meta(sess: &session::session, c: &ast::crate, output: &istr,
     ret {name: name, vers: vers, extras_hash: extras_hash};
 }
 
-fn truncated_sha1_result(sha: sha1) -> istr {
+fn truncated_sha1_result(sha: sha1) -> str {
     ret str::substr(sha.result_str(), 0u, 16u);
 }
 
 
 // This calculates STH for a symbol, as defined above
 fn symbol_hash(tcx: ty::ctxt, sha: sha1, t: ty::t, link_meta: &link_meta) ->
-   istr {
+   str {
     // NB: do *not* use abbrevs here as we want the symbol names
     // to be independent of one another in the crate.
 
     sha.reset();
     sha.input_str(link_meta.name);
-    sha.input_str(~"-");
+    sha.input_str("-");
     // FIXME: This wants to be link_meta.meta_hash
     sha.input_str(link_meta.name);
-    sha.input_str(~"-");
+    sha.input_str("-");
     sha.input_str(encoder::encoded_ty(tcx, t));
     let hash = truncated_sha1_result(sha);
     // Prefix with _ so that it never blends into adjacent digits
 
-    ret ~"_" + hash;
+    ret "_" + hash;
 }
 
-fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> istr {
-    let hash = ~"";
+fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> str {
+    let hash = "";
     alt ccx.type_sha1s.find(t) {
       some(h) { hash = h; }
       none. {
@@ -452,48 +453,46 @@ fn get_symbol_hash(ccx: &@crate_ctxt, t: ty::t) -> istr {
     ret hash;
 }
 
-fn mangle(ss: &[istr]) -> istr {
+fn mangle(ss: &[str]) -> str {
     // Follow C++ namespace-mangling style
 
-    let n = ~"_ZN"; // Begin name-sequence.
+    let n = "_ZN"; // Begin name-sequence.
 
-    for s: istr in ss {
-        n += #fmt["%u%s", str::byte_len(s), s];
-    }
-    n += ~"E"; // End name-sequence.
+    for s: str in ss { n += #fmt["%u%s", str::byte_len(s), s]; }
+    n += "E"; // End name-sequence.
 
     ret n;
 }
 
-fn exported_name(path: &[istr], hash: &istr, _vers: &istr) -> istr {
+fn exported_name(path: &[str], hash: &str, _vers: &str) -> str {
     // FIXME: versioning isn't working yet
 
     ret mangle(path + [hash]); //  + "@" + vers;
 
 }
 
-fn mangle_exported_name(ccx: &@crate_ctxt, path: &[istr], t: ty::t) -> istr {
+fn mangle_exported_name(ccx: &@crate_ctxt, path: &[str], t: ty::t) -> str {
     let hash = get_symbol_hash(ccx, t);
     ret exported_name(path, hash, ccx.link_meta.vers);
 }
 
-fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: ty::t, name: &istr)
-   -> istr {
+fn mangle_internal_name_by_type_only(ccx: &@crate_ctxt, t: ty::t, name: &str)
+   -> str {
     let s = util::ppaux::ty_to_short_str(ccx.tcx, t);
     let hash = get_symbol_hash(ccx, t);
     ret mangle([name, s, hash]);
 }
 
-fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[istr],
-                                        flav: &istr) -> istr {
+fn mangle_internal_name_by_path_and_seq(ccx: &@crate_ctxt, path: &[str],
+                                        flav: &str) -> str {
     ret mangle(path + [ccx.names.next(flav)]);
 }
 
-fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[istr]) -> istr {
+fn mangle_internal_name_by_path(_ccx: &@crate_ctxt, path: &[str]) -> str {
     ret mangle(path);
 }
 
-fn mangle_internal_name_by_seq(ccx: &@crate_ctxt, flav: &istr) -> istr {
+fn mangle_internal_name_by_seq(ccx: &@crate_ctxt, flav: &str) -> str {
     ret ccx.names.next(flav);
 }
 //
diff --git a/src/comp/back/upcall.rs b/src/comp/back/upcall.rs
index dc007a1d3f2..c3ae653316b 100644
--- a/src/comp/back/upcall.rs
+++ b/src/comp/back/upcall.rs
@@ -46,16 +46,14 @@ type upcalls =
 
 fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef,
                    taskptr_type: TypeRef, llmod: ModuleRef) -> @upcalls {
-    fn decl(llmod: ModuleRef, name: &istr, tys: [TypeRef], rv: TypeRef) ->
+    fn decl(llmod: ModuleRef, name: &str, tys: [TypeRef], rv: TypeRef) ->
        ValueRef {
         let arg_tys: [TypeRef] = [];
         for t: TypeRef in tys { arg_tys += [t]; }
         let fn_ty = T_fn(arg_tys, rv);
-        ret trans::decl_cdecl_fn(llmod,
-                                 ~"upcall_" + name, fn_ty);
+        ret trans::decl_cdecl_fn(llmod, "upcall_" + name, fn_ty);
     }
-    fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef,
-                         name: &istr,
+    fn decl_with_taskptr(taskptr_type: TypeRef, llmod: ModuleRef, name: &str,
                          tys: [TypeRef], rv: TypeRef) -> ValueRef {
         ret decl(llmod, name, [taskptr_type] + tys, rv);
     }
@@ -64,44 +62,45 @@ fn declare_upcalls(_tn: type_names, tydesc_type: TypeRef,
     let dr = bind decl(llmod, _, _, _);
 
     let empty_vec: [TypeRef] = [];
-    ret @{grow_task: dv(~"grow_task", [T_size_t()]),
-          _yield: dv(~"yield", empty_vec),
-          sleep: dv(~"sleep", [T_size_t()]),
-          _fail: dv(~"fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]),
-          kill: dv(~"kill", [taskptr_type]),
-          exit: dv(~"exit", empty_vec),
+    ret @{grow_task: dv("grow_task", [T_size_t()]),
+          _yield: dv("yield", empty_vec),
+          sleep: dv("sleep", [T_size_t()]),
+          _fail: dv("fail", [T_ptr(T_i8()), T_ptr(T_i8()), T_size_t()]),
+          kill: dv("kill", [taskptr_type]),
+          exit: dv("exit", empty_vec),
           malloc:
-              d(~"malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())),
-          free: dv(~"free", [T_ptr(T_i8()), T_int()]),
+              d("malloc", [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())),
+          free: dv("free", [T_ptr(T_i8()), T_int()]),
           shared_malloc:
-              d(~"shared_malloc", [T_size_t(), T_ptr(tydesc_type)],
+              d("shared_malloc", [T_size_t(), T_ptr(tydesc_type)],
                 T_ptr(T_i8())),
-          shared_free: dv(~"shared_free", [T_ptr(T_i8())]),
-          mark: d(~"mark", [T_ptr(T_i8())], T_int()),
+          shared_free: dv("shared_free", [T_ptr(T_i8())]),
+          mark: d("mark", [T_ptr(T_i8())], T_int()),
           get_type_desc:
-              d(~"get_type_desc",
+              d("get_type_desc",
                 [T_ptr(T_nil()), T_size_t(), T_size_t(), T_size_t(),
                  T_ptr(T_ptr(tydesc_type)), T_int()], T_ptr(tydesc_type)),
           vec_grow:
-              d(~"vec_grow", [T_ptr(T_ptr(T_opaque_vec())), T_int()],
+              d("vec_grow", [T_ptr(T_ptr(T_opaque_vec())), T_int()],
                 T_void()),
           vec_push:
-              d(~"vec_push",
+              d("vec_push",
                 [T_ptr(T_ptr(T_opaque_vec())), T_ptr(tydesc_type),
                  T_ptr(T_i8())], T_void()),
           cmp_type:
-              dr(~"cmp_type",
+              dr("cmp_type",
                  [T_ptr(T_i1()), taskptr_type, T_ptr(tydesc_type),
                   T_ptr(T_ptr(tydesc_type)), T_ptr(T_i8()), T_ptr(T_i8()),
                   T_i8()], T_void()),
           log_type:
-              dr(~"log_type",
+              dr("log_type",
                  [taskptr_type, T_ptr(tydesc_type), T_ptr(T_i8()), T_i32()],
                  T_void()),
-          dynastack_mark: d(~"dynastack_mark", [], T_ptr(T_i8())),
-          dynastack_alloc: d(~"dynastack_alloc_2",
-                             [T_size_t(), T_ptr(tydesc_type)], T_ptr(T_i8())),
-          dynastack_free: d(~"dynastack_free", [T_ptr(T_i8())], T_void())};
+          dynastack_mark: d("dynastack_mark", [], T_ptr(T_i8())),
+          dynastack_alloc:
+              d("dynastack_alloc_2", [T_size_t(), T_ptr(tydesc_type)],
+                T_ptr(T_i8())),
+          dynastack_free: d("dynastack_free", [T_ptr(T_i8())], T_void())};
 }
 //
 // Local Variables:
diff --git a/src/comp/back/x86.rs b/src/comp/back/x86.rs
index 02b33ff105c..80f0245a3cd 100644
--- a/src/comp/back/x86.rs
+++ b/src/comp/back/x86.rs
@@ -4,32 +4,30 @@ import lib::llvm::llvm::ModuleRef;
 import std::str;
 import std::os::target_os;
 
-fn get_module_asm() -> istr { ret ~""; }
+fn get_module_asm() -> str { ret ""; }
 
-fn get_meta_sect_name() -> istr {
-    if str::eq(target_os(), ~"macos") { ret ~"__DATA,__note.rustc"; }
-    if str::eq(target_os(), ~"win32") { ret ~".note.rustc"; }
-    ret ~".note.rustc";
+fn get_meta_sect_name() -> str {
+    if str::eq(target_os(), "macos") { ret "__DATA,__note.rustc"; }
+    if str::eq(target_os(), "win32") { ret ".note.rustc"; }
+    ret ".note.rustc";
 }
 
-fn get_data_layout() -> istr {
-    if str::eq(target_os(), ~"macos") {
-        ret ~"e-p:32:32:32-i1:8:8-i8:8:8-i16:16:16" +
-            ~"-i32:32:32-i64:32:64" +
-            ~"-f32:32:32-f64:32:64-v64:64:64" +
-            ~"-v128:128:128-a0:0:64-f80:128:128" +
-            ~"-n8:16:32";
+fn get_data_layout() -> str {
+    if str::eq(target_os(), "macos") {
+        ret "e-p:32:32:32-i1:8:8-i8:8:8-i16:16:16" + "-i32:32:32-i64:32:64" +
+                "-f32:32:32-f64:32:64-v64:64:64" +
+                "-v128:128:128-a0:0:64-f80:128:128" + "-n8:16:32";
     }
-    if str::eq(target_os(), ~"win32") {
-        ret ~"e-p:32:32-f64:64:64-i64:64:64-f80:32:32-n8:16:32";
+    if str::eq(target_os(), "win32") {
+        ret "e-p:32:32-f64:64:64-i64:64:64-f80:32:32-n8:16:32";
     }
-    ret ~"e-p:32:32-f64:32:64-i64:32:64-f80:32:32-n8:16:32";
+    ret "e-p:32:32-f64:32:64-i64:32:64-f80:32:32-n8:16:32";
 }
 
-fn get_target_triple() -> istr {
-    if str::eq(target_os(), ~"macos") { ret ~"i686-apple-darwin"; }
-    if str::eq(target_os(), ~"win32") { ret ~"i686-pc-mingw32"; }
-    ret ~"i686-unknown-linux-gnu";
+fn get_target_triple() -> str {
+    if str::eq(target_os(), "macos") { ret "i686-apple-darwin"; }
+    if str::eq(target_os(), "win32") { ret "i686-pc-mingw32"; }
+    ret "i686-unknown-linux-gnu";
 }
 //
 // Local Variables:
diff --git a/src/comp/driver/rustc.rs b/src/comp/driver/rustc.rs
index 829c40ed803..9f8249215e8 100644
--- a/src/comp/driver/rustc.rs
+++ b/src/comp/driver/rustc.rs
@@ -41,29 +41,26 @@ import back::link::output_type;
 
 tag pp_mode { ppm_normal; ppm_expanded; ppm_typed; ppm_identified; }
 
-fn default_configuration(sess: session::session,
-                         argv0: &istr, input: &istr) ->
+fn default_configuration(sess: session::session, argv0: &str, input: &str) ->
    ast::crate_cfg {
     let libc =
         alt sess.get_targ_cfg().os {
-          session::os_win32. { ~"msvcrt.dll" }
-          session::os_macos. { ~"libc.dylib" }
-          session::os_linux. { ~"libc.so.6" }
-          _ { ~"libc.so" }
+          session::os_win32. { "msvcrt.dll" }
+          session::os_macos. { "libc.dylib" }
+          session::os_linux. { "libc.so.6" }
+          _ { "libc.so" }
         };
 
     let mk = attr::mk_name_value_item_str;
 
     ret [ // Target bindings.
-         mk(~"target_os", std::os::target_os()),
-        mk(~"target_arch", ~"x86"),
-         mk(~"target_libc", libc),
+         mk("target_os", std::os::target_os()), mk("target_arch", "x86"),
+         mk("target_libc", libc),
          // Build bindings.
-         mk(~"build_compiler", argv0),
-        mk(~"build_input", input)];
+         mk("build_compiler", argv0), mk("build_input", input)];
 }
 
-fn build_configuration(sess: session::session, argv0: &istr, input: &istr) ->
+fn build_configuration(sess: session::session, argv0: &str, input: &str) ->
    ast::crate_cfg {
     // Combine the configuration requested by the session (command line) with
     // some default and generated configuration items
@@ -72,51 +69,46 @@ fn build_configuration(sess: session::session, argv0: &istr, input: &istr) ->
     // If the user wants a test runner, then add the test cfg
     let gen_cfg =
         {
-            if sess.get_opts().test
-                && !attr::contains_name(user_cfg, ~"test") {
-                [attr::mk_word_item(~"test")]
+            if sess.get_opts().test && !attr::contains_name(user_cfg, "test")
+               {
+                [attr::mk_word_item("test")]
             } else { [] }
         };
     ret user_cfg + gen_cfg + default_cfg;
 }
 
 // Convert strings provided as --cfg [cfgspec] into a crate_cfg
-fn parse_cfgspecs(cfgspecs: &[istr]) -> ast::crate_cfg {
+fn parse_cfgspecs(cfgspecs: &[str]) -> ast::crate_cfg {
     // FIXME: It would be nice to use the parser to parse all varieties of
     // meta_item here. At the moment we just support the meta_word variant.
     let words = [];
-    for s: istr in cfgspecs {
-        words += [attr::mk_word_item(s)];
-    }
+    for s: str in cfgspecs { words += [attr::mk_word_item(s)]; }
     ret words;
 }
 
-fn input_is_stdin(filename: &istr) -> bool { filename == ~"-" }
+fn input_is_stdin(filename: &str) -> bool { filename == "-" }
 
-fn parse_input(sess: session::session, cfg: &ast::crate_cfg,
-               input: &istr) -> @ast::crate {
+fn parse_input(sess: session::session, cfg: &ast::crate_cfg, input: &str) ->
+   @ast::crate {
     if !input_is_stdin(input) {
-        parser::parse_crate_from_file(
-            input, cfg, sess.get_parse_sess())
+        parser::parse_crate_from_file(input, cfg, sess.get_parse_sess())
     } else { parse_input_src(sess, cfg, input).crate }
 }
 
-fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg,
-                   infile: &istr) -> {crate: @ast::crate, src: istr} {
+fn parse_input_src(sess: session::session, cfg: &ast::crate_cfg, infile: &str)
+   -> {crate: @ast::crate, src: str} {
     let srcbytes =
-        if infile != ~"-" {
+        if infile != "-" {
             io::file_reader(infile)
         } else { io::stdin() }.read_whole_stream();
     let src = str::unsafe_from_bytes(srcbytes);
     let crate =
-        parser::parse_crate_from_source_str(
-            infile,
-            src, cfg,
-            sess.get_parse_sess());
+        parser::parse_crate_from_source_str(infile, src, cfg,
+                                            sess.get_parse_sess());
     ret {crate: crate, src: src};
 }
 
-fn time<@T>(do_it: bool, what: &istr, thunk: fn() -> T) -> T {
+fn time<@T>(do_it: bool, what: &str, thunk: fn() -> T) -> T {
     if !do_it { ret thunk(); }
     let start = std::time::precise_time_s();
     let rv = thunk();
@@ -126,61 +118,60 @@ fn time<@T>(do_it: bool, what: &istr, thunk: fn() -> T) -> T {
     ret rv;
 }
 
-fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: &istr,
-                 output: &istr) {
+fn compile_input(sess: session::session, cfg: ast::crate_cfg, input: &str,
+                 output: &str) {
     let time_passes = sess.get_opts().time_passes;
     let crate =
-        time(time_passes, ~"parsing", bind parse_input(sess, cfg, input));
+        time(time_passes, "parsing", bind parse_input(sess, cfg, input));
     if sess.get_opts().parse_only { ret; }
     crate =
-        time(time_passes, ~"configuration",
+        time(time_passes, "configuration",
              bind front::config::strip_unconfigured_items(crate));
     if sess.get_opts().test {
         crate =
-            time(time_passes, ~"building test harness",
+            time(time_passes, "building test harness",
                  bind front::test::modify_for_testing(crate));
     }
     crate =
-        time(time_passes, ~"expansion",
+        time(time_passes, "expansion",
              bind syntax::ext::expand::expand_crate(sess, crate));
 
     let ast_map =
-        time(time_passes, ~"ast indexing",
+        time(time_passes, "ast indexing",
              bind middle::ast_map::map_crate(*crate));
-    time(time_passes, ~"external crate/lib resolution",
+    time(time_passes, "external crate/lib resolution",
          bind creader::read_crates(sess, *crate));
     let {def_map: def_map, ext_map: ext_map} =
-        time(time_passes, ~"resolution",
+        time(time_passes, "resolution",
              bind resolve::resolve_crate(sess, ast_map, crate));
     let freevars =
-        time(time_passes, ~"freevar finding",
+        time(time_passes, "freevar finding",
              bind freevars::annotate_freevars(def_map, crate));
     let ty_cx = ty::mk_ctxt(sess, def_map, ext_map, ast_map, freevars);
-    time(time_passes, ~"typechecking",
-         bind typeck::check_crate(ty_cx, crate));
-    time(time_passes, ~"alt checking",
+    time(time_passes, "typechecking", bind typeck::check_crate(ty_cx, crate));
+    time(time_passes, "alt checking",
          bind middle::check_alt::check_crate(ty_cx, crate));
     if sess.get_opts().run_typestate {
-        time(time_passes, ~"typestate checking",
+        time(time_passes, "typestate checking",
              bind middle::tstate::ck::check_crate(ty_cx, crate));
     }
-    let mut_map = time(time_passes, ~"mutability checking",
-                       bind middle::mut::check_crate(ty_cx, crate));
-    time(time_passes, ~"alias checking",
+    let mut_map =
+        time(time_passes, "mutability checking",
+             bind middle::mut::check_crate(ty_cx, crate));
+    time(time_passes, "alias checking",
          bind middle::alias::check_crate(ty_cx, crate));
-    time(time_passes, ~"kind checking",
-         bind kind::check_crate(ty_cx, crate));
+    time(time_passes, "kind checking", bind kind::check_crate(ty_cx, crate));
     if sess.get_opts().no_trans { ret; }
-    let llmod = time(time_passes, ~"translation",
-                     bind trans::trans_crate(sess, crate, ty_cx,
-                                             output,
-                                             ast_map, mut_map));
-    time(time_passes, ~"LLVM passes",
+    let llmod =
+        time(time_passes, "translation",
+             bind trans::trans_crate(sess, crate, ty_cx, output, ast_map,
+                                     mut_map));
+    time(time_passes, "LLVM passes",
          bind link::write::run_passes(sess, llmod, output));
 }
 
 fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg,
-                      input: &istr, ppm: pp_mode) {
+                      input: &str, ppm: pp_mode) {
     fn ann_paren_for_expr(node: &pprust::ann_node) {
         alt node { pprust::node_expr(s, expr) { pprust::popen(s); } _ { } }
     }
@@ -188,11 +179,9 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg,
         alt node {
           pprust::node_expr(s, expr) {
             pp::space(s.s);
-            pp::word(s.s, ~"as");
+            pp::word(s.s, "as");
             pp::space(s.s);
-            pp::word(
-                s.s,
-                ppaux::ty_to_str(tcx, ty::expr_ty(tcx, expr)));
+            pp::word(s.s, ppaux::ty_to_str(tcx, ty::expr_ty(tcx, expr)));
             pprust::pclose(s);
           }
           _ { }
@@ -202,18 +191,16 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg,
         alt node {
           pprust::node_item(s, item) {
             pp::space(s.s);
-            pprust::synth_comment(
-                s, int::to_str(item.id, 10u));
+            pprust::synth_comment(s, int::to_str(item.id, 10u));
           }
           pprust::node_block(s, blk) {
             pp::space(s.s);
-            pprust::synth_comment(
-                s, ~"block " + int::to_str(blk.node.id, 10u));
+            pprust::synth_comment(s,
+                                  "block " + int::to_str(blk.node.id, 10u));
           }
           pprust::node_expr(s, expr) {
             pp::space(s.s);
-            pprust::synth_comment(
-                s, int::to_str(expr.id, 10u));
+            pprust::synth_comment(s, int::to_str(expr.id, 10u));
             pprust::pclose(s);
           }
           _ { }
@@ -249,26 +236,20 @@ fn pretty_print_input(sess: session::session, cfg: ast::crate_cfg,
       }
       ppm_normal. { ann = pprust::no_ann(); }
     }
-    pprust::print_crate(sess.get_codemap(), crate,
-                        input,
-                        io::string_reader(src),
-                        io::stdout(), ann);
+    pprust::print_crate(sess.get_codemap(), crate, input,
+                        io::string_reader(src), io::stdout(), ann);
 }
 
-fn version(argv0: &istr) {
-    let vers = ~"unknown version";
+fn version(argv0: &str) {
+    let vers = "unknown version";
     let env_vers = #env["CFG_VERSION"];
     if str::byte_len(env_vers) != 0u { vers = env_vers; }
-    io::stdout().write_str(
-        #fmt["%s %s\n",
-                             argv0,
-                             vers]);
+    io::stdout().write_str(#fmt["%s %s\n", argv0, vers]);
 }
 
-fn usage(argv0: &istr) {
-    io::stdout().write_str(
-        #fmt["usage: %s [options] <input>\n", argv0] +
-                               ~"
+fn usage(argv0: &str) {
+    io::stdout().write_str(#fmt["usage: %s [options] <input>\n", argv0] +
+                               "
 options:
 
     -h --help          display this message
@@ -304,41 +285,39 @@ options:
 ");
 }
 
-fn get_os(triple: &istr) -> session::os {
-    ret if str::find(triple, ~"win32") >= 0 ||
-               str::find(triple, ~"mingw32") >= 0 {
+fn get_os(triple: &str) -> session::os {
+    ret if str::find(triple, "win32") >= 0 ||
+               str::find(triple, "mingw32") >= 0 {
             session::os_win32
-        } else if str::find(triple, ~"darwin") >= 0 {
+        } else if str::find(triple, "darwin") >= 0 {
             session::os_macos
-        } else if str::find(triple, ~"linux") >= 0 {
+        } else if str::find(triple, "linux") >= 0 {
             session::os_linux
-        } else { log_err ~"Unknown operating system!"; fail };
+        } else { log_err "Unknown operating system!"; fail };
 }
 
-fn get_arch(triple: &istr) -> session::arch {
-    ret if str::find(triple, ~"i386") >= 0 ||
-        str::find(triple, ~"i486") >= 0 ||
-               str::find(triple, ~"i586") >= 0 ||
-               str::find(triple, ~"i686") >= 0 ||
-               str::find(triple, ~"i786") >= 0 {
+fn get_arch(triple: &str) -> session::arch {
+    ret if str::find(triple, "i386") >= 0 || str::find(triple, "i486") >= 0 ||
+               str::find(triple, "i586") >= 0 ||
+               str::find(triple, "i686") >= 0 ||
+               str::find(triple, "i786") >= 0 {
             session::arch_x86
-        } else if str::find(triple, ~"x86_64") >= 0 {
+        } else if str::find(triple, "x86_64") >= 0 {
             session::arch_x64
-        } else if str::find(triple, ~"arm") >= 0 ||
-                      str::find(triple, ~"xscale") >= 0 {
+        } else if str::find(triple, "arm") >= 0 ||
+                      str::find(triple, "xscale") >= 0 {
             session::arch_arm
-        } else { log_err ~"Unknown architecture! " + triple; fail };
+        } else { log_err "Unknown architecture! " + triple; fail };
 }
 
-fn get_default_sysroot(binary: &istr) -> istr {
+fn get_default_sysroot(binary: &str) -> str {
     let dirname = fs::dirname(binary);
-    if str::eq(dirname, binary) { ret ~"."; }
+    if str::eq(dirname, binary) { ret "."; }
     ret dirname;
 }
 
 fn build_target_config() -> @session::config {
-    let triple: istr =
-        str::str_from_cstr(llvm::llvm::LLVMRustGetHostTriple());
+    let triple: str = str::str_from_cstr(llvm::llvm::LLVMRustGetHostTriple());
     let target_cfg: @session::config =
         @{os: get_os(triple),
           arch: get_arch(triple),
@@ -348,51 +327,49 @@ fn build_target_config() -> @session::config {
     ret target_cfg;
 }
 
-fn build_session_options(binary: &istr, match: &getopts::match,
-                         binary_dir: &istr) -> @session::options {
-    let library = opt_present(match, ~"lib");
-    let static = opt_present(match, ~"static");
+fn build_session_options(binary: &str, match: &getopts::match,
+                         binary_dir: &str) -> @session::options {
+    let library = opt_present(match, "lib");
+    let static = opt_present(match, "static");
 
-    let library_search_paths = [binary_dir + ~"/lib"];
-    let lsp_vec = getopts::opt_strs(match, ~"L");
-    for lsp: istr in lsp_vec {
-        library_search_paths += [lsp];
-    }
+    let library_search_paths = [binary_dir + "/lib"];
+    let lsp_vec = getopts::opt_strs(match, "L");
+    for lsp: str in lsp_vec { library_search_paths += [lsp]; }
 
-    let parse_only = opt_present(match, ~"parse-only");
-    let no_trans = opt_present(match, ~"no-trans");
+    let parse_only = opt_present(match, "parse-only");
+    let no_trans = opt_present(match, "no-trans");
 
     let output_type =
         if parse_only || no_trans {
             link::output_type_none
-        } else if opt_present(match, ~"S") {
+        } else if opt_present(match, "S") {
             link::output_type_assembly
-        } else if opt_present(match, ~"c") {
+        } else if opt_present(match, "c") {
             link::output_type_object
-        } else if opt_present(match, ~"emit-llvm") {
+        } else if opt_present(match, "emit-llvm") {
             link::output_type_bitcode
         } else { link::output_type_exe };
-    let verify = !opt_present(match, ~"noverify");
-    let save_temps = opt_present(match, ~"save-temps");
-    let debuginfo = opt_present(match, ~"g");
-    let stats = opt_present(match, ~"stats");
-    let time_passes = opt_present(match, ~"time-passes");
-    let time_llvm_passes = opt_present(match, ~"time-llvm-passes");
-    let run_typestate = !opt_present(match, ~"no-typestate");
-    let sysroot_opt = getopts::opt_maybe_str(match, ~"sysroot");
+    let verify = !opt_present(match, "noverify");
+    let save_temps = opt_present(match, "save-temps");
+    let debuginfo = opt_present(match, "g");
+    let stats = opt_present(match, "stats");
+    let time_passes = opt_present(match, "time-passes");
+    let time_llvm_passes = opt_present(match, "time-llvm-passes");
+    let run_typestate = !opt_present(match, "no-typestate");
+    let sysroot_opt = getopts::opt_maybe_str(match, "sysroot");
     let opt_level: uint =
-        if opt_present(match, ~"O") {
-            if opt_present(match, ~"OptLevel") {
+        if opt_present(match, "O") {
+            if opt_present(match, "OptLevel") {
                 log_err "error: -O and --OptLevel both provided";
                 fail;
             }
             2u
-        } else if opt_present(match, ~"OptLevel") {
-            alt getopts::opt_str(match, ~"OptLevel") {
-              ~"0" { 0u }
-              ~"1" { 1u }
-              ~"2" { 2u }
-              ~"3" { 3u }
+        } else if opt_present(match, "OptLevel") {
+            alt getopts::opt_str(match, "OptLevel") {
+              "0" { 0u }
+              "1" { 1u }
+              "2" { 2u }
+              "3" { 3u }
               _ {
                 log_err "error: optimization level needs " +
                             "to be between 0-3";
@@ -405,10 +382,9 @@ fn build_session_options(binary: &istr, match: &getopts::match,
           none. { get_default_sysroot(binary) }
           some(s) { s }
         };
-    let cfg = parse_cfgspecs(
-        getopts::opt_strs(match, ~"cfg"));
-    let test = opt_present(match, ~"test");
-    let do_gc = opt_present(match, ~"gc");
+    let cfg = parse_cfgspecs(getopts::opt_strs(match, "cfg"));
+    let test = opt_present(match, "test");
+    let do_gc = opt_present(match, "gc");
     let sopts: @session::options =
         @{library: library,
           static: static,
@@ -439,32 +415,31 @@ fn build_session(sopts: @session::options) -> session::session {
                          none, 0u);
 }
 
-fn parse_pretty(sess: session::session, name: &istr) -> pp_mode {
-    if str::eq(name, ~"normal") {
+fn parse_pretty(sess: session::session, name: &str) -> pp_mode {
+    if str::eq(name, "normal") {
         ret ppm_normal;
-    } else if str::eq(name, ~"expanded") {
+    } else if str::eq(name, "expanded") {
         ret ppm_expanded;
-    } else if str::eq(name, ~"typed") {
+    } else if str::eq(name, "typed") {
         ret ppm_typed;
-    } else if str::eq(name, ~"identified") { ret ppm_identified; }
-    sess.fatal(~"argument to `pretty` must be one of `normal`, `typed`, or "
-               + ~"`identified`");
+    } else if str::eq(name, "identified") { ret ppm_identified; }
+    sess.fatal("argument to `pretty` must be one of `normal`, `typed`, or " +
+                   "`identified`");
 }
 
 fn opts() -> [getopts::opt] {
-    ret [optflag(~"h"), optflag(~"help"), optflag(~"v"), optflag(~"version"),
-         optflag(~"glue"), optflag(~"emit-llvm"), optflagopt(~"pretty"),
-         optflag(~"ls"), optflag(~"parse-only"), optflag(~"no-trans"),
-         optflag(~"O"), optopt(~"OptLevel"), optmulti(~"L"),
-         optflag(~"S"), optflag(~"c"), optopt(~"o"), optflag(~"g"),
-         optflag(~"save-temps"), optopt(~"sysroot"), optflag(~"stats"),
-         optflag(~"time-passes"), optflag(~"time-llvm-passes"),
-         optflag(~"no-typestate"), optflag(~"noverify"), optmulti(~"cfg"),
-         optflag(~"test"), optflag(~"lib"), optflag(~"static"),
-         optflag(~"gc")];
+    ret [optflag("h"), optflag("help"), optflag("v"), optflag("version"),
+         optflag("glue"), optflag("emit-llvm"), optflagopt("pretty"),
+         optflag("ls"), optflag("parse-only"), optflag("no-trans"),
+         optflag("O"), optopt("OptLevel"), optmulti("L"), optflag("S"),
+         optflag("c"), optopt("o"), optflag("g"), optflag("save-temps"),
+         optopt("sysroot"), optflag("stats"), optflag("time-passes"),
+         optflag("time-llvm-passes"), optflag("no-typestate"),
+         optflag("noverify"), optmulti("cfg"), optflag("test"),
+         optflag("lib"), optflag("static"), optflag("gc")];
 }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let binary = vec::shift(args);
     let binary_dir = fs::dirname(binary);
     let match =
@@ -475,49 +450,45 @@ fn main(args: [istr]) {
             fail
           }
         };
-    if opt_present(match, ~"h") || opt_present(match, ~"help") {
+    if opt_present(match, "h") || opt_present(match, "help") {
         usage(binary);
         ret;
     }
-    if opt_present(match, ~"v") || opt_present(match, ~"version") {
+    if opt_present(match, "v") || opt_present(match, "version") {
         version(binary);
         ret;
     }
     let sopts = build_session_options(binary, match, binary_dir);
     let sess = build_session(sopts);
-    let n_inputs = vec::len::<istr>(match.free);
-    let output_file = getopts::opt_maybe_str(match, ~"o");
-    let glue = opt_present(match, ~"glue");
+    let n_inputs = vec::len::<str>(match.free);
+    let output_file = getopts::opt_maybe_str(match, "o");
+    let glue = opt_present(match, "glue");
     if glue {
         if n_inputs > 0u {
-            sess.fatal(~"No input files allowed with --glue.");
+            sess.fatal("No input files allowed with --glue.");
         }
-        let out = option::from_maybe::<istr>(~"glue.bc", output_file);
+        let out = option::from_maybe::<str>("glue.bc", output_file);
         middle::trans::make_common_glue(sess, out);
         ret;
     }
     if n_inputs == 0u {
-        sess.fatal(~"No input filename given.");
+        sess.fatal("No input filename given.");
     } else if n_inputs > 1u {
-        sess.fatal(~"Multiple input filenames provided.");
+        sess.fatal("Multiple input filenames provided.");
     }
     let ifile = match.free[0];
-    let saved_out_filename: istr = ~"";
-    let cfg = build_configuration(sess, binary,
-                                  ifile);
+    let saved_out_filename: str = "";
+    let cfg = build_configuration(sess, binary, ifile);
     let pretty =
-        option::map::<istr,
+        option::map::<str,
                       pp_mode>(bind parse_pretty(sess, _),
-                               getopts::opt_default(match, ~"pretty",
-                                                    ~"normal"));
+                               getopts::opt_default(match, "pretty",
+                                                    "normal"));
     alt pretty {
-      some::<pp_mode>(ppm) {
-        pretty_print_input(sess, cfg, ifile, ppm);
-        ret;
-      }
+      some::<pp_mode>(ppm) { pretty_print_input(sess, cfg, ifile, ppm); ret; }
       none::<pp_mode>. {/* continue */ }
     }
-    let ls = opt_present(match, ~"ls");
+    let ls = opt_present(match, "ls");
     if ls { metadata::creader::list_file_metadata(ifile, io::stdout()); ret; }
 
     let stop_after_codegen =
@@ -532,21 +503,22 @@ fn main(args: [istr]) {
         let parts =
             if !input_is_stdin(ifile) {
                 str::split(ifile, '.' as u8)
-            } else { [~"default", ~"rs"] };
+            } else { ["default", "rs"] };
         vec::pop(parts);
-        saved_out_filename = str::connect(parts, ~".");
+        saved_out_filename = str::connect(parts, ".");
         let suffix =
             alt sopts.output_type {
-              link::output_type_none. { ~"none" }
-              link::output_type_bitcode. { ~"bc" }
-              link::output_type_assembly. { ~"s" }
+              link::output_type_none. { "none" }
+              link::output_type_bitcode. { "bc" }
+              link::output_type_assembly. { "s" }
+
 
               // Object and exe output both use the '.o' extension here
               link::output_type_object. | link::output_type_exe. {
-                ~"o"
+                "o"
               }
             };
-        let ofile = saved_out_filename + ~"." + suffix;
+        let ofile = saved_out_filename + "." + suffix;
         compile_input(sess, cfg, ifile, ofile);
       }
       some(ofile) {
@@ -554,7 +526,7 @@ fn main(args: [istr]) {
         // FIXME: what about windows? This will create a foo.exe.o.
         saved_out_filename = ofile;
         let temp_filename =
-            if !stop_after_codegen { ofile + ~".o" } else { ofile };
+            if !stop_after_codegen { ofile + ".o" } else { ofile };
         compile_input(sess, cfg, ifile, temp_filename);
       }
     }
@@ -565,39 +537,37 @@ fn main(args: [istr]) {
     // TODO: Factor this out of main.
     if stop_after_codegen { ret; }
 
-    let glu: istr = binary_dir + ~"/lib/glue.o";
-    let main: istr = binary_dir + ~"/lib/main.o";
-    let stage: istr = ~"-L" + binary_dir + ~"/lib";
-    let prog: istr = ~"gcc";
+    let glu: str = binary_dir + "/lib/glue.o";
+    let main: str = binary_dir + "/lib/main.o";
+    let stage: str = "-L" + binary_dir + "/lib";
+    let prog: str = "gcc";
     // The invocations of gcc share some flags across platforms
 
     let gcc_args =
-        [stage,
-         ~"-Lrt", ~"-lrustrt", glu,
-         ~"-m32", ~"-o", saved_out_filename,
-         saved_out_filename + ~".o"];
+        [stage, "-Lrt", "-lrustrt", glu, "-m32", "-o", saved_out_filename,
+         saved_out_filename + ".o"];
     let lib_cmd;
 
     let os = sess.get_targ_cfg().os;
     if os == session::os_macos {
-        lib_cmd = ~"-dynamiclib";
-    } else { lib_cmd = ~"-shared"; }
+        lib_cmd = "-dynamiclib";
+    } else { lib_cmd = "-shared"; }
 
     // Converts a library file name into a gcc -l argument
-    fn unlib(config: @session::config, filename: &istr) -> istr {
+    fn unlib(config: @session::config, filename: &str) -> str {
         let rmlib =
-            bind fn (config: @session::config, filename: &istr) -> istr {
-            if config.os == session::os_macos ||
-                config.os == session::os_linux &&
-                str::find(filename, ~"lib") == 0 {
-                ret str::slice(filename, 3u,
-                                str::byte_len(filename));
-            } else { ret filename; }
-        }(config, _);
-        fn rmext(filename: &istr) -> istr {
+            bind fn (config: @session::config, filename: &str) -> str {
+                     if config.os == session::os_macos ||
+                            config.os == session::os_linux &&
+                                str::find(filename, "lib") == 0 {
+                         ret str::slice(filename, 3u,
+                                        str::byte_len(filename));
+                     } else { ret filename; }
+                 }(config, _);
+        fn rmext(filename: &str) -> str {
             let parts = str::split(filename, '.' as u8);
             vec::pop(parts);
-            ret str::connect(parts, ~".");
+            ret str::connect(parts, ".");
         }
         ret alt config.os {
               session::os_macos. { rmext(rmlib(filename)) }
@@ -607,53 +577,48 @@ fn main(args: [istr]) {
     }
 
     let cstore = sess.get_cstore();
-    for cratepath: istr in cstore::get_used_crate_files(cstore) {
-        if str::ends_with(cratepath, ~".rlib") {
+    for cratepath: str in cstore::get_used_crate_files(cstore) {
+        if str::ends_with(cratepath, ".rlib") {
             gcc_args += [cratepath];
             cont;
         }
         let cratepath = cratepath;
         let dir = fs::dirname(cratepath);
-        if dir != ~"" { gcc_args += [~"-L" + dir]; }
+        if dir != "" { gcc_args += ["-L" + dir]; }
         let libarg = unlib(sess.get_targ_cfg(), fs::basename(cratepath));
-        gcc_args += [~"-l" + libarg];
+        gcc_args += ["-l" + libarg];
     }
 
     let ula = cstore::get_used_link_args(cstore);
-    for arg: istr in ula { gcc_args += [arg]; }
+    for arg: str in ula { gcc_args += [arg]; }
 
     let used_libs = cstore::get_used_libraries(cstore);
-    for l: istr in used_libs { gcc_args += [~"-l" + l]; }
+    for l: str in used_libs { gcc_args += ["-l" + l]; }
 
     if sopts.library {
         gcc_args += [lib_cmd];
     } else {
         // FIXME: why do we hardcode -lm?
-        gcc_args += [~"-lm", main];
+        gcc_args += ["-lm", main];
     }
     // We run 'gcc' here
 
     let err_code = run::run_program(prog, gcc_args);
     if 0 != err_code {
-        sess.err(
-            #fmt["linking with gcc failed with code %d", err_code]);
-        sess.note(
-            #fmt["gcc arguments: %s",
-                       str::connect(gcc_args, ~" ")]);
+        sess.err(#fmt["linking with gcc failed with code %d", err_code]);
+        sess.note(#fmt["gcc arguments: %s", str::connect(gcc_args, " ")]);
         sess.abort_if_errors();
     }
     // Clean up on Darwin
 
     if sess.get_targ_cfg().os == session::os_macos {
-        run::run_program(~"dsymutil",
-                         [saved_out_filename]);
+        run::run_program("dsymutil", [saved_out_filename]);
     }
 
 
     // Remove the temporary object file if we aren't saving temps
     if !sopts.save_temps {
-        run::run_program(~"rm",
-                         [saved_out_filename + ~".o"]);
+        run::run_program("rm", [saved_out_filename + ".o"]);
     }
 }
 
@@ -664,13 +629,13 @@ mod test {
     #[test]
     fn test_switch_implies_cfg_test() {
         let match =
-            alt getopts::getopts([~"--test"], opts()) {
+            alt getopts::getopts(["--test"], opts()) {
               getopts::success(m) { m }
             };
-        let sessopts = build_session_options(~"whatever", match, ~"whatever");
+        let sessopts = build_session_options("whatever", match, "whatever");
         let sess = build_session(sessopts);
-        let cfg = build_configuration(sess, ~"whatever", ~"whatever");
-        assert (attr::contains_name(cfg, ~"test"));
+        let cfg = build_configuration(sess, "whatever", "whatever");
+        assert (attr::contains_name(cfg, "test"));
     }
 
     // When the user supplies --test and --cfg test, don't implicitly add
@@ -678,13 +643,13 @@ mod test {
     #[test]
     fn test_switch_implies_cfg_test_unless_cfg_test() {
         let match =
-            alt getopts::getopts([~"--test", ~"--cfg=test"], opts()) {
+            alt getopts::getopts(["--test", "--cfg=test"], opts()) {
               getopts::success(m) { m }
             };
-        let sessopts = build_session_options(~"whatever", match, ~"whatever");
+        let sessopts = build_session_options("whatever", match, "whatever");
         let sess = build_session(sessopts);
-        let cfg = build_configuration(sess, ~"whatever", ~"whatever");
-        let test_items = attr::find_meta_items_by_name(cfg, ~"test");
+        let cfg = build_configuration(sess, "whatever", "whatever");
+        let test_items = attr::find_meta_items_by_name(cfg, "test");
         assert (vec::len(test_items) == 1u);
     }
 }
diff --git a/src/comp/driver/session.rs b/src/comp/driver/session.rs
index 312cdc58f69..13d17ef6303 100644
--- a/src/comp/driver/session.rs
+++ b/src/comp/driver/session.rs
@@ -37,15 +37,15 @@ type options =
      time_passes: bool,
      time_llvm_passes: bool,
      output_type: back::link::output_type,
-     library_search_paths: [istr],
-     sysroot: istr,
+     library_search_paths: [str],
+     sysroot: str,
      cfg: ast::crate_cfg,
      test: bool,
      parse_only: bool,
      no_trans: bool,
      do_gc: bool};
 
-type crate_metadata = {name: istr, data: [u8]};
+type crate_metadata = {name: str, data: [u8]};
 
 obj session(targ_cfg: @config,
             opts: @options,
@@ -58,54 +58,46 @@ obj session(targ_cfg: @config,
     fn get_targ_cfg() -> @config { ret targ_cfg; }
     fn get_opts() -> @options { ret opts; }
     fn get_cstore() -> metadata::cstore::cstore { cstore }
-    fn span_fatal(sp: span, msg: &istr) -> ! {
+    fn span_fatal(sp: span, msg: &str) -> ! {
         // FIXME: Use constants, but rustboot doesn't know how to export them.
         codemap::emit_error(some(sp), msg, parse_sess.cm);
         fail;
     }
-    fn fatal(msg: &istr) -> ! {
+    fn fatal(msg: &str) -> ! {
         codemap::emit_error(none, msg, parse_sess.cm);
         fail;
     }
-    fn span_err(sp: span, msg: &istr) {
+    fn span_err(sp: span, msg: &str) {
         codemap::emit_error(some(sp), msg, parse_sess.cm);
         err_count += 1u;
     }
-    fn err(msg: &istr) {
+    fn err(msg: &str) {
         codemap::emit_error(none, msg, parse_sess.cm);
         err_count += 1u;
     }
     fn abort_if_errors() {
-        if err_count > 0u { self.fatal(~"aborting due to previous errors"); }
+        if err_count > 0u { self.fatal("aborting due to previous errors"); }
     }
-    fn span_warn(sp: span, msg: &istr) {
+    fn span_warn(sp: span, msg: &str) {
         // FIXME: Use constants, but rustboot doesn't know how to export them.
         codemap::emit_warning(some(sp), msg, parse_sess.cm);
     }
-    fn warn(msg: &istr) {
-        codemap::emit_warning(none, msg, parse_sess.cm);
-    }
-    fn span_note(sp: span, msg: &istr) {
+    fn warn(msg: &str) { codemap::emit_warning(none, msg, parse_sess.cm); }
+    fn span_note(sp: span, msg: &str) {
         // FIXME: Use constants, but rustboot doesn't know how to export them.
         codemap::emit_note(some(sp), msg, parse_sess.cm);
     }
-    fn note(msg: &istr) {
-        codemap::emit_note(none, msg, parse_sess.cm);
-    }
-    fn span_bug(sp: span, msg: &istr) -> ! {
-        self.span_fatal(sp,
-                        #fmt["internal compiler error %s",
-                                             msg]);
+    fn note(msg: &str) { codemap::emit_note(none, msg, parse_sess.cm); }
+    fn span_bug(sp: span, msg: &str) -> ! {
+        self.span_fatal(sp, #fmt["internal compiler error %s", msg]);
     }
-    fn bug(msg: &istr) -> ! {
-        self.fatal(
-            #fmt["internal compiler error %s",
-                 msg]);
+    fn bug(msg: &str) -> ! {
+        self.fatal(#fmt["internal compiler error %s", msg]);
     }
-    fn span_unimpl(sp: span, msg: &istr) -> ! {
-        self.span_bug(sp, ~"unimplemented " + msg);
+    fn span_unimpl(sp: span, msg: &str) -> ! {
+        self.span_bug(sp, "unimplemented " + msg);
     }
-    fn unimpl(msg: &istr) -> ! { self.bug(~"unimplemented " + msg); }
+    fn unimpl(msg: &str) -> ! { self.bug("unimplemented " + msg); }
     fn get_codemap() -> codemap::codemap { ret parse_sess.cm; }
     fn lookup_pos(pos: uint) -> codemap::loc {
         ret codemap::lookup_char_pos(parse_sess.cm, pos);
@@ -114,7 +106,7 @@ obj session(targ_cfg: @config,
     fn next_node_id() -> ast::node_id {
         ret syntax::parse::parser::next_node_id(parse_sess);
     }
-    fn span_str(sp: span) -> istr {
+    fn span_str(sp: span) -> str {
         ret codemap::span_to_str(sp, self.get_codemap());
     }
     fn set_main_id(d: node_id) { main_fn = some(d); }
diff --git a/src/comp/front/attr.rs b/src/comp/front/attr.rs
index 731e05125da..edb6da5b257 100644
--- a/src/comp/front/attr.rs
+++ b/src/comp/front/attr.rs
@@ -32,7 +32,7 @@ export mk_attr;
 // linkage
 fn find_linkage_metas(attrs: &[ast::attribute]) -> [@ast::meta_item] {
     let metas: [@ast::meta_item] = [];
-    for attr: ast::attribute in find_attrs_by_name(attrs, ~"link") {
+    for attr: ast::attribute in find_attrs_by_name(attrs, "link") {
         alt attr.node.value.node {
           ast::meta_list(_, items) { metas += items; }
           _ { log "ignoring link attribute that has incorrect type"; }
@@ -80,13 +80,10 @@ fn get_meta_item_name(meta: &@ast::meta_item) -> ast::ident {
 
 // Gets the string value if the meta_item is a meta_name_value variant
 // containing a string, otherwise none
-fn get_meta_item_value_str(meta: &@ast::meta_item) -> option::t<istr> {
+fn get_meta_item_value_str(meta: &@ast::meta_item) -> option::t<str> {
     alt meta.node {
       ast::meta_name_value(_, v) {
-        alt v.node {
-          ast::lit_str(s) { option::some(s) }
-          _ { option::none }
-        }
+        alt v.node { ast::lit_str(s) { option::some(s) } _ { option::none } }
       }
       _ { option::none }
     }
@@ -124,10 +121,10 @@ fn eq(a: @ast::meta_item, b: @ast::meta_item) -> bool {
 
 fn contains(haystack: &[@ast::meta_item], needle: @ast::meta_item) -> bool {
     log #fmt["looking for %s",
-                 syntax::print::pprust::meta_item_to_str(*needle)];
+             syntax::print::pprust::meta_item_to_str(*needle)];
     for item: @ast::meta_item in haystack {
         log #fmt["looking in %s",
-                     syntax::print::pprust::meta_item_to_str(*item)];
+                 syntax::print::pprust::meta_item_to_str(*item)];
         if eq(item, needle) { log "found it!"; ret true; }
     }
     log "found it not :(";
@@ -163,11 +160,11 @@ fn sort_meta_items(items: &[@ast::meta_item]) -> [@ast::meta_item] {
     ret v2;
 }
 
-fn remove_meta_items_by_name(items: &[@ast::meta_item], name: &istr) ->
+fn remove_meta_items_by_name(items: &[@ast::meta_item], name: &str) ->
    [@ast::meta_item] {
 
     let filter =
-        bind fn (item: &@ast::meta_item, name: &istr) ->
+        bind fn (item: &@ast::meta_item, name: &str) ->
                 option::t<@ast::meta_item> {
                  if get_meta_item_name(item) != name {
                      option::some(item)
@@ -183,8 +180,7 @@ fn require_unique_names(sess: &session::session, metas: &[@ast::meta_item]) {
         let name = get_meta_item_name(meta);
         if map.contains_key(name) {
             sess.span_fatal(meta.span,
-                            #fmt["duplicate meta item `%s`",
-                                 name]);
+                            #fmt["duplicate meta item `%s`", name]);
         }
         map.insert(name, ());
     }
@@ -194,8 +190,7 @@ fn span<@T>(item: &T) -> ast::spanned<T> {
     ret {node: item, span: ast_util::dummy_sp()};
 }
 
-fn mk_name_value_item_str(name: ast::ident,
-                          value: &istr) -> @ast::meta_item {
+fn mk_name_value_item_str(name: ast::ident, value: &str) -> @ast::meta_item {
     let value_lit = span(ast::lit_str(value));
     ret mk_name_value_item(name, value_lit);
 }
diff --git a/src/comp/front/config.rs b/src/comp/front/config.rs
index be02086cc01..0d391f63c34 100644
--- a/src/comp/front/config.rs
+++ b/src/comp/front/config.rs
@@ -77,7 +77,8 @@ fn fold_block(cfg: &ast::crate_cfg, b: &ast::blk_, fld: fold::ast_fold) ->
     let filtered_stmts = vec::filter_map(filter, b.stmts);
     ret {stmts: vec::map(fld.fold_stmt, filtered_stmts),
          expr: option::map(fld.fold_expr, b.expr),
-         id: b.id, rules: b.rules};
+         id: b.id,
+         rules: b.rules};
 }
 
 fn item_in_cfg(cfg: &ast::crate_cfg, item: &@ast::item) -> bool {
@@ -94,7 +95,7 @@ fn native_item_in_cfg(cfg: &ast::crate_cfg, item: &@ast::native_item) ->
 fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool {
 
     // The "cfg" attributes on the item
-    let item_cfg_attrs = attr::find_attrs_by_name(attrs, ~"cfg");
+    let item_cfg_attrs = attr::find_attrs_by_name(attrs, "cfg");
     let item_has_cfg_attrs = vec::len(item_cfg_attrs) > 0u;
     if !item_has_cfg_attrs { ret true; }
 
@@ -108,7 +109,7 @@ fn in_cfg(cfg: &ast::crate_cfg, attrs: &[ast::attribute]) -> bool {
                [@ast::meta_item] {
                 alt cfg_item.node {
                   ast::meta_list(name, items) {
-                    assert (name == ~"cfg");
+                    assert (name == "cfg");
                     inner_items + items
                   }
                   _ { inner_items }
diff --git a/src/comp/front/test.rs b/src/comp/front/test.rs
index ae2a663c3db..997ca4e47a7 100644
--- a/src/comp/front/test.rs
+++ b/src/comp/front/test.rs
@@ -65,7 +65,7 @@ fn fold_mod(_cx: &test_ctxt, m: &ast::_mod, fld: fold::ast_fold) ->
     fn nomain(item: &@ast::item) -> option::t<@ast::item> {
         alt item.node {
           ast::item_fn(f, _) {
-            if item.ident == ~"main" {
+            if item.ident == "main" {
                 option::none
             } else { option::some(item) }
           }
@@ -92,8 +92,7 @@ fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) ->
    @ast::item {
 
     cx.path += [i.ident];
-    log #fmt["current path: %s",
-             ast_util::path_name_i(cx.path)];
+    log #fmt["current path: %s", ast_util::path_name_i(cx.path)];
 
     if is_test_fn(i) {
         log "this is a test function";
@@ -109,7 +108,7 @@ fn fold_item(cx: &test_ctxt, i: &@ast::item, fld: fold::ast_fold) ->
 
 fn is_test_fn(i: &@ast::item) -> bool {
     let has_test_attr =
-        vec::len(attr::find_attrs_by_name(i.attrs, ~"test")) > 0u;
+        vec::len(attr::find_attrs_by_name(i.attrs, "test")) > 0u;
 
     fn has_test_signature(i: &@ast::item) -> bool {
         alt i.node {
@@ -127,7 +126,7 @@ fn is_test_fn(i: &@ast::item) -> bool {
 }
 
 fn is_ignored(i: &@ast::item) -> bool {
-    attr::contains_name(attr::attr_metas(i.attrs), ~"ignore")
+    attr::contains_name(attr::attr_metas(i.attrs), "ignore")
 }
 
 fn add_test_module(cx: &test_ctxt, m: &ast::_mod) -> ast::_mod {
@@ -162,21 +161,18 @@ fn mk_test_module(cx: &test_ctxt) -> @ast::item {
     let testmod: ast::_mod = {view_items: [], items: [mainfn, testsfn]};
     let item_ = ast::item_mod(testmod);
     let item: ast::item =
-        {ident: ~"__test",
+        {ident: "__test",
          attrs: [],
          id: cx.next_node_id(),
          node: item_,
          span: dummy_sp()};
 
-    log #fmt["Synthetic test module:\n%s\n",
-             pprust::item_to_str(@item)];
+    log #fmt["Synthetic test module:\n%s\n", pprust::item_to_str(@item)];
 
     ret @item;
 }
 
-fn nospan<@T>(t: &T) -> ast::spanned<T> {
-    ret {node: t, span: dummy_sp()};
-}
+fn nospan<@T>(t: &T) -> ast::spanned<T> { ret {node: t, span: dummy_sp()}; }
 
 fn mk_tests(cx: &test_ctxt) -> @ast::item {
     let ret_ty = mk_test_desc_vec_ty(cx);
@@ -193,15 +189,15 @@ fn mk_tests(cx: &test_ctxt) -> @ast::item {
     // The vector of test_descs for this crate
     let test_descs = mk_test_desc_vec(cx);
 
-    let body_: ast::blk_ = checked_blk([], option::some(test_descs),
-                                       cx.next_node_id());
+    let body_: ast::blk_ =
+        checked_blk([], option::some(test_descs), cx.next_node_id());
     let body = nospan(body_);
 
     let fn_ = {decl: decl, proto: proto, body: body};
 
     let item_ = ast::item_fn(fn_, []);
     let item: ast::item =
-        {ident: ~"tests",
+        {ident: "tests",
          attrs: [],
          id: cx.next_node_id(),
          node: item_,
@@ -222,7 +218,7 @@ fn empty_fn_ty() -> ast::ty {
 fn mk_test_desc_vec_ty(cx: &test_ctxt) -> @ast::ty {
     let test_desc_ty_path: ast::path =
         nospan({global: false,
-                idents: [~"std", ~"test", ~"test_desc"],
+                idents: ["std", "test", "test_desc"],
                 types: []});
 
     let test_desc_ty: ast::ty =
@@ -249,8 +245,7 @@ fn mk_test_desc_vec(cx: &test_ctxt) -> @ast::expr {
 fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
     let path = test.path;
 
-    log #fmt["encoding %s",
-             ast_util::path_name_i(path)];
+    log #fmt["encoding %s", ast_util::path_name_i(path)];
 
     let name_lit: ast::lit =
         nospan(ast::lit_str(ast_util::path_name_i(path)));
@@ -260,7 +255,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
          span: dummy_sp()};
 
     let name_field: ast::field =
-        nospan({mut: ast::imm, ident: ~"name", expr: @name_expr});
+        nospan({mut: ast::imm, ident: "name", expr: @name_expr});
 
     let fn_path: ast::path = nospan({global: false, idents: path, types: []});
 
@@ -270,7 +265,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
          span: dummy_sp()};
 
     let fn_field: ast::field =
-        nospan({mut: ast::imm, ident: ~"fn", expr: @fn_expr});
+        nospan({mut: ast::imm, ident: "fn", expr: @fn_expr});
 
     let ignore_lit: ast::lit = nospan(ast::lit_bool(test.ignore));
 
@@ -280,7 +275,7 @@ fn mk_test_desc_rec(cx: &test_ctxt, test: test) -> @ast::expr {
          span: dummy_sp()};
 
     let ignore_field: ast::field =
-        nospan({mut: ast::imm, ident: ~"ignore", expr: @ignore_expr});
+        nospan({mut: ast::imm, ident: "ignore", expr: @ignore_expr});
 
     let desc_rec_: ast::expr_ =
         ast::expr_rec([name_field, fn_field, ignore_field], option::none);
@@ -295,7 +290,7 @@ fn mk_main(cx: &test_ctxt) -> @ast::item {
     let args_ty: ast::ty = nospan(ast::ty_vec(args_mt));
 
     let args_arg: ast::arg =
-        {mode: ast::val, ty: @args_ty, ident: ~"args", id: cx.next_node_id()};
+        {mode: ast::val, ty: @args_ty, ident: "args", id: cx.next_node_id()};
 
     let ret_ty = nospan(ast::ty_nil);
 
@@ -310,15 +305,15 @@ fn mk_main(cx: &test_ctxt) -> @ast::item {
 
     let test_main_call_expr = mk_test_main_call(cx);
 
-    let body_: ast::blk_ = checked_blk([], option::some(test_main_call_expr),
-                                       cx.next_node_id());
+    let body_: ast::blk_ =
+        checked_blk([], option::some(test_main_call_expr), cx.next_node_id());
     let body = {node: body_, span: dummy_sp()};
 
     let fn_ = {decl: decl, proto: proto, body: body};
 
     let item_ = ast::item_fn(fn_, []);
     let item: ast::item =
-        {ident: ~"main",
+        {ident: "main",
          attrs: [],
          id: cx.next_node_id(),
          node: item_,
@@ -330,7 +325,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr {
 
     // Get the args passed to main so we can pass the to test_main
     let args_path: ast::path =
-        nospan({global: false, idents: [~"args"], types: []});
+        nospan({global: false, idents: ["args"], types: []});
 
     let args_path_expr_: ast::expr_ = ast::expr_path(args_path);
 
@@ -339,7 +334,7 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr {
 
     // Call __test::test to generate the vector of test_descs
     let test_path: ast::path =
-        nospan({global: false, idents: [~"tests"], types: []});
+        nospan({global: false, idents: ["tests"], types: []});
 
     let test_path_expr_: ast::expr_ = ast::expr_path(test_path);
 
@@ -354,24 +349,20 @@ fn mk_test_main_call(cx: &test_ctxt) -> @ast::expr {
     // Call std::test::test_main
     let test_main_path: ast::path =
         nospan({global: false,
-                idents: [~"std", ~"test", ~"test_main"],
+                idents: ["std", "test", "test_main"],
                 types: []});
 
     let test_main_path_expr_: ast::expr_ = ast::expr_path(test_main_path);
 
     let test_main_path_expr: ast::expr =
-        {id: cx.next_node_id(),
-         node: test_main_path_expr_,
-         span: dummy_sp()};
+        {id: cx.next_node_id(), node: test_main_path_expr_, span: dummy_sp()};
 
     let test_main_call_expr_: ast::expr_ =
         ast::expr_call(@test_main_path_expr,
                        [@args_path_expr, @test_call_expr]);
 
     let test_main_call_expr: ast::expr =
-        {id: cx.next_node_id(),
-         node: test_main_call_expr_,
-         span: dummy_sp()};
+        {id: cx.next_node_id(), node: test_main_call_expr_, span: dummy_sp()};
 
     ret @test_main_call_expr;
 }
diff --git a/src/comp/lib/llvm.rs b/src/comp/lib/llvm.rs
index 105490ac223..431893b0201 100644
--- a/src/comp/lib/llvm.rs
+++ b/src/comp/lib/llvm.rs
@@ -810,18 +810,14 @@ native "cdecl" mod llvm = "rustllvm" {
     fn LLVMPassManagerBuilderSetDisableUnrollLoops(PMB: PassManagerBuilderRef,
                                                    Value: Bool);
     fn LLVMPassManagerBuilderSetDisableSimplifyLibCalls(
-        PMB: PassManagerBuilderRef,
-        Value: Bool);
+        PMB: PassManagerBuilderRef, Value: Bool);
     fn LLVMPassManagerBuilderUseInlinerWithThreshold(
-        PMB: PassManagerBuilderRef,
-        threshold: uint);
+        PMB: PassManagerBuilderRef, threshold: uint);
     fn LLVMPassManagerBuilderPopulateModulePassManager(
-        PMB: PassManagerBuilderRef,
-        PM: PassManagerRef);
+        PMB: PassManagerBuilderRef, PM: PassManagerRef);
 
     fn LLVMPassManagerBuilderPopulateFunctionPassManager(
-        PMB: PassManagerBuilderRef,
-        PM: PassManagerRef);
+        PMB: PassManagerBuilderRef, PM: PassManagerRef);
 
     /** Destroys a memory buffer. */
     fn LLVMDisposeMemoryBuffer(MemBuf: MemoryBufferRef);
@@ -899,10 +895,10 @@ native "cdecl" mod llvm = "rustllvm" {
 
 /* Memory-managed object interface to type handles. */
 
-obj type_names(type_names: std::map::hashmap<TypeRef, istr>,
-               named_types: std::map::hashmap<istr, TypeRef>) {
+obj type_names(type_names: std::map::hashmap<TypeRef, str>,
+               named_types: std::map::hashmap<str, TypeRef>) {
 
-    fn associate(s: &istr, t: TypeRef) {
+    fn associate(s: &str, t: TypeRef) {
         assert (!named_types.contains_key(s));
         assert (!type_names.contains_key(t));
         type_names.insert(t, s);
@@ -911,15 +907,11 @@ obj type_names(type_names: std::map::hashmap<TypeRef, istr>,
 
     fn type_has_name(t: TypeRef) -> bool { ret type_names.contains_key(t); }
 
-    fn get_name(t: TypeRef) -> istr { ret type_names.get(t); }
+    fn get_name(t: TypeRef) -> str { ret type_names.get(t); }
 
-    fn name_has_type(s: &istr) -> bool {
-        ret named_types.contains_key(s);
-    }
+    fn name_has_type(s: &str) -> bool { ret named_types.contains_key(s); }
 
-    fn get_type(s: &istr) -> TypeRef {
-        ret named_types.get(s);
-    }
+    fn get_type(s: &str) -> TypeRef { ret named_types.get(s); }
 }
 
 fn mk_type_names() -> type_names {
@@ -931,17 +923,17 @@ fn mk_type_names() -> type_names {
 
     let hasher: std::map::hashfn<TypeRef> = hash;
     let eqer: std::map::eqfn<TypeRef> = eq;
-    let tn = std::map::mk_hashmap::<TypeRef, istr>(hasher, eqer);
+    let tn = std::map::mk_hashmap::<TypeRef, str>(hasher, eqer);
 
     ret type_names(tn, nt);
 }
 
-fn type_to_str(names: type_names, ty: TypeRef) -> istr {
+fn type_to_str(names: type_names, ty: TypeRef) -> str {
     ret type_to_str_inner(names, [], ty);
 }
 
 fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
-   istr {
+   str {
 
     if names.type_has_name(ty) { ret names.get_name(ty); }
 
@@ -949,12 +941,11 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
 
     let kind: int = llvm::LLVMGetTypeKind(ty);
 
-    fn tys_str(names: type_names, outer: &[TypeRef],
-               tys: &[TypeRef]) -> istr {
-        let s: istr = ~"";
+    fn tys_str(names: type_names, outer: &[TypeRef], tys: &[TypeRef]) -> str {
+        let s: str = "";
         let first: bool = true;
         for t: TypeRef in tys {
-            if first { first = false; } else { s += ~", "; }
+            if first { first = false; } else { s += ", "; }
             s += type_to_str_inner(names, outer, t);
         }
         ret s;
@@ -965,81 +956,87 @@ fn type_to_str_inner(names: type_names, outer0: &[TypeRef], ty: TypeRef) ->
 
 
 
+
       // FIXME: more enum-as-int constants determined from Core::h;
       // horrible, horrible. Complete as needed.
 
       0 {
-        ret ~"Void";
+        ret "Void";
       }
-      1 { ret ~"Float"; }
-      2 { ret ~"Double"; }
-      3 { ret ~"X86_FP80"; }
-      4 { ret ~"FP128"; }
-      5 { ret ~"PPC_FP128"; }
-      6 { ret ~"Label"; }
+      1 { ret "Float"; }
+      2 { ret "Double"; }
+      3 { ret "X86_FP80"; }
+      4 { ret "FP128"; }
+      5 { ret "PPC_FP128"; }
+      6 { ret "Label"; }
+
 
 
 
       7 {
-        ret ~"i" + std::int::str(
-            llvm::LLVMGetIntTypeWidth(ty) as int);
+        ret "i" + std::int::str(llvm::LLVMGetIntTypeWidth(ty) as int);
       }
 
 
 
+
       8 {
-        let s = ~"fn(";
+        let s = "fn(";
         let out_ty: TypeRef = llvm::LLVMGetReturnType(ty);
         let n_args: uint = llvm::LLVMCountParamTypes(ty);
         let args: [TypeRef] = vec::init_elt::<TypeRef>(0 as TypeRef, n_args);
         llvm::LLVMGetParamTypes(ty, vec::to_ptr(args));
         s += tys_str(names, outer, args);
-        s += ~") -> ";
+        s += ") -> ";
         s += type_to_str_inner(names, outer, out_ty);
         ret s;
       }
 
 
 
+
       9 {
-        let s: istr = ~"{";
+        let s: str = "{";
         let n_elts: uint = llvm::LLVMCountStructElementTypes(ty);
         let elts: [TypeRef] = vec::init_elt::<TypeRef>(0 as TypeRef, n_elts);
         llvm::LLVMGetStructElementTypes(ty, vec::to_ptr(elts));
         s += tys_str(names, outer, elts);
-        s += ~"}";
+        s += "}";
         ret s;
       }
 
 
 
+
       10 {
         let el_ty = llvm::LLVMGetElementType(ty);
-        ret ~"[" + type_to_str_inner(names, outer, el_ty) + ~"]";
+        ret "[" + type_to_str_inner(names, outer, el_ty) + "]";
       }
 
 
 
+
       11 {
         let i: uint = 0u;
         for tout: TypeRef in outer0 {
             i += 1u;
             if tout as int == ty as int {
                 let n: uint = vec::len::<TypeRef>(outer0) - i;
-                ret ~"*\\" + std::int::str(n as int);
+                ret "*\\" + std::int::str(n as int);
             }
         }
-        ret ~"*" +
+        ret "*" +
                 type_to_str_inner(names, outer, llvm::LLVMGetElementType(ty));
       }
 
 
 
+
       12 {
-        ret ~"Opaque";
+        ret "Opaque";
       }
-      13 { ret ~"Vector"; }
-      14 { ret ~"Metadata"; }
+      13 { ret "Vector"; }
+      14 { ret "Metadata"; }
       _ { log_err #fmt["unknown TypeKind %d", kind as int]; fail; }
     }
 }
@@ -1069,10 +1066,9 @@ resource target_data_res(TD: TargetDataRef) {
 
 type target_data = {lltd: TargetDataRef, dtor: @target_data_res};
 
-fn mk_target_data(string_rep: &istr) -> target_data {
-    let lltd = str::as_buf(string_rep, { |buf|
-        llvm::LLVMCreateTargetData(buf)
-    });
+fn mk_target_data(string_rep: &str) -> target_data {
+    let lltd =
+        str::as_buf(string_rep, {|buf| llvm::LLVMCreateTargetData(buf) });
     ret {lltd: lltd, dtor: @target_data_res(lltd)};
 }
 
diff --git a/src/comp/metadata/common.rs b/src/comp/metadata/common.rs
index 05c0de1bb2b..9d6a2c745f8 100644
--- a/src/comp/metadata/common.rs
+++ b/src/comp/metadata/common.rs
@@ -67,7 +67,7 @@ const tag_items_data_item_inlineness: uint = 0x27u;
 // djb's cdb hashes.
 fn hash_node_id(node_id: &int) -> uint { ret 177573u ^ (node_id as uint); }
 
-fn hash_path(s: &istr) -> uint {
+fn hash_path(s: &str) -> uint {
     let h = 5381u;
     for ch: u8 in str::bytes(s) { h = (h << 5u) + h ^ (ch as uint); }
     ret h;
diff --git a/src/comp/metadata/creader.rs b/src/comp/metadata/creader.rs
index 4fd911a1bad..2c74f03612e 100644
--- a/src/comp/metadata/creader.rs
+++ b/src/comp/metadata/creader.rs
@@ -34,8 +34,7 @@ fn read_crates(sess: session::session, crate: &ast::crate) {
     let e =
         @{sess: sess,
           crate_cache: @std::map::new_str_hash::<int>(),
-          library_search_paths:
-          sess.get_opts().library_search_paths,
+          library_search_paths: sess.get_opts().library_search_paths,
           mutable next_crate_num: 1};
     let v =
         visit::mk_simple_visitor(@{visit_view_item:
@@ -47,8 +46,8 @@ fn read_crates(sess: session::session, crate: &ast::crate) {
 
 type env =
     @{sess: session::session,
-      crate_cache: @hashmap<istr, int>,
-      library_search_paths: [istr],
+      crate_cache: @hashmap<str, int>,
+      library_search_paths: [str],
       mutable next_crate_num: ast::crate_num};
 
 fn visit_view_item(e: env, i: &@ast::view_item) {
@@ -68,14 +67,11 @@ fn visit_item(e: env, i: &@ast::item) {
             ret;
         }
         let cstore = e.sess.get_cstore();
-        if !cstore::add_used_library(cstore,
-                                     m.native_name) { ret; }
+        if !cstore::add_used_library(cstore, m.native_name) { ret; }
         for a: ast::attribute in
-            attr::find_attrs_by_name(i.attrs, ~"link_args") {
+            attr::find_attrs_by_name(i.attrs, "link_args") {
             alt attr::get_meta_item_value_str(attr::attr_meta(a)) {
-              some(linkarg) {
-                cstore::add_used_link_args(cstore, linkarg);
-              }
+              some(linkarg) { cstore::add_used_link_args(cstore, linkarg); }
               none. {/* fallthrough */ }
             }
         }
@@ -85,12 +81,11 @@ fn visit_item(e: env, i: &@ast::item) {
 }
 
 // A diagnostic function for dumping crate metadata to an output stream
-fn list_file_metadata(path: &istr, out: io::writer) {
+fn list_file_metadata(path: &str, out: io::writer) {
     alt get_metadata_section(path) {
       option::some(bytes) { decoder::list_crate_metadata(bytes, out); }
       option::none. {
-        out.write_str(
-            ~"Could not find metadata in " + path + ~".\n");
+        out.write_str("Could not find metadata in " + path + ".\n");
       }
     }
 }
@@ -104,8 +99,7 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool {
 
     for needed: @ast::meta_item in metas {
         if !attr::contains(linkage_metas, needed) {
-            log #fmt["missing %s",
-                     pprust::meta_item_to_str(*needed)];
+            log #fmt["missing %s", pprust::meta_item_to_str(*needed)];
             ret false;
         }
     }
@@ -113,19 +107,18 @@ fn metadata_matches(crate_data: &@[u8], metas: &[@ast::meta_item]) -> bool {
 }
 
 fn default_native_lib_naming(sess: session::session, static: bool) ->
-   {prefix: istr, suffix: istr} {
-    if static { ret {prefix: ~"lib", suffix: ~".rlib"}; }
+   {prefix: str, suffix: str} {
+    if static { ret {prefix: "lib", suffix: ".rlib"}; }
     alt sess.get_targ_cfg().os {
-      session::os_win32. { ret {prefix: ~"", suffix: ~".dll"}; }
-      session::os_macos. { ret {prefix: ~"lib", suffix: ~".dylib"}; }
-      session::os_linux. { ret {prefix: ~"lib", suffix: ~".so"}; }
+      session::os_win32. { ret {prefix: "", suffix: ".dll"}; }
+      session::os_macos. { ret {prefix: "lib", suffix: ".dylib"}; }
+      session::os_linux. { ret {prefix: "lib", suffix: ".so"}; }
     }
 }
 
 fn find_library_crate(sess: &session::session, ident: &ast::ident,
-                      metas: &[@ast::meta_item],
-                      library_search_paths: &[istr])
-   -> option::t<{ident: istr, data: @[u8]}> {
+                      metas: &[@ast::meta_item], library_search_paths: &[str])
+   -> option::t<{ident: str, data: @[u8]}> {
 
     attr::require_unique_names(sess, metas);
 
@@ -133,7 +126,7 @@ fn find_library_crate(sess: &session::session, ident: &ast::ident,
     // is using the wrong type of meta item
     let crate_name =
         {
-            let name_items = attr::find_meta_items_by_name(metas, ~"name");
+            let name_items = attr::find_meta_items_by_name(metas, "name");
             alt vec::last(name_items) {
               some(i) {
                 alt attr::get_meta_item_value_str(i) {
@@ -147,49 +140,41 @@ fn find_library_crate(sess: &session::session, ident: &ast::ident,
 
     let nn = default_native_lib_naming(sess, sess.get_opts().static);
     let x =
-        find_library_crate_aux(nn, crate_name,
-                               metas, library_search_paths);
+        find_library_crate_aux(nn, crate_name, metas, library_search_paths);
     if x != none || sess.get_opts().static { ret x; }
     let nn2 = default_native_lib_naming(sess, true);
-    ret find_library_crate_aux(nn2, crate_name,
-                               metas, library_search_paths);
+    ret find_library_crate_aux(nn2, crate_name, metas, library_search_paths);
 }
 
-fn find_library_crate_aux(nn: &{prefix: istr, suffix: istr},
-                          crate_name: &istr,
+fn find_library_crate_aux(nn: &{prefix: str, suffix: str}, crate_name: &str,
                           metas: &[@ast::meta_item],
-                          library_search_paths: &[istr]) ->
-   option::t<{ident: istr, data: @[u8]}> {
-    let prefix: istr = nn.prefix + crate_name;
-    let suffix: istr = nn.suffix;
+                          library_search_paths: &[str]) ->
+   option::t<{ident: str, data: @[u8]}> {
+    let prefix: str = nn.prefix + crate_name;
+    let suffix: str = nn.suffix;
     // FIXME: we could probably use a 'glob' function in std::fs but it will
     // be much easier to write once the unsafe module knows more about FFI
     // tricks. Currently the glob(3) interface is a bit more than we can
     // stomach from here, and writing a C++ wrapper is more work than just
     // manually filtering fs::list_dir here.
 
-    for library_search_path: istr in library_search_paths {
+    for library_search_path: str in library_search_paths {
         log #fmt["searching %s", library_search_path];
-        for path: istr in fs::list_dir(library_search_path) {
+        for path: str in fs::list_dir(library_search_path) {
             log #fmt["searching %s", path];
-            let f: istr = fs::basename(path);
-            if !(str::starts_with(f, prefix) && str::ends_with(f, suffix))
-               {
-                log #fmt["skipping %s, doesn't look like %s*%s",
-                         path,
-                         prefix,
+            let f: str = fs::basename(path);
+            if !(str::starts_with(f, prefix) && str::ends_with(f, suffix)) {
+                log #fmt["skipping %s, doesn't look like %s*%s", path, prefix,
                          suffix];
                 cont;
             }
             alt get_metadata_section(path) {
               option::some(cvec) {
                 if !metadata_matches(cvec, metas) {
-                    log #fmt["skipping %s, metadata doesn't match",
-                             path];
+                    log #fmt["skipping %s, metadata doesn't match", path];
                     cont;
                 }
-                log #fmt["found %s with matching metadata",
-                         path];
+                log #fmt["found %s with matching metadata", path];
                 ret some({ident: path, data: cvec});
               }
               _ { }
@@ -199,10 +184,11 @@ fn find_library_crate_aux(nn: &{prefix: istr, suffix: istr},
     ret none;
 }
 
-fn get_metadata_section(filename: &istr) -> option::t<@[u8]> {
-    let mb = str::as_buf(filename, { |buf|
-        llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf)
-    });
+fn get_metadata_section(filename: &str) -> option::t<@[u8]> {
+    let mb =
+        str::as_buf(filename, {|buf|
+            llvm::LLVMRustCreateMemoryBufferWithContentsOfFile(buf)
+        });
     if mb as int == 0 { ret option::none::<@[u8]>; }
     let of = mk_object_file(mb);
     let si = mk_section_iter(of.llof);
@@ -221,17 +207,14 @@ fn get_metadata_section(filename: &istr) -> option::t<@[u8]> {
 }
 
 fn load_library_crate(sess: &session::session, span: span, ident: &ast::ident,
-                      metas: &[@ast::meta_item],
-                      library_search_paths: &[istr])
-   -> {ident: istr, data: @[u8]} {
+                      metas: &[@ast::meta_item], library_search_paths: &[str])
+   -> {ident: str, data: @[u8]} {
 
 
     alt find_library_crate(sess, ident, metas, library_search_paths) {
       some(t) { ret t; }
       none. {
-        sess.span_fatal(span,
-                        #fmt["can't find crate for '%s'",
-                                   ident]);
+        sess.span_fatal(span, #fmt["can't find crate for '%s'", ident]);
       }
     }
 }
@@ -254,13 +237,11 @@ fn resolve_crate(e: env, ident: &ast::ident, metas: [@ast::meta_item],
         // Now resolve the crates referenced by this crate
         let cnum_map = resolve_crate_deps(e, cdata);
 
-        let cmeta = {name: ident,
-                     data: cdata, cnum_map: cnum_map};
+        let cmeta = {name: ident, data: cdata, cnum_map: cnum_map};
 
         let cstore = e.sess.get_cstore();
         cstore::set_crate_data(cstore, cnum, cmeta);
-        cstore::add_used_crate_file(cstore,
-                                    cfilename);
+        cstore::add_used_crate_file(cstore, cfilename);
         ret cnum;
     } else { ret e.crate_cache.get(ident); }
 }
@@ -285,9 +266,7 @@ fn resolve_crate_deps(e: env, cdata: &@[u8]) -> cstore::cnum_map {
             // This is a new one so we've got to load it
             // FIXME: Need better error reporting than just a bogus span
             let fake_span = ast_util::dummy_sp();
-            let local_cnum = resolve_crate(e,
-                                           cname,
-                                           [], fake_span);
+            let local_cnum = resolve_crate(e, cname, [], fake_span);
             cnum_map.insert(extrn_cnum, local_cnum);
         }
     }
diff --git a/src/comp/metadata/csearch.rs b/src/comp/metadata/csearch.rs
index a729c596375..d526ee05247 100644
--- a/src/comp/metadata/csearch.rs
+++ b/src/comp/metadata/csearch.rs
@@ -11,7 +11,7 @@ export lookup_defs;
 export get_tag_variants;
 export get_type;
 
-fn get_symbol(cstore: &cstore::cstore, def: ast::def_id) -> istr {
+fn get_symbol(cstore: &cstore::cstore, def: ast::def_id) -> str {
     let cdata = cstore::get_crate_data(cstore, def.crate).data;
     ret decoder::get_symbol(cdata, def.node);
 }
@@ -63,7 +63,7 @@ fn translate_def_id(sess: &session::session, searched_crate: ast::crate_num,
     let local_cnum =
         alt cmeta.cnum_map.find(ext_cnum) {
           option::some(n) { n }
-          option::none. { sess.bug(~"didn't find a crate in the cnum_map") }
+          option::none. { sess.bug("didn't find a crate in the cnum_map") }
         };
 
     ret {crate: local_cnum, node: node_id};
diff --git a/src/comp/metadata/cstore.rs b/src/comp/metadata/cstore.rs
index c5f161394bd..ed737e046ec 100644
--- a/src/comp/metadata/cstore.rs
+++ b/src/comp/metadata/cstore.rs
@@ -29,7 +29,7 @@ export get_use_stmt_cnum;
 // own crate numbers.
 type cnum_map = map::hashmap<ast::crate_num, ast::crate_num>;
 
-type crate_metadata = {name: istr, data: @[u8], cnum_map: cnum_map};
+type crate_metadata = {name: str, data: @[u8], cnum_map: cnum_map};
 
 // This is a bit of an experiment at encapsulating the data in cstore. By
 // keeping all the data in a non-exported tag variant, it's impossible for
@@ -41,9 +41,9 @@ tag cstore { private(cstore_private); }
 type cstore_private =
     @{metas: map::hashmap<ast::crate_num, crate_metadata>,
       use_crate_map: use_crate_map,
-      mutable used_crate_files: [istr],
-      mutable used_libraries: [istr],
-      mutable used_link_args: [istr]};
+      mutable used_crate_files: [str],
+      mutable used_libraries: [str],
+      mutable used_link_args: [str]};
 
 // Map from node_id's of local use statements to crate numbers
 type use_crate_map = map::hashmap<ast::node_id, ast::crate_num>;
@@ -82,18 +82,18 @@ iter iter_crate_data(cstore: &cstore) ->
     }
 }
 
-fn add_used_crate_file(cstore: &cstore, lib: &istr) {
+fn add_used_crate_file(cstore: &cstore, lib: &str) {
     if !vec::member(lib, p(cstore).used_crate_files) {
         p(cstore).used_crate_files += [lib];
     }
 }
 
-fn get_used_crate_files(cstore: &cstore) -> [istr] {
+fn get_used_crate_files(cstore: &cstore) -> [str] {
     ret p(cstore).used_crate_files;
 }
 
-fn add_used_library(cstore: &cstore, lib: &istr) -> bool {
-    if lib == ~"" { ret false; }
+fn add_used_library(cstore: &cstore, lib: &str) -> bool {
+    if lib == "" { ret false; }
 
     if vec::member(lib, p(cstore).used_libraries) { ret false; }
 
@@ -101,15 +101,15 @@ fn add_used_library(cstore: &cstore, lib: &istr) -> bool {
     ret true;
 }
 
-fn get_used_libraries(cstore: &cstore) -> [istr] {
+fn get_used_libraries(cstore: &cstore) -> [str] {
     ret p(cstore).used_libraries;
 }
 
-fn add_used_link_args(cstore: &cstore, args: &istr) {
+fn add_used_link_args(cstore: &cstore, args: &str) {
     p(cstore).used_link_args += str::split(args, ' ' as u8);
 }
 
-fn get_used_link_args(cstore: &cstore) -> [istr] {
+fn get_used_link_args(cstore: &cstore) -> [str] {
     ret p(cstore).used_link_args;
 }
 
diff --git a/src/comp/metadata/decoder.rs b/src/comp/metadata/decoder.rs
index e99e9d274da..7803e6922a1 100644
--- a/src/comp/metadata/decoder.rs
+++ b/src/comp/metadata/decoder.rs
@@ -83,7 +83,7 @@ fn item_family(item: &ebml::doc) -> u8 {
     ret ebml::doc_as_uint(fam) as u8;
 }
 
-fn item_symbol(item: &ebml::doc) -> istr {
+fn item_symbol(item: &ebml::doc) -> str {
     let sym = ebml::get_doc(item, tag_items_data_item_symbol);
     ret str::unsafe_from_bytes(ebml::doc_data(sym));
 }
@@ -96,7 +96,7 @@ fn variant_tag_id(d: &ebml::doc) -> ast::def_id {
 fn item_type(item: &ebml::doc, this_cnum: ast::crate_num, tcx: ty::ctxt,
              extres: &external_resolver) -> ty::t {
     fn parse_external_def_id(this_cnum: ast::crate_num,
-                             extres: &external_resolver, s: &istr) ->
+                             extres: &external_resolver, s: &str) ->
        ast::def_id {
         let buf = str::bytes(s);
         let external_def_id = parse_def_id(buf);
@@ -149,16 +149,15 @@ fn tag_variant_ids(item: &ebml::doc, this_cnum: ast::crate_num) ->
 // Given a path and serialized crate metadata, returns the ID of the
 // definition the path refers to.
 fn resolve_path(path: &[ast::ident], data: @[u8]) -> [ast::def_id] {
-    fn eq_item(data: &[u8], s: &istr) -> bool {
+    fn eq_item(data: &[u8], s: &str) -> bool {
         ret str::eq(str::unsafe_from_bytes(data), s);
     }
-    let s = str::connect(path, ~"::");
+    let s = str::connect(path, "::");
     let md = ebml::new_doc(data);
     let paths = ebml::get_doc(md, tag_paths);
     let eqer = bind eq_item(_, s);
     let result: [ast::def_id] = [];
-    for doc: ebml::doc in lookup_hash(paths, eqer,
-                                      hash_path(s)) {
+    for doc: ebml::doc in lookup_hash(paths, eqer, hash_path(s)) {
         let did_doc = ebml::get_doc(doc, tag_def_id);
         result += [parse_def_id(ebml::doc_data(did_doc))];
     }
@@ -222,7 +221,7 @@ fn get_type_param_kinds(data: @[u8], id: ast::node_id) -> [ast::kind] {
     ret item_ty_param_kinds(lookup_item(id, data));
 }
 
-fn get_symbol(data: @[u8], id: ast::node_id) -> istr {
+fn get_symbol(data: @[u8], id: ast::node_id) -> str {
     ret item_symbol(lookup_item(id, data));
 }
 
@@ -268,7 +267,7 @@ fn family_has_type_params(fam_ch: u8) -> bool {
         };
 }
 
-fn read_path(d: &ebml::doc) -> {path: istr, pos: uint} {
+fn read_path(d: &ebml::doc) -> {path: str, pos: uint} {
     let desc = ebml::doc_data(d);
     let pos = ebml::be_uint_from_bytes(@desc, 0u, 4u);
     let pathbytes = vec::slice::<u8>(desc, 4u, vec::len::<u8>(desc));
@@ -276,23 +275,23 @@ fn read_path(d: &ebml::doc) -> {path: istr, pos: uint} {
     ret {path: path, pos: pos};
 }
 
-fn describe_def(items: &ebml::doc, id: ast::def_id) -> istr {
-    if id.crate != ast::local_crate { ret ~"external"; }
+fn describe_def(items: &ebml::doc, id: ast::def_id) -> str {
+    if id.crate != ast::local_crate { ret "external"; }
     ret item_family_to_str(item_family(find_item(id.node, items)));
 }
 
-fn item_family_to_str(fam: u8) -> istr {
+fn item_family_to_str(fam: u8) -> str {
     alt fam as char {
-      'c' { ret ~"const"; }
-      'f' { ret ~"fn"; }
-      'p' { ret ~"pure fn"; }
-      'F' { ret ~"native fn"; }
-      'y' { ret ~"type"; }
-      'T' { ret ~"native type"; }
-      't' { ret ~"type"; }
-      'm' { ret ~"mod"; }
-      'n' { ret ~"native mod"; }
-      'v' { ret ~"tag"; }
+      'c' { ret "const"; }
+      'f' { ret "fn"; }
+      'p' { ret "pure fn"; }
+      'F' { ret "native fn"; }
+      'y' { ret "type"; }
+      'T' { ret "native type"; }
+      't' { ret "type"; }
+      'm' { ret "mod"; }
+      'n' { ret "native mod"; }
+      'v' { ret "tag"; }
     }
 }
 
@@ -347,29 +346,25 @@ fn get_attributes(md: &ebml::doc) -> [ast::attribute] {
 
 fn list_meta_items(meta_items: &ebml::doc, out: io::writer) {
     for mi: @ast::meta_item in get_meta_items(meta_items) {
-        out.write_str(
-                #fmt["%s\n",
-                     pprust::meta_item_to_str(*mi)]);
+        out.write_str(#fmt["%s\n", pprust::meta_item_to_str(*mi)]);
     }
 }
 
 fn list_crate_attributes(md: &ebml::doc, out: io::writer) {
-    out.write_str(~"=Crate Attributes=\n");
+    out.write_str("=Crate Attributes=\n");
 
     for attr: ast::attribute in get_attributes(md) {
-        out.write_str(
-                #fmt["%s\n",
-                     pprust::attribute_to_str(attr)]);
+        out.write_str(#fmt["%s\n", pprust::attribute_to_str(attr)]);
     }
 
-    out.write_str(~"\n\n");
+    out.write_str("\n\n");
 }
 
 fn get_crate_attributes(data: @[u8]) -> [ast::attribute] {
     ret get_attributes(ebml::new_doc(data));
 }
 
-type crate_dep = {cnum: ast::crate_num, ident: istr};
+type crate_dep = {cnum: ast::crate_num, ident: str};
 
 fn get_crate_deps(data: @[u8]) -> [crate_dep] {
     let deps: [crate_dep] = [];
@@ -385,19 +380,17 @@ fn get_crate_deps(data: @[u8]) -> [crate_dep] {
 }
 
 fn list_crate_deps(data: @[u8], out: io::writer) {
-    out.write_str(~"=External Dependencies=\n");
+    out.write_str("=External Dependencies=\n");
 
     for dep: crate_dep in get_crate_deps(data) {
-        out.write_str(
-            #fmt["%d %s\n", dep.cnum,
-                                 dep.ident]);
+        out.write_str(#fmt["%d %s\n", dep.cnum, dep.ident]);
     }
 
-    out.write_str(~"\n");
+    out.write_str("\n");
 }
 
 fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) {
-    out.write_str(~"=Items=\n");
+    out.write_str("=Items=\n");
     let paths = ebml::get_doc(md, tag_paths);
     let items = ebml::get_doc(md, tag_items);
     let index = ebml::get_doc(paths, tag_index);
@@ -410,13 +403,11 @@ fn list_crate_items(bytes: &@[u8], md: &ebml::doc, out: io::writer) {
             let def = ebml::doc_at(bytes, data.pos);
             let did_doc = ebml::get_doc(def, tag_def_id);
             let did = parse_def_id(ebml::doc_data(did_doc));
-            out.write_str(
-                    #fmt["%s (%s)\n",
-                         data.path,
-                         describe_def(items, did)]);
+            out.write_str(#fmt["%s (%s)\n", data.path,
+                               describe_def(items, did)]);
         }
     }
-    out.write_str(~"\n");
+    out.write_str("\n");
 }
 
 fn list_crate_metadata(bytes: &@[u8], out: io::writer) {
diff --git a/src/comp/metadata/encoder.rs b/src/comp/metadata/encoder.rs
index e1a9e54a6c5..342ddcc887d 100644
--- a/src/comp/metadata/encoder.rs
+++ b/src/comp/metadata/encoder.rs
@@ -26,7 +26,7 @@ type abbrev_map = map::hashmap<ty::t, tyencode::ty_abbrev>;
 type encode_ctxt = {ccx: @crate_ctxt, type_abbrevs: abbrev_map};
 
 // Path table encoding
-fn encode_name(ebml_w: &ebml::writer, name: &istr) {
+fn encode_name(ebml_w: &ebml::writer, name: &str) {
     ebml::start_tag(ebml_w, tag_paths_data_name);
     ebml_w.writer.write(str::bytes(name));
     ebml::end_tag(ebml_w);
@@ -41,7 +41,7 @@ fn encode_def_id(ebml_w: &ebml::writer, id: &def_id) {
 type entry<T> = {val: T, pos: uint};
 
 fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant],
-                            path: &[istr], index: &mutable [entry<istr>]) {
+                            path: &[str], index: &mutable [entry<str>]) {
     for variant: variant in variants {
         add_to_index(ebml_w, path, index, variant.node.name);
         ebml::start_tag(ebml_w, tag_paths_data_item);
@@ -51,16 +51,16 @@ fn encode_tag_variant_paths(ebml_w: &ebml::writer, variants: &[variant],
     }
 }
 
-fn add_to_index(ebml_w: &ebml::writer, path: &[istr],
-                index: &mutable [entry<istr>], name: &istr) {
+fn add_to_index(ebml_w: &ebml::writer, path: &[str],
+                index: &mutable [entry<str>], name: &str) {
     let full_path = path + [name];
     index +=
-        [{val: str::connect(full_path, ~"::"), pos: ebml_w.writer.tell()}];
+        [{val: str::connect(full_path, "::"), pos: ebml_w.writer.tell()}];
 }
 
 fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod,
-                                   path: &[istr],
-                                   index: &mutable [entry<istr>]) {
+                                   path: &[str],
+                                   index: &mutable [entry<str>]) {
     for nitem: @native_item in nmod.items {
         add_to_index(ebml_w, path, index, nitem.ident);
         ebml::start_tag(ebml_w, tag_paths_data_item);
@@ -71,7 +71,7 @@ fn encode_native_module_item_paths(ebml_w: &ebml::writer, nmod: &native_mod,
 }
 
 fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
-                            path: &[istr], index: &mutable [entry<istr>]) {
+                            path: &[str], index: &mutable [entry<str>]) {
     for it: @item in module.items {
         if !ast_util::is_exported(it.ident, module) { cont; }
         alt it.node {
@@ -94,9 +94,7 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
             ebml::start_tag(ebml_w, tag_paths_data_mod);
             encode_name(ebml_w, it.ident);
             encode_def_id(ebml_w, local_def(it.id));
-            encode_module_item_paths(ebml_w, _mod,
-                                     path + [it.ident],
-                                     index);
+            encode_module_item_paths(ebml_w, _mod, path + [it.ident], index);
             ebml::end_tag(ebml_w);
           }
           item_native_mod(nmod) {
@@ -104,10 +102,8 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
             ebml::start_tag(ebml_w, tag_paths_data_mod);
             encode_name(ebml_w, it.ident);
             encode_def_id(ebml_w, local_def(it.id));
-            encode_native_module_item_paths(
-                ebml_w, nmod,
-                path + [it.ident],
-                index);
+            encode_native_module_item_paths(ebml_w, nmod, path + [it.ident],
+                                            index);
             ebml::end_tag(ebml_w);
           }
           item_ty(_, tps) {
@@ -153,9 +149,9 @@ fn encode_module_item_paths(ebml_w: &ebml::writer, module: &_mod,
     }
 }
 
-fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<istr>] {
-    let index: [entry<istr>] = [];
-    let path: [istr] = [];
+fn encode_item_paths(ebml_w: &ebml::writer, crate: &@crate) -> [entry<str>] {
+    let index: [entry<str>] = [];
+    let path: [str] = [];
     ebml::start_tag(ebml_w, tag_paths);
     encode_module_item_paths(ebml_w, crate.node.module, path, index);
     ebml::end_tag(ebml_w);
@@ -176,9 +172,7 @@ fn encode_inlineness(ebml_w: &ebml::writer, c: u8) {
     ebml::end_tag(ebml_w);
 }
 
-fn def_to_str(did: &def_id) -> istr {
-    ret #fmt["%d:%d", did.crate, did.node];
-}
+fn def_to_str(did: &def_id) -> str { ret #fmt["%d:%d", did.crate, did.node]; }
 
 fn encode_type_param_kinds(ebml_w: &ebml::writer, tps: &[ty_param]) {
     ebml::start_tag(ebml_w, tag_items_data_item_ty_param_kinds);
@@ -441,9 +435,7 @@ fn encode_index<T>(ebml_w: &ebml::writer, buckets: &[@[entry<T>]],
     ebml::end_tag(ebml_w);
 }
 
-fn write_str(writer: &io::writer, s: &istr) {
-    writer.write_str(s);
-}
+fn write_str(writer: &io::writer, s: &str) { writer.write_str(s); }
 
 fn write_int(writer: &io::writer, n: &int) {
     writer.write_be_uint(n as uint, 4u);
@@ -505,24 +497,22 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] {
     fn synthesize_link_attr(ecx: &@encode_ctxt, items: &[@meta_item]) ->
        attribute {
 
-        assert (ecx.ccx.link_meta.name != ~"");
-        assert (ecx.ccx.link_meta.vers != ~"");
+        assert (ecx.ccx.link_meta.name != "");
+        assert (ecx.ccx.link_meta.vers != "");
 
         let name_item =
-            attr::mk_name_value_item_str(
-                ~"name", ecx.ccx.link_meta.name);
+            attr::mk_name_value_item_str("name", ecx.ccx.link_meta.name);
         let vers_item =
-            attr::mk_name_value_item_str(
-                ~"vers", ecx.ccx.link_meta.vers);
+            attr::mk_name_value_item_str("vers", ecx.ccx.link_meta.vers);
 
         let other_items =
             {
-                let tmp = attr::remove_meta_items_by_name(items, ~"name");
-                attr::remove_meta_items_by_name(tmp, ~"vers")
+                let tmp = attr::remove_meta_items_by_name(items, "name");
+                attr::remove_meta_items_by_name(tmp, "vers")
             };
 
         let meta_items = [name_item, vers_item] + other_items;
-        let link_item = attr::mk_list_item(~"link", meta_items);
+        let link_item = attr::mk_list_item("link", meta_items);
 
         ret attr::mk_attr(link_item);
     }
@@ -531,7 +521,7 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] {
     let found_link_attr = false;
     for attr: attribute in crate.node.attrs {
         attrs +=
-            if attr::get_attr_name(attr) != ~"link" {
+            if attr::get_attr_name(attr) != "link" {
                 [attr]
             } else {
                 alt attr.node.value.node {
@@ -551,9 +541,9 @@ fn synthesize_crate_attrs(ecx: &@encode_ctxt, crate: &@crate) -> [attribute] {
 
 fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) {
 
-    fn get_ordered_names(cstore: &cstore::cstore) -> [istr] {
+    fn get_ordered_names(cstore: &cstore::cstore) -> [str] {
         type hashkv = @{key: crate_num, val: cstore::crate_metadata};
-        type numname = {crate: crate_num, ident: istr};
+        type numname = {crate: crate_num, ident: str};
 
         // Pull the cnums and names out of cstore
         let pairs: [mutable numname] = [mutable];
@@ -575,7 +565,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) {
         }
 
         // Return just the names
-        fn name(kv: &numname) -> istr { kv.ident }
+        fn name(kv: &numname) -> str { kv.ident }
         // mutable -> immutable hack for vec::map
         let immpairs = vec::slice(pairs, 0u, vec::len(pairs));
         ret vec::map(name, immpairs);
@@ -586,7 +576,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) {
     // FIXME: This is not nearly enough to support correct versioning
     // but is enough to get transitive crate dependencies working.
     ebml::start_tag(ebml_w, tag_crate_deps);
-    for cname: istr in get_ordered_names(cstore) {
+    for cname: str in get_ordered_names(cstore) {
         ebml::start_tag(ebml_w, tag_crate_dep);
         ebml_w.writer.write(str::bytes(cname));
         ebml::end_tag(ebml_w);
@@ -594,7 +584,7 @@ fn encode_crate_deps(ebml_w: &ebml::writer, cstore: &cstore::cstore) {
     ebml::end_tag(ebml_w);
 }
 
-fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> istr {
+fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> str {
 
     let abbrevs = map::mk_hashmap(ty::hash_ty, ty::eq_ty);
     let ecx = @{ccx: cx, type_abbrevs: abbrevs};
@@ -630,7 +620,7 @@ fn encode_metadata(cx: &@crate_ctxt, crate: &@crate) -> istr {
 }
 
 // Get the encoded string for a type
-fn encoded_ty(tcx: &ty::ctxt, t: ty::t) -> istr {
+fn encoded_ty(tcx: &ty::ctxt, t: ty::t) -> str {
     let cx = @{ds: def_to_str, tcx: tcx, abbrevs: tyencode::ac_no_abbrevs};
     let sw = io::string_writer();
     tyencode::enc_ty(sw.get_writer(), cx, t);
diff --git a/src/comp/metadata/tydecode.rs b/src/comp/metadata/tydecode.rs
index c72bc020288..1adbc2d47a2 100644
--- a/src/comp/metadata/tydecode.rs
+++ b/src/comp/metadata/tydecode.rs
@@ -20,7 +20,7 @@ export parse_ty_data;
 // data buffer. Whatever format you choose should not contain pipe characters.
 
 // Callback to translate defs to strs or back:
-type str_def = fn(&istr) -> ast::def_id;
+type str_def = fn(&str) -> ast::def_id;
 
 type pstate =
     {data: @[u8], crate: int, mutable pos: uint, len: uint, tcx: ty::ctxt};
@@ -42,7 +42,7 @@ fn parse_ident(st: @pstate, sd: str_def, last: char) -> ast::ident {
 
 fn parse_ident_(st: @pstate, _sd: str_def, is_last: fn(char) -> bool) ->
    ast::ident {
-    let rslt = ~"";
+    let rslt = "";
     while !is_last(peek(st) as char) {
         rslt += str::unsafe_from_byte(next(st));
     }
@@ -224,7 +224,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
         assert (next(st) as char == '[');
         let fields: [ty::field] = [];
         while peek(st) as char != ']' {
-            let name = ~"";
+            let name = "";
             while peek(st) as char != '=' {
                 name += str::unsafe_from_byte(next(st));
             }
@@ -277,7 +277,7 @@ fn parse_ty(st: @pstate, sd: str_def) -> ty::t {
               'W' { proto = ast::proto_iter; }
               'F' { proto = ast::proto_fn; }
             }
-            let name = ~"";
+            let name = "";
             while peek(st) as char != '[' {
                 name += str::unsafe_from_byte(next(st));
             }
@@ -342,10 +342,8 @@ fn parse_mt(st: @pstate, sd: str_def) -> ty::mt {
 }
 
 fn parse_def(st: @pstate, sd: str_def) -> ast::def_id {
-    let def = ~"";
-    while peek(st) as char != '|' {
-        def += str::unsafe_from_byte(next(st));
-    }
+    let def = "";
+    while peek(st) as char != '|' { def += str::unsafe_from_byte(next(st)); }
     st.pos = st.pos + 1u;
     ret sd(def);
 }
diff --git a/src/comp/metadata/tyencode.rs b/src/comp/metadata/tyencode.rs
index 46015f72cf8..1688b8b7d12 100644
--- a/src/comp/metadata/tyencode.rs
+++ b/src/comp/metadata/tyencode.rs
@@ -19,14 +19,14 @@ export ac_use_abbrevs;
 export enc_ty;
 
 type ctxt =
-     // Def -> str Callback:
-     // The type context.
-     {ds: fn(&def_id) -> istr, tcx: ty::ctxt, abbrevs: abbrev_ctxt};
+    // Def -> str Callback:
+    // The type context.
+    {ds: fn(&def_id) -> str, tcx: ty::ctxt, abbrevs: abbrev_ctxt};
 
 // Compact string representation for ty.t values. API ty_str & parse_from_str.
 // Extra parameters are for converting to/from def_ids in the string rep.
 // Whatever format you choose should not contain pipe characters.
-type ty_abbrev = {pos: uint, len: uint, s: @istr};
+type ty_abbrev = {pos: uint, len: uint, s: @str};
 
 tag abbrev_ctxt { ac_no_abbrevs; ac_use_abbrevs(hashmap<ty::t, ty_abbrev>); }
 
@@ -40,7 +40,7 @@ fn cx_uses_abbrevs(cx: &@ctxt) -> bool {
 fn enc_ty(w: &io::writer, cx: &@ctxt, t: ty::t) {
     alt cx.abbrevs {
       ac_no_abbrevs. {
-        let result_str: @istr;
+        let result_str: @str;
         alt cx.tcx.short_names_cache.find(t) {
           some(s) { result_str = s; }
           none. {
@@ -71,8 +71,8 @@ fn enc_ty(w: &io::writer, cx: &@ctxt, t: ty::t) {
                 // I.e. it's actually an abbreviation.
 
                 let s =
-                    ~"#" + uint::to_str(pos, 16u) + ~":" +
-                    uint::to_str(len, 16u) + ~"#";
+                    "#" + uint::to_str(pos, 16u) + ":" +
+                        uint::to_str(len, 16u) + "#";
                 let a = {pos: pos, len: len, s: @s};
                 abbrevs.insert(t, a);
             }
@@ -100,29 +100,29 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
       ty::ty_float. { w.write_char('l'); }
       ty::ty_machine(mach) {
         alt mach {
-          ty_u8. { w.write_str(~"Mb"); }
-          ty_u16. { w.write_str(~"Mw"); }
-          ty_u32. { w.write_str(~"Ml"); }
-          ty_u64. { w.write_str(~"Md"); }
-          ty_i8. { w.write_str(~"MB"); }
-          ty_i16. { w.write_str(~"MW"); }
-          ty_i32. { w.write_str(~"ML"); }
-          ty_i64. { w.write_str(~"MD"); }
-          ty_f32. { w.write_str(~"Mf"); }
-          ty_f64. { w.write_str(~"MF"); }
+          ty_u8. { w.write_str("Mb"); }
+          ty_u16. { w.write_str("Mw"); }
+          ty_u32. { w.write_str("Ml"); }
+          ty_u64. { w.write_str("Md"); }
+          ty_i8. { w.write_str("MB"); }
+          ty_i16. { w.write_str("MW"); }
+          ty_i32. { w.write_str("ML"); }
+          ty_i64. { w.write_str("MD"); }
+          ty_f32. { w.write_str("Mf"); }
+          ty_f64. { w.write_str("MF"); }
         }
       }
       ty::ty_char. { w.write_char('c'); }
       ty::ty_istr. { w.write_char('S'); }
       ty::ty_tag(def, tys) {
-        w.write_str(~"t[");
+        w.write_str("t[");
         w.write_str(cx.ds(def));
         w.write_char('|');
         for t: ty::t in tys { enc_ty(w, cx, t); }
         w.write_char(']');
       }
       ty::ty_tup(ts) {
-        w.write_str(~"T[");
+        w.write_str("T[");
         for t in ts { enc_ty(w, cx, t); }
         w.write_char(']');
       }
@@ -131,7 +131,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
       ty::ty_ptr(mt) { w.write_char('*'); enc_mt(w, cx, mt); }
       ty::ty_vec(mt) { w.write_char('I'); enc_mt(w, cx, mt); }
       ty::ty_rec(fields) {
-        w.write_str(~"R[");
+        w.write_str("R[");
         for field: ty::field in fields {
             w.write_str(field.ident);
             w.write_char('=');
@@ -155,7 +155,7 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
         enc_ty_fn(w, cx, args, out, return, []);
       }
       ty::ty_obj(methods) {
-        w.write_str(~"O[");
+        w.write_str("O[");
         for m: ty::method in methods {
             enc_proto(w, m.proto);
             w.write_str(m.ident);
@@ -164,17 +164,14 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
         w.write_char(']');
       }
       ty::ty_res(def, ty, tps) {
-        w.write_str(~"r[");
+        w.write_str("r[");
         w.write_str(cx.ds(def));
         w.write_char('|');
         enc_ty(w, cx, ty);
         for t: ty::t in tps { enc_ty(w, cx, t); }
         w.write_char(']');
       }
-      ty::ty_var(id) {
-        w.write_char('X');
-        w.write_str(int::str(id));
-      }
+      ty::ty_var(id) { w.write_char('X'); w.write_str(int::str(id)); }
       ty::ty_native(def) {
         w.write_char('E');
         w.write_str(cx.ds(def));
@@ -182,15 +179,15 @@ fn enc_sty(w: &io::writer, cx: &@ctxt, st: &ty::sty) {
       }
       ty::ty_param(id, k) {
         alt k {
-          kind_unique. { w.write_str(~"pu"); }
-          kind_shared. { w.write_str(~"ps"); }
-          kind_pinned. { w.write_str(~"pp"); }
+          kind_unique. { w.write_str("pu"); }
+          kind_shared. { w.write_str("ps"); }
+          kind_pinned. { w.write_str("pp"); }
         }
         w.write_str(uint::str(id));
       }
       ty::ty_type. { w.write_char('Y'); }
       ty::ty_constr(ty, cs) {
-        w.write_str(~"A[");
+        w.write_str("A[");
         enc_ty(w, cx, ty);
         for tc: @ty::type_constr in cs { enc_ty_constr(w, cx, tc); }
         w.write_char(']');
@@ -244,9 +241,7 @@ fn enc_constr(w: &io::writer, cx: &@ctxt, c: &@ty::constr) {
         alt a.node {
           carg_base. { w.write_char('*'); }
           carg_ident(i) { w.write_uint(i); }
-          carg_lit(l) {
-            w.write_str(lit_to_str(l));
-          }
+          carg_lit(l) { w.write_str(lit_to_str(l)); }
         }
     }
     w.write_char(')');
@@ -262,10 +257,8 @@ fn enc_ty_constr(w: &io::writer, cx: &@ctxt, c: &@ty::type_constr) {
         if semi { w.write_char(';'); } else { semi = true; }
         alt a.node {
           carg_base. { w.write_char('*'); }
-          carg_ident(p) {
-            w.write_str(path_to_str(p)); }
-          carg_lit(l) {
-            w.write_str(lit_to_str(l)); }
+          carg_ident(p) { w.write_str(path_to_str(p)); }
+          carg_lit(l) { w.write_str(lit_to_str(l)); }
         }
     }
     w.write_char(')');
diff --git a/src/comp/middle/alias.rs b/src/comp/middle/alias.rs
index e957bb7163d..f191a7bc9db 100644
--- a/src/comp/middle/alias.rs
+++ b/src/comp/middle/alias.rs
@@ -32,37 +32,45 @@ type restrict =
 
 type scope = @[restrict];
 
-tag local_info {
-    local(uint);
-}
+tag local_info { local(uint); }
 
-type ctx = {tcx: ty::ctxt,
-            local_map: std::map::hashmap<node_id, local_info>,
-            mutable next_local: uint};
+type ctx =
+    {tcx: ty::ctxt,
+     local_map: std::map::hashmap<node_id, local_info>,
+     mutable next_local: uint};
 
 fn check_crate(tcx: ty::ctxt, crate: &@ast::crate) {
     // Stores information about object fields and function
     // arguments that's otherwise not easily available.
-    let cx = @{tcx: tcx,
-               local_map: std::map::new_int_hash(),
-               mutable next_local: 0u};
-    let v = @{visit_fn: visit_fn,
-              visit_expr: bind visit_expr(cx, _, _, _),
-              visit_decl: bind visit_decl(cx, _, _, _)
-              with *visit::default_visitor::<scope>()};
+    let cx =
+        @{tcx: tcx,
+          local_map: std::map::new_int_hash(),
+          mutable next_local: 0u};
+    let v =
+        @{visit_fn: visit_fn,
+          visit_expr: bind visit_expr(cx, _, _, _),
+          visit_decl: bind visit_decl(cx, _, _, _)
+             with *visit::default_visitor::<scope>()};
     visit::visit_crate(*crate, @[], visit::mk_vt(v));
     tcx.sess.abort_if_errors();
 }
 
-fn visit_fn(f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span,
-            _name: &fn_ident, _id: ast::node_id, sc: &scope, v: &vt<scope>) {
+fn visit_fn(f: &ast::_fn, _tp: &[ast::ty_param], _sp: &span, _name: &fn_ident,
+            _id: ast::node_id, sc: &scope, v: &vt<scope>) {
     visit::visit_fn_decl(f.decl, sc, v);
-    let scope = alt f.proto {
-      // Blocks need to obey any restrictions from the enclosing scope.
-      ast::proto_block. | ast::proto_closure. { sc }
-      // Non capturing functions start out fresh.
-      _ { @[] }
-    };
+    let scope =
+        alt f.proto {
+
+          // Blocks need to obey any restrictions from the enclosing scope.
+          ast::proto_block. | ast::proto_closure. {
+            sc
+          }
+
+          // Non capturing functions start out fresh.
+          _ {
+            @[]
+          }
+        };
     v.visit_block(f.body, scope, v);
 }
 
@@ -80,8 +88,8 @@ fn visit_expr(cx: &@ctx, ex: &@ast::expr, sc: &scope, v: &vt<scope>) {
             let root = expr_root(cx.tcx, ex, false);
             if mut_field(root.ds) {
                 cx.tcx.sess.span_err(ex.span,
-                                     ~"result of put must be" +
-                                         ~" immutably rooted");
+                                     "result of put must be" +
+                                         " immutably rooted");
             }
             visit_expr(cx, ex, sc, v);
           }
@@ -140,8 +148,8 @@ fn visit_decl(cx: &@ctx, d: &@ast::decl, sc: &scope, v: &vt<scope>) {
     }
 }
 
-fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope)
-    -> [restrict] {
+fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope) ->
+   [restrict] {
     let fty = ty::type_autoderef(cx.tcx, ty::expr_ty(cx.tcx, f));
     let arg_ts = ty::ty_fn_args(cx.tcx, fty);
     let mut_roots: [{arg: uint, node: node_id}] = [];
@@ -157,27 +165,27 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope)
                     let dnum = ast_util::def_id_of_def(def).node;
                     mut_roots += [{arg: i, node: dnum}];
                   }
-                  _ {}
+                  _ { }
                 }
             }
             let root_var = path_def_id(cx, root.ex);
-            let unsafe_t = alt inner_mut(root.ds) {
-              some(t) { some(t) }
-              _ { none }
-            };
-            restricts += [@{root_var: root_var,
-                            local_id: cx.next_local,
-                            bindings: [arg.id],
-                            unsafe_ty: unsafe_t,
-                            depends_on: deps(sc, root_var),
-                            mutable ok: valid}];
+            let unsafe_t =
+                alt inner_mut(root.ds) { some(t) { some(t) } _ { none } };
+            restricts +=
+                [@{root_var: root_var,
+                   local_id: cx.next_local,
+                   bindings: [arg.id],
+                   unsafe_ty: unsafe_t,
+                   depends_on: deps(sc, root_var),
+                   mutable ok: valid}];
         }
         i += 1u;
     }
-    let f_may_close = alt f.node {
-      ast::expr_path(_) { def_is_local(cx.tcx.def_map.get(f.id), true) }
-      _ { true }
-    };
+    let f_may_close =
+        alt f.node {
+          ast::expr_path(_) { def_is_local(cx.tcx.def_map.get(f.id), true) }
+          _ { true }
+        };
     if f_may_close {
         let i = 0u;
         for r in restricts {
@@ -185,37 +193,39 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope)
                 cx.tcx.sess.span_err(f.span,
                                      #fmt["function may alias with argument \
                                            %u, which is not immutably rooted",
-                                           i]);
+                                          i]);
             }
             i += 1u;
         }
     }
     let j = 0u;
-    for @{unsafe_ty, _} in restricts {
+    for @{unsafe_ty: unsafe_ty, _} in restricts {
         alt unsafe_ty {
           some(ty) {
             let i = 0u;
             for arg_t: ty::arg in arg_ts {
                 let mut_alias = arg_t.mode == ty::mo_alias(true);
                 if i != j &&
-                   ty_can_unsafely_include(cx, ty, arg_t.ty, mut_alias) {
-                    cx.tcx.sess.span_err(args[i].span,
+                       ty_can_unsafely_include(cx, ty, arg_t.ty, mut_alias) {
+                    cx.tcx.sess.span_err(
+                        args[i].span,
                         #fmt["argument %u may alias with argument %u, \
-                               which is not immutably rooted", i, j]);
+                               which is not immutably rooted",
+                                              i, j]);
                 }
                 i += 1u;
             }
           }
-          _ {}
+          _ { }
         }
         j += 1u;
     }
     // Ensure we're not passing a root by mutable alias.
 
-    for {node, arg} in mut_roots {
+    for {node: node, arg: arg} in mut_roots {
         let mut_alias_to_root = false;
         let mut_alias_to_root_count = 0u;
-        for @{root_var, _} in restricts {
+        for @{root_var: root_var, _} in restricts {
             alt root_var {
               some(root) {
                 if node == root {
@@ -226,13 +236,13 @@ fn check_call(cx: &ctx, f: &@ast::expr, args: &[@ast::expr], sc: &scope)
                     }
                 }
               }
-              none. {}
+              none. { }
             }
         }
 
         if mut_alias_to_root {
             cx.tcx.sess.span_err(args[arg].span,
-                                 ~"passing a mutable alias to a variable \
+                                 "passing a mutable alias to a variable \
                                    that roots another alias");
         }
     }
@@ -248,12 +258,14 @@ fn check_alt(cx: &ctx, input: &@ast::expr, arms: &[ast::arm], sc: &scope,
         let new_sc = sc;
         if vec::len(dnums) > 0u {
             let root_var = path_def_id(cx, root.ex);
-            new_sc = @(*sc + [@{root_var: root_var,
-                                local_id: cx.next_local,
-                                bindings: dnums,
-                                unsafe_ty: inner_mut(root.ds),
-                                depends_on: deps(sc, root_var),
-                                mutable ok: valid}]);
+            new_sc =
+                @(*sc +
+                      [@{root_var: root_var,
+                         local_id: cx.next_local,
+                         bindings: dnums,
+                         unsafe_ty: inner_mut(root.ds),
+                         depends_on: deps(sc, root_var),
+                         mutable ok: valid}]);
         }
         register_locals(cx, a.pats[0]);
         visit::visit_arm(a, new_sc, v);
@@ -284,8 +296,9 @@ fn check_for(cx: &ctx, local: &@ast::local, seq: &@ast::expr, blk: &ast::blk,
       ty::ty_vec(mt) { if mt.mut != ast::imm { unsafe = some(seq_t); } }
       ty::ty_istr. {/* no-op */ }
       _ {
-        cx.tcx.sess.span_unimpl(seq.span, ~"unknown seq type " +
-                                util::ppaux::ty_to_str(cx.tcx, seq_t));
+        cx.tcx.sess.span_unimpl(seq.span,
+                                "unknown seq type " +
+                                    util::ppaux::ty_to_str(cx.tcx, seq_t));
       }
     }
     let root_var = path_def_id(cx, root.ex);
@@ -305,12 +318,11 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id,
     let def = cx.tcx.def_map.get(id);
     if !def_is_local(def, true) { ret; }
     let my_defnum = ast_util::def_id_of_def(def).node;
-    let my_local_id = alt cx.local_map.find(my_defnum) {
-      some(local(id)) { id }
-      _ { 0u }
-    };
+    let my_local_id =
+        alt cx.local_map.find(my_defnum) { some(local(id)) { id } _ { 0u } };
     let var_t = ty::expr_ty(cx.tcx, ex);
     for r: restrict in *sc {
+
         // excludes variables introduced since the alias was made
         if my_local_id < r.local_id {
             alt r.unsafe_ty {
@@ -319,7 +331,7 @@ fn check_var(cx: &ctx, ex: &@ast::expr, p: &ast::path, id: ast::node_id,
                     r.ok = val_taken(ex.span, p);
                 }
               }
-              _ {}
+              _ { }
             }
         } else if vec::member(my_defnum, r.bindings) {
             test_scope(cx, sc, r, p);
@@ -333,9 +345,7 @@ fn check_lval(cx: &@ctx, dest: &@ast::expr, sc: &scope, v: &vt<scope>) {
         let def = cx.tcx.def_map.get(dest.id);
         let dnum = ast_util::def_id_of_def(def).node;
         for r: restrict in *sc {
-            if r.root_var == some(dnum) {
-                r.ok = overwritten(dest.span, p);
-            }
+            if r.root_var == some(dnum) { r.ok = overwritten(dest.span, p); }
         }
       }
       _ { visit_expr(cx, dest, sc, v); }
@@ -358,19 +368,17 @@ fn test_scope(cx: &ctx, sc: &scope, r: &restrict, p: &ast::path) {
         let msg =
             alt prob {
               overwritten(sp, wpt) {
-                {span: sp, msg: ~"overwriting " +
-                    ast_util::path_name(wpt)}
+                {span: sp, msg: "overwriting " + ast_util::path_name(wpt)}
               }
               val_taken(sp, vpt) {
                 {span: sp,
-                 msg: ~"taking the value of " +
-                     ast_util::path_name(vpt)}
+                 msg: "taking the value of " + ast_util::path_name(vpt)}
               }
             };
         cx.tcx.sess.span_err(msg.span,
-                             msg.msg + ~" will invalidate alias " +
-                             ast_util::path_name(p) +
-                             ~", which is still used");
+                             msg.msg + " will invalidate alias " +
+                                 ast_util::path_name(p) +
+                                 ", which is still used");
     }
 }
 
@@ -384,7 +392,7 @@ fn deps(sc: &scope, root: &option::t<node_id>) -> [uint] {
             i += 1u;
         }
       }
-      _ {}
+      _ { }
     }
     ret result;
 }
@@ -438,6 +446,7 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t,
           }
 
 
+
           // These may contain anything.
           ty::ty_fn(_, _, _, _, _) {
             ret true;
@@ -445,6 +454,7 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t,
           ty::ty_obj(_) { ret true; }
 
 
+
           // A type param may include everything, but can only be
           // treated as opaque downstream, and is thus safe unless we
           // saw mutable fields, in which case the whole thing can be
@@ -460,11 +470,13 @@ fn ty_can_unsafely_include(cx: &ctx, needle: ty::t, haystack: ty::t,
 
 fn def_is_local(d: &ast::def, objfields_count: bool) -> bool {
     ret alt d {
-      ast::def_local(_) | ast::def_arg(_, _) | ast::def_binding(_) |
-      ast::def_upvar(_, _, _) { true }
-      ast::def_obj_field(_, _) { objfields_count }
-      _ { false }
-    };
+          ast::def_local(_) | ast::def_arg(_, _) | ast::def_binding(_) |
+          ast::def_upvar(_, _, _) {
+            true
+          }
+          ast::def_obj_field(_, _) { objfields_count }
+          _ { false }
+        };
 }
 
 // Local Variables:
diff --git a/src/comp/middle/ast_map.rs b/src/comp/middle/ast_map.rs
index a0b1a96e3d6..356d2b46b8c 100644
--- a/src/comp/middle/ast_map.rs
+++ b/src/comp/middle/ast_map.rs
@@ -131,7 +131,7 @@ mod test {
     fn test_node_span_item() {
         let expected: codemap::span = ast_util::mk_sp(20u, 30u);
         let node =
-            node_item(@{ident: ~"test",
+            node_item(@{ident: "test",
                         attrs: [],
                         id: 0,
                         node: item_mod({view_items: [], items: []}),
@@ -143,7 +143,7 @@ mod test {
     fn test_node_span_obj_ctor() {
         let expected: codemap::span = ast_util::mk_sp(20u, 30u);
         let node =
-            node_obj_ctor(@{ident: ~"test",
+            node_obj_ctor(@{ident: "test",
                             attrs: [],
                             id: 0,
                             node: item_mod({view_items: [], items: []}),
@@ -155,7 +155,7 @@ mod test {
     fn test_node_span_native_item() {
         let expected: codemap::span = ast_util::mk_sp(20u, 30u);
         let node =
-            node_native_item(@{ident: ~"test",
+            node_native_item(@{ident: "test",
                                attrs: [],
                                node: native_item_ty,
                                id: 0,
diff --git a/src/comp/middle/check_alt.rs b/src/comp/middle/check_alt.rs
index a764388fdf7..ce5e937cf69 100644
--- a/src/comp/middle/check_alt.rs
+++ b/src/comp/middle/check_alt.rs
@@ -34,7 +34,7 @@ fn check_arms(tcx: &ty::ctxt, arms: &[arm]) {
                 j += 1;
             }
             if !reachable {
-                tcx.sess.span_err(arm_pat.span, ~"unreachable pattern");
+                tcx.sess.span_err(arm_pat.span, "unreachable pattern");
             }
         }
         i += 1;
@@ -106,7 +106,7 @@ fn check_local(tcx: &ty::ctxt, loc: &@local, s: &(), v: &visit::vt<()>) {
     visit::visit_local(loc, s, v);
     if is_refutable(tcx, loc.node.pat) {
         tcx.sess.span_err(loc.node.pat.span,
-                          ~"refutable pattern in local binding");
+                          "refutable pattern in local binding");
     }
 }
 
diff --git a/src/comp/middle/freevars.rs b/src/comp/middle/freevars.rs
index 706e814a01c..50d4d1c062b 100644
--- a/src/comp/middle/freevars.rs
+++ b/src/comp/middle/freevars.rs
@@ -29,53 +29,50 @@ type freevar_map = hashmap<ast::node_id, freevar_info>;
 // Since we want to be able to collect upvars in some arbitrary piece
 // of the AST, we take a walker function that we invoke with a visitor
 // in order to start the search.
-fn collect_freevars(def_map: &resolve::def_map,
-                    walker: &fn(&visit::vt<int>)) -> freevar_info {
+fn collect_freevars(def_map: &resolve::def_map, walker: &fn(&visit::vt<int>))
+   -> freevar_info {
     let seen = new_int_hash();
     let refs = @mutable [];
 
-    fn ignore_item(_i: &@ast::item, _depth: &int, _v: &visit::vt<int>) {}
+    fn ignore_item(_i: &@ast::item, _depth: &int, _v: &visit::vt<int>) { }
 
-    let walk_expr = lambda(expr: &@ast::expr, depth: &int,
-                           v: &visit::vt<int>) {
-        alt expr.node {
-          ast::expr_fn(f) {
-            if f.proto == ast::proto_block ||
-               f.proto == ast::proto_closure {
-                visit::visit_expr(expr, depth + 1, v);
-            }
-          }
-          ast::expr_for_each(dcl, x, b) {
-            v.visit_local(dcl, depth, v);
-            v.visit_expr(x, depth, v);
-            v.visit_block(b, depth + 1, v);
-          }
-          ast::expr_path(path) {
-            let def = def_map.get(expr.id), i = 0;
-            while i < depth {
-                alt {def} {
-                  ast::def_upvar(_, inner, _) {
-                    def = *inner;
-                  }
-                  _ { break; }
+    let walk_expr =
+        lambda (expr: &@ast::expr, depth: &int, v: &visit::vt<int>) {
+            alt expr.node {
+              ast::expr_fn(f) {
+                if f.proto == ast::proto_block ||
+                       f.proto == ast::proto_closure {
+                    visit::visit_expr(expr, depth + 1, v);
                 }
-                i += 1;
-            }
-            if i == depth { // Made it to end of loop
-                let dnum = ast_util::def_id_of_def(def).node;
-                if !seen.contains_key(dnum) {
-                    *refs += [def];
-                    seen.insert(dnum, ());
+              }
+              ast::expr_for_each(dcl, x, b) {
+                v.visit_local(dcl, depth, v);
+                v.visit_expr(x, depth, v);
+                v.visit_block(b, depth + 1, v);
+              }
+              ast::expr_path(path) {
+                let def = def_map.get(expr.id), i = 0;
+                while i < depth {
+                    alt { def } {
+                      ast::def_upvar(_, inner, _) { def = *inner; }
+                      _ { break; }
+                    }
+                    i += 1;
                 }
+                if i == depth { // Made it to end of loop
+                    let dnum = ast_util::def_id_of_def(def).node;
+                    if !seen.contains_key(dnum) {
+                        *refs += [def];
+                        seen.insert(dnum, ());
+                    }
+                }
+              }
+              _ { visit::visit_expr(expr, depth, v); }
             }
-          }
-          _ { visit::visit_expr(expr, depth, v); }
-        }
-    };
+        };
 
-    walker(visit::mk_vt(@{visit_item: ignore_item,
-                          visit_expr: walk_expr
-                          with *visit::default_visitor()}));
+    walker(visit::mk_vt(@{visit_item: ignore_item, visit_expr: walk_expr
+                             with *visit::default_visitor()}));
     ret @*refs;
 }
 
@@ -84,30 +81,34 @@ fn collect_freevars(def_map: &resolve::def_map,
 // efficient as it fully recomputes the free variables at every
 // node of interest rather than building up the free variables in
 // one pass. This could be improved upon if it turns out to matter.
-fn annotate_freevars(def_map: &resolve::def_map,
-                     crate: &@ast::crate) -> freevar_map {
+fn annotate_freevars(def_map: &resolve::def_map, crate: &@ast::crate) ->
+   freevar_map {
     let freevars = new_int_hash();
 
-    let walk_fn = lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span,
-                          i: &ast::fn_ident, nid: ast::node_id) {
-        let start_walk = lambda (v: &visit::vt<int>) {
-            v.visit_fn(f, tps, sp, i, nid, 1, v);
-        };
-        let vars = collect_freevars(def_map, start_walk);
-        freevars.insert(nid, vars);
-    };
-    let walk_expr = lambda (expr: &@ast::expr) {
-        alt expr.node {
-          ast::expr_for_each(local, _, body) {
-            let start_walk = lambda (v: &visit::vt<int>) {
-                v.visit_block(body, 1, v);
-            };
+    let walk_fn =
+        lambda (f: &ast::_fn, tps: &[ast::ty_param], sp: &span,
+                i: &ast::fn_ident, nid: ast::node_id) {
+            let start_walk =
+                lambda (v: &visit::vt<int>) {
+                    v.visit_fn(f, tps, sp, i, nid, 1, v);
+                };
             let vars = collect_freevars(def_map, start_walk);
-            freevars.insert(body.node.id, vars);
-          }
-          _ { }
-        }
-    };
+            freevars.insert(nid, vars);
+        };
+    let walk_expr =
+        lambda (expr: &@ast::expr) {
+            alt expr.node {
+              ast::expr_for_each(local, _, body) {
+                let start_walk =
+                    lambda (v: &visit::vt<int>) {
+                        v.visit_block(body, 1, v);
+                    };
+                let vars = collect_freevars(def_map, start_walk);
+                freevars.insert(body.node.id, vars);
+              }
+              _ { }
+            }
+        };
 
     let visitor =
         visit::mk_simple_visitor(@{visit_fn: walk_fn, visit_expr: walk_expr
@@ -119,10 +120,7 @@ fn annotate_freevars(def_map: &resolve::def_map,
 
 fn get_freevars(tcx: &ty::ctxt, fid: ast::node_id) -> freevar_info {
     alt tcx.freevars.find(fid) {
-      none. {
-        fail ~"get_freevars: " + int::str(fid)
-            + ~" has no freevars";
-      }
+      none. { fail "get_freevars: " + int::str(fid) + " has no freevars"; }
       some(d) { ret d; }
     }
 }
diff --git a/src/comp/middle/gc.rs b/src/comp/middle/gc.rs
index f0e366f0e9e..e25f952a6c8 100644
--- a/src/comp/middle/gc.rs
+++ b/src/comp/middle/gc.rs
@@ -4,7 +4,7 @@ import lib::llvm::False;
 import lib::llvm::True;
 import lib::llvm::llvm::ValueRef;
 import middle::trans;
-import middle::trans::{ get_tydesc, tps_normal };
+import middle::trans::{get_tydesc, tps_normal};
 import middle::trans_common::*;
 import middle::ty;
 import std::option::none;
@@ -21,10 +21,12 @@ type ctxt = @{mutable next_tydesc_num: uint};
 
 fn mk_ctxt() -> ctxt { ret @{mutable next_tydesc_num: 0u}; }
 
-fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: &istr) -> ValueRef {
-    let llglobal = str::as_buf(name, { |buf|
-        lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf)
-    });
+fn add_global(ccx: &@crate_ctxt, llval: ValueRef, name: &str) -> ValueRef {
+    let llglobal =
+        str::as_buf(name,
+                    {|buf|
+                        lll::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf)
+                    });
     lll::LLVMSetInitializer(llglobal, llval);
     lll::LLVMSetGlobalConstant(llglobal, True);
     ret llglobal;
@@ -48,7 +50,7 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt {
     bcx = td_r.result.bcx;
     let lltydesc = td_r.result.val;
 
-    let gcroot = bcx_ccx(bcx).intrinsics.get(~"llvm.gcroot");
+    let gcroot = bcx_ccx(bcx).intrinsics.get("llvm.gcroot");
     let llvalptr = bld::PointerCast(bcx, llval, T_ptr(T_ptr(T_i8())));
 
     alt td_r.kind {
@@ -65,30 +67,31 @@ fn add_gc_root(cx: &@block_ctxt, llval: ValueRef, ty: ty::t) -> @block_ctxt {
 
         let lldestindex =
             add_global(bcx_ccx(bcx), C_struct([C_int(0), C_uint(number)]),
-                       ~"rust_gc_tydesc_dest_index");
+                       "rust_gc_tydesc_dest_index");
         let llsrcindex =
             add_global(bcx_ccx(bcx), C_struct([C_int(1), C_uint(number)]),
-                       ~"rust_gc_tydesc_src_index");
+                       "rust_gc_tydesc_src_index");
 
         lldestindex = lll::LLVMConstPointerCast(lldestindex, T_ptr(T_i8()));
         llsrcindex = lll::LLVMConstPointerCast(llsrcindex, T_ptr(T_i8()));
 
-        lltydescptr = bld::PointerCast(llderivedtydescs, lltydescptr,
-                                       T_ptr(T_ptr(T_i8())));
+        lltydescptr =
+            bld::PointerCast(llderivedtydescs, lltydescptr,
+                             T_ptr(T_ptr(T_i8())));
 
         bld::Call(llderivedtydescs, gcroot, [lltydescptr, lldestindex]);
         bld::Call(bcx, gcroot, [llvalptr, llsrcindex]);
       }
       tk_param. {
-        bcx_tcx(cx).sess.bug(~"we should never be trying to root values " +
-                                 ~"of a type parameter");
+        bcx_tcx(cx).sess.bug("we should never be trying to root values " +
+                                 "of a type parameter");
       }
       tk_static. {
         // Static type descriptor.
 
         let llstaticgcmeta =
             add_global(bcx_ccx(bcx), C_struct([C_int(2), lltydesc]),
-                       ~"rust_gc_tydesc_static_gc_meta");
+                       "rust_gc_tydesc_static_gc_meta");
         let llstaticgcmetaptr =
             lll::LLVMConstPointerCast(llstaticgcmeta, T_ptr(T_i8()));
 
@@ -109,6 +112,7 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool {
       }
 
 
+
       ty::ty_rec(fields) {
         for f in fields { if type_is_gc_relevant(cx, f.mt.ty) { ret true; } }
         ret false;
@@ -119,6 +123,7 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool {
       }
 
 
+
       ty::ty_tag(did, tps) {
         let variants = ty::tag_variants(cx, did);
         for variant in variants {
@@ -131,19 +136,22 @@ fn type_is_gc_relevant(cx: &ty::ctxt, ty: ty::t) -> bool {
       }
 
 
+
       ty::ty_vec(tm) {
         ret type_is_gc_relevant(cx, tm.ty);
       }
       ty::ty_constr(sub, _) { ret type_is_gc_relevant(cx, sub); }
 
 
-      ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _)
-      | ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) |
+
+      ty::ty_box(_) | ty::ty_uniq(_) | ty::ty_fn(_, _, _, _, _) |
+      ty::ty_native_fn(_, _, _) | ty::ty_obj(_) | ty::ty_param(_, _) |
       ty::ty_res(_, _, _) {
         ret true;
       }
 
 
+
       ty::ty_var(_) {
         fail "ty_var in type_is_gc_relevant";
       }
diff --git a/src/comp/middle/kind.rs b/src/comp/middle/kind.rs
index 744d328f0f7..052eccb304d 100644
--- a/src/comp/middle/kind.rs
+++ b/src/comp/middle/kind.rs
@@ -96,11 +96,11 @@ fn lower_kind(a: kind, b: kind) -> kind {
     if kind_lteq(a, b) { a } else { b }
 }
 
-fn kind_to_str(k: kind) -> istr {
+fn kind_to_str(k: kind) -> str {
     alt k {
-      ast::kind_pinned. { ~"pinned" }
-      ast::kind_unique. { ~"unique" }
-      ast::kind_shared. { ~"shared" }
+      ast::kind_pinned. { "pinned" }
+      ast::kind_unique. { "unique" }
+      ast::kind_shared. { "shared" }
     }
 }
 
@@ -112,7 +112,7 @@ fn type_and_kind(tcx: &ty::ctxt, e: &@ast::expr) ->
 }
 
 fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind,
-                  descr: &istr) {
+                  descr: &str) {
     let tk = type_and_kind(tcx, e);
     log #fmt["for %s: want %s type, got %s type %s", descr,
              kind_to_str(k_need), kind_to_str(tk.kind),
@@ -121,36 +121,35 @@ fn need_expr_kind(tcx: &ty::ctxt, e: &@ast::expr, k_need: ast::kind,
     if !kind_lteq(k_need, tk.kind) {
         let s =
             #fmt["mismatched kinds for %s: needed %s type, got %s type %s",
-                 descr, kind_to_str(k_need),
-                 kind_to_str(tk.kind),
+                 descr, kind_to_str(k_need), kind_to_str(tk.kind),
                  util::ppaux::ty_to_str(tcx, tk.ty)];
         tcx.sess.span_err(e.span, s);
     }
 }
 
 fn need_shared_lhs_rhs(tcx: &ty::ctxt, a: &@ast::expr, b: &@ast::expr,
-                       op: &istr) {
-    need_expr_kind(tcx, a, ast::kind_shared, op + ~" lhs");
-    need_expr_kind(tcx, b, ast::kind_shared, op + ~" rhs");
+                       op: &str) {
+    need_expr_kind(tcx, a, ast::kind_shared, op + " lhs");
+    need_expr_kind(tcx, b, ast::kind_shared, op + " rhs");
 }
 
 fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) {
     alt e.node {
-      ast::expr_move(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"<-"); }
-      ast::expr_assign(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"="); }
-      ast::expr_assign_op(_, a, b) { need_shared_lhs_rhs(tcx, a, b, ~"op="); }
-      ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, ~"<->"); }
+      ast::expr_move(a, b) { need_shared_lhs_rhs(tcx, a, b, "<-"); }
+      ast::expr_assign(a, b) { need_shared_lhs_rhs(tcx, a, b, "="); }
+      ast::expr_assign_op(_, a, b) { need_shared_lhs_rhs(tcx, a, b, "op="); }
+      ast::expr_swap(a, b) { need_shared_lhs_rhs(tcx, a, b, "<->"); }
       ast::expr_copy(a) {
-        need_expr_kind(tcx, a, ast::kind_shared, ~"'copy' operand");
+        need_expr_kind(tcx, a, ast::kind_shared, "'copy' operand");
       }
       ast::expr_ret(option::some(a)) {
-        need_expr_kind(tcx, a, ast::kind_shared, ~"'ret' operand");
+        need_expr_kind(tcx, a, ast::kind_shared, "'ret' operand");
       }
       ast::expr_be(a) {
-        need_expr_kind(tcx, a, ast::kind_shared, ~"'be' operand");
+        need_expr_kind(tcx, a, ast::kind_shared, "'be' operand");
       }
       ast::expr_fail(option::some(a)) {
-        need_expr_kind(tcx, a, ast::kind_shared, ~"'fail' operand");
+        need_expr_kind(tcx, a, ast::kind_shared, "'fail' operand");
       }
       ast::expr_call(callee, _) {
         let tpt = ty::expr_ty_params_and_ty(tcx, callee);
@@ -159,8 +158,8 @@ fn check_expr(tcx: &ty::ctxt, e: &@ast::expr) {
         // that all the types we're supplying as typarams conform to the
         // typaram kind constraints on that item.
         if vec::len(tpt.params) != 0u {
-            let callee_def = ast_util::def_id_of_def(
-                tcx.def_map.get(callee.id));
+            let callee_def =
+                ast_util::def_id_of_def(tcx.def_map.get(callee.id));
             let item_tk = ty::lookup_item_type(tcx, callee_def);
             let i = 0;
             assert (vec::len(item_tk.kinds) == vec::len(tpt.params));
diff --git a/src/comp/middle/mut.rs b/src/comp/middle/mut.rs
index bf54a5d01d6..1721a6e130f 100644
--- a/src/comp/middle/mut.rs
+++ b/src/comp/middle/mut.rs
@@ -12,8 +12,8 @@ type deref = @{mut: bool, kind: deref_t, outer_t: ty::t};
 // vec of dereferences that were used on this root. Note that, in this vec,
 // the inner derefs come in front, so foo.bar[1] becomes rec(ex=foo,
 // ds=[index,field])
-fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool)
-    -> {ex: @expr, ds: @[deref]} {
+fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool) ->
+   {ex: @expr, ds: @[deref]} {
     fn maybe_auto_unbox(tcx: &ty::ctxt, t: ty::t) -> {t: ty::t, ds: [deref]} {
         let ds = [];
         while true {
@@ -32,13 +32,11 @@ fn expr_root(tcx: &ty::ctxt, ex: @expr, autoderef: bool)
               ty::ty_tag(did, tps) {
                 let variants = ty::tag_variants(tcx, did);
                 if vec::len(variants) != 1u ||
-                   vec::len(variants[0].args) != 1u {
+                       vec::len(variants[0].args) != 1u {
                     break;
                 }
                 ds += [@{mut: false, kind: unbox, outer_t: t}];
-                t =
-                    ty::substitute_type_params(tcx, tps,
-                                               variants[0].args[0]);
+                t = ty::substitute_type_params(tcx, tps, variants[0].args[0]);
               }
               _ { break; }
             }
@@ -121,21 +119,25 @@ type ctx = {tcx: ty::ctxt, mut_map: mut_map};
 
 fn check_crate(tcx: ty::ctxt, crate: &@crate) -> mut_map {
     let cx = @{tcx: tcx, mut_map: std::map::new_int_hash()};
-    let v = @{visit_expr: bind visit_expr(cx, _, _, _),
-              visit_decl: bind visit_decl(cx, _, _, _)
-              with *visit::default_visitor::<()>()};
+    let v =
+        @{visit_expr: bind visit_expr(cx, _, _, _),
+          visit_decl: bind visit_decl(cx, _, _, _)
+             with *visit::default_visitor::<()>()};
     visit::visit_crate(*crate, (), visit::mk_vt(v));
     ret cx.mut_map;
 }
 
 tag msg { msg_assign; msg_move_out; msg_mut_alias; }
 
-fn mk_err(cx: &@ctx, span: &syntax::codemap::span, msg: msg, name: &istr) {
-    cx.tcx.sess.span_err(span, alt msg {
-      msg_assign. { ~"assigning to " + name }
-      msg_move_out. { ~"moving out of " + name }
-      msg_mut_alias. { ~"passing " + name + ~" by mutable alias" }
-    });
+fn mk_err(cx: &@ctx, span: &syntax::codemap::span, msg: msg, name: &str) {
+    cx.tcx.sess.span_err(span,
+                         alt msg {
+                           msg_assign. { "assigning to " + name }
+                           msg_move_out. { "moving out of " + name }
+                           msg_mut_alias. {
+                             "passing " + name + " by mutable alias"
+                           }
+                         });
 }
 
 fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) {
@@ -145,9 +147,7 @@ fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) {
         for loc: @local in locs {
             alt loc.node.init {
               some(init) {
-                if init.op == init_move {
-                    check_move_rhs(cx, init.expr);
-                }
+                if init.op == init_move { check_move_rhs(cx, init.expr); }
               }
               none. { }
             }
@@ -159,9 +159,7 @@ fn visit_decl(cx: &@ctx, d: &@decl, e: &(), v: &visit::vt<()>) {
 
 fn visit_expr(cx: &@ctx, ex: &@expr, e: &(), v: &visit::vt<()>) {
     alt ex.node {
-      expr_call(f, args) {
-        check_call(cx, f, args);
-      }
+      expr_call(f, args) { check_call(cx, f, args); }
       expr_swap(lhs, rhs) {
         check_lval(cx, lhs, msg_assign);
         check_lval(cx, rhs, msg_assign);
@@ -173,7 +171,7 @@ fn visit_expr(cx: &@ctx, ex: &@expr, e: &(), v: &visit::vt<()>) {
       expr_assign(dest, src) | expr_assign_op(_, dest, src) {
         check_lval(cx, dest, msg_assign);
       }
-      _ {}
+      _ { }
     }
     visit::visit_expr(ex, e, v);
 }
@@ -184,20 +182,21 @@ fn check_lval(cx: &@ctx, dest: &@expr, msg: msg) {
         let def = cx.tcx.def_map.get(dest.id);
         alt is_immutable_def(def) {
           some(name) { mk_err(cx, dest.span, msg, name); }
-          _ {}
+          _ { }
         }
         cx.mut_map.insert(ast_util::def_id_of_def(def).node, ());
       }
       _ {
         let root = expr_root(cx.tcx, dest, false);
         if vec::len(*root.ds) == 0u {
-            mk_err(cx, dest.span, msg, ~"non-lvalue");
+            mk_err(cx, dest.span, msg, "non-lvalue");
         } else if !root.ds[0].mut {
-            let name = alt root.ds[0].kind {
-              mut::unbox. { ~"immutable box" }
-              mut::field. { ~"immutable field" }
-              mut::index. { ~"immutable vec content" }
-            };
+            let name =
+                alt root.ds[0].kind {
+                  mut::unbox. { "immutable box" }
+                  mut::field. { "immutable field" }
+                  mut::index. { "immutable vec content" }
+                };
             mk_err(cx, dest.span, msg, name);
         }
       }
@@ -209,7 +208,7 @@ fn check_move_rhs(cx: &@ctx, src: &@expr) {
       expr_path(p) {
         alt cx.tcx.def_map.get(src.id) {
           def_obj_field(_, _) {
-            mk_err(cx, src.span, msg_move_out, ~"object field");
+            mk_err(cx, src.span, msg_move_out, "object field");
           }
           _ { }
         }
@@ -217,17 +216,19 @@ fn check_move_rhs(cx: &@ctx, src: &@expr) {
       }
       _ {
         let root = expr_root(cx.tcx, src, false);
+
         // Not a path and no-derefs means this is a temporary.
         if vec::len(*root.ds) != 0u {
-            cx.tcx.sess.span_err(src.span, ~"moving out of a data structure");
+            cx.tcx.sess.span_err(src.span, "moving out of a data structure");
         }
       }
     }
 }
 
 fn check_call(cx: &@ctx, f: &@expr, args: &[@expr]) {
-    let arg_ts = ty::ty_fn_args(cx.tcx, ty::type_autoderef
-                                (cx.tcx, ty::expr_ty(cx.tcx, f)));
+    let arg_ts =
+        ty::ty_fn_args(cx.tcx,
+                       ty::type_autoderef(cx.tcx, ty::expr_ty(cx.tcx, f)));
     let i = 0u;
     for arg_t: ty::arg in arg_ts {
         if arg_t.mode == ty::mo_alias(true) {
@@ -237,17 +238,18 @@ fn check_call(cx: &@ctx, f: &@expr, args: &[@expr]) {
     }
 }
 
-fn is_immutable_def(def: &def) -> option::t<istr> {
+fn is_immutable_def(def: &def) -> option::t<str> {
     alt def {
       def_fn(_, _) | def_mod(_) | def_native_mod(_) | def_const(_) |
-      def_use(_) { some(~"static item") }
-      def_obj_field(_, imm.) { some(~"immutable object field") }
-      def_arg(_, alias(false)) { some(~"immutable alias") }
+      def_use(_) {
+        some("static item")
+      }
+      def_obj_field(_, imm.) { some("immutable object field") }
+      def_arg(_, alias(false)) { some("immutable alias") }
       def_upvar(_, inner, mut) {
-        if !mut { some(~"upvar") }
-        else { is_immutable_def(*inner) }
+        if !mut { some("upvar") } else { is_immutable_def(*inner) }
       }
-      def_binding(_) { some(~"binding") }
+      def_binding(_) { some("binding") }
       _ { none }
     }
 }
diff --git a/src/comp/middle/resolve.rs b/src/comp/middle/resolve.rs
index 3fcf6bde032..a08458f910d 100644
--- a/src/comp/middle/resolve.rs
+++ b/src/comp/middle/resolve.rs
@@ -74,10 +74,10 @@ tag import_state {
              option::t<def>); /* module */
 }
 
-type ext_hash = hashmap<{did: def_id, ident: istr, ns: namespace}, def>;
+type ext_hash = hashmap<{did: def_id, ident: str, ns: namespace}, def>;
 
 fn new_ext_hash() -> ext_hash {
-    type key = {did: def_id, ident: istr, ns: namespace};
+    type key = {did: def_id, ident: str, ns: namespace};
     fn hash(v: &key) -> uint {
         ret str::hash(v.ident) + util::common::hash_def(v.did) +
                 alt v.ns {
@@ -110,7 +110,7 @@ type indexed_mod =
     {m: option::t<ast::_mod>,
      index: mod_index,
      mutable glob_imports: [glob_imp_def],
-     glob_imported_names: hashmap<istr, import_state>};
+     glob_imported_names: hashmap<str, import_state>};
 
 
 /* native modules can't contain tags, and we don't store their ASTs because we
@@ -127,7 +127,7 @@ type env =
      mod_map: hashmap<ast::node_id, @indexed_mod>,
      ext_map: hashmap<def_id, [ident]>,
      ext_cache: ext_hash,
-     mutable reported: [{ident: istr, sc: scope}],
+     mutable reported: [{ident: str, sc: scope}],
      sess: session};
 
 
@@ -242,6 +242,7 @@ fn map_crate(e: &@env, c: &@ast::crate) {
         alt vi.node {
 
 
+
           //if it really is a glob import, that is
           ast::view_item_import_glob(path, _) {
             let imp = follow_import(*e, sc, path, vi.span);
@@ -323,8 +324,8 @@ fn resolve_names(e: &@env, c: &@ast::crate) {
               }
               _ {
                 e.sess.span_err(p.span,
-                                ~"not a tag variant: " +
-                                ast_util::path_name(p));
+                                "not a tag variant: " +
+                                    ast_util::path_name(p));
               }
             }
           }
@@ -430,8 +431,8 @@ fn follow_import(e: &env, sc: &scopes, path: &[ident], sp: &span) ->
           ast::def_mod(_) | ast::def_native_mod(_) { ret dcur; }
           _ {
             e.sess.span_err(sp,
-                            str::connect(path, ~"::") +
-                                ~" does not name a module.");
+                            str::connect(path, "::") +
+                                " does not name a module.");
             ret none;
           }
         }
@@ -448,8 +449,8 @@ fn resolve_constr(e: @env, c: &@ast::constr, sc: &scopes, _v: &vt<scopes>) {
           }
           _ {
             e.sess.span_err(c.span,
-                            ~"Non-predicate in constraint: " +
-                            path_to_str(c.node.path));
+                            "Non-predicate in constraint: " +
+                                path_to_str(c.node.path));
           }
         }
     }
@@ -475,8 +476,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
             alt lookup_in_scope(e, sc, sp, ids[0], ns_module) {
               some(dcur) { dcur }
               none. {
-                unresolved_err(e, sc, sp, ids[0],
-                               ns_name(ns_module));
+                unresolved_err(e, sc, sp, ids[0], ns_name(ns_module));
                 remove_if_unresolved(e.imports, defid.node);
                 ret ()
               }
@@ -498,8 +498,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
                         {
                       some(dcur) { dcur }
                       none. {
-                        unresolved_err(e, sc, sp, ids[i],
-                                       ns_name(ns_module));
+                        unresolved_err(e, sc, sp, ids[i], ns_name(ns_module));
                         remove_if_unresolved(e.imports, defid.node);
                         ret () // FIXME (issue #521)
                       }
@@ -512,7 +511,7 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
                 val: &option::t<def>, typ: &option::t<def>,
                 md: &option::t<def>) {
         if is_none(val) && is_none(typ) && is_none(md) {
-            unresolved_err(e, sc, sp, name, ~"import");
+            unresolved_err(e, sc, sp, name, "import");
         } else { e.imports.insert(defid.node, resolved(val, typ, md)); }
     }
     fn remove_if_unresolved(imports: hashmap<ast::node_id, import_state>,
@@ -532,16 +531,15 @@ fn resolve_import(e: &env, defid: ast::def_id, name: &ast::ident,
 
 
 // Utilities
-fn ns_name(ns: namespace) -> istr {
+fn ns_name(ns: namespace) -> str {
     alt ns {
-      ns_type. { ret ~"typename"; }
-      ns_value. { ret ~"name"; }
-      ns_module. { ret ~"modulename"; }
+      ns_type. { ret "typename"; }
+      ns_value. { ret "name"; }
+      ns_module. { ret "modulename"; }
     }
 }
 
-fn unresolved_err(e: &env, sc: &scopes, sp: &span,
-                  name: &ident, kind: &istr) {
+fn unresolved_err(e: &env, sc: &scopes, sp: &span, name: &ident, kind: &str) {
     fn find_fn_or_mod_scope(sc: scopes) -> scope {
         while true {
             alt sc {
@@ -559,19 +557,18 @@ fn unresolved_err(e: &env, sc: &scopes, sp: &span,
         fail;
     }
     let err_scope = find_fn_or_mod_scope(sc);
-    for rs: {ident: istr, sc: scope} in e.reported {
-        if str::eq(rs.ident, name)
-            && err_scope == rs.sc { ret; }
+    for rs: {ident: str, sc: scope} in e.reported {
+        if str::eq(rs.ident, name) && err_scope == rs.sc { ret; }
     }
     e.reported += [{ident: name, sc: err_scope}];
     e.sess.span_err(sp, mk_unresolved_msg(name, kind));
 }
 
-fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &istr) -> ! {
+fn unresolved_fatal(e: &env, sp: &span, id: &ident, kind: &str) -> ! {
     e.sess.span_fatal(sp, mk_unresolved_msg(id, kind));
 }
 
-fn mk_unresolved_msg(id: &ident, kind: &istr) -> istr {
+fn mk_unresolved_msg(id: &ident, kind: &str) -> str {
     ret #fmt["unresolved %s: %s", kind, id];
 }
 
@@ -603,8 +600,7 @@ fn lookup_path_strict(e: &env, sc: &scopes, sp: &span, pth: &ast::path_,
 fn lookup_in_scope_strict(e: &env, sc: scopes, sp: &span, name: &ident,
                           ns: namespace) -> option::t<def> {
     alt lookup_in_scope(e, sc, sp, name, ns) {
-      none. { unresolved_err(e, sc, sp, name,
-                             ns_name(ns)); ret none; }
+      none. { unresolved_err(e, sc, sp, name, ns_name(ns)); ret none; }
       some(d) { ret some(d); }
     }
 }
@@ -629,10 +625,12 @@ fn scope_closes(sc: &scope) -> option::t<bool> {
 
 fn def_is_local(d: &def) -> bool {
     ret alt d {
-      ast::def_arg(_, _) | ast::def_local(_) | ast::def_binding(_) |
-      ast::def_upvar(_, _, _) { true }
-      _ { false }
-    };
+          ast::def_arg(_, _) | ast::def_local(_) | ast::def_binding(_) |
+          ast::def_upvar(_, _, _) {
+            true
+          }
+          _ { false }
+        };
 }
 
 fn def_is_obj_field(d: &def) -> bool {
@@ -715,24 +713,23 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident,
             if !is_none(fnd) {
                 let df = option::get(fnd);
                 let local = def_is_local(df);
-                if left_fn && local ||
-                       left_fn_level2 && def_is_obj_field(df) ||
-                       scope_is_fn(hd) && left_fn && def_is_ty_arg(df) {
-                    let msg = alt ns {
-                      ns_type. {
-                        ~"Attempt to use a type argument out of scope"
-                      }
-                      _ {
-                        ~"attempted dynamic environment-capture"
-                      }
-                    };
+                if left_fn && local || left_fn_level2 && def_is_obj_field(df)
+                       || scope_is_fn(hd) && left_fn && def_is_ty_arg(df) {
+                    let msg =
+                        alt ns {
+                          ns_type. {
+                            "Attempt to use a type argument out of scope"
+                          }
+                          _ { "attempted dynamic environment-capture" }
+                        };
                     e.sess.span_fatal(sp, msg);
                 } else if local {
                     let i = vec::len(closing);
                     while i > 0u {
                         i -= 1u;
-                        df = ast::def_upvar(ast_util::def_id_of_def(df),
-                                            @df, closing[i]);
+                        df =
+                            ast::def_upvar(ast_util::def_id_of_def(df), @df,
+                                           closing[i]);
                         fnd = some(df);
                     }
                 }
@@ -742,16 +739,13 @@ fn lookup_in_scope(e: &env, sc: scopes, sp: &span, name: &ident,
                 left_fn_level2 = true;
             } else if ns == ns_value || ns == ns_type {
                 left_fn = scope_is_fn(hd);
-                alt scope_closes(hd) {
-                  some(mut) { closing += [mut]; }
-                  _ {}
-                }
+                alt scope_closes(hd) { some(mut) { closing += [mut]; } _ { } }
             }
             sc = *tl;
           }
         }
     }
-    e.sess.bug(~"reached unreachable code in lookup_in_scope"); // sigh
+    e.sess.bug("reached unreachable code in lookup_in_scope"); // sigh
 
 }
 
@@ -912,8 +906,7 @@ fn found_def_item(i: &@ast::item, ns: namespace) -> option::t<def> {
 fn lookup_in_mod_strict(e: &env, sc: &scopes, m: def, sp: &span, name: &ident,
                         ns: namespace, dr: dir) -> option::t<def> {
     alt lookup_in_mod(e, m, sp, name, ns, dr) {
-      none. { unresolved_err(e, sc, sp, name,
-                             ns_name(ns)); ret none; }
+      none. { unresolved_err(e, sc, sp, name, ns_name(ns)); ret none; }
       some(d) { ret some(d); }
     }
 }
@@ -924,15 +917,13 @@ fn lookup_in_mod(e: &env, m: &def, sp: &span, name: &ident, ns: namespace,
     if defid.crate != ast::local_crate {
         // examining a module in an external crate
 
-        let cached = e.ext_cache.find({did: defid,
-                                       ident: name, ns: ns});
+        let cached = e.ext_cache.find({did: defid, ident: name, ns: ns});
         if !is_none(cached) { ret cached; }
         let path = [name];
         if defid.node != -1 { path = e.ext_map.get(defid) + path; }
         let fnd = lookup_external(e, defid.crate, path, ns);
         if !is_none(fnd) {
-            e.ext_cache.insert({did: defid,
-                                ident: name, ns: ns},
+            e.ext_cache.insert({did: defid, ident: name, ns: ns},
                                option::get(fnd));
         }
         ret fnd;
@@ -962,7 +953,7 @@ fn lookup_import(e: &env, defid: def_id, ns: namespace) -> option::t<def> {
         resolve_import(e, local_def(node_id), name, path, span, scopes);
         ret lookup_import(e, defid, ns);
       }
-      resolving(sp) { e.sess.span_err(sp, ~"cyclic import"); ret none; }
+      resolving(sp) { e.sess.span_err(sp, "cyclic import"); ret none; }
       resolved(val, typ, md) {
         ret alt ns { ns_value. { val } ns_type. { typ } ns_module. { md } };
       }
@@ -1026,13 +1017,11 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident,
         } else {
             for match: glob_imp_def in matches {
                 let sp = match.item.span;
-                e.sess.span_note(
-                    sp, #fmt["'%s' is imported here", id]);
+                e.sess.span_note(sp, #fmt["'%s' is imported here", id]);
             }
             e.sess.span_fatal(sp,
-                              ~"'" + id
-                              + ~"' is glob-imported from" +
-                                  ~" multiple different modules.");
+                              "'" + id + "' is glob-imported from" +
+                                  " multiple different modules.");
         }
     }
     // since we don't know what names we have in advance,
@@ -1043,11 +1032,10 @@ fn lookup_glob_in_mod(e: &env, info: @indexed_mod, sp: &span, id: &ident,
         let val = per_ns(e, info, sp, id, ns_value, dr);
         let typ = per_ns(e, info, sp, id, ns_type, dr);
         let md = per_ns(e, info, sp, id, ns_module, dr);
-        info.glob_imported_names.insert(id,
-                                        resolved(val, typ, md));
+        info.glob_imported_names.insert(id, resolved(val, typ, md));
     }
     alt info.glob_imported_names.get(id) {
-      todo(_, _, _, _, _) { e.sess.bug(~"Shouldn't've put a todo in."); }
+      todo(_, _, _, _, _) { e.sess.bug("Shouldn't've put a todo in."); }
       resolving(sp) {
         ret none::<def>; //circularity is okay in import globs
 
@@ -1101,11 +1089,10 @@ fn lookup_in_mie(e: &env, mie: &mod_index_entry, ns: namespace) ->
 
 
 // Module indexing
-fn add_to_index(index: &hashmap<ident, list<mod_index_entry>>,
-                id: &ident, ent: &mod_index_entry) {
+fn add_to_index(index: &hashmap<ident, list<mod_index_entry>>, id: &ident,
+                ent: &mod_index_entry) {
     alt index.find(id) {
-      none. { index.insert(id,
-                           cons(ent, @nil::<mod_index_entry>)); }
+      none. { index.insert(id, cons(ent, @nil::<mod_index_entry>)); }
       some(prev) { index.insert(id, cons(ent, @prev)); }
     }
 }
@@ -1119,11 +1106,13 @@ fn index_mod(md: &ast::_mod) -> mod_index {
           }
 
 
+
           ast::view_item_import(ident, _, id) {
             add_to_index(index, ident, mie_import_ident(id, it.span));
           }
 
 
+
           ast::view_item_import_from(_, idents, _) {
             for ident in idents {
                 add_to_index(index, ident.node.name,
@@ -1132,6 +1121,7 @@ fn index_mod(md: &ast::_mod) -> mod_index {
           }
 
 
+
           //globbed imports have to be resolved lazily.
           ast::view_item_import_glob(_, _) | ast::view_item_export(_, _) {
           }
@@ -1238,26 +1228,25 @@ fn check_mod_name(e: &env, name: &ident, entries: list<mod_index_entry>) {
     let saw_mod = false;
     let saw_type = false;
     let saw_value = false;
-    fn dup(e: &env, sp: &span, word: &istr, name: &ident) {
-        e.sess.span_fatal(sp, ~"duplicate definition of " +
-                          word + name);
+    fn dup(e: &env, sp: &span, word: &str, name: &ident) {
+        e.sess.span_fatal(sp, "duplicate definition of " + word + name);
     }
     while true {
         alt entries {
           cons(entry, rest) {
             if !is_none(lookup_in_mie(e, entry, ns_value)) {
                 if saw_value {
-                    dup(e, mie_span(entry), ~"", name);
+                    dup(e, mie_span(entry), "", name);
                 } else { saw_value = true; }
             }
             if !is_none(lookup_in_mie(e, entry, ns_type)) {
                 if saw_type {
-                    dup(e, mie_span(entry), ~"type ", name);
+                    dup(e, mie_span(entry), "type ", name);
                 } else { saw_type = true; }
             }
             if !is_none(lookup_in_mie(e, entry, ns_module)) {
                 if saw_mod {
-                    dup(e, mie_span(entry), ~"module ", name);
+                    dup(e, mie_span(entry), "module ", name);
                 } else { saw_mod = true; }
             }
             entries = *rest;
@@ -1288,20 +1277,20 @@ fn check_item(e: &@env, i: &@ast::item, x: &(), v: &vt<()>) {
       ast::item_fn(f, ty_params) {
         check_fn(*e, i.span, f);
         ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
-                      ~"type parameter");
+                      "type parameter");
       }
       ast::item_obj(ob, ty_params, _) {
         fn field_name(field: &ast::obj_field) -> ident { ret field.ident; }
-        ensure_unique(*e, i.span, ob.fields, field_name, ~"object field");
+        ensure_unique(*e, i.span, ob.fields, field_name, "object field");
         for m: @ast::method in ob.methods {
             check_fn(*e, m.span, m.node.meth);
         }
         ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
-                      ~"type parameter");
+                      "type parameter");
       }
       ast::item_tag(_, ty_params) {
         ensure_unique(*e, i.span, typaram_names(ty_params), ident_id,
-                      ~"type parameter");
+                      "type parameter");
       }
       _ { }
     }
@@ -1316,28 +1305,28 @@ fn check_pat(ch: checker, p: &@ast::pat) {
 
 fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) {
     visit::visit_arm(a, x, v);
-    let ch0 = checker(*e, ~"binding");
+    let ch0 = checker(*e, "binding");
     check_pat(ch0, a.pats[0]);
     let seen0 = ch0.seen;
     let i = vec::len(a.pats);
     while i > 1u {
         i -= 1u;
-        let ch = checker(*e, ~"binding");
+        let ch = checker(*e, "binding");
         check_pat(ch, a.pats[i]);
 
         // Ensure the bindings introduced in this pattern are the same as in
         // the first pattern.
         if vec::len(ch.seen) != vec::len(seen0) {
             e.sess.span_err(a.pats[i].span,
-                            ~"inconsistent number of bindings");
+                            "inconsistent number of bindings");
         } else {
             for name: ident in ch.seen {
                 if is_none(vec::find(bind str::eq(name, _), seen0)) {
                     // Fight the alias checker
                     let name_ = name;
                     e.sess.span_err(a.pats[i].span,
-                                    ~"binding " + name_ +
-                                        ~" does not occur in first pattern");
+                                    "binding " + name_ +
+                                        " does not occur in first pattern");
                 }
             }
         }
@@ -1346,15 +1335,15 @@ fn check_arm(e: &@env, a: &ast::arm, x: &(), v: &vt<()>) {
 
 fn check_block(e: &@env, b: &ast::blk, x: &(), v: &vt<()>) {
     visit::visit_block(b, x, v);
-    let values = checker(*e, ~"value");
-    let types = checker(*e, ~"type");
-    let mods = checker(*e, ~"module");
+    let values = checker(*e, "value");
+    let types = checker(*e, "type");
+    let mods = checker(*e, "module");
     for st: @ast::stmt in b.node.stmts {
         alt st.node {
           ast::stmt_decl(d, _) {
             alt d.node {
               ast::decl_local(locs) {
-                let local_values = checker(*e, ~"value");
+                let local_values = checker(*e, "value");
                 for loc in locs {
                     for each p in ast_util::pat_bindings(loc.node.pat) {
                         let ident = alt p.node { pat_bind(n) { n } };
@@ -1394,14 +1383,14 @@ fn check_block(e: &@env, b: &ast::blk, x: &(), v: &vt<()>) {
 
 fn check_fn(e: &env, sp: &span, f: &ast::_fn) {
     fn arg_name(a: &ast::arg) -> ident { ret a.ident; }
-    ensure_unique(e, sp, f.decl.inputs, arg_name, ~"argument");
+    ensure_unique(e, sp, f.decl.inputs, arg_name, "argument");
 }
 
 fn check_expr(e: &@env, ex: &@ast::expr, x: &(), v: &vt<()>) {
     alt ex.node {
       ast::expr_rec(fields, _) {
         fn field_name(f: &ast::field) -> ident { ret f.node.ident; }
-        ensure_unique(*e, ex.span, fields, field_name, ~"field");
+        ensure_unique(*e, ex.span, fields, field_name, "field");
       }
       _ { }
     }
@@ -1412,16 +1401,16 @@ fn check_ty(e: &@env, ty: &@ast::ty, x: &(), v: &vt<()>) {
     alt ty.node {
       ast::ty_rec(fields) {
         fn field_name(f: &ast::ty_field) -> ident { ret f.node.ident; }
-        ensure_unique(*e, ty.span, fields, field_name, ~"field");
+        ensure_unique(*e, ty.span, fields, field_name, "field");
       }
       _ { }
     }
     visit::visit_ty(ty, x, v);
 }
 
-type checker = @{mutable seen: [ident], kind: istr, sess: session};
+type checker = @{mutable seen: [ident], kind: str, sess: session};
 
-fn checker(e: &env, kind: &istr) -> checker {
+fn checker(e: &env, kind: &str) -> checker {
     let seen: [ident] = [];
     ret @{mutable seen: seen, kind: kind, sess: e.sess};
 }
@@ -1429,8 +1418,7 @@ fn checker(e: &env, kind: &istr) -> checker {
 fn check_name(ch: &checker, sp: &span, name: &ident) {
     for s: ident in ch.seen {
         if str::eq(s, name) {
-            ch.sess.span_fatal(sp, ~"duplicate " + ch.kind
-                               + ~" name: " + name);
+            ch.sess.span_fatal(sp, "duplicate " + ch.kind + " name: " + name);
         }
     }
 }
@@ -1442,23 +1430,23 @@ fn add_name(ch: &checker, sp: &span, name: &ident) {
 fn ident_id(i: &ident) -> ident { ret i; }
 
 fn ensure_unique<T>(e: &env, sp: &span, elts: &[T], id: fn(&T) -> ident,
-                    kind: &istr) {
+                    kind: &str) {
     let ch = checker(e, kind);
     for elt: T in elts { add_name(ch, sp, id(elt)); }
 }
 
 fn check_bad_exports(e: &@env) {
-    fn lookup_glob_any(e: &env, info: &@indexed_mod, sp: &span,
-                       ident: &ident) -> bool {
-        ret !option::is_none(lookup_glob_in_mod(e, info, sp, ident,
-                                                ns_module, inside)) ||
-            !option::is_none(lookup_glob_in_mod(e, info, sp, ident,
-                                                ns_value, inside)) ||
-            !option::is_none(lookup_glob_in_mod(e, info, sp, ident,
-                                                ns_type, inside));
+    fn lookup_glob_any(e: &env, info: &@indexed_mod, sp: &span, ident: &ident)
+       -> bool {
+        ret !option::is_none(lookup_glob_in_mod(e, info, sp, ident, ns_module,
+                                                inside)) ||
+                !option::is_none(lookup_glob_in_mod(e, info, sp, ident,
+                                                    ns_value, inside)) ||
+                !option::is_none(lookup_glob_in_mod(e, info, sp, ident,
+                                                    ns_type, inside));
     }
 
-    for each @{val, _} in e.mod_map.items() {
+    for each @{val: val, _} in e.mod_map.items() {
         alt val.m {
           some(m) {
             for vi in m.view_items {
@@ -1466,17 +1454,18 @@ fn check_bad_exports(e: &@env) {
                   ast::view_item_export(idents, _) {
                     for ident in idents {
                         if !val.index.contains_key(ident) &&
-                           !lookup_glob_any(*e, val, vi.span, ident) {
-                            e.sess.span_warn(vi.span, ~"exported item " +
-                                             ident + ~" is not defined");
+                               !lookup_glob_any(*e, val, vi.span, ident) {
+                            e.sess.span_warn(vi.span,
+                                             "exported item " + ident +
+                                                 " is not defined");
                         }
                     }
                   }
-                  _ {}
+                  _ { }
                 }
             }
           }
-          none. {}
+          none. { }
         }
     }
 }
diff --git a/src/comp/middle/shape.rs b/src/comp/middle/shape.rs
index 73627cfc67a..6740fc0966d 100644
--- a/src/comp/middle/shape.rs
+++ b/src/comp/middle/shape.rs
@@ -84,15 +84,18 @@ fn eq_res_info(a: &res_info, b: &res_info) -> bool {
     ret a.did.crate == b.did.crate && a.did.node == b.did.node && a.t == b.t;
 }
 
-fn mk_global(ccx: &@crate_ctxt, name: &istr, llval: ValueRef,
-             internal: bool) -> ValueRef {
-    let llglobal = str::as_buf(name, { |buf|
-        lib::llvm::llvm::LLVMAddGlobal(ccx.llmod, val_ty(llval), buf)
-    });
+fn mk_global(ccx: &@crate_ctxt, name: &str, llval: ValueRef, internal: bool)
+   -> ValueRef {
+    let llglobal =
+        str::as_buf(name,
+                    {|buf|
+                        lib::llvm::llvm::LLVMAddGlobal(ccx.llmod,
+                                                       val_ty(llval), buf)
+                    });
     lib::llvm::llvm::LLVMSetInitializer(llglobal, llval);
     lib::llvm::llvm::LLVMSetGlobalConstant(llglobal, True);
 
-    if (internal) {
+    if internal {
         lib::llvm::llvm::LLVMSetLinkage(llglobal,
                                         lib::llvm::LLVMInternalLinkage as
                                             lib::llvm::llvm::Linkage);
@@ -256,10 +259,13 @@ fn s_float(_tcx: &ty_ctxt) -> u8 {
 }
 
 fn mk_ctxt(llmod: ModuleRef) -> ctxt {
-    let llshapetablesty = trans_common::T_named_struct(~"shapes");
-    let llshapetables = str::as_buf(~"shapes", { |buf|
-        lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty, buf)
-    });
+    let llshapetablesty = trans_common::T_named_struct("shapes");
+    let llshapetables =
+        str::as_buf("shapes",
+                    {|buf|
+                        lib::llvm::llvm::LLVMAddGlobal(llmod, llshapetablesty,
+                                                       buf)
+                    });
 
     ret {mutable next_tag_id: 0u16,
          pad: 0u16,
@@ -292,17 +298,20 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
       }
 
 
+
       ty::ty_int. {
         s += [s_int(ccx.tcx)];
       }
       ty::ty_float. { s += [s_float(ccx.tcx)]; }
 
 
+
       ty::ty_uint. | ty::ty_ptr(_) | ty::ty_type. | ty::ty_native(_) {
         s += [s_uint(ccx.tcx)];
       }
 
 
+
       ty::ty_machine(ast::ty_i8.) {
         s += [shape_i8];
       }
@@ -314,6 +323,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
       ty::ty_machine(ast::ty_i64.) { s += [shape_i64]; }
 
 
+
       ty::ty_istr. {
         s += [shape_vec];
         add_bool(s, true); // type is POD
@@ -321,6 +331,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
         add_substr(s, shape_of(ccx, unit_ty, ty_param_map));
       }
 
+
       ty::ty_tag(did, tps) {
         alt tag_kind(ccx, did) {
           tk_unit. {
@@ -358,6 +369,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
       }
 
 
+
       ty::ty_box(mt) {
         s += [shape_box];
         add_substr(s, shape_of(ccx, mt.ty, ty_param_map));
@@ -387,6 +399,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
       }
 
 
+
       ty::ty_fn(_, _, _, _, _) {
         s += [shape_fn];
       }
@@ -394,6 +407,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
       ty::ty_obj(_) { s += [shape_obj]; }
 
 
+
       ty::ty_res(did, raw_subt, tps) {
         let subt = ty::substitute_type_params(ccx.tcx, tps, raw_subt);
         let ri = {did: did, t: subt};
@@ -409,15 +423,17 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
 
       }
 
+
       ty::ty_var(n) {
         fail "shape_of ty_var";
       }
 
+
       ty::ty_param(n, _) {
         // Find the type parameter in the parameter list.
         let found = false;
         let i = 0u;
-        while (i < vec::len(ty_param_map)) {
+        while i < vec::len(ty_param_map) {
             if n == ty_param_map[i] {
                 s += [shape_var, i as u8];
                 found = true;
@@ -425,7 +441,7 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
             }
             i += 1u;
         }
-        assert found;
+        assert (found);
       }
     }
 
@@ -433,15 +449,11 @@ fn shape_of(ccx: &@crate_ctxt, t: ty::t, ty_param_map: &[uint]) -> [u8] {
 }
 
 // FIXME: We might discover other variants as we traverse these. Handle this.
-fn shape_of_variant(ccx: &@crate_ctxt,
-                    v: &ty::variant_info,
+fn shape_of_variant(ccx: &@crate_ctxt, v: &ty::variant_info,
                     ty_param_count: uint) -> [u8] {
     let ty_param_map = [];
     let i = 0u;
-    while (i < ty_param_count) {
-        ty_param_map += [i];
-        i += 1u;
-    }
+    while i < ty_param_count { ty_param_map += [i]; i += 1u; }
 
     let s = [];
     for t: ty::t in v.args { s += shape_of(ccx, t, ty_param_map); }
@@ -540,7 +552,7 @@ fn gen_tag_shapes(ccx: &@crate_ctxt) -> ValueRef {
     header += data;
     header += lv_table;
 
-    ret mk_global(ccx, ~"tag_shapes", C_bytes(header), true);
+    ret mk_global(ccx, "tag_shapes", C_bytes(header), true);
 }
 
 fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef {
@@ -553,7 +565,7 @@ fn gen_resource_shapes(ccx: &@crate_ctxt) -> ValueRef {
         i += 1u;
     }
 
-    ret mk_global(ccx, ~"resource_shapes", C_struct(dtors), true);
+    ret mk_global(ccx, "resource_shapes", C_struct(dtors), true);
 }
 
 fn gen_shape_tables(ccx: &@crate_ctxt) {
diff --git a/src/comp/middle/trans.rs b/src/comp/middle/trans.rs
index 315b11340ba..16621d779e8 100644
--- a/src/comp/middle/trans.rs
+++ b/src/comp/middle/trans.rs
@@ -82,14 +82,16 @@ fn type_of_explicit_args(cx: &@crate_ctxt, sp: &span, inputs: &[ty::arg]) ->
     let atys: [TypeRef] = [];
     for arg: ty::arg in inputs {
         let t: TypeRef = type_of_inner(cx, sp, arg.ty);
-        t = alt arg.mode {
-          ty::mo_alias(_) { T_ptr(t) }
-          ty::mo_move. { T_ptr(t) }
-          _ {
-            if ty::type_is_structural(cx.tcx, arg.ty) { T_ptr(t) }
-            else { t }
-          }
-        };
+        t =
+            alt arg.mode {
+              ty::mo_alias(_) { T_ptr(t) }
+              ty::mo_move. { T_ptr(t) }
+              _ {
+                if ty::type_is_structural(cx.tcx, arg.ty) {
+                    T_ptr(t)
+                } else { t }
+              }
+            };
         atys += [t];
     }
     ret atys;
@@ -224,7 +226,7 @@ fn type_of_inner(cx: &@crate_ctxt, sp: &span, t: ty::t) -> TypeRef {
         ret T_struct([T_i32(), type_of_inner(cx, sp, sub1)]);
       }
       ty::ty_var(_) {
-        cx.tcx.sess.span_fatal(sp, ~"trans::type_of called on ty_var");
+        cx.tcx.sess.span_fatal(sp, "trans::type_of called on ty_var");
       }
       ty::ty_param(_, _) { llty = T_typaram(cx.tn); }
       ty::ty_type. { llty = T_ptr(cx.tydesc_type); }
@@ -286,17 +288,17 @@ fn type_of_or_i8(bcx: &@block_ctxt, typ: ty::t) -> TypeRef {
 
 // Name sanitation. LLVM will happily accept identifiers with weird names, but
 // gas doesn't!
-fn sanitize(s: &istr) -> istr {
-    let result = ~"";
+fn sanitize(s: &str) -> str {
+    let result = "";
     for c: u8 in s {
         if c == '@' as u8 {
-            result += ~"boxed_";
+            result += "boxed_";
         } else {
             if c == ',' as u8 {
-                result += ~"_";
+                result += "_";
             } else {
                 if c == '{' as u8 || c == '(' as u8 {
-                    result += ~"_of_";
+                    result += "_of_";
                 } else {
                     if c != 10u8 && c != '}' as u8 && c != ')' as u8 &&
                            c != ' ' as u8 && c != '\t' as u8 && c != ';' as u8
@@ -312,7 +314,7 @@ fn sanitize(s: &istr) -> istr {
 }
 
 
-fn log_fn_time(ccx: &@crate_ctxt, name: &istr, start: &time::timeval,
+fn log_fn_time(ccx: &@crate_ctxt, name: &str, start: &time::timeval,
                end: &time::timeval) {
     let elapsed =
         1000 * (end.sec - start.sec as int) +
@@ -321,98 +323,83 @@ fn log_fn_time(ccx: &@crate_ctxt, name: &istr, start: &time::timeval,
 }
 
 
-fn decl_fn(llmod: ModuleRef, name: &istr, cc: uint, llty: TypeRef) ->
+fn decl_fn(llmod: ModuleRef, name: &str, cc: uint, llty: TypeRef) ->
    ValueRef {
-    let llfn: ValueRef = str::as_buf(name, { |buf|
-        llvm::LLVMAddFunction(llmod, buf, llty)
-    });
+    let llfn: ValueRef =
+        str::as_buf(name, {|buf| llvm::LLVMAddFunction(llmod, buf, llty) });
     llvm::LLVMSetFunctionCallConv(llfn, cc);
     ret llfn;
 }
 
-fn decl_cdecl_fn(llmod: ModuleRef, name: &istr, llty: TypeRef) -> ValueRef {
+fn decl_cdecl_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> ValueRef {
     ret decl_fn(llmod, name, lib::llvm::LLVMCCallConv, llty);
 }
 
-fn decl_fastcall_fn(llmod: ModuleRef, name: &istr,
-                    llty: TypeRef) -> ValueRef {
+fn decl_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) -> ValueRef {
     let llfn = decl_fn(llmod, name, lib::llvm::LLVMFastCallConv, llty);
-    let _: () = str::as_buf(~"rust", { |buf|
-        llvm::LLVMSetGC(llfn, buf)
-    });
+    let _: () = str::as_buf("rust", {|buf| llvm::LLVMSetGC(llfn, buf) });
     ret llfn;
 }
 
 
 // Only use this if you are going to actually define the function. It's
 // not valid to simply declare a function as internal.
-fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &istr, llty: TypeRef) ->
+fn decl_internal_fastcall_fn(llmod: ModuleRef, name: &str, llty: TypeRef) ->
    ValueRef {
     let llfn = decl_fn(llmod, name, lib::llvm::LLVMFastCallConv, llty);
     llvm::LLVMSetLinkage(llfn,
                          lib::llvm::LLVMInternalLinkage as llvm::Linkage);
-    let _: () = str::as_buf(~"rust", { |buf|
-        llvm::LLVMSetGC(llfn, buf)
-    });
+    let _: () = str::as_buf("rust", {|buf| llvm::LLVMSetGC(llfn, buf) });
     ret llfn;
 }
 
-fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &istr) -> ValueRef {
+fn decl_glue(llmod: ModuleRef, cx: &crate_ctxt, s: &str) -> ValueRef {
     ret decl_cdecl_fn(llmod, s, T_fn([T_taskptr(cx)], T_void()));
 }
 
-fn get_extern_fn(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef,
-                 name: &istr, cc: uint, ty: TypeRef) -> ValueRef {
-    if externs.contains_key(name) {
-        ret externs.get(name);
-    }
+fn get_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef,
+                 name: &str, cc: uint, ty: TypeRef) -> ValueRef {
+    if externs.contains_key(name) { ret externs.get(name); }
     let f = decl_fn(llmod, name, cc, ty);
     externs.insert(name, f);
     ret f;
 }
 
-fn get_extern_const(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef,
-                    name: &istr, ty: TypeRef) -> ValueRef {
-    if externs.contains_key(name) {
-        ret externs.get(name);
-    }
-    let c = str::as_buf(name, { |buf|
-        llvm::LLVMAddGlobal(llmod, ty, buf)
-    });
+fn get_extern_const(externs: &hashmap<str, ValueRef>, llmod: ModuleRef,
+                    name: &str, ty: TypeRef) -> ValueRef {
+    if externs.contains_key(name) { ret externs.get(name); }
+    let c = str::as_buf(name, {|buf| llvm::LLVMAddGlobal(llmod, ty, buf) });
     externs.insert(name, c);
     ret c;
 }
 
-fn get_simple_extern_fn(externs: &hashmap<istr, ValueRef>, llmod: ModuleRef,
-                        name: &istr, n_args: int) -> ValueRef {
+fn get_simple_extern_fn(externs: &hashmap<str, ValueRef>, llmod: ModuleRef,
+                        name: &str, n_args: int) -> ValueRef {
     let inputs = std::vec::init_elt::<TypeRef>(T_int(), n_args as uint);
     let output = T_int();
     let t = T_fn(inputs, output);
     ret get_extern_fn(externs, llmod, name, lib::llvm::LLVMCCallConv, t);
 }
 
-fn trans_native_call(cx: &@block_ctxt, externs: &hashmap<istr, ValueRef>,
-                     llmod: ModuleRef, name: &istr, args: &[ValueRef]) ->
+fn trans_native_call(cx: &@block_ctxt, externs: &hashmap<str, ValueRef>,
+                     llmod: ModuleRef, name: &str, args: &[ValueRef]) ->
    ValueRef {
     let n: int = std::vec::len::<ValueRef>(args) as int;
     let llnative: ValueRef = get_simple_extern_fn(externs, llmod, name, n);
     let call_args: [ValueRef] = [];
-    for a: ValueRef in args {
-        call_args += [ZExtOrBitCast(cx, a, T_int())];
-    }
+    for a: ValueRef in args { call_args += [ZExtOrBitCast(cx, a, T_int())]; }
     ret Call(cx, llnative, call_args);
 }
 
 fn trans_non_gc_free(cx: &@block_ctxt, v: ValueRef) -> @block_ctxt {
     Call(cx, bcx_ccx(cx).upcalls.free,
-                  [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8())),
-                   C_int(0)]);
+         [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8())), C_int(0)]);
     ret cx;
 }
 
 fn trans_shared_free(cx: &@block_ctxt, v: ValueRef) -> @block_ctxt {
     Call(cx, bcx_ccx(cx).upcalls.shared_free,
-                  [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8()))]);
+         [cx.fcx.lltaskptr, PointerCast(cx, v, T_ptr(T_i8()))]);
     ret cx;
 }
 
@@ -479,8 +466,8 @@ fn alloca(cx: &@block_ctxt, t: TypeRef) -> ValueRef {
     ret Alloca(new_raw_block_ctxt(cx.fcx, cx.fcx.llstaticallocas), t);
 }
 
-fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t)
-        -> ValueRef {
+fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t) ->
+   ValueRef {
     let bcx = cx;
     let dy_cx = new_raw_block_ctxt(cx.fcx, cx.fcx.lldynamicallocas);
     let lltaskptr = bcx_fcx(bcx).lltaskptr;
@@ -502,8 +489,8 @@ fn dynastack_alloca(cx: &@block_ctxt, t: TypeRef, n: ValueRef, ty: ty::t)
     ret PointerCast(dy_cx, llresult, T_ptr(t));
 }
 
-fn mk_obstack_token(ccx: &@crate_ctxt, fcx: @fn_ctxt,
-                    lltaskptr: ValueRef) -> ValueRef {
+fn mk_obstack_token(ccx: &@crate_ctxt, fcx: @fn_ctxt, lltaskptr: ValueRef) ->
+   ValueRef {
     let cx = new_raw_block_ctxt(fcx, fcx.lldynamicallocas);
     ret Call(cx, ccx.upcalls.dynastack_mark, [lltaskptr]);
 }
@@ -544,7 +531,7 @@ fn simplify_type(ccx: &@crate_ctxt, typ: ty::t) -> ty::t {
 fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: ty::t) -> uint {
     if ty::type_has_dynamic_size(cx.tcx, t) {
         cx.tcx.sess.span_fatal(sp,
-                               ~"dynamically sized type passed to \
+                               "dynamically sized type passed to \
                                static_size_of_tag()");
     }
     if cx.tag_sizes.contains_key(t) { ret cx.tag_sizes.get(t); }
@@ -572,7 +559,7 @@ fn static_size_of_tag(cx: &@crate_ctxt, sp: &span, t: ty::t) -> uint {
         ret max_size;
       }
       _ {
-        cx.tcx.sess.span_fatal(sp, ~"non-tag passed to static_size_of_tag()");
+        cx.tcx.sess.span_fatal(sp, "non-tag passed to static_size_of_tag()");
       }
     }
 }
@@ -793,8 +780,9 @@ fn GEP_tup_like(cx: &@block_ctxt, t: ty::t, base: ValueRef, ixs: &[int]) ->
 // appropriate. @llblobptr is the data part of a tag value; its actual type is
 // meaningless, as it will be cast away.
 fn GEP_tag(cx: @block_ctxt, llblobptr: ValueRef, tag_id: &ast::def_id,
-           variant_id: &ast::def_id, ty_substs: &[ty::t], ix: uint)
-    : valid_variant_index(ix, cx, tag_id, variant_id) -> result {
+           variant_id: &ast::def_id, ty_substs: &[ty::t],
+           ix: uint) : valid_variant_index(ix, cx, tag_id, variant_id) ->
+   result {
     let variant = ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id);
     // Synthesize a tuple type so that GEP_tup_like() can work its magic.
     // Separately, store the type of the element we're interested in.
@@ -849,7 +837,7 @@ fn trans_raw_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef) ->
     let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type));
     let rval =
         Call(cx, bcx_ccx(cx).upcalls.malloc,
-                      [cx.fcx.lltaskptr, llsize, tydesc]);
+             [cx.fcx.lltaskptr, llsize, tydesc]);
     ret rslt(cx, PointerCast(cx, rval, llptr_ty));
 }
 
@@ -862,7 +850,7 @@ fn trans_shared_malloc(cx: &@block_ctxt, llptr_ty: TypeRef, llsize: ValueRef)
     let tydesc = C_null(T_ptr(bcx_ccx(cx).tydesc_type));
     let rval =
         Call(cx, bcx_ccx(cx).upcalls.shared_malloc,
-                      [cx.fcx.lltaskptr, llsize, tydesc]);
+             [cx.fcx.lltaskptr, llsize, tydesc]);
     ret rslt(cx, PointerCast(cx, rval, llptr_ty));
 }
 
@@ -951,8 +939,7 @@ fn linearize_ty_params(cx: &@block_ctxt, t: ty::t) ->
 fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef,
                                     llalign: ValueRef, llroottydesc: ValueRef,
                                     llfirstparam: ValueRef, n_params: uint,
-                                    obj_params: uint)
-   -> ValueRef {
+                                    obj_params: uint) -> ValueRef {
     let llmyroottydesc = alloca(cx, bcx_ccx(cx).tydesc_type);
 
     // By convention, desc 0 is the root descriptor.
@@ -975,11 +962,7 @@ fn trans_stack_local_derived_tydesc(cx: &@block_ctxt, llsz: ValueRef,
 
 // Objects and closures store their type parameters differently (in the object
 // or closure itself rather than in the type descriptor).
-tag ty_param_storage {
-    tps_normal;
-    tps_obj(uint);
-    tps_fn(uint);
-}
+tag ty_param_storage { tps_normal; tps_obj(uint); tps_fn(uint); }
 
 fn get_derived_tydesc(cx: &@block_ctxt, t: ty::t, escapes: bool,
                       storage: ty_param_storage,
@@ -1034,27 +1017,28 @@ fn get_derived_tydesc(cx: &@block_ctxt, t: ty::t, escapes: bool,
 
     let llfirstparam =
         PointerCast(bcx, llparamtydescs,
-                         T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type)));
+                    T_ptr(T_ptr(bcx_ccx(bcx).tydesc_type)));
 
     // The top bit indicates whether this type descriptor describes an object
     // (0) or a function (1).
     let obj_params;
     alt storage {
-        tps_normal. { obj_params = 0u; }
-        tps_obj(np) { obj_params = np; }
-        tps_fn(np)  { obj_params = 0x80000000u | np; }
+      tps_normal. { obj_params = 0u; }
+      tps_obj(np) { obj_params = np; }
+      tps_fn(np) { obj_params = 0x80000000u | np; }
     }
 
     let v;
     if escapes {
         let td_val =
             Call(bcx, bcx_ccx(bcx).upcalls.get_type_desc,
-                           [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val,
-                            align.val, C_uint(1u + n_params),
-                            llfirstparam, C_uint(obj_params)]);
+                 [bcx.fcx.lltaskptr, C_null(T_ptr(T_nil())), sz.val,
+                  align.val, C_uint(1u + n_params), llfirstparam,
+                  C_uint(obj_params)]);
         v = td_val;
     } else {
-        v = trans_stack_local_derived_tydesc(bcx, sz.val, align.val, root,
+        v =
+            trans_stack_local_derived_tydesc(bcx, sz.val, align.val, root,
                                              llfirstparam, n_params,
                                              obj_params);
     }
@@ -1077,13 +1061,12 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: ty::t, escapes: bool,
         if id < vec::len(cx.fcx.lltydescs) {
             ret {kind: tk_param, result: rslt(cx, cx.fcx.lltydescs[id])};
         } else {
-            bcx_tcx(cx).sess.span_bug(
-                cx.sp,
-                ~"Unbound typaram in get_tydesc: " +
-                ~"orig_t = " +
-                ty_to_str(bcx_tcx(cx), orig_t) +
-                ~" ty_param = " +
-                std::uint::str(id));
+            bcx_tcx(cx).sess.span_bug(cx.sp,
+                                      "Unbound typaram in get_tydesc: " +
+                                          "orig_t = " +
+                                          ty_to_str(bcx_tcx(cx), orig_t) +
+                                          " ty_param = " +
+                                          std::uint::str(id));
         }
       }
       none. {/* fall through */ }
@@ -1094,7 +1077,6 @@ fn get_tydesc(cx: &@block_ctxt, orig_t: ty::t, escapes: bool,
         ret {kind: tk_derived,
              result: get_derived_tydesc(cx, t, escapes, storage, static_ti)};
     }
-
     // Otherwise, generate a tydesc if necessary, and return it.
     let info = get_static_tydesc(cx, t, []);
     static_ti = some::<@tydesc_info>(info);
@@ -1147,7 +1129,7 @@ fn set_glue_inlining(cx: &@local_ctxt, f: ValueRef, t: ty::t) {
 // Generates the declaration for (but doesn't emit) a type descriptor.
 fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint])
    -> @tydesc_info {
-    log ~"+++ declare_tydesc " + ty_to_str(cx.ccx.tcx, t);
+    log "+++ declare_tydesc " + ty_to_str(cx.ccx.tcx, t);
     let ccx = cx.ccx;
     let llsize;
     let llalign;
@@ -1164,12 +1146,14 @@ fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint])
     }
     let name;
     if cx.ccx.sess.get_opts().debuginfo {
-        name = mangle_internal_name_by_type_only(cx.ccx, t, ~"tydesc");
+        name = mangle_internal_name_by_type_only(cx.ccx, t, "tydesc");
         name = sanitize(name);
-    } else { name = mangle_internal_name_by_seq(cx.ccx, ~"tydesc"); }
-    let gvar = str::as_buf(name, { |buf|
-        llvm::LLVMAddGlobal(ccx.llmod, ccx.tydesc_type, buf)
-    });
+    } else { name = mangle_internal_name_by_seq(cx.ccx, "tydesc"); }
+    let gvar =
+        str::as_buf(name,
+                    {|buf|
+                        llvm::LLVMAddGlobal(ccx.llmod, ccx.tydesc_type, buf)
+                    });
     let info =
         @{ty: t,
           tydesc: gvar,
@@ -1180,7 +1164,7 @@ fn declare_tydesc(cx: &@local_ctxt, sp: &span, t: ty::t, ty_params: &[uint])
           mutable free_glue: none::<ValueRef>,
           mutable cmp_glue: none::<ValueRef>,
           ty_params: ty_params};
-    log ~"--- declare_tydesc " + ty_to_str(cx.ccx.tcx, t);
+    log "--- declare_tydesc " + ty_to_str(cx.ccx.tcx, t);
     ret info;
 }
 
@@ -1190,21 +1174,20 @@ tag glue_helper {
 }
 
 fn declare_generic_glue(cx: &@local_ctxt, t: ty::t, llfnty: TypeRef,
-                        name: &istr) -> ValueRef {
+                        name: &str) -> ValueRef {
     let name = name;
     let fn_nm;
     if cx.ccx.sess.get_opts().debuginfo {
-        fn_nm = mangle_internal_name_by_type_only(cx.ccx, t, ~"glue_" + name);
+        fn_nm = mangle_internal_name_by_type_only(cx.ccx, t, "glue_" + name);
         fn_nm = sanitize(fn_nm);
-    } else { fn_nm = mangle_internal_name_by_seq(cx.ccx, ~"glue_" + name); }
+    } else { fn_nm = mangle_internal_name_by_seq(cx.ccx, "glue_" + name); }
     let llfn = decl_cdecl_fn(cx.ccx.llmod, fn_nm, llfnty);
     set_glue_inlining(cx, llfn, t);
     ret llfn;
 }
 
 fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t,
-                           llfn: ValueRef,
-                           helper: &glue_helper,
+                           llfn: ValueRef, helper: &glue_helper,
                            ty_params: &[uint]) -> ValueRef {
     let fcx = new_fn_ctxt(cx, sp, llfn);
     llvm::LLVMSetLinkage(llfn,
@@ -1242,9 +1225,7 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t,
     let llrawptr0 = llvm::LLVMGetParam(llfn, 4u);
     let llval0 = BitCast(bcx, llrawptr0, llty);
     alt helper {
-      default_helper(helper) {
-        helper(bcx, llval0, t);
-      }
+      default_helper(helper) { helper(bcx, llval0, t); }
       copy_helper(helper) {
         let llrawptr1 = llvm::LLVMGetParam(llfn, 5u);
         let llval1 = BitCast(bcx, llrawptr1, llty);
@@ -1256,8 +1237,8 @@ fn make_generic_glue_inner(cx: &@local_ctxt, sp: &span, t: ty::t,
 }
 
 fn make_generic_glue(cx: &@local_ctxt, sp: &span, t: ty::t, llfn: ValueRef,
-                     helper: &glue_helper, ty_params: &[uint],
-                     name: &istr) -> ValueRef {
+                     helper: &glue_helper, ty_params: &[uint], name: &str) ->
+   ValueRef {
     if !cx.ccx.sess.get_opts().stats {
         ret make_generic_glue_inner(cx, sp, t, llfn, helper, ty_params);
     }
@@ -1265,8 +1246,7 @@ fn make_generic_glue(cx: &@local_ctxt, sp: &span, t: ty::t, llfn: ValueRef,
     let start = time::get_time();
     let llval = make_generic_glue_inner(cx, sp, t, llfn, helper, ty_params);
     let end = time::get_time();
-    log_fn_time(cx.ccx, ~"glue " + name + ~" " +
-                ty_to_short_str(cx.ccx.tcx, t),
+    log_fn_time(cx.ccx, "glue " + name + " " + ty_to_short_str(cx.ccx.tcx, t),
                 start, end);
     ret llval;
 }
@@ -1317,7 +1297,7 @@ fn emit_tydescs(ccx: &@crate_ctxt) {
                             cmp_glue, // cmp_glue
                             C_shape(ccx, shape), // shape
                             shape_tables, // shape_tables
-                            C_int(0),   // n_params
+                            C_int(0), // n_params
                             C_int(0)]); // n_obj_params
 
         let gvar = ti.tydesc;
@@ -1354,56 +1334,56 @@ fn incr_refcnt_of_boxed(cx: &@block_ctxt, box_ptr: ValueRef) -> @block_ctxt {
 
 fn make_free_glue(bcx: &@block_ctxt, v0: ValueRef, t: ty::t) {
     // NB: v is an *alias* of type t here, not a direct value.
-    let bcx = alt ty::struct(bcx_tcx(bcx), t) {
-      ty::ty_box(body_mt) {
-        let v = Load(bcx, v0);
-        let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]);
-        let bcx = drop_ty(bcx, body, body_mt.ty);
-        if !bcx_ccx(bcx).sess.get_opts().do_gc {
-            trans_non_gc_free(bcx, v)
-        } else { bcx }
-      }
-      ty::ty_uniq(_) { fail "free uniq unimplemented"; }
-      ty::ty_obj(_) {
-        // Call through the obj's own fields-drop glue first.
-        // Then free the body.
-        let box_cell =
-            GEP(bcx, v0, [C_int(0), C_int(abi::obj_field_box)]);
-        let b = Load(bcx, box_cell);
-        let ccx = bcx_ccx(bcx);
-        let llbox_ty = T_opaque_obj_ptr(*ccx);
-        b = PointerCast(bcx, b, llbox_ty);
-        let body =
-            GEP(bcx, b, [C_int(0), C_int(abi::box_rc_field_body)]);
-        let tydescptr =
-            GEP(bcx, body, [C_int(0), C_int(abi::obj_body_elt_tydesc)]);
-        let tydesc = Load(bcx, tydescptr);
-        let ti = none;
-        call_tydesc_glue_full(bcx, body, tydesc,
-                              abi::tydesc_field_drop_glue, ti);
-        if !bcx_ccx(bcx).sess.get_opts().do_gc {
-            trans_non_gc_free(bcx, b)
-        } else { bcx }
-      }
-      ty::ty_fn(_, _, _, _, _) {
-        // Call through the closure's own fields-drop glue first.
-        // Then free the body.
-        let box_cell = GEP(bcx, v0, [C_int(0), C_int(abi::fn_field_box)]);
-        let v = Load(bcx, box_cell);
-        let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]);
-        let bindings =
-            GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_bindings)]);
-        let tydescptr =
-            GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_tydesc)]);
-        let ti = none;
-        call_tydesc_glue_full(bcx, bindings, Load(bcx, tydescptr),
-                              abi::tydesc_field_drop_glue, ti);
-        if !bcx_ccx(bcx).sess.get_opts().do_gc {
-            trans_non_gc_free(bcx, v)
-        } else { bcx }
-      }
-      _ { bcx }
-    };
+    let bcx =
+        alt ty::struct(bcx_tcx(bcx), t) {
+          ty::ty_box(body_mt) {
+            let v = Load(bcx, v0);
+            let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]);
+            let bcx = drop_ty(bcx, body, body_mt.ty);
+            if !bcx_ccx(bcx).sess.get_opts().do_gc {
+                trans_non_gc_free(bcx, v)
+            } else { bcx }
+          }
+          ty::ty_uniq(_) { fail "free uniq unimplemented"; }
+          ty::ty_obj(_) {
+            // Call through the obj's own fields-drop glue first.
+            // Then free the body.
+            let box_cell =
+                GEP(bcx, v0, [C_int(0), C_int(abi::obj_field_box)]);
+            let b = Load(bcx, box_cell);
+            let ccx = bcx_ccx(bcx);
+            let llbox_ty = T_opaque_obj_ptr(*ccx);
+            b = PointerCast(bcx, b, llbox_ty);
+            let body = GEP(bcx, b, [C_int(0), C_int(abi::box_rc_field_body)]);
+            let tydescptr =
+                GEP(bcx, body, [C_int(0), C_int(abi::obj_body_elt_tydesc)]);
+            let tydesc = Load(bcx, tydescptr);
+            let ti = none;
+            call_tydesc_glue_full(bcx, body, tydesc,
+                                  abi::tydesc_field_drop_glue, ti);
+            if !bcx_ccx(bcx).sess.get_opts().do_gc {
+                trans_non_gc_free(bcx, b)
+            } else { bcx }
+          }
+          ty::ty_fn(_, _, _, _, _) {
+            // Call through the closure's own fields-drop glue first.
+            // Then free the body.
+            let box_cell = GEP(bcx, v0, [C_int(0), C_int(abi::fn_field_box)]);
+            let v = Load(bcx, box_cell);
+            let body = GEP(bcx, v, [C_int(0), C_int(abi::box_rc_field_body)]);
+            let bindings =
+                GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_bindings)]);
+            let tydescptr =
+                GEP(bcx, body, [C_int(0), C_int(abi::closure_elt_tydesc)]);
+            let ti = none;
+            call_tydesc_glue_full(bcx, bindings, Load(bcx, tydescptr),
+                                  abi::tydesc_field_drop_glue, ti);
+            if !bcx_ccx(bcx).sess.get_opts().do_gc {
+                trans_non_gc_free(bcx, v)
+            } else { bcx }
+          }
+          _ { bcx }
+        };
 
     build_return(bcx);
 }
@@ -1448,8 +1428,8 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id,
     let ccx = bcx_ccx(cx);
     let inner_t_s = ty::substitute_type_params(ccx.tcx, tps, inner_t);
     let tup_ty = ty::mk_tup(ccx.tcx, [ty::mk_int(ccx.tcx), inner_t_s]);
-    let drop_cx = new_sub_block_ctxt(cx, ~"drop res");
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let drop_cx = new_sub_block_ctxt(cx, "drop res");
+    let next_cx = new_sub_block_ctxt(cx, "next");
 
     let drop_flag = GEP_tup_like(cx, tup_ty, rs, [0, 0]);
     cx = drop_flag.bcx;
@@ -1462,11 +1442,9 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id,
     // Find and call the actual destructor.
     let dtor_pair = trans_common::get_res_dtor(ccx, cx.sp, did, inner_t);
     let dtor_addr =
-        Load(cx, GEP(cx, dtor_pair,
-                                   [C_int(0), C_int(abi::fn_field_code)]));
+        Load(cx, GEP(cx, dtor_pair, [C_int(0), C_int(abi::fn_field_code)]));
     let dtor_env =
-        Load(cx, GEP(cx, dtor_pair,
-                                   [C_int(0), C_int(abi::fn_field_box)]));
+        Load(cx, GEP(cx, dtor_pair, [C_int(0), C_int(abi::fn_field_box)]));
     let args = [cx.fcx.llretptr, cx.fcx.lltaskptr, dtor_env];
     for tp: ty::t in tps {
         let ti: option::t<@tydesc_info> = none;
@@ -1478,9 +1456,8 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id,
     // value here, but the dtor expects a type that still has opaque pointers
     // for type variables.
     let val_llty =
-        lib::llvm::fn_ty_param_tys(
-            llvm::LLVMGetElementType(
-                llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)];
+        lib::llvm::fn_ty_param_tys(llvm::LLVMGetElementType(
+            llvm::LLVMTypeOf(dtor_addr)))[std::vec::len(args)];
     let val_cast = BitCast(cx, val.val, val_llty);
     FastCall(cx, dtor_addr, args + [val_cast]);
 
@@ -1493,17 +1470,16 @@ fn trans_res_drop(cx: @block_ctxt, rs: ValueRef, did: &ast::def_id,
 fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef,
                           full_alias: ValueRef, t: ty::t) -> @block_ctxt {
     let ccx = bcx_ccx(cx);
-    let rc_adj_cx = new_sub_block_ctxt(cx, ~"rc--");
-    let free_cx = new_sub_block_ctxt(cx, ~"free");
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let rc_adj_cx = new_sub_block_ctxt(cx, "rc--");
+    let free_cx = new_sub_block_ctxt(cx, "free");
+    let next_cx = new_sub_block_ctxt(cx, "next");
     let box_ptr = Load(cx, box_ptr_alias);
     let llbox_ty = T_opaque_obj_ptr(*ccx);
     box_ptr = PointerCast(cx, box_ptr, llbox_ty);
     let null_test = IsNull(cx, box_ptr);
     CondBr(cx, null_test, next_cx.llbb, rc_adj_cx.llbb);
     let rc_ptr =
-        GEP(rc_adj_cx, box_ptr,
-                             [C_int(0), C_int(abi::box_rc_field_refcnt)]);
+        GEP(rc_adj_cx, box_ptr, [C_int(0), C_int(abi::box_rc_field_refcnt)]);
     let rc = Load(rc_adj_cx, rc_ptr);
     rc = Sub(rc_adj_cx, rc, C_int(1));
     Store(rc_adj_cx, rc, rc_ptr);
@@ -1516,11 +1492,9 @@ fn decr_refcnt_maybe_free(cx: &@block_ctxt, box_ptr_alias: ValueRef,
 
 
 // Structural comparison: a rather involved form of glue.
-fn maybe_name_value(cx: &@crate_ctxt, v: ValueRef, s: &istr) {
+fn maybe_name_value(cx: &@crate_ctxt, v: ValueRef, s: &str) {
     if cx.sess.get_opts().save_temps {
-        let _: () = str::as_buf(s, { |buf|
-            llvm::LLVMSetValueName(v, buf)
-        });
+        let _: () = str::as_buf(s, {|buf| llvm::LLVMSetValueName(v, buf) });
     }
 }
 
@@ -1553,21 +1527,21 @@ fn compare_scalar_types(cx: @block_ctxt, lhs: ValueRef, rhs: ValueRef,
         }
       }
       ty::ty_type. {
-        trans_fail(cx, none, ~"attempt to compare values of type type");
+        trans_fail(cx, none, "attempt to compare values of type type");
 
         // This is a bit lame, because we return a dummy block to the
         // caller that's actually unreachable, but I don't think it
         // matters.
-        ret rslt(new_sub_block_ctxt(cx, ~"after_fail_dummy"), C_bool(false));
+        ret rslt(new_sub_block_ctxt(cx, "after_fail_dummy"), C_bool(false));
       }
       ty::ty_native(_) {
         trans_fail(cx, none::<span>,
-                   ~"attempt to compare values of type native");
-        ret rslt(new_sub_block_ctxt(cx, ~"after_fail_dummy"), C_bool(false));
+                   "attempt to compare values of type native");
+        ret rslt(new_sub_block_ctxt(cx, "after_fail_dummy"), C_bool(false));
       }
       _ {
         // Should never get here, because t is scalar.
-        bcx_ccx(cx).sess.bug(~"non-scalar type passed to \
+        bcx_ccx(cx).sess.bug("non-scalar type passed to \
                                  compare_scalar_types");
       }
     }
@@ -1620,17 +1594,17 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef,
         } else { r = ICmp(cx, op, lhs, rhs); }
         ret r;
     }
-    let last_cx = new_sub_block_ctxt(cx, ~"last");
-    let eq_cx = new_sub_block_ctxt(cx, ~"eq");
+    let last_cx = new_sub_block_ctxt(cx, "last");
+    let eq_cx = new_sub_block_ctxt(cx, "eq");
     let eq_result = generic_cmp(eq_cx, nt, eq_cmp, lhs, rhs);
     Br(eq_cx, last_cx.llbb);
-    let lt_cx = new_sub_block_ctxt(cx, ~"lt");
+    let lt_cx = new_sub_block_ctxt(cx, "lt");
     let lt_result = generic_cmp(lt_cx, nt, lt_cmp, lhs, rhs);
     Br(lt_cx, last_cx.llbb);
-    let le_cx = new_sub_block_ctxt(cx, ~"le");
+    let le_cx = new_sub_block_ctxt(cx, "le");
     let le_result = generic_cmp(le_cx, nt, le_cmp, lhs, rhs);
     Br(le_cx, last_cx.llbb);
-    let unreach_cx = new_sub_block_ctxt(cx, ~"unreach");
+    let unreach_cx = new_sub_block_ctxt(cx, "unreach");
     Unreachable(unreach_cx);
     let llswitch = Switch(cx, llop, unreach_cx.llbb, 3u);
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_eq), eq_cx.llbb);
@@ -1638,7 +1612,7 @@ fn compare_scalar_values(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef,
     llvm::LLVMAddCase(llswitch, C_u8(abi::cmp_glue_op_le), le_cx.llbb);
     let last_result =
         Phi(last_cx, T_i1(), [eq_result, lt_result, le_result],
-                          [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
+            [eq_cx.llbb, lt_cx.llbb, le_cx.llbb]);
     ret rslt(last_cx, last_result);
 }
 
@@ -1664,13 +1638,13 @@ fn incr_ptr(cx: &@block_ctxt, p: ValueRef, incr: ValueRef, pp: ValueRef) {
 // Iterates through the elements of a structural type.
 fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
                       f: &val_and_ty_fn) -> @block_ctxt {
-    fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn)
-        -> @block_ctxt {
+    fn iter_boxpp(cx: @block_ctxt, box_cell: ValueRef, f: &val_and_ty_fn) ->
+       @block_ctxt {
         let box_ptr = Load(cx, box_cell);
         let tnil = ty::mk_nil(bcx_tcx(cx));
         let tbox = ty::mk_imm_box(bcx_tcx(cx), tnil);
-        let inner_cx = new_sub_block_ctxt(cx, ~"iter box");
-        let next_cx = new_sub_block_ctxt(cx, ~"next");
+        let inner_cx = new_sub_block_ctxt(cx, "iter box");
+        let next_cx = new_sub_block_ctxt(cx, "next");
         let null_test = IsNull(cx, box_ptr);
         CondBr(cx, null_test, next_cx.llbb, inner_cx.llbb);
         let inner_cx = f(inner_cx, box_cell, tbox);
@@ -1689,7 +1663,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
             let j = 0u;
             let v_id = variant.id;
             for a: ty::arg in args {
-                check valid_variant_index(j, cx, tid, v_id);
+                check (valid_variant_index(j, cx, tid, v_id));
                 let rslt = GEP_tag(cx, a_tup, tid, v_id, tps, j);
                 let llfldp_a = rslt.val;
                 cx = rslt.bcx;
@@ -1706,7 +1680,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
       ty::ty_rec(fields) {
         let i: int = 0;
         for fld: ty::field in fields {
-            let {bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]);
+            let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]);
             cx = f(bcx, llfld_a, fld.mt.ty);
             i += 1;
         }
@@ -1714,7 +1688,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
       ty::ty_tup(args) {
         let i = 0;
         for arg in args {
-            let {bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]);
+            let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, t, av, [0, i]);
             cx = f(bcx, llfld_a, arg);
             i += 1;
         }
@@ -1724,7 +1698,7 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
         let inner1 = ty::substitute_type_params(tcx, tps, inner);
         let inner_t_s = ty::substitute_type_params(tcx, tps, inner);
         let tup_t = ty::mk_tup(tcx, [ty::mk_int(tcx), inner_t_s]);
-        let {bcx, val: llfld_a} = GEP_tup_like(cx, tup_t, av, [0, 1]);
+        let {bcx: bcx, val: llfld_a} = GEP_tup_like(cx, tup_t, av, [0, 1]);
         ret f(bcx, llfld_a, inner1);
       }
       ty::ty_tag(tid, tps) {
@@ -1745,55 +1719,52 @@ fn iter_structural_ty(cx: @block_ctxt, av: ValueRef, t: ty::t,
         // NB: we must hit the discriminant first so that structural
         // comparison know not to proceed when the discriminants differ.
         cx = f(cx, lldiscrim_a_ptr, ty::mk_int(bcx_tcx(cx)));
-        let unr_cx = new_sub_block_ctxt(cx, ~"tag-iter-unr");
+        let unr_cx = new_sub_block_ctxt(cx, "tag-iter-unr");
         Unreachable(unr_cx);
         let llswitch = Switch(cx, lldiscrim_a, unr_cx.llbb, n_variants);
-        let next_cx = new_sub_block_ctxt(cx, ~"tag-iter-next");
+        let next_cx = new_sub_block_ctxt(cx, "tag-iter-next");
         let i = 0u;
         for variant: ty::variant_info in variants {
             let variant_cx =
-                new_sub_block_ctxt(cx, ~"tag-iter-variant-" +
-                                   uint::to_str(i, 10u));
+                new_sub_block_ctxt(cx,
+                                   "tag-iter-variant-" +
+                                       uint::to_str(i, 10u));
             llvm::LLVMAddCase(llswitch, C_int(i as int), variant_cx.llbb);
-            variant_cx = iter_variant(variant_cx, llunion_a_ptr, variant,
-                                      tps, tid, f);
+            variant_cx =
+                iter_variant(variant_cx, llunion_a_ptr, variant, tps, tid, f);
             Br(variant_cx, next_cx.llbb);
             i += 1u;
         }
         ret next_cx;
       }
       ty::ty_fn(_, _, _, _, _) {
-        let box_cell_a =
-            GEP(cx, av, [C_int(0), C_int(abi::fn_field_box)]);
+        let box_cell_a = GEP(cx, av, [C_int(0), C_int(abi::fn_field_box)]);
         ret iter_boxpp(cx, box_cell_a, f);
       }
       ty::ty_obj(_) {
-        let box_cell_a =
-            GEP(cx, av, [C_int(0), C_int(abi::obj_field_box)]);
+        let box_cell_a = GEP(cx, av, [C_int(0), C_int(abi::obj_field_box)]);
         ret iter_boxpp(cx, box_cell_a, f);
       }
-      _ { bcx_ccx(cx).sess.unimpl(~"type in iter_structural_ty"); }
+      _ { bcx_ccx(cx).sess.unimpl("type in iter_structural_ty"); }
     }
     ret cx;
 }
 
 
 // Iterates through a pointer range, until the src* hits the src_lim*.
-fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef,
-                     src: ValueRef, src_lim: ValueRef,
-                     elt_sz: ValueRef, f: &val_pair_fn) -> @block_ctxt {
+fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef, src: ValueRef,
+                     src_lim: ValueRef, elt_sz: ValueRef, f: &val_pair_fn) ->
+   @block_ctxt {
     let bcx = cx;
     let dst_int: ValueRef = vp2i(bcx, dst);
     let src_int: ValueRef = vp2i(bcx, src);
     let src_lim_int: ValueRef = vp2i(bcx, src_lim);
-    let cond_cx = new_scope_block_ctxt(cx, ~"sequence-iter cond");
-    let body_cx = new_scope_block_ctxt(cx, ~"sequence-iter body");
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let cond_cx = new_scope_block_ctxt(cx, "sequence-iter cond");
+    let body_cx = new_scope_block_ctxt(cx, "sequence-iter body");
+    let next_cx = new_sub_block_ctxt(cx, "next");
     Br(bcx, cond_cx.llbb);
-    let dst_curr: ValueRef =
-        Phi(cond_cx, T_int(), [dst_int], [bcx.llbb]);
-    let src_curr: ValueRef =
-        Phi(cond_cx, T_int(), [src_int], [bcx.llbb]);
+    let dst_curr: ValueRef = Phi(cond_cx, T_int(), [dst_int], [bcx.llbb]);
+    let src_curr: ValueRef = Phi(cond_cx, T_int(), [src_int], [bcx.llbb]);
     let end_test =
         ICmp(cond_cx, lib::llvm::LLVMIntULT, src_curr, src_lim_int);
     CondBr(cond_cx, end_test, body_cx.llbb, next_cx.llbb);
@@ -1808,8 +1779,7 @@ fn iter_sequence_raw(cx: @block_ctxt, dst: ValueRef,
     ret next_cx;
 }
 
-fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef,
-                       src_lim: ValueRef,
+fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef, src_lim: ValueRef,
                        elt_ty: &ty::t, f: &val_and_ty_fn) -> @block_ctxt {
     fn adaptor_fn(f: val_and_ty_fn, elt_ty: ty::t, cx: &@block_ctxt,
                   _dst: ValueRef, src: ValueRef) -> @block_ctxt {
@@ -1832,11 +1802,11 @@ fn iter_sequence_inner(cx: &@block_ctxt, src: ValueRef,
 
 
 // Iterates through the elements of a vec or str.
-fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn)
-   -> @block_ctxt {
+fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn) ->
+   @block_ctxt {
     fn iter_sequence_body(bcx: @block_ctxt, v: ValueRef, elt_ty: ty::t,
-                          f: &val_and_ty_fn, trailing_null: bool)
-        -> @block_ctxt {
+                          f: &val_and_ty_fn, trailing_null: bool) ->
+       @block_ctxt {
         let llunit_ty = type_of_or_i8(bcx, elt_ty);
         let p0 = tvec::get_dataptr(bcx, v, llunit_ty);
         let len = tvec::get_fill(bcx, v);
@@ -1846,24 +1816,20 @@ fn iter_sequence(cx: @block_ctxt, v: ValueRef, t: ty::t, f: &val_and_ty_fn)
             bcx = unit_sz.bcx;
             len = Sub(bcx, len, unit_sz.val);
         }
-        let p1 =
-            vi2p(bcx, Add(bcx, vp2i(bcx, p0), len), T_ptr(llunit_ty));
+        let p1 = vi2p(bcx, Add(bcx, vp2i(bcx, p0), len), T_ptr(llunit_ty));
         ret iter_sequence_inner(bcx, p0, p1, elt_ty, f);
     }
 
 
     alt ty::struct(bcx_tcx(cx), t) {
-      ty::ty_vec(elt) {
-        ret iter_sequence_body(cx, v, elt.ty, f, false);
-      }
+      ty::ty_vec(elt) { ret iter_sequence_body(cx, v, elt.ty, f, false); }
       ty::ty_istr. {
         let et = ty::mk_mach(bcx_tcx(cx), ast::ty_u8);
         ret iter_sequence_body(cx, v, et, f, true);
       }
       _ {
-        bcx_ccx(cx).sess.bug(
-            ~"unexpected type in trans::iter_sequence: "
-            + ty_to_str(cx.fcx.lcx.ccx.tcx, t));
+        bcx_ccx(cx).sess.bug("unexpected type in trans::iter_sequence: " +
+                                 ty_to_str(cx.fcx.lcx.ccx.tcx, t));
       }
     }
 }
@@ -1897,11 +1863,11 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int,
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
-                                         ~"take");
+                                         "take");
                 ti.take_glue = some::<ValueRef>(glue_fn);
                 make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
                                   default_helper(make_take_glue),
-                                  ti.ty_params, ~"take");
+                                  ti.ty_params, "take");
                 log #fmt["--- lazily_emit_tydesc_glue TAKE %s",
                          ty_to_str(bcx_tcx(cx), ti.ty)];
               }
@@ -1915,16 +1881,16 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int,
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
-                                         ~"drop");
+                                         "drop");
                 ti.drop_glue = some::<ValueRef>(glue_fn);
                 make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
                                   default_helper(make_drop_glue),
-                                  ti.ty_params, ~"drop");
+                                  ti.ty_params, "drop");
                 log #fmt["--- lazily_emit_tydesc_glue DROP %s",
                          ty_to_str(bcx_tcx(cx), ti.ty)];
               }
             }
-         } else if field == abi::tydesc_field_free_glue {
+        } else if field == abi::tydesc_field_free_glue {
             alt { ti.free_glue } {
               some(_) { }
               none. {
@@ -1933,11 +1899,11 @@ fn lazily_emit_tydesc_glue(cx: &@block_ctxt, field: int,
                 let lcx = cx.fcx.lcx;
                 let glue_fn =
                     declare_generic_glue(lcx, ti.ty, T_glue_fn(*lcx.ccx),
-                                         ~"free");
+                                         "free");
                 ti.free_glue = some::<ValueRef>(glue_fn);
                 make_generic_glue(lcx, cx.sp, ti.ty, glue_fn,
                                   default_helper(make_free_glue),
-                                  ti.ty_params, ~"free");
+                                  ti.ty_params, "free");
                 log #fmt["--- lazily_emit_tydesc_glue FREE %s",
                          ty_to_str(bcx_tcx(cx), ti.ty)];
               }
@@ -1978,8 +1944,7 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef,
 
     let llrawptr = PointerCast(cx, v, T_ptr(T_i8()));
     let lltydescs =
-        GEP(cx, tydesc,
-                     [C_int(0), C_int(abi::tydesc_field_first_param)]);
+        GEP(cx, tydesc, [C_int(0), C_int(abi::tydesc_field_first_param)]);
     lltydescs = Load(cx, lltydescs);
 
     let llfn;
@@ -1992,14 +1957,14 @@ fn call_tydesc_glue_full(cx: &@block_ctxt, v: ValueRef, tydesc: ValueRef,
     }
 
     Call(cx, llfn,
-                  [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr,
-                   C_null(T_ptr(T_nil())), lltydescs, llrawptr]);
+         [C_null(T_ptr(T_nil())), cx.fcx.lltaskptr, C_null(T_ptr(T_nil())),
+          lltydescs, llrawptr]);
 }
 
 fn call_tydesc_glue(cx: &@block_ctxt, v: ValueRef, t: ty::t, field: int) ->
-    @block_ctxt {
+   @block_ctxt {
     let ti: option::t<@tydesc_info> = none::<@tydesc_info>;
-    let {bcx, val: td} = get_tydesc(cx, t, false, tps_normal, ti).result;
+    let {bcx: bcx, val: td} = get_tydesc(cx, t, false, tps_normal, ti).result;
     call_tydesc_glue_full(bcx, v, td, field, ti);
     ret bcx;
 }
@@ -2012,25 +1977,28 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: ty::t,
     let bcx = cx;
 
     let r = spill_if_immediate(bcx, lhs, t);
-    let lllhs = r.val; bcx = r.bcx;
+    let lllhs = r.val;
+    bcx = r.bcx;
     r = spill_if_immediate(bcx, rhs, t);
-    let llrhs = r.val; bcx = r.bcx;
+    let llrhs = r.val;
+    bcx = r.bcx;
 
     let llrawlhsptr = BitCast(bcx, lllhs, T_ptr(T_i8()));
     let llrawrhsptr = BitCast(bcx, llrhs, T_ptr(T_i8()));
     let ti = none::<@tydesc_info>;
     r = get_tydesc(bcx, t, false, tps_normal, ti).result;
-    let lltydesc = r.val; bcx = r.bcx;
+    let lltydesc = r.val;
+    bcx = r.bcx;
     lazily_emit_tydesc_glue(bcx, abi::tydesc_field_cmp_glue, ti);
-    let lltydescs = GEP(bcx, lltydesc,
-                        [C_int(0), C_int(abi::tydesc_field_first_param)]);
+    let lltydescs =
+        GEP(bcx, lltydesc, [C_int(0), C_int(abi::tydesc_field_first_param)]);
     lltydescs = Load(bcx, lltydescs);
 
     let llfn;
     alt ti {
       none. {
-        let llfnptr = GEP(bcx, lltydesc,
-                          [C_int(0), C_int(abi::tydesc_field_cmp_glue)]);
+        let llfnptr =
+            GEP(bcx, lltydesc, [C_int(0), C_int(abi::tydesc_field_cmp_glue)]);
         llfn = Load(bcx, llfnptr);
       }
       some(sti) { llfn = option::get(sti.cmp_glue); }
@@ -2038,8 +2006,8 @@ fn call_cmp_glue(cx: &@block_ctxt, lhs: ValueRef, rhs: ValueRef, t: ty::t,
 
     let llcmpresultptr = alloca(bcx, T_i1());
     let llargs: [ValueRef] =
-        [llcmpresultptr, bcx.fcx.lltaskptr, lltydesc, lltydescs,
-         llrawlhsptr, llrawrhsptr, llop];
+        [llcmpresultptr, bcx.fcx.lltaskptr, lltydesc, lltydescs, llrawlhsptr,
+         llrawrhsptr, llop];
     Call(bcx, llfn, llargs);
     ret rslt(bcx, Load(bcx, llcmpresultptr));
 }
@@ -2083,16 +2051,15 @@ fn call_memmove(cx: &@block_ctxt, dst: ValueRef, src: ValueRef,
     // LLVM complains -- not even a constant element of a tydesc works).
 
     let i = bcx_ccx(cx).intrinsics;
-    assert (i.contains_key(~"llvm.memmove.p0i8.p0i8.i32"));
-    let memmove = i.get(~"llvm.memmove.p0i8.p0i8.i32");
+    assert (i.contains_key("llvm.memmove.p0i8.p0i8.i32"));
+    let memmove = i.get("llvm.memmove.p0i8.p0i8.i32");
     let src_ptr = PointerCast(cx, src, T_ptr(T_i8()));
     let dst_ptr = PointerCast(cx, dst, T_ptr(T_i8()));
     let size = IntCast(cx, n_bytes, T_i32());
     let align = C_int(1);
     let volatile = C_bool(false);
     ret rslt(cx,
-             Call(cx, memmove,
-                           [dst_ptr, src_ptr, size, align, volatile]));
+             Call(cx, memmove, [dst_ptr, src_ptr, size, align, volatile]));
 }
 
 fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef,
@@ -2100,8 +2067,8 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef,
     // FIXME: switch to the 64-bit variant when on such a platform.
 
     let i = bcx_ccx(cx).intrinsics;
-    assert (i.contains_key(~"llvm.memset.p0i8.i32"));
-    let memset = i.get(~"llvm.memset.p0i8.i32");
+    assert (i.contains_key("llvm.memset.p0i8.i32"));
+    let memset = i.get("llvm.memset.p0i8.i32");
     let dst_ptr = PointerCast(cx, dst, T_ptr(T_i8()));
     let size = IntCast(cx, n_bytes, T_i32());
     let align =
@@ -2110,8 +2077,7 @@ fn call_bzero(cx: &@block_ctxt, dst: ValueRef, n_bytes: ValueRef,
         } else { IntCast(cx, C_int(0), T_i32()) };
     let volatile = C_bool(false);
     ret rslt(cx,
-             Call(cx, memset,
-                           [dst_ptr, C_u8(0u), size, align, volatile]));
+             Call(cx, memset, [dst_ptr, C_u8(0u), size, align, volatile]));
 }
 
 fn memmove_ty(cx: &@block_ctxt, dst: ValueRef, src: ValueRef, t: ty::t) ->
@@ -2144,12 +2110,12 @@ fn type_is_structural_or_param(tcx: &ty::ctxt, t: ty::t) -> bool {
 fn copy_val(cx: &@block_ctxt, action: copy_action, dst: ValueRef,
             src: ValueRef, t: ty::t) -> @block_ctxt {
     if type_is_structural_or_param(bcx_ccx(cx).tcx, t) &&
-       action == DROP_EXISTING {
-        let do_copy_cx = new_sub_block_ctxt(cx, ~"do_copy");
-        let next_cx = new_sub_block_ctxt(cx, ~"next");
+           action == DROP_EXISTING {
+        let do_copy_cx = new_sub_block_ctxt(cx, "do_copy");
+        let next_cx = new_sub_block_ctxt(cx, "next");
         let self_assigning =
-            ICmp(cx, lib::llvm::LLVMIntNE,
-                          PointerCast(cx, dst, val_ty(src)), src);
+            ICmp(cx, lib::llvm::LLVMIntNE, PointerCast(cx, dst, val_ty(src)),
+                 src);
         CondBr(cx, self_assigning, do_copy_cx.llbb, next_cx.llbb);
         do_copy_cx = copy_val_no_check(do_copy_cx, action, dst, src, t);
         Br(do_copy_cx, next_cx.llbb);
@@ -2164,7 +2130,7 @@ fn copy_val_no_check(cx: &@block_ctxt, action: copy_action, dst: ValueRef,
     // FIXME this is just a clunky stopgap. we should do proper checking in an
     // earlier pass.
     if !ty::type_is_copyable(ccx.tcx, t) {
-        ccx.sess.span_fatal(cx.sp, ~"Copying a non-copyable type.");
+        ccx.sess.span_fatal(cx.sp, "Copying a non-copyable type.");
     }
 
     if ty::type_is_scalar(ccx.tcx, t) || ty::type_is_native(ccx.tcx, t) {
@@ -2172,23 +2138,20 @@ fn copy_val_no_check(cx: &@block_ctxt, action: copy_action, dst: ValueRef,
         ret cx;
     } else if ty::type_is_nil(ccx.tcx, t) || ty::type_is_bot(ccx.tcx, t) {
         ret cx;
-    } else if ty::type_is_boxed(ccx.tcx, t) ||
-              ty::type_is_vec(ccx.tcx, t) {
-        let bcx = if action == DROP_EXISTING {
-            drop_ty(cx, dst, t)
-        } else { cx };
+    } else if ty::type_is_boxed(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t) {
+        let bcx =
+            if action == DROP_EXISTING { drop_ty(cx, dst, t) } else { cx };
         Store(bcx, src, dst);
         bcx = take_ty(bcx, dst, t);
         ret bcx;
     } else if type_is_structural_or_param(ccx.tcx, t) {
-        let bcx = if action == DROP_EXISTING {
-            drop_ty(cx, dst, t)
-        } else { cx };
+        let bcx =
+            if action == DROP_EXISTING { drop_ty(cx, dst, t) } else { cx };
         bcx = memmove_ty(bcx, dst, src, t).bcx;
         ret take_ty(bcx, dst, t);
     }
-    ccx.sess.bug(~"unexpected type in trans::copy_val_no_check: " +
-                 ty_to_str(ccx.tcx, t));
+    ccx.sess.bug("unexpected type in trans::copy_val_no_check: " +
+                     ty_to_str(ccx.tcx, t));
 }
 
 
@@ -2201,19 +2164,15 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef,
             src: &lval_result, t: ty::t) -> @block_ctxt {
     let src_val = src.res.val;
     let tcx = bcx_tcx(cx);
-    if ty::type_is_scalar(tcx, t) ||
-           ty::type_is_native(tcx, t) {
+    if ty::type_is_scalar(tcx, t) || ty::type_is_native(tcx, t) {
         if src.is_mem { src_val = Load(cx, src_val); }
         Store(cx, src_val, dst);
         ret cx;
     } else if ty::type_is_nil(tcx, t) || ty::type_is_bot(tcx, t) {
         ret cx;
-    } else if ty::type_is_unique(tcx, t) ||
-              ty::type_is_boxed(tcx, t) {
+    } else if ty::type_is_unique(tcx, t) || ty::type_is_boxed(tcx, t) {
         if src.is_mem { src_val = Load(cx, src_val); }
-        if action == DROP_EXISTING {
-            cx = drop_ty(cx, dst, t);
-        }
+        if action == DROP_EXISTING { cx = drop_ty(cx, dst, t); }
         Store(cx, src_val, dst);
         if src.is_mem { ret zero_alloca(cx, src.res.val, t).bcx; }
 
@@ -2230,8 +2189,8 @@ fn move_val(cx: @block_ctxt, action: copy_action, dst: ValueRef,
             ret cx;
         }
     }
-    bcx_ccx(cx).sess.bug(~"unexpected type in trans::move_val: " +
-                         ty_to_str(tcx, t));
+    bcx_ccx(cx).sess.bug("unexpected type in trans::move_val: " +
+                             ty_to_str(tcx, t));
 }
 
 fn move_val_if_temp(cx: @block_ctxt, action: copy_action, dst: ValueRef,
@@ -2278,7 +2237,7 @@ fn trans_crate_lit(cx: &@crate_ctxt, lit: &ast::lit) -> ValueRef {
       ast::lit_bool(b) { ret C_bool(b); }
       ast::lit_nil. { ret C_nil(); }
       ast::lit_str(s) {
-        cx.sess.span_unimpl(lit.span, ~"unique string in this context");
+        cx.sess.span_unimpl(lit.span, "unique string in this context");
       }
     }
 }
@@ -2341,7 +2300,7 @@ fn trans_unary(cx: &@block_ctxt, op: ast::unop, e: &@ast::expr,
         ret rslt(bcx, sub.box);
       }
       ast::deref. {
-        bcx_ccx(cx).sess.bug(~"deref expressions should have been \
+        bcx_ccx(cx).sess.bug("deref expressions should have been \
                                  translated using trans_lval(), not \
                                  trans_unary()");
       }
@@ -2438,8 +2397,7 @@ fn autoderef(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> result_t {
     while true {
         alt ty::struct(ccx.tcx, t1) {
           ty::ty_box(mt) {
-            let body =
-                GEP(cx, v1, [C_int(0), C_int(abi::box_rc_field_body)]);
+            let body = GEP(cx, v1, [C_int(0), C_int(abi::box_rc_field_body)]);
             t1 = mt.ty;
 
             // Since we're changing levels of box indirection, we may have
@@ -2484,10 +2442,10 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr,
       ast::and. {
         // Lazy-eval and
         let lhs_res = trans_expr(cx, a);
-        let rhs_cx = new_scope_block_ctxt(cx, ~"rhs");
+        let rhs_cx = new_scope_block_ctxt(cx, "rhs");
         let rhs_res = trans_expr(rhs_cx, b);
 
-        let lhs_false_cx = new_scope_block_ctxt(cx, ~"lhs false");
+        let lhs_false_cx = new_scope_block_ctxt(cx, "lhs false");
         let lhs_false_res = rslt(lhs_false_cx, C_bool(false));
 
         // The following line ensures that any cleanups for rhs
@@ -2502,9 +2460,9 @@ fn trans_binary(cx: &@block_ctxt, op: ast::binop, a: &@ast::expr,
       ast::or. {
         // Lazy-eval or
         let lhs_res = trans_expr(cx, a);
-        let rhs_cx = new_scope_block_ctxt(cx, ~"rhs");
+        let rhs_cx = new_scope_block_ctxt(cx, "rhs");
         let rhs_res = trans_expr(rhs_cx, b);
-        let lhs_true_cx = new_scope_block_ctxt(cx, ~"lhs true");
+        let lhs_true_cx = new_scope_block_ctxt(cx, "lhs true");
         let lhs_true_res = rslt(lhs_true_cx, C_bool(true));
 
         // see the and case for an explanation
@@ -2550,17 +2508,15 @@ fn join_results(parent_cx: &@block_ctxt, t: TypeRef, ins: &[result]) ->
     }
     // We have >1 incoming edges. Make a join block and br+phi them into it.
 
-    let join_cx = new_sub_block_ctxt(parent_cx, ~"join");
+    let join_cx = new_sub_block_ctxt(parent_cx, "join");
     for r: result in live { Br(r.bcx, join_cx.llbb); }
     let phi = Phi(join_cx, t, vals, bbs);
     ret rslt(join_cx, phi);
 }
 
 fn join_branches(parent_cx: &@block_ctxt, ins: &[result]) -> @block_ctxt {
-    let out = new_sub_block_ctxt(parent_cx, ~"join");
-    for r: result in ins {
-        if !is_terminated(r.bcx) { Br(r.bcx, out.llbb); }
-    }
+    let out = new_sub_block_ctxt(parent_cx, "join");
+    for r: result in ins { if !is_terminated(r.bcx) { Br(r.bcx, out.llbb); } }
     ret out;
 }
 
@@ -2579,9 +2535,9 @@ fn trans_if(cx: &@block_ctxt, cond: &@ast::expr, thn: &ast::blk,
         } else { ret cond_res; }
     }
 
-    let then_cx = new_scope_block_ctxt(cx, ~"then");
+    let then_cx = new_scope_block_ctxt(cx, "then");
     let then_res = trans_block(then_cx, thn, output);
-    let else_cx = new_scope_block_ctxt(cx, ~"else");
+    let else_cx = new_scope_block_ctxt(cx, "else");
     // Synthesize a block here to act as the else block
     // containing an if expression. Needed in order for the
     // else scope to behave like a normal block scope. A tad
@@ -2613,17 +2569,19 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
     // obviously a bug.
     fn inner(cx: &@block_ctxt, local: @ast::local, curr: ValueRef, t: ty::t,
              body: &ast::blk, outer_next_cx: @block_ctxt) -> @block_ctxt {
-        let next_cx = new_sub_block_ctxt(cx, ~"next");
+        let next_cx = new_sub_block_ctxt(cx, "next");
         let scope_cx =
             new_loop_scope_block_ctxt(cx,
                                       option::some::<@block_ctxt>(next_cx),
-                                      outer_next_cx, ~"for loop scope");
+                                      outer_next_cx, "for loop scope");
         Br(cx, scope_cx.llbb);
         let local_res = alloc_local(scope_cx, local);
         let bcx = copy_val(local_res.bcx, INIT, local_res.val, curr, t);
         add_clean(scope_cx, local_res.val, t);
-        let bcx = trans_alt::bind_irrefutable_pat
-            (bcx, local.node.pat, local_res.val, cx.fcx.lllocals, false);
+        let bcx =
+            trans_alt::bind_irrefutable_pat(bcx, local.node.pat,
+                                            local_res.val, cx.fcx.lllocals,
+                                            false);
         bcx = trans_block(bcx, body, return).bcx;
         if !is_terminated(bcx) {
             Br(bcx, next_cx.llbb);
@@ -2631,11 +2589,12 @@ fn trans_for(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
         }
         ret next_cx;
     }
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let next_cx = new_sub_block_ctxt(cx, "next");
     let seq_ty = ty::expr_ty(bcx_tcx(cx), seq);
     let seq_res = trans_expr(cx, seq);
-    let bcx = iter_sequence(seq_res.bcx, seq_res.val, seq_ty,
-                            bind inner(_, local, _, _, body, next_cx));
+    let bcx =
+        iter_sequence(seq_res.bcx, seq_res.val, seq_ty,
+                      bind inner(_, local, _, _, body, next_cx));
     Br(bcx, next_cx.llbb);
     ret rslt(next_cx, C_nil());
 }
@@ -2742,8 +2701,8 @@ fn build_environment(bcx: @block_ctxt, lltydescs: [ValueRef],
 
 // Given a context and a list of upvars, build a closure. This just
 // collects the upvars and packages them up for build_environment.
-fn build_closure(cx: &@block_ctxt, upvars: &@[ast::def], copying: bool)
-    -> {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
+fn build_closure(cx: &@block_ctxt, upvars: &@[ast::def], copying: bool) ->
+   {ptr: ValueRef, ptrty: ty::t, bcx: @block_ctxt} {
     let closure_vals: [lval_result] = [];
     let closure_tys: [ty::t] = [];
     // If we need to, package up the iterator body to call
@@ -2785,11 +2744,9 @@ fn find_environment_tydescs(bcx: &@block_ctxt, envty: ty::t,
             let llenv = GEPi(bcx, closure, [0, abi::box_rc_field_body]);
             // Load the tydesc and find the size of the body
             let lldesc =
-                Load(bcx, GEPi(bcx, llenv,
-                                    [0, abi::closure_elt_tydesc]));
+                Load(bcx, GEPi(bcx, llenv, [0, abi::closure_elt_tydesc]));
             let llsz =
-                Load(bcx, GEPi(bcx, lldesc,
-                                    [0, abi::tydesc_field_size]));
+                Load(bcx, GEPi(bcx, lldesc, [0, abi::tydesc_field_size]));
 
             // Get the bindings pointer and add the size to it
             let llbinds = GEPi(bcx, llenv, [0, abi::closure_elt_bindings]);
@@ -2885,10 +2842,8 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
     let llenv = build_closure(cx, upvars, false);
 
     // Step 2: Declare foreach body function.
-    let s: istr =
-        mangle_internal_name_by_path_and_seq(lcx.ccx,
-                                             lcx.path,
-                                             ~"foreach");
+    let s: str =
+        mangle_internal_name_by_path_and_seq(lcx.ccx, lcx.path, "foreach");
 
     // The 'env' arg entering the body function is a fake env member (as in
     // the env-part of the normal rust calling convention) that actually
@@ -2899,8 +2854,7 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
         type_of_fn_from_ty(lcx.ccx, cx.sp,
                            ty::mk_iter_body_fn(lcx.ccx.tcx, decl_ty), 0u);
     let lliterbody: ValueRef =
-        decl_internal_fastcall_fn(lcx.ccx.llmod,
-                                  s, iter_body_llty);
+        decl_internal_fastcall_fn(lcx.ccx.llmod, s, iter_body_llty);
     let fcx = new_fn_ctxt_w_id(lcx, cx.sp, lliterbody, body.node.id);
     fcx.iterbodyty = cx.fcx.iterbodyty;
 
@@ -2936,11 +2890,11 @@ fn trans_for_each(cx: &@block_ctxt, local: &@ast::local, seq: &@ast::expr,
 
 fn trans_while(cx: &@block_ctxt, cond: &@ast::expr, body: &ast::blk) ->
    result {
-    let next_cx = new_sub_block_ctxt(cx, ~"while next");
-    let cond_cx = new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>,
-                                            next_cx, ~"while cond");
-    let body_cx =
-        new_scope_block_ctxt(cond_cx, ~"while loop body");
+    let next_cx = new_sub_block_ctxt(cx, "while next");
+    let cond_cx =
+        new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>, next_cx,
+                                  "while cond");
+    let body_cx = new_scope_block_ctxt(cond_cx, "while loop body");
     let body_res = trans_block(body_cx, body, return);
     let cond_res = trans_expr(cond_cx, cond);
     Br(body_res.bcx, cond_cx.llbb);
@@ -2952,10 +2906,10 @@ fn trans_while(cx: &@block_ctxt, cond: &@ast::expr, body: &ast::blk) ->
 
 fn trans_do_while(cx: &@block_ctxt, body: &ast::blk, cond: &@ast::expr) ->
    result {
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let next_cx = new_sub_block_ctxt(cx, "next");
     let body_cx =
         new_loop_scope_block_ctxt(cx, option::none::<@block_ctxt>, next_cx,
-                                  ~"do-while loop body");
+                                  "do-while loop body");
     let body_res = trans_block(body_cx, body, return);
     if is_terminated(body_res.bcx) {
         // This is kind of ridiculous, but no permutations
@@ -3003,8 +2957,7 @@ fn trans_external_path(cx: &@block_ctxt, did: &ast::def_id,
                        tpt: &ty::ty_param_kinds_and_ty) -> ValueRef {
     let lcx = cx.fcx.lcx;
     let name = csearch::get_symbol(lcx.ccx.sess.get_cstore(), did);
-    ret get_extern_const(lcx.ccx.externs, lcx.ccx.llmod,
-                         name,
+    ret get_extern_const(lcx.ccx.externs, lcx.ccx.llmod, name,
                          type_of_ty_param_kinds_and_ty(lcx, cx.sp, tpt));
 }
 
@@ -3045,9 +2998,11 @@ fn lookup_discriminant(lcx: &@local_ctxt, vid: &ast::def_id) -> ValueRef {
         // It's an external discriminant that we haven't seen yet.
         assert (vid.crate != ast::local_crate);
         let sym = csearch::get_symbol(lcx.ccx.sess.get_cstore(), vid);
-        let gvar = str::as_buf(sym, { |buf|
-            llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf)
-        });
+        let gvar =
+            str::as_buf(sym,
+                        {|buf|
+                            llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf)
+                        });
         llvm::LLVMSetLinkage(gvar,
                              lib::llvm::LLVMExternalLinkage as llvm::Linkage);
         llvm::LLVMSetGlobalConstant(gvar, True);
@@ -3081,14 +3036,15 @@ fn trans_local_var(cx: &@block_ctxt, def: &ast::def) -> lval_result {
         ret lval_mem(cx, cx.fcx.llobjfields.get(did.node));
       }
       _ {
-        bcx_ccx(cx).sess.span_unimpl
-            (cx.sp, ~"unsupported def type in trans_local_def");
+        bcx_ccx(cx).sess.span_unimpl(
+            cx.sp,
+            "unsupported def type in trans_local_def");
       }
     }
 }
 
-fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def,
-             id: ast::node_id) -> lval_result {
+fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def, id: ast::node_id) ->
+   lval_result {
     let ccx = bcx_ccx(cx);
     alt def {
       ast::def_fn(did, _) {
@@ -3114,8 +3070,7 @@ fn trans_var(cx: &@block_ctxt, sp: &span, def: &ast::def,
             if std::vec::len(ty::tag_variants(ccx.tcx, tid)) != 1u {
                 let lldiscrim_gv = lookup_discriminant(bcx.fcx.lcx, vid);
                 let lldiscrim = Load(bcx, lldiscrim_gv);
-                let lldiscrimptr =
-                    GEP(bcx, lltagptr, [C_int(0), C_int(0)]);
+                let lldiscrimptr = GEP(bcx, lltagptr, [C_int(0), C_int(0)]);
                 Store(bcx, lldiscrim, lldiscrimptr);
             }
             ret lval_val(bcx, lltagptr);
@@ -3162,8 +3117,7 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: ty::t,
       }
       ty::ty_obj(methods) {
         let ix: uint = ty::method_idx(bcx_ccx(cx).sess, sp, field, methods);
-        let vtbl =
-            GEP(r.bcx, r.val, [C_int(0), C_int(abi::obj_field_vtbl)]);
+        let vtbl = GEP(r.bcx, r.val, [C_int(0), C_int(abi::obj_field_vtbl)]);
         vtbl = Load(r.bcx, vtbl);
 
         let vtbl_type = T_ptr(T_array(T_ptr(T_nil()), ix + 1u));
@@ -3181,7 +3135,7 @@ fn trans_field(cx: &@block_ctxt, sp: &span, v: ValueRef, t0: ty::t,
         ret {llobj: some::<ValueRef>(r.val), method_ty: some::<ty::t>(fn_ty)
                 with lvo};
       }
-      _ { bcx_ccx(cx).sess.unimpl(~"field variant in trans_field"); }
+      _ { bcx_ccx(cx).sess.unimpl("field variant in trans_field"); }
     }
 }
 
@@ -3208,19 +3162,19 @@ fn trans_index(cx: &@block_ctxt, sp: &span, base: &@ast::expr,
     let unit_ty = node_id_type(bcx_ccx(cx), id);
     let unit_sz = size_of(bcx, unit_ty);
     bcx = unit_sz.bcx;
-    maybe_name_value(bcx_ccx(cx), unit_sz.val, ~"unit_sz");
+    maybe_name_value(bcx_ccx(cx), unit_sz.val, "unit_sz");
     let scaled_ix = Mul(bcx, ix_val, unit_sz.val);
-    maybe_name_value(bcx_ccx(cx), scaled_ix, ~"scaled_ix");
+    maybe_name_value(bcx_ccx(cx), scaled_ix, "scaled_ix");
     let lim = tvec::get_fill(bcx, v);
     let body = tvec::get_dataptr(bcx, v, type_of_or_i8(bcx, unit_ty));
     let bounds_check = ICmp(bcx, lib::llvm::LLVMIntULT, scaled_ix, lim);
-    let fail_cx = new_sub_block_ctxt(bcx, ~"fail");
-    let next_cx = new_sub_block_ctxt(bcx, ~"next");
+    let fail_cx = new_sub_block_ctxt(bcx, "fail");
+    let next_cx = new_sub_block_ctxt(bcx, "next");
     let ncx = bcx_ccx(next_cx);
     CondBr(bcx, bounds_check, next_cx.llbb, fail_cx.llbb);
     // fail: bad bounds check.
 
-    trans_fail(fail_cx, some::<span>(sp), ~"bounds check");
+    trans_fail(fail_cx, some::<span>(sp), "bounds check");
     let elt = if check type_has_static_size(ncx, unit_ty) {
           let elt_1 = GEP(next_cx, body, [ix_val]);
           let llunitty = type_of(ncx, sp, unit_ty);
@@ -3256,8 +3210,7 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result {
             alt ty::struct(ccx.tcx, t) {
               ty::ty_box(_) {
                 InBoundsGEP(sub.bcx, sub.val,
-                                          [C_int(0),
-                                           C_int(abi::box_rc_field_body)])
+                            [C_int(0), C_int(abi::box_rc_field_body)])
               }
               ty::ty_uniq(_) { fail "uniq lval translation unimplemented" }
               ty::ty_res(_, _, _) {
@@ -3286,7 +3239,7 @@ fn trans_lval_gen(cx: &@block_ctxt, e: &@ast::expr) -> lval_result {
           }
           _ {
             // Shouldn't happen.
-            bcx_ccx(cx).sess.bug(~"trans_lval called on \
+            bcx_ccx(cx).sess.bug("trans_lval called on \
                                          expr_self_method in \
                                          a context without llself");
           }
@@ -3392,7 +3345,7 @@ fn trans_cast(cx: &@block_ctxt, e: &@ast::expr, id: ast::node_id) -> result {
           {in: native_., out: native_.} {
             PointerCast(e_res.bcx, e_res.val, ll_t_out)
           }
-          _ { ccx.sess.bug(~"Translating unsupported cast.") }
+          _ { ccx.sess.bug("Translating unsupported cast.") }
         };
     ret rslt(e_res.bcx, newval);
 }
@@ -3430,8 +3383,8 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t,
     // construct and return that thunk.
 
     // Give the thunk a name, type, and value.
-    let s: istr =
-        mangle_internal_name_by_path_and_seq(ccx, cx.path, ~"thunk");
+    let s: str =
+        mangle_internal_name_by_path_and_seq(ccx, cx.path, "thunk");
     let llthunk_ty: TypeRef =
         get_pair_fn_ty(type_of(ccx, sp, incoming_fty));
     let llthunk: ValueRef =
@@ -3529,6 +3482,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t,
         let is_val = out_arg.mode == ty::mo_val;
         alt arg {
 
+
           // Arg provided at binding time; thunk copies it from
           // closure.
           some(e) {
@@ -3554,6 +3508,7 @@ fn trans_bind_thunk(cx: &@local_ctxt, sp: &span, incoming_fty: ty::t,
           }
 
 
+
           // Arg will be provided when the thunk is invoked.
           none. {
             let arg: ValueRef = llvm::LLVMGetParam(llthunk, a);
@@ -3701,7 +3656,8 @@ fn trans_arg_expr(cx: &@block_ctxt, arg: &ty::arg, lldestty0: TypeRef,
         }
     } else if type_is_immediate(ccx, e_ty) && !lv.is_mem {
         let r = do_spill(bcx, val, e_ty);
-        val = r.val; bcx = r.bcx;
+        val = r.val;
+        bcx = r.bcx;
     }
 
     if !is_bot && ty::type_contains_params(ccx.tcx, arg.ty) {
@@ -3834,7 +3790,7 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr,
     // NB: 'f' isn't necessarily a function; it might be an entire self-call
     // expression because of the hack that allows us to process self-calls
     // with trans_call.
-    let cx = new_scope_block_ctxt(in_cx, ~"call");
+    let cx = new_scope_block_ctxt(in_cx, "call");
     Br(in_cx, cx.llbb);
     let f_res = trans_lval_gen(cx, f);
     let fn_ty: ty::t;
@@ -3866,8 +3822,7 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr,
         let pair = res.val;
         faddr = GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_code)]);
         faddr = Load(bcx, faddr);
-        let llclosure =
-            GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_box)]);
+        let llclosure = GEP(bcx, pair, [C_int(0), C_int(abi::fn_field_box)]);
         llenv = Load(bcx, llclosure);
       }
     }
@@ -3915,11 +3870,9 @@ fn trans_call(in_cx: &@block_ctxt, f: &@ast::expr,
         for {v: v, t: t}: {v: ValueRef, t: ty::t} in args_res.to_zero {
             zero_alloca(bcx, v, t)
         }
-        for v: ValueRef in args_res.to_revoke {
-            revoke_clean(bcx, v)
-        }
+        for v: ValueRef in args_res.to_revoke { revoke_clean(bcx, v) }
         bcx = trans_block_cleanups(bcx, cx);
-        let next_cx = new_sub_block_ctxt(in_cx, ~"next");
+        let next_cx = new_sub_block_ctxt(in_cx, "next");
         Br(bcx, next_cx.llbb);
         bcx = next_cx;
     }
@@ -3975,8 +3928,8 @@ fn trans_rec(cx: &@block_ctxt, fields: &[ast::field],
             if str::eq(f.node.ident, tf.ident) {
                 expr_provided = true;
                 let lv = trans_lval(bcx, f.node.expr);
-                bcx = move_val_if_temp(lv.res.bcx, INIT, dst_res.val,
-                                       lv, e_ty);
+                bcx =
+                    move_val_if_temp(lv.res.bcx, INIT, dst_res.val, lv, e_ty);
                 break;
             }
         }
@@ -4029,12 +3982,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         let ccx = bcx_ccx(cx);
         let llfnty: TypeRef =
             type_of_fn_from_ty(ccx, e.span, node_id_type(ccx, e.id), 0u);
-        let sub_cx = extend_path(cx.fcx.lcx,
-                                 ccx.names.next(~"anon"));
-        let s = mangle_internal_name_by_path(ccx,
-                                             sub_cx.path);
-        let llfn = decl_internal_fastcall_fn(ccx.llmod,
-                                             s, llfnty);
+        let sub_cx = extend_path(cx.fcx.lcx, ccx.names.next("anon"));
+        let s = mangle_internal_name_by_path(ccx, sub_cx.path);
+        let llfn = decl_internal_fastcall_fn(ccx.llmod, s, llfnty);
 
         let fn_res =
             trans_closure(some(cx), some(llfnty), sub_cx, e.span, f, llfn,
@@ -4043,16 +3993,15 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
             alt fn_res {
               some(fn_pair) { fn_pair }
               none. {
-                {fn_pair: create_fn_pair(ccx, s,
-                                         llfnty, llfn, false),
+                {fn_pair: create_fn_pair(ccx, s, llfnty, llfn, false),
                  bcx: cx}
               }
             };
         ret rslt(fn_pair.bcx, fn_pair.fn_pair);
       }
       ast::expr_block(blk) {
-        let sub_cx = new_scope_block_ctxt(cx, ~"block-expr body");
-        let next_cx = new_sub_block_ctxt(cx, ~"next");
+        let sub_cx = new_scope_block_ctxt(cx, "block-expr body");
+        let next_cx = new_sub_block_ctxt(cx, "next");
         let sub =
             with_out_method(bind trans_block(sub_cx, blk, _), cx, e.id,
                             output);
@@ -4073,8 +4022,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         let t = ty::expr_ty(bcx_tcx(cx), src);
         // FIXME: calculate copy init-ness in typestate.
 
-        let bcx = move_val(rhs_res.res.bcx, DROP_EXISTING, lhs_res.res.val,
-                           rhs_res, t);
+        let bcx =
+            move_val(rhs_res.res.bcx, DROP_EXISTING, lhs_res.res.val, rhs_res,
+                     t);
         ret rslt(bcx, C_nil());
       }
       ast::expr_assign(dst, src) {
@@ -4084,8 +4034,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         let rhs = trans_lval(lhs_res.res.bcx, src);
         let t = ty::expr_ty(bcx_tcx(cx), src);
         // FIXME: calculate copy init-ness in typestate.
-        let bcx = move_val_if_temp(rhs.res.bcx, DROP_EXISTING,
-                                   lhs_res.res.val, rhs, t);
+        let bcx =
+            move_val_if_temp(rhs.res.bcx, DROP_EXISTING, lhs_res.res.val, rhs,
+                             t);
         ret rslt(bcx, C_nil());
       }
       ast::expr_swap(dst, src) {
@@ -4095,13 +4046,13 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
 
         let rhs_res = trans_lval(lhs_res.res.bcx, src);
         let t = ty::expr_ty(bcx_tcx(cx), src);
-        let {bcx, val: tmp_alloc} = alloc_ty(rhs_res.res.bcx, t);
+        let {bcx: bcx, val: tmp_alloc} = alloc_ty(rhs_res.res.bcx, t);
         // Swap through a temporary.
 
         bcx = move_val(bcx, INIT, tmp_alloc, lhs_res, t);
         bcx = move_val(bcx, INIT, lhs_res.res.val, rhs_res, t);
-        bcx = move_val(bcx, INIT, rhs_res.res.val,
-                       lval_mem(bcx, tmp_alloc), t);
+        bcx =
+            move_val(bcx, INIT, rhs_res.res.val, lval_mem(bcx, tmp_alloc), t);
         ret rslt(bcx, C_nil());
       }
       ast::expr_assign_op(op, dst, src) {
@@ -4115,14 +4066,15 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
           ty::ty_vec(_) {
             alt src.node {
               ast::expr_vec(args, _) {
-                let bcx = tvec::trans_append_literal
-                    (lhs_res.res.bcx, lhs_res.res.val, t, args);
+                let bcx =
+                    tvec::trans_append_literal(lhs_res.res.bcx,
+                                               lhs_res.res.val, t, args);
                 ret rslt(bcx, C_nil());
               }
-              _ {}
+              _ { }
             }
           }
-          _ {}
+          _ { }
         }
 
         // FIXME Fill in lhs_res.res.bcx.sp
@@ -4141,8 +4093,9 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
             trans_eager_binop(rhs_res.bcx, op, lhs_val, t, rhs_res.val, t);
         // FIXME: calculate copy init-ness in typestate.
         // This is always a temporary, so can always be safely moved
-        let bcx = move_val(v.bcx, DROP_EXISTING, lhs_res.res.val,
-                           lval_val(v.bcx, v.val), t);
+        let bcx =
+            move_val(v.bcx, DROP_EXISTING, lhs_res.res.val,
+                     lval_val(v.bcx, v.val), t);
         ret rslt(bcx, C_nil());
       }
       ast::expr_bind(f, args) { ret trans_bind(cx, f, args, e.id); }
@@ -4153,12 +4106,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
       ast::expr_vec(args, _) { ret tvec::trans_vec(cx, args, e.id); }
       ast::expr_rec(args, base) { ret trans_rec(cx, args, base, e.id); }
       ast::expr_tup(args) { ret trans_tup(cx, args, e.id); }
-      ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug(~"unexpanded macro"); }
+      ast::expr_mac(_) { ret bcx_ccx(cx).sess.bug("unexpanded macro"); }
       ast::expr_fail(expr) { ret trans_fail_expr(cx, some(e.span), expr); }
       ast::expr_log(lvl, a) { ret trans_log(lvl, cx, a); }
-      ast::expr_assert(a) { ret trans_check_expr(cx, a, ~"Assertion"); }
+      ast::expr_assert(a) { ret trans_check_expr(cx, a, "Assertion"); }
       ast::expr_check(ast::checked., a) {
-        ret trans_check_expr(cx, a, ~"Predicate");
+        ret trans_check_expr(cx, a, "Predicate");
       }
       ast::expr_check(ast::unchecked., a) {
         /* Claims are turned on and off by a global variable
@@ -4168,12 +4121,12 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
            otherwise. */
         let c =
             get_extern_const(bcx_ccx(cx).externs, bcx_ccx(cx).llmod,
-                             ~"check_claims", T_bool());
+                             "check_claims", T_bool());
         let cond = Load(cx, c);
 
-        let then_cx = new_scope_block_ctxt(cx, ~"claim_then");
-        let check_res = trans_check_expr(then_cx, a, ~"Claim");
-        let else_cx = new_scope_block_ctxt(cx, ~"else");
+        let then_cx = new_scope_block_ctxt(cx, "claim_then");
+        let check_res = trans_check_expr(then_cx, a, "Claim");
+        let else_cx = new_scope_block_ctxt(cx, "else");
         let els = rslt(else_cx, C_nil());
 
         CondBr(cx, cond, then_cx.llbb, else_cx.llbb);
@@ -4188,7 +4141,7 @@ fn trans_expr_out(cx: &@block_ctxt, e: &@ast::expr, output: out_method) ->
         // that is_call_expr(ex) -- but we don't support that
         // yet
         // FIXME
-        check ast_util::is_call_expr(ex);
+        check (ast_util::is_call_expr(ex));
         ret trans_be(cx, ex);
       }
       ast::expr_anon_obj(anon_obj) {
@@ -4236,7 +4189,7 @@ fn with_out_method(work: fn(&out_method) -> result, cx: @block_ctxt,
 // immediate-ness of the type.
 fn type_is_immediate(ccx: &@crate_ctxt, t: ty::t) -> bool {
     ret ty::type_is_scalar(ccx.tcx, t) || ty::type_is_boxed(ccx.tcx, t) ||
-        ty::type_is_native(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t);
+            ty::type_is_native(ccx.tcx, t) || ty::type_is_vec(ccx.tcx, t);
 }
 
 fn do_spill(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> result {
@@ -4271,27 +4224,28 @@ fn load_if_immediate(cx: &@block_ctxt, v: ValueRef, t: ty::t) -> ValueRef {
 
 fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result {
     let lcx = cx.fcx.lcx;
-    let modname = str::connect(lcx.module_path, ~"::");
+    let modname = str::connect(lcx.module_path, "::");
     let global;
     if lcx.ccx.module_data.contains_key(modname) {
         global = lcx.ccx.module_data.get(modname);
     } else {
         let s =
-            link::mangle_internal_name_by_path_and_seq(
-                lcx.ccx,
-                lcx.module_path,
-                ~"loglevel");
-        global = str::as_buf(s, { |buf|
-            llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf)
-        });
+            link::mangle_internal_name_by_path_and_seq(lcx.ccx,
+                                                       lcx.module_path,
+                                                       "loglevel");
+        global =
+            str::as_buf(s,
+                        {|buf|
+                            llvm::LLVMAddGlobal(lcx.ccx.llmod, T_int(), buf)
+                        });
         llvm::LLVMSetGlobalConstant(global, False);
         llvm::LLVMSetInitializer(global, C_null(T_int()));
         llvm::LLVMSetLinkage(global,
                              lib::llvm::LLVMInternalLinkage as llvm::Linkage);
         lcx.ccx.module_data.insert(modname, global);
     }
-    let log_cx = new_scope_block_ctxt(cx, ~"log");
-    let after_cx = new_sub_block_ctxt(cx, ~"after");
+    let log_cx = new_scope_block_ctxt(cx, "log");
+    let after_cx = new_sub_block_ctxt(cx, "after");
     let load = Load(cx, global);
     let test = ICmp(cx, lib::llvm::LLVMIntSGE, load, C_int(lvl));
     CondBr(cx, test, log_cx.llbb, after_cx.llbb);
@@ -4319,12 +4273,12 @@ fn trans_log(lvl: int, cx: &@block_ctxt, e: &@ast::expr) -> result {
     ret rslt(after_cx, C_nil());
 }
 
-fn trans_check_expr(cx: &@block_ctxt, e: &@ast::expr, s: &istr) -> result {
+fn trans_check_expr(cx: &@block_ctxt, e: &@ast::expr, s: &str) -> result {
     let cond_res = trans_expr(cx, e);
-    let expr_str = s + ~" " + expr_to_str(e) + ~" failed";
-    let fail_cx = new_sub_block_ctxt(cx, ~"fail");
+    let expr_str = s + " " + expr_to_str(e) + " failed";
+    let fail_cx = new_sub_block_ctxt(cx, "fail");
     trans_fail(fail_cx, some::<span>(e.span), expr_str);
-    let next_cx = new_sub_block_ctxt(cx, ~"next");
+    let next_cx = new_sub_block_ctxt(cx, "next");
     CondBr(cond_res.bcx, cond_res.val, next_cx.llbb, fail_cx.llbb);
     ret rslt(next_cx, C_nil());
 }
@@ -4340,21 +4294,23 @@ fn trans_fail_expr(cx: &@block_ctxt, sp_opt: &option::t<span>,
         bcx = expr_res.bcx;
 
         if ty::type_is_str(tcx, e_ty) {
-            let data = tvec::get_dataptr(
-                bcx, expr_res.val,
-                type_of_or_i8(bcx, ty::mk_mach(tcx, ast::ty_u8)));
+            let data =
+                tvec::get_dataptr(bcx, expr_res.val,
+                                  type_of_or_i8(bcx,
+                                                ty::mk_mach(tcx,
+                                                            ast::ty_u8)));
             ret trans_fail_value(bcx, sp_opt, data);
         } else {
             bcx_ccx(cx).sess.span_bug(expr.span,
-                                      ~"fail called with unsupported type "
-                                      + ty_to_str(tcx, e_ty));
+                                      "fail called with unsupported type " +
+                                          ty_to_str(tcx, e_ty));
         }
       }
-      _ { ret trans_fail(bcx, sp_opt, ~"explicit failure"); }
+      _ { ret trans_fail(bcx, sp_opt, "explicit failure"); }
     }
 }
 
-fn trans_fail(cx: &@block_ctxt, sp_opt: &option::t<span>, fail_str: &istr) ->
+fn trans_fail(cx: &@block_ctxt, sp_opt: &option::t<span>, fail_str: &str) ->
    result {
     let V_fail_str = C_cstr(bcx_ccx(cx), fail_str);
     ret trans_fail_value(cx, sp_opt, V_fail_str);
@@ -4370,7 +4326,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>,
         V_filename = C_cstr(bcx_ccx(cx), loc.filename);
         V_line = loc.line as int;
       }
-      none. { V_filename = C_cstr(bcx_ccx(cx), ~"<runtime>"); V_line = 0; }
+      none. { V_filename = C_cstr(bcx_ccx(cx), "<runtime>"); V_line = 0; }
     }
     let V_str = PointerCast(cx, V_fail_str, T_ptr(T_i8()));
     V_filename = PointerCast(cx, V_filename, T_ptr(T_i8()));
@@ -4381,7 +4337,7 @@ fn trans_fail_value(cx: &@block_ctxt, sp_opt: &option::t<span>,
 }
 
 fn trans_put(in_cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
-    let cx = new_scope_block_ctxt(in_cx, ~"put");
+    let cx = new_scope_block_ctxt(in_cx, "put");
     Br(in_cx, cx.llbb);
     let llcallee = C_nil();
     let llenv = C_nil();
@@ -4413,7 +4369,7 @@ fn trans_put(in_cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
     }
     FastCall(bcx, llcallee, llargs);
     bcx = trans_block_cleanups(bcx, cx);
-    let next_cx = new_sub_block_ctxt(in_cx, ~"next");
+    let next_cx = new_sub_block_ctxt(in_cx, "next");
     Br(bcx, next_cx.llbb);
     ret rslt(next_cx, C_nil());
 }
@@ -4454,7 +4410,7 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result {
                   _ { Br(bcx, cleanup_cx.llbb); }
                 }
             }
-            ret rslt(new_sub_block_ctxt(bcx, ~"break_cont.unreachable"),
+            ret rslt(new_sub_block_ctxt(bcx, "break_cont.unreachable"),
                      C_nil());
           }
           _ {
@@ -4463,9 +4419,9 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result {
               parent_none. {
                 bcx_ccx(cx).sess.span_fatal(sp,
                                             if to_end {
-                                                ~"Break"
-                                            } else { ~"Cont" } +
-                                                ~" outside a loop");
+                                                "Break"
+                                            } else { "Cont" } +
+                                                " outside a loop");
               }
             }
           }
@@ -4473,7 +4429,7 @@ fn trans_break_cont(sp: &span, cx: &@block_ctxt, to_end: bool) -> result {
     }
     // If we get here without returning, it's a bug
 
-    bcx_ccx(cx).sess.bug(~"in trans::trans_break_cont()");
+    bcx_ccx(cx).sess.bug("in trans::trans_break_cont()");
 }
 
 fn trans_break(sp: &span, cx: &@block_ctxt) -> result {
@@ -4503,9 +4459,7 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
             };
         if is_local {
             bcx = move_val(bcx, INIT, cx.fcx.llretptr, lv, t);
-        } else {
-            bcx = move_val_if_temp(bcx, INIT, cx.fcx.llretptr, lv, t);
-        }
+        } else { bcx = move_val_if_temp(bcx, INIT, cx.fcx.llretptr, lv, t); }
       }
       _ {
         let t = llvm::LLVMGetElementType(val_ty(cx.fcx.llretptr));
@@ -4524,14 +4478,14 @@ fn trans_ret(cx: &@block_ctxt, e: &option::t<@ast::expr>) -> result {
         }
     }
     build_return(bcx);
-    ret rslt(new_sub_block_ctxt(bcx, ~"ret.unreachable"), C_nil());
+    ret rslt(new_sub_block_ctxt(bcx, "ret.unreachable"), C_nil());
 }
 
 fn build_return(bcx: &@block_ctxt) { Br(bcx, bcx_fcx(bcx).llreturn); }
 
 // fn trans_be(cx: &@block_ctxt, e: &@ast::expr) -> result {
-fn trans_be(cx: &@block_ctxt, e: &@ast::expr)
-    : ast_util::is_call_expr(e) -> result {
+fn trans_be(cx: &@block_ctxt, e: &@ast::expr) : ast_util::is_call_expr(e) ->
+   result {
 
     // FIXME: Turn this into a real tail call once
     // calling convention issues are settled
@@ -4545,9 +4499,7 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result {
     // Make a note to drop this slot on the way out.
     add_clean(bcx, llptr, ty);
 
-    if (must_zero(local)) {
-        bcx = zero_alloca(bcx, llptr, ty).bcx;
-    }
+    if must_zero(local) { bcx = zero_alloca(bcx, llptr, ty).bcx; }
 
     alt local.node.init {
       some(init) {
@@ -4575,9 +4527,7 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result {
 
     fn must_zero(local: &@ast::local) -> bool {
         alt local.node.init {
-          some(init) {
-            might_not_init(init.expr)
-          }
+          some(init) { might_not_init(init.expr) }
           none. { true }
         }
     }
@@ -4585,25 +4535,24 @@ fn init_local(bcx: @block_ctxt, local: &@ast::local) -> result {
     fn might_not_init(expr: &@ast::expr) -> bool {
         type env = @mutable bool;
         let e = @mutable false;
-        let visitor = visit::mk_vt(@{
-            visit_expr: fn(ex: &@ast::expr, e: &env, v: &vt<env>) {
-                // FIXME: Probably also need to account for expressions that
-                // fail but since we don't unwind yet, it doesn't seem to be a
-                // problem
-                let might_not_init = alt ex.node {
-                  ast::expr_ret(_) { true }
-                  ast::expr_break. { true }
-                  ast::expr_cont. { true }
-                  _ { false }
-                };
-                if might_not_init {
-                    *e = true;
-                } else {
-                    visit::visit_expr(ex, e, v);
-                }
-            }
-            with *visit::default_visitor()
-        });
+        // FIXME: Probably also need to account for expressions that
+        // fail but since we don't unwind yet, it doesn't seem to be a
+        // problem
+        let visitor =
+            visit::mk_vt(
+                         @{visit_expr:
+                               fn (ex: &@ast::expr, e: &env, v: &vt<env>) {
+                                   let might_not_init =
+                                       alt ex.node {
+                                         ast::expr_ret(_) { true }
+                                         ast::expr_break. { true }
+                                         ast::expr_cont. { true }
+                                         _ { false }
+                                       };
+                                   if might_not_init {
+                                       *e = true;
+                                   } else { visit::visit_expr(ex, e, v); }
+                               } with *visit::default_visitor()});
         visitor.visit_expr(expr, e, visitor);
         ret *e;
     }
@@ -4642,7 +4591,7 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result {
           ast::decl_item(i) { trans_item(cx.fcx.lcx, *i); }
         }
       }
-      _ { bcx_ccx(cx).sess.unimpl(~"stmt variant"); }
+      _ { bcx_ccx(cx).sess.unimpl("stmt variant"); }
     }
     ret rslt(bcx, C_nil());
 }
@@ -4650,15 +4599,14 @@ fn trans_stmt(cx: &@block_ctxt, s: &ast::stmt) -> result {
 // You probably don't want to use this one. See the
 // next three functions instead.
 fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind,
-                  name: &istr) -> @block_ctxt {
-    let s = ~"";
+                  name: &str) -> @block_ctxt {
+    let s = "";
     if cx.lcx.ccx.sess.get_opts().save_temps ||
            cx.lcx.ccx.sess.get_opts().debuginfo {
         s = cx.lcx.ccx.names.next(name);
     }
-    let llbb: BasicBlockRef = str::as_buf(s, { |buf|
-        llvm::LLVMAppendBasicBlock(cx.llfn, buf)
-    });
+    let llbb: BasicBlockRef =
+        str::as_buf(s, {|buf| llvm::LLVMAppendBasicBlock(cx.llfn, buf) });
     ret @{llbb: llbb,
           mutable terminated: false,
           parent: parent,
@@ -4671,25 +4619,25 @@ fn new_block_ctxt(cx: &@fn_ctxt, parent: &block_parent, kind: block_kind,
 
 // Use this when you're at the top block of a function or the like.
 fn new_top_block_ctxt(fcx: &@fn_ctxt) -> @block_ctxt {
-    ret new_block_ctxt(fcx, parent_none, SCOPE_BLOCK, ~"function top level");
+    ret new_block_ctxt(fcx, parent_none, SCOPE_BLOCK, "function top level");
 }
 
 
 // Use this when you're at a curly-brace or similar lexical scope.
-fn new_scope_block_ctxt(bcx: &@block_ctxt, n: &istr) -> @block_ctxt {
+fn new_scope_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt {
     ret new_block_ctxt(bcx.fcx, parent_some(bcx), SCOPE_BLOCK, n);
 }
 
 fn new_loop_scope_block_ctxt(bcx: &@block_ctxt,
                              _cont: &option::t<@block_ctxt>,
-                             _break: &@block_ctxt, n: &istr) -> @block_ctxt {
+                             _break: &@block_ctxt, n: &str) -> @block_ctxt {
     ret new_block_ctxt(bcx.fcx, parent_some(bcx),
                        LOOP_SCOPE_BLOCK(_cont, _break), n);
 }
 
 
 // Use this when you're making a general CFG BB within a scope.
-fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &istr) -> @block_ctxt {
+fn new_sub_block_ctxt(bcx: &@block_ctxt, n: &str) -> @block_ctxt {
     ret new_block_ctxt(bcx.fcx, parent_some(bcx), NON_SCOPE_BLOCK, n);
 }
 
@@ -4734,7 +4682,7 @@ fn trans_fn_cleanups(fcx: &@fn_ctxt, cx: &@block_ctxt) {
       some(lltoken_) {
         let lltoken = lltoken_; // satisfy alias checker
         Call(cx, fcx_ccx(fcx).upcalls.dynastack_free,
-                  [fcx.lltaskptr, lltoken]);
+             [fcx.lltaskptr, lltoken]);
       }
       none. {/* nothing to do */ }
     }
@@ -4818,9 +4766,9 @@ fn alloc_local(cx: &@block_ctxt, local: &@ast::local) -> result {
     alt local.node.pat.node {
       ast::pat_bind(ident) {
         if bcx_ccx(cx).sess.get_opts().debuginfo {
-            let _: () = str::as_buf(ident, { |buf|
-                llvm::LLVMSetValueName(r.val, buf)
-            });
+            let _: () =
+                str::as_buf(ident,
+                            {|buf| llvm::LLVMSetValueName(r.val, buf) });
         }
       }
       _ { }
@@ -4887,7 +4835,7 @@ fn trans_block(cx: &@block_ctxt, b: &ast::blk, output: &out_method) ->
 }
 
 fn new_local_ctxt(ccx: &@crate_ctxt) -> @local_ctxt {
-    let pth: [istr] = [];
+    let pth: [str] = [];
     ret @{path: pth,
           module_path: [ccx.link_meta.name],
           obj_typarams: [],
@@ -4904,21 +4852,21 @@ fn mk_standard_basic_blocks(llfn: ValueRef) ->
     dt: BasicBlockRef,
     da: BasicBlockRef,
     rt: BasicBlockRef} {
-    ret {sa: str::as_buf(~"statuc_allocas", { |buf|
-             llvm::LLVMAppendBasicBlock(llfn, buf)
-                                             }),
-         ca: str::as_buf(~"copy_args", { |buf|
-             llvm::LLVMAppendBasicBlock(llfn, buf)
-                                        }),
-         dt: str::as_buf(~"derived_tydescs", { |buf|
-             llvm::LLVMAppendBasicBlock(llfn, buf)
-                                              }),
-         da: str::as_buf(~"dynamic_allocas", { |buf|
-             llvm::LLVMAppendBasicBlock(llfn, buf)
-                                              }),
-         rt: str::as_buf(~"return", { |buf|
-             llvm::LLVMAppendBasicBlock(llfn, buf)
-                                     })};
+    ret {sa:
+             str::as_buf("statuc_allocas",
+                         {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }),
+         ca:
+             str::as_buf("copy_args",
+                         {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }),
+         dt:
+             str::as_buf("derived_tydescs",
+                         {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }),
+         da:
+             str::as_buf("dynamic_allocas",
+                         {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) }),
+         rt:
+             str::as_buf("return",
+                         {|buf| llvm::LLVMAppendBasicBlock(llfn, buf) })};
 }
 
 
@@ -5028,8 +4976,8 @@ fn create_llargs_for_fn_args(cx: &@fn_ctxt, proto: ast::proto,
     }
 }
 
-fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt,
-                        args: &[ast::arg], arg_tys: &[ty::arg]) {
+fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt, args: &[ast::arg],
+                        arg_tys: &[ty::arg]) {
     let llcopyargs = new_raw_block_ctxt(fcx, fcx.llcopyargs);
     let bcx = llcopyargs;
     let arg_n: uint = 0u;
@@ -5037,6 +4985,7 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt,
         let arg_ty = arg_tys[arg_n].ty;
         alt aarg.mode {
           ast::val. {
+
             // Structural types are passed by pointer, and we use the
             // pointed-to memory for the local.
             if !type_is_structural_or_param(fcx_tcx(fcx), arg_ty) {
@@ -5060,7 +5009,7 @@ fn copy_args_to_allocas(fcx: @fn_ctxt, scope: @block_ctxt,
           ast::move. {
             add_clean(scope, bcx.fcx.llargs.get(aarg.id), arg_ty);
           }
-          _ {}
+          _ { }
         }
         arg_n += 1u;
     }
@@ -5090,14 +5039,13 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) {
     let fields_tup_ty = ty::mk_tup(fcx.lcx.ccx.tcx, field_tys);
     let n_typarams = std::vec::len::<ast::ty_param>(bcx.fcx.lcx.obj_typarams);
     let llobj_box_ty: TypeRef = T_obj_ptr(*bcx_ccx(bcx), n_typarams);
-    let box_cell =
-        GEP(bcx, llself.v, [C_int(0), C_int(abi::obj_field_box)]);
+    let box_cell = GEP(bcx, llself.v, [C_int(0), C_int(abi::obj_field_box)]);
     let box_ptr = Load(bcx, box_cell);
     box_ptr = PointerCast(bcx, box_ptr, llobj_box_ty);
     let obj_typarams =
         GEP(bcx, box_ptr,
-                      [C_int(0), C_int(abi::box_rc_field_body),
-                       C_int(abi::obj_body_elt_typarams)]);
+            [C_int(0), C_int(abi::box_rc_field_body),
+             C_int(abi::obj_body_elt_typarams)]);
     // The object fields immediately follow the type parameters, so we skip
     // over them to get the pointer.
 
@@ -5139,10 +5087,8 @@ fn populate_fn_ctxt_from_llself(fcx: @fn_ctxt, llself: val_self_pair) {
 // lldynamicallocas -> lltop edges, and builds the return block.
 fn finish_fn(fcx: &@fn_ctxt, lltop: BasicBlockRef) {
     Br(new_raw_block_ctxt(fcx, fcx.llstaticallocas), fcx.llcopyargs);
-    Br(new_raw_block_ctxt(fcx, fcx.llcopyargs),
-            fcx.llderivedtydescs_first);
-    Br(new_raw_block_ctxt(fcx, fcx.llderivedtydescs),
-            fcx.lldynamicallocas);
+    Br(new_raw_block_ctxt(fcx, fcx.llcopyargs), fcx.llderivedtydescs_first);
+    Br(new_raw_block_ctxt(fcx, fcx.llderivedtydescs), fcx.lldynamicallocas);
     Br(new_raw_block_ctxt(fcx, fcx.lldynamicallocas), lltop);
 
     let ret_cx = new_raw_block_ctxt(fcx, fcx.llreturn);
@@ -5245,8 +5191,7 @@ fn trans_fn(cx: @local_ctxt, sp: &span, f: &ast::_fn, llfndecl: ValueRef,
     let start = time::get_time();
     trans_fn_inner(cx, sp, f, llfndecl, ty_self, ty_params, id);
     let end = time::get_time();
-    log_fn_time(cx.ccx, str::connect(cx.path, ~"::"),
-                start, end);
+    log_fn_time(cx.ccx, str::connect(cx.path, "::"), start, end);
 }
 
 fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn,
@@ -5255,7 +5200,7 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn,
     let llctor_decl;
     alt cx.ccx.item_ids.find(ctor_id) {
       some(x) { llctor_decl = x; }
-      _ { cx.ccx.sess.span_fatal(sp, ~"unbound ctor_id in trans_res_ctor"); }
+      _ { cx.ccx.sess.span_fatal(sp, "unbound ctor_id in trans_res_ctor"); }
     }
     let fcx = new_fn_ctxt(cx, sp, llctor_decl);
     let ret_t = ty::ret_ty_of_fn(cx.ccx.tcx, ctor_id);
@@ -5268,8 +5213,7 @@ fn trans_res_ctor(cx: @local_ctxt, sp: &span, dtor: &ast::_fn,
     let arg;
     alt fcx.llargs.find(dtor.decl.inputs[0].id) {
       some(x) { arg = load_if_immediate(bcx, x, arg_t); }
-      _ { cx.ccx.sess.span_fatal(
-          sp, ~"unbound dtor decl in trans_res_ctor"); }
+      _ { cx.ccx.sess.span_fatal(sp, "unbound dtor decl in trans_res_ctor"); }
     }
     let llretptr = fcx.llretptr;
     if ty::type_has_dynamic_size(cx.ccx.tcx, ret_t) {
@@ -5303,7 +5247,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
         fn_args +=
             [{mode: ast::alias(false),
               ty: varg.ty,
-              ident: ~"arg" + uint::to_str(i, 10u),
+              ident: "arg" + uint::to_str(i, 10u),
               id: varg.id}];
     }
     assert (cx.ccx.item_ids.contains_key(variant.node.id));
@@ -5312,7 +5256,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
       some(x) { llfndecl = x; }
       _ {
         cx.ccx.sess.span_fatal(variant.span,
-                               ~"unbound variant id in trans_tag_variant");
+                               "unbound variant id in trans_tag_variant");
       }
     }
     let fcx = new_fn_ctxt(cx, variant.span, llfndecl);
@@ -5337,7 +5281,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
         } else {
             let lltagptr =
                 PointerCast(bcx, fcx.llretptr,
-                                      T_opaque_tag_ptr(fcx.lcx.ccx.tn));
+                            T_opaque_tag_ptr(fcx.lcx.ccx.tn));
             let lldiscrimptr = GEP(bcx, lltagptr, [C_int(0), C_int(0)]);
             Store(bcx, C_int(index), lldiscrimptr);
             GEP(bcx, lltagptr, [C_int(0), C_int(1)])
@@ -5346,9 +5290,8 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
     let t_id = ast_util::local_def(tag_id);
     let v_id = ast_util::local_def(variant.node.id);
     for va: ast::variant_arg in variant.node.args {
-        check valid_variant_index(i, bcx, t_id, v_id);
-        let rslt =
-            GEP_tag(bcx, llblobptr, t_id, v_id, ty_param_substs, i);
+        check (valid_variant_index(i, bcx, t_id, v_id));
+        let rslt = GEP_tag(bcx, llblobptr, t_id, v_id, ty_param_substs, i);
         bcx = rslt.bcx;
         let lldestptr = rslt.val;
         // If this argument to this function is a tag, it'll have come in to
@@ -5359,7 +5302,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
         alt fcx.llargs.find(va.id) {
           some(x) { llargptr = PointerCast(bcx, x, val_ty(lldestptr)); }
           none. {
-            bcx_ccx(bcx).sess.bug(~"unbound argptr in \
+            bcx_ccx(bcx).sess.bug("unbound argptr in \
                                       trans_tag_variant");
           }
         }
@@ -5384,7 +5327,7 @@ fn trans_tag_variant(cx: @local_ctxt, tag_id: ast::node_id,
 fn trans_const_expr(cx: &@crate_ctxt, e: @ast::expr) -> ValueRef {
     alt e.node {
       ast::expr_lit(lit) { ret trans_crate_lit(cx, *lit); }
-      _ { cx.sess.span_unimpl(e.span, ~"consts that's not a plain literal"); }
+      _ { cx.sess.span_unimpl(e.span, "consts that's not a plain literal"); }
     }
 }
 
@@ -5399,7 +5342,7 @@ fn trans_const(cx: &@crate_ctxt, e: @ast::expr, id: ast::node_id) {
         llvm::LLVMSetInitializer(g, v);
         llvm::LLVMSetGlobalConstant(g, True);
       }
-      _ { cx.sess.span_fatal(e.span, ~"Unbound const in trans_const"); }
+      _ { cx.sess.span_fatal(e.span, "Unbound const in trans_const"); }
     }
 }
 
@@ -5413,7 +5356,7 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) {
           }
           _ {
             cx.ccx.sess.span_fatal(item.span,
-                                   ~"unbound function item in trans_item");
+                                   "unbound function item in trans_item");
           }
         }
       }
@@ -5432,15 +5375,14 @@ fn trans_item(cx: @local_ctxt, item: &ast::item) {
             trans_fn(cx, item.span, dtor, lldtor_decl, none, tps, dtor_id);
           }
           _ {
-            cx.ccx.sess.span_fatal(item.span, ~"unbound dtor in trans_item");
+            cx.ccx.sess.span_fatal(item.span, "unbound dtor in trans_item");
           }
         }
       }
       ast::item_mod(m) {
         let sub_cx =
             @{path: cx.path + [item.ident],
-              module_path: cx.module_path
-                  + [item.ident] with *cx};
+              module_path: cx.module_path + [item.ident] with *cx};
         trans_mod(sub_cx, m);
       }
       ast::item_tag(variants, tps) {
@@ -5473,14 +5415,14 @@ fn get_pair_fn_ty(llpairty: TypeRef) -> TypeRef {
     ret struct_elt(llpairty, 0u);
 }
 
-fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr], flav: &istr,
+fn decl_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str], flav: &str,
                     ty_params: &[ast::ty_param], node_id: ast::node_id) {
     decl_fn_and_pair_full(ccx, sp, path, flav, ty_params, node_id,
                           node_id_type(ccx, node_id));
 }
 
-fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[istr],
-                         _flav: &istr, ty_params: &[ast::ty_param],
+fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[str],
+                         _flav: &str, ty_params: &[ast::ty_param],
                          node_id: ast::node_id, node_type: ty::t) {
     let path = path;
     let llfty =
@@ -5491,15 +5433,13 @@ fn decl_fn_and_pair_full(ccx: &@crate_ctxt, sp: &span, path: &[istr],
             type_of_fn(ccx, sp, proto, inputs, output,
                        std::vec::len::<ast::ty_param>(ty_params));
       }
-      _ { ccx.sess.bug(
-          ~"decl_fn_and_pair(): fn item doesn't have fn type!"); }
+      _ { ccx.sess.bug("decl_fn_and_pair(): fn item doesn't have fn type!"); }
     }
-    let s: istr = mangle_internal_name_by_path(ccx, path);
-    let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod,
-                                                   s, llfty);
+    let s: str = mangle_internal_name_by_path(ccx, path);
+    let llfn: ValueRef = decl_internal_fastcall_fn(ccx.llmod, s, llfty);
     // Declare the global constant pair that points to it.
 
-    let ps: istr = mangle_exported_name(ccx, path, node_type);
+    let ps: str = mangle_exported_name(ccx, path, node_type);
     register_fn_pair(ccx, ps, llfty, llfn, node_id);
 
     let is_main: bool = is_main_name(path) && !ccx.sess.get_opts().library;
@@ -5512,18 +5452,15 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
                        main_node_type: ty::t) {
 
     if ccx.main_fn != none::<ValueRef> {
-        ccx.sess.span_fatal(sp, ~"multiple 'main' functions");
+        ccx.sess.span_fatal(sp, "multiple 'main' functions");
     }
 
     let main_takes_argv =
         alt ty::struct(ccx.tcx, main_node_type) {
-          ty::ty_fn(_, args, _, _, _) {
-            std::vec::len(args) != 0u
-          }
+          ty::ty_fn(_, args, _, _, _) { std::vec::len(args) != 0u }
         };
 
-    let llfn = create_main(ccx, sp, main_llfn,
-                           main_takes_argv);
+    let llfn = create_main(ccx, sp, main_llfn, main_takes_argv);
     ccx.main_fn = some(llfn);
 
     fn create_main(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
@@ -5531,13 +5468,11 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
         let unit_ty = ty::mk_istr(ccx.tcx);
         let vecarg_ty: ty::arg =
             {mode: ty::mo_val,
-             ty:
-                 ty::mk_vec(ccx.tcx,
-                            {ty: unit_ty, mut: ast::imm})};
+             ty: ty::mk_vec(ccx.tcx, {ty: unit_ty, mut: ast::imm})};
         let llfty =
             type_of_fn(ccx, sp, ast::proto_fn, [vecarg_ty],
                        ty::mk_nil(ccx.tcx), 0u);
-        let llfdecl = decl_fastcall_fn(ccx.llmod, ~"_rust_main", llfty);
+        let llfdecl = decl_fastcall_fn(ccx.llmod, "_rust_main", llfty);
 
         let fcx = new_fn_ctxt(new_local_ctxt(ccx), sp, llfdecl);
 
@@ -5563,11 +5498,14 @@ fn create_main_wrapper(ccx: &@crate_ctxt, sp: &span, main_llfn: ValueRef,
 // Create a closure: a pair containing (1) a ValueRef, pointing to where the
 // fn's definition is in the executable we're creating, and (2) a pointer to
 // space for the function's environment.
-fn create_fn_pair(cx: &@crate_ctxt, ps: &istr, llfnty: TypeRef,
-                  llfn: ValueRef, external: bool) -> ValueRef {
-    let gvar = str::as_buf(ps, { |buf|
-        llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty), buf)
-    });
+fn create_fn_pair(cx: &@crate_ctxt, ps: &str, llfnty: TypeRef, llfn: ValueRef,
+                  external: bool) -> ValueRef {
+    let gvar =
+        str::as_buf(ps,
+                    {|buf|
+                        llvm::LLVMAddGlobal(cx.llmod, T_fn_pair(*cx, llfnty),
+                                            buf)
+                    });
     let pair = C_struct([llfn, C_null(T_opaque_closure_ptr(*cx))]);
     llvm::LLVMSetInitializer(gvar, pair);
     llvm::LLVMSetGlobalConstant(gvar, True);
@@ -5595,7 +5533,7 @@ fn create_real_fn_pair(cx: &@block_ctxt, llfnty: TypeRef, llfn: ValueRef,
     ret pair;
 }
 
-fn register_fn_pair(cx: &@crate_ctxt, ps: &istr, llfnty: TypeRef,
+fn register_fn_pair(cx: &@crate_ctxt, ps: &str, llfnty: TypeRef,
                     llfn: ValueRef, id: ast::node_id) {
     // FIXME: We should also hide the unexported pairs in crates.
 
@@ -5614,7 +5552,7 @@ fn native_fn_ty_param_count(cx: &@crate_ctxt, id: ast::node_id) -> uint {
         alt cx.ast_map.find(id) { some(ast_map::node_native_item(i)) { i } };
     alt native_item.node {
       ast::native_item_ty. {
-        cx.sess.bug(~"decl_native_fn_and_pair(): native fn isn't \
+        cx.sess.bug("decl_native_fn_and_pair(): native fn isn't \
                         actually a fn");
       }
       ast::native_item_fn(_, _, tps) {
@@ -5633,21 +5571,20 @@ fn native_fn_wrapper_type(cx: &@crate_ctxt, sp: &span, ty_param_count: uint,
     }
 }
 
-fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr],
-                           name: &istr, id: ast::node_id) {
+fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[str],
+                           name: &str, id: ast::node_id) {
     let path = path;
     let num_ty_param = native_fn_ty_param_count(ccx, id);
     // Declare the wrapper.
 
     let t = node_id_type(ccx, id);
     let wrapper_type = native_fn_wrapper_type(ccx, sp, num_ty_param, t);
-    let s: istr = mangle_internal_name_by_path(ccx, path);
+    let s: str = mangle_internal_name_by_path(ccx, path);
     let wrapper_fn: ValueRef =
-        decl_internal_fastcall_fn(ccx.llmod,
-                                  s, wrapper_type);
+        decl_internal_fastcall_fn(ccx.llmod, s, wrapper_type);
     // Declare the global constant pair that points to it.
 
-    let ps: istr = mangle_exported_name(ccx, path, node_id_type(ccx, id));
+    let ps: str = mangle_exported_name(ccx, path, node_id_type(ccx, id));
     register_fn_pair(ccx, ps, wrapper_type, wrapper_fn, id);
     // Build the wrapper.
 
@@ -5733,14 +5670,12 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr],
                 }
                 ret TruncOrBitCast(cx, v, T_int());
             }
-            if ty::type_is_fp(bcx_tcx(cx), t) {
-                ret FPToSI(cx, v, T_int());
-            }
+            if ty::type_is_fp(bcx_tcx(cx), t) { ret FPToSI(cx, v, T_int()); }
         }
         ret vp2i(cx, v);
     }
 
-    fn trans_simple_native_abi(bcx: &@block_ctxt, name: &istr,
+    fn trans_simple_native_abi(bcx: &@block_ctxt, name: &str,
                                call_args: &mutable [ValueRef], fn_type: ty::t,
                                uses_retptr: bool, cc: uint) ->
        {val: ValueRef, rptr: ValueRef} {
@@ -5792,7 +5727,7 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr],
         rptr = result.rptr;
       }
       ast::native_abi_rust_intrinsic. {
-        let external_name = ~"rust_intrinsic_" + name;
+        let external_name = "rust_intrinsic_" + name;
         let result =
             trans_simple_native_abi(bcx, external_name, call_args, fn_type,
                                     uses_retptr, lib::llvm::LLVMCCallConv);
@@ -5808,7 +5743,8 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr],
         rptr = result.rptr;
       }
       _ {
-        r = trans_native_call(new_raw_block_ctxt(bcx.fcx, bcx.llbb),
+        r =
+            trans_native_call(new_raw_block_ctxt(bcx.fcx, bcx.llbb),
                               ccx.externs, ccx.llmod, name, call_args);
         rptr = BitCast(bcx, fcx.llretptr, T_ptr(T_i32()));
       }
@@ -5823,23 +5759,22 @@ fn decl_native_fn_and_pair(ccx: &@crate_ctxt, sp: &span, path: &[istr],
     finish_fn(fcx, lltop);
 }
 
-fn item_path(item: &@ast::item) -> [istr] { ret [item.ident]; }
+fn item_path(item: &@ast::item) -> [str] { ret [item.ident]; }
 
-fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[istr],
-                       _v: &vt<[istr]>) {
+fn collect_native_item(ccx: @crate_ctxt, i: &@ast::native_item, pt: &[str],
+                       _v: &vt<[str]>) {
     alt i.node {
       ast::native_item_fn(_, _, _) {
         if !ccx.obj_methods.contains_key(i.id) {
-            decl_native_fn_and_pair(ccx, i.span, pt,
-                                    i.ident, i.id);
+            decl_native_fn_and_pair(ccx, i.span, pt, i.ident, i.id);
         }
       }
       _ { }
     }
 }
 
-fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr],
-                  v: &vt<[istr]>) {
+fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[str],
+                  v: &vt<[str]>) {
     visit::visit_item(i, pt + item_path(i), v);
     alt i.node {
       ast::item_const(_, _) {
@@ -5860,29 +5795,29 @@ fn collect_item_1(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr],
     }
 }
 
-fn collect_item_2(ccx: &@crate_ctxt, i: &@ast::item, pt: &[istr],
-                  v: &vt<[istr]>) {
+fn collect_item_2(ccx: &@crate_ctxt, i: &@ast::item, pt: &[str],
+                  v: &vt<[str]>) {
     let new_pt = pt + item_path(i);
     visit::visit_item(i, new_pt, v);
     alt i.node {
       ast::item_fn(f, tps) {
         if !ccx.obj_methods.contains_key(i.id) {
-            decl_fn_and_pair(ccx, i.span, new_pt, ~"fn", tps, i.id);
+            decl_fn_and_pair(ccx, i.span, new_pt, "fn", tps, i.id);
         }
       }
       ast::item_obj(ob, tps, ctor_id) {
-        decl_fn_and_pair(ccx, i.span, new_pt, ~"obj_ctor", tps, ctor_id);
+        decl_fn_and_pair(ccx, i.span, new_pt, "obj_ctor", tps, ctor_id);
         for m: @ast::method in ob.methods {
             ccx.obj_methods.insert(m.node.id, ());
         }
       }
       ast::item_res(_, dtor_id, tps, ctor_id) {
-        decl_fn_and_pair(ccx, i.span, new_pt, ~"res_ctor", tps, ctor_id);
+        decl_fn_and_pair(ccx, i.span, new_pt, "res_ctor", tps, ctor_id);
         // Note that the destructor is associated with the item's id, not
         // the dtor_id. This is a bit counter-intuitive, but simplifies
         // ty_res, which would have to carry around two def_ids otherwise
         // -- one to identify the type, and one to find the dtor symbol.
-        decl_fn_and_pair_full(ccx, i.span, new_pt, ~"res_dtor", tps, i.id,
+        decl_fn_and_pair_full(ccx, i.span, new_pt, "res_dtor", tps, i.id,
                               node_id_type(ccx, dtor_id));
       }
       _ { }
@@ -5900,17 +5835,16 @@ fn collect_items(ccx: &@crate_ctxt, crate: @ast::crate) {
     visit::visit_crate(*crate, [], visit::mk_vt(visitor2));
 }
 
-fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[istr],
-                    v: &vt<[istr]>) {
+fn collect_tag_ctor(ccx: @crate_ctxt, i: &@ast::item, pt: &[str],
+                    v: &vt<[str]>) {
     let new_pt = pt + item_path(i);
     visit::visit_item(i, new_pt, v);
     alt i.node {
       ast::item_tag(variants, tps) {
         for variant: ast::variant in variants {
             if std::vec::len(variant.node.args) != 0u {
-                decl_fn_and_pair(ccx, i.span,
-                                 new_pt + [variant.node.name],
-                                 ~"tag", tps, variant.node.id);
+                decl_fn_and_pair(ccx, i.span, new_pt + [variant.node.name],
+                                 "tag", tps, variant.node.id);
             }
         }
       }
@@ -5927,8 +5861,8 @@ fn collect_tag_ctors(ccx: &@crate_ctxt, crate: @ast::crate) {
 
 
 // The constant translation pass.
-fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[istr],
-                  v: &vt<[istr]>) {
+fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[str],
+                  v: &vt<[str]>) {
     let new_pt = pt + item_path(it);
     visit::visit_item(it, new_pt, v);
     alt it.node {
@@ -5937,14 +5871,13 @@ fn trans_constant(ccx: @crate_ctxt, it: &@ast::item, pt: &[istr],
         let n_variants = std::vec::len::<ast::variant>(variants);
         while i < n_variants {
             let variant = variants[i];
-            let p = new_pt + [it.ident,
-                              variant.node.name,
-                              ~"discrim"];
-            let s = mangle_exported_name(ccx, p,
-                                         ty::mk_int(ccx.tcx));
-            let discrim_gvar = str::as_buf(s, { |buf|
-                llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf)
-            });
+            let p = new_pt + [it.ident, variant.node.name, "discrim"];
+            let s = mangle_exported_name(ccx, p, ty::mk_int(ccx.tcx));
+            let discrim_gvar =
+                str::as_buf(s,
+                            {|buf|
+                                llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf)
+                            });
             if n_variants != 1u {
                 llvm::LLVMSetInitializer(discrim_gvar, C_int(i as int));
                 llvm::LLVMSetGlobalConstant(discrim_gvar, True);
@@ -5975,7 +5908,7 @@ fn vi2p(cx: &@block_ctxt, v: ValueRef, t: TypeRef) -> ValueRef {
 
 fn p2i(v: ValueRef) -> ValueRef { ret llvm::LLVMConstPtrToInt(v, T_int()); }
 
-fn declare_intrinsics(llmod: ModuleRef) -> hashmap<istr, ValueRef> {
+fn declare_intrinsics(llmod: ModuleRef) -> hashmap<str, ValueRef> {
     let T_memmove32_args: [TypeRef] =
         [T_ptr(T_i8()), T_ptr(T_i8()), T_i32(), T_i32(), T_i1()];
     let T_memmove64_args: [TypeRef] =
@@ -5986,75 +5919,74 @@ fn declare_intrinsics(llmod: ModuleRef) -> hashmap<istr, ValueRef> {
         [T_ptr(T_i8()), T_i8(), T_i64(), T_i32(), T_i1()];
     let T_trap_args: [TypeRef] = [];
     let gcroot =
-        decl_cdecl_fn(llmod, ~"llvm.gcroot",
+        decl_cdecl_fn(llmod, "llvm.gcroot",
                       T_fn([T_ptr(T_ptr(T_i8())), T_ptr(T_i8())], T_void()));
     let gcread =
-        decl_cdecl_fn(llmod, ~"llvm.gcread",
+        decl_cdecl_fn(llmod, "llvm.gcread",
                       T_fn([T_ptr(T_i8()), T_ptr(T_ptr(T_i8()))], T_void()));
     let memmove32 =
-        decl_cdecl_fn(llmod, ~"llvm.memmove.p0i8.p0i8.i32",
+        decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i32",
                       T_fn(T_memmove32_args, T_void()));
     let memmove64 =
-        decl_cdecl_fn(llmod, ~"llvm.memmove.p0i8.p0i8.i64",
+        decl_cdecl_fn(llmod, "llvm.memmove.p0i8.p0i8.i64",
                       T_fn(T_memmove64_args, T_void()));
     let memset32 =
-        decl_cdecl_fn(llmod, ~"llvm.memset.p0i8.i32",
+        decl_cdecl_fn(llmod, "llvm.memset.p0i8.i32",
                       T_fn(T_memset32_args, T_void()));
     let memset64 =
-        decl_cdecl_fn(llmod, ~"llvm.memset.p0i8.i64",
+        decl_cdecl_fn(llmod, "llvm.memset.p0i8.i64",
                       T_fn(T_memset64_args, T_void()));
-    let trap = decl_cdecl_fn(llmod, ~"llvm.trap",
-                             T_fn(T_trap_args, T_void()));
+    let trap = decl_cdecl_fn(llmod, "llvm.trap", T_fn(T_trap_args, T_void()));
     let intrinsics = new_str_hash::<ValueRef>();
-    intrinsics.insert(~"llvm.gcroot", gcroot);
-    intrinsics.insert(~"llvm.gcread", gcread);
-    intrinsics.insert(~"llvm.memmove.p0i8.p0i8.i32", memmove32);
-    intrinsics.insert(~"llvm.memmove.p0i8.p0i8.i64", memmove64);
-    intrinsics.insert(~"llvm.memset.p0i8.i32", memset32);
-    intrinsics.insert(~"llvm.memset.p0i8.i64", memset64);
-    intrinsics.insert(~"llvm.trap", trap);
+    intrinsics.insert("llvm.gcroot", gcroot);
+    intrinsics.insert("llvm.gcread", gcread);
+    intrinsics.insert("llvm.memmove.p0i8.p0i8.i32", memmove32);
+    intrinsics.insert("llvm.memmove.p0i8.p0i8.i64", memmove64);
+    intrinsics.insert("llvm.memset.p0i8.i32", memset32);
+    intrinsics.insert("llvm.memset.p0i8.i64", memset64);
+    intrinsics.insert("llvm.trap", trap);
     ret intrinsics;
 }
 
 fn trap(bcx: &@block_ctxt) {
     let v: [ValueRef] = [];
-    alt bcx_ccx(bcx).intrinsics.find(~"llvm.trap") {
+    alt bcx_ccx(bcx).intrinsics.find("llvm.trap") {
       some(x) { Call(bcx, x, v); }
-      _ { bcx_ccx(bcx).sess.bug(~"unbound llvm.trap in trap"); }
+      _ { bcx_ccx(bcx).sess.bug("unbound llvm.trap in trap"); }
     }
 }
 
 fn decl_no_op_type_glue(llmod: ModuleRef, taskptr_type: TypeRef) -> ValueRef {
     let ty = T_fn([taskptr_type, T_ptr(T_i8())], T_void());
-    ret decl_fastcall_fn(llmod,
-                         abi::no_op_type_glue_name(), ty);
+    ret decl_fastcall_fn(llmod, abi::no_op_type_glue_name(), ty);
 }
 
 fn make_glues(llmod: ModuleRef, taskptr_type: TypeRef) -> @glue_fns {
     ret @{no_op_type_glue: decl_no_op_type_glue(llmod, taskptr_type)};
 }
 
-fn make_common_glue(sess: &session::session, output: &istr) {
+fn make_common_glue(sess: &session::session, output: &str) {
     // FIXME: part of this is repetitive and is probably a good idea
     // to autogen it.
     let task_type = T_task();
     let taskptr_type = T_ptr(task_type);
 
-    let llmod = str::as_buf(~"rust_out", { |buf|
-        llvm::LLVMModuleCreateWithNameInContext(buf,
-                                                llvm::LLVMGetGlobalContext())
-    });
-    let _: () = str::as_buf(x86::get_data_layout(), { |buf|
-        llvm::LLVMSetDataLayout(llmod, buf)
-    });
-    let _: () = str::as_buf(x86::get_target_triple(), { |buf|
-        llvm::LLVMSetTarget(llmod, buf)
-    });
+    let llmod =
+        str::as_buf("rust_out", {|buf|
+            llvm::LLVMModuleCreateWithNameInContext(
+                buf, llvm::LLVMGetGlobalContext())
+        });
+    let _: () =
+        str::as_buf(x86::get_data_layout(),
+                    {|buf| llvm::LLVMSetDataLayout(llmod, buf) });
+    let _: () =
+        str::as_buf(x86::get_target_triple(),
+                    {|buf| llvm::LLVMSetTarget(llmod, buf) });
     mk_target_data(x86::get_data_layout());
     declare_intrinsics(llmod);
-    let _: () = str::as_buf(x86::get_module_asm(), { |buf|
-        llvm::LLVMSetModuleInlineAsm(llmod, buf)
-    });
+    let _: () =
+        str::as_buf(x86::get_module_asm(),
+                    {|buf| llvm::LLVMSetModuleInlineAsm(llmod, buf) });
     make_glues(llmod, taskptr_type);
     link::write::run_passes(sess, llmod, output);
 }
@@ -6062,15 +5994,14 @@ fn make_common_glue(sess: &session::session, output: &istr) {
 fn create_module_map(ccx: &@crate_ctxt) -> ValueRef {
     let elttype = T_struct([T_int(), T_int()]);
     let maptype = T_array(elttype, ccx.module_data.size() + 1u);
-    let map = str::as_buf(~"_rust_mod_map", { |buf|
-        llvm::LLVMAddGlobal(ccx.llmod, maptype, buf)
-    });
+    let map =
+        str::as_buf("_rust_mod_map",
+                    {|buf| llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) });
     llvm::LLVMSetLinkage(map,
                          lib::llvm::LLVMInternalLinkage as llvm::Linkage);
     let elts: [ValueRef] = [];
-    for each item: @{key: istr, val: ValueRef} in ccx.module_data.items() {
-        let elt = C_struct([p2i(C_cstr(ccx, item.key)),
-                            p2i(item.val)]);
+    for each item: @{key: str, val: ValueRef} in ccx.module_data.items() {
+        let elt = C_struct([p2i(C_cstr(ccx, item.key)), p2i(item.val)]);
         elts += [elt];
     }
     let term = C_struct([C_int(0), C_int(0)]);
@@ -6086,11 +6017,12 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef {
     let i = 1;
     let cstore = ccx.sess.get_cstore();
     while cstore::have_crate_data(cstore, i) {
-        let nm = ~"_rust_crate_map_" +
-            cstore::get_crate_data(cstore, i).name;
-        let cr = str::as_buf(nm, { |buf|
-            llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf)
-        });
+        let nm = "_rust_crate_map_" + cstore::get_crate_data(cstore, i).name;
+        let cr =
+            str::as_buf(nm,
+                        {|buf|
+                            llvm::LLVMAddGlobal(ccx.llmod, T_int(), buf)
+                        });
         subcrates += [p2i(cr)];
         i += 1;
     }
@@ -6098,13 +6030,13 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef {
     let mapname;
     if ccx.sess.get_opts().library {
         mapname = ccx.link_meta.name;
-    } else { mapname = ~"toplevel"; }
-    let sym_name = ~"_rust_crate_map_" + mapname;
+    } else { mapname = "toplevel"; }
+    let sym_name = "_rust_crate_map_" + mapname;
     let arrtype = T_array(T_int(), std::vec::len::<ValueRef>(subcrates));
     let maptype = T_struct([T_int(), arrtype]);
-    let map = str::as_buf(sym_name, { |buf|
-        llvm::LLVMAddGlobal(ccx.llmod, maptype, buf)
-    });
+    let map =
+        str::as_buf(sym_name,
+                    {|buf| llvm::LLVMAddGlobal(ccx.llmod, maptype, buf) });
     llvm::LLVMSetLinkage(map,
                          lib::llvm::LLVMExternalLinkage as llvm::Linkage);
     llvm::LLVMSetInitializer(map,
@@ -6115,24 +6047,28 @@ fn create_crate_map(ccx: &@crate_ctxt) -> ValueRef {
 
 fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) {
     if !cx.sess.get_opts().library { ret; }
-    let llmeta = C_postr(
-        metadata::encoder::encode_metadata(cx, crate));
+    let llmeta = C_postr(metadata::encoder::encode_metadata(cx, crate));
     let llconst = trans_common::C_struct([llmeta]);
-    let llglobal = str::as_buf(~"rust_metadata", { |buf|
-        llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst), buf)
-    });
+    let llglobal =
+        str::as_buf("rust_metadata",
+                    {|buf|
+                        llvm::LLVMAddGlobal(cx.llmod, val_ty(llconst), buf)
+                    });
     llvm::LLVMSetInitializer(llglobal, llconst);
-    let _: () = str::as_buf(x86::get_meta_sect_name(), { |buf|
-        llvm::LLVMSetSection(llglobal, buf)
-    });
+    let _: () =
+        str::as_buf(x86::get_meta_sect_name(),
+                    {|buf| llvm::LLVMSetSection(llglobal, buf) });
     llvm::LLVMSetLinkage(llglobal,
                          lib::llvm::LLVMInternalLinkage as llvm::Linkage);
 
     let t_ptr_i8 = T_ptr(T_i8());
     llglobal = llvm::LLVMConstBitCast(llglobal, t_ptr_i8);
-    let llvm_used = str::as_buf(~"llvm.used", { |buf|
-        llvm::LLVMAddGlobal(cx.llmod, T_array(t_ptr_i8, 1u), buf)
-    });
+    let llvm_used =
+        str::as_buf("llvm.used",
+                    {|buf|
+                        llvm::LLVMAddGlobal(cx.llmod, T_array(t_ptr_i8, 1u),
+                                            buf)
+                    });
     llvm::LLVMSetLinkage(llvm_used,
                          lib::llvm::LLVMAppendingLinkage as llvm::Linkage);
     llvm::LLVMSetInitializer(llvm_used, C_array(t_ptr_i8, [llglobal]));
@@ -6140,39 +6076,40 @@ fn write_metadata(cx: &@crate_ctxt, crate: &@ast::crate) {
 
 // Writes the current ABI version into the crate.
 fn write_abi_version(ccx: &@crate_ctxt) {
-    shape::mk_global(ccx, ~"rust_abi_version", C_uint(abi::abi_version),
+    shape::mk_global(ccx, "rust_abi_version", C_uint(abi::abi_version),
                      false);
 }
 
 fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
-               output: &istr, amap: &ast_map::map, mut_map: mut::mut_map)
-    -> ModuleRef {
-    let llmod = str::as_buf(~"rust_out", { |buf|
-        llvm::LLVMModuleCreateWithNameInContext(buf,
-                                                llvm::LLVMGetGlobalContext())
-    });
-    let _: () = str::as_buf(x86::get_data_layout(), { |buf|
-        llvm::LLVMSetDataLayout(llmod, buf)
-    });
-    let _: () = str::as_buf(x86::get_target_triple(), { |buf|
-        llvm::LLVMSetTarget(llmod, buf)
-    });
+               output: &str, amap: &ast_map::map, mut_map: mut::mut_map) ->
+   ModuleRef {
+    let llmod =
+        str::as_buf("rust_out", {|buf|
+            llvm::LLVMModuleCreateWithNameInContext(
+                buf, llvm::LLVMGetGlobalContext())
+        });
+    let _: () =
+        str::as_buf(x86::get_data_layout(),
+                    {|buf| llvm::LLVMSetDataLayout(llmod, buf) });
+    let _: () =
+        str::as_buf(x86::get_target_triple(),
+                    {|buf| llvm::LLVMSetTarget(llmod, buf) });
     let td = mk_target_data(x86::get_data_layout());
     let tn = mk_type_names();
     let intrinsics = declare_intrinsics(llmod);
     let task_type = T_task();
     let taskptr_type = T_ptr(task_type);
-    tn.associate(~"taskptr", taskptr_type);
+    tn.associate("taskptr", taskptr_type);
     let tydesc_type = T_tydesc(taskptr_type);
-    tn.associate(~"tydesc", tydesc_type);
+    tn.associate("tydesc", tydesc_type);
     let glues = make_glues(llmod, taskptr_type);
     let hasher = ty::hash_ty;
     let eqer = ty::eq_ty;
     let tag_sizes = map::mk_hashmap::<ty::t, uint>(hasher, eqer);
     let tydescs = map::mk_hashmap::<ty::t, @tydesc_info>(hasher, eqer);
     let lltypes = map::mk_hashmap::<ty::t, TypeRef>(hasher, eqer);
-    let sha1s = map::mk_hashmap::<ty::t, istr>(hasher, eqer);
-    let short_names = map::mk_hashmap::<ty::t, istr>(hasher, eqer);
+    let sha1s = map::mk_hashmap::<ty::t, str>(hasher, eqer);
+    let short_names = map::mk_hashmap::<ty::t, str>(hasher, eqer);
     let sha = std::sha1::mk_sha1();
     let ccx =
         @{sess: sess,
@@ -6183,13 +6120,12 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
           intrinsics: intrinsics,
           item_ids: new_int_hash::<ValueRef>(),
           ast_map: amap,
-          item_symbols: new_int_hash::<istr>(),
+          item_symbols: new_int_hash::<str>(),
           mutable main_fn: none::<ValueRef>,
-          link_meta: link::build_link_meta(sess, *crate,
-                                           output, sha),
+          link_meta: link::build_link_meta(sess, *crate, output, sha),
           tag_sizes: tag_sizes,
           discrims: new_int_hash::<ValueRef>(),
-          discrim_symbols: new_int_hash::<istr>(),
+          discrim_symbols: new_int_hash::<str>(),
           fn_pairs: new_int_hash::<ValueRef>(),
           consts: new_int_hash::<ValueRef>(),
           obj_methods: new_int_hash::<()>(),
@@ -6239,9 +6175,8 @@ fn trans_crate(sess: &session::session, crate: &@ast::crate, tcx: &ty::ctxt,
         log_err #fmt["n_real_glues: %u", ccx.stats.n_real_glues];
 
 
-        for timing: {ident: istr, time: int} in *ccx.stats.fn_times {
-            log_err #fmt["time: %s took %d ms",
-                         timing.ident, timing.time];
+        for timing: {ident: str, time: int} in *ccx.stats.fn_times {
+            log_err #fmt["time: %s took %d ms", timing.ident, timing.time];
         }
     }
     ret llmod;
diff --git a/src/comp/middle/trans_alt.rs b/src/comp/middle/trans_alt.rs
index e81f6b5b97f..5bb5afacb29 100644
--- a/src/comp/middle/trans_alt.rs
+++ b/src/comp/middle/trans_alt.rs
@@ -57,7 +57,7 @@ fn variant_opt(ccx: &@crate_ctxt, pat_id: ast::node_id) -> opt {
 }
 
 type bind_map = [{ident: ast::ident, val: ValueRef}];
-fn assoc(key: &istr, list: &bind_map) -> option::t<ValueRef> {
+fn assoc(key: &str, list: &bind_map) -> option::t<ValueRef> {
     for elt: {ident: ast::ident, val: ValueRef} in list {
         if str::eq(elt.ident, key) { ret some(elt.val); }
     }
@@ -67,9 +67,10 @@ fn assoc(key: &istr, list: &bind_map) -> option::t<ValueRef> {
 type match_branch =
     @{pats: [@ast::pat],
       bound: bind_map,
-      data: @{body: BasicBlockRef,
-              guard: option::t<@ast::expr>,
-              id_map: ast_util::pat_id_map}};
+      data:
+          @{body: BasicBlockRef,
+            guard: option::t<@ast::expr>,
+            id_map: ast_util::pat_id_map}};
 type match = [match_branch];
 
 fn matches_always(p: &@ast::pat) -> bool {
@@ -89,16 +90,18 @@ fn enter_match(m: &match, col: uint, val: ValueRef, e: &enter_pat) -> match {
     for br: match_branch in m {
         alt e(br.pats[col]) {
           some(sub) {
-            let pats = vec::slice(br.pats, 0u, col) + sub +
+            let pats =
+                vec::slice(br.pats, 0u, col) + sub +
                     vec::slice(br.pats, col + 1u, vec::len(br.pats));
-            let new_br = @{pats: pats,
-                           bound: alt br.pats[col].node {
-                             ast::pat_bind(name) {
-                               br.bound + [{ident: name, val: val}]
-                             }
-                             _ { br.bound }
-                           }
-                           with *br};
+            let new_br =
+                @{pats: pats,
+                  bound:
+                      alt br.pats[col].node {
+                        ast::pat_bind(name) {
+                          br.bound + [{ident: name, val: val}]
+                        }
+                        _ { br.bound }
+                      } with *br};
             result += [new_br];
           }
           none. { }
@@ -211,15 +214,14 @@ fn extract_variant_args(bcx: @block_ctxt, pat_id: ast::node_id,
         vec::len(ty::tag_variant_with_id(ccx.tcx, vdefs.tg, vdefs.var).args);
     if size > 0u && vec::len(variants) != 1u {
         let tagptr =
-            PointerCast(bcx, val,
-                                  trans_common::T_opaque_tag_ptr(ccx.tn));
+            PointerCast(bcx, val, trans_common::T_opaque_tag_ptr(ccx.tn));
         blobptr = GEP(bcx, tagptr, [C_int(0), C_int(1)]);
     }
     let i = 0u;
     let vdefs_tg = vdefs.tg;
     let vdefs_var = vdefs.var;
     while i < size {
-        check valid_variant_index(i, bcx, vdefs_tg, vdefs_var);
+        check (valid_variant_index(i, bcx, vdefs_tg, vdefs_var));
         let r =
             trans::GEP_tag(bcx, blobptr, vdefs_tg, vdefs_var, ty_param_substs,
                            i);
@@ -298,26 +300,25 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
         let data = m[0].data;
         alt data.guard {
           some(e) {
-            let guard_cx = new_scope_block_ctxt(bcx, ~"submatch_guard");
-            let next_cx = new_sub_block_ctxt(bcx, ~"submatch_next");
-            let else_cx = new_sub_block_ctxt(bcx, ~"submatch_else");
+            let guard_cx = new_scope_block_ctxt(bcx, "submatch_guard");
+            let next_cx = new_sub_block_ctxt(bcx, "submatch_next");
+            let else_cx = new_sub_block_ctxt(bcx, "submatch_else");
             Br(bcx, guard_cx.llbb);
             // Temporarily set bindings. They'll be rewritten to PHI nodes for
             // the actual arm block.
-            for each @{key, val} in data.id_map.items() {
-                bcx.fcx.lllocals.insert
-                    (val, option::get(assoc(key,
-                                            m[0].bound)));
+            for each @{key: key, val: val} in data.id_map.items() {
+                bcx.fcx.lllocals.insert(val,
+                                        option::get(assoc(key, m[0].bound)));
             }
             let {bcx: guard_bcx, val: guard_val} =
                 trans::trans_expr(guard_cx, e);
             guard_bcx = trans::trans_block_cleanups(guard_bcx, guard_cx);
             CondBr(guard_bcx, guard_val, next_cx.llbb, else_cx.llbb);
-            compile_submatch(else_cx, vec::slice(m, 1u, vec::len(m)),
-                             vals, f, exits);
+            compile_submatch(else_cx, vec::slice(m, 1u, vec::len(m)), vals, f,
+                             exits);
             bcx = next_cx;
           }
-          _ {}
+          _ { }
         }
         exits += [{bound: m[0].bound, from: bcx.llbb, to: data.body}];
         Br(bcx, data.body);
@@ -380,8 +381,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
         let box = Load(bcx, val);
         let unboxed =
             InBoundsGEP(bcx, box,
-                                  [C_int(0),
-                                   C_int(back::abi::box_rc_field_body)]);
+                        [C_int(0), C_int(back::abi::box_rc_field_body)]);
         compile_submatch(bcx, enter_box(m, col, val), [unboxed] + vals_left,
                          f, exits);
         ret;
@@ -400,7 +400,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
             } else {
                 let tagptr =
                     PointerCast(bcx, val,
-                        trans_common::T_opaque_tag_ptr(ccx.tn));
+                                trans_common::T_opaque_tag_ptr(ccx.tn));
                 let discrimptr = GEP(bcx, tagptr, [C_int(0), C_int(0)]);
                 test_val = Load(bcx, discrimptr);
                 kind = switch;
@@ -415,7 +415,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
     let else_cx =
         alt kind {
           no_branch. | single. { bcx }
-          _ { new_sub_block_ctxt(bcx, ~"match_else") }
+          _ { new_sub_block_ctxt(bcx, "match_else") }
         };
     let sw =
         if kind == switch {
@@ -424,7 +424,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
 
      // Compile subtrees for each option
     for opt: opt in opts {
-        let opt_cx = new_sub_block_ctxt(bcx, ~"match_case");
+        let opt_cx = new_sub_block_ctxt(bcx, "match_case");
         alt kind {
           single. { Br(bcx, opt_cx.llbb); }
           switch. {
@@ -433,7 +433,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
             llvm::LLVMAddCase(sw, r.val, opt_cx.llbb);
           }
           compare. {
-            let compare_cx = new_scope_block_ctxt(bcx, ~"compare_scope");
+            let compare_cx = new_scope_block_ctxt(bcx, "compare_scope");
             Br(bcx, compare_cx.llbb);
             bcx = compare_cx;
             let r = trans_opt(bcx, opt);
@@ -442,7 +442,7 @@ fn compile_submatch(bcx: @block_ctxt, m: &match, vals: [ValueRef],
             let eq =
                 trans::trans_compare(bcx, ast::eq, test_val, t, r.val, t);
             let cleanup_cx = trans::trans_block_cleanups(bcx, compare_cx);
-            bcx = new_sub_block_ctxt(bcx, ~"compare_next");
+            bcx = new_sub_block_ctxt(bcx, "compare_next");
             CondBr(cleanup_cx, eq.val, opt_cx.llbb, bcx.llbb);
           }
           _ { }
@@ -509,15 +509,14 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm],
     }
 
     for a: ast::arm in arms {
-        let body = new_scope_block_ctxt(cx, ~"case_body");
+        let body = new_scope_block_ctxt(cx, "case_body");
         let id_map = ast_util::pat_id_map(a.pats[0]);
         bodies += [body];
         for p: @ast::pat in a.pats {
-            match += [@{pats: [p],
-                        bound: [],
-                        data: @{body: body.llbb,
-                                guard: a.guard,
-                                id_map: id_map}}];
+            match +=
+                [@{pats: [p],
+                   bound: [],
+                   data: @{body: body.llbb, guard: a.guard, id_map: id_map}}];
         }
     }
 
@@ -526,8 +525,8 @@ fn trans_alt(cx: &@block_ctxt, expr: &@ast::expr, arms: &[ast::arm],
     fn mk_fail(cx: &@block_ctxt, sp: &span,
                done: @mutable option::t<BasicBlockRef>) -> BasicBlockRef {
         alt *done { some(bb) { ret bb; } _ { } }
-        let fail_cx = new_sub_block_ctxt(cx, ~"case_fallthrough");
-        trans::trans_fail(fail_cx, some(sp), ~"non-exhaustive match failure");
+        let fail_cx = new_sub_block_ctxt(cx, "case_fallthrough");
+        trans::trans_fail(fail_cx, some(sp), "non-exhaustive match failure");;
         *done = some(fail_cx.llbb);
         ret fail_cx.llbb;
     }
@@ -568,8 +567,9 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
             check type_has_static_size(ccx, ty);
             let llty = trans::type_of(ccx, pat.span, ty);
             let alloc = trans::alloca(bcx, llty);
-            bcx = trans::copy_val(bcx, trans::INIT, alloc,
-                                  trans::load_if_immediate(bcx, val, ty), ty);
+            bcx =
+                trans::copy_val(bcx, trans::INIT, alloc,
+                                trans::load_if_immediate(bcx, val, ty), ty);
             table.insert(pat.id, alloc);
             trans_common::add_clean(bcx, alloc, ty);
         } else { table.insert(pat.id, val); }
@@ -606,9 +606,9 @@ fn bind_irrefutable_pat(bcx: @block_ctxt, pat: &@ast::pat, val: ValueRef,
       }
       ast::pat_box(inner) {
         let box = Load(bcx, val);
-        let unboxed = InBoundsGEP(bcx, box,
-                                  [C_int(0),
-                                   C_int(back::abi::box_rc_field_body)]);
+        let unboxed =
+            InBoundsGEP(bcx, box,
+                        [C_int(0), C_int(back::abi::box_rc_field_body)]);
         bcx = bind_irrefutable_pat(bcx, inner, unboxed, table, true);
       }
       ast::pat_wild. | ast::pat_lit(_) { }
diff --git a/src/comp/middle/trans_build.rs b/src/comp/middle/trans_build.rs
index 1355bbff0aa..52b976e2844 100644
--- a/src/comp/middle/trans_build.rs
+++ b/src/comp/middle/trans_build.rs
@@ -1,8 +1,8 @@
 import std::{vec, str};
 import std::str::sbuf;
 import lib::llvm::llvm;
-import llvm::{ValueRef, TypeRef, BasicBlockRef, BuilderRef,
-              Opcode, ModuleRef};
+import llvm::{ValueRef, TypeRef, BasicBlockRef, BuilderRef, Opcode,
+              ModuleRef};
 import trans_common::block_ctxt;
 
 fn B(cx: &@block_ctxt) -> BuilderRef {
@@ -12,277 +12,212 @@ fn B(cx: &@block_ctxt) -> BuilderRef {
 }
 
 fn RetVoid(cx: &@block_ctxt) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildRetVoid(B(cx));
 }
 
 fn Ret(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildRet(B(cx), V);
 }
 
 fn AggregateRet(cx: &@block_ctxt, RetVals: &[ValueRef]) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildAggregateRet(B(cx), vec::to_ptr(RetVals),
                                     vec::len(RetVals));
 }
 
 fn Br(cx: &@block_ctxt, Dest: BasicBlockRef) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildBr(B(cx), Dest);
 }
 
 fn CondBr(cx: &@block_ctxt, If: ValueRef, Then: BasicBlockRef,
           Else: BasicBlockRef) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildCondBr(B(cx), If, Then, Else);
 }
 
-fn Switch(cx: &@block_ctxt, V: ValueRef, Else: BasicBlockRef,
-          NumCases: uint) -> ValueRef {
-    assert (!cx.terminated);;
+fn Switch(cx: &@block_ctxt, V: ValueRef, Else: BasicBlockRef, NumCases: uint)
+   -> ValueRef {
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildSwitch(B(cx), V, Else, NumCases);
 }
 
-fn IndirectBr(cx: &@block_ctxt, Addr: ValueRef,
-              NumDests: uint) -> ValueRef {
-    assert (!cx.terminated);;
+fn IndirectBr(cx: &@block_ctxt, Addr: ValueRef, NumDests: uint) -> ValueRef {
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildIndirectBr(B(cx), Addr, NumDests);
 }
 
 fn Invoke(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef],
           Then: BasicBlockRef, Catch: BasicBlockRef) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildInvoke(B(cx), Fn, vec::to_ptr(Args),
-                              vec::len(Args), Then, Catch, buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildInvoke(B(cx), Fn, vec::to_ptr(Args),
+                                              vec::len(Args), Then, Catch,
+                                              buf)
+                    });
 }
 
 fn Unreachable(cx: &@block_ctxt) -> ValueRef {
-    assert (!cx.terminated);;
+    assert (!cx.terminated);
     cx.terminated = true;
     ret llvm::LLVMBuildUnreachable(B(cx));
 }
 
 /* Arithmetic */
 fn Add(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildAdd(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildAdd(B(cx), LHS, RHS, buf) });
 }
 
 fn NSWAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNSWAdd(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNSWAdd(B(cx), LHS, RHS, buf) });
 }
 
 fn NUWAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNUWAdd(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNUWAdd(B(cx), LHS, RHS, buf) });
 }
 
 fn FAdd(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFAdd(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFAdd(B(cx), LHS, RHS, buf) });
 }
 
 fn Sub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSub(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildSub(B(cx), LHS, RHS, buf) });
 }
 
 fn NSWSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNSWSub(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNSWSub(B(cx), LHS, RHS, buf) });
 }
 
 fn NUWSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNUWSub(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNUWSub(B(cx), LHS, RHS, buf) });
 }
 
 fn FSub(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFSub(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFSub(B(cx), LHS, RHS, buf) });
 }
 
 fn Mul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildMul(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildMul(B(cx), LHS, RHS, buf) });
 }
 
 fn NSWMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNSWMul(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNSWMul(B(cx), LHS, RHS, buf) });
 }
 
 fn NUWMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNUWMul(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNUWMul(B(cx), LHS, RHS, buf) });
 }
 
 fn FMul(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFMul(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFMul(B(cx), LHS, RHS, buf) });
 }
 
 fn UDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildUDiv(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildUDiv(B(cx), LHS, RHS, buf) });
 }
 
 fn SDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSDiv(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildSDiv(B(cx), LHS, RHS, buf) });
 }
 
 fn ExactSDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildExactSDiv(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildExactSDiv(B(cx), LHS, RHS, buf) });
 }
 
 fn FDiv(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFDiv(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFDiv(B(cx), LHS, RHS, buf) });
 }
 
 fn URem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildURem(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildURem(B(cx), LHS, RHS, buf) });
 }
 
 fn SRem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSRem(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildSRem(B(cx), LHS, RHS, buf) });
 }
 
 fn FRem(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFRem(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFRem(B(cx), LHS, RHS, buf) });
 }
 
 fn Shl(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildShl(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildShl(B(cx), LHS, RHS, buf) });
 }
 
 fn LShr(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildLShr(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildLShr(B(cx), LHS, RHS, buf) });
 }
 
 fn AShr(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildAShr(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildAShr(B(cx), LHS, RHS, buf) });
 }
 
 fn And(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildAnd(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildAnd(B(cx), LHS, RHS, buf) });
 }
 
 fn Or(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildOr(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildOr(B(cx), LHS, RHS, buf) });
 }
 
 fn Xor(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildXor(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildXor(B(cx), LHS, RHS, buf) });
 }
 
-fn BinOp(cx: &@block_ctxt, Op: Opcode, LHS: ValueRef,
-         RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildBinOp(B(cx), Op, LHS, RHS, buf)
-    });
+fn BinOp(cx: &@block_ctxt, Op: Opcode, LHS: ValueRef, RHS: ValueRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildBinOp(B(cx), Op, LHS, RHS, buf) });
 }
 
 fn Neg(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNeg(B(cx), V, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNeg(B(cx), V, buf) });
 }
 
 fn NSWNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNSWNeg(B(cx), V, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNSWNeg(B(cx), V, buf) });
 }
 
 fn NUWNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNUWNeg(B(cx), V, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNUWNeg(B(cx), V, buf) });
 }
 fn FNeg(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFNeg(B(cx), V, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildFNeg(B(cx), V, buf) });
 }
 
 fn Not(cx: &@block_ctxt, V: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildNot(B(cx), V, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildNot(B(cx), V, buf) });
 }
 
 /* Memory */
 fn Malloc(cx: &@block_ctxt, Ty: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildMalloc(B(cx), Ty, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildMalloc(B(cx), Ty, buf) });
 }
 
 fn ArrayMalloc(cx: &@block_ctxt, Ty: TypeRef, Val: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildArrayMalloc(B(cx), Ty, Val, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildArrayMalloc(B(cx), Ty, Val, buf) });
 }
 
 fn Alloca(cx: &@block_ctxt, Ty: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildAlloca(B(cx), Ty, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildAlloca(B(cx), Ty, buf) });
 }
 
 fn ArrayAlloca(cx: &@block_ctxt, Ty: TypeRef, Val: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildArrayAlloca(B(cx), Ty, Val, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildArrayAlloca(B(cx), Ty, Val, buf) });
 }
 
 fn Free(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef {
@@ -290,194 +225,185 @@ fn Free(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef {
 }
 
 fn Load(cx: &@block_ctxt, PointerVal: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildLoad(B(cx), PointerVal, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildLoad(B(cx), PointerVal, buf) });
 }
 
 fn Store(cx: &@block_ctxt, Val: ValueRef, Ptr: ValueRef) -> ValueRef {
     ret llvm::LLVMBuildStore(B(cx), Val, Ptr);
 }
 
-fn GEP(cx: &@block_ctxt, Pointer: ValueRef,
-       Indices: &[ValueRef]) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildGEP(B(cx), Pointer, vec::to_ptr(Indices),
-                           vec::len(Indices), buf)
-    });
+fn GEP(cx: &@block_ctxt, Pointer: ValueRef, Indices: &[ValueRef]) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildGEP(B(cx), Pointer,
+                                           vec::to_ptr(Indices),
+                                           vec::len(Indices), buf)
+                    });
 }
 
-fn InBoundsGEP(cx: &@block_ctxt, Pointer: ValueRef,
-               Indices: &[ValueRef]) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildInBoundsGEP(B(cx), Pointer, vec::to_ptr(Indices),
-                                   vec::len(Indices), buf)
-    });
+fn InBoundsGEP(cx: &@block_ctxt, Pointer: ValueRef, Indices: &[ValueRef]) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildInBoundsGEP(B(cx), Pointer,
+                                                   vec::to_ptr(Indices),
+                                                   vec::len(Indices), buf)
+                    });
 }
 
 fn StructGEP(cx: &@block_ctxt, Pointer: ValueRef, Idx: uint) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildStructGEP(B(cx), Pointer, Idx, buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildStructGEP(B(cx), Pointer, Idx, buf)
+                    });
 }
 
 fn GlobalString(cx: &@block_ctxt, _Str: sbuf) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildGlobalString(B(cx), _Str, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildGlobalString(B(cx), _Str, buf) });
 }
 
 fn GlobalStringPtr(cx: &@block_ctxt, _Str: sbuf) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildGlobalStringPtr(B(cx), _Str, buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildGlobalStringPtr(B(cx), _Str, buf)
+                    });
 }
 
 /* Casts */
 fn Trunc(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildTrunc(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildTrunc(B(cx), Val, DestTy, buf) });
 }
 
 fn ZExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildZExt(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildZExt(B(cx), Val, DestTy, buf) });
 }
 
 fn SExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSExt(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildSExt(B(cx), Val, DestTy, buf) });
 }
 
 fn FPToUI(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFPToUI(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFPToUI(B(cx), Val, DestTy, buf) });
 }
 
 fn FPToSI(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFPToSI(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFPToSI(B(cx), Val, DestTy, buf) });
 }
 
 fn UIToFP(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildUIToFP(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildUIToFP(B(cx), Val, DestTy, buf) });
 }
 
 fn SIToFP(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSIToFP(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildSIToFP(B(cx), Val, DestTy, buf) });
 }
 
 fn FPTrunc(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFPTrunc(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFPTrunc(B(cx), Val, DestTy, buf) });
 }
 
 fn FPExt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFPExt(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFPExt(B(cx), Val, DestTy, buf) });
 }
 
-fn PtrToInt(cx: &@block_ctxt, Val: ValueRef,
-            DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildPtrToInt(B(cx), Val, DestTy, buf)
-    });
+fn PtrToInt(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildPtrToInt(B(cx), Val, DestTy, buf)
+                    });
 }
 
-fn IntToPtr(cx: &@block_ctxt, Val: ValueRef,
-            DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildIntToPtr(B(cx), Val, DestTy, buf)
-    });
+fn IntToPtr(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildIntToPtr(B(cx), Val, DestTy, buf)
+                    });
 }
 
 fn BitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildBitCast(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildBitCast(B(cx), Val, DestTy, buf) });
 }
 
-fn ZExtOrBitCast(cx: &@block_ctxt, Val: ValueRef,
-                 DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildZExtOrBitCast(B(cx), Val, DestTy, buf)
-    });
+fn ZExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildZExtOrBitCast(B(cx), Val, DestTy, buf)
+                    });
 }
 
-fn SExtOrBitCast(cx: &@block_ctxt, Val: ValueRef,
-                 DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSExtOrBitCast(B(cx), Val, DestTy, buf)
-    });
+fn SExtOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildSExtOrBitCast(B(cx), Val, DestTy, buf)
+                    });
 }
 
-fn TruncOrBitCast(cx: &@block_ctxt, Val: ValueRef,
-                  DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildTruncOrBitCast(B(cx), Val, DestTy, buf)
-    });
+fn TruncOrBitCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildTruncOrBitCast(B(cx), Val, DestTy, buf)
+                    });
 }
 
-fn Cast(cx: &@block_ctxt, Op: Opcode, Val: ValueRef,
-        DestTy: TypeRef, _Name: sbuf) ->
-    ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildCast(B(cx), Op, Val, DestTy, buf)
-    });
+fn Cast(cx: &@block_ctxt, Op: Opcode, Val: ValueRef, DestTy: TypeRef,
+        _Name: sbuf) -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildCast(B(cx), Op, Val, DestTy, buf)
+                    });
 }
 
 fn PointerCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildPointerCast(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildPointerCast(B(cx), Val, DestTy, buf)
+                    });
 }
 
 fn IntCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildIntCast(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildIntCast(B(cx), Val, DestTy, buf) });
 }
 
 fn FPCast(cx: &@block_ctxt, Val: ValueRef, DestTy: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFPCast(B(cx), Val, DestTy, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFPCast(B(cx), Val, DestTy, buf) });
 }
 
 
 /* Comparisons */
-fn ICmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef,
-        RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildICmp(B(cx), Op, LHS, RHS, buf)
-    });
+fn ICmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, RHS: ValueRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildICmp(B(cx), Op, LHS, RHS, buf) });
 }
 
-fn FCmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef,
-        RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildFCmp(B(cx), Op, LHS, RHS, buf)
-    });
+fn FCmp(cx: &@block_ctxt, Op: uint, LHS: ValueRef, RHS: ValueRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildFCmp(B(cx), Op, LHS, RHS, buf) });
 }
 
 
 /* Miscellaneous instructions */
 fn Phi(cx: &@block_ctxt, Ty: TypeRef, vals: &[ValueRef],
        bbs: &[BasicBlockRef]) -> ValueRef {
-    let phi = str::as_buf(~"", { |buf|
-        llvm::LLVMBuildPhi(B(cx), Ty, buf)
-    });
+    let phi = str::as_buf("", {|buf| llvm::LLVMBuildPhi(B(cx), Ty, buf) });
     assert (vec::len::<ValueRef>(vals) == vec::len::<BasicBlockRef>(bbs));
     llvm::LLVMAddIncoming(phi, vec::to_ptr(vals), vec::to_ptr(bbs),
                           vec::len(vals));
@@ -491,93 +417,101 @@ fn AddIncomingToPhi(phi: ValueRef, vals: &[ValueRef], bbs: &[BasicBlockRef]) {
 }
 
 fn Call(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef]) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args),
-                            vec::len(Args), buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args),
+                                            vec::len(Args), buf)
+                    });
 }
 
 fn FastCall(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef]) -> ValueRef {
-    let v = str::as_buf(~"", { |buf|
-        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), vec::len(Args), buf)
-    });
+    let v =
+        str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args),
+                                            vec::len(Args), buf)
+                    });
     llvm::LLVMSetInstructionCallConv(v, lib::llvm::LLVMFastCallConv);
     ret v;
 }
 
-fn CallWithConv(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef],
-                Conv: uint) -> ValueRef {
-    let v = str::as_buf(~"", { |buf|
-        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args), vec::len(Args), buf)
-    });
+fn CallWithConv(cx: &@block_ctxt, Fn: ValueRef, Args: &[ValueRef], Conv: uint)
+   -> ValueRef {
+    let v =
+        str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildCall(B(cx), Fn, vec::to_ptr(Args),
+                                            vec::len(Args), buf)
+                    });
     llvm::LLVMSetInstructionCallConv(v, Conv);
     ret v;
 }
 
-fn Select(cx: &@block_ctxt, If: ValueRef, Then: ValueRef,
-          Else: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildSelect(B(cx), If, Then, Else, buf)
-    });
+fn Select(cx: &@block_ctxt, If: ValueRef, Then: ValueRef, Else: ValueRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildSelect(B(cx), If, Then, Else, buf)
+                    });
 }
 
 fn VAArg(cx: &@block_ctxt, list: ValueRef, Ty: TypeRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildVAArg(B(cx), list, Ty, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildVAArg(B(cx), list, Ty, buf) });
 }
 
-fn ExtractElement(cx: &@block_ctxt, VecVal: ValueRef,
-                  Index: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildExtractElement(B(cx), VecVal, Index, buf)
-    });
+fn ExtractElement(cx: &@block_ctxt, VecVal: ValueRef, Index: ValueRef) ->
+   ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildExtractElement(B(cx), VecVal, Index,
+                                                      buf)
+                    });
 }
 
 fn InsertElement(cx: &@block_ctxt, VecVal: ValueRef, EltVal: ValueRef,
-                 Index: ValueRef) ->
-    ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildInsertElement(B(cx), VecVal, EltVal, Index, buf)
-    });
+                 Index: ValueRef) -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildInsertElement(B(cx), VecVal, EltVal,
+                                                     Index, buf)
+                    });
 }
 
-fn ShuffleVector(cx: &@block_ctxt, V1: ValueRef, V2: ValueRef,
-                 Mask: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildShuffleVector(B(cx), V1, V2, Mask, buf)
-    });
+fn ShuffleVector(cx: &@block_ctxt, V1: ValueRef, V2: ValueRef, Mask: ValueRef)
+   -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildShuffleVector(B(cx), V1, V2, Mask, buf)
+                    });
 }
 
 fn ExtractValue(cx: &@block_ctxt, AggVal: ValueRef, Index: uint) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildExtractValue(B(cx), AggVal, Index, buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildExtractValue(B(cx), AggVal, Index, buf)
+                    });
 }
 
-fn InsertValue(cx: &@block_ctxt, AggVal: ValueRef,
-               EltVal: ValueRef, Index: uint) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildInsertValue(B(cx), AggVal, EltVal, Index, buf)
-    });
+fn InsertValue(cx: &@block_ctxt, AggVal: ValueRef, EltVal: ValueRef,
+               Index: uint) -> ValueRef {
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildInsertValue(B(cx), AggVal, EltVal,
+                                                   Index, buf)
+                    });
 }
 
 fn IsNull(cx: &@block_ctxt, Val: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildIsNull(B(cx), Val, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildIsNull(B(cx), Val, buf) });
 }
 
 fn IsNotNull(cx: &@block_ctxt, Val: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildIsNotNull(B(cx), Val, buf)
-    });
+    ret str::as_buf("", {|buf| llvm::LLVMBuildIsNotNull(B(cx), Val, buf) });
 }
 
 fn PtrDiff(cx: &@block_ctxt, LHS: ValueRef, RHS: ValueRef) -> ValueRef {
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildPtrDiff(B(cx), LHS, RHS, buf)
-    });
+    ret str::as_buf("",
+                    {|buf| llvm::LLVMBuildPtrDiff(B(cx), LHS, RHS, buf) });
 }
 
 fn Trap(cx: &@block_ctxt) -> ValueRef {
@@ -585,14 +519,15 @@ fn Trap(cx: &@block_ctxt) -> ValueRef {
     let BB: BasicBlockRef = llvm::LLVMGetInsertBlock(b);
     let FN: ValueRef = llvm::LLVMGetBasicBlockParent(BB);
     let M: ModuleRef = llvm::LLVMGetGlobalParent(FN);
-    let T: ValueRef = str::as_buf(~"llvm.trap", { |buf|
-        llvm::LLVMGetNamedFunction(M, buf)
-    });
+    let T: ValueRef =
+        str::as_buf("llvm.trap", {|buf| llvm::LLVMGetNamedFunction(M, buf) });
     assert (T as int != 0);
     let Args: [ValueRef] = [];
-    ret str::as_buf(~"", { |buf|
-        llvm::LLVMBuildCall(b, T, vec::to_ptr(Args), vec::len(Args), buf)
-    });
+    ret str::as_buf("",
+                    {|buf|
+                        llvm::LLVMBuildCall(b, T, vec::to_ptr(Args),
+                                            vec::len(Args), buf)
+                    });
 }
 
 //
diff --git a/src/comp/middle/trans_common.rs b/src/comp/middle/trans_common.rs
index b18f81bb45c..2943edd4333 100644
--- a/src/comp/middle/trans_common.rs
+++ b/src/comp/middle/trans_common.rs
@@ -62,9 +62,7 @@ import trans::type_of_fn_full;
 import trans::drop_ty;
 
 obj namegen(mutable i: int) {
-    fn next(prefix: &istr) -> istr {
-        i += 1; ret prefix + int::str(i);
-    }
+    fn next(prefix: &str) -> str { i += 1; ret prefix + int::str(i); }
 }
 
 type derived_tydesc_info = {lltydesc: ValueRef, escapes: bool};
@@ -109,11 +107,9 @@ type stats =
      mutable n_glues_created: uint,
      mutable n_null_glues: uint,
      mutable n_real_glues: uint,
-     fn_times: @mutable [{ident: istr, time: int}]};
+     fn_times: @mutable [{ident: str, time: int}]};
 
-resource BuilderRef_res(B: llvm::BuilderRef) {
-    llvm::LLVMDisposeBuilder(B);
-}
+resource BuilderRef_res(B: llvm::BuilderRef) { llvm::LLVMDisposeBuilder(B); }
 
 // Crate context.  Every crate we compile has one of these.
 type crate_ctxt =
@@ -125,27 +121,27 @@ type crate_ctxt =
      llmod: ModuleRef,
      td: target_data,
      tn: type_names,
-     externs: hashmap<istr, ValueRef>,
-     intrinsics: hashmap<istr, ValueRef>,
+     externs: hashmap<str, ValueRef>,
+     intrinsics: hashmap<str, ValueRef>,
      item_ids: hashmap<ast::node_id, ValueRef>,
      ast_map: ast_map::map,
-     item_symbols: hashmap<ast::node_id, istr>,
+     item_symbols: hashmap<ast::node_id, str>,
      mutable main_fn: option::t<ValueRef>,
      link_meta: link::link_meta,
      tag_sizes: hashmap<ty::t, uint>,
      discrims: hashmap<ast::node_id, ValueRef>,
-     discrim_symbols: hashmap<ast::node_id, istr>,
+     discrim_symbols: hashmap<ast::node_id, str>,
      fn_pairs: hashmap<ast::node_id, ValueRef>,
      consts: hashmap<ast::node_id, ValueRef>,
      obj_methods: hashmap<ast::node_id, ()>,
      tydescs: hashmap<ty::t, @tydesc_info>,
-     module_data: hashmap<istr, ValueRef>,
+     module_data: hashmap<str, ValueRef>,
      lltypes: hashmap<ty::t, TypeRef>,
      glues: @glue_fns,
      names: namegen,
      sha: std::sha1::sha1,
-     type_sha1s: hashmap<ty::t, istr>,
-     type_short_names: hashmap<ty::t, istr>,
+     type_sha1s: hashmap<ty::t, str>,
+     type_short_names: hashmap<ty::t, str>,
      tcx: ty::ctxt,
      mut_map: mut::mut_map,
      stats: stats,
@@ -158,8 +154,8 @@ type crate_ctxt =
      gc_cx: gc::ctxt};
 
 type local_ctxt =
-    {path: [istr],
-     module_path: [istr],
+    {path: [str],
+     module_path: [str],
      obj_typarams: [ast::ty_param],
      obj_fields: [ast::obj_field],
      ccx: @crate_ctxt};
@@ -302,11 +298,12 @@ fn add_clean(cx: &@block_ctxt, val: ValueRef, ty: ty::t) {
     find_scope_cx(cx).cleanups += [clean(bind drop_ty(_, val, ty))];
 }
 fn add_clean_temp(cx: &@block_ctxt, val: ValueRef, ty: ty::t) {
-    fn spill_and_drop(cx: &@block_ctxt, val: ValueRef, ty: ty::t)
-        -> @block_ctxt {
+    fn spill_and_drop(cx: &@block_ctxt, val: ValueRef, ty: ty::t) ->
+       @block_ctxt {
         let bcx = cx;
         let r = trans::spill_if_immediate(bcx, val, ty);
-        let spilled = r.val; bcx = r.bcx;
+        let spilled = r.val;
+        bcx = r.bcx;
         ret drop_ty(bcx, spilled, ty);
     }
     find_scope_cx(cx).cleanups +=
@@ -345,7 +342,7 @@ fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id,
     if did.crate == ast::local_crate {
         alt ccx.fn_pairs.find(did.node) {
           some(x) { ret x; }
-          _ { ccx.tcx.sess.bug(~"get_res_dtor: can't find resource dtor!"); }
+          _ { ccx.tcx.sess.bug("get_res_dtor: can't find resource dtor!"); }
         }
     }
 
@@ -355,9 +352,8 @@ fn get_res_dtor(ccx: &@crate_ctxt, sp: &span, did: &ast::def_id,
                           [{mode: ty::mo_alias(false), ty: inner_t}],
                           ty::mk_nil(ccx.tcx), params);
     ret trans::get_extern_const(ccx.externs, ccx.llmod,
-                                csearch::get_symbol(
-                                    ccx.sess.get_cstore(),
-                                    did),
+                                csearch::get_symbol(ccx.sess.get_cstore(),
+                                                    did),
                                 T_fn_pair(*ccx, f_t));
 }
 
@@ -396,26 +392,24 @@ type block_ctxt =
     // llvm::LLVMAppendBasicBlock(llfn, name), which adds a basic
     // block to the function pointed to by llfn.  We insert
     // instructions into that block by way of this block context.
+    // The block pointing to this one in the function's digraph.
+    // The 'kind' of basic block this is.
+    // A list of functions that run at the end of translating this
+    // block, cleaning up any variables that were introduced in the
+    // block and need to go out of scope at the end of it.
+    // The source span where this block comes from, for error
+    // reporting. FIXME this is not currently reliable
+    // The function context for the function to which this block is
+    // attached.
     {llbb: BasicBlockRef,
      mutable terminated: bool,
-     // The block pointing to this one in the function's digraph.
      parent: block_parent,
-     // The 'kind' of basic block this is.
      kind: block_kind,
-     // A list of functions that run at the end of translating this
-     // block, cleaning up any variables that were introduced in the
-     // block and need to go out of scope at the end of it.
      mutable cleanups: [cleanup],
-     // The source span where this block comes from, for error
-     // reporting. FIXME this is not currently reliable
      sp: span,
-     // The function context for the function to which this block is
-     // attached.
      fcx: @fn_ctxt};
 
-fn is_terminated(cx: &@block_ctxt) -> bool {
-    ret cx.terminated;
-}
+fn is_terminated(cx: &@block_ctxt) -> bool { ret cx.terminated; }
 
 // FIXME: we should be able to use option::t<@block_parent> here but
 // the infinite-tag check in rustboot gets upset.
@@ -424,7 +418,7 @@ tag block_parent { parent_none; parent_some(@block_ctxt); }
 type result = {bcx: @block_ctxt, val: ValueRef};
 type result_t = {bcx: @block_ctxt, val: ValueRef, ty: ty::t};
 
-fn extend_path(cx: @local_ctxt, name: &istr) -> @local_ctxt {
+fn extend_path(cx: @local_ctxt, name: &str) -> @local_ctxt {
     ret @{path: cx.path + [name] with *cx};
 }
 
@@ -432,15 +426,13 @@ fn rslt(bcx: @block_ctxt, val: ValueRef) -> result {
     ret {bcx: bcx, val: val};
 }
 
-fn ty_str(tn: type_names, t: TypeRef) -> istr {
+fn ty_str(tn: type_names, t: TypeRef) -> str {
     ret lib::llvm::type_to_str(tn, t);
 }
 
 fn val_ty(v: ValueRef) -> TypeRef { ret llvm::LLVMTypeOf(v); }
 
-fn val_str(tn: type_names, v: ValueRef) -> istr {
-    ret ty_str(tn, val_ty(v));
-}
+fn val_str(tn: type_names, v: ValueRef) -> str { ret ty_str(tn, val_ty(v)); }
 
 // Returns the nth element of the given LLVM structure type.
 fn struct_elt(llstructty: TypeRef, n: uint) -> TypeRef {
@@ -456,8 +448,8 @@ fn find_scope_cx(cx: &@block_ctxt) -> @block_ctxt {
     alt cx.parent {
       parent_some(b) { ret find_scope_cx(b); }
       parent_none. {
-        cx.fcx.lcx.ccx.sess.bug(~"trans::find_scope_cx() " +
-                                ~"called on parentless block_ctxt");
+        cx.fcx.lcx.ccx.sess.bug("trans::find_scope_cx() " +
+                                    "called on parentless block_ctxt");
       }
     }
 }
@@ -543,20 +535,16 @@ fn T_fn_pair(cx: &crate_ctxt, tfn: TypeRef) -> TypeRef {
 fn T_ptr(t: TypeRef) -> TypeRef { ret llvm::LLVMPointerType(t, 0u); }
 
 fn T_struct(elts: &[TypeRef]) -> TypeRef {
-    ret llvm::LLVMStructType(to_ptr(elts),
-                             std::vec::len(elts), False);
+    ret llvm::LLVMStructType(to_ptr(elts), std::vec::len(elts), False);
 }
 
-fn T_named_struct(name: &istr) -> TypeRef {
+fn T_named_struct(name: &str) -> TypeRef {
     let c = llvm::LLVMGetGlobalContext();
-    ret str::as_buf(name, { |buf|
-        llvm::LLVMStructCreateNamed(c, buf)
-    });
+    ret str::as_buf(name, {|buf| llvm::LLVMStructCreateNamed(c, buf) });
 }
 
 fn set_struct_body(t: TypeRef, elts: &[TypeRef]) {
-    llvm::LLVMStructSetBody(t, to_ptr(elts),
-                            std::vec::len(elts), False);
+    llvm::LLVMStructSetBody(t, to_ptr(elts), std::vec::len(elts), False);
 }
 
 fn T_empty_struct() -> TypeRef { ret T_struct([]); }
@@ -566,25 +554,25 @@ fn T_empty_struct() -> TypeRef { ret T_struct([]); }
 // existing objects, use ccx.rust_object_type.  Calling
 // T_rust_object() again will return a different one.
 fn T_rust_object() -> TypeRef {
-    let t = T_named_struct(~"rust_object");
+    let t = T_named_struct("rust_object");
     let e = T_ptr(T_empty_struct());
     set_struct_body(t, [e, e]);
     ret t;
 }
 
 fn T_task() -> TypeRef {
-    let t = T_named_struct(~"task");
+    let t = T_named_struct("task");
 
-     // Refcount
-     // Delegate pointer
-     // Stack segment pointer
-     // Runtime SP
-     // Rust SP
-     // GC chain
+    // Refcount
+    // Delegate pointer
+    // Stack segment pointer
+    // Runtime SP
+    // Rust SP
+    // GC chain
 
 
-     // Domain pointer
-     // Crate cache pointer
+    // Domain pointer
+    // Crate cache pointer
 
     let elems =
         [T_int(), T_int(), T_int(), T_int(), T_int(), T_int(), T_int(),
@@ -605,7 +593,7 @@ fn T_tydesc_field(cx: &crate_ctxt, field: int) -> TypeRef {
 }
 
 fn T_glue_fn(cx: &crate_ctxt) -> TypeRef {
-    let s = ~"glue_fn";
+    let s = "glue_fn";
     if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); }
     let t = T_tydesc_field(cx, abi::tydesc_field_drop_glue);
     cx.tn.associate(s, t);
@@ -613,7 +601,7 @@ fn T_glue_fn(cx: &crate_ctxt) -> TypeRef {
 }
 
 fn T_cmp_glue_fn(cx: &crate_ctxt) -> TypeRef {
-    let s = ~"cmp_glue_fn";
+    let s = "cmp_glue_fn";
     if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); }
     let t = T_tydesc_field(cx, abi::tydesc_field_cmp_glue);
     cx.tn.associate(s, t);
@@ -621,7 +609,7 @@ fn T_cmp_glue_fn(cx: &crate_ctxt) -> TypeRef {
 }
 
 fn T_tydesc(taskptr_type: TypeRef) -> TypeRef {
-    let tydesc = T_named_struct(~"tydesc");
+    let tydesc = T_named_struct("tydesc");
     let tydescpp = T_ptr(T_ptr(tydesc));
     let pvoid = T_ptr(T_i8());
     let glue_fn_ty =
@@ -652,9 +640,7 @@ fn T_vec(t: TypeRef) -> TypeRef {
 }
 
 // Note that the size of this one is in bytes.
-fn T_opaque_vec() -> TypeRef {
-    ret T_vec(T_i8());
-}
+fn T_opaque_vec() -> TypeRef { ret T_vec(T_i8()); }
 
 fn T_box(t: TypeRef) -> TypeRef { ret T_struct([T_int(), t]); }
 
@@ -673,7 +659,7 @@ fn T_taskptr(cx: &crate_ctxt) -> TypeRef { ret T_ptr(cx.task_type); }
 
 // This type must never be used directly; it must always be cast away.
 fn T_typaram(tn: &type_names) -> TypeRef {
-    let s = ~"typaram";
+    let s = "typaram";
     if tn.name_has_type(s) { ret tn.get_type(s); }
     let t = T_i8();
     tn.associate(s, t);
@@ -692,7 +678,7 @@ fn T_closure_ptr(cx: &crate_ctxt, llbindings_ty: TypeRef, n_ty_params: uint)
 }
 
 fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef {
-    let s = ~"*closure";
+    let s = "*closure";
     if cx.tn.name_has_type(s) { ret cx.tn.get_type(s); }
     let t = T_closure_ptr(cx, T_nil(), 0u);
     cx.tn.associate(s, t);
@@ -700,7 +686,7 @@ fn T_opaque_closure_ptr(cx: &crate_ctxt) -> TypeRef {
 }
 
 fn T_tag(tn: &type_names, size: uint) -> TypeRef {
-    let s = ~"tag_" + uint::to_str(size, 10u);
+    let s = "tag_" + uint::to_str(size, 10u);
     if tn.name_has_type(s) { ret tn.get_type(s); }
     let t = T_struct([T_int(), T_array(T_i8(), size)]);
     tn.associate(s, t);
@@ -708,7 +694,7 @@ fn T_tag(tn: &type_names, size: uint) -> TypeRef {
 }
 
 fn T_opaque_tag(tn: &type_names) -> TypeRef {
-    let s = ~"opaque_tag";
+    let s = "opaque_tag";
     if tn.name_has_type(s) { ret tn.get_type(s); }
     let t = T_struct([T_int(), T_i8()]);
     tn.associate(s, t);
@@ -754,16 +740,12 @@ fn C_integral(t: TypeRef, u: uint, sign_extend: Bool) -> ValueRef {
     ret llvm::LLVMRustConstSmallInt(t, u, sign_extend);
 }
 
-fn C_float(s: &istr) -> ValueRef {
-    ret str::as_buf(s, { |buf|
-        llvm::LLVMConstRealOfString(T_float(), buf)
-    });
+fn C_float(s: &str) -> ValueRef {
+    ret str::as_buf(s, {|buf| llvm::LLVMConstRealOfString(T_float(), buf) });
 }
 
-fn C_floating(s: &istr, t: TypeRef) -> ValueRef {
-    ret str::as_buf(s, { |buf|
-        llvm::LLVMConstRealOfString(t, buf)
-    });
+fn C_floating(s: &str, t: TypeRef) -> ValueRef {
+    ret str::as_buf(s, {|buf| llvm::LLVMConstRealOfString(t, buf) });
 }
 
 fn C_nil() -> ValueRef {
@@ -787,13 +769,15 @@ fn C_u8(i: uint) -> ValueRef { ret C_integral(T_i8(), i, False); }
 
 // This is a 'c-like' raw string, which differs from
 // our boxed-and-length-annotated strings.
-fn C_cstr(cx: &@crate_ctxt, s: &istr) -> ValueRef {
-    let sc = str::as_buf(s, { |buf|
-        llvm::LLVMConstString(buf, str::byte_len(s), False)
-    });
-    let g = str::as_buf(cx.names.next(~"str"), { |buf|
-        llvm::LLVMAddGlobal(cx.llmod, val_ty(sc), buf)
-    });
+fn C_cstr(cx: &@crate_ctxt, s: &str) -> ValueRef {
+    let sc =
+        str::as_buf(s,
+                    {|buf|
+                        llvm::LLVMConstString(buf, str::byte_len(s), False)
+                    });
+    let g =
+        str::as_buf(cx.names.next("str"),
+                    {|buf| llvm::LLVMAddGlobal(cx.llmod, val_ty(sc), buf) });
     llvm::LLVMSetInitializer(g, sc);
     llvm::LLVMSetGlobalConstant(g, True);
     llvm::LLVMSetLinkage(g, lib::llvm::LLVMInternalLinkage as llvm::Linkage);
@@ -801,10 +785,11 @@ fn C_cstr(cx: &@crate_ctxt, s: &istr) -> ValueRef {
 }
 
 // Returns a Plain Old LLVM String:
-fn C_postr(s: &istr) -> ValueRef {
-    ret str::as_buf(s, { |buf|
-        llvm::LLVMConstString(buf, str::byte_len(s), False)
-    });
+fn C_postr(s: &str) -> ValueRef {
+    ret str::as_buf(s,
+                    {|buf|
+                        llvm::LLVMConstString(buf, str::byte_len(s), False)
+                    });
 }
 
 fn C_zero_byte_arr(size: uint) -> ValueRef {
@@ -836,9 +821,11 @@ fn C_bytes(bytes: &[u8]) -> ValueRef {
 
 fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef {
     let llshape = C_bytes(bytes);
-    let llglobal = str::as_buf(ccx.names.next(~"shape"), { |buf|
-        llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), buf)
-    });
+    let llglobal =
+        str::as_buf(ccx.names.next("shape"),
+                    {|buf|
+                        llvm::LLVMAddGlobal(ccx.llmod, val_ty(llshape), buf)
+                    });
     llvm::LLVMSetInitializer(llglobal, llshape);
     llvm::LLVMSetGlobalConstant(llglobal, True);
     llvm::LLVMSetLinkage(llglobal,
@@ -847,14 +834,16 @@ fn C_shape(ccx: &@crate_ctxt, bytes: &[u8]) -> ValueRef {
 }
 
 
-pure fn valid_variant_index(ix:uint, cx:@block_ctxt, tag_id: &ast::def_id,
+pure fn valid_variant_index(ix: uint, cx: @block_ctxt, tag_id: &ast::def_id,
                             variant_id: &ast::def_id) -> bool {
+
     // Handwaving: it's ok to pretend this code is referentially
     // transparent, because the relevant parts of the type context don't
     // change. (We're not adding new variants during trans.)
-    unchecked {
-      let variant = ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id);
-      ix < vec::len(variant.args)
+    unchecked{
+        let variant =
+            ty::tag_variant_with_id(bcx_tcx(cx), tag_id, variant_id);
+        ix < vec::len(variant.args)
     }
 }
 
diff --git a/src/comp/middle/trans_objects.rs b/src/comp/middle/trans_objects.rs
index cb48ef95d6d..ed2ee1ba74d 100644
--- a/src/comp/middle/trans_objects.rs
+++ b/src/comp/middle/trans_objects.rs
@@ -37,7 +37,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
     let llctor_decl;
     alt ccx.item_ids.find(ctor_id) {
       some(x) { llctor_decl = x; }
-      _ { cx.ccx.sess.span_fatal(sp, ~"unbound llctor_decl in trans_obj"); }
+      _ { cx.ccx.sess.span_fatal(sp, "unbound llctor_decl in trans_obj"); }
     }
 
     // Much like trans_fn, we must create an LLVM function, but since we're
@@ -79,8 +79,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
     // Grab onto the first and second elements of the pair.
     // abi::obj_field_vtbl and abi::obj_field_box simply specify words 0 and 1
     // of 'pair'.
-    let pair_vtbl =
-        GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
+    let pair_vtbl = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
     let pair_box = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_box)]);
 
     // Make a vtable for this object: a static array of pointers to functions.
@@ -135,8 +134,8 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
         bcx = body_tydesc.bcx;
         let ti = none::<@tydesc_info>;
 
-        let r = GEP_tup_like(bcx, body_ty, body,
-                             [0, abi::obj_body_elt_typarams]);
+        let r =
+            GEP_tup_like(bcx, body_ty, body, [0, abi::obj_body_elt_typarams]);
         bcx = r.bcx;
         let body_typarams = r.val;
 
@@ -186,7 +185,7 @@ fn trans_obj(cx: @local_ctxt, sp: &span, ob: &ast::_obj,
               }
               none. {
                 bcx_ccx(bcx).sess.span_fatal(f.ty.span,
-                                             ~"internal error in trans_obj");
+                                             "internal error in trans_obj");
               }
             }
         }
@@ -285,8 +284,7 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
     add_clean_temp(bcx, pair, t);
 
     // Grab onto the first and second elements of the pair.
-    let pair_vtbl =
-        GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
+    let pair_vtbl = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_vtbl)]);
     let pair_box = GEP(bcx, pair, [C_int(0), C_int(abi::obj_field_box)]);
 
     vtbl = PointerCast(bcx, vtbl, T_ptr(T_empty_struct()));
@@ -370,8 +368,9 @@ fn trans_anon_obj(bcx: @block_ctxt, sp: &span, anon_obj: &ast::anon_obj,
                 GEP_tup_like(bcx, body_ty, body,
                              [0, abi::obj_body_elt_inner_obj]);
             bcx = body_inner_obj.bcx;
-            bcx = copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val,
-                           inner_obj_ty);
+            bcx =
+                copy_val(bcx, INIT, body_inner_obj.val, inner_obj_val.val,
+                         inner_obj_ty);
           }
         }
 
@@ -435,7 +434,7 @@ fn filtering_fn(cx: @local_ctxt, m: &vtbl_mthd, addtl_meths: [@ast::method])
         ret some(fwding_mthd(fm));
       }
       normal_mthd(_) {
-        cx.ccx.sess.bug(~"create_vtbl(): shouldn't be any \
+        cx.ccx.sess.bug("create_vtbl(): shouldn't be any \
                         normal_mthds in meths here");
       }
     }
@@ -485,7 +484,7 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
             }
           }
           _ {
-            cx.ccx.sess.bug(~"create_vtbl(): trying to extend a \
+            cx.ccx.sess.bug("create_vtbl(): trying to extend a \
                             non-object");
           }
         }
@@ -526,7 +525,7 @@ fn create_vtbl(cx: @local_ctxt, sp: &span, outer_obj_ty: ty::t,
       }
     }
 
-    ret finish_vtbl(cx, llmethods, ~"vtbl");
+    ret finish_vtbl(cx, llmethods, "vtbl");
 }
 
 // create_backwarding_vtbl: Create a vtable for the inner object of an
@@ -549,7 +548,7 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t,
       }
       _ {
         // Shouldn't happen.
-        cx.ccx.sess.bug(~"create_backwarding_vtbl(): trying to extend a \
+        cx.ccx.sess.bug("create_backwarding_vtbl(): trying to extend a \
                             non-object");
       }
     }
@@ -560,19 +559,20 @@ fn create_backwarding_vtbl(cx: @local_ctxt, sp: &span, inner_obj_ty: ty::t,
         // being forwarded to.
         llmethods += [process_bkwding_mthd(cx, sp, @m, [], outer_obj_ty, [])];
     }
-    ret finish_vtbl(cx, llmethods, ~"backwarding_vtbl");
+    ret finish_vtbl(cx, llmethods, "backwarding_vtbl");
 }
 
 // finish_vtbl: Given a vector of vtable entries, create the table in
 // read-only memory and return a pointer to it.
-fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: &istr) ->
+fn finish_vtbl(cx: @local_ctxt, llmethods: [ValueRef], name: &str) ->
    ValueRef {
     let vtbl = C_struct(llmethods);
-    let vtbl_name = mangle_internal_name_by_path(
-        cx.ccx, cx.path + [name]);
-    let gvar = str::as_buf(vtbl_name, { |buf|
-        llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), buf)
-    });
+    let vtbl_name = mangle_internal_name_by_path(cx.ccx, cx.path + [name]);
+    let gvar =
+        str::as_buf(vtbl_name,
+                    {|buf|
+                        llvm::LLVMAddGlobal(cx.ccx.llmod, val_ty(vtbl), buf)
+                    });
     llvm::LLVMSetInitializer(gvar, vtbl);
     llvm::LLVMSetGlobalConstant(gvar, True);
     llvm::LLVMSetLinkage(gvar,
@@ -600,22 +600,19 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
 
     // Create a local context that's aware of the name of the method we're
     // creating.
-    let mcx: @local_ctxt = @{path: cx.path
-        + [~"method", m.ident] with *cx};
+    let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx};
 
     // Make up a name for the backwarding function.
-    let fn_name: istr = ~"backwarding_fn";
-    let s: istr =
-        mangle_internal_name_by_path_and_seq(
-            mcx.ccx, mcx.path, fn_name);
+    let fn_name: str = "backwarding_fn";
+    let s: str =
+        mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name);
 
     // Get the backwarding function's type and declare it.
     let llbackwarding_fn_ty: TypeRef =
         type_of_fn_full(cx.ccx, sp, m.proto, true, m.inputs, m.output,
                         std::vec::len::<ast::ty_param>(ty_params));
     let llbackwarding_fn: ValueRef =
-        decl_internal_fastcall_fn(
-            cx.ccx.llmod, s, llbackwarding_fn_ty);
+        decl_internal_fastcall_fn(cx.ccx.llmod, s, llbackwarding_fn_ty);
 
     // Create a new function context and block context for the backwarding
     // function, holding onto a pointer to the first block.
@@ -630,8 +627,8 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // Cast to self-stack's type.
     let llenv =
         PointerCast(bcx, fcx.llenv,
-            T_ptr(T_struct([cx.ccx.rust_object_type,
-                            T_ptr(cx.ccx.rust_object_type)])));
+                    T_ptr(T_struct([cx.ccx.rust_object_type,
+                                    T_ptr(cx.ccx.rust_object_type)])));
     let llself_obj_ptr = GEP(bcx, llenv, [C_int(0), C_int(1)]);
     llself_obj_ptr = Load(bcx, llself_obj_ptr);
 
@@ -656,7 +653,7 @@ fn process_bkwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
       }
       _ {
         // Shouldn't happen.
-        cx.ccx.sess.bug(~"process_bkwding_mthd(): non-object type passed \
+        cx.ccx.sess.bug("process_bkwding_mthd(): non-object type passed \
                         as outer_obj_ty");
       }
     }
@@ -731,22 +728,19 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
 
     // Create a local context that's aware of the name of the method we're
     // creating.
-    let mcx: @local_ctxt = @{path: cx.path
-        + [~"method", m.ident] with *cx};
+    let mcx: @local_ctxt = @{path: cx.path + ["method", m.ident] with *cx};
 
     // Make up a name for the forwarding function.
-    let fn_name: istr = ~"forwarding_fn";
-    let s: istr =
-        mangle_internal_name_by_path_and_seq(
-            mcx.ccx, mcx.path, fn_name);
+    let fn_name: str = "forwarding_fn";
+    let s: str =
+        mangle_internal_name_by_path_and_seq(mcx.ccx, mcx.path, fn_name);
 
     // Get the forwarding function's type and declare it.
     let llforwarding_fn_ty: TypeRef =
         type_of_fn_full(cx.ccx, sp, m.proto, true, m.inputs, m.output,
                         std::vec::len::<ast::ty_param>(ty_params));
     let llforwarding_fn: ValueRef =
-        decl_internal_fastcall_fn(
-            cx.ccx.llmod, s, llforwarding_fn_ty);
+        decl_internal_fastcall_fn(cx.ccx.llmod, s, llforwarding_fn_ty);
 
     // Create a new function context and block context for the forwarding
     // function, holding onto a pointer to the first block.
@@ -782,8 +776,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
 
     // Now, reach into the box and grab the body.
     let llself_obj_body =
-        GEP(bcx, llself_obj_box,
-                      [C_int(0), C_int(abi::box_rc_field_body)]);
+        GEP(bcx, llself_obj_box, [C_int(0), C_int(abi::box_rc_field_body)]);
 
     // Now, we need to figure out exactly what type the body is supposed to be
     // cast to.
@@ -811,8 +804,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
     // method's entry out of the vtable so that the forwarding function can
     // call it.
     let llinner_obj_vtbl =
-        GEP(bcx, llinner_obj.val,
-                      [C_int(0), C_int(abi::obj_field_vtbl)]);
+        GEP(bcx, llinner_obj.val, [C_int(0), C_int(abi::obj_field_vtbl)]);
     llinner_obj_vtbl = Load(bcx, llinner_obj_vtbl);
 
     let llinner_obj_body =
@@ -827,7 +819,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
       }
       _ {
         // Shouldn't happen.
-        cx.ccx.sess.bug(~"process_fwding_mthd(): non-object type passed \
+        cx.ccx.sess.bug("process_fwding_mthd(): non-object type passed \
                         as target_obj_ty");
       }
     }
@@ -846,8 +838,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
                         ty::ty_fn_proto(bcx_tcx(bcx), orig_mthd_ty), true,
                         m.inputs, m.output,
                         std::vec::len::<ast::ty_param>(ty_params));
-    llorig_mthd =
-        PointerCast(bcx, llorig_mthd, T_ptr(T_ptr(llorig_mthd_ty)));
+    llorig_mthd = PointerCast(bcx, llorig_mthd, T_ptr(T_ptr(llorig_mthd_ty)));
     llorig_mthd = Load(bcx, llorig_mthd);
 
     // Set up the self-stack.
@@ -860,8 +851,7 @@ fn process_fwding_mthd(cx: @local_ctxt, sp: &span, m: @ty::method,
                             llinner_obj_body);
 
     // Cast self_stack back to pointer-to-object-type to make LLVM happy.
-    self_stack =
-        PointerCast(bcx, self_stack, T_ptr(cx.ccx.rust_object_type));
+    self_stack = PointerCast(bcx, self_stack, T_ptr(cx.ccx.rust_object_type));
 
     // Set up the three implicit arguments to the original method we'll need
     // to call.
@@ -930,11 +920,9 @@ fn process_normal_mthd(cx: @local_ctxt, m: @ast::method, self_ty: ty::t,
       }
     }
     let mcx: @local_ctxt =
-        @{path: cx.path + [~"method", m.node.ident] with *cx};
-    let s: istr = mangle_internal_name_by_path(mcx.ccx,
-                                               mcx.path);
-    let llfn: ValueRef = decl_internal_fastcall_fn(
-        cx.ccx.llmod, s, llfnty);
+        @{path: cx.path + ["method", m.node.ident] with *cx};
+    let s: str = mangle_internal_name_by_path(mcx.ccx, mcx.path);
+    let llfn: ValueRef = decl_internal_fastcall_fn(cx.ccx.llmod, s, llfnty);
 
     // Every method on an object gets its node_id inserted into the crate-wide
     // item_ids map, together with the ValueRef that points to where that
diff --git a/src/comp/middle/trans_vec.rs b/src/comp/middle/trans_vec.rs
index 84d542bbdcd..10a5ed5ce7d 100644
--- a/src/comp/middle/trans_vec.rs
+++ b/src/comp/middle/trans_vec.rs
@@ -3,12 +3,11 @@ import std::option::none;
 import syntax::ast;
 import lib::llvm::llvm::{ValueRef, TypeRef};
 import back::abi;
-import trans::{call_memmove, trans_shared_malloc, llsize_of,
-               type_of_or_i8, incr_ptr, INIT, copy_val, load_if_immediate,
-               alloca, size_of, llderivedtydescs_block_ctxt,
-               lazily_emit_tydesc_glue, get_tydesc, load_inbounds,
-               move_val_if_temp, trans_lval, node_id_type,
-               new_sub_block_ctxt, tps_normal, do_spill_noroot};
+import trans::{call_memmove, trans_shared_malloc, llsize_of, type_of_or_i8,
+               incr_ptr, INIT, copy_val, load_if_immediate, alloca, size_of,
+               llderivedtydescs_block_ctxt, lazily_emit_tydesc_glue,
+               get_tydesc, load_inbounds, move_val_if_temp, trans_lval,
+               node_id_type, new_sub_block_ctxt, tps_normal, do_spill_noroot};
 import trans_build::*;
 import trans_common::*;
 
@@ -18,14 +17,14 @@ fn get_fill(bcx: &@block_ctxt, vptr: ValueRef) -> ValueRef {
 fn get_alloc(bcx: &@block_ctxt, vptr: ValueRef) -> ValueRef {
     Load(bcx, InBoundsGEP(bcx, vptr, [C_int(0), C_uint(abi::vec_elt_alloc)]))
 }
-fn get_dataptr(bcx: &@block_ctxt, vpt: ValueRef,
-               unit_ty: TypeRef) -> ValueRef {
+fn get_dataptr(bcx: &@block_ctxt, vpt: ValueRef, unit_ty: TypeRef) ->
+   ValueRef {
     let ptr = InBoundsGEP(bcx, vpt, [C_int(0), C_uint(abi::vec_elt_elems)]);
     PointerCast(bcx, ptr, T_ptr(unit_ty))
 }
 
-fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef)
-    -> ValueRef {
+fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef) ->
+   ValueRef {
     let old_ty = val_ty(ptr);
     let bptr = PointerCast(bcx, ptr, T_ptr(T_i8()));
     ret PointerCast(bcx, InBoundsGEP(bcx, bptr, [bytes]), old_ty);
@@ -34,53 +33,58 @@ fn pointer_add(bcx: &@block_ctxt, ptr: ValueRef, bytes: ValueRef)
 fn alloc_raw(bcx: &@block_ctxt, fill: ValueRef, alloc: ValueRef) -> result {
     let llvecty = T_opaque_vec();
     let vecsize = Add(bcx, alloc, llsize_of(llvecty));
-    let {bcx, val: vecptr} =
+    let {bcx: bcx, val: vecptr} =
         trans_shared_malloc(bcx, T_ptr(llvecty), vecsize);
-    Store(bcx, fill, InBoundsGEP
-          (bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_fill)]));
-    Store(bcx, alloc, InBoundsGEP
-          (bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_alloc)]));
+    Store(bcx, fill,
+          InBoundsGEP(bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_fill)]));
+    Store(bcx, alloc,
+          InBoundsGEP(bcx, vecptr, [C_int(0), C_uint(abi::vec_elt_alloc)]));
     ret {bcx: bcx, val: vecptr};
 }
 
-type alloc_result = {bcx: @block_ctxt,
-                     val: ValueRef,
-                     unit_ty: ty::t,
-                     llunitsz: ValueRef,
-                     llunitty: TypeRef};
+type alloc_result =
+    {bcx: @block_ctxt,
+     val: ValueRef,
+     unit_ty: ty::t,
+     llunitsz: ValueRef,
+     llunitty: TypeRef};
 
 fn alloc(bcx: &@block_ctxt, vec_ty: &ty::t, elts: uint) -> alloc_result {
     let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty);
     let llunitty = type_of_or_i8(bcx, unit_ty);
     let llvecty = T_vec(llunitty);
-    let {bcx, val: unit_sz} = size_of(bcx, unit_ty);
+    let {bcx: bcx, val: unit_sz} = size_of(bcx, unit_ty);
 
     let fill = Mul(bcx, C_uint(elts), unit_sz);
     let alloc = if elts < 4u { Mul(bcx, C_int(4), unit_sz) } else { fill };
-    let {bcx, val: vptr} = alloc_raw(bcx, fill, alloc);
+    let {bcx: bcx, val: vptr} = alloc_raw(bcx, fill, alloc);
     let vptr = PointerCast(bcx, vptr, T_ptr(llvecty));
     add_clean_temp(bcx, vptr, vec_ty);
-    ret {bcx: bcx, val: vptr, unit_ty: unit_ty,
-         llunitsz: unit_sz, llunitty: llunitty};
+    ret {bcx: bcx,
+         val: vptr,
+         unit_ty: unit_ty,
+         llunitsz: unit_sz,
+         llunitty: llunitty};
 }
 
 fn duplicate(bcx: &@block_ctxt, vptrptr: ValueRef) -> @block_ctxt {
     let vptr = Load(bcx, vptrptr);
     let fill = get_fill(bcx, vptr);
     let size = Add(bcx, fill, llsize_of(T_opaque_vec()));
-    let {bcx, val: newptr} = trans_shared_malloc(bcx, val_ty(vptr), size);
+    let {bcx: bcx, val: newptr} =
+        trans_shared_malloc(bcx, val_ty(vptr), size);
     let bcx = call_memmove(bcx, newptr, vptr, size).bcx;
     Store(bcx, fill,
           InBoundsGEP(bcx, newptr, [C_int(0), C_uint(abi::vec_elt_alloc)]));
     Store(bcx, newptr, vptrptr);
     ret bcx;
 }
-fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t)
-    -> @block_ctxt {
+fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t) ->
+   @block_ctxt {
     let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty);
     let vptr = Load(bcx, vptrptr);
-    let drop_cx = new_sub_block_ctxt(bcx, ~"drop");
-    let next_cx = new_sub_block_ctxt(bcx, ~"next");
+    let drop_cx = new_sub_block_ctxt(bcx, "drop");
+    let next_cx = new_sub_block_ctxt(bcx, "next");
     let null_test = IsNull(bcx, vptr);
     CondBr(bcx, null_test, next_cx.llbb, drop_cx.llbb);
     if ty::type_needs_drop(bcx_tcx(bcx), unit_ty) {
@@ -92,10 +96,14 @@ fn make_drop_glue(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t)
     ret next_cx;
 }
 
-fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr],
-              id: ast::node_id) -> result {
+fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr], id: ast::node_id) ->
+   result {
     let vec_ty = node_id_type(bcx_ccx(bcx), id);
-    let {bcx, val: vptr, llunitsz, unit_ty, llunitty} =
+    let {bcx: bcx,
+         val: vptr,
+         llunitsz: llunitsz,
+         unit_ty: unit_ty,
+         llunitty: llunitty} =
         alloc(bcx, vec_ty, vec::len(args));
 
     // Store the individual elements.
@@ -104,24 +112,24 @@ fn trans_vec(bcx: &@block_ctxt, args: &[@ast::expr],
     for e in args {
         let lv = trans_lval(bcx, e);
         bcx = lv.res.bcx;
-        let lleltptr = if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
-            InBoundsGEP(bcx, dataptr, [Mul(bcx, C_uint(i), llunitsz)])
-        } else {
-            InBoundsGEP(bcx, dataptr, [C_uint(i)])
-        };
+        let lleltptr =
+            if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
+                InBoundsGEP(bcx, dataptr, [Mul(bcx, C_uint(i), llunitsz)])
+            } else { InBoundsGEP(bcx, dataptr, [C_uint(i)]) };
         bcx = move_val_if_temp(bcx, INIT, lleltptr, lv, unit_ty);
         i += 1u;
     }
     ret rslt(bcx, vptr);
 }
-fn trans_istr(bcx: &@block_ctxt, s: istr) -> result {
+fn trans_istr(bcx: &@block_ctxt, s: str) -> result {
     let veclen = std::str::byte_len(s) + 1u; // +1 for \0
-    let {bcx, val: sptr, _} =
+    let {bcx: bcx, val: sptr, _} =
         alloc(bcx, ty::mk_istr(bcx_tcx(bcx)), veclen);
 
     let llcstr = C_cstr(bcx_ccx(bcx), s);
-    let bcx = call_memmove(bcx, get_dataptr(bcx, sptr, T_i8()),
-                           llcstr, C_uint(veclen)).bcx;
+    let bcx =
+        call_memmove(bcx, get_dataptr(bcx, sptr, T_i8()), llcstr,
+                     C_uint(veclen)).bcx;
 
     ret rslt(bcx, sptr);
 }
@@ -135,12 +143,13 @@ fn trans_append(cx: &@block_ctxt, vec_ty: ty::t, lhsptr: ValueRef,
         lhsptr = PointerCast(cx, lhsptr, T_ptr(T_ptr(T_opaque_vec())));
         rhs = PointerCast(cx, rhs, T_ptr(T_opaque_vec()));
     }
-    let strings = alt ty::struct(bcx_tcx(cx), vec_ty) {
-      ty::ty_istr. { true }
-      ty::ty_vec(_) { false }
-    };
+    let strings =
+        alt ty::struct(bcx_tcx(cx), vec_ty) {
+          ty::ty_istr. { true }
+          ty::ty_vec(_) { false }
+        };
 
-    let {bcx, val: unit_sz} = size_of(cx, unit_ty);
+    let {bcx: bcx, val: unit_sz} = size_of(cx, unit_ty);
     let llunitty = type_of_or_i8(cx, unit_ty);
 
     let lhs = Load(bcx, lhsptr);
@@ -161,18 +170,23 @@ fn trans_append(cx: &@block_ctxt, vec_ty: ty::t, lhsptr: ValueRef,
     if strings { lhs_off = Sub(bcx, lhs_off, C_int(1)); }
     let write_ptr = pointer_add(bcx, lhs_data, lhs_off);
     let write_ptr_ptr = do_spill_noroot(bcx, write_ptr);
-    let bcx = iter_vec_raw(bcx, rhs, vec_ty, rfill, { | &bcx, addr, _ty |
-        let write_ptr = Load(bcx, write_ptr_ptr);
-        let bcx = copy_val(bcx, INIT, write_ptr,
-                           load_if_immediate(bcx, addr, unit_ty), unit_ty);
-        if dynamic {
-            // We have to increment by the dynamically-computed size.
-            incr_ptr(bcx, write_ptr, unit_sz, write_ptr_ptr);
-        } else {
-            incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr);
-        }
-        ret bcx;
-    });
+    let bcx =
+        iter_vec_raw(bcx, rhs, vec_ty, rfill,
+                     // We have to increment by the dynamically-computed size.
+                     {|&bcx, addr, _ty|
+                         let write_ptr = Load(bcx, write_ptr_ptr);
+                         let bcx =
+                             copy_val(bcx, INIT, write_ptr,
+                                      load_if_immediate(bcx, addr, unit_ty),
+                                      unit_ty);
+                         if dynamic {
+                             incr_ptr(bcx, write_ptr, unit_sz, write_ptr_ptr);
+                         } else {
+                             incr_ptr(bcx, write_ptr, C_int(1),
+                                      write_ptr_ptr);
+                         }
+                         ret bcx;
+                     });
     ret rslt(bcx, C_nil());
 }
 
@@ -180,7 +194,7 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t,
                         vals: &[@ast::expr]) -> @block_ctxt {
     let elt_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty);
     let ti = none;
-    let {bcx, val: td} =
+    let {bcx: bcx, val: td} =
         get_tydesc(bcx, elt_ty, false, tps_normal, ti).result;
     trans::lazily_emit_tydesc_glue(bcx, abi::tydesc_field_take_glue, ti);
     let opaque_v = PointerCast(bcx, vptrptr, T_ptr(T_ptr(T_opaque_vec())));
@@ -188,7 +202,8 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t,
         let {bcx: e_bcx, val: elt} = trans::trans_expr(bcx, val);
         bcx = e_bcx;
         let r = trans::spill_if_immediate(bcx, elt, elt_ty);
-        let spilled = r.val; bcx = r.bcx;
+        let spilled = r.val;
+        bcx = r.bcx;
         Call(bcx, bcx_ccx(bcx).upcalls.vec_push,
              [bcx.fcx.lltaskptr, opaque_v, td,
               PointerCast(bcx, spilled, T_ptr(T_i8()))]);
@@ -196,40 +211,41 @@ fn trans_append_literal(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t,
     ret bcx;
 }
 
-fn trans_add(bcx: &@block_ctxt, vec_ty: ty::t, lhs: ValueRef,
-             rhs: ValueRef) -> result {
-    let strings = alt ty::struct(bcx_tcx(bcx), vec_ty) {
-      ty::ty_istr. { true }
-      ty::ty_vec(_) { false }
-    };
+fn trans_add(bcx: &@block_ctxt, vec_ty: ty::t, lhs: ValueRef, rhs: ValueRef)
+   -> result {
+    let strings =
+        alt ty::struct(bcx_tcx(bcx), vec_ty) {
+          ty::ty_istr. { true }
+          ty::ty_vec(_) { false }
+        };
     let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty);
     let llunitty = type_of_or_i8(bcx, unit_ty);
-    let {bcx, val: llunitsz} = size_of(bcx, unit_ty);
+    let {bcx: bcx, val: llunitsz} = size_of(bcx, unit_ty);
 
     let lhs_fill = get_fill(bcx, lhs);
     if strings { lhs_fill = Sub(bcx, lhs_fill, C_int(1)); }
     let rhs_fill = get_fill(bcx, rhs);
     let new_fill = Add(bcx, lhs_fill, rhs_fill);
-    let {bcx, val: new_vec} = alloc_raw(bcx, new_fill, new_fill);
+    let {bcx: bcx, val: new_vec} = alloc_raw(bcx, new_fill, new_fill);
     let new_vec = PointerCast(bcx, new_vec, T_ptr(T_vec(llunitty)));
     add_clean_temp(bcx, new_vec, vec_ty);
 
-    let write_ptr_ptr = do_spill_noroot(bcx,
-                                        get_dataptr(bcx, new_vec, llunitty));
-    let copy_fn = bind fn(bcx: &@block_ctxt, addr: ValueRef, _ty: ty::t,
-                          write_ptr_ptr: ValueRef, unit_ty: ty::t,
-                          llunitsz: ValueRef) -> @block_ctxt {
-        let write_ptr = Load(bcx, write_ptr_ptr);
-        let bcx = copy_val(bcx, INIT, write_ptr,
-                           load_if_immediate(bcx, addr, unit_ty), unit_ty);
-        if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
-            // We have to increment by the dynamically-computed size.
-            incr_ptr(bcx, write_ptr, llunitsz, write_ptr_ptr);
-        } else {
-            incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr);
-        }
-        ret bcx;
-    } (_, _, _, write_ptr_ptr, unit_ty, llunitsz);
+    let write_ptr_ptr =
+        do_spill_noroot(bcx, get_dataptr(bcx, new_vec, llunitty));
+    let copy_fn =
+        bind fn (bcx: &@block_ctxt, addr: ValueRef, _ty: ty::t,
+                 write_ptr_ptr: ValueRef, unit_ty: ty::t, llunitsz: ValueRef)
+                -> @block_ctxt {
+                 let write_ptr = Load(bcx, write_ptr_ptr);
+                 let bcx =
+                     copy_val(bcx, INIT, write_ptr,
+                              load_if_immediate(bcx, addr, unit_ty), unit_ty);
+                 if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
+                     // We have to increment by the dynamically-computed size.
+                     incr_ptr(bcx, write_ptr, llunitsz, write_ptr_ptr);
+                 } else { incr_ptr(bcx, write_ptr, C_int(1), write_ptr_ptr); }
+                 ret bcx;
+             }(_, _, _, write_ptr_ptr, unit_ty, llunitsz);
 
     let bcx = iter_vec_raw(bcx, lhs, vec_ty, lhs_fill, copy_fn);
     let bcx = iter_vec_raw(bcx, rhs, vec_ty, rhs_fill, copy_fn);
@@ -241,10 +257,10 @@ type val_and_ty_fn = fn(&@block_ctxt, ValueRef, ty::t) -> result;
 type iter_vec_block = block(&@block_ctxt, ValueRef, ty::t) -> @block_ctxt;
 
 fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t,
-                 fill: ValueRef, f: &iter_vec_block) -> @block_ctxt {
+                fill: ValueRef, f: &iter_vec_block) -> @block_ctxt {
     let unit_ty = ty::sequence_element_type(bcx_tcx(bcx), vec_ty);
     let llunitty = type_of_or_i8(bcx, unit_ty);
-    let {bcx, val: unit_sz} = size_of(bcx, unit_ty);
+    let {bcx: bcx, val: unit_sz} = size_of(bcx, unit_ty);
     let vptr = PointerCast(bcx, vptr, T_ptr(T_vec(llunitty)));
     let data_ptr = get_dataptr(bcx, vptr, llunitty);
 
@@ -255,18 +271,19 @@ fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t,
     let data_ptr_ptr = do_spill_noroot(bcx, data_ptr);
 
     // Now perform the iteration.
-    let header_cx = new_sub_block_ctxt(bcx, ~"iter_vec_loop_header");
+    let header_cx = new_sub_block_ctxt(bcx, "iter_vec_loop_header");
     Br(bcx, header_cx.llbb);
     let data_ptr = Load(header_cx, data_ptr_ptr);
-    let not_yet_at_end = ICmp(header_cx, lib::llvm::LLVMIntULT,
-                              data_ptr, data_end_ptr);
-    let body_cx = new_sub_block_ctxt(bcx, ~"iter_vec_loop_body");
-    let next_cx = new_sub_block_ctxt(bcx, ~"iter_vec_next");
+    let not_yet_at_end =
+        ICmp(header_cx, lib::llvm::LLVMIntULT, data_ptr, data_end_ptr);
+    let body_cx = new_sub_block_ctxt(bcx, "iter_vec_loop_body");
+    let next_cx = new_sub_block_ctxt(bcx, "iter_vec_next");
     CondBr(header_cx, not_yet_at_end, body_cx.llbb, next_cx.llbb);
     body_cx = f(body_cx, data_ptr, unit_ty);
-    let increment = if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
-        unit_sz
-    } else { C_int(1) };
+    let increment =
+        if ty::type_has_dynamic_size(bcx_tcx(bcx), unit_ty) {
+            unit_sz
+        } else { C_int(1) };
     incr_ptr(body_cx, data_ptr, increment, data_ptr_ptr);
     Br(body_cx, header_cx.llbb);
 
@@ -274,9 +291,9 @@ fn iter_vec_raw(bcx: &@block_ctxt, vptr: ValueRef, vec_ty: ty::t,
 }
 
 fn iter_vec(bcx: &@block_ctxt, vptrptr: ValueRef, vec_ty: ty::t,
-             f: &iter_vec_block) -> @block_ctxt {
-    let vptr = Load(bcx, PointerCast(bcx, vptrptr,
-                                     T_ptr(T_ptr(T_opaque_vec()))));
+            f: &iter_vec_block) -> @block_ctxt {
+    let vptr =
+        Load(bcx, PointerCast(bcx, vptrptr, T_ptr(T_ptr(T_opaque_vec()))));
     ret iter_vec_raw(bcx, vptr, vec_ty, get_fill(bcx, vptr), f);
 }
 
diff --git a/src/comp/middle/tstate/ann.rs b/src/comp/middle/tstate/ann.rs
index d8d495d11a2..f88d803b7bf 100644
--- a/src/comp/middle/tstate/ann.rs
+++ b/src/comp/middle/tstate/ann.rs
@@ -239,8 +239,8 @@ fn implies(a: t, b: t) -> bool {
     ret tritv_doesntcare(tmp);
 }
 
-fn trit_str(t: trit) -> istr {
-    alt t { dont_care. { ~"?" } ttrue. { ~"1" } tfalse. { ~"0" } }
+fn trit_str(t: trit) -> str {
+    alt t { dont_care. { "?" } ttrue. { "1" } tfalse. { "0" } }
 }
 //
 // Local Variables:
diff --git a/src/comp/middle/tstate/annotate.rs b/src/comp/middle/tstate/annotate.rs
index 0be3d1776ba..5a97d6bc0ae 100644
--- a/src/comp/middle/tstate/annotate.rs
+++ b/src/comp/middle/tstate/annotate.rs
@@ -32,12 +32,12 @@ fn collect_ids_block(b: &blk, rs: @mutable [node_id]) { *rs += [b.node.id]; }
 fn collect_ids_stmt(s: &@stmt, rs: @mutable [node_id]) {
     alt s.node {
       stmt_decl(_, id) {
-        log ~"node_id " + int::str(id);
+        log "node_id " + int::str(id);
         log_stmt(*s);;
         *rs += [id];
       }
       stmt_expr(_, id) {
-        log ~"node_id " + int::str(id);
+        log "node_id " + int::str(id);
         log_stmt(*s);;
         *rs += [id];
       }
@@ -62,7 +62,7 @@ fn node_ids_in_fn(f: &_fn, tps: &[ty_param], sp: &span, i: &fn_ident,
 
 fn init_vecs(ccx: &crate_ctxt, node_ids: &[node_id], len: uint) {
     for i: node_id in node_ids {
-        log int::str(i) + ~" |-> " + uint::str(len);
+        log int::str(i) + " |-> " + uint::str(len);
         add_node(ccx, i, empty_ann(len));
     }
 }
diff --git a/src/comp/middle/tstate/auxiliary.rs b/src/comp/middle/tstate/auxiliary.rs
index 62c883eb9f8..65015b4fea1 100644
--- a/src/comp/middle/tstate/auxiliary.rs
+++ b/src/comp/middle/tstate/auxiliary.rs
@@ -55,17 +55,17 @@ tag oper_type {
 }
 
 /* logging funs */
-fn def_id_to_str(d: def_id) -> istr {
-    ret int::str(d.crate) + ~"," + int::str(d.node);
+fn def_id_to_str(d: def_id) -> str {
+    ret int::str(d.crate) + "," + int::str(d.node);
 }
 
-fn comma_str(args: &[@constr_arg_use]) -> istr {
-    let rslt = ~"";
+fn comma_str(args: &[@constr_arg_use]) -> str {
+    let rslt = "";
     let comma = false;
     for a: @constr_arg_use in args {
-        if comma { rslt += ~", "; } else { comma = true; }
+        if comma { rslt += ", "; } else { comma = true; }
         alt a.node {
-          carg_base. { rslt += ~"*"; }
+          carg_base. { rslt += "*"; }
           carg_ident(i) { rslt += i.ident; }
           carg_lit(l) { rslt += lit_to_str(l); }
         }
@@ -73,30 +73,28 @@ fn comma_str(args: &[@constr_arg_use]) -> istr {
     ret rslt;
 }
 
-fn constraint_to_str(tcx: &ty::ctxt, c: &sp_constr) -> istr {
+fn constraint_to_str(tcx: &ty::ctxt, c: &sp_constr) -> str {
     alt c.node {
       ninit(_, i) {
-        ret ~"init(" + i + ~" [" +
-            tcx.sess.span_str(c.span) + ~"])";
+        ret "init(" + i + " [" + tcx.sess.span_str(c.span) + "])";
       }
       npred(p, _, args) {
-        ret path_to_str(p) + ~"(" +
-            comma_str(args) + ~")" + ~"[" +
-                tcx.sess.span_str(c.span) + ~"]";
+        ret path_to_str(p) + "(" + comma_str(args) + ")" + "[" +
+                tcx.sess.span_str(c.span) + "]";
       }
     }
 }
 
-fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> istr {
-    let s = ~"";
+fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> str {
+    let s = "";
     let comma = false;
     for p: norm_constraint in constraints(fcx) {
         alt tritv_get(v, p.bit_num) {
           dont_care. { }
           t {
             s +=
-                if comma { ~", " } else { comma = true; ~"" } +
-                    if t == tfalse { ~"!" } else { ~"" } +
+                if comma { ", " } else { comma = true; "" } +
+                    if t == tfalse { "!" } else { "" } +
                     constraint_to_str(fcx.ccx.tcx, p.c);
           }
         }
@@ -107,8 +105,8 @@ fn tritv_to_str(fcx: fn_ctxt, v: &tritv::t) -> istr {
 fn log_tritv(fcx: &fn_ctxt, v: &tritv::t) { log tritv_to_str(fcx, v); }
 
 fn first_difference_string(fcx: &fn_ctxt, expected: &tritv::t,
-                           actual: &tritv::t) -> istr {
-    let s: istr = ~"";
+                           actual: &tritv::t) -> str {
+    let s: str = "";
     for c: norm_constraint in constraints(fcx) {
         if tritv_get(expected, c.bit_num) == ttrue &&
                tritv_get(actual, c.bit_num) != ttrue {
@@ -120,12 +118,12 @@ fn first_difference_string(fcx: &fn_ctxt, expected: &tritv::t,
 
 fn log_tritv_err(fcx: fn_ctxt, v: tritv::t) { log_err tritv_to_str(fcx, v); }
 
-fn tos(v: &[uint]) -> istr {
-    let rslt = ~"";
+fn tos(v: &[uint]) -> str {
+    let rslt = "";
     for i: uint in v {
         if i == 0u {
-            rslt += ~"0";
-        } else if i == 1u { rslt += ~"1"; } else { rslt += ~"?"; }
+            rslt += "0";
+        } else if i == 1u { rslt += "1"; } else { rslt += "?"; }
     }
     ret rslt;
 }
@@ -170,11 +168,11 @@ fn log_states_err(pp: &pre_and_post_state) {
     log_cond_err(p2);
 }
 
-fn print_ident(i: &ident) { log ~" " + i + ~" "; }
+fn print_ident(i: &ident) { log " " + i + " "; }
 
 fn print_idents(idents: &mutable [ident]) {
     if vec::len::<ident>(idents) == 0u { ret; }
-    log ~"an ident: " + vec::pop::<ident>(idents);
+    log "an ident: " + vec::pop::<ident>(idents);
     print_idents(idents);
 }
 
@@ -272,15 +270,15 @@ So we need context. And so it seems clearer to just have separate
 constraints.
 */
 type fn_info =
+    /* list, accumulated during pre/postcondition
+    computation, of all local variables that may be
+    used */
+    // Doesn't seem to work without the @ -- bug
     {constrs: constr_map,
      num_constraints: uint,
      cf: controlflow,
      i_return: tsconstr,
      i_diverge: tsconstr,
-     /* list, accumulated during pre/postcondition
-     computation, of all local variables that may be
-     used */
-     // Doesn't seem to work without the @ -- bug
      used_vars: @mutable [node_id]};
 
 fn tsconstr_to_def_id(t: &tsconstr) -> def_id {
@@ -330,8 +328,7 @@ fn get_ts_ann(ccx: &crate_ctxt, i: node_id) -> option::t<ts_ann> {
 fn node_id_to_ts_ann(ccx: &crate_ctxt, id: node_id) -> ts_ann {
     alt get_ts_ann(ccx, id) {
       none. {
-        log_err ~"node_id_to_ts_ann: no ts_ann for node_id "
-            + int::str(id);
+        log_err "node_id_to_ts_ann: no ts_ann for node_id " + int::str(id);
         fail;
       }
       some(t) { ret t; }
@@ -533,8 +530,7 @@ fn constraints_expr(cx: &ty::ctxt, e: @expr) -> [@ty::constr] {
 fn node_id_to_def_strict(cx: &ty::ctxt, id: node_id) -> def {
     alt cx.def_map.find(id) {
       none. {
-        log_err ~"node_id_to_def: node_id "
-            + int::str(id) + ~" has no def";
+        log_err "node_id_to_def: node_id " + int::str(id) + " has no def";
         fail;
       }
       some(d) { ret d; }
@@ -579,26 +575,23 @@ fn constraints(fcx: &fn_ctxt) -> [norm_constraint] {
 // should freeze it at some earlier point.
 fn match_args(fcx: &fn_ctxt, occs: &@mutable [pred_args],
               occ: &[@constr_arg_use]) -> uint {
-    log ~"match_args: looking at " +
-            constr_args_to_str(fn (i: &inst) -> istr {
-                ret i.ident;
-            }, occ);
+    log "match_args: looking at " +
+            constr_args_to_str(fn (i: &inst) -> str { ret i.ident; }, occ);
     for pd: pred_args in *occs {
-        log ~"match_args: candidate " + pred_args_to_str(pd);
+        log "match_args: candidate " + pred_args_to_str(pd);
         fn eq(p: &inst, q: &inst) -> bool { ret p.node == q.node; }
         if ty::args_eq(eq, pd.node.args, occ) { ret pd.node.bit_num; }
     }
-    fcx.ccx.tcx.sess.bug(~"match_args: no match for occurring args");
+    fcx.ccx.tcx.sess.bug("match_args: no match for occurring args");
 }
 
 fn def_id_for_constr(tcx: ty::ctxt, t: node_id) -> def_id {
     alt tcx.def_map.find(t) {
       none. {
-        tcx.sess.bug(~"node_id_for_constr: bad node_id "
-                     + int::str(t));
+        tcx.sess.bug("node_id_for_constr: bad node_id " + int::str(t));
       }
       some(def_fn(i, _)) { ret i; }
-      _ { tcx.sess.bug(~"node_id_for_constr: pred is not a function"); }
+      _ { tcx.sess.bug("node_id_for_constr: pred is not a function"); }
     }
 }
 
@@ -612,12 +605,11 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use {
                         carg_ident({ident: p.node.idents[0], node: id.node}));
           }
           some(_) {
-            tcx.sess.bug(~"exprs_to_constr_args: non-local variable " +
-                             ~"as pred arg");
+            tcx.sess.bug("exprs_to_constr_args: non-local variable " +
+                             "as pred arg");
           }
           none {
-            tcx.sess.bug(~"exprs_to_constr_args: NONE " +
-                             ~"as pred arg");
+            tcx.sess.bug("exprs_to_constr_args: NONE " + "as pred arg");
 
           }
         }
@@ -625,8 +617,8 @@ fn expr_to_constr_arg(tcx: ty::ctxt, e: &@expr) -> @constr_arg_use {
       expr_lit(l) { ret @respan(e.span, carg_lit(l)); }
       _ {
         tcx.sess.span_fatal(e.span,
-                            ~"Arguments to constrained functions must be " +
-                                ~"literals or local variables");
+                            "Arguments to constrained functions must be " +
+                                "literals or local variables");
       }
     }
 }
@@ -649,25 +641,23 @@ fn expr_to_constr(tcx: ty::ctxt, e: &@expr) -> sp_constr {
           }
           _ {
             tcx.sess.span_fatal(operator.span,
-                                ~"Internal error: " +
-                                    ~" ill-formed operator \
+                                "Internal error: " +
+                                    " ill-formed operator \
                                             in predicate");
           }
         }
       }
       _ {
         tcx.sess.span_fatal(e.span,
-                            ~"Internal error: " + ~" ill-formed predicate");
+                            "Internal error: " + " ill-formed predicate");
       }
     }
 }
 
-fn pred_args_to_str(p: &pred_args) -> istr {
-    ~"<" + uint::str(p.node.bit_num) + ~", " +
-        constr_args_to_str(fn (i: &inst) -> istr {
-            ret i.ident;
-        }, p.node.args)
-        + ~">"
+fn pred_args_to_str(p: &pred_args) -> str {
+    "<" + uint::str(p.node.bit_num) + ", " +
+        constr_args_to_str(fn (i: &inst) -> str { ret i.ident; }, p.node.args)
+        + ">"
 }
 
 fn substitute_constr_args(cx: &ty::ctxt, actuals: &[@expr], c: &@ty::constr)
@@ -687,7 +677,7 @@ fn substitute_arg(cx: &ty::ctxt, actuals: &[@expr], a: @constr_arg) ->
         if i < num_actuals {
             ret expr_to_constr_arg(cx, actuals[i]);
         } else {
-            cx.sess.span_fatal(a.span, ~"Constraint argument out of bounds");
+            cx.sess.span_fatal(a.span, "Constraint argument out of bounds");
         }
       }
       carg_base. { ret @respan(a.span, carg_base); }
@@ -766,18 +756,18 @@ fn find_in_subst_bool(s: &subst, id: node_id) -> bool {
     is_some(find_in_subst(id, s))
 }
 
-fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> istr {
-    let rslt = ~"<";
+fn insts_to_str(stuff: &[constr_arg_general_<inst>]) -> str {
+    let rslt = "<";
     for i: constr_arg_general_<inst> in stuff {
         rslt +=
-            ~" " +
+            " " +
                 alt i {
                   carg_ident(p) { p.ident }
-                  carg_base. { ~"*" }
-                  carg_lit(_) { ~"[lit]" }
-                } + ~" ";
+                  carg_base. { "*" }
+                  carg_lit(_) { "[lit]" }
+                } + " ";
     }
-    rslt += ~">";
+    rslt += ">";
     rslt
 }
 
@@ -814,7 +804,7 @@ fn replace(subst: subst, d: pred_args) -> [constr_arg_general_<inst>] {
 
 fn path_to_ident(cx: &ty::ctxt, p: &path) -> ident {
     alt vec::last(p.node.idents) {
-      none. { cx.sess.span_fatal(p.span, ~"Malformed path"); }
+      none. { cx.sess.span_fatal(p.span, "Malformed path"); }
       some(i) { ret i; }
     }
 }
@@ -829,13 +819,13 @@ fn local_node_id_to_def_id_strict(fcx: &fn_ctxt, sp: &span, i: &node_id) ->
       }
       some(_) {
         fcx.ccx.tcx.sess.span_fatal(sp,
-                                    ~"local_node_id_to_def_id: id \
+                                    "local_node_id_to_def_id: id \
                isn't a local");
       }
       none. {
         // should really be bug. span_bug()?
         fcx.ccx.tcx.sess.span_fatal(sp,
-                                    ~"local_node_id_to_def_id: id \
+                                    "local_node_id_to_def_id: id \
                is unbound");
       }
     }
@@ -848,7 +838,9 @@ fn local_node_id_to_def(fcx: &fn_ctxt, i: &node_id) -> option::t<def> {
 fn local_node_id_to_def_id(fcx: &fn_ctxt, i: &node_id) -> option::t<def_id> {
     alt local_node_id_to_def(fcx, i) {
       some(def_local(id)) | some(def_arg(id, _)) | some(def_binding(id)) |
-      some(def_upvar(id, _, _)) { some(id) }
+      some(def_upvar(id, _, _)) {
+        some(id)
+      }
       _ { none }
     }
 }
@@ -1048,23 +1040,27 @@ fn do_nothing<T>(_f: &_fn, _tp: &[ty_param], _sp: &span, _i: &fn_ident,
 
 
 fn args_to_constr_args(tcx: &ty::ctxt, args: &[arg],
-                       indices:&[@sp_constr_arg<uint>]) -> [@constr_arg_use] {
+                       indices: &[@sp_constr_arg<uint>]) ->
+   [@constr_arg_use] {
     let actuals: [@constr_arg_use] = [];
     let num_args = vec::len(args);
-    for a:@sp_constr_arg<uint> in indices {
-        actuals += [@respan(a.span, alt a.node {
-          carg_base. { carg_base }
-          carg_ident(i) {
-            if i < num_args {
-                carg_ident({ident: args[i].ident, node:args[i].id})
-            }
-            else {
-                tcx.sess.span_bug(a.span, ~"Index out of bounds in \
+    for a: @sp_constr_arg<uint> in indices {
+        actuals +=
+            [@respan(a.span,
+                     alt a.node {
+                       carg_base. { carg_base }
+                       carg_ident(i) {
+                         if i < num_args {
+                             carg_ident({ident: args[i].ident,
+                                         node: args[i].id})
+                         } else {
+                             tcx.sess.span_bug(a.span,
+                                               "Index out of bounds in \
                   constraint arg");
-            }
-          }
-          carg_lit(l) { carg_lit(l) }
-        })];
+                         }
+                       }
+                       carg_lit(l) { carg_lit(l) }
+                     })];
     }
     ret actuals;
 }
@@ -1073,7 +1069,7 @@ fn ast_constr_to_ts_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) ->
    tsconstr {
     let tconstr = ty::ast_constr_to_constr(tcx, c);
     ret npred(tconstr.node.path, tconstr.node.id,
-         args_to_constr_args(tcx, args, tconstr.node.args));
+              args_to_constr_args(tcx, args, tconstr.node.args));
 }
 
 fn ast_constr_to_sp_constr(tcx: &ty::ctxt, args: &[arg], c: &@constr) ->
@@ -1109,9 +1105,8 @@ fn callee_modes(fcx: &fn_ctxt, callee: node_id) -> [ty::mode] {
       }
       _ {
         // Shouldn't happen; callee should be ty_fn.
-        fcx.ccx.tcx.sess.bug(
-            ~"non-fn callee type in callee_modes: " +
-            util::ppaux::ty_to_str(fcx.ccx.tcx, ty));
+        fcx.ccx.tcx.sess.bug("non-fn callee type in callee_modes: " +
+                                 util::ppaux::ty_to_str(fcx.ccx.tcx, ty));
       }
     }
 }
diff --git a/src/comp/middle/tstate/bitvectors.rs b/src/comp/middle/tstate/bitvectors.rs
index 208f984660a..8c37df3cec4 100644
--- a/src/comp/middle/tstate/bitvectors.rs
+++ b/src/comp/middle/tstate/bitvectors.rs
@@ -36,8 +36,8 @@ fn bit_num(fcx: &fn_ctxt, c: &tsconstr) -> uint {
         alt rslt {
           cinit(n, _, _) { ret n; }
           _ {
-            fcx.ccx.tcx.sess.bug(~"bit_num: asked for init constraint," +
-                                     ~" found a pred constraint");
+            fcx.ccx.tcx.sess.bug("bit_num: asked for init constraint," +
+                                     " found a pred constraint");
           }
         }
       }
@@ -45,8 +45,8 @@ fn bit_num(fcx: &fn_ctxt, c: &tsconstr) -> uint {
         alt rslt {
           cpred(_, descs) { ret match_args(fcx, descs, args); }
           _ {
-            fcx.ccx.tcx.sess.bug(~"bit_num: asked for pred constraint," +
-                                     ~" found an init constraint");
+            fcx.ccx.tcx.sess.bug("bit_num: asked for pred constraint," +
+                                     " found an init constraint");
           }
         }
       }
@@ -205,12 +205,12 @@ fn clear_in_poststate_expr(fcx: &fn_ctxt, e: &@expr, t: &poststate) {
               }
               some(_) {/* ignore args (for now...) */ }
               _ {
-                fcx.ccx.tcx.sess.bug(~"clear_in_poststate_expr: \
+                fcx.ccx.tcx.sess.bug("clear_in_poststate_expr: \
                                    unbound var");
               }
             }
           }
-          _ { fcx.ccx.tcx.sess.bug(~"clear_in_poststate_expr"); }
+          _ { fcx.ccx.tcx.sess.bug("clear_in_poststate_expr"); }
         }
       }
       _ {/* do nothing */ }
diff --git a/src/comp/middle/tstate/ck.rs b/src/comp/middle/tstate/ck.rs
index cef36843ea6..8348fc27409 100644
--- a/src/comp/middle/tstate/ck.rs
+++ b/src/comp/middle/tstate/ck.rs
@@ -55,9 +55,7 @@ fn check_unused_vars(fcx: &fn_ctxt) {
           ninit(id, v) {
             if !vec_contains(fcx.enclosing.used_vars, id) && v[0] != '_' as u8
                {
-                fcx.ccx.tcx.sess.span_warn(c.c.span,
-                                           ~"unused variable "
-                                           + v);
+                fcx.ccx.tcx.sess.span_warn(c.c.span, "unused variable " + v);
             }
           }
           _ {/* ignore pred constraints */ }
@@ -82,15 +80,15 @@ fn check_states_expr(e: &@expr, fcx: &fn_ctxt, v: &visit::vt<fn_ctxt>) {
     */
 
     if !implies(pres, prec) {
-        let s = ~"";
+        let s = "";
         let diff = first_difference_string(fcx, prec, pres);
         s +=
-            ~"Unsatisfied precondition constraint (for example, " + diff +
-                ~") for expression:\n";
+            "Unsatisfied precondition constraint (for example, " + diff +
+                ") for expression:\n";
         s += syntax::print::pprust::expr_to_str(e);
-        s += ~"\nPrecondition:\n";
+        s += "\nPrecondition:\n";
         s += tritv_to_str(fcx, prec);
-        s += ~"\nPrestate:\n";
+        s += "\nPrestate:\n";
         s += tritv_to_str(fcx, pres);
         fcx.ccx.tcx.sess.span_fatal(e.span, s);
     }
@@ -114,15 +112,15 @@ fn check_states_stmt(s: &@stmt, fcx: &fn_ctxt, v: &visit::vt<fn_ctxt>) {
     */
 
     if !implies(pres, prec) {
-        let ss = ~"";
+        let ss = "";
         let diff = first_difference_string(fcx, prec, pres);
         ss +=
-            ~"Unsatisfied precondition constraint (for example, " + diff +
-                ~") for statement:\n";
+            "Unsatisfied precondition constraint (for example, " + diff +
+                ") for statement:\n";
         ss += syntax::print::pprust::stmt_to_str(*s);
-        ss += ~"\nPrecondition:\n";
+        ss += "\nPrecondition:\n";
         ss += tritv_to_str(fcx, prec);
-        ss += ~"\nPrestate: \n";
+        ss += "\nPrestate: \n";
         ss += tritv_to_str(fcx, pres);
         fcx.ccx.tcx.sess.span_fatal(s.span, ss);
     }
@@ -150,14 +148,12 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn,
            !type_is_nil(fcx.ccx.tcx, ret_ty_of_fn(fcx.ccx.tcx, id)) &&
            f.decl.cf == return {
         fcx.ccx.tcx.sess.span_err(f.body.span,
-                                  ~"In function " +
-                                  fcx.name +
-                                      ~", not all control paths \
+                                  "In function " + fcx.name +
+                                      ", not all control paths \
                                         return a value");
-        fcx.ccx.tcx.sess.span_fatal(
-            f.decl.output.span,
-            ~"see declared return type of '" +
-            ty_to_str(f.decl.output) + ~"'");
+        fcx.ccx.tcx.sess.span_fatal(f.decl.output.span,
+                                    "see declared return type of '" +
+                                        ty_to_str(f.decl.output) + "'");
     } else if f.decl.cf == noreturn {
 
         // check that this really always fails
@@ -166,9 +162,9 @@ fn check_states_against_conditions(fcx: &fn_ctxt, f: &_fn,
 
         if !promises(fcx, post, fcx.enclosing.i_diverge) {
             fcx.ccx.tcx.sess.span_fatal(f.body.span,
-                                        ~"In non-returning function " +
+                                        "In non-returning function " +
                                             fcx.name +
-                                            ~", some control paths may \
+                                            ", some control paths may \
                                            return to the caller");
         }
     }
@@ -197,11 +193,8 @@ fn fn_states(f: &_fn, tps: &[ast::ty_param], sp: &span, i: &fn_ident,
 
     assert (ccx.fm.contains_key(id));
     let f_info = ccx.fm.get(id);
-    let name = option::from_maybe(~"anon", i);
-    let fcx = {enclosing: f_info,
-               id: id,
-               name: name,
-               ccx: ccx};
+    let name = option::from_maybe("anon", i);
+    let fcx = {enclosing: f_info, id: id, name: name, ccx: ccx};
     check_fn_states(fcx, f, tps, id, sp, i);
 }
 
diff --git a/src/comp/middle/tstate/collect_locals.rs b/src/comp/middle/tstate/collect_locals.rs
index 4c6ce536d7d..bac29c049da 100644
--- a/src/comp/middle/tstate/collect_locals.rs
+++ b/src/comp/middle/tstate/collect_locals.rs
@@ -18,7 +18,7 @@ type ctxt = {cs: @mutable [sp_constr], tcx: ty::ctxt};
 fn collect_local(loc: &@local, cx: &ctxt, v: &visit::vt<ctxt>) {
     for each p: @pat in pat_bindings(loc.node.pat) {
         let ident = alt p.node { pat_bind(id) { id } };
-        log ~"collect_local: pushing " + ident;;
+        log "collect_local: pushing " + ident;;
         *cx.cs += [respan(loc.span, ninit(p.id, ident))];
     }
     visit::visit_local(loc, cx, v);
@@ -30,6 +30,7 @@ fn collect_pred(e: &@expr, cx: &ctxt, v: &visit::vt<ctxt>) {
       expr_if_check(ex, _, _) { *cx.cs += [expr_to_constr(cx.tcx, ex)]; }
 
 
+
       // If it's a call, generate appropriate instances of the
       // call's constraints.
       expr_call(operator, operands) {
@@ -61,8 +62,7 @@ fn find_locals(tcx: &ty::ctxt, f: &_fn, tps: &[ty_param], sp: &span,
 
 fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map)
    -> uint {
-    log constraint_to_str(tcx, c) + ~" |-> "
-        + std::uint::str(next);
+    log constraint_to_str(tcx, c) + " |-> " + std::uint::str(next);
     alt c.node {
       ninit(id, i) { tbl.insert(local_def(id), cinit(next, c.span, i)); }
       npred(p, d_id, args) {
@@ -70,8 +70,8 @@ fn add_constraint(tcx: &ty::ctxt, c: sp_constr, next: uint, tbl: constr_map)
           some(ct) {
             alt ct {
               cinit(_, _, _) {
-                tcx.sess.bug(~"add_constraint: same def_id used" +
-                                 ~" as a variable and a pred");
+                tcx.sess.bug("add_constraint: same def_id used" +
+                                 " as a variable and a pred");
               }
               cpred(_, pds) {
                 *pds += [respan(c.span, {args: args, bit_num: next})];
@@ -130,7 +130,7 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span,
     // and the name of the function, with a '!' appended to it, for the
     // "diverges" constraint
     let diverges_id = ccx.tcx.sess.next_node_id();
-    let diverges_name = name + ~"!";
+    let diverges_name = name + "!";
     add_constraint(cx.tcx, respan(f_sp, ninit(diverges_id, diverges_name)),
                    next, res_map);
 
@@ -147,9 +147,8 @@ fn mk_fn_info(ccx: &crate_ctxt, f: &_fn, tp: &[ty_param], f_sp: &span,
          i_diverge: ninit(diverges_id, diverges_name),
          used_vars: v};
     ccx.fm.insert(id, rslt);
-    log name + ~" has "
-                      + std::uint::str(num_constraints(rslt))
-                      + ~" constraints";
+    log name + " has " + std::uint::str(num_constraints(rslt)) +
+            " constraints";
 }
 
 
diff --git a/src/comp/middle/tstate/pre_post_conditions.rs b/src/comp/middle/tstate/pre_post_conditions.rs
index a7f38516125..ac96fb3cde9 100644
--- a/src/comp/middle/tstate/pre_post_conditions.rs
+++ b/src/comp/middle/tstate/pre_post_conditions.rs
@@ -69,11 +69,11 @@ fn find_pre_post_item(ccx: &crate_ctxt, i: &item) {
                  {constrs: @new_def_hash::<constraint>(),
                   num_constraints: 0u,
                   cf: return,
-                  i_return: ninit(0, ~""),
-                  i_diverge: ninit(0, ~""),
+                  i_return: ninit(0, ""),
+                  i_diverge: ninit(0, ""),
                   used_vars: v},
              id: 0,
-             name: ~"",
+             name: "",
              ccx: ccx};
         find_pre_post_expr(fake_fcx, e);
       }
@@ -373,7 +373,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         let rslt = expr_pp(fcx.ccx, e);
         clear_pp(rslt);
         for def in *freevars::get_freevars(fcx.ccx.tcx, e.id) {
-            handle_var_def(fcx, rslt, def, ~"upvar");
+            handle_var_def(fcx, rslt, def, "upvar");
         }
       }
       expr_block(b) {
@@ -481,7 +481,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
         let rslt = expr_pp(fcx.ccx, e);
         clear_pp(rslt);
         for def in *freevars::get_freevars(fcx.ccx.tcx, body.node.id) {
-            handle_var_def(fcx, rslt, def, ~"upvar");
+            handle_var_def(fcx, rslt, def, "upvar");
         }
       }
       expr_index(val, sub) { find_pre_post_exprs(fcx, [val, sub], e.id); }
@@ -545,6 +545,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
 
 
 
+
       expr_bind(operator, maybe_args) {
         let args = [];
         let cmodes = callee_modes(fcx, operator.id);
@@ -563,7 +564,7 @@ fn find_pre_post_expr(fcx: &fn_ctxt, e: @expr) {
       }
       expr_break. { clear_pp(expr_pp(fcx.ccx, e)); }
       expr_cont. { clear_pp(expr_pp(fcx.ccx, e)); }
-      expr_mac(_) { fcx.ccx.tcx.sess.bug(~"unexpanded macro"); }
+      expr_mac(_) { fcx.ccx.tcx.sess.bug("unexpanded macro"); }
       expr_anon_obj(anon_obj) {
         alt anon_obj.inner_obj {
           some(ex) {
@@ -614,7 +615,7 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) {
                               pat_bind(n) { n }
                               _ {
                                 fcx.ccx.tcx.sess.span_bug(pat.span,
-                                                          ~"Impossible LHS");
+                                                          "Impossible LHS");
                               }
                             };
                         alt p {
@@ -651,7 +652,7 @@ fn find_pre_post_stmt(fcx: &fn_ctxt, s: &stmt) {
                           }
                           _ {
                             fcx.ccx.tcx.sess.span_bug(pat.span,
-                                                      ~"Impossible LHS");
+                                                      "Impossible LHS");
                           }
                         }
                     }
diff --git a/src/comp/middle/tstate/states.rs b/src/comp/middle/tstate/states.rs
index a2d33039158..af14db2e9c8 100644
--- a/src/comp/middle/tstate/states.rs
+++ b/src/comp/middle/tstate/states.rs
@@ -358,7 +358,7 @@ fn find_pre_post_state_expr(fcx: &fn_ctxt, pres: &prestate, e: @expr) ->
       expr_log(_, ex) {
         ret find_pre_post_state_sub(fcx, pres, ex, e.id, none);
       }
-      expr_mac(_) { fcx.ccx.tcx.sess.bug(~"unexpanded macro"); }
+      expr_mac(_) { fcx.ccx.tcx.sess.bug("unexpanded macro"); }
       expr_put(maybe_e) {
         alt maybe_e {
           some(arg) {
@@ -751,6 +751,7 @@ fn find_pre_post_state_fn(fcx: &fn_ctxt, f: &_fn) -> bool {
     // Treat the tail expression as a return statement
     alt f.body.node.expr {
       some(tailexpr) {
+
         // We don't want to clear the diverges bit for bottom typed things,
         // which really do diverge. I feel like there is a cleaner way
         // to do this than checking the type.
diff --git a/src/comp/middle/tstate/tritv.rs b/src/comp/middle/tstate/tritv.rs
index 78245adc22c..60a724de524 100644
--- a/src/comp/middle/tstate/tritv.rs
+++ b/src/comp/middle/tstate/tritv.rs
@@ -55,6 +55,7 @@ fn trit_minus(a: trit, b: trit) -> trit {
           ttrue. { dont_care }
           tfalse. { ttrue }
 
+
           /* internally contradictory, but
              I guess it'll get flagged? */
           dont_care. {
@@ -66,6 +67,7 @@ fn trit_minus(a: trit, b: trit) -> trit {
         alt b {
           ttrue. { tfalse }
 
+
           /* see above comment */
           _ {
             tfalse
@@ -83,6 +85,7 @@ fn trit_or(a: trit, b: trit) -> trit {
         alt b {
           ttrue. { dont_care }
 
+
           /* FIXME: ?????? */
           _ {
             tfalse
@@ -101,17 +104,20 @@ fn trit_and(a: trit, b: trit) -> trit {
     alt a {
       dont_care. { b }
 
+
       // also seems wrong for case b = ttrue
       ttrue. {
         alt b {
           dont_care. { ttrue }
 
+
           // ??? Seems wrong
           ttrue. {
             ttrue
           }
 
 
+
           // false wins, since if something is uninit
           // on one path, we care
           // (Rationale: it's always safe to assume that
@@ -124,6 +130,7 @@ fn trit_and(a: trit, b: trit) -> trit {
       }
 
 
+
       // Rationale: if it's uninit on one path,
       // we can consider it as uninit on all paths
       tfalse. {
@@ -261,15 +268,15 @@ fn to_vec(v: &t) -> [uint] {
     ret rslt;
 }
 
-fn to_str(v: &t) -> istr {
+fn to_str(v: &t) -> str {
     let i: uint = 0u;
-    let rs: istr = ~"";
+    let rs: str = "";
     while i < v.nbits {
         rs +=
             alt tritv_get(v, i) {
-              dont_care. { ~"?" }
-              ttrue. { ~"1" }
-              tfalse. { ~"0" }
+              dont_care. { "?" }
+              ttrue. { "1" }
+              tfalse. { "0" }
             };
         i += 1u;
     }
diff --git a/src/comp/middle/ty.rs b/src/comp/middle/ty.rs
index 5b3197b1bd8..bd5eef137e9 100644
--- a/src/comp/middle/ty.rs
+++ b/src/comp/middle/ty.rs
@@ -211,7 +211,7 @@ type ctxt =
       freevars: freevars::freevar_map,
       tcache: type_cache,
       rcache: creader_cache,
-      short_names_cache: hashmap<t, @istr>,
+      short_names_cache: hashmap<t, @str>,
       has_pointer_cache: hashmap<t, bool>,
       kind_cache: hashmap<t, ast::kind>,
       ast_ty_to_ty_cache: hashmap<@ast::ty, option::t<t>>};
@@ -230,7 +230,7 @@ fn method_ty_to_fn_ty(cx: &ctxt, m: method) -> t {
 // Never construct these manually. These are interned.
 type raw_t =
     {struct: sty,
-     cname: option::t<istr>,
+     cname: option::t<str>,
      hash: uint,
      has_params: bool,
      has_vars: bool};
@@ -401,16 +401,16 @@ fn mk_ctxt(s: session::session, dm: resolve::def_map,
           short_names_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty),
           has_pointer_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty),
           kind_cache: map::mk_hashmap(ty::hash_ty, ty::eq_ty),
-          ast_ty_to_ty_cache: map::mk_hashmap(ast_util::hash_ty,
-                                              ast_util::eq_ty)};
+          ast_ty_to_ty_cache:
+              map::mk_hashmap(ast_util::hash_ty, ast_util::eq_ty)};
     populate_type_store(cx);
     ret cx;
 }
 
 
 // Type constructors
-fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<istr>) -> @raw_t {
-    let cname: option::t<istr> = none;
+fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<str>) -> @raw_t {
+    let cname: option::t<str> = none;
     let h = hash_type_info(st, cname);
     let has_params: bool = false;
     let has_vars: bool = false;
@@ -486,11 +486,11 @@ fn mk_raw_ty(cx: &ctxt, st: &sty, _in_cname: &option::t<istr>) -> @raw_t {
           has_vars: has_vars};
 }
 
-fn intern(cx: &ctxt, st: &sty, cname: &option::t<istr>) {
+fn intern(cx: &ctxt, st: &sty, cname: &option::t<str>) {
     interner::intern(*cx.ts, mk_raw_ty(cx, st, cname));
 }
 
-fn gen_ty_full(cx: &ctxt, st: &sty, cname: &option::t<istr>) -> t {
+fn gen_ty_full(cx: &ctxt, st: &sty, cname: &option::t<str>) -> t {
     let raw_type = mk_raw_ty(cx, st, cname);
     ret interner::intern(*cx.ts, raw_type);
 }
@@ -559,8 +559,8 @@ fn mk_constr(cx: &ctxt, t: t, cs: &[@type_constr]) -> t {
 
 fn mk_tup(cx: &ctxt, ts: &[t]) -> t { ret gen_ty(cx, ty_tup(ts)); }
 
-fn mk_fn(cx: &ctxt, proto: &ast::proto, args: &[arg], ty: t,
-         cf: &controlflow, constrs: &[@constr]) -> t {
+fn mk_fn(cx: &ctxt, proto: &ast::proto, args: &[arg], ty: t, cf: &controlflow,
+         constrs: &[@constr]) -> t {
     ret gen_ty(cx, ty_fn(proto, args, ty, cf, constrs));
 }
 
@@ -590,13 +590,11 @@ fn mk_iter_body_fn(cx: &ctxt, output: t) -> t {
 }
 
 // Returns the one-level-deep type structure of the given type.
-fn struct(cx: &ctxt, typ: t) -> sty {
-    ret interner::get(*cx.ts, typ).struct;
-}
+fn struct(cx: &ctxt, typ: t) -> sty { ret interner::get(*cx.ts, typ).struct; }
 
 
 // Returns the canonical name of the given type.
-fn cname(cx: &ctxt, typ: t) -> option::t<istr> {
+fn cname(cx: &ctxt, typ: t) -> option::t<str> {
     ret interner::get(*cx.ts, typ).cname;
 }
 
@@ -771,7 +769,7 @@ fn fold_ty(cx: &ctxt, fld: fold_mode, ty_0: t) -> t {
 
 // Type utilities
 
-fn rename(cx: &ctxt, typ: t, new_cname: &istr) -> t {
+fn rename(cx: &ctxt, typ: t, new_cname: &str) -> t {
     ret gen_ty_full(cx, struct(cx, typ), some(new_cname));
 }
 
@@ -826,18 +824,14 @@ fn type_is_sequence(cx: &ctxt, ty: t) -> bool {
 }
 
 fn type_is_str(cx: &ctxt, ty: t) -> bool {
-    alt struct(cx, ty) {
-      ty_istr. { ret true; }
-      _ { ret false; }
-    }
+    alt struct(cx, ty) { ty_istr. { ret true; } _ { ret false; } }
 }
 
 fn sequence_element_type(cx: &ctxt, ty: t) -> t {
     alt struct(cx, ty) {
       ty_istr. { ret mk_mach(cx, ast::ty_u8); }
       ty_vec(mt) { ret mt.ty; }
-      _ { cx.sess.bug(
-          ~"sequence_element_type called on non-sequence value"); }
+      _ { cx.sess.bug("sequence_element_type called on non-sequence value"); }
     }
 }
 
@@ -856,9 +850,8 @@ fn get_element_type(cx: &ctxt, ty: t, i: uint) -> t {
       ty_rec(flds) { ret flds[i].mt.ty; }
       ty_tup(ts) { ret ts[i]; }
       _ {
-        cx.sess.bug(~"get_element_type called on type " +
-                    ty_to_str(cx, ty) +
-                        ~" - expected a \
+        cx.sess.bug("get_element_type called on type " + ty_to_str(cx, ty) +
+                        " - expected a \
             tuple or record");
       }
     }
@@ -871,18 +864,15 @@ fn type_is_box(cx: &ctxt, ty: t) -> bool {
 }
 
 fn type_is_boxed(cx: &ctxt, ty: t) -> bool {
-    alt struct(cx, ty) {
-      ty_box(_) { ret true; }
-      _ { ret false; }
-    }
+    alt struct(cx, ty) { ty_box(_) { ret true; } _ { ret false; } }
 }
 
 fn type_is_vec(cx: &ctxt, ty: t) -> bool {
     ret alt struct(cx, ty) {
-      ty_vec(_) { true }
-      ty_istr. { true }
-      _ { false }
-    };
+          ty_vec(_) { true }
+          ty_istr. { true }
+          _ { false }
+        };
 }
 
 fn type_is_unique(cx: &ctxt, ty: t) -> bool {
@@ -890,7 +880,8 @@ fn type_is_unique(cx: &ctxt, ty: t) -> bool {
       ty_uniq(_) { ret true; }
       ty_vec(_) { true }
       ty_istr. { true }
-      _ { ret false; } }
+      _ { ret false; }
+    }
 }
 
 fn type_is_scalar(cx: &ctxt, ty: t) -> bool {
@@ -917,8 +908,12 @@ fn type_has_pointers(cx: &ctxt, ty: t) -> bool {
 
     let result = false;
     alt struct(cx, ty) {
+
       // scalar types
-      ty_nil. {/* no-op */ }
+      ty_nil. {
+        /* no-op */
+
+      }
       ty_bot. {/* no-op */ }
       ty_bool. {/* no-op */ }
       ty_int. {/* no-op */ }
@@ -980,6 +975,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
     alt struct(cx, ty) {
 
 
+
       // Scalar types are unique-kind, no substructure.
       ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_uint. | ty_float. |
       ty_machine(_) | ty_char. | ty_native(_) {
@@ -987,12 +983,14 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // A handful of other built-in are unique too.
       ty_type. | ty_istr. | ty_native_fn(_, _, _) {
         // no-op
       }
 
 
+
       // FIXME: obj is broken for now, since we aren't asserting
       // anything about its fields.
       ty_obj(_) {
@@ -1000,6 +998,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // FIXME: the environment capture mode is not fully encoded
       // here yet, leading to weirdness around closure.
       ty_fn(proto, _, _, _, _) {
@@ -1012,6 +1011,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // Those with refcounts-to-inner raise pinned to shared,
       // lower unique to shared. Therefore just set result to shared.
       ty_box(mt) {
@@ -1019,6 +1019,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // Pointers and unique boxes / vecs raise pinned to shared,
       // otherwise pass through their pointee kind.
       ty_ptr(tm) | ty_vec(tm) {
@@ -1028,6 +1029,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // Records lower to the lowest of their members.
       ty_rec(flds) {
         for f: field in flds {
@@ -1036,6 +1038,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
         }
       }
 
+
       // Tuples lower to the lowest of their members.
       ty_tup(tys) {
         for ty: t in tys {
@@ -1045,6 +1048,7 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // Tags lower to the lowest of their variants.
       ty_tag(did, tps) {
         let variants = tag_variants(cx, did);
@@ -1060,29 +1064,34 @@ fn type_kind(cx: &ctxt, ty: t) -> ast::kind {
       }
 
 
+
       // Resources are always pinned.
       ty_res(did, inner, tps) {
         result = ast::kind_pinned;
       }
 
 
+
       ty_var(_) {
         fail;
       }
 
 
+
       ty_param(_, k) {
         result = kind::lower_kind(result, k);
       }
 
 
+
       ty_constr(t, _) {
         result = type_kind(cx, t);
       }
 
 
+
       _ {
-        cx.sess.bug(~"missed case: " + ty_to_str(cx, ty));
+        cx.sess.bug("missed case: " + ty_to_str(cx, ty));
       }
     }
 
@@ -1098,8 +1107,8 @@ fn type_is_native(cx: &ctxt, ty: t) -> bool {
     alt struct(cx, ty) { ty_native(_) { ret true; } _ { ret false; } }
 }
 
-fn type_structurally_contains(cx: &ctxt, ty: t,
-                              test: fn(&sty) -> bool) -> bool {
+fn type_structurally_contains(cx: &ctxt, ty: t, test: fn(&sty) -> bool) ->
+   bool {
     let sty = struct(cx, ty);
     if test(sty) { ret true; }
     alt sty {
@@ -1209,6 +1218,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool {
     let result = true;
     alt struct(cx, ty) {
 
+
       // Scalar types
       ty_nil. | ty_bot. | ty_bool. | ty_int. | ty_float. | ty_uint. |
       ty_machine(_) | ty_char. | ty_type. | ty_native(_) | ty_ptr(_) {
@@ -1216,6 +1226,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool {
       }
 
 
+
       // Boxed types
       ty_istr. | ty_box(_) | ty_vec(_) | ty_fn(_, _, _, _, _) |
       ty_native_fn(_, _, _) | ty_obj(_) {
@@ -1223,6 +1234,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool {
       }
 
 
+
       // Structural types
       ty_tag(did, tps) {
         let variants = tag_variants(cx, did);
@@ -1248,6 +1260,7 @@ fn type_is_pod(cx: &ctxt, ty: t) -> bool {
       ty_constr(subt, _) { result = type_is_pod(cx, subt); }
 
 
+
       ty_var(_) {
         fail "ty_var in type_is_pod";
       }
@@ -1389,6 +1402,7 @@ fn hash_type_structure(st: &sty) -> uint {
       }
 
 
+
       // ???
       ty_fn(_, args, rty, _, _) {
         ret hash_fn(27u, args, rty);
@@ -1419,7 +1433,7 @@ fn hash_type_structure(st: &sty) -> uint {
     }
 }
 
-fn hash_type_info(st: &sty, cname_opt: &option::t<istr>) -> uint {
+fn hash_type_info(st: &sty, cname_opt: &option::t<str>) -> uint {
     let h = hash_type_structure(st);
     alt cname_opt {
       none. {/* no-op */ }
@@ -1511,10 +1525,9 @@ fn node_id_to_ty_param_substs_opt_and_ty(cx: &ctxt, id: &ast::node_id) ->
     // Pull out the node type table.
     alt smallintmap::find(*cx.node_types, id as uint) {
       none. {
-        cx.sess.bug(~"node_id_to_ty_param_substs_opt_and_ty() called on " +
-                    ~"an untyped node (" +
-                    std::int::to_str(id, 10u) +
-                    ~")");
+        cx.sess.bug("node_id_to_ty_param_substs_opt_and_ty() called on " +
+                        "an untyped node (" + std::int::to_str(id, 10u) +
+                        ")");
       }
       some(tpot) { ret tpot; }
     }
@@ -1589,21 +1602,21 @@ fn ty_fn_args(cx: &ctxt, fty: t) -> [arg] {
     alt struct(cx, fty) {
       ty::ty_fn(_, a, _, _, _) { ret a; }
       ty::ty_native_fn(_, a, _) { ret a; }
-      _ { cx.sess.bug(~"ty_fn_args() called on non-fn type"); }
+      _ { cx.sess.bug("ty_fn_args() called on non-fn type"); }
     }
 }
 
 fn ty_fn_proto(cx: &ctxt, fty: t) -> ast::proto {
     alt struct(cx, fty) {
       ty::ty_fn(p, _, _, _, _) { ret p; }
-      _ { cx.sess.bug(~"ty_fn_proto() called on non-fn type"); }
+      _ { cx.sess.bug("ty_fn_proto() called on non-fn type"); }
     }
 }
 
 fn ty_fn_abi(cx: &ctxt, fty: t) -> ast::native_abi {
     alt struct(cx, fty) {
       ty::ty_native_fn(a, _, _) { ret a; }
-      _ { cx.sess.bug(~"ty_fn_abi() called on non-native-fn type"); }
+      _ { cx.sess.bug("ty_fn_abi() called on non-native-fn type"); }
     }
 }
 
@@ -1611,7 +1624,7 @@ fn ty_fn_ret(cx: &ctxt, fty: t) -> t {
     alt struct(cx, fty) {
       ty::ty_fn(_, _, r, _, _) { ret r; }
       ty::ty_native_fn(_, _, r) { ret r; }
-      _ { cx.sess.bug(~"ty_fn_ret() called on non-fn type"); }
+      _ { cx.sess.bug("ty_fn_ret() called on non-fn type"); }
     }
 }
 
@@ -1625,7 +1638,7 @@ fn is_fn_ty(cx: &ctxt, fty: t) -> bool {
 
 // Just checks whether it's a fn that returns bool,
 // not its purity.
-fn is_pred_ty(cx: &ctxt, fty:t) -> bool {
+fn is_pred_ty(cx: &ctxt, fty: t) -> bool {
     is_fn_ty(cx, fty) && type_is_bool(cx, ty_fn_ret(cx, fty))
 }
 
@@ -1685,15 +1698,14 @@ fn field_idx(sess: &session::session, sp: &span, id: &ast::ident,
              fields: &[field]) -> uint {
     let i: uint = 0u;
     for f: field in fields { if str::eq(f.ident, id) { ret i; } i += 1u; }
-    sess.span_fatal(sp, ~"unknown field '" +
-                    id + ~"' of record");
+    sess.span_fatal(sp, "unknown field '" + id + "' of record");
 }
 
 fn method_idx(sess: &session::session, sp: &span, id: &ast::ident,
               meths: &[method]) -> uint {
     let i: uint = 0u;
     for m: method in meths { if str::eq(m.ident, id) { ret i; } i += 1u; }
-    sess.span_fatal(sp, ~"unknown method '" + id + ~"' of obj");
+    sess.span_fatal(sp, "unknown method '" + id + "' of obj");
 }
 
 fn sort_methods(meths: &[method]) -> [method] {
@@ -1729,12 +1741,11 @@ fn occurs_check_fails(tcx: &ctxt, sp: &option::t<span>, vid: int, rt: t) ->
             // variables, so in this case we have to be sure to die.
             tcx.sess.span_fatal(
                 s,
-                ~"Type inference failed because I \
+                "Type inference failed because I \
                  could not find a type\n that's both of the form "
                 + ty_to_str(tcx, ty::mk_var(tcx, vid)) +
-                ~" and of the form " +
-                ty_to_str(tcx, rt) +
-                ~". Such a type would have to be infinitely \
+                " and of the form " + ty_to_str(tcx, rt) +
+                ". Such a type would have to be infinitely \
                  large.");
           }
           _ { ret true; }
@@ -1927,9 +1938,9 @@ mod unify {
 
             let result_mode;
             if expected_input.mode != actual_input.mode {
-                ret fn_common_res_err(
-                    ures_err(terr_mode_mismatch(expected_input.mode,
-                                                actual_input.mode)));
+                ret fn_common_res_err(ures_err(
+                    terr_mode_mismatch(expected_input.mode,
+                                       actual_input.mode)));
             } else { result_mode = expected_input.mode; }
             let result = unify_step(cx, expected_input.ty, actual_input.ty);
             alt result {
@@ -1956,6 +1967,7 @@ mod unify {
         alt expected_cf {
           ast::return. { }
 
+
           // ok
           ast::noreturn. {
             alt actual_cf {
@@ -2069,6 +2081,7 @@ mod unify {
         alt struct(cx.tcx, actual) {
 
 
+
           // If the RHS is a variable type, then just do the
           // appropriate binding.
           ty::ty_var(actual_id) {
@@ -2117,6 +2130,7 @@ mod unify {
           ty::ty_nil. { ret struct_cmp(cx, expected, actual); }
 
 
+
           // _|_ unifies with anything
           ty::ty_bot. {
             ret ures_ok(actual);
@@ -2410,7 +2424,7 @@ mod unify {
     fn dump_var_bindings(tcx: ty_ctxt, vb: @var_bindings) {
         let i = 0u;
         while i < vec::len::<ufind::node>(vb.sets.nodes) {
-            let sets = ~"";
+            let sets = "";
             let j = 0u;
             while j < vec::len::<option::t<uint>>(vb.sets.nodes) {
                 if ufind::find(vb.sets, j) == i { sets += #fmt[" %u", j]; }
@@ -2418,10 +2432,8 @@ mod unify {
             }
             let typespec;
             alt smallintmap::find::<t>(vb.types, i) {
-              none. { typespec = ~""; }
-              some(typ) {
-                typespec = ~" =" + ty_to_str(tcx, typ);
-              }
+              none. { typespec = ""; }
+              some(typ) { typespec = " =" + ty_to_str(tcx, typ); }
             }
             log_err #fmt["set %u:%s%s", i, typespec, sets];
             i += 1u;
@@ -2478,54 +2490,49 @@ mod unify {
     }
 }
 
-fn type_err_to_str(err: &ty::type_err) -> istr {
+fn type_err_to_str(err: &ty::type_err) -> str {
     alt err {
-      terr_mismatch. { ret ~"types differ"; }
+      terr_mismatch. { ret "types differ"; }
       terr_controlflow_mismatch. {
-        ret ~"returning function used where non-returning function" +
-                ~" was expected";
+        ret "returning function used where non-returning function" +
+                " was expected";
       }
-      terr_box_mutability. { ret ~"boxed values differ in mutability"; }
-      terr_vec_mutability. { ret ~"vectors differ in mutability"; }
+      terr_box_mutability. { ret "boxed values differ in mutability"; }
+      terr_vec_mutability. { ret "vectors differ in mutability"; }
       terr_tuple_size(e_sz, a_sz) {
-        ret ~"expected a tuple with " +
-            uint::to_str(e_sz, 10u) +
-            ~" elements but found one with " +
-            uint::to_str(a_sz, 10u) +
-            ~" elements";
+        ret "expected a tuple with " + uint::to_str(e_sz, 10u) +
+                " elements but found one with " + uint::to_str(a_sz, 10u) +
+                " elements";
       }
       terr_record_size(e_sz, a_sz) {
-        ret ~"expected a record with " +
-            uint::to_str(e_sz, 10u) +
-            ~" fields but found one with " +
-            uint::to_str(a_sz, 10u) +
-            ~" fields";
+        ret "expected a record with " + uint::to_str(e_sz, 10u) +
+                " fields but found one with " + uint::to_str(a_sz, 10u) +
+                " fields";
       }
-      terr_record_mutability. { ret ~"record elements differ in mutability"; }
+      terr_record_mutability. { ret "record elements differ in mutability"; }
       terr_record_fields(e_fld, a_fld) {
-        ret ~"expected a record with field '" + e_fld +
-                ~"' but found one with field '" + a_fld + ~"'";
+        ret "expected a record with field '" + e_fld +
+                "' but found one with field '" + a_fld + "'";
       }
-      terr_arg_count. { ret ~"incorrect number of function parameters"; }
-      terr_meth_count. { ret ~"incorrect number of object methods"; }
+      terr_arg_count. { ret "incorrect number of function parameters"; }
+      terr_meth_count. { ret "incorrect number of object methods"; }
       terr_obj_meths(e_meth, a_meth) {
-        ret ~"expected an obj with method '" + e_meth +
-                ~"' but found one with method '" + a_meth + ~"'";
+        ret "expected an obj with method '" + e_meth +
+                "' but found one with method '" + a_meth + "'";
       }
       terr_mode_mismatch(e_mode, a_mode) {
-        ret ~"expected argument mode " + mode_str_1(e_mode) + ~" but found " +
+        ret "expected argument mode " + mode_str_1(e_mode) + " but found " +
                 mode_str_1(a_mode);
       }
       terr_constr_len(e_len, a_len) {
-        ret ~"Expected a type with " +
-            uint::str(e_len) +
-            ~" constraints, but found one with " +
-            uint::str(a_len) + ~" constraints";
+        ret "Expected a type with " + uint::str(e_len) +
+                " constraints, but found one with " + uint::str(a_len) +
+                " constraints";
       }
       terr_constr_mismatch(e_constr, a_constr) {
-        ret ~"Expected a type with constraint " + ty_constr_to_str(e_constr) +
-            ~" but found one with constraint " +
-            ty_constr_to_str(a_constr);
+        ret "Expected a type with constraint " + ty_constr_to_str(e_constr) +
+                " but found one with constraint " +
+                ty_constr_to_str(a_constr);
       }
     }
 }
@@ -2543,8 +2550,7 @@ fn bind_params_in_type(sp: &span, cx: &ctxt, next_ty_var: fn() -> int, typ: t,
         if index < vec::len(*param_var_ids) {
             ret mk_var(cx, param_var_ids[index]);
         } else {
-            cx.sess.span_fatal(
-                sp, ~"Unbound type parameter in callee's type");
+            cx.sess.span_fatal(sp, "Unbound type parameter in callee's type");
         }
     }
     let new_typ =
@@ -2595,7 +2601,7 @@ fn tag_variants(cx: &ctxt, id: &ast::def_id) -> [variant_info] {
     let item =
         alt cx.items.find(id.node) {
           some(i) { i }
-          none. { cx.sess.bug(~"expected to find cached node_item") }
+          none. { cx.sess.bug("expected to find cached node_item") }
         };
     alt item {
       ast_map::node_item(item) {
@@ -2634,7 +2640,7 @@ fn tag_variant_with_id(cx: &ctxt, tag_id: &ast::def_id,
         if def_eq(variant.id, variant_id) { ret variant; }
         i += 1u;
     }
-    cx.sess.bug(~"tag_variant_with_id(): no variant exists with that ID");
+    cx.sess.bug("tag_variant_with_id(): no variant exists with that ID");
 }
 
 
@@ -2662,8 +2668,8 @@ fn ret_ty_of_fn_ty(cx: ctxt, a_ty: t) -> t {
       ty::ty_fn(_, _, ret_ty, _, _) { ret ret_ty; }
       ty::ty_native_fn(_, _, ret_ty) { ret ret_ty; }
       _ {
-        cx.sess.bug(~"ret_ty_of_fn_ty() called on non-function type: " +
-                    ty_to_str(cx, a_ty));
+        cx.sess.bug("ret_ty_of_fn_ty() called on non-function type: " +
+                        ty_to_str(cx, a_ty));
       }
     }
 }
@@ -2750,13 +2756,13 @@ fn is_binopable(cx: &ctxt, ty: t, op: ast::binop) -> bool {
     /*.          add,     shift,   bit
       .             sub,     rel,     logic
       .                mult,    eq,         */
-     /*other*/
-     /*bool*/
-     /*int*/
-     /*float*/
-     /*str*/
-     /*vec*/
-     /*bot*/
+    /*other*/
+    /*bool*/
+    /*int*/
+    /*float*/
+    /*str*/
+    /*vec*/
+    /*bot*/
     let tbl =
         [[f, f, f, f, t, t, f, f], [f, f, f, f, t, t, t, t],
          [t, t, t, t, t, t, t, f], [t, t, t, f, t, t, f, f],
@@ -2776,11 +2782,11 @@ fn ast_constr_to_constr<T>(tcx: ty::ctxt, c: &@ast::constr_general<T>) ->
                                id: pred_id});
       }
       _ {
-        tcx.sess.span_fatal(c.span,
-                            ~"Predicate " +
-                            path_to_str(c.node.path) +
-                            ~" is unbound or bound to a non-function or an \
-                             impure function");
+        tcx.sess.span_fatal(
+            c.span,
+            "Predicate " + path_to_str(c.node.path) +
+            " is unbound or bound to a non-function or an \
+            impure function");
       }
     }
 }
diff --git a/src/comp/middle/typeck.rs b/src/comp/middle/typeck.rs
index daa6e5f368d..04c0160269f 100644
--- a/src/comp/middle/typeck.rs
+++ b/src/comp/middle/typeck.rs
@@ -88,7 +88,7 @@ fn lookup_local(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> int {
       some(x) { x }
       _ {
         fcx.ccx.tcx.sess.span_fatal(sp,
-                                    ~"internal error looking up a local var")
+                                    "internal error looking up a local var")
       }
     }
 }
@@ -98,7 +98,7 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def {
       some(x) { x }
       _ {
         fcx.ccx.tcx.sess.span_fatal(sp,
-                                    ~"internal error looking up a definition")
+                                    "internal error looking up a definition")
       }
     }
 }
@@ -106,7 +106,7 @@ fn lookup_def(fcx: &@fn_ctxt, sp: &span, id: ast::node_id) -> ast::def {
 fn ident_for_local(loc: &@ast::local) -> ast::ident {
     ret alt loc.node.pat.node {
           ast::pat_bind(name) { name }
-          _ { ~"local" }
+          _ { "local" }
         }; // FIXME DESTR
 }
 
@@ -145,14 +145,14 @@ fn ty_param_kinds_and_ty_for_def(fcx: &@fn_ctxt, sp: &span, defn: &ast::def)
         ret {kinds: no_kinds, ty: ty::mk_nil(fcx.ccx.tcx)};
       }
       ast::def_ty(_) {
-        fcx.ccx.tcx.sess.span_fatal(sp, ~"expected value but found type");
+        fcx.ccx.tcx.sess.span_fatal(sp, "expected value but found type");
       }
       ast::def_upvar(_, inner, _) {
         ret ty_param_kinds_and_ty_for_def(fcx, sp, *inner);
       }
       _ {
         // FIXME: handle other names.
-        fcx.ccx.tcx.sess.unimpl(~"definition variant");
+        fcx.ccx.tcx.sess.unimpl("definition variant");
       }
     }
 }
@@ -175,15 +175,15 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path,
         if param_var_len == 0u {
             fcx.ccx.tcx.sess.span_fatal(
                 sp,
-                ~"this item does not take type parameters");
+                "this item does not take type parameters");
         } else if ty_substs_len > param_var_len {
             fcx.ccx.tcx.sess.span_fatal(
                 sp,
-                ~"too many type parameter provided for this item");
+                "too many type parameter provided for this item");
         } else if ty_substs_len < param_var_len {
             fcx.ccx.tcx.sess.span_fatal(
                 sp,
-                ~"not enough type parameters provided for this item");
+                "not enough type parameters provided for this item");
         }
         let ty_substs: [ty::t] = [];
         let i = 0u;
@@ -197,7 +197,7 @@ fn instantiate_path(fcx: &@fn_ctxt, pth: &ast::path,
         ty_substs_opt = some::<[ty::t]>(ty_substs);
         if ty_param_count == 0u {
             fcx.ccx.tcx.sess.span_fatal(sp,
-                                        ~"this item does not take type \
+                                        "this item does not take type \
                                       parameters");
         }
     } else {
@@ -229,7 +229,7 @@ fn structurally_resolved_type(fcx: &@fn_ctxt, sp: &span, tp: ty::t) -> ty::t {
       fix_err(_) {
         fcx.ccx.tcx.sess.span_fatal(
             sp,
-            ~"the type of this value must be known in this context");
+            "the type of this value must be known in this context");
       }
     }
 }
@@ -272,7 +272,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
       some(some(ty)) { ret ty; }
       some(none.) {
         tcx.sess.span_fatal(ast_ty.span,
-                            ~"illegal recursive type \
+                            "illegal recursive type \
                               insert a tag in the cycle, \
                               if this is desired)");
       }
@@ -307,7 +307,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         }
         if vec::len(param_bindings) != vec::len(ty_param_kinds_and_ty.kinds) {
             tcx.sess.span_fatal(sp,
-                                ~"Wrong number of type arguments for a \
+                                "Wrong number of type arguments for a \
                                  polymorphic type");
         }
         let typ =
@@ -316,7 +316,7 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         ret typ;
     }
     let typ;
-    let cname = none::<istr>;
+    let cname = none::<str>;
     alt ast_ty.node {
       ast::ty_nil. { typ = ty::mk_nil(tcx); }
       ast::ty_bot. { typ = ty::mk_bot(tcx); }
@@ -370,11 +370,10 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
           some(ast::def_ty_arg(id, k)) { typ = ty::mk_param(tcx, id, k); }
           some(_) {
             tcx.sess.span_fatal(ast_ty.span,
-                                ~"found type name used as a variable");
+                                "found type name used as a variable");
           }
           _ {
-            tcx.sess.span_fatal(
-                ast_ty.span, ~"internal error in instantiate");
+            tcx.sess.span_fatal(ast_ty.span, "internal error in instantiate");
           }
         }
         cname = some(path_to_str(path));
@@ -411,14 +410,12 @@ fn ast_ty_to_ty(tcx: &ty::ctxt, getter: &ty_getter, ast_ty: &@ast::ty) ->
         typ = ty::mk_constr(tcx, ast_ty_to_ty(tcx, getter, t), out_cs);
       }
       ast::ty_infer. {
-        tcx.sess.span_bug(ast_ty.span, ~"found ty_infer in unexpected place");
+        tcx.sess.span_bug(ast_ty.span, "found ty_infer in unexpected place");
       }
     }
     alt cname {
       none. {/* no-op */ }
-      some(cname_str) {
-        typ = ty::rename(tcx, typ, cname_str);
-      }
+      some(cname_str) { typ = ty::rename(tcx, typ, cname_str); }
     }
     tcx.ast_ty_to_ty_cache.insert(ast_ty, some(typ));
     ret typ;
@@ -590,10 +587,7 @@ mod collect {
           some(ast_map::node_native_item(native_item)) {
             tpt = ty_of_native_item(cx, native_item, ast::native_abi_cdecl);
           }
-          _ {
-            cx.tcx.sess.fatal(
-                ~"internal error " + std::int::str(id.node));
-          }
+          _ { cx.tcx.sess.fatal("internal error " + std::int::str(id.node)); }
         }
         ret tpt;
     }
@@ -871,9 +865,9 @@ mod collect {
         let visit =
             visit::mk_simple_visitor(@{visit_item: bind convert(cx, abi, _),
                                        visit_native_item:
-                                       bind convert_native(cx, abi, _)
-                                           with
-                                           *visit::default_simple_visitor()});
+                                           bind convert_native(cx, abi, _)
+                                          with
+                                          *visit::default_simple_visitor()});
         visit::visit_crate(*crate, (), visit);
     }
 }
@@ -965,14 +959,13 @@ mod demand {
        ty::t {
         full(fcx, sp, expected, actual, [], false).ty
     }
-    fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: ty::t,
-                    actual: ty::t) -> ty::t {
+    fn block_coerce(fcx: &@fn_ctxt, sp: &span, expected: ty::t, actual: ty::t)
+       -> ty::t {
         full(fcx, sp, expected, actual, [], true).ty
     }
 
-    fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: ty::t,
-                   actual: ty::t, ty_param_substs_0: &[ty::t]) ->
-       ty_param_substs_and_ty {
+    fn with_substs(fcx: &@fn_ctxt, sp: &span, expected: ty::t, actual: ty::t,
+                   ty_param_substs_0: &[ty::t]) -> ty_param_substs_and_ty {
         full(fcx, sp, expected, actual, ty_param_substs_0, false)
     }
 
@@ -1013,14 +1006,12 @@ mod demand {
           ures_err(err) {
             let e_err = resolve_type_vars_if_possible(fcx, expected);
             let a_err = resolve_type_vars_if_possible(fcx, actual);
-            fcx.ccx.tcx.sess.span_err(
-                sp,
-                ~"mismatched types: expected " +
-                ty_to_str(fcx.ccx.tcx, e_err) +
-                ~" but found " +
-                ty_to_str(fcx.ccx.tcx, a_err) + ~" ("
-                + ty::type_err_to_str(err)
-                + ~")");
+            fcx.ccx.tcx.sess.span_err(sp,
+                                      "mismatched types: expected " +
+                                          ty_to_str(fcx.ccx.tcx, e_err) +
+                                          " but found " +
+                                          ty_to_str(fcx.ccx.tcx, a_err) + " ("
+                                          + ty::type_err_to_str(err) + ")");
             ret mk_result(fcx, expected, ty_param_subst_var_ids);
           }
         }
@@ -1083,7 +1074,7 @@ mod writeback {
           fix_ok(new_type) { ret some(new_type); }
           fix_err(vid) {
             fcx.ccx.tcx.sess.span_err(sp,
-                                      ~"cannot determine a type \
+                                      "cannot determine a type \
                                            for this expression");
             ret none;
           }
@@ -1135,7 +1126,7 @@ mod writeback {
                 resolve_type_vars_for_node(wbcx, e.span, input.id);
             }
           }
-          _ {}
+          _ { }
         }
         visit::visit_expr(e, wbcx, v);
     }
@@ -1159,7 +1150,7 @@ mod writeback {
           fix_ok(lty) { write::ty_only(wbcx.fcx.ccx.tcx, l.node.id, lty); }
           fix_err(_) {
             wbcx.fcx.ccx.tcx.sess.span_err(l.span,
-                                           ~"cannot determine a type \
+                                           "cannot determine a type \
                                                 for this local variable");
             wbcx.success = false;
           }
@@ -1381,10 +1372,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
                         #fmt["this pattern has %u field%s, but the \
                                        corresponding variant has %u field%s",
                              subpats_len,
-                             if subpats_len == 1u { ~"" } else { ~"s" },
-                             arg_len, if arg_len == 1u { ~"" } else { ~"s" }];
-                    fcx.ccx.tcx.sess.span_fatal(
-                        pat.span, s);
+                             if subpats_len == 1u { "" } else { "s" },
+                             arg_len, if arg_len == 1u { "" } else { "s" }];
+                    fcx.ccx.tcx.sess.span_fatal(pat.span, s);
                 }
 
                 // TODO: vec::iter2
@@ -1401,10 +1391,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
                     #fmt["this pattern has %u field%s, \
                           but the corresponding \
                           variant has no fields",
-                         subpats_len,
-                         if subpats_len == 1u {
-                             ~""
-                         } else { ~"s" }]);
+                                                 subpats_len,
+                                                 if subpats_len == 1u {
+                                                     ""
+                                                 } else { "s" }]);
             }
             write::ty_fixup(fcx, pat.id, path_tpot);
           }
@@ -1414,7 +1404,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
             fcx.ccx.tcx.sess.span_fatal(
                 pat.span,
                 #fmt["mismatched types: expected %s, found tag",
-                     ty_to_str(fcx.ccx.tcx, expected)]);
+                     ty_to_str(fcx.ccx.tcx,
+                               expected)]);
           }
         }
         write::ty_fixup(fcx, pat.id, path_tpot);
@@ -1427,7 +1418,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
             fcx.ccx.tcx.sess.span_fatal(
                 pat.span,
                 #fmt["mismatched types: expected %s, found record",
-                     ty_to_str(fcx.ccx.tcx, expected)]);
+                                             ty_to_str(fcx.ccx.tcx,
+                                                       expected)]);
           }
         }
         let f_count = vec::len(fields);
@@ -1438,9 +1430,9 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
                 #fmt["mismatched types: expected a record \
                       with %u fields, found one with %u \
                       fields",
-                     ex_f_count, f_count]);
+                                             ex_f_count, f_count]);
         }
-        fn matches(name: &istr, f: &ty::field) -> bool {
+        fn matches(name: &str, f: &ty::field) -> bool {
             ret str::eq(name, f.ident);
         }
         for f: ast::field_pat in fields {
@@ -1464,7 +1456,8 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
             fcx.ccx.tcx.sess.span_fatal(
                 pat.span,
                 #fmt["mismatched types: expected %s, found tuple",
-                     ty_to_str(fcx.ccx.tcx, expected)]);
+                                             ty_to_str(fcx.ccx.tcx,
+                                                       expected)]);
           }
         }
         let e_count = vec::len(elts);
@@ -1474,7 +1467,7 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
                 #fmt["mismatched types: expected a tuple \
                       with %u fields, found one with %u \
                       fields",
-                     vec::len(ex_elts), e_count]);
+                                             vec::len(ex_elts), e_count]);
         }
         let i = 0u;
         for elt in elts { check_pat(fcx, map, elt, ex_elts[i]); i += 1u; }
@@ -1487,11 +1480,10 @@ fn check_pat(fcx: &@fn_ctxt, map: &ast_util::pat_id_map, pat: &@ast::pat,
             write::ty_only_fixup(fcx, pat.id, expected);
           }
           _ {
-            fcx.ccx.tcx.sess.span_fatal(
-                pat.span,
-                ~"mismatched types: expected " +
-                ty_to_str(fcx.ccx.tcx, expected) +
-                ~" found box");
+            fcx.ccx.tcx.sess.span_fatal(pat.span,
+                                        "mismatched types: expected " +
+                                            ty_to_str(fcx.ccx.tcx, expected) +
+                                            " found box");
           }
         }
       }
@@ -1503,7 +1495,7 @@ fn require_impure(sess: &session::session, f_purity: &ast::purity,
     alt f_purity {
       ast::impure_fn. { ret; }
       ast::pure_fn. {
-        sess.span_fatal(sp, ~"Found impure expression in pure function decl");
+        sess.span_fatal(sp, "Found impure expression in pure function decl");
       }
     }
 }
@@ -1518,7 +1510,7 @@ fn require_pure_call(ccx: @crate_ctxt, caller_purity: &ast::purity,
           _ {
             ccx.tcx.sess.span_fatal(
                 sp,
-                ~"Pure function calls function not known to be pure");
+                "Pure function calls function not known to be pure");
           }
         }
       }
@@ -1569,14 +1561,14 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             if call_kind != kind_for_each {
                 fcx.ccx.tcx.sess.span_err(
                     sp,
-                    ~"calling iter outside of for each loop");
+                    "calling iter outside of for each loop");
             }
           }
           _ {
             if call_kind == kind_for_each {
                 fcx.ccx.tcx.sess.span_err(
                     sp,
-                    ~"calling non-iter as sequence of for each loop");
+                    "calling non-iter as sequence of for each loop");
             }
           }
         }
@@ -1589,12 +1581,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                 arg_tys
               }
               _ {
-                fcx.ccx.tcx.sess.span_fatal(
-                    f.span,
-                    ~"mismatched types: \
+                fcx.ccx.tcx.sess.span_fatal(f.span,
+                                            "mismatched types: \
                      expected function or native \
                      function but found "
-                    + ty_to_str(fcx.ccx.tcx, fty))
+                                                + ty_to_str(fcx.ccx.tcx, fty))
               }
             };
 
@@ -1602,17 +1593,16 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
         let expected_arg_count = vec::len(arg_tys);
         let supplied_arg_count = vec::len(args);
         if expected_arg_count != supplied_arg_count {
-            fcx.ccx.tcx.sess.span_err(
-                sp,
-                #fmt["this function takes %u \
+            fcx.ccx.tcx.sess.span_err(sp,
+                                      #fmt["this function takes %u \
                       parameter%s but %u parameter%s supplied",
-                      expected_arg_count,
-                      if expected_arg_count == 1u {
-                          ~""
-                      } else { ~"s" }, supplied_arg_count,
-                      if supplied_arg_count == 1u {
-                          ~" was"
-                      } else { ~"s were" }]);
+                                           expected_arg_count,
+                                           if expected_arg_count == 1u {
+                                               ""
+                                           } else { "s" }, supplied_arg_count,
+                                           if supplied_arg_count == 1u {
+                                               " was"
+                                           } else { "s were" }]);
             // HACK: build an arguments list with dummy arguments to
             // check against
             let dummy = {mode: ty::mo_val, ty: ty::mk_bot(fcx.ccx.tcx)};
@@ -1753,9 +1743,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             let binopstr = ast_util::binop_to_str(binop);
             let t_str = ty_to_str(fcx.ccx.tcx, resolved_t);
             let errmsg =
-                ~"binary operation " + binopstr +
-                ~" cannot be applied to type `" +
-                t_str + ~"`";
+                "binary operation " + binopstr +
+                    " cannot be applied to type `" + t_str + "`";
             fcx.ccx.tcx.sess.span_err(span, errmsg);
         }
     }
@@ -1804,31 +1793,29 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                        vec::len(variants[0].args) != 1u {
                     tcx.sess.span_fatal(
                         expr.span,
-                        ~"can only dereference tags " +
-                        ~"with a single variant which has a "
-                        + ~"single argument");
+                        "can only dereference tags " +
+                        "with a single variant which has a "
+                        + "single argument");
                 }
                 oper_t =
                     ty::substitute_type_params(tcx, tps, variants[0].args[0]);
               }
               ty::ty_ptr(inner) { oper_t = inner.ty; }
               _ {
-                tcx.sess.span_fatal(
-                    expr.span,
-                    ~"dereferencing non-" +
-                    ~"dereferenceable type: " +
-                    ty_to_str(tcx, oper_t));
+                tcx.sess.span_fatal(expr.span,
+                                    "dereferencing non-" +
+                                        "dereferenceable type: " +
+                                        ty_to_str(tcx, oper_t));
               }
             }
           }
           ast::not. {
             if !type_is_integral(fcx, oper.span, oper_t) &&
                    structure_of(fcx, oper.span, oper_t) != ty::ty_bool {
-                tcx.sess.span_err(
-                    expr.span,
-                    #fmt["mismatched types: expected bool \
+                tcx.sess.span_err(expr.span,
+                                  #fmt["mismatched types: expected bool \
                           or integer but found %s",
-                         ty_to_str(tcx, oper_t)]);
+                                       ty_to_str(tcx, oper_t)]);
             }
           }
           ast::neg. {
@@ -1836,9 +1823,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             if !(ty::type_is_integral(tcx, oper_t) ||
                      ty::type_is_fp(tcx, oper_t)) {
                 tcx.sess.span_err(expr.span,
-                                  ~"applying unary minus to \
+                                  "applying unary minus to \
                    non-numeric type "
-                                  + ty_to_str(tcx, oper_t));
+                                      + ty_to_str(tcx, oper_t));
             }
           }
         }
@@ -1855,20 +1842,18 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             // supplied some, that's an error.
             if vec::len::<@ast::ty>(pth.node.types) > 0u {
                 tcx.sess.span_fatal(expr.span,
-                                    ~"this kind of value does not \
+                                    "this kind of value does not \
                                      take type parameters");
             }
             write::ty_only_fixup(fcx, id, tpt.ty);
         }
       }
-      ast::expr_mac(_) { tcx.sess.bug(~"unexpanded macro"); }
+      ast::expr_mac(_) { tcx.sess.bug("unexpanded macro"); }
       ast::expr_fail(expr_opt) {
         bot = true;
         alt expr_opt {
           none. {/* do nothing */ }
-          some(e) {
-            check_expr_with(fcx, e, ty::mk_istr(tcx));
-          }
+          some(e) { check_expr_with(fcx, e, ty::mk_istr(tcx)); }
         }
         write::bot_ty(tcx, id);
       }
@@ -1881,7 +1866,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             let nil = ty::mk_nil(tcx);
             if !are_compatible(fcx, fcx.ret_ty, nil) {
                 tcx.sess.span_err(expr.span,
-                                  ~"ret; in function returning non-nil");
+                                  "ret; in function returning non-nil");
             }
           }
           some(e) { check_expr_with(fcx, e, fcx.ret_ty); }
@@ -1891,14 +1876,14 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
       ast::expr_put(expr_opt) {
         require_impure(tcx.sess, fcx.purity, expr.span);
         if fcx.proto != ast::proto_iter {
-            tcx.sess.span_err(expr.span, ~"put in non-iterator");
+            tcx.sess.span_err(expr.span, "put in non-iterator");
         }
         alt expr_opt {
           none. {
             let nil = ty::mk_nil(tcx);
             if !are_compatible(fcx, fcx.ret_ty, nil) {
                 tcx.sess.span_err(expr.span,
-                                  ~"put; in iterator yielding non-nil");
+                                  "put; in iterator yielding non-nil");
             }
           }
           some(e) { bot = check_expr_with(fcx, e, fcx.ret_ty); }
@@ -1971,8 +1956,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
           _ {
             tcx.sess.span_fatal(
                 expr.span,
-                ~"mismatched types: expected vector or string but "
-                + ~"found " + ty_to_str(tcx, ety));
+                "mismatched types: expected vector or string but "
+                + "found " + ty_to_str(tcx, ety));
           }
         }
         bot |= check_for_or_for_each(fcx, decl, elt_ty, body, id);
@@ -1986,7 +1971,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
           }
           _ {
             tcx.sess.span_fatal(expr.span,
-                                ~"sequence in for each loop not a call");
+                                "sequence in for each loop not a call");
           }
         }
         bot |= check_for_or_for_each(fcx, decl, expr_ty(tcx, seq), body, id);
@@ -2017,10 +2002,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
         let arm_non_bot = false;
         for arm: ast::arm in arms {
             alt arm.guard {
-              some(e) {
-                check_expr_with(fcx, e, ty::mk_bool(tcx));
-              }
-              none. {}
+              some(e) { check_expr_with(fcx, e, ty::mk_bool(tcx)); }
+              none. { }
             }
             if !check_block(fcx, arm.body) { arm_non_bot = true; }
             let bty = block_ty(tcx, arm.body);
@@ -2054,10 +2037,11 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
       }
       ast::expr_block(b) {
         // If this is an unchecked block, turn off purity-checking
-        let fcx_for_block = alt b.node.rules {
-          ast::unchecked. { @{ purity: ast::impure_fn with *fcx } }
-          _               { fcx }
-        };
+        let fcx_for_block =
+            alt b.node.rules {
+              ast::unchecked. { @{purity: ast::impure_fn with *fcx} }
+              _ { fcx }
+            };
         bot = check_block(fcx_for_block, b);
         let typ =
             alt b.node.expr {
@@ -2124,9 +2108,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                     this_obj_sty = some(structure_of(fcx, expr.span, tpt.ty));
                   }
                   none. {
-                    tcx.sess.bug(~"didn't find " +
-                                 int::str(did.node) +
-                                 ~" in type cache");
+                    tcx.sess.bug("didn't find " + int::str(did.node) +
+                                     " in type cache");
                   }
                 }
               }
@@ -2135,7 +2118,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
           }
           none. {
             // Shouldn't happen.
-            tcx.sess.span_err(expr.span, ~"self-call in non-object context");
+            tcx.sess.span_err(expr.span, "self-call in non-object context");
           }
         }
 
@@ -2166,10 +2149,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
         if !(type_is_scalar(fcx, expr.span, expr_ty(tcx, e)) &&
                  type_is_scalar(fcx, expr.span, t_1)) {
             tcx.sess.span_err(expr.span,
-                              ~"non-scalar cast: " +
-                              ty_to_str(tcx, expr_ty(tcx, e))
-                              + ~" as " +
-                              ty_to_str(tcx, t_1));
+                              "non-scalar cast: " +
+                                  ty_to_str(tcx, expr_ty(tcx, e)) + " as " +
+                                  ty_to_str(tcx, t_1));
         }
         write::ty_only_fixup(fcx, id, t_1);
       }
@@ -2217,7 +2199,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
               ty::ty_rec(flds) { base_fields = flds; }
               _ {
                 tcx.sess.span_fatal(expr.span,
-                                    ~"record update has non-record base");
+                                    "record update has non-record base");
               }
             }
             write::ty_only_fixup(fcx, id, bexpr_t);
@@ -2231,8 +2213,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                 }
                 if !found {
                     tcx.sess.span_fatal(f.span,
-                                        ~"unknown field in record update: " +
-                                        f.node.ident);
+                                        "unknown field in record update: " +
+                                            f.node.ident);
                 }
             }
           }
@@ -2246,7 +2228,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
           ty::ty_rec(fields) {
             let ix: uint = ty::field_idx(tcx.sess, expr.span, field, fields);
             if ix >= vec::len::<ty::field>(fields) {
-                tcx.sess.span_fatal(expr.span, ~"bad index on record");
+                tcx.sess.span_fatal(expr.span, "bad index on record");
             }
             write::ty_only_fixup(fcx, id, fields[ix].mt.ty);
           }
@@ -2254,7 +2236,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
             let ix: uint =
                 ty::method_idx(tcx.sess, expr.span, field, methods);
             if ix >= vec::len::<ty::method>(methods) {
-                tcx.sess.span_fatal(expr.span, ~"bad index on obj");
+                tcx.sess.span_fatal(expr.span, "bad index on obj");
             }
             let meth = methods[ix];
             let t =
@@ -2279,9 +2261,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
         let idx_t = expr_ty(tcx, idx);
         if !type_is_integral(fcx, idx.span, idx_t) {
             tcx.sess.span_err(idx.span,
-                              ~"mismatched types: expected \
+                              "mismatched types: expected \
                                integer but found "
-                              + ty_to_str(tcx, idx_t));
+                                  + ty_to_str(tcx, idx_t));
         }
         alt structure_of(fcx, expr.span, base_t) {
           ty::ty_vec(mt) { write::ty_only_fixup(fcx, id, mt.ty); }
@@ -2291,8 +2273,8 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
           }
           _ {
             tcx.sess.span_fatal(expr.span,
-                                ~"vector-indexing bad type: " +
-                                ty_to_str(tcx, base_t));
+                                "vector-indexing bad type: " +
+                                    ty_to_str(tcx, base_t));
           }
         }
       }
@@ -2362,9 +2344,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                         // The user is trying to extend a non-object.
                         tcx.sess.span_fatal(
                             e.span,
-                                syntax::print::pprust::expr_to_str(e)
+                            syntax::print::pprust::expr_to_str(e)
                             +
-                            ~" does not have object type");
+                            " does not have object type");
                       }
                     }
                   }
@@ -2391,9 +2373,9 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
                         if new_type != m {
                             ccx.tcx.sess.span_fatal(
                                 om.span,
-                                ~"Attempted to override method "
+                                "Attempted to override method "
                                 + m.ident +
-                                ~" with one of a different type");
+                                " with one of a different type");
                         }
                         ret none;
                     }
@@ -2435,7 +2417,7 @@ fn check_expr_with_unifier(fcx: &@fn_ctxt, expr: &@ast::expr, unify: &unifier,
         check_expr_with(fcx, x, t);
         write::ty_only_fixup(fcx, id, ty::mk_uniq(tcx, t));
       }
-      _ { tcx.sess.unimpl(~"expr type in typeck::check_expr"); }
+      _ { tcx.sess.unimpl("expr type in typeck::check_expr"); }
     }
     if bot { write::ty_only_fixup(fcx, expr.id, ty::mk_bot(tcx)); }
 
@@ -2468,8 +2450,8 @@ fn check_decl_local(fcx: &@fn_ctxt, local: &@ast::local) -> bool {
 
     alt fcx.locals.find(local.node.id) {
       none. {
-        fcx.ccx.tcx.sess.bug(~"check_decl_local: local id not found " +
-                             ident_for_local(local));
+        fcx.ccx.tcx.sess.bug("check_decl_local: local id not found " +
+                                 ident_for_local(local));
       }
       some(i) {
         let t = ty::mk_var(fcx.ccx.tcx, i);
@@ -2518,7 +2500,7 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool {
                  }
                  _ { false }
                } {
-            fcx.ccx.tcx.sess.span_warn(s.span, ~"unreachable statement");
+            fcx.ccx.tcx.sess.span_warn(s.span, "unreachable statement");
             warned = true;
         }
         bot |= check_stmt(fcx, s);
@@ -2527,7 +2509,7 @@ fn check_block(fcx: &@fn_ctxt, blk: &ast::blk) -> bool {
       none. { write::nil_ty(fcx.ccx.tcx, blk.node.id); }
       some(e) {
         if bot && !warned {
-            fcx.ccx.tcx.sess.span_warn(e.span, ~"unreachable expression");
+            fcx.ccx.tcx.sess.span_warn(e.span, "unreachable expression");
         }
         bot |= check_expr(fcx, e);
         let ety = expr_ty(fcx.ccx.tcx, e);
@@ -2569,8 +2551,9 @@ fn check_pred_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool {
     alt e.node {
       ast::expr_call(operator, operands) {
         if !ty::is_pred_ty(fcx.ccx.tcx, expr_ty(fcx.ccx.tcx, operator)) {
-            fcx.ccx.tcx.sess.span_fatal(operator.span,
-                 ~"Operator in constraint has non-boolean return type");
+            fcx.ccx.tcx.sess.span_fatal(
+                operator.span,
+                "Operator in constraint has non-boolean return type");
         }
 
         alt operator.node {
@@ -2581,14 +2564,14 @@ fn check_pred_expr(fcx: &@fn_ctxt, e: &@ast::expr) -> bool {
               }
               _ {
                 fcx.ccx.tcx.sess.span_fatal(operator.span,
-                                            ~"Impure function as operator \
+                                            "Impure function as operator \
 in constraint");
               }
             }
             for operand: @ast::expr in operands {
                 if !ast_util::is_constraint_arg(operand) {
                     let s =
-                        ~"Constraint args must be \
+                        "Constraint args must be \
 slot variables or literals";
                     fcx.ccx.tcx.sess.span_fatal(e.span, s);
                 }
@@ -2596,70 +2579,76 @@ slot variables or literals";
           }
           _ {
             let s =
-                ~"In a constraint, expected the \
+                "In a constraint, expected the \
 constraint name to be an explicit name";
             fcx.ccx.tcx.sess.span_fatal(e.span, s);
           }
         }
       }
-      _ { fcx.ccx.tcx.sess.span_fatal(
-          e.span, ~"check on non-predicate"); }
+      _ { fcx.ccx.tcx.sess.span_fatal(e.span, "check on non-predicate"); }
     }
     ret bot;
 }
 
-fn check_constraints(fcx: &@fn_ctxt, cs: [@ast::constr], args:[ast::arg]) {
+fn check_constraints(fcx: &@fn_ctxt, cs: [@ast::constr], args: [ast::arg]) {
     let c_args;
     let num_args = vec::len(args);
     for c: @ast::constr in cs {
         c_args = [];
         for a: @spanned<ast::fn_constr_arg> in c.node.args {
-            c_args += [@(alt a.node {
-              ast::carg_base. {
-                // "base" should not occur in a fn type thing, as of
-                // yet, b/c we don't allow constraints on the return type
-
-                fcx.ccx.tcx.sess.span_bug(a.span, ~"check_constraints:\
+            c_args +=
+                [
+                 // "base" should not occur in a fn type thing, as of
+                 // yet, b/c we don't allow constraints on the return type
+
+                 // Works b/c no higher-order polymorphism
+                 /*
+                 This is kludgy, and we probably shouldn't be assigning
+                 node IDs here, but we're creating exprs that are
+                 ephemeral, just for the purposes of typechecking. So
+                 that's my justification.
+                 */
+                 @alt a.node {
+                    ast::carg_base. {
+                      fcx.ccx.tcx.sess.span_bug(a.span,
+                                                "check_constraints:\
                     unexpected carg_base");
-              }
-              ast::carg_lit(l) {
-                let tmp_node_id = fcx.ccx.tcx.sess.next_node_id();
-                {id:tmp_node_id, node: ast::expr_lit(l), span:a.span} }
-              ast::carg_ident(i) {
-                if i < num_args {
-                    let p : ast::path_ =
-                        {global:false, idents:[(args[i]).ident],
-                         // Works b/c no higher-order polymorphism
-                         types:[]};
-                    /*
-                    This is kludgy, and we probably shouldn't be assigning
-                    node IDs here, but we're creating exprs that are
-                    ephemeral, just for the purposes of typechecking. So
-                    that's my justification.
-                    */
-                    let arg_occ_node_id = fcx.ccx.tcx.sess.next_node_id();
-                    fcx.ccx.tcx.def_map.insert
-                        (arg_occ_node_id, ast::def_arg(local_def(args[i].id),
-                                                       args[i].mode));
-                    {id:arg_occ_node_id,
-                     node: ast::expr_path(respan(a.span, p)),
-                     span:a.span}
-                }
-                else {
-                    fcx.ccx.tcx.sess.span_bug(a.span, ~"check_constraints:\
+                    }
+                    ast::carg_lit(l) {
+                      let tmp_node_id = fcx.ccx.tcx.sess.next_node_id();
+                      {id: tmp_node_id, node: ast::expr_lit(l), span: a.span}
+                    }
+                    ast::carg_ident(i) {
+                      if i < num_args {
+                          let p: ast::path_ =
+                              {global: false,
+                               idents: [args[i].ident],
+                               types: []};
+                          let arg_occ_node_id =
+                              fcx.ccx.tcx.sess.next_node_id();
+                          fcx.ccx.tcx.def_map.insert(
+                              arg_occ_node_id,
+                              ast::def_arg(local_def(args[i].id),
+                                           args[i].mode));
+                          {id: arg_occ_node_id,
+                           node: ast::expr_path(respan(a.span, p)),
+                           span: a.span}
+                      } else {
+                          fcx.ccx.tcx.sess.span_bug(a.span,
+                                                    "check_constraints:\
                      carg_ident index out of bounds");
-                }
-              }
-            })]
+                      }
+                    }
+                  }]
         }
         let p_op: ast::expr_ = ast::expr_path(c.node.path);
-        let oper: @ast::expr = @{id:c.node.id,
-                                 node: p_op, span:c.span};
+        let oper: @ast::expr = @{id: c.node.id, node: p_op, span: c.span};
         // Another ephemeral expr
         let call_expr_id = fcx.ccx.tcx.sess.next_node_id();
-        let call_expr = @{id: call_expr_id,
-                          node: ast::expr_call(oper, c_args),
-                          span: c.span};
+        let call_expr =
+            @{id: call_expr_id,
+              node: ast::expr_call(oper, c_args),
+              span: c.span};
         check_pred_expr(fcx, call_expr);
     }
 }
@@ -2688,14 +2677,14 @@ fn check_fn(ccx: &@crate_ctxt, f: &ast::_fn, id: &ast::node_id,
     // function result type, if there is a tail expr.
     // We don't do this check for an iterator, as the tail expr doesn't
     // have to have the result type of the iterator.
-    alt (body.node.expr) {
+    alt body.node.expr {
       some(tail_expr) {
         if f.proto != ast::proto_iter {
             let tail_expr_ty = expr_ty(ccx.tcx, tail_expr);
             demand::simple(fcx, tail_expr.span, fcx.ret_ty, tail_expr_ty);
         }
       }
-      none. {}
+      none. { }
     }
 
     let args = ty::ty_fn_args(ccx.tcx, ty::node_id_to_type(ccx.tcx, id));
@@ -2762,15 +2751,15 @@ fn check_main_fn_ty(tcx: &ty::ctxt, main_id: &ast::node_id) {
         if !ok {
             let span = ast_map::node_span(tcx.items.get(main_id));
             tcx.sess.span_err(span,
-                              ~"wrong type in main function: found " +
-                              ty_to_str(tcx, main_t));
+                              "wrong type in main function: found " +
+                                  ty_to_str(tcx, main_t));
         }
       }
       _ {
         let span = ast_map::node_span(tcx.items.get(main_id));
         tcx.sess.span_bug(span,
-                          ~"main has a non-function type: found" +
-                          ty_to_str(tcx, main_t));
+                          "main has a non-function type: found" +
+                              ty_to_str(tcx, main_t));
       }
     }
 }
@@ -2779,7 +2768,7 @@ fn check_for_main_fn(tcx: &ty::ctxt, crate: &@ast::crate) {
     if !tcx.sess.get_opts().library {
         alt tcx.sess.get_main_id() {
           some(id) { check_main_fn_ty(tcx, id); }
-          none. { tcx.sess.span_err(crate.span, ~"main function not found"); }
+          none. { tcx.sess.span_err(crate.span, "main function not found"); }
         }
     }
 }
diff --git a/src/comp/syntax/ast.rs b/src/comp/syntax/ast.rs
index a6d04451ba1..84d9c28cfe1 100644
--- a/src/comp/syntax/ast.rs
+++ b/src/comp/syntax/ast.rs
@@ -6,7 +6,7 @@ import codemap::filename;
 
 type spanned<T> = {node: T, span: span};
 
-type ident = istr;
+type ident = str;
 
 // Functions may or may not have names.
 type fn_ident = option::t<ident>;
@@ -43,7 +43,7 @@ tag def {
     def_use(def_id);
     def_native_ty(def_id);
     def_native_fn(def_id);
-    def_upvar(def_id, @def, bool /* writable */);
+    def_upvar(def_id, @def, /* writable */bool);
 }
 
 // The set of meta_items that define the compilation environment of the crate,
@@ -78,8 +78,8 @@ tag meta_item_ {
 
 type blk = spanned<blk_>;
 
-type blk_ = {stmts: [@stmt], expr: option::t<@expr>,
-    id: node_id, rules: check_mode};
+type blk_ =
+    {stmts: [@stmt], expr: option::t<@expr>, id: node_id, rules: check_mode};
 
 type pat = {id: node_id, node: pat_, span: span};
 
@@ -229,7 +229,7 @@ tag blk_sort {
 type mac = spanned<mac_>;
 
 tag mac_ {
-    mac_invoc(path, @expr, option::t<istr>);
+    mac_invoc(path, @expr, option::t<str>);
     mac_embed_type(@ty);
     mac_embed_block(blk);
     mac_ellipsis;
@@ -238,13 +238,13 @@ tag mac_ {
 type lit = spanned<lit_>;
 
 tag lit_ {
-    lit_str(istr);
+    lit_str(str);
     lit_char(char);
     lit_int(int);
     lit_uint(uint);
     lit_mach_int(ty_mach, int);
-    lit_float(istr);
-    lit_mach_float(ty_mach, istr);
+    lit_float(str);
+    lit_mach_float(ty_mach, str);
     lit_nil;
     lit_bool(bool);
 }
@@ -292,6 +292,7 @@ tag ty_ {
              ret/fail/break/cont. there is no syntax
              for this type. */
 
+
      /* bot represents the value of functions that don't return a value
         locally to their context. in contrast, things like log that do
         return, but don't return a meaningful value, have result type nil. */
@@ -379,6 +380,7 @@ tag controlflow {
     noreturn; // functions with return type _|_ that always
               // raise an error or exit (i.e. never return to the caller)
 
+
     return; // everything else
 }
 
@@ -412,7 +414,7 @@ tag native_abi {
 }
 
 type native_mod =
-    {native_name: istr,
+    {native_name: str,
      abi: native_abi,
      view_items: [@view_item],
      items: [@native_item]};
@@ -467,9 +469,11 @@ tag item_ {
     item_tag([variant], [ty_param]);
     item_obj(_obj, [ty_param], /* constructor id */node_id);
     item_res(_fn,
-              /* dtor */
+
+             /* dtor */
              node_id,
-              /* dtor id */
+
+             /* dtor id */
              [ty_param],
 
              /* ctor id */
@@ -485,7 +489,7 @@ type native_item =
 
 tag native_item_ {
     native_item_ty;
-    native_item_fn(option::t<istr>, fn_decl, [ty_param]);
+    native_item_fn(option::t<str>, fn_decl, [ty_param]);
 }
 
 //
diff --git a/src/comp/syntax/ast_util.rs b/src/comp/syntax/ast_util.rs
index d82a2302be5..c5d769c1299 100644
--- a/src/comp/syntax/ast_util.rs
+++ b/src/comp/syntax/ast_util.rs
@@ -13,11 +13,9 @@ fn mk_sp(lo: uint, hi: uint) -> span {
 // make this a const, once the compiler supports it
 fn dummy_sp() -> span { ret mk_sp(0u, 0u); }
 
-fn path_name(p: &path) -> istr { path_name_i(p.node.idents) }
+fn path_name(p: &path) -> str { path_name_i(p.node.idents) }
 
-fn path_name_i(idents: &[ident]) -> istr {
-    str::connect(idents, ~"::")
-}
+fn path_name_i(idents: &[ident]) -> str { str::connect(idents, "::") }
 
 fn local_def(id: node_id) -> def_id { ret {crate: local_crate, node: id}; }
 
@@ -45,7 +43,7 @@ fn def_id_of_def(d: def) -> def_id {
     }
 }
 
-type pat_id_map = std::map::hashmap<istr, node_id>;
+type pat_id_map = std::map::hashmap<str, node_id>;
 
 // This is used because same-named variables in alternative patterns need to
 // use the node_id of their namesake in the first pattern.
@@ -82,27 +80,27 @@ fn pat_binding_ids(pat: &@pat) -> [node_id] {
     ret found;
 }
 
-fn binop_to_str(op: binop) -> istr {
+fn binop_to_str(op: binop) -> str {
     alt op {
-      add. { ret ~"+"; }
-      sub. { ret ~"-"; }
-      mul. { ret ~"*"; }
-      div. { ret ~"/"; }
-      rem. { ret ~"%"; }
-      and. { ret ~"&&"; }
-      or. { ret ~"||"; }
-      bitxor. { ret ~"^"; }
-      bitand. { ret ~"&"; }
-      bitor. { ret ~"|"; }
-      lsl. { ret ~"<<"; }
-      lsr. { ret ~">>"; }
-      asr. { ret ~">>>"; }
-      eq. { ret ~"=="; }
-      lt. { ret ~"<"; }
-      le. { ret ~"<="; }
-      ne. { ret ~"!="; }
-      ge. { ret ~">="; }
-      gt. { ret ~">"; }
+      add. { ret "+"; }
+      sub. { ret "-"; }
+      mul. { ret "*"; }
+      div. { ret "/"; }
+      rem. { ret "%"; }
+      and. { ret "&&"; }
+      or. { ret "||"; }
+      bitxor. { ret "^"; }
+      bitand. { ret "&"; }
+      bitor. { ret "|"; }
+      lsl. { ret "<<"; }
+      lsr. { ret ">>"; }
+      asr. { ret ">>>"; }
+      eq. { ret "=="; }
+      lt. { ret "<"; }
+      le. { ret "<="; }
+      ne. { ret "!="; }
+      ge. { ret ">="; }
+      gt. { ret ">"; }
     }
 }
 
@@ -110,12 +108,12 @@ pure fn lazy_binop(b: binop) -> bool {
     alt b { and. { true } or. { true } _ { false } }
 }
 
-fn unop_to_str(op: unop) -> istr {
+fn unop_to_str(op: unop) -> str {
     alt op {
-      box(mt) { if mt == mut { ret ~"@mutable "; } ret ~"@"; }
-      deref. { ret ~"*"; }
-      not. { ret ~"!"; }
-      neg. { ret ~"-"; }
+      box(mt) { if mt == mut { ret "@mutable "; } ret "@"; }
+      deref. { ret "*"; }
+      not. { ret "!"; }
+      neg. { ret "-"; }
     }
 }
 
@@ -123,18 +121,18 @@ fn is_path(e: &@expr) -> bool {
     ret alt e.node { expr_path(_) { true } _ { false } };
 }
 
-fn ty_mach_to_str(tm: ty_mach) -> istr {
+fn ty_mach_to_str(tm: ty_mach) -> str {
     alt tm {
-      ty_u8. { ret ~"u8"; }
-      ty_u16. { ret ~"u16"; }
-      ty_u32. { ret ~"u32"; }
-      ty_u64. { ret ~"u64"; }
-      ty_i8. { ret ~"i8"; }
-      ty_i16. { ret ~"i16"; }
-      ty_i32. { ret ~"i32"; }
-      ty_i64. { ret ~"i64"; }
-      ty_f32. { ret ~"f32"; }
-      ty_f64. { ret ~"f64"; }
+      ty_u8. { ret "u8"; }
+      ty_u16. { ret "u16"; }
+      ty_u32. { ret "u32"; }
+      ty_u64. { ret "u64"; }
+      ty_i8. { ret "i8"; }
+      ty_i16. { ret "i16"; }
+      ty_i32. { ret "i32"; }
+      ty_i64. { ret "i64"; }
+      ty_f32. { ret "f32"; }
+      ty_f64. { ret "f64"; }
     }
 }
 
@@ -190,8 +188,8 @@ fn block_from_expr(e: @expr) -> blk {
     ret {node: blk_, span: e.span};
 }
 
-fn checked_blk(stmts1: [@stmt], expr1: option::t<@expr>, id1: node_id)
-    -> blk_ {
+fn checked_blk(stmts1: [@stmt], expr1: option::t<@expr>, id1: node_id) ->
+   blk_ {
     ret {stmts: stmts1, expr: expr1, id: id1, rules: checked};
 }
 
diff --git a/src/comp/syntax/codemap.rs b/src/comp/syntax/codemap.rs
index 42120906b78..edb414b4e9b 100644
--- a/src/comp/syntax/codemap.rs
+++ b/src/comp/syntax/codemap.rs
@@ -7,7 +7,7 @@ import std::option;
 import std::option::some;
 import std::option::none;
 
-type filename = istr;
+type filename = str;
 
 type file_pos = {ch: uint, byte: uint};
 
@@ -66,15 +66,16 @@ fn lookup_byte_pos(map: codemap, pos: uint) -> loc {
 }
 
 tag opt_span {
-     //hack (as opposed to option::t), to make `span` compile
+
+    //hack (as opposed to option::t), to make `span` compile
     os_none;
     os_some(@span);
 }
 type span = {lo: uint, hi: uint, expanded_from: opt_span};
 
-fn span_to_str(sp: &span, cm: &codemap) -> istr {
+fn span_to_str(sp: &span, cm: &codemap) -> str {
     let cur = sp;
-    let res = ~"";
+    let res = "";
     let prev_file = none;
     while true {
         let lo = lookup_char_pos(cm, cur.lo);
@@ -82,16 +83,14 @@ fn span_to_str(sp: &span, cm: &codemap) -> istr {
         res +=
             #fmt["%s:%u:%u: %u:%u",
                  if some(lo.filename) == prev_file {
-                     ~"-"
-                 } else {
-                     lo.filename
-                 }, lo.line, lo.col, hi.line, hi.col];
+                     "-"
+                 } else { lo.filename }, lo.line, lo.col, hi.line, hi.col];
         alt cur.expanded_from {
           os_none. { break; }
           os_some(new_sp) {
             cur = *new_sp;
             prev_file = some(lo.filename);
-            res += ~"<<";
+            res += "<<";
           }
         }
     }
@@ -99,13 +98,13 @@ fn span_to_str(sp: &span, cm: &codemap) -> istr {
     ret res;
 }
 
-fn emit_diagnostic(sp: &option::t<span>, msg: &istr, kind: &istr, color: u8,
+fn emit_diagnostic(sp: &option::t<span>, msg: &str, kind: &str, color: u8,
                    cm: &codemap) {
-    let ss = ~"";
+    let ss = "";
     let maybe_lines: option::t<@file_lines> = none;
     alt sp {
       some(ssp) {
-        ss = span_to_str(ssp, cm) + ~" ";
+        ss = span_to_str(ssp, cm) + " ";
         maybe_lines = some(span_to_lines(ssp, cm));
       }
       none. { }
@@ -114,9 +113,9 @@ fn emit_diagnostic(sp: &option::t<span>, msg: &istr, kind: &istr, color: u8,
     if term::color_supported() {
         term::fg(io::stdout().get_buf_writer(), color);
     }
-    io::stdout().write_str(#fmt[~"%s:", kind]);
+    io::stdout().write_str(#fmt["%s:", kind]);
     if term::color_supported() { term::reset(io::stdout().get_buf_writer()); }
-    io::stdout().write_str(#fmt[~" %s\n", msg]);
+    io::stdout().write_str(#fmt[" %s\n", msg]);
 
     maybe_highlight_lines(sp, cm, maybe_lines);
 }
@@ -128,7 +127,7 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap,
       some(lines) {
         // If we're not looking at a real file then we can't re-open it to
         // pull out the lines
-        if lines.name == ~"-" { ret; }
+        if lines.name == "-" { ret; }
 
         // FIXME: reading in the entire file is the worst possible way to
         //        get access to the necessary lines.
@@ -145,19 +144,18 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap,
         }
         // Print the offending lines
         for line: uint in display_lines {
-            io::stdout().write_str(
-                #fmt[~"%s:%u ", fm.name, line + 1u]);
+            io::stdout().write_str(#fmt["%s:%u ", fm.name, line + 1u]);
             let s = get_line(fm, line as int, file);
-            if !str::ends_with(s, ~"\n") { s += ~"\n"; }
+            if !str::ends_with(s, "\n") { s += "\n"; }
             io::stdout().write_str(s);
         }
         if elided {
             let last_line = display_lines[vec::len(display_lines) - 1u];
-            let s = #fmt[~"%s:%u ", fm.name, last_line + 1u];
+            let s = #fmt["%s:%u ", fm.name, last_line + 1u];
             let indent = str::char_len(s);
-            let out = ~"";
-            while indent > 0u { out += ~" "; indent -= 1u; }
-            out += ~"...\n";
+            let out = "";
+            while indent > 0u { out += " "; indent -= 1u; }
+            out += "...\n";
             io::stdout().write_str(out);
         }
 
@@ -173,34 +171,34 @@ fn maybe_highlight_lines(sp: &option::t<span>, cm: &codemap,
 
             // indent past |name:## | and the 0-offset column location
             let left = str::char_len(fm.name) + digits + lo.col + 3u;
-            let s = ~"";
+            let s = "";
             while left > 0u { str::push_char(s, ' '); left -= 1u; }
 
-            s += ~"^";
+            s += "^";
             let hi = lookup_char_pos(cm, option::get(sp).hi);
             if hi.col != lo.col {
                 // the ^ already takes up one space
                 let width = hi.col - lo.col - 1u;
                 while width > 0u { str::push_char(s, '~'); width -= 1u; }
             }
-            io::stdout().write_str(s + ~"\n");
+            io::stdout().write_str(s + "\n");
         }
       }
       _ { }
     }
 }
 
-fn emit_warning(sp: &option::t<span>, msg: &istr, cm: &codemap) {
-    emit_diagnostic(sp, msg, ~"warning", 11u8, cm);
+fn emit_warning(sp: &option::t<span>, msg: &str, cm: &codemap) {
+    emit_diagnostic(sp, msg, "warning", 11u8, cm);
 }
-fn emit_error(sp: &option::t<span>, msg: &istr, cm: &codemap) {
-    emit_diagnostic(sp, msg, ~"error", 9u8, cm);
+fn emit_error(sp: &option::t<span>, msg: &str, cm: &codemap) {
+    emit_diagnostic(sp, msg, "error", 9u8, cm);
 }
-fn emit_note(sp: &option::t<span>, msg: &istr, cm: &codemap) {
-    emit_diagnostic(sp, msg, ~"note", 10u8, cm);
+fn emit_note(sp: &option::t<span>, msg: &str, cm: &codemap) {
+    emit_diagnostic(sp, msg, "note", 10u8, cm);
 }
 
-type file_lines = {name: istr, lines: [uint]};
+type file_lines = {name: str, lines: [uint]};
 
 fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines {
     let lo = lookup_char_pos(cm, sp.lo);
@@ -212,7 +210,7 @@ fn span_to_lines(sp: span, cm: codemap::codemap) -> @file_lines {
     ret @{name: lo.filename, lines: lines};
 }
 
-fn get_line(fm: filemap, line: int, file: &istr) -> istr {
+fn get_line(fm: filemap, line: int, file: &str) -> str {
     let begin: uint = fm.lines[line].byte - fm.start_pos.byte;
     let end: uint;
     if line as uint < vec::len(fm.lines) - 1u {
@@ -229,10 +227,8 @@ fn get_line(fm: filemap, line: int, file: &istr) -> istr {
     ret str::slice(file, begin, end);
 }
 
-fn get_filemap(cm: codemap, filename: istr) -> filemap {
-    for fm: filemap in cm.files {
-        if fm.name == filename { ret fm; }
-    }
+fn get_filemap(cm: codemap, filename: str) -> filemap {
+    for fm: filemap in cm.files { if fm.name == filename { ret fm; } }
     //XXjdm the following triggers a mismatched type bug
     //      (or expected function, found _|_)
     fail; // ("asking for " + filename + " which we don't know about");
diff --git a/src/comp/syntax/ext/base.rs b/src/comp/syntax/ext/base.rs
index 2dcc43ef178..298f90237bc 100644
--- a/src/comp/syntax/ext/base.rs
+++ b/src/comp/syntax/ext/base.rs
@@ -8,10 +8,10 @@ import std::map::new_str_hash;
 import codemap;
 
 type syntax_expander =
-    fn(&ext_ctxt, span, @ast::expr, &option::t<istr>) -> @ast::expr;
-type macro_def = {ident: istr, ext: syntax_extension};
+    fn(&ext_ctxt, span, @ast::expr, &option::t<str>) -> @ast::expr;
+type macro_def = {ident: str, ext: syntax_extension};
 type macro_definer =
-    fn(&ext_ctxt, span, @ast::expr, &option::t<istr>) -> macro_def;
+    fn(&ext_ctxt, span, @ast::expr, &option::t<str>) -> macro_def;
 
 tag syntax_extension {
     normal(syntax_expander);
@@ -20,25 +20,25 @@ tag syntax_extension {
 
 // A temporary hard-coded map of methods for expanding syntax extension
 // AST nodes into full ASTs
-fn syntax_expander_table() -> hashmap<istr, syntax_extension> {
+fn syntax_expander_table() -> hashmap<str, syntax_extension> {
     let syntax_expanders = new_str_hash::<syntax_extension>();
-    syntax_expanders.insert(~"fmt", normal(ext::fmt::expand_syntax_ext));
-    syntax_expanders.insert(~"env", normal(ext::env::expand_syntax_ext));
-    syntax_expanders.insert(~"macro",
+    syntax_expanders.insert("fmt", normal(ext::fmt::expand_syntax_ext));
+    syntax_expanders.insert("env", normal(ext::env::expand_syntax_ext));
+    syntax_expanders.insert("macro",
                             macro_defining(ext::simplext::add_new_extension));
-    syntax_expanders.insert(~"concat_idents",
+    syntax_expanders.insert("concat_idents",
                             normal(ext::concat_idents::expand_syntax_ext));
-    syntax_expanders.insert(~"ident_to_str",
+    syntax_expanders.insert("ident_to_str",
                             normal(ext::ident_to_str::expand_syntax_ext));
-    syntax_expanders.insert(~"log_syntax",
+    syntax_expanders.insert("log_syntax",
                             normal(ext::log_syntax::expand_syntax_ext));
     ret syntax_expanders;
 }
 
 obj ext_ctxt(sess: @session,
-             crate_file_name_hack: istr,
+             crate_file_name_hack: str,
              mutable backtrace: codemap::opt_span) {
-    fn crate_file_name() -> istr { ret crate_file_name_hack; }
+    fn crate_file_name() -> str { ret crate_file_name_hack; }
 
     fn session() -> @session { ret sess; }
 
@@ -58,30 +58,27 @@ obj ext_ctxt(sess: @session,
             let tmp = pre;
             backtrace = tmp;
           }
-          _ { self.bug(~"tried to pop without a push"); }
+          _ { self.bug("tried to pop without a push"); }
         }
     }
 
-    fn span_fatal(sp: span, msg: istr) -> ! {
+    fn span_fatal(sp: span, msg: str) -> ! {
         self.print_backtrace();
         sess.span_fatal(sp, msg);
     }
-    fn span_err(sp: span, msg: istr) {
+    fn span_err(sp: span, msg: str) {
         self.print_backtrace();
         sess.span_err(sp, msg);
     }
-    fn span_unimpl(sp: span, msg: istr) -> ! {
+    fn span_unimpl(sp: span, msg: str) -> ! {
         self.print_backtrace();
         sess.span_unimpl(sp, msg);
     }
-    fn span_bug(sp: span, msg: istr) -> ! {
+    fn span_bug(sp: span, msg: str) -> ! {
         self.print_backtrace();
         sess.span_bug(sp, msg);
     }
-    fn bug(msg: istr) -> ! {
-        self.print_backtrace();
-        sess.bug(msg);
-    }
+    fn bug(msg: str) -> ! { self.print_backtrace(); sess.bug(msg); }
     fn next_id() -> ast::node_id { ret sess.next_node_id(); }
 
 }
@@ -96,11 +93,10 @@ fn mk_ctxt(sess: &session) -> ext_ctxt {
     // super-ugly and needs a better solution.
     let crate_file_name_hack = sess.get_codemap().files[0].name;
 
-    ret ext_ctxt(@sess, crate_file_name_hack,
-                 codemap::os_none);
+    ret ext_ctxt(@sess, crate_file_name_hack, codemap::os_none);
 }
 
-fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &istr) -> istr {
+fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &str) -> str {
     alt expr.node {
       ast::expr_lit(l) {
         alt l.node {
@@ -112,8 +108,7 @@ fn expr_to_str(cx: &ext_ctxt, expr: @ast::expr, error: &istr) -> istr {
     }
 }
 
-fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr,
-                 error: &istr) -> ast::ident {
+fn expr_to_ident(cx: &ext_ctxt, expr: @ast::expr, error: &str) -> ast::ident {
     alt expr.node {
       ast::expr_path(p) {
         if vec::len(p.node.types) > 0u || vec::len(p.node.idents) != 1u {
diff --git a/src/comp/syntax/ext/concat_idents.rs b/src/comp/syntax/ext/concat_idents.rs
index f5ce004ea00..53ee6cb0397 100644
--- a/src/comp/syntax/ext/concat_idents.rs
+++ b/src/comp/syntax/ext/concat_idents.rs
@@ -3,17 +3,17 @@ import base::*;
 import syntax::ast;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
-                     _body: &option::t<istr>) -> @ast::expr {
+                     _body: &option::t<str>) -> @ast::expr {
     let args: [@ast::expr] =
         alt arg.node {
           ast::expr_vec(elts, _) { elts }
           _ {
-            cx.span_fatal(sp, ~"#concat_idents requires a vector argument .")
+            cx.span_fatal(sp, "#concat_idents requires a vector argument .")
           }
         };
-    let res: ast::ident = ~"";
+    let res: ast::ident = "";
     for e: @ast::expr in args {
-        res += expr_to_ident(cx, e, ~"expected an ident");
+        res += expr_to_ident(cx, e, "expected an ident");
     }
 
     ret @{id: cx.next_id(),
diff --git a/src/comp/syntax/ext/env.rs b/src/comp/syntax/ext/env.rs
index 487b12d0bc2..081bfd80c1d 100644
--- a/src/comp/syntax/ext/env.rs
+++ b/src/comp/syntax/ext/env.rs
@@ -12,30 +12,28 @@ import base::*;
 export expand_syntax_ext;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
-                     _body: &option::t<istr>) -> @ast::expr {
+                     _body: &option::t<str>) -> @ast::expr {
     let args: [@ast::expr] =
         alt arg.node {
           ast::expr_vec(elts, _) { elts }
           _ {
-            cx.span_fatal(sp, ~"#env requires arguments of the form `[...]`.")
+            cx.span_fatal(sp, "#env requires arguments of the form `[...]`.")
           }
         };
     if vec::len::<@ast::expr>(args) != 1u {
-        cx.span_fatal(sp, ~"malformed #env call");
+        cx.span_fatal(sp, "malformed #env call");
     }
     // FIXME: if this was more thorough it would manufacture an
     // option::t<str> rather than just an maybe-empty string.
 
-    let var = expr_to_str(cx, args[0], ~"#env requires a string");
+    let var = expr_to_str(cx, args[0], "#env requires a string");
     alt generic_os::getenv(var) {
-      option::none. { ret make_new_str(cx, sp, ~""); }
-      option::some(s) {
-        ret make_new_str(cx, sp, s);
-      }
+      option::none. { ret make_new_str(cx, sp, ""); }
+      option::some(s) { ret make_new_str(cx, sp, s); }
     }
 }
 
-fn make_new_str(cx: &ext_ctxt, sp: codemap::span, s: &istr) -> @ast::expr {
+fn make_new_str(cx: &ext_ctxt, sp: codemap::span, s: &str) -> @ast::expr {
     ret make_new_lit(cx, sp, ast::lit_str(s));
 }
 //
diff --git a/src/comp/syntax/ext/expand.rs b/src/comp/syntax/ext/expand.rs
index c2a3a201126..7037139bd93 100644
--- a/src/comp/syntax/ext/expand.rs
+++ b/src/comp/syntax/ext/expand.rs
@@ -15,7 +15,7 @@ import syntax::fold::*;
 import syntax::ext::base::*;
 
 
-fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt,
+fn expand_expr(exts: &hashmap<str, syntax_extension>, cx: &ext_ctxt,
                e: &expr_, fld: ast_fold, orig: &fn(&expr_, ast_fold) -> expr_)
    -> expr_ {
     ret alt e {
@@ -27,8 +27,7 @@ fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt,
                 alt exts.find(extname) {
                   none. {
                     cx.span_fatal(pth.span,
-                                  #fmt["macro undefined: '%s'",
-                                       extname])
+                                  #fmt["macro undefined: '%s'", extname])
                   }
                   some(normal(ext)) {
                     let expanded = ext(cx, pth.span, args, body);
@@ -42,14 +41,12 @@ fn expand_expr(exts: &hashmap<istr, syntax_extension>, cx: &ext_ctxt,
                   }
                   some(macro_defining(ext)) {
                     let named_extension = ext(cx, pth.span, args, body);
-                    exts.insert(
-                        named_extension.ident,
-                        named_extension.ext);
+                    exts.insert(named_extension.ident, named_extension.ext);
                     ast::expr_rec([], none)
                   }
                 }
               }
-              _ { cx.span_bug(mac.span, ~"naked syntactic bit") }
+              _ { cx.span_bug(mac.span, "naked syntactic bit") }
             }
           }
           _ { orig(e, fld) }
diff --git a/src/comp/syntax/ext/fmt.rs b/src/comp/syntax/ext/fmt.rs
index 91a83b06267..aef3cc46902 100644
--- a/src/comp/syntax/ext/fmt.rs
+++ b/src/comp/syntax/ext/fmt.rs
@@ -16,26 +16,24 @@ import codemap::span;
 export expand_syntax_ext;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: span, arg: @ast::expr,
-                     _body: &option::t<istr>) -> @ast::expr {
+                     _body: &option::t<str>) -> @ast::expr {
     let args: [@ast::expr] =
         alt arg.node {
           ast::expr_vec(elts, _) { elts }
           _ {
-            cx.span_fatal(
-                sp, ~"#fmt requires arguments of the form `[...]`.")
+            cx.span_fatal(sp, "#fmt requires arguments of the form `[...]`.")
           }
         };
     if vec::len::<@ast::expr>(args) == 0u {
-        cx.span_fatal(sp, ~"#fmt requires a format string");
+        cx.span_fatal(sp, "#fmt requires a format string");
     }
     let fmt =
         expr_to_str(cx, args[0],
-                    ~"first argument to #fmt must be a "
-                    + ~"string literal.");
+                    "first argument to #fmt must be a " + "string literal.");
     let fmtspan = args[0].span;
     log "Format string:";
     log fmt;
-    fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: &istr) -> ! {
+    fn parse_fmt_err_(cx: &ext_ctxt, sp: span, msg: &str) -> ! {
         cx.span_fatal(sp, msg);
     }
     let parse_fmt_err = bind parse_fmt_err_(cx, fmtspan, _);
@@ -52,7 +50,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
         let sp_lit = @{node: lit, span: sp};
         ret @{id: cx.next_id(), node: ast::expr_lit(sp_lit), span: sp};
     }
-    fn make_new_str(cx: &ext_ctxt, sp: span, s: &istr) -> @ast::expr {
+    fn make_new_str(cx: &ext_ctxt, sp: span, s: &str) -> @ast::expr {
         let lit = ast::lit_str(s);
         ret make_new_lit(cx, sp, lit);
     }
@@ -103,14 +101,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     }
     fn make_path_vec(cx: &ext_ctxt, ident: &ast::ident) -> [ast::ident] {
         fn compiling_std(cx: &ext_ctxt) -> bool {
-            ret str::find(cx.crate_file_name(), ~"std.rc") >= 0;
+            ret str::find(cx.crate_file_name(), "std.rc") >= 0;
         }
         if compiling_std(cx) {
-            ret [~"extfmt", ~"rt", ident];
-        } else { ret [~"std", ~"extfmt", ~"rt", ident]; }
+            ret ["extfmt", "rt", ident];
+        } else { ret ["std", "extfmt", "rt", ident]; }
     }
-    fn make_rt_path_expr(cx: &ext_ctxt, sp: span,
-                         ident: &istr) -> @ast::expr {
+    fn make_rt_path_expr(cx: &ext_ctxt, sp: span, ident: &str) -> @ast::expr {
         let path = make_path_vec(cx, ident);
         ret make_path_expr(cx, sp, path);
     }
@@ -123,11 +120,11 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             for f: flag in flags {
                 let fstr;
                 alt f {
-                  flag_left_justify. { fstr = ~"flag_left_justify"; }
-                  flag_left_zero_pad. { fstr = ~"flag_left_zero_pad"; }
-                  flag_space_for_sign. { fstr = ~"flag_space_for_sign"; }
-                  flag_sign_always. { fstr = ~"flag_sign_always"; }
-                  flag_alternate. { fstr = ~"flag_alternate"; }
+                  flag_left_justify. { fstr = "flag_left_justify"; }
+                  flag_left_zero_pad. { fstr = "flag_left_zero_pad"; }
+                  flag_space_for_sign. { fstr = "flag_space_for_sign"; }
+                  flag_sign_always. { fstr = "flag_sign_always"; }
+                  flag_alternate. { fstr = "flag_alternate"; }
                 }
                 flagexprs += [make_rt_path_expr(cx, sp, fstr)];
             }
@@ -136,22 +133,22 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             // this is a hack placeholder flag
 
             if vec::len::<@ast::expr>(flagexprs) == 0u {
-                flagexprs += [make_rt_path_expr(cx, sp, ~"flag_none")];
+                flagexprs += [make_rt_path_expr(cx, sp, "flag_none")];
             }
             ret make_vec_expr(cx, sp, flagexprs);
         }
         fn make_count(cx: &ext_ctxt, sp: span, cnt: &count) -> @ast::expr {
             alt cnt {
               count_implied. {
-                ret make_rt_path_expr(cx, sp, ~"count_implied");
+                ret make_rt_path_expr(cx, sp, "count_implied");
               }
               count_is(c) {
                 let count_lit = make_new_int(cx, sp, c);
-                let count_is_path = make_path_vec(cx, ~"count_is");
+                let count_is_path = make_path_vec(cx, "count_is");
                 let count_is_args = [count_lit];
                 ret make_call(cx, sp, count_is_path, count_is_args);
               }
-              _ { cx.span_unimpl(sp, ~"unimplemented #fmt conversion"); }
+              _ { cx.span_unimpl(sp, "unimplemented #fmt conversion"); }
             }
         }
         fn make_ty(cx: &ext_ctxt, sp: span, t: &ty) -> @ast::expr {
@@ -159,13 +156,13 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             alt t {
               ty_hex(c) {
                 alt c {
-                  case_upper. { rt_type = ~"ty_hex_upper"; }
-                  case_lower. { rt_type = ~"ty_hex_lower"; }
+                  case_upper. { rt_type = "ty_hex_upper"; }
+                  case_lower. { rt_type = "ty_hex_lower"; }
                 }
               }
-              ty_bits. { rt_type = ~"ty_bits"; }
-              ty_octal. { rt_type = ~"ty_octal"; }
-              _ { rt_type = ~"ty_default"; }
+              ty_bits. { rt_type = "ty_bits"; }
+              ty_octal. { rt_type = "ty_octal"; }
+              _ { rt_type = "ty_default"; }
             }
             ret make_rt_path_expr(cx, sp, rt_type);
         }
@@ -173,10 +170,10 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
                          width_expr: @ast::expr, precision_expr: @ast::expr,
                          ty_expr: @ast::expr) -> @ast::expr {
             ret make_rec_expr(cx, sp,
-                              [{ident: ~"flags", ex: flags_expr},
-                               {ident: ~"width", ex: width_expr},
-                               {ident: ~"precision", ex: precision_expr},
-                               {ident: ~"ty", ex: ty_expr}]);
+                              [{ident: "flags", ex: flags_expr},
+                               {ident: "width", ex: width_expr},
+                               {ident: "precision", ex: precision_expr},
+                               {ident: "ty", ex: ty_expr}]);
         }
         let rt_conv_flags = make_flags(cx, sp, cnv.flags);
         let rt_conv_width = make_count(cx, sp, cnv.width);
@@ -185,9 +182,9 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
         ret make_conv_rec(cx, sp, rt_conv_flags, rt_conv_width,
                           rt_conv_precision, rt_conv_ty);
     }
-    fn make_conv_call(cx: &ext_ctxt, sp: span, conv_type: &istr,
-                      cnv: &conv, arg: @ast::expr) -> @ast::expr {
-        let fname = ~"conv_" + conv_type;
+    fn make_conv_call(cx: &ext_ctxt, sp: span, conv_type: &str, cnv: &conv,
+                      arg: @ast::expr) -> @ast::expr {
+        let fname = "conv_" + conv_type;
         let path = make_path_vec(cx, fname);
         let cnv_expr = make_rt_conv_expr(cx, sp, cnv);
         let args = [cnv_expr, arg];
@@ -205,7 +202,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
               _ { ret false; }
             }
         }
-        let unsupported = ~"conversion not supported in #fmt string";
+        let unsupported = "conversion not supported in #fmt string";
         alt cnv.param {
           option::none. { }
           _ { cx.span_unimpl(sp, unsupported); }
@@ -216,15 +213,15 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
               flag_sign_always. {
                 if !is_signed_type(cnv) {
                     cx.span_fatal(sp,
-                                  ~"+ flag only valid in " +
-                                      ~"signed #fmt conversion");
+                                  "+ flag only valid in " +
+                                      "signed #fmt conversion");
                 }
               }
               flag_space_for_sign. {
                 if !is_signed_type(cnv) {
                     cx.span_fatal(sp,
-                                  ~"space flag only valid in " +
-                                      ~"signed #fmt conversions");
+                                  "space flag only valid in " +
+                                      "signed #fmt conversions");
                 }
               }
               flag_left_zero_pad. { }
@@ -242,28 +239,26 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
           _ { cx.span_unimpl(sp, unsupported); }
         }
         alt cnv.ty {
-          ty_str. { ret make_conv_call(cx, arg.span, ~"str", cnv, arg); }
+          ty_str. { ret make_conv_call(cx, arg.span, "str", cnv, arg); }
           ty_int(sign) {
             alt sign {
-              signed. { ret make_conv_call(cx, arg.span, ~"int", cnv, arg); }
+              signed. { ret make_conv_call(cx, arg.span, "int", cnv, arg); }
               unsigned. {
-                ret make_conv_call(cx, arg.span, ~"uint", cnv, arg);
+                ret make_conv_call(cx, arg.span, "uint", cnv, arg);
               }
             }
           }
-          ty_bool. { ret make_conv_call(cx, arg.span, ~"bool", cnv, arg); }
-          ty_char. { ret make_conv_call(cx, arg.span, ~"char", cnv, arg); }
-          ty_hex(_) { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); }
-          ty_bits. { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); }
-          ty_octal. { ret make_conv_call(cx, arg.span, ~"uint", cnv, arg); }
+          ty_bool. { ret make_conv_call(cx, arg.span, "bool", cnv, arg); }
+          ty_char. { ret make_conv_call(cx, arg.span, "char", cnv, arg); }
+          ty_hex(_) { ret make_conv_call(cx, arg.span, "uint", cnv, arg); }
+          ty_bits. { ret make_conv_call(cx, arg.span, "uint", cnv, arg); }
+          ty_octal. { ret make_conv_call(cx, arg.span, "uint", cnv, arg); }
           _ { cx.span_unimpl(sp, unsupported); }
         }
     }
     fn log_conv(c: conv) {
         alt c.param {
-          some(p) {
-            log ~"param: " + std::int::to_str(p, 10u);
-          }
+          some(p) { log "param: " + std::int::to_str(p, 10u); }
           _ { log "param: none"; }
         }
         for f: flag in c.flags {
@@ -276,21 +271,17 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             }
         }
         alt c.width {
-          count_is(i) { log ~"width: count is "
-              + std::int::to_str(i, 10u); }
+          count_is(i) { log "width: count is " + std::int::to_str(i, 10u); }
           count_is_param(i) {
-            log ~"width: count is param "
-                + std::int::to_str(i, 10u);
+            log "width: count is param " + std::int::to_str(i, 10u);
           }
           count_is_next_param. { log "width: count is next param"; }
           count_implied. { log "width: count is implied"; }
         }
         alt c.precision {
-          count_is(i) { log ~"prec: count is "
-              + std::int::to_str(i, 10u); }
+          count_is(i) { log "prec: count is " + std::int::to_str(i, 10u); }
           count_is_param(i) {
-            log ~"prec: count is param "
-                + std::int::to_str(i, 10u);
+            log "prec: count is param " + std::int::to_str(i, 10u);
           }
           count_is_next_param. { log "prec: count is next param"; }
           count_implied. { log "prec: count is implied"; }
@@ -317,7 +308,7 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
     }
     let fmt_sp = args[0].span;
     let n = 0u;
-    let tmp_expr = make_new_str(cx, sp, ~"");
+    let tmp_expr = make_new_str(cx, sp, "");
     let nargs = vec::len::<@ast::expr>(args);
     for pc: piece in pieces {
         alt pc {
@@ -329,8 +320,8 @@ fn pieces_to_expr(cx: &ext_ctxt, sp: span, pieces: &[piece],
             n += 1u;
             if n >= nargs {
                 cx.span_fatal(sp,
-                              ~"not enough arguments to #fmt " +
-                                  ~"for the given format string");
+                              "not enough arguments to #fmt " +
+                                  "for the given format string");
             }
             log "Building conversion:";
             log_conv(conv);
diff --git a/src/comp/syntax/ext/ident_to_str.rs b/src/comp/syntax/ext/ident_to_str.rs
index f30d6932555..1cf015fcaf0 100644
--- a/src/comp/syntax/ext/ident_to_str.rs
+++ b/src/comp/syntax/ext/ident_to_str.rs
@@ -5,20 +5,20 @@ import base::*;
 import syntax::ast;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
-                     _body: &option::t<istr>) -> @ast::expr {
+                     _body: &option::t<str>) -> @ast::expr {
     let args: [@ast::expr] =
         alt arg.node {
           ast::expr_vec(elts, _) { elts }
           _ {
-            cx.span_fatal(sp, ~"#ident_to_str requires a vector argument .")
+            cx.span_fatal(sp, "#ident_to_str requires a vector argument .")
           }
         };
     if vec::len::<@ast::expr>(args) != 1u {
-        cx.span_fatal(sp, ~"malformed #ident_to_str call");
+        cx.span_fatal(sp, "malformed #ident_to_str call");
     }
 
     ret make_new_lit(cx, sp,
                      ast::lit_str(expr_to_ident(cx, args[0u],
-                                                ~"expected an ident")));
+                                                "expected an ident")));
 
 }
diff --git a/src/comp/syntax/ext/log_syntax.rs b/src/comp/syntax/ext/log_syntax.rs
index a8fa657c20c..50e7e307bdc 100644
--- a/src/comp/syntax/ext/log_syntax.rs
+++ b/src/comp/syntax/ext/log_syntax.rs
@@ -4,11 +4,10 @@ import syntax::ast;
 import std::str;
 
 fn expand_syntax_ext(cx: &ext_ctxt, sp: codemap::span, arg: @ast::expr,
-                     _body: &option::t<istr>) -> @ast::expr {
+                     _body: &option::t<str>) -> @ast::expr {
 
     cx.print_backtrace();
-    std::io::stdout().write_line(
-        print::pprust::expr_to_str(arg));
+    std::io::stdout().write_line(print::pprust::expr_to_str(arg));
 
     //trivial expression
     ret @{id: cx.next_id(), node: ast::expr_rec([], option::none), span: sp};
diff --git a/src/comp/syntax/ext/simplext.rs b/src/comp/syntax/ext/simplext.rs
index 3496791ce6e..4e76ec0d787 100644
--- a/src/comp/syntax/ext/simplext.rs
+++ b/src/comp/syntax/ext/simplext.rs
@@ -57,29 +57,29 @@ tag matchable {
 }
 
 /* for when given an incompatible bit of AST */
-fn match_error(cx: &ext_ctxt, m: &matchable, expected: &istr) -> ! {
+fn match_error(cx: &ext_ctxt, m: &matchable, expected: &str) -> ! {
     alt m {
       match_expr(x) {
         cx.span_fatal(x.span,
-                      ~"this argument is an expr, expected " + expected);
+                      "this argument is an expr, expected " + expected);
       }
       match_path(x) {
         cx.span_fatal(x.span,
-                      ~"this argument is a path, expected " + expected);
+                      "this argument is a path, expected " + expected);
       }
       match_ident(x) {
         cx.span_fatal(x.span,
-                      ~"this argument is an ident, expected " + expected);
+                      "this argument is an ident, expected " + expected);
       }
       match_ty(x) {
         cx.span_fatal(x.span,
-                      ~"this argument is a type, expected " + expected);
+                      "this argument is a type, expected " + expected);
       }
       match_block(x) {
         cx.span_fatal(x.span,
-                      ~"this argument is a block, expected " + expected);
+                      "this argument is a block, expected " + expected);
       }
-      match_exact. { cx.bug(~"what is a match_exact doing in a bindings?"); }
+      match_exact. { cx.bug("what is a match_exact doing in a bindings?"); }
     }
 }
 
@@ -102,7 +102,7 @@ fn elts_to_ell(cx: &ext_ctxt, elts: &[@expr]) ->
             alt m.node {
               ast::mac_ellipsis. {
                 if res != none {
-                    cx.span_fatal(m.span, ~"only one ellipsis allowed");
+                    cx.span_fatal(m.span, "only one ellipsis allowed");
                 }
                 res =
                     some({pre: vec::slice(elts, 0u, idx - 1u),
@@ -190,8 +190,7 @@ fn use_selectors_to_bind(b: &binders, e: @expr) -> option::t<bindings> {
         alt sel(match_expr(e)) { none. { ret none; } _ { } }
     }
     let never_mind: bool = false;
-    for each pair: @{key: ident,
-                     val: selector} in b.real_binders.items() {
+    for each pair: @{key: ident, val: selector} in b.real_binders.items() {
         alt pair.val(match_expr(e)) {
           none. { never_mind = true; }
           some(mtc) { res.insert(pair.key, mtc); }
@@ -252,8 +251,8 @@ fn follow_for_trans(cx: &ext_ctxt, mmaybe: &option::t<arb_depth<matchable>>,
         ret alt follow(m, idx_path) {
               seq(_, sp) {
                 cx.span_fatal(sp,
-                              ~"syntax matched under ... but not " +
-                                  ~"used that way.")
+                              "syntax matched under ... but not " +
+                                  "used that way.")
               }
               leaf(m) { ret some(m) }
             }
@@ -267,9 +266,7 @@ iter free_vars(b: &bindings, e: @expr) -> ident {
     let idents: hashmap<ident, ()> = new_str_hash::<()>();
     fn mark_ident(i: &ident, _fld: ast_fold, b: &bindings,
                   idents: &hashmap<ident, ()>) -> ident {
-        if b.contains_key(i) {
-            idents.insert(i, ());
-        }
+        if b.contains_key(i) { idents.insert(i, ()); }
         ret i;
     }
     // using fold is a hack: we want visit, but it doesn't hit idents ) :
@@ -309,13 +306,10 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                         let len = vec::len(*ms);
                         if old_len != len {
                             let msg =
-                                #fmt["'%s' occurs %u times, but ",
-                                     fv, len] +
-                                    #fmt["'%s' occurs %u times",
-                                         old_name,
+                                #fmt["'%s' occurs %u times, but ", fv, len] +
+                                    #fmt["'%s' occurs %u times", old_name,
                                          old_len];
-                            cx.span_fatal(
-                                repeat_me.span, msg);
+                            cx.span_fatal(repeat_me.span, msg);
                         }
                       }
                     }
@@ -325,8 +319,8 @@ fn transcribe_exprs(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
             alt repeat {
               none. {
                 cx.span_fatal(repeat_me.span,
-                              ~"'...' surrounds an expression without any" +
-                                  ~" repeating syntax variables");
+                              "'...' surrounds an expression without any" +
+                                  " repeating syntax variables");
               }
               some({rep_count: rc, _}) {
                 /* Whew, we now know how how many times to repeat */
@@ -354,7 +348,7 @@ fn transcribe_ident(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                     i: &ident, _fld: ast_fold) -> ident {
     ret alt follow_for_trans(cx, b.find(i), idx_path) {
           some(match_ident(a_id)) { a_id.node }
-          some(m) { match_error(cx, m, ~"an identifier") }
+          some(m) { match_error(cx, m, "an identifier") }
           none. { i }
         }
 }
@@ -369,7 +363,7 @@ fn transcribe_path(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
             {global: false, idents: [id.node], types: []}
           }
           some(match_path(a_pth)) { a_pth.node }
-          some(m) { match_error(cx, m, ~"a path") }
+          some(m) { match_error(cx, m, "a path") }
           none. { p }
         }
 }
@@ -394,7 +388,7 @@ fn transcribe_expr(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
               }
               some(match_path(a_pth)) { expr_path(a_pth) }
               some(match_expr(a_exp)) { a_exp.node }
-              some(m) { match_error(cx, m, ~"an expression") }
+              some(m) { match_error(cx, m, "an expression") }
               none. { orig(e, fld) }
             }
           }
@@ -411,7 +405,7 @@ fn transcribe_type(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
               some(id) {
                 alt follow_for_trans(cx, b.find(id), idx_path) {
                   some(match_ty(ty)) { ty.node }
-                  some(m) { match_error(cx, m, ~"a type") }
+                  some(m) { match_error(cx, m, "a type") }
                   none. { orig(t, fld) }
                 }
               }
@@ -431,14 +425,14 @@ fn transcribe_block(cx: &ext_ctxt, b: &bindings, idx_path: @mutable [uint],
                     orig: fn(&blk_, ast_fold) -> blk_) -> blk_ {
     ret alt block_to_ident(blk) {
           some(id) {
-            alt follow_for_trans(cx, b.find(
-                id), idx_path) {
+            alt follow_for_trans(cx, b.find(id), idx_path) {
               some(match_block(new_blk)) { new_blk.node }
 
 
+
               // possibly allow promotion of ident/path/expr to blocks?
               some(m) {
-                match_error(cx, m, ~"a block")
+                match_error(cx, m, "a block")
               }
               none. { orig(blk, fld) }
             }
@@ -469,12 +463,12 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
 
                 if vec::len(post) > 0u {
                     cx.span_unimpl(e.span,
-                                   ~"matching after `...` not yet supported");
+                                   "matching after `...` not yet supported");
                 }
               }
               {pre: pre, rep: none., post: post} {
                 if post != [] {
-                    cx.bug(~"elts_to_ell provided an invalid result");
+                    cx.bug("elts_to_ell provided an invalid result");
                 }
                 p_t_s_r_length(cx, vec::len(pre), false, s, b);
                 p_t_s_r_actual_vector(cx, pre, false, s, b);
@@ -483,6 +477,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
           }
 
 
+
           /* TODO: handle embedded types and blocks, at least */
           expr_mac(mac) {
             p_t_s_r_mac(cx, mac, s, b);
@@ -494,7 +489,7 @@ fn p_t_s_rec(cx: &ext_ctxt, m: &matchable, s: &selector, b: &binders) {
                       match_expr(e) {
                         if e == pat { some(leaf(match_exact)) } else { none }
                       }
-                      _ { cx.bug(~"broken traversal in p_t_s_r") }
+                      _ { cx.bug("broken traversal in p_t_s_r") }
                     }
             }
             b.literal_ast_matchers += [bind select(cx, _, e)];
@@ -530,14 +525,13 @@ fn p_t_s_r_path(cx: &ext_ctxt, p: &path, s: &selector, b: &binders) {
         fn select(cx: &ext_ctxt, m: &matchable) -> match_result {
             ret alt m {
                   match_expr(e) { some(leaf(specialize_match(m))) }
-                  _ { cx.bug(~"broken traversal in p_t_s_r") }
+                  _ { cx.bug("broken traversal in p_t_s_r") }
                 }
         }
         if b.real_binders.contains_key(p_id) {
-            cx.span_fatal(p.span, ~"duplicate binding identifier");
+            cx.span_fatal(p.span, "duplicate binding identifier");
         }
-        b.real_binders.insert(p_id,
-                              compose_sels(s, bind select(cx, _)));
+        b.real_binders.insert(p_id, compose_sels(s, bind select(cx, _)));
       }
       none. { }
     }
@@ -560,16 +554,15 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) {
               match_expr(e) {
                 alt e.node { expr_mac(mac) { fn_m(mac) } _ { none } }
               }
-              _ { cx.bug(~"broken traversal in p_t_s_r") }
+              _ { cx.bug("broken traversal in p_t_s_r") }
             }
     }
-    fn no_des(cx: &ext_ctxt, sp: &span, syn: &istr) -> ! {
-        cx.span_fatal(sp, ~"destructuring "
-                      + syn + ~" is not yet supported");
+    fn no_des(cx: &ext_ctxt, sp: &span, syn: &str) -> ! {
+        cx.span_fatal(sp, "destructuring " + syn + " is not yet supported");
     }
     alt mac.node {
-      ast::mac_ellipsis. { cx.span_fatal(mac.span, ~"misused `...`"); }
-      ast::mac_invoc(_, _, _) { no_des(cx, mac.span, ~"macro calls"); }
+      ast::mac_ellipsis. { cx.span_fatal(mac.span, "misused `...`"); }
+      ast::mac_invoc(_, _, _) { no_des(cx, mac.span, "macro calls"); }
       ast::mac_embed_type(ty) {
         alt ty.node {
           ast::ty_path(pth, _) {
@@ -583,13 +576,12 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) {
                         }
                 }
                 let final_step = bind select_pt_1(cx, _, select_pt_2);
-                b.real_binders.insert(
-                    id, compose_sels(s, final_step));
+                b.real_binders.insert(id, compose_sels(s, final_step));
               }
-              none. { no_des(cx, pth.span, ~"under `#<>`"); }
+              none. { no_des(cx, pth.span, "under `#<>`"); }
             }
           }
-          _ { no_des(cx, ty.span, ~"under `#<>`"); }
+          _ { no_des(cx, ty.span, "under `#<>`"); }
         }
       }
       ast::mac_embed_block(blk) {
@@ -604,10 +596,9 @@ fn p_t_s_r_mac(cx: &ext_ctxt, mac: &ast::mac, s: &selector, b: &binders) {
                     }
             }
             let final_step = bind select_pt_1(cx, _, select_pt_2);
-            b.real_binders.insert(id,
-                                  compose_sels(s, final_step));
+            b.real_binders.insert(id, compose_sels(s, final_step));
           }
-          none. { no_des(cx, blk.span, ~"under `#{}`"); }
+          none. { no_des(cx, blk.span, "under `#{}`"); }
         }
       }
     }
@@ -635,7 +626,7 @@ fn p_t_s_r_ellipses(cx: &ext_ctxt, repeat_me: @expr, offset: uint,
                   _ { none }
                 }
               }
-              _ { cx.bug(~"broken traversal in p_t_s_r") }
+              _ { cx.bug("broken traversal in p_t_s_r") }
             }
     }
     p_t_s_rec(cx, match_expr(repeat_me),
@@ -680,7 +671,7 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
                       _ { none }
                     }
                   }
-                  _ { cx.bug(~"broken traversal in p_t_s_r") }
+                  _ { cx.bug("broken traversal in p_t_s_r") }
                 }
         }
         p_t_s_rec(cx, match_expr(elts[idx]),
@@ -690,25 +681,25 @@ fn p_t_s_r_actual_vector(cx: &ext_ctxt, elts: [@expr], _repeat_after: bool,
 }
 
 fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
-                     _body: &option::t<istr>) -> base::macro_def {
+                     _body: &option::t<str>) -> base::macro_def {
     let args: [@ast::expr] =
         alt arg.node {
           ast::expr_vec(elts, _) { elts }
           _ {
             cx.span_fatal(sp,
-                          ~"#macro requires arguments of the form `[...]`.")
+                          "#macro requires arguments of the form `[...]`.")
           }
         };
 
-    let macro_name: option::t<istr> = none;
+    let macro_name: option::t<str> = none;
     let clauses: [@clause] = [];
     for arg: @expr in args {
         alt arg.node {
           expr_vec(elts, mut) {
             if vec::len(elts) != 2u {
                 cx.span_fatal((*arg).span,
-                              ~"extension clause must consist of [" +
-                                  ~"macro invocation, expansion body]");
+                              "extension clause must consist of [" +
+                                  "macro invocation, expansion body]");
             }
 
 
@@ -723,15 +714,15 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                           some(other_id) {
                             if id != other_id {
                                 cx.span_fatal(pth.span,
-                                              ~"macro name must be " +
-                                                  ~"consistent");
+                                              "macro name must be " +
+                                                  "consistent");
                             }
                           }
                         }
                       }
                       none. {
                         cx.span_fatal(pth.span,
-                                      ~"macro name must not be a path");
+                                      "macro name must not be a path");
                       }
                     }
                     clauses +=
@@ -744,14 +735,14 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
               }
               _ {
                 cx.span_fatal(elts[0u].span,
-                              ~"extension clause must" +
-                                  ~" start with a macro invocation.");
+                              "extension clause must" +
+                                  " start with a macro invocation.");
               }
             }
           }
           _ {
             cx.span_fatal((*arg).span,
-                          ~"extension must be [clause, " + ~" ...]");
+                          "extension must be [clause, " + " ...]");
           }
         }
     }
@@ -763,22 +754,22 @@ fn add_new_extension(cx: &ext_ctxt, sp: span, arg: @expr,
                some(id) { id }
                none. {
                  cx.span_fatal(sp,
-                               ~"macro definition must have " +
-                                   ~"at least one clause")
+                               "macro definition must have " +
+                                   "at least one clause")
                }
              },
          ext: normal(ext)};
 
     fn generic_extension(cx: &ext_ctxt, sp: span, arg: @expr,
-                         _body: &option::t<istr>,
-                         clauses: [@clause]) -> @expr {
+                         _body: &option::t<str>, clauses: [@clause]) ->
+       @expr {
         for c: @clause in clauses {
             alt use_selectors_to_bind(c.params, arg) {
               some(bindings) { ret transcribe(cx, bindings, c.body) }
               none. { cont; }
             }
         }
-        cx.span_fatal(sp, ~"no clauses match macro invocation");
+        cx.span_fatal(sp, "no clauses match macro invocation");
     }
 }
 
diff --git a/src/comp/syntax/parse/eval.rs b/src/comp/syntax/parse/eval.rs
index ee7c5a3d338..6535ecfe586 100644
--- a/src/comp/syntax/parse/eval.rs
+++ b/src/comp/syntax/parse/eval.rs
@@ -19,15 +19,14 @@ tag eval_mode { mode_depend; mode_parse; }
 type ctx =
     @{p: parser,
       mode: eval_mode,
-      mutable deps: [istr],
+      mutable deps: [str],
       sess: parser::parse_sess,
       mutable chpos: uint,
       mutable byte_pos: uint,
       cfg: ast::crate_cfg};
 
 fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive],
-                         prefix: &istr,
-                         view_items: &mutable [@ast::view_item],
+                         prefix: &str, view_items: &mutable [@ast::view_item],
                          items: &mutable [@ast::item]) {
     for sub_cdir: @ast::crate_directive in cdirs {
         eval_crate_directive(cx, sub_cdir, prefix, view_items, items);
@@ -35,34 +34,27 @@ fn eval_crate_directives(cx: ctx, cdirs: &[@ast::crate_directive],
 }
 
 fn eval_crate_directives_to_mod(cx: ctx, cdirs: &[@ast::crate_directive],
-                                prefix: &istr) -> ast::_mod {
+                                prefix: &str) -> ast::_mod {
     let view_items: [@ast::view_item] = [];
     let items: [@ast::item] = [];
     eval_crate_directives(cx, cdirs, prefix, view_items, items);
     ret {view_items: view_items, items: items};
 }
 
-fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &istr,
+fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &str,
                         view_items: &mutable [@ast::view_item],
                         items: &mutable [@ast::item]) {
     alt cdir.node {
       ast::cdir_src_mod(id, file_opt, attrs) {
-        let file_path = id + ~".rs";
-        alt file_opt {
-          some(f) {
-            file_path = f;
-          }
-          none. { }
-        }
-        let full_path = if std::fs::path_is_absolute(file_path) {
-            file_path
-        } else {
-            prefix + std::fs::path_sep() + file_path
-        };
+        let file_path = id + ".rs";
+        alt file_opt { some(f) { file_path = f; } none. { } }
+        let full_path =
+            if std::fs::path_is_absolute(file_path) {
+                file_path
+            } else { prefix + std::fs::path_sep() + file_path };
         if cx.mode == mode_depend { cx.deps += [full_path]; ret; }
         let p0 =
-            new_parser_from_file(cx.sess, cx.cfg,
-                                 full_path, cx.chpos,
+            new_parser_from_file(cx.sess, cx.cfg, full_path, cx.chpos,
                                  cx.byte_pos, SOURCE_FILE);
         let inner_attrs = parse_inner_attrs_and_next(p0);
         let mod_attrs = attrs + inner_attrs.inner;
@@ -79,18 +71,11 @@ fn eval_crate_directive(cx: ctx, cdir: @ast::crate_directive, prefix: &istr,
       }
       ast::cdir_dir_mod(id, dir_opt, cdirs, attrs) {
         let path = id;
-        alt dir_opt {
-          some(d) {
-            path = d;
-          }
-          none. { }
-        }
+        alt dir_opt { some(d) { path = d; } none. { } }
         let full_path =
             if std::fs::path_is_absolute(path) {
                 path
-            } else {
-            prefix + std::fs::path_sep() + path
-        };
+            } else { prefix + std::fs::path_sep() + path };
         let m0 = eval_crate_directives_to_mod(cx, cdirs, full_path);
         let i =
             @{ident: id,
diff --git a/src/comp/syntax/parse/lexer.rs b/src/comp/syntax/parse/lexer.rs
index e479377f3d7..f0d5bfeb729 100644
--- a/src/comp/syntax/parse/lexer.rs
+++ b/src/comp/syntax/parse/lexer.rs
@@ -19,29 +19,29 @@ type reader =
         fn next() -> char;
         fn init();
         fn bump();
-        fn get_str_from(uint) -> istr;
-        fn get_interner() -> @interner::interner<istr>;
+        fn get_str_from(uint) -> str;
+        fn get_interner() -> @interner::interner<str>;
         fn get_chpos() -> uint;
         fn get_byte_pos() -> uint;
         fn get_col() -> uint;
         fn get_filemap() -> codemap::filemap;
-        fn err(&istr);
+        fn err(&str);
     };
 
-fn new_reader(cm: &codemap::codemap, src: &istr, filemap: codemap::filemap,
-              itr: @interner::interner<istr>) -> reader {
+fn new_reader(cm: &codemap::codemap, src: &str, filemap: codemap::filemap,
+              itr: @interner::interner<str>) -> reader {
     obj reader(cm: codemap::codemap,
-               src: istr,
+               src: str,
                len: uint,
                mutable col: uint,
                mutable pos: uint,
                mutable ch: char,
                mutable chpos: uint,
-               mutable strs: [istr],
+               mutable strs: [str],
                fm: codemap::filemap,
-               itr: @interner::interner<istr>) {
+               itr: @interner::interner<str>) {
         fn is_eof() -> bool { ret ch == -1 as char; }
-        fn get_str_from(start: uint) -> istr {
+        fn get_str_from(start: uint) -> str {
             // I'm pretty skeptical about this subtraction. What if there's a
             // multi-byte character before the mark?
             ret str::slice(src, start - 1u, pos - 1u);
@@ -74,16 +74,14 @@ fn new_reader(cm: &codemap::codemap, src: &istr, filemap: codemap::filemap,
                 ch = next.ch;
             } else { ch = -1 as char; }
         }
-        fn get_interner() -> @interner::interner<istr> { ret itr; }
+        fn get_interner() -> @interner::interner<str> { ret itr; }
         fn get_col() -> uint { ret col; }
         fn get_filemap() -> codemap::filemap { ret fm; }
-        fn err(m: &istr) {
-            codemap::emit_error(
-                some(ast_util::mk_sp(chpos, chpos)),
-                m, cm);
+        fn err(m: &str) {
+            codemap::emit_error(some(ast_util::mk_sp(chpos, chpos)), m, cm);
         }
     }
-    let strs: [istr] = [];
+    let strs: [str] = [];
     let rd =
         reader(cm, src, str::byte_len(src), 0u, 0u, -1 as char,
                filemap.start_pos.ch, strs, filemap, itr);
@@ -148,9 +146,7 @@ fn consume_any_line_comment(rdr: &reader) {
 fn consume_block_comment(rdr: &reader) {
     let level: int = 1;
     while level > 0 {
-        if rdr.is_eof() {
-            rdr.err(~"unterminated block comment"); fail;
-        }
+        if rdr.is_eof() { rdr.err("unterminated block comment"); fail; }
         if rdr.curr() == '/' && rdr.next() == '*' {
             rdr.bump();
             rdr.bump();
@@ -168,15 +164,15 @@ fn consume_block_comment(rdr: &reader) {
     be consume_whitespace_and_comments(rdr);
 }
 
-fn digits_to_string(s: &istr) -> int {
+fn digits_to_string(s: &str) -> int {
     let accum_int: int = 0;
     for c: u8 in s { accum_int *= 10; accum_int += dec_digit_val(c as char); }
     ret accum_int;
 }
 
-fn scan_exponent(rdr: &reader) -> option::t<istr> {
+fn scan_exponent(rdr: &reader) -> option::t<str> {
     let c = rdr.curr();
-    let rslt = ~"";
+    let rslt = "";
     if c == 'e' || c == 'E' {
         rslt += str::unsafe_from_bytes([c as u8]);
         rdr.bump();
@@ -188,13 +184,13 @@ fn scan_exponent(rdr: &reader) -> option::t<istr> {
         let exponent = scan_dec_digits(rdr);
         if str::byte_len(exponent) > 0u {
             ret some(rslt + exponent);
-        } else { rdr.err(~"scan_exponent: bad fp literal"); fail; }
-    } else { ret none::<istr>; }
+        } else { rdr.err("scan_exponent: bad fp literal"); fail; }
+    } else { ret none::<str>; }
 }
 
-fn scan_dec_digits(rdr: &reader) -> istr {
+fn scan_dec_digits(rdr: &reader) -> str {
     let c = rdr.curr();
-    let rslt: istr = ~"";
+    let rslt: str = "";
     while is_dec_digit(c) || c == '_' {
         if c != '_' { rslt += str::unsafe_from_bytes([c as u8]); }
         rdr.bump();
@@ -205,7 +201,7 @@ fn scan_dec_digits(rdr: &reader) -> istr {
 
 fn scan_number(c: char, rdr: &reader) -> token::token {
     let accum_int = 0;
-    let dec_str: istr = ~"";
+    let dec_str: str = "";
     let is_dec_integer: bool = false;
     let n = rdr.next();
     if c == '0' && n == 'x' {
@@ -276,7 +272,7 @@ fn scan_number(c: char, rdr: &reader) -> token::token {
 
         rdr.bump();
         let dec_part = scan_dec_digits(rdr);
-        let float_str = dec_str + ~"." + dec_part;
+        let float_str = dec_str + "." + dec_part;
         c = rdr.curr();
         let exponent_str = scan_exponent(rdr);
         alt exponent_str { some(s) { float_str += s; } none. { } }
@@ -302,17 +298,15 @@ fn scan_number(c: char, rdr: &reader) -> token::token {
 
             }
         } else {
-            ret token::LIT_FLOAT(interner::intern::<istr>(
-                *rdr.get_interner(),
-                float_str));
+            ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(),
+                                                         float_str));
         }
     }
     let maybe_exponent = scan_exponent(rdr);
     alt maybe_exponent {
       some(s) {
-        ret token::LIT_FLOAT(interner::intern::<istr>(
-            *rdr.get_interner(),
-            dec_str + s));
+        ret token::LIT_FLOAT(interner::intern::<str>(*rdr.get_interner(),
+                                                     dec_str + s));
       }
       none. { ret token::LIT_INT(accum_int); }
     }
@@ -324,8 +318,7 @@ fn scan_numeric_escape(rdr: &reader, n_hex_digits: uint) -> char {
         let n = rdr.curr();
         rdr.bump();
         if !is_hex_digit(n) {
-            rdr.err(
-                    #fmt["illegal numeric character escape: %d", n as int]);
+            rdr.err(#fmt["illegal numeric character escape: %d", n as int]);
             fail;
         }
         accum_int *= 16;
@@ -344,7 +337,7 @@ fn next_token(rdr: &reader) -> {tok: token::token, chpos: uint, bpos: uint} {
 }
 
 fn next_token_inner(rdr: &reader) -> token::token {
-    let accum_str = ~"";
+    let accum_str = "";
     let c = rdr.curr();
     if is_alpha(c) || c == '_' {
         while is_alnum(c) || c == '_' {
@@ -352,11 +345,10 @@ fn next_token_inner(rdr: &reader) -> token::token {
             rdr.bump();
             c = rdr.curr();
         }
-        if str::eq(accum_str, ~"_") { ret token::UNDERSCORE; }
+        if str::eq(accum_str, "_") { ret token::UNDERSCORE; }
         let is_mod_name = c == ':' && rdr.next() == ':';
-        ret token::IDENT(interner::intern::<istr>(
-            *rdr.get_interner(),
-            accum_str), is_mod_name);
+        ret token::IDENT(interner::intern::<str>(*rdr.get_interner(),
+                                                 accum_str), is_mod_name);
     }
     if is_dec_digit(c) { ret scan_number(c, rdr); }
     fn binop(rdr: &reader, op: token::binop) -> token::token {
@@ -369,6 +361,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
     alt c {
 
 
+
       // One-byte tokens.
       '?' {
         rdr.bump();
@@ -408,6 +401,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
       }
 
 
+
       // Multi-byte tokens.
       '=' {
         rdr.bump();
@@ -468,15 +462,13 @@ fn next_token_inner(rdr: &reader) -> token::token {
               'u' { c2 = scan_numeric_escape(rdr, 4u); }
               'U' { c2 = scan_numeric_escape(rdr, 8u); }
               c2 {
-                rdr.err(
-                    #fmt["unknown character escape: %d",
-                                         c2 as int]);
+                rdr.err(#fmt["unknown character escape: %d", c2 as int]);
                 fail;
               }
             }
         }
         if rdr.curr() != '\'' {
-            rdr.err(~"unterminated character constant");
+            rdr.err("unterminated character constant");
             fail;
         }
         rdr.bump(); // advance curr past token
@@ -509,9 +501,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
                     str::push_char(accum_str, scan_numeric_escape(rdr, 8u));
                   }
                   c2 {
-                    rdr.err(
-                        #fmt["unknown string escape: %d",
-                                             c2 as int]);
+                    rdr.err(#fmt["unknown string escape: %d", c2 as int]);
                     fail;
                   }
                 }
@@ -520,9 +510,8 @@ fn next_token_inner(rdr: &reader) -> token::token {
             }
         }
         rdr.bump();
-        ret token::LIT_STR(interner::intern::<istr>(
-            *rdr.get_interner(),
-            accum_str));
+        ret token::LIT_STR(interner::intern::<str>(*rdr.get_interner(),
+                                                   accum_str));
       }
       '-' {
         if rdr.next() == '>' {
@@ -549,11 +538,7 @@ fn next_token_inner(rdr: &reader) -> token::token {
       '/' { ret binop(rdr, token::SLASH); }
       '^' { ret binop(rdr, token::CARET); }
       '%' { ret binop(rdr, token::PERCENT); }
-      c {
-        rdr.err(
-            #fmt["unkown start of token: %d", c as int]);
-        fail;
-      }
+      c { rdr.err(#fmt["unkown start of token: %d", c as int]); fail; }
     }
 }
 
@@ -564,10 +549,10 @@ tag cmnt_style {
     blank_line; // Just a manual blank line "\n\n", for layout
 }
 
-type cmnt = {style: cmnt_style, lines: [istr], pos: uint};
+type cmnt = {style: cmnt_style, lines: [str], pos: uint};
 
-fn read_to_eol(rdr: &reader) -> istr {
-    let val = ~"";
+fn read_to_eol(rdr: &reader) -> str {
+    let val = "";
     while rdr.curr() != '\n' && !rdr.is_eof() {
         str::push_char(val, rdr.curr());
         rdr.bump();
@@ -576,7 +561,7 @@ fn read_to_eol(rdr: &reader) -> istr {
     ret val;
 }
 
-fn read_one_line_comment(rdr: &reader) -> istr {
+fn read_one_line_comment(rdr: &reader) -> str {
     let val = read_to_eol(rdr);
     assert (val[0] == '/' as u8 && val[1] == '/' as u8);
     ret val;
@@ -594,7 +579,7 @@ fn consume_non_eol_whitespace(rdr: &reader) {
 
 fn push_blank_line_comment(rdr: &reader, comments: &mutable [cmnt]) {
     log ">>> blank-line comment";
-    let v: [istr] = [];
+    let v: [str] = [];
     comments += [{style: blank_line, lines: v, pos: rdr.get_chpos()}];
 }
 
@@ -611,7 +596,7 @@ fn consume_whitespace_counting_blank_lines(rdr: &reader,
 fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt {
     log ">>> line comments";
     let p = rdr.get_chpos();
-    let lines: [istr] = [];
+    let lines: [str] = [];
     while rdr.curr() == '/' && rdr.next() == '/' {
         let line = read_one_line_comment(rdr);
         log line;
@@ -624,52 +609,52 @@ fn read_line_comments(rdr: &reader, code_to_the_left: bool) -> cmnt {
          pos: p};
 }
 
-fn all_whitespace(s: &istr, begin: uint, end: uint) -> bool {
+fn all_whitespace(s: &str, begin: uint, end: uint) -> bool {
     let i: uint = begin;
     while i != end { if !is_whitespace(s[i] as char) { ret false; } i += 1u; }
     ret true;
 }
 
-fn trim_whitespace_prefix_and_push_line(lines: &mutable [istr], s: &istr,
+fn trim_whitespace_prefix_and_push_line(lines: &mutable [str], s: &str,
                                         col: uint) {
     let s1;
     if all_whitespace(s, 0u, col) {
         if col < str::byte_len(s) {
             s1 = str::slice(s, col, str::byte_len(s));
-        } else { s1 = ~""; }
+        } else { s1 = ""; }
     } else { s1 = s; }
-    log ~"pushing line: " + s1;
+    log "pushing line: " + s1;
     lines += [s1];
 }
 
 fn read_block_comment(rdr: &reader, code_to_the_left: bool) -> cmnt {
     log ">>> block comment";
     let p = rdr.get_chpos();
-    let lines: [istr] = [];
+    let lines: [str] = [];
     let col: uint = rdr.get_col();
     rdr.bump();
     rdr.bump();
-    let curr_line = ~"/*";
+    let curr_line = "/*";
     let level: int = 1;
     while level > 0 {
         log #fmt["=== block comment level %d", level];
-        if rdr.is_eof() { rdr.err(~"unterminated block comment"); fail; }
+        if rdr.is_eof() { rdr.err("unterminated block comment"); fail; }
         if rdr.curr() == '\n' {
             trim_whitespace_prefix_and_push_line(lines, curr_line, col);
-            curr_line = ~"";
+            curr_line = "";
             rdr.bump();
         } else {
             str::push_char(curr_line, rdr.curr());
             if rdr.curr() == '/' && rdr.next() == '*' {
                 rdr.bump();
                 rdr.bump();
-                curr_line += ~"*";
+                curr_line += "*";
                 level += 1;
             } else {
                 if rdr.curr() == '*' && rdr.next() == '/' {
                     rdr.bump();
                     rdr.bump();
-                    curr_line += ~"/";
+                    curr_line += "/";
                     level -= 1;
                 } else { rdr.bump(); }
             }
@@ -717,16 +702,14 @@ fn is_lit(t: &token::token) -> bool {
         }
 }
 
-type lit = {lit: istr, pos: uint};
+type lit = {lit: str, pos: uint};
 
-fn gather_comments_and_literals(cm: &codemap::codemap, path: &istr,
+fn gather_comments_and_literals(cm: &codemap::codemap, path: &str,
                                 srdr: io::reader) ->
    {cmnts: [cmnt], lits: [lit]} {
     let src = str::unsafe_from_bytes(srdr.read_whole_stream());
-    let itr = @interner::mk::<istr>(str::hash, str::eq);
-    let rdr = new_reader(cm, src,
-                         codemap::new_filemap(
-                             path, 0u, 0u), itr);
+    let itr = @interner::mk::<str>(str::hash, str::eq);
+    let rdr = new_reader(cm, src, codemap::new_filemap(path, 0u, 0u), itr);
     let comments: [cmnt] = [];
     let literals: [lit] = [];
     let first_read: bool = true;
@@ -748,7 +731,7 @@ fn gather_comments_and_literals(cm: &codemap::codemap, path: &istr,
         if is_lit(tok.tok) {
             literals += [{lit: rdr.get_str_from(tok.bpos), pos: tok.chpos}];
         }
-        log ~"tok: " + token::to_str(rdr, tok.tok);
+        log "tok: " + token::to_str(rdr, tok.tok);
         first_read = false;
     }
     ret {cmnts: comments, lits: literals};
diff --git a/src/comp/syntax/parse/parser.rs b/src/comp/syntax/parse/parser.rs
index 7be1d78d730..6c40115ecda 100644
--- a/src/comp/syntax/parse/parser.rs
+++ b/src/comp/syntax/parse/parser.rs
@@ -37,8 +37,8 @@ type parser =
         fn bump();
         fn swap(token::token, uint, uint);
         fn look_ahead(uint) -> token::token;
-        fn fatal(&istr) -> ! ;
-        fn warn(&istr);
+        fn fatal(&str) -> ! ;
+        fn warn(&str);
         fn restrict(restriction);
         fn get_restriction() -> restriction;
         fn get_file_type() -> file_type;
@@ -49,22 +49,21 @@ type parser =
         fn get_last_lo_pos() -> uint;
         fn get_last_hi_pos() -> uint;
         fn get_prec_table() -> @[op_spec];
-        fn get_str(token::str_num) -> istr;
+        fn get_str(token::str_num) -> str;
         fn get_reader() -> lexer::reader;
         fn get_filemap() -> codemap::filemap;
-        fn get_bad_expr_words() -> hashmap<istr, ()>;
+        fn get_bad_expr_words() -> hashmap<str, ()>;
         fn get_chpos() -> uint;
         fn get_byte_pos() -> uint;
         fn get_id() -> node_id;
         fn get_sess() -> parse_sess;
     };
 
-fn new_parser_from_file(sess: parse_sess, cfg: &ast::crate_cfg, path: &istr,
+fn new_parser_from_file(sess: parse_sess, cfg: &ast::crate_cfg, path: &str,
                         chpos: uint, byte_pos: uint, ftype: file_type) ->
    parser {
     let src = io::read_whole_file_str(path);
-    let filemap = codemap::new_filemap(
-        path, chpos, byte_pos);
+    let filemap = codemap::new_filemap(path, chpos, byte_pos);
     sess.cm.files += [filemap];
     let itr = @interner::mk(str::hash, str::eq);
     let rdr = lexer::new_reader(sess.cm, src, filemap, itr);
@@ -83,7 +82,7 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader,
                      mutable restr: restriction,
                      rdr: lexer::reader,
                      precs: @[op_spec],
-                     bad_words: hashmap<istr, ()>) {
+                     bad_words: hashmap<str, ()>) {
         fn peek() -> token::token { ret tok; }
         fn bump() {
             last_tok_span = tok_span;
@@ -109,14 +108,12 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader,
             }
             ret buffer[distance - 1u].tok;
         }
-        fn fatal(m: &istr) -> ! {
-            codemap::emit_error(some(self.get_span()),
-                                m, sess.cm);
+        fn fatal(m: &str) -> ! {
+            codemap::emit_error(some(self.get_span()), m, sess.cm);
             fail;
         }
-        fn warn(m: &istr) {
-            codemap::emit_warning(some(self.get_span()),
-                                  m, sess.cm);
+        fn warn(m: &str) {
+            codemap::emit_warning(some(self.get_span()), m, sess.cm);
         }
         fn restrict(r: restriction) { restr = r; }
         fn get_restriction() -> restriction { ret restr; }
@@ -128,12 +125,12 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader,
         fn get_file_type() -> file_type { ret ftype; }
         fn get_cfg() -> ast::crate_cfg { ret cfg; }
         fn get_prec_table() -> @[op_spec] { ret precs; }
-        fn get_str(i: token::str_num) -> istr {
+        fn get_str(i: token::str_num) -> str {
             ret interner::get(*rdr.get_interner(), i);
         }
         fn get_reader() -> lexer::reader { ret rdr; }
         fn get_filemap() -> codemap::filemap { ret rdr.get_filemap(); }
-        fn get_bad_expr_words() -> hashmap<istr, ()> { ret bad_words; }
+        fn get_bad_expr_words() -> hashmap<str, ()> { ret bad_words; }
         fn get_chpos() -> uint { ret rdr.get_chpos(); }
         fn get_byte_pos() -> uint { ret rdr.get_byte_pos(); }
         fn get_id() -> node_id { ret next_node_id(sess); }
@@ -148,48 +145,48 @@ fn new_parser(sess: parse_sess, cfg: &ast::crate_cfg, rdr: lexer::reader,
 // These are the words that shouldn't be allowed as value identifiers,
 // because, if used at the start of a line, they will cause the line to be
 // interpreted as a specific kind of statement, which would be confusing.
-fn bad_expr_word_table() -> hashmap<istr, ()> {
+fn bad_expr_word_table() -> hashmap<str, ()> {
     let words = new_str_hash();
-    words.insert(~"mod", ());
-    words.insert(~"if", ());
-    words.insert(~"else", ());
-    words.insert(~"while", ());
-    words.insert(~"do", ());
-    words.insert(~"alt", ());
-    words.insert(~"for", ());
-    words.insert(~"each", ());
-    words.insert(~"break", ());
-    words.insert(~"cont", ());
-    words.insert(~"put", ());
-    words.insert(~"ret", ());
-    words.insert(~"be", ());
-    words.insert(~"fail", ());
-    words.insert(~"type", ());
-    words.insert(~"resource", ());
-    words.insert(~"check", ());
-    words.insert(~"assert", ());
-    words.insert(~"claim", ());
-    words.insert(~"prove", ());
-    words.insert(~"native", ());
-    words.insert(~"fn", ());
-    words.insert(~"lambda", ());
-    words.insert(~"pure", ());
-    words.insert(~"iter", ());
-    words.insert(~"block", ());
-    words.insert(~"import", ());
-    words.insert(~"export", ());
-    words.insert(~"let", ());
-    words.insert(~"const", ());
-    words.insert(~"log", ());
-    words.insert(~"log_err", ());
-    words.insert(~"tag", ());
-    words.insert(~"obj", ());
-    words.insert(~"copy", ());
+    words.insert("mod", ());
+    words.insert("if", ());
+    words.insert("else", ());
+    words.insert("while", ());
+    words.insert("do", ());
+    words.insert("alt", ());
+    words.insert("for", ());
+    words.insert("each", ());
+    words.insert("break", ());
+    words.insert("cont", ());
+    words.insert("put", ());
+    words.insert("ret", ());
+    words.insert("be", ());
+    words.insert("fail", ());
+    words.insert("type", ());
+    words.insert("resource", ());
+    words.insert("check", ());
+    words.insert("assert", ());
+    words.insert("claim", ());
+    words.insert("prove", ());
+    words.insert("native", ());
+    words.insert("fn", ());
+    words.insert("lambda", ());
+    words.insert("pure", ());
+    words.insert("iter", ());
+    words.insert("block", ());
+    words.insert("import", ());
+    words.insert("export", ());
+    words.insert("let", ());
+    words.insert("const", ());
+    words.insert("log", ());
+    words.insert("log_err", ());
+    words.insert("tag", ());
+    words.insert("obj", ());
+    words.insert("copy", ());
     ret words;
 }
 
 fn unexpected(p: &parser, t: token::token) -> ! {
-    let s: istr = ~"unexpected token: ";
+    let s: str = "unexpected token: ";
     s += token::to_str(p.get_reader(), t);
     p.fatal(s);
 }
@@ -198,9 +195,9 @@ fn expect(p: &parser, t: token::token) {
     if p.peek() == t {
         p.bump();
     } else {
-        let s: istr = ~"expecting ";
+        let s: str = "expecting ";
         s += token::to_str(p.get_reader(), t);
-        s += ~", found ";
+        s += ", found ";
         s += token::to_str(p.get_reader(), p.peek());
         p.fatal(s);
     }
@@ -214,9 +211,9 @@ fn expect_gt(p: &parser) {
     } else if p.peek() == token::BINOP(token::ASR) {
         p.swap(token::BINOP(token::LSR), p.get_lo_pos() + 1u, p.get_hi_pos());
     } else {
-        let s: istr = ~"expecting ";
+        let s: str = "expecting ";
         s += token::to_str(p.get_reader(), token::GT);
-        s += ~", found ";
+        s += ", found ";
         s += token::to_str(p.get_reader(), p.peek());
         p.fatal(s);
     }
@@ -228,11 +225,8 @@ fn spanned<@T>(lo: uint, hi: uint, node: &T) -> spanned<T> {
 
 fn parse_ident(p: &parser) -> ast::ident {
     alt p.peek() {
-      token::IDENT(i, _) {
-        p.bump();
-        ret p.get_str(i);
-      }
-      _ { p.fatal(~"expecting ident"); }
+      token::IDENT(i, _) { p.bump(); ret p.get_str(i); }
+      _ { p.fatal("expecting ident"); }
     }
 }
 
@@ -245,14 +239,14 @@ fn eat(p: &parser, tok: &token::token) -> bool {
     ret if p.peek() == tok { p.bump(); true } else { false };
 }
 
-fn is_word(p: &parser, word: &istr) -> bool {
+fn is_word(p: &parser, word: &str) -> bool {
     ret alt p.peek() {
           token::IDENT(sid, false) { str::eq(word, p.get_str(sid)) }
           _ { false }
         };
 }
 
-fn eat_word(p: &parser, word: &istr) -> bool {
+fn eat_word(p: &parser, word: &str) -> bool {
     alt p.peek() {
       token::IDENT(sid, false) {
         if str::eq(word, p.get_str(sid)) {
@@ -264,10 +258,10 @@ fn eat_word(p: &parser, word: &istr) -> bool {
     }
 }
 
-fn expect_word(p: &parser, word: &istr) {
+fn expect_word(p: &parser, word: &str) {
     if !eat_word(p, word) {
-        p.fatal(~"expecting " + word + ~", found " +
-                token::to_str(p.get_reader(), p.peek()));
+        p.fatal("expecting " + word + ", found " +
+                    token::to_str(p.get_reader(), p.peek()));
     }
 }
 
@@ -276,7 +270,7 @@ fn check_bad_word(p: &parser) {
       token::IDENT(sid, false) {
         let w = p.get_str(sid);
         if p.get_bad_expr_words().contains_key(w) {
-            p.fatal(~"found " + w + ~" in expression position");
+            p.fatal("found " + w + " in expression position");
         }
       }
       _ { }
@@ -294,7 +288,7 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ {
         let mode = ast::val;
         if p.peek() == token::BINOP(token::AND) {
             p.bump();
-            mode = ast::alias(eat_word(p, ~"mutable"));
+            mode = ast::alias(eat_word(p, "mutable"));
         }
         let t = parse_ty(p, false);
         ret spanned(lo, t.span.hi, {mode: mode, ty: t});
@@ -323,11 +317,11 @@ fn parse_ty_fn(proto: ast::proto, p: &parser) -> ast::ty_ {
 }
 
 fn parse_proto(p: &parser) -> ast::proto {
-    if eat_word(p, ~"iter") {
+    if eat_word(p, "iter") {
         ret ast::proto_iter;
-    } else if eat_word(p, ~"fn") {
+    } else if eat_word(p, "fn") {
         ret ast::proto_fn;
-    } else if eat_word(p, ~"block") {
+    } else if eat_word(p, "block") {
         ret ast::proto_block;
     } else { unexpected(p, p.peek()); }
 }
@@ -377,8 +371,7 @@ fn parse_ty_field(p: &parser) -> ast::ty_field {
 fn ident_index(p: &parser, args: &[ast::arg], i: &ast::ident) -> uint {
     let j = 0u;
     for a: ast::arg in args { if a.ident == i { ret j; } j += 1u; }
-    p.fatal(~"Unbound variable " +
-            i + ~" in constraint arg");
+    p.fatal("Unbound variable " + i + " in constraint arg");
 }
 
 fn parse_type_constr_arg(p: &parser) -> @ast::ty_constr_arg {
@@ -467,7 +460,7 @@ fn parse_ty_postfix(orig_t: ast::ty_, p: &parser, colons_before_params: bool)
                                            idents: pth.node.idents,
                                            types: seq}), ann));
       }
-      _ { p.fatal(~"type parameter instantiation only allowed for paths"); }
+      _ { p.fatal("type parameter instantiation only allowed for paths"); }
     }
 }
 
@@ -484,43 +477,43 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty {
     let t: ast::ty_;
     // FIXME: do something with this
 
-    if eat_word(p, ~"bool") {
+    if eat_word(p, "bool") {
         t = ast::ty_bool;
-    } else if eat_word(p, ~"int") {
+    } else if eat_word(p, "int") {
         t = ast::ty_int;
-    } else if eat_word(p, ~"uint") {
+    } else if eat_word(p, "uint") {
         t = ast::ty_uint;
-    } else if eat_word(p, ~"float") {
+    } else if eat_word(p, "float") {
         t = ast::ty_float;
-    } else if eat_word(p, ~"str") {
+    } else if eat_word(p, "str") {
         t = ast::ty_istr;
-    } else if eat_word(p, ~"istr") {
+    } else if eat_word(p, "istr") {
         t = ast::ty_istr;
-    } else if eat_word(p, ~"char") {
+    } else if eat_word(p, "char") {
         t = ast::ty_char;
         /*
             } else if (eat_word(p, "task")) {
                 t = ast::ty_task;
         */
-    } else if eat_word(p, ~"i8") {
+    } else if eat_word(p, "i8") {
         t = ast::ty_machine(ast::ty_i8);
-    } else if eat_word(p, ~"i16") {
+    } else if eat_word(p, "i16") {
         t = ast::ty_machine(ast::ty_i16);
-    } else if eat_word(p, ~"i32") {
+    } else if eat_word(p, "i32") {
         t = ast::ty_machine(ast::ty_i32);
-    } else if eat_word(p, ~"i64") {
+    } else if eat_word(p, "i64") {
         t = ast::ty_machine(ast::ty_i64);
-    } else if eat_word(p, ~"u8") {
+    } else if eat_word(p, "u8") {
         t = ast::ty_machine(ast::ty_u8);
-    } else if eat_word(p, ~"u16") {
+    } else if eat_word(p, "u16") {
         t = ast::ty_machine(ast::ty_u16);
-    } else if eat_word(p, ~"u32") {
+    } else if eat_word(p, "u32") {
         t = ast::ty_machine(ast::ty_u32);
-    } else if eat_word(p, ~"u64") {
+    } else if eat_word(p, "u64") {
         t = ast::ty_machine(ast::ty_u64);
-    } else if eat_word(p, ~"f32") {
+    } else if eat_word(p, "f32") {
         t = ast::ty_machine(ast::ty_f32);
-    } else if eat_word(p, ~"f64") {
+    } else if eat_word(p, "f64") {
         t = ast::ty_machine(ast::ty_f64);
     } else if p.peek() == token::LPAREN {
         p.bump();
@@ -567,19 +560,19 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty {
         t = ast::ty_vec(parse_mt(p));
         hi = p.get_hi_pos();
         expect(p, token::RBRACKET);
-    } else if eat_word(p, ~"fn") {
+    } else if eat_word(p, "fn") {
         t = parse_ty_fn(ast::proto_fn, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if eat_word(p, ~"block") {
+    } else if eat_word(p, "block") {
         t = parse_ty_fn(ast::proto_block, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if eat_word(p, ~"iter") {
+    } else if eat_word(p, "iter") {
         t = parse_ty_fn(ast::proto_iter, p);
         alt t { ast::ty_fn(_, _, out, _, _) { hi = out.span.hi; } }
-    } else if eat_word(p, ~"obj") {
+    } else if eat_word(p, "obj") {
         t = parse_ty_obj(p, hi);
-    } else if eat_word(p, ~"mutable") {
-        p.warn(~"ignoring deprecated 'mutable' type constructor");
+    } else if eat_word(p, "mutable") {
+        p.warn("ignoring deprecated 'mutable' type constructor");
         let typ = parse_ty(p, false);
         t = typ.node;
         hi = typ.span.hi;
@@ -587,13 +580,13 @@ fn parse_ty(p: &parser, colons_before_params: bool) -> @ast::ty {
         let path = parse_path(p);
         t = ast::ty_path(path, p.get_id());
         hi = path.span.hi;
-    } else { p.fatal(~"expecting type"); }
+    } else { p.fatal("expecting type"); }
     ret parse_ty_postfix(t, p, colons_before_params);
 }
 
 fn parse_arg_mode(p: &parser) -> ast::mode {
     if eat(p, token::BINOP(token::AND)) {
-        ast::alias(eat_word(p, ~"mutable"))
+        ast::alias(eat_word(p, "mutable"))
     } else if eat(p, token::BINOP(token::MINUS)) {
         ast::move
     } else { ast::val }
@@ -685,9 +678,9 @@ fn parse_seq<T>(bra: token::token, ket: token::token,
 fn parse_lit(p: &parser) -> ast::lit {
     let sp = p.get_span();
     let lit: ast::lit_ = ast::lit_nil;
-    if eat_word(p, ~"true") {
+    if eat_word(p, "true") {
         lit = ast::lit_bool(true);
-    } else if eat_word(p, ~"false") {
+    } else if eat_word(p, "false") {
         lit = ast::lit_bool(false);
     } else {
         alt p.peek() {
@@ -706,10 +699,7 @@ fn parse_lit(p: &parser) -> ast::lit {
             lit = ast::lit_mach_float(tm, p.get_str(s));
           }
           token::LIT_CHAR(c) { p.bump(); lit = ast::lit_char(c); }
-          token::LIT_STR(s) {
-            p.bump();
-            lit = ast::lit_str(p.get_str(s));
-          }
+          token::LIT_STR(s) { p.bump(); lit = ast::lit_str(p.get_str(s)); }
           token::LPAREN. {
             p.bump();
             expect(p, token::RPAREN);
@@ -777,7 +767,7 @@ fn parse_path_and_ty_param_substs(p: &parser) -> ast::path {
 }
 
 fn parse_mutability(p: &parser) -> ast::mutability {
-    if eat_word(p, ~"mutable") {
+    if eat_word(p, "mutable") {
         if p.peek() == token::QUES { p.bump(); ret ast::maybe_mut; }
         ret ast::mut;
     }
@@ -825,12 +815,12 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         } else { ret mk_expr(p, lo, hi, ast::expr_tup(es)); }
     } else if p.peek() == token::LBRACE {
         p.bump();
-        if is_word(p, ~"mutable") ||
+        if is_word(p, "mutable") ||
                is_plain_ident(p) && p.look_ahead(1u) == token::COLON {
             let fields = [parse_field(p, token::COLON)];
             let base = none;
             while p.peek() != token::RBRACE {
-                if eat_word(p, ~"with") { base = some(parse_expr(p)); break; }
+                if eat_word(p, "with") { base = some(parse_expr(p)); break; }
                 expect(p, token::COMMA);
                 fields += [parse_field(p, token::COLON)];
             }
@@ -843,27 +833,27 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
             let blk = parse_block_tail(p, lo, ast::checked);
             ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk));
         }
-    } else if eat_word(p, ~"if") {
+    } else if eat_word(p, "if") {
         ret parse_if_expr(p);
-    } else if eat_word(p, ~"for") {
+    } else if eat_word(p, "for") {
         ret parse_for_expr(p);
-    } else if eat_word(p, ~"while") {
+    } else if eat_word(p, "while") {
         ret parse_while_expr(p);
-    } else if eat_word(p, ~"do") {
+    } else if eat_word(p, "do") {
         ret parse_do_while_expr(p);
-    } else if eat_word(p, ~"alt") {
+    } else if eat_word(p, "alt") {
         ret parse_alt_expr(p);
         /*
             } else if (eat_word(p, "spawn")) {
                 ret parse_spawn_expr(p);
         */
-    } else if eat_word(p, ~"fn") {
+    } else if eat_word(p, "fn") {
         ret parse_fn_expr(p, ast::proto_fn);
-    } else if eat_word(p, ~"block") {
+    } else if eat_word(p, "block") {
         ret parse_fn_expr(p, ast::proto_block);
-    } else if eat_word(p, ~"lambda") {
+    } else if eat_word(p, "lambda") {
         ret parse_fn_expr(p, ast::proto_closure);
-    } else if eat_word(p, ~"unchecked") {
+    } else if eat_word(p, "unchecked") {
         expect(p, token::LBRACE);
         let blk = parse_block_tail(p, lo, ast::unchecked);
         ret mk_expr(p, blk.span.lo, blk.span.hi, ast::expr_block(blk));
@@ -894,14 +884,12 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
           token::LIT_STR(s) {
             let sp = p.get_span();
             p.bump();
-            let lit =
-                @{node: ast::lit_str(p.get_str(s)),
-                  span: sp};
+            let lit = @{node: ast::lit_str(p.get_str(s)), span: sp};
             ex = ast::expr_lit(lit);
           }
           _ { ex = ast::expr_uniq(parse_expr(p)); }
         }
-    } else if eat_word(p, ~"obj") {
+    } else if eat_word(p, "obj") {
         // Anonymous object
 
         // Only make people type () if they're actually adding new fields
@@ -916,7 +904,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let inner_obj: option::t<@ast::expr> = none;
         expect(p, token::LBRACE);
         while p.peek() != token::RBRACE {
-            if eat_word(p, ~"with") {
+            if eat_word(p, "with") {
                 inner_obj = some(parse_expr(p));
             } else { meths += [parse_method(p)]; }
         }
@@ -930,7 +918,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         // "spanned".
         let ob = {fields: fields, methods: meths, inner_obj: inner_obj};
         ex = ast::expr_anon_obj(ob);
-    } else if eat_word(p, ~"bind") {
+    } else if eat_word(p, "bind") {
         let e = parse_expr_res(p, RESTRICT_NO_CALL_EXPRS);
         fn parse_expr_opt(p: &parser) -> option::t<@ast::expr> {
             alt p.peek() {
@@ -947,25 +935,25 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let ex_ext = parse_syntax_ext(p);
         hi = ex_ext.span.hi;
         ex = ex_ext.node;
-    } else if eat_word(p, ~"fail") {
+    } else if eat_word(p, "fail") {
         if can_begin_expr(p.peek()) {
             let e = parse_expr(p);
             hi = e.span.hi;
             ex = ast::expr_fail(some(e));
         } else { ex = ast::expr_fail(none); }
-    } else if eat_word(p, ~"log") {
+    } else if eat_word(p, "log") {
         let e = parse_expr(p);
         ex = ast::expr_log(1, e);
         hi = e.span.hi;
-    } else if eat_word(p, ~"log_err") {
+    } else if eat_word(p, "log_err") {
         let e = parse_expr(p);
         ex = ast::expr_log(0, e);
         hi = e.span.hi;
-    } else if eat_word(p, ~"assert") {
+    } else if eat_word(p, "assert") {
         let e = parse_expr(p);
         ex = ast::expr_assert(e);
         hi = e.span.hi;
-    } else if eat_word(p, ~"check") {
+    } else if eat_word(p, "check") {
         /* Should be a predicate (pure boolean function) applied to
            arguments that are all either slot variables or literals.
            but the typechecker enforces that. */
@@ -973,7 +961,7 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let e = parse_expr(p);
         hi = e.span.hi;
         ex = ast::expr_check(ast::checked, e);
-    } else if eat_word(p, ~"claim") {
+    } else if eat_word(p, "claim") {
         /* Same rules as check, except that if check-claims
          is enabled (a command-line flag), then the parser turns
         claims into check */
@@ -981,19 +969,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         let e = parse_expr(p);
         hi = e.span.hi;
         ex = ast::expr_check(ast::unchecked, e);
-    } else if eat_word(p, ~"ret") {
+    } else if eat_word(p, "ret") {
         if can_begin_expr(p.peek()) {
             let e = parse_expr(p);
             hi = e.span.hi;
             ex = ast::expr_ret(some(e));
         } else { ex = ast::expr_ret(none); }
-    } else if eat_word(p, ~"break") {
+    } else if eat_word(p, "break") {
         ex = ast::expr_break;
         hi = p.get_hi_pos();
-    } else if eat_word(p, ~"cont") {
+    } else if eat_word(p, "cont") {
         ex = ast::expr_cont;
         hi = p.get_hi_pos();
-    } else if eat_word(p, ~"put") {
+    } else if eat_word(p, "put") {
         alt p.peek() {
           token::SEMI. { ex = ast::expr_put(none); }
           _ {
@@ -1002,19 +990,19 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
             ex = ast::expr_put(some(e));
           }
         }
-    } else if eat_word(p, ~"be") {
+    } else if eat_word(p, "be") {
         let e = parse_expr(p);
 
         // FIXME: Is this the right place for this check?
         if /*check*/ast_util::is_call_expr(e) {
             hi = e.span.hi;
             ex = ast::expr_be(e);
-        } else { p.fatal(~"Non-call expression in tail call"); }
-    } else if eat_word(p, ~"copy") {
+        } else { p.fatal("Non-call expression in tail call"); }
+    } else if eat_word(p, "copy") {
         let e = parse_expr(p);
         ex = ast::expr_copy(e);
         hi = e.span.hi;
-    } else if eat_word(p, ~"self") {
+    } else if eat_word(p, "self") {
         expect(p, token::DOT);
         // The rest is a call expression.
         let f: @ast::expr = parse_self_method(p);
@@ -1024,8 +1012,8 @@ fn parse_bottom_expr(p: &parser) -> @ast::expr {
         hi = es.span.hi;
         ex = ast::expr_call(f, es.node);
     } else if p.peek() == token::MOD_SEP ||
-                  is_ident(p.peek()) && !is_word(p, ~"true") &&
-                      !is_word(p, ~"false") {
+                  is_ident(p.peek()) && !is_word(p, "true") &&
+                      !is_word(p, "false") {
         check_bad_word(p);
         let pth = parse_path_and_ty_param_substs(p);
         hi = pth.span.hi;
@@ -1047,7 +1035,7 @@ fn parse_syntax_ext(p: &parser) -> @ast::expr {
 fn parse_syntax_ext_naked(p: &parser, lo: uint) -> @ast::expr {
     let pth = parse_path(p);
     if vec::len(pth.node.idents) == 0u {
-        p.fatal(~"expected a syntax expander name");
+        p.fatal("expected a syntax expander name");
     }
     //temporary for a backwards-compatible cycle:
     let es =
@@ -1105,9 +1093,7 @@ fn parse_dot_or_call_expr_with(p: &parser, e: @ast::expr) -> @ast::expr {
               token::IDENT(i, _) {
                 hi = p.get_hi_pos();
                 p.bump();
-                e = mk_expr(p, lo, hi,
-                            ast::expr_field(
-                                e, p.get_str(i)));
+                e = mk_expr(p, lo, hi, ast::expr_field(e, p.get_str(i)));
               }
               t { unexpected(p, t); }
             }
@@ -1119,8 +1105,8 @@ fn parse_dot_or_call_expr_with(p: &parser, e: @ast::expr) -> @ast::expr {
 }
 
 fn parse_prefix_expr(p: &parser) -> @ast::expr {
-    if eat_word(p, ~"mutable") {
-        p.warn(~"ignoring deprecated 'mutable' prefix operator");
+    if eat_word(p, "mutable") {
+        p.warn("ignoring deprecated 'mutable' prefix operator");
     }
     let lo = p.get_lo_pos();
     let hi = p.get_hi_pos();
@@ -1223,7 +1209,7 @@ fn parse_more_binops(p: &parser, lhs: @ast::expr, min_prec: int) ->
             ret parse_more_binops(p, bin, min_prec);
         }
     }
-    if as_prec > min_prec && eat_word(p, ~"as") {
+    if as_prec > min_prec && eat_word(p, "as") {
         let rhs = parse_ty(p, true);
         let _as =
             mk_expr(p, lhs.span.lo, rhs.span.hi, ast::expr_cast(lhs, rhs));
@@ -1286,7 +1272,7 @@ fn parse_if_expr_1(p: &parser) ->
     let thn = parse_block(p);
     let els: option::t<@ast::expr> = none;
     let hi = thn.span.hi;
-    if eat_word(p, ~"else") {
+    if eat_word(p, "else") {
         let elexpr = parse_else_expr(p);
         els = some(elexpr);
         hi = elexpr.span.hi;
@@ -1295,7 +1281,7 @@ fn parse_if_expr_1(p: &parser) ->
 }
 
 fn parse_if_expr(p: &parser) -> @ast::expr {
-    if eat_word(p, ~"check") {
+    if eat_word(p, "check") {
         let q = parse_if_expr_1(p);
         ret mk_expr(p, q.lo, q.hi, ast::expr_if_check(q.cond, q.then, q.els));
     } else {
@@ -1321,7 +1307,7 @@ fn parse_fn_block_expr(p: &parser) -> @ast::expr {
 }
 
 fn parse_else_expr(p: &parser) -> @ast::expr {
-    if eat_word(p, ~"if") {
+    if eat_word(p, "if") {
         ret parse_if_expr(p);
     } else {
         let blk = parse_block(p);
@@ -1331,9 +1317,9 @@ fn parse_else_expr(p: &parser) -> @ast::expr {
 
 fn parse_for_expr(p: &parser) -> @ast::expr {
     let lo = p.get_last_lo_pos();
-    let is_each = eat_word(p, ~"each");
+    let is_each = eat_word(p, "each");
     let decl = parse_local(p, false);
-    expect_word(p, ~"in");
+    expect_word(p, "in");
     let seq = parse_expr(p);
     let body = parse_block(p);
     let hi = body.span.hi;
@@ -1353,7 +1339,7 @@ fn parse_while_expr(p: &parser) -> @ast::expr {
 fn parse_do_while_expr(p: &parser) -> @ast::expr {
     let lo = p.get_last_lo_pos();
     let body = parse_block(p);
-    expect_word(p, ~"while");
+    expect_word(p, "while");
     let cond = parse_expr(p);
     let hi = cond.span.hi;
     ret mk_expr(p, lo, hi, ast::expr_do_while(body, cond));
@@ -1367,9 +1353,7 @@ fn parse_alt_expr(p: &parser) -> @ast::expr {
     while p.peek() != token::RBRACE {
         let pats = parse_pats(p);
         let guard = none;
-        if eat_word(p, ~"when") {
-            guard = some(parse_expr(p));
-        }
+        if eat_word(p, "when") { guard = some(parse_expr(p)); }
         let blk = parse_block(p);
         arms += [{pats: pats, guard: guard, body: blk}];
     }
@@ -1402,6 +1386,7 @@ fn parse_initializer(p: &parser) -> option::t<ast::initializer> {
       }
 
 
+
       // Now that the the channel is the first argument to receive,
       // combining it with an initializer doesn't really make sense.
       // case (token::RECV) {
@@ -1447,8 +1432,8 @@ fn parse_pat(p: &parser) -> @ast::pat {
             if p.peek() == token::UNDERSCORE {
                 p.bump();
                 if p.peek() != token::RBRACE {
-                    p.fatal(~"expecting }, found " +
-                            token::to_str(p.get_reader(), p.peek()));
+                    p.fatal("expecting }, found " +
+                                token::to_str(p.get_reader(), p.peek()));
                 }
                 etc = true;
                 break;
@@ -1461,8 +1446,7 @@ fn parse_pat(p: &parser) -> @ast::pat {
                 subpat = parse_pat(p);
             } else {
                 if p.get_bad_expr_words().contains_key(fieldname) {
-                    p.fatal(~"found " + fieldname
-                            + ~" in binding position");
+                    p.fatal("found " + fieldname + " in binding position");
                 }
                 subpat =
                     @{id: p.get_id(),
@@ -1501,17 +1485,15 @@ fn parse_pat(p: &parser) -> @ast::pat {
           token::LIT_STR(s) {
             let sp = p.get_span();
             p.bump();
-            let lit =
-                @{node: ast::lit_str(p.get_str(s)),
-                  span: sp};
+            let lit = @{node: ast::lit_str(p.get_str(s)), span: sp};
             hi = lit.span.hi;
             pat = ast::pat_lit(lit);
           }
-          _ { p.fatal(~"expected string literal"); }
+          _ { p.fatal("expected string literal"); }
         }
       }
       tok {
-        if !is_ident(tok) || is_word(p, ~"true") || is_word(p, ~"false") {
+        if !is_ident(tok) || is_word(p, "true") || is_word(p, "false") {
             let lit = parse_lit(p);
             hi = lit.span.hi;
             pat = ast::pat_lit(@lit);
@@ -1580,7 +1562,7 @@ fn parse_crate_stmt(p: &parser) -> @ast::stmt {
 
 fn parse_source_stmt(p: &parser) -> @ast::stmt {
     let lo = p.get_lo_pos();
-    if eat_word(p, ~"let") {
+    if eat_word(p, "let") {
         let decl = parse_let(p);
         ret @spanned(lo, decl.span.hi, ast::stmt_decl(decl, p.get_id()));
     } else {
@@ -1600,7 +1582,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt {
         if vec::len(item_attrs) > 0u {
             alt maybe_item {
               some(_) {/* fallthrough */ }
-              _ { ret p.fatal(~"expected item"); }
+              _ { ret p.fatal("expected item"); }
             }
         }
 
@@ -1616,7 +1598,7 @@ fn parse_source_stmt(p: &parser) -> @ast::stmt {
             let e = parse_expr(p);
             ret @spanned(lo, e.span.hi, ast::stmt_expr(e, p.get_id()));
           }
-          _ { p.fatal(~"expected statement"); }
+          _ { p.fatal("expected statement"); }
         }
     }
 }
@@ -1677,6 +1659,7 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool {
       }
 
 
+
       // We should not be calling this on a cdir.
       ast::stmt_crate_directive(cdir) {
         fail;
@@ -1686,10 +1669,9 @@ fn stmt_ends_with_semi(stmt: &ast::stmt) -> bool {
 
 fn parse_block(p: &parser) -> ast::blk {
     let lo = p.get_lo_pos();
-    if eat_word(p, ~"unchecked") {
+    if eat_word(p, "unchecked") {
         be parse_block_tail(p, lo, ast::unchecked);
-    }
-    else {
+    } else {
         expect(p, token::LBRACE);
         be parse_block_tail(p, lo, ast::checked);
     }
@@ -1716,8 +1698,8 @@ fn parse_block_tail(p: &parser, lo: uint, s: ast::check_mode) -> ast::blk {
                   token::RBRACE. { expr = some(e); }
                   t {
                     if stmt_ends_with_semi(*stmt) {
-                        p.fatal(~"expected ';' or '}' after " +
-                                    ~"expression but found " +
+                        p.fatal("expected ';' or '}' after " +
+                                    "expression but found " +
                                     token::to_str(p.get_reader(), t));
                     }
                     stmts += [stmt];
@@ -1935,7 +1917,7 @@ fn parse_mod_items(p: &parser, term: token::token,
         alt parse_item(p, attrs) {
           some(i) { items += [i]; }
           _ {
-            p.fatal(~"expected item but found " +
+            p.fatal("expected item but found " +
                         token::to_str(p.get_reader(), p.peek()));
           }
         }
@@ -1985,10 +1967,7 @@ fn parse_item_native_fn(p: &parser, attrs: &[ast::attribute]) ->
     let t = parse_fn_header(p);
     let decl = parse_fn_decl(p, ast::impure_fn, ast::il_normal);
     let link_name = none;
-    if p.peek() == token::EQ {
-        p.bump();
-        link_name = some(parse_str(p));
-    }
+    if p.peek() == token::EQ { p.bump(); link_name = some(parse_str(p)); }
     let hi = p.get_hi_pos();
     expect(p, token::SEMI);
     ret @{ident: t.ident,
@@ -2000,15 +1979,14 @@ fn parse_item_native_fn(p: &parser, attrs: &[ast::attribute]) ->
 
 fn parse_native_item(p: &parser, attrs: &[ast::attribute]) ->
    @ast::native_item {
-    if eat_word(p, ~"type") {
+    if eat_word(p, "type") {
         ret parse_item_native_type(p, attrs);
-    } else if eat_word(p, ~"fn") {
+    } else if eat_word(p, "fn") {
         ret parse_item_native_fn(p, attrs);
     } else { unexpected(p, p.peek()); }
 }
 
-fn parse_native_mod_items(p: &parser, native_name: &istr,
-                          abi: ast::native_abi,
+fn parse_native_mod_items(p: &parser, native_name: &str, abi: ast::native_abi,
                           first_item_attrs: &[ast::attribute]) ->
    ast::native_mod {
     // Shouldn't be any view items since we've already parsed an item attr
@@ -2032,20 +2010,20 @@ fn parse_native_mod_items(p: &parser, native_name: &istr,
 fn parse_item_native_mod(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     let lo = p.get_last_lo_pos();
     let abi = ast::native_abi_cdecl;
-    if !is_word(p, ~"mod") {
+    if !is_word(p, "mod") {
         let t = parse_str(p);
-        if str::eq(t, ~"cdecl") {
-        } else if str::eq(t, ~"rust") {
+        if str::eq(t, "cdecl") {
+        } else if str::eq(t, "rust") {
             abi = ast::native_abi_rust;
-        } else if str::eq(t, ~"llvm") {
+        } else if str::eq(t, "llvm") {
             abi = ast::native_abi_llvm;
-        } else if str::eq(t, ~"rust-intrinsic") {
+        } else if str::eq(t, "rust-intrinsic") {
             abi = ast::native_abi_rust_intrinsic;
-        } else if str::eq(t, ~"x86stdcall") {
+        } else if str::eq(t, "x86stdcall") {
             abi = ast::native_abi_x86stdcall;
-        } else { p.fatal(~"unsupported abi: " + t); }
+        } else { p.fatal("unsupported abi: " + t); }
     }
-    expect_word(p, ~"mod");
+    expect_word(p, "mod");
     let id = parse_ident(p);
     let native_name;
     if p.peek() == token::EQ {
@@ -2087,8 +2065,7 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
     // Newtype syntax
     if p.peek() == token::EQ {
         if p.get_bad_expr_words().contains_key(id) {
-            p.fatal(~"found " + id
-                    + ~" in tag constructor position");
+            p.fatal("found " + id + " in tag constructor position");
         }
         p.bump();
         let ty = parse_ty(p, false);
@@ -2125,13 +2102,12 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
             }
             expect(p, token::SEMI);
             p.get_id();
-            let vr = {name: p.get_str(name),
-                      args: args, id: p.get_id()};
+            let vr = {name: p.get_str(name), args: args, id: p.get_id()};
             variants += [spanned(vlo, vhi, vr)];
           }
           token::RBRACE. {/* empty */ }
           _ {
-            p.fatal(~"expected name of variant or '}' but found " +
+            p.fatal("expected name of variant or '}' but found " +
                         token::to_str(p.get_reader(), tok));
           }
         }
@@ -2142,42 +2118,42 @@ fn parse_item_tag(p: &parser, attrs: &[ast::attribute]) -> @ast::item {
 }
 
 fn parse_auth(p: &parser) -> ast::_auth {
-    if eat_word(p, ~"unsafe") {
+    if eat_word(p, "unsafe") {
         ret ast::auth_unsafe;
     } else { unexpected(p, p.peek()); }
 }
 
 fn parse_item(p: &parser, attrs: &[ast::attribute]) -> option::t<@ast::item> {
-    if eat_word(p, ~"const") {
+    if eat_word(p, "const") {
         ret some(parse_item_const(p, attrs));
-    } else if eat_word(p, ~"inline") {
-        expect_word(p, ~"fn");
+    } else if eat_word(p, "inline") {
+        expect_word(p, "fn");
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn,
                                        attrs, ast::il_inline));
-    } else if is_word(p, ~"fn") && p.look_ahead(1u) != token::LPAREN {
+    } else if is_word(p, "fn") && p.look_ahead(1u) != token::LPAREN {
         p.bump();
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_fn,
                                        attrs, ast::il_normal));
-    } else if eat_word(p, ~"pure") {
-        expect_word(p, ~"fn");
+    } else if eat_word(p, "pure") {
+        expect_word(p, "fn");
         ret some(parse_item_fn_or_iter(p, ast::pure_fn, ast::proto_fn, attrs,
                                        ast::il_normal));
-    } else if eat_word(p, ~"iter") {
+    } else if eat_word(p, "iter") {
         ret some(parse_item_fn_or_iter(p, ast::impure_fn, ast::proto_iter,
                                        attrs, ast::il_normal));
-    } else if eat_word(p, ~"mod") {
+    } else if eat_word(p, "mod") {
         ret some(parse_item_mod(p, attrs));
-    } else if eat_word(p, ~"native") {
+    } else if eat_word(p, "native") {
         ret some(parse_item_native_mod(p, attrs));
     }
-    if eat_word(p, ~"type") {
+    if eat_word(p, "type") {
         ret some(parse_item_type(p, attrs));
-    } else if eat_word(p, ~"tag") {
+    } else if eat_word(p, "tag") {
         ret some(parse_item_tag(p, attrs));
-    } else if is_word(p, ~"obj") && p.look_ahead(1u) != token::LPAREN {
+    } else if is_word(p, "obj") && p.look_ahead(1u) != token::LPAREN {
         p.bump();
         ret some(parse_item_obj(p, attrs));
-    } else if eat_word(p, ~"resource") {
+    } else if eat_word(p, "resource") {
         ret some(parse_item_res(p, attrs));
     } else { ret none; }
 }
@@ -2297,18 +2273,19 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident,
         alt p.peek() {
           token::SEMI. { break; }
           token::MOD_SEP. {
-            if glob { p.fatal(~"cannot path into a glob"); }
+            if glob { p.fatal("cannot path into a glob"); }
             if option::is_some(from_idents) {
-                p.fatal(~"cannot path into import list");
+                p.fatal("cannot path into import list");
             }
             p.bump();
           }
-          _ { p.fatal(~"expecting '::' or ';'"); }
+          _ { p.fatal("expecting '::' or ';'"); }
         }
         alt p.peek() {
           token::IDENT(_, _) { identifiers += [parse_ident(p)]; }
 
 
+
           //the lexer can't tell the different kinds of stars apart ) :
           token::BINOP(token::STAR.) {
             glob = true;
@@ -2316,6 +2293,7 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident,
           }
 
 
+
           token::LBRACE. {
             fn parse_import_ident(p: &parser) -> ast::import_ident {
                 let lo = p.get_lo_pos();
@@ -2327,22 +2305,23 @@ fn parse_rest_import_name(p: &parser, first: &ast::ident,
                 parse_seq(token::LBRACE, token::RBRACE, some(token::COMMA),
                           parse_import_ident, p).node;
             if vec::is_empty(from_idents_) {
-                p.fatal(~"at least one import is required");
+                p.fatal("at least one import is required");
             }
             from_idents = some(from_idents_);
           }
 
 
+
           _ {
-            p.fatal(~"expecting an identifier, or '*'");
+            p.fatal("expecting an identifier, or '*'");
           }
         }
     }
     alt def_ident {
       some(i) {
-        if glob { p.fatal(~"globbed imports can't be renamed"); }
+        if glob { p.fatal("globbed imports can't be renamed"); }
         if option::is_some(from_idents) {
-            p.fatal(~"can't rename import list");
+            p.fatal("can't rename import list");
         }
         ret ast::view_item_import(i, identifiers, p.get_id());
       }
@@ -2367,10 +2346,9 @@ fn parse_full_import_name(p: &parser, def_ident: &ast::ident) ->
     alt p.peek() {
       token::IDENT(i, _) {
         p.bump();
-        ret parse_rest_import_name(
-            p, p.get_str(i), some(def_ident));
+        ret parse_rest_import_name(p, p.get_str(i), some(def_ident));
       }
-      _ { p.fatal(~"expecting an identifier"); }
+      _ { p.fatal("expecting an identifier"); }
     }
 }
 
@@ -2383,13 +2361,10 @@ fn parse_import(p: &parser) -> ast::view_item_ {
             p.bump();
             ret parse_full_import_name(p, p.get_str(i));
           }
-          _ {
-            ret parse_rest_import_name(
-                p, p.get_str(i), none);
-          }
+          _ { ret parse_rest_import_name(p, p.get_str(i), none); }
         }
       }
-      _ { p.fatal(~"expecting an identifier"); }
+      _ { p.fatal("expecting an identifier"); }
     }
 }
 
@@ -2403,11 +2378,11 @@ fn parse_export(p: &parser) -> ast::view_item_ {
 fn parse_view_item(p: &parser) -> @ast::view_item {
     let lo = p.get_lo_pos();
     let the_item =
-        if eat_word(p, ~"use") {
+        if eat_word(p, "use") {
             parse_use(p)
-        } else if eat_word(p, ~"import") {
+        } else if eat_word(p, "import") {
             parse_import(p)
-        } else if eat_word(p, ~"export") { parse_export(p) } else { fail };
+        } else if eat_word(p, "export") { parse_export(p) } else { fail };
     let hi = p.get_lo_pos();
     expect(p, token::SEMI);
     ret @spanned(lo, hi, the_item);
@@ -2417,8 +2392,8 @@ fn is_view_item(p: &parser) -> bool {
     alt p.peek() {
       token::IDENT(sid, false) {
         let st = p.get_str(sid);
-        ret str::eq(st, ~"use") || str::eq(st, ~"import") ||
-                str::eq(st, ~"export");
+        ret str::eq(st, "use") || str::eq(st, "import") ||
+                str::eq(st, "export");
       }
       _ { ret false; }
     }
@@ -2436,21 +2411,19 @@ fn parse_native_view(p: &parser) -> [@ast::view_item] {
     ret items;
 }
 
-fn parse_crate_from_source_file(input: &istr, cfg: &ast::crate_cfg,
+fn parse_crate_from_source_file(input: &str, cfg: &ast::crate_cfg,
                                 sess: &parse_sess) -> @ast::crate {
     let p = new_parser_from_file(sess, cfg, input, 0u, 0u, SOURCE_FILE);
     ret parse_crate_mod(p, cfg);
 }
 
-fn parse_crate_from_source_str(name: &istr, source: &istr,
-                               cfg: &ast::crate_cfg,
+fn parse_crate_from_source_str(name: &str, source: &str, cfg: &ast::crate_cfg,
                                sess: &parse_sess) -> @ast::crate {
     let ftype = SOURCE_FILE;
     let filemap = codemap::new_filemap(name, 0u, 0u);
     sess.cm.files += [filemap];
     let itr = @interner::mk(str::hash, str::eq);
-    let rdr = lexer::new_reader(sess.cm, source,
-                                filemap, itr);
+    let rdr = lexer::new_reader(sess.cm, source, filemap, itr);
     let p = new_parser(sess, cfg, rdr, ftype);
     ret parse_crate_mod(p, cfg);
 }
@@ -2468,7 +2441,7 @@ fn parse_crate_mod(p: &parser, _cfg: &ast::crate_cfg) -> @ast::crate {
                   config: p.get_cfg()});
 }
 
-fn parse_str(p: &parser) -> istr {
+fn parse_str(p: &parser) -> str {
     alt p.peek() {
       token::LIT_STR(s) { p.bump(); ret p.get_str(s); }
       _ { fail; }
@@ -2489,8 +2462,8 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
     let expect_mod = vec::len(outer_attrs) > 0u;
 
     let lo = p.get_lo_pos();
-    if expect_mod || is_word(p, ~"mod") {
-        expect_word(p, ~"mod");
+    if expect_mod || is_word(p, "mod") {
+        expect_word(p, "mod");
         let id = parse_ident(p);
         let file_opt =
             alt p.peek() {
@@ -2500,6 +2473,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
         alt p.peek() {
 
 
+
           // mod x = "foo.rs";
           token::SEMI. {
             let hi = p.get_hi_pos();
@@ -2508,6 +2482,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
           }
 
 
+
           // mod x = "foo_dir" { ...directives... }
           token::LBRACE. {
             p.bump();
@@ -2523,7 +2498,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
           }
           t { unexpected(p, t); }
         }
-    } else if eat_word(p, ~"auth") {
+    } else if eat_word(p, "auth") {
         let n = parse_path(p);
         expect(p, token::EQ);
         let a = parse_auth(p);
@@ -2533,7 +2508,7 @@ fn parse_crate_directive(p: &parser, first_outer_attr: &[ast::attribute]) ->
     } else if is_view_item(p) {
         let vi = parse_view_item(p);
         ret spanned(lo, vi.span.hi, ast::cdir_view_item(vi));
-    } else { ret p.fatal(~"expected crate directive"); }
+    } else { ret p.fatal("expected crate directive"); }
 }
 
 fn parse_crate_directives(p: &parser, term: token::token,
@@ -2544,7 +2519,7 @@ fn parse_crate_directives(p: &parser, term: token::token,
     // seeing the terminator next, so if we do see it then fail the same way
     // parse_crate_directive would
     if vec::len(first_outer_attr) > 0u && p.peek() == term {
-        expect_word(p, ~"mod");
+        expect_word(p, "mod");
     }
 
     let cdirs: [@ast::crate_directive] = [];
@@ -2555,17 +2530,16 @@ fn parse_crate_directives(p: &parser, term: token::token,
     ret cdirs;
 }
 
-fn parse_crate_from_crate_file(input: &istr, cfg: &ast::crate_cfg,
+fn parse_crate_from_crate_file(input: &str, cfg: &ast::crate_cfg,
                                sess: &parse_sess) -> @ast::crate {
     let p = new_parser_from_file(sess, cfg, input, 0u, 0u, CRATE_FILE);
     let lo = p.get_lo_pos();
-    let prefix =
-        std::fs::dirname(p.get_filemap().name);
+    let prefix = std::fs::dirname(p.get_filemap().name);
     let leading_attrs = parse_inner_attrs_and_next(p);
     let crate_attrs = leading_attrs.inner;
     let first_cdir_attr = leading_attrs.next;
     let cdirs = parse_crate_directives(p, token::EOF, first_cdir_attr);
-    let deps: [istr] = [];
+    let deps: [str] = [];
     let cx =
         @{p: p,
           mode: eval::mode_parse,
@@ -2584,15 +2558,14 @@ fn parse_crate_from_crate_file(input: &istr, cfg: &ast::crate_cfg,
                   config: p.get_cfg()});
 }
 
-fn parse_crate_from_file(input: &istr, cfg: &ast::crate_cfg,
-                         sess: &parse_sess) -> @ast::crate {
-    if str::ends_with(input, ~".rc") {
+fn parse_crate_from_file(input: &str, cfg: &ast::crate_cfg, sess: &parse_sess)
+   -> @ast::crate {
+    if str::ends_with(input, ".rc") {
         parse_crate_from_crate_file(input, cfg, sess)
-    } else if str::ends_with(input, ~".rs") {
+    } else if str::ends_with(input, ".rs") {
         parse_crate_from_source_file(input, cfg, sess)
     } else {
-        codemap::emit_error(none, ~"unknown input file type: "
-                            + input,
+        codemap::emit_error(none, "unknown input file type: " + input,
                             sess.cm);
         fail
     }
diff --git a/src/comp/syntax/parse/token.rs b/src/comp/syntax/parse/token.rs
index 24d2a3b9a6f..153f5236c4b 100644
--- a/src/comp/syntax/parse/token.rs
+++ b/src/comp/syntax/parse/token.rs
@@ -84,62 +84,64 @@ tag token {
     EOF;
 }
 
-fn binop_to_str(o: binop) -> istr {
+fn binop_to_str(o: binop) -> str {
     alt o {
-      PLUS. { ret ~"+"; }
-      MINUS. { ret ~"-"; }
-      STAR. { ret ~"*"; }
-      SLASH. { ret ~"/"; }
-      PERCENT. { ret ~"%"; }
-      CARET. { ret ~"^"; }
-      AND. { ret ~"&"; }
-      OR. { ret ~"|"; }
-      LSL. { ret ~"<<"; }
-      LSR. { ret ~">>"; }
-      ASR. { ret ~">>>"; }
+      PLUS. { ret "+"; }
+      MINUS. { ret "-"; }
+      STAR. { ret "*"; }
+      SLASH. { ret "/"; }
+      PERCENT. { ret "%"; }
+      CARET. { ret "^"; }
+      AND. { ret "&"; }
+      OR. { ret "|"; }
+      LSL. { ret "<<"; }
+      LSR. { ret ">>"; }
+      ASR. { ret ">>>"; }
     }
 }
 
-fn to_str(r: lexer::reader, t: token) -> istr {
+fn to_str(r: lexer::reader, t: token) -> str {
     alt t {
-      EQ. { ret ~"="; }
-      LT. { ret ~"<"; }
-      LE. { ret ~"<="; }
-      EQEQ. { ret ~"=="; }
-      NE. { ret ~"!="; }
-      GE. { ret ~">="; }
-      GT. { ret ~">"; }
-      NOT. { ret ~"!"; }
-      TILDE. { ret ~"~"; }
-      OROR. { ret ~"||"; }
-      ANDAND. { ret ~"&&"; }
+      EQ. { ret "="; }
+      LT. { ret "<"; }
+      LE. { ret "<="; }
+      EQEQ. { ret "=="; }
+      NE. { ret "!="; }
+      GE. { ret ">="; }
+      GT. { ret ">"; }
+      NOT. { ret "!"; }
+      TILDE. { ret "~"; }
+      OROR. { ret "||"; }
+      ANDAND. { ret "&&"; }
       BINOP(op) { ret binop_to_str(op); }
-      BINOPEQ(op) { ret binop_to_str(op) + ~"="; }
+      BINOPEQ(op) { ret binop_to_str(op) + "="; }
+
 
 
       /* Structural symbols */
       AT. {
-        ret ~"@";
+        ret "@";
       }
-      DOT. { ret ~"."; }
-      ELLIPSIS. { ret ~"..."; }
-      COMMA. { ret ~","; }
-      SEMI. { ret ~";"; }
-      COLON. { ret ~":"; }
-      MOD_SEP. { ret ~"::"; }
-      QUES. { ret ~"?"; }
-      RARROW. { ret ~"->"; }
-      LARROW. { ret ~"<-"; }
-      DARROW. { ret ~"<->"; }
-      LPAREN. { ret ~"("; }
-      RPAREN. { ret ~")"; }
-      LBRACKET. { ret ~"["; }
-      RBRACKET. { ret ~"]"; }
-      LBRACE. { ret ~"{"; }
-      RBRACE. { ret ~"}"; }
-      POUND. { ret ~"#"; }
-      POUND_LBRACE. { ret ~"#{"; }
-      POUND_LT. { ret ~"#<"; }
+      DOT. { ret "."; }
+      ELLIPSIS. { ret "..."; }
+      COMMA. { ret ","; }
+      SEMI. { ret ";"; }
+      COLON. { ret ":"; }
+      MOD_SEP. { ret "::"; }
+      QUES. { ret "?"; }
+      RARROW. { ret "->"; }
+      LARROW. { ret "<-"; }
+      DARROW. { ret "<->"; }
+      LPAREN. { ret "("; }
+      RPAREN. { ret ")"; }
+      LBRACKET. { ret "["; }
+      RBRACKET. { ret "]"; }
+      LBRACE. { ret "{"; }
+      RBRACE. { ret "}"; }
+      POUND. { ret "#"; }
+      POUND_LBRACE. { ret "#{"; }
+      POUND_LT. { ret "#<"; }
+
 
 
       /* Literals */
@@ -148,39 +150,35 @@ fn to_str(r: lexer::reader, t: token) -> istr {
       }
       LIT_UINT(u) { ret uint::to_str(u, 10u); }
       LIT_MACH_INT(tm, i) {
-        ret int::to_str(i, 10u) + ~"_" + ty_mach_to_str(tm);
+        ret int::to_str(i, 10u) + "_" + ty_mach_to_str(tm);
       }
       LIT_MACH_FLOAT(tm, s) {
-        ret interner::get::<istr>(
-            *r.get_interner(), s) + ~"_" +
-            ty_mach_to_str(tm);
-      }
-      LIT_FLOAT(s) {
-        ret interner::get::<istr>(*r.get_interner(), s);
+        ret interner::get::<str>(*r.get_interner(), s) + "_" +
+                ty_mach_to_str(tm);
       }
+      LIT_FLOAT(s) { ret interner::get::<str>(*r.get_interner(), s); }
       LIT_STR(s) { // FIXME: escape.
-        ret ~"\"" +
-            interner::get::<istr>(*r.get_interner(), s)
-            + ~"\"";
+        ret "\"" + interner::get::<str>(*r.get_interner(), s) + "\"";
       }
       LIT_CHAR(c) {
         // FIXME: escape.
-        let tmp = ~"'";
+        let tmp = "'";
         str::push_char(tmp, c);
         str::push_byte(tmp, '\'' as u8);
         ret tmp;
       }
-      LIT_BOOL(b) { if b { ret ~"true"; } else { ret ~"false"; } }
+      LIT_BOOL(b) { if b { ret "true"; } else { ret "false"; } }
+
 
 
       /* Name components */
       IDENT(s, _) {
-        ret interner::get::<istr>(*r.get_interner(), s);
+        ret interner::get::<str>(*r.get_interner(), s);
       }
-      IDX(i) { ret ~"_" + int::to_str(i, 10u); }
-      UNDERSCORE. { ret ~"_"; }
-      BRACEQUOTE(_) { ret ~"<bracequote>"; }
-      EOF. { ret ~"<eof>"; }
+      IDX(i) { ret "_" + int::to_str(i, 10u); }
+      UNDERSCORE. { ret "_"; }
+      BRACEQUOTE(_) { ret "<bracequote>"; }
+      EOF. { ret "<eof>"; }
     }
 }
 
diff --git a/src/comp/syntax/print/pp.rs b/src/comp/syntax/print/pp.rs
index ef92672435a..fad670fbefb 100644
--- a/src/comp/syntax/print/pp.rs
+++ b/src/comp/syntax/print/pp.rs
@@ -61,35 +61,33 @@ type break_t = {offset: int, blank_space: int};
 
 type begin_t = {offset: int, breaks: breaks};
 
-tag token { STRING(istr, int); BREAK(break_t); BEGIN(begin_t); END; EOF; }
+tag token { STRING(str, int); BREAK(break_t); BEGIN(begin_t); END; EOF; }
 
-fn tok_str(t: token) -> istr {
+fn tok_str(t: token) -> str {
     alt t {
-      STRING(s, len) {
-        ret #fmt[~"STR(%s,%d)", s, len];
-      }
-      BREAK(_) { ret ~"BREAK"; }
-      BEGIN(_) { ret ~"BEGIN"; }
-      END. { ret ~"END"; }
-      EOF. { ret ~"EOF"; }
+      STRING(s, len) { ret #fmt["STR(%s,%d)", s, len]; }
+      BREAK(_) { ret "BREAK"; }
+      BEGIN(_) { ret "BEGIN"; }
+      END. { ret "END"; }
+      EOF. { ret "EOF"; }
     }
 }
 
 fn buf_str(toks: &[mutable token], szs: &[mutable int], left: uint,
-           right: uint, lim: uint) -> istr {
+           right: uint, lim: uint) -> str {
     let n = vec::len(toks);
     assert (n == vec::len(szs));
     let i = left;
     let L = lim;
-    let s = ~"[";
+    let s = "[";
     while i != right && L != 0u {
         L -= 1u;
-        if i != left { s += ~", "; }
-        s += #fmt[~"%d=%s", szs[i], tok_str(toks[i])];
+        if i != left { s += ", "; }
+        s += #fmt["%d=%s", szs[i], tok_str(toks[i])];
         i += 1u;
         i %= n;
     }
-    s += ~"]";
+    s += "]";
     ret s;
 }
 
@@ -104,7 +102,7 @@ fn mk_printer(out: io::writer, linewidth: uint) -> printer {
     // fall behind.
 
     let n: uint = 3u * linewidth;
-    log #fmt[~"mk_printer %u", linewidth];
+    log #fmt["mk_printer %u", linewidth];
     let token: [mutable token] = vec::init_elt_mut(EOF, n);
     let size: [mutable int] = vec::init_elt_mut(0, n);
     let scan_stack: [mutable uint] = vec::init_elt_mut(0u, n);
@@ -244,7 +242,7 @@ obj printer(out: io::writer,
     fn replace_last_token(t: token) { token[right] = t; }
 
     fn pretty_print(t: token) {
-        log #fmt[~"pp [%u,%u]", left, right];
+        log #fmt["pp [%u,%u]", left, right];
         alt t {
           EOF. {
             if !scan_stack_empty {
@@ -260,17 +258,17 @@ obj printer(out: io::writer,
                 left = 0u;
                 right = 0u;
             } else { self.advance_right(); }
-            log #fmt[~"pp BEGIN/buffer [%u,%u]", left, right];
+            log #fmt["pp BEGIN/buffer [%u,%u]", left, right];
             token[right] = t;
             size[right] = -right_total;
             self.scan_push(right);
           }
           END. {
             if scan_stack_empty {
-                log #fmt[~"pp END/print [%u,%u]", left, right];
+                log #fmt["pp END/print [%u,%u]", left, right];
                 self.print(t, 0);
             } else {
-                log #fmt[~"pp END/buffer [%u,%u]", left, right];
+                log #fmt["pp END/buffer [%u,%u]", left, right];
                 self.advance_right();
                 token[right] = t;
                 size[right] = -1;
@@ -284,7 +282,7 @@ obj printer(out: io::writer,
                 left = 0u;
                 right = 0u;
             } else { self.advance_right(); }
-            log #fmt[~"pp BREAK/buffer [%u,%u]", left, right];
+            log #fmt["pp BREAK/buffer [%u,%u]", left, right];
             self.check_stack(0);
             self.scan_push(right);
             token[right] = t;
@@ -293,10 +291,10 @@ obj printer(out: io::writer,
           }
           STRING(s, len) {
             if scan_stack_empty {
-                log #fmt[~"pp STRING/print [%u,%u]", left, right];
+                log #fmt["pp STRING/print [%u,%u]", left, right];
                 self.print(t, len);
             } else {
-                log #fmt[~"pp STRING/buffer [%u,%u]", left, right];
+                log #fmt["pp STRING/buffer [%u,%u]", left, right];
                 self.advance_right();
                 token[right] = t;
                 size[right] = len;
@@ -307,10 +305,10 @@ obj printer(out: io::writer,
         }
     }
     fn check_stream() {
-        log #fmt[~"check_stream [%u, %u] with left_total=%d, right_total=%d",
+        log #fmt["check_stream [%u, %u] with left_total=%d, right_total=%d",
                  left, right, left_total, right_total];
         if right_total - left_total > space {
-            log #fmt[~"scan window is %d, longer than space on line (%d)",
+            log #fmt["scan window is %d, longer than space on line (%d)",
                      right_total - left_total, space];
             if !scan_stack_empty {
                 if left == scan_stack[bottom] {
@@ -392,7 +390,7 @@ obj printer(out: io::writer,
     }
     fn print_newline(amount: int) {
         log #fmt["NEWLINE %d", amount];
-        out.write_str(~"\n");
+        out.write_str("\n");
         pending_indentation = 0;
         self.indent(amount);
     }
@@ -406,16 +404,15 @@ obj printer(out: io::writer,
         if n != 0u { top = print_stack[n - 1u]; }
         ret top;
     }
-    fn write_str(s: &istr) {
+    fn write_str(s: &str) {
         while pending_indentation > 0 {
-            out.write_str(~" ");
+            out.write_str(" ");
             pending_indentation -= 1;
         }
         out.write_str(s);
     }
     fn print(x: token, L: int) {
-        log #fmt["print %s %d (remaining line space=%d)",
-                 tok_str(x), L,
+        log #fmt["print %s %d (remaining line space=%d)", tok_str(x), L,
                  space];
         log buf_str(token, size, left, right, 6u);
         alt x {
@@ -495,15 +492,15 @@ fn end(p: printer) { p.pretty_print(END); }
 
 fn eof(p: printer) { p.pretty_print(EOF); }
 
-fn word(p: printer, wrd: &istr) {
+fn word(p: printer, wrd: &str) {
     p.pretty_print(STRING(wrd, str::char_len(wrd) as int));
 }
 
-fn huge_word(p: printer, wrd: &istr) {
+fn huge_word(p: printer, wrd: &str) {
     p.pretty_print(STRING(wrd, size_infinity));
 }
 
-fn zero_word(p: printer, wrd: &istr) { p.pretty_print(STRING(wrd, 0)); }
+fn zero_word(p: printer, wrd: &str) { p.pretty_print(STRING(wrd, 0)); }
 
 fn spaces(p: printer, n: uint) { break_offset(p, n, 0); }
 
diff --git a/src/comp/syntax/print/pprust.rs b/src/comp/syntax/print/pprust.rs
index 257404e7f65..33704b0e07c 100644
--- a/src/comp/syntax/print/pprust.rs
+++ b/src/comp/syntax/print/pprust.rs
@@ -74,11 +74,10 @@ const default_columns: uint = 78u;
 // Requires you to pass an input filename and reader so that
 // it can scan the input text for comments and literals to
 // copy forward.
-fn print_crate(cm: &codemap, crate: @ast::crate, filename: &istr,
+fn print_crate(cm: &codemap, crate: @ast::crate, filename: &str,
                in: io::reader, out: io::writer, ann: &pp_ann) {
     let boxes: [pp::breaks] = [];
-    let r = lexer::gather_comments_and_literals(
-        cm, filename, in);
+    let r = lexer::gather_comments_and_literals(cm, filename, in);
     let s =
         @{s: pp::mk_printer(out, default_columns),
           cm: some(cm),
@@ -93,22 +92,22 @@ fn print_crate(cm: &codemap, crate: @ast::crate, filename: &istr,
     eof(s.s);
 }
 
-fn ty_to_str(ty: &@ast::ty) -> istr { be to_str(ty, print_type); }
+fn ty_to_str(ty: &@ast::ty) -> str { be to_str(ty, print_type); }
 
-fn pat_to_str(pat: &@ast::pat) -> istr { be to_str(pat, print_pat); }
+fn pat_to_str(pat: &@ast::pat) -> str { be to_str(pat, print_pat); }
 
-fn expr_to_str(e: &@ast::expr) -> istr { be to_str(e, print_expr); }
+fn expr_to_str(e: &@ast::expr) -> str { be to_str(e, print_expr); }
 
-fn stmt_to_str(s: &ast::stmt) -> istr { be to_str(s, print_stmt); }
+fn stmt_to_str(s: &ast::stmt) -> str { be to_str(s, print_stmt); }
 
-fn item_to_str(i: &@ast::item) -> istr { be to_str(i, print_item); }
+fn item_to_str(i: &@ast::item) -> str { be to_str(i, print_item); }
 
-fn path_to_str(p: &ast::path) -> istr {
+fn path_to_str(p: &ast::path) -> str {
     be to_str(p, bind print_path(_, _, false));
 }
 
-fn fun_to_str(f: &ast::_fn, name: &ast::ident,
-              params: &[ast::ty_param]) -> istr {
+fn fun_to_str(f: &ast::_fn, name: &ast::ident, params: &[ast::ty_param]) ->
+   str {
     let writer = io::string_writer();
     let s = rust_printer(writer.get_writer());
     print_fn(s, f.decl, f.proto, name, params, f.decl.constraints);
@@ -116,7 +115,7 @@ fn fun_to_str(f: &ast::_fn, name: &ast::ident,
     ret writer.get_str();
 }
 
-fn block_to_str(blk: &ast::blk) -> istr {
+fn block_to_str(blk: &ast::blk) -> str {
     let writer = io::string_writer();
     let s = rust_printer(writer.get_writer());
     // containing cbox, will be closed by print-block at }
@@ -130,11 +129,11 @@ fn block_to_str(blk: &ast::blk) -> istr {
     ret writer.get_str();
 }
 
-fn meta_item_to_str(mi: &ast::meta_item) -> istr {
+fn meta_item_to_str(mi: &ast::meta_item) -> str {
     ret to_str(@mi, print_meta_item);
 }
 
-fn attribute_to_str(attr: &ast::attribute) -> istr {
+fn attribute_to_str(attr: &ast::attribute) -> str {
     be to_str(attr, print_attribute);
 }
 
@@ -142,17 +141,17 @@ fn cbox(s: &ps, u: uint) { s.boxes += [pp::consistent]; pp::cbox(s.s, u); }
 
 fn box(s: &ps, u: uint, b: pp::breaks) { s.boxes += [b]; pp::box(s.s, u, b); }
 
-fn nbsp(s: &ps) { word(s.s, ~" "); }
+fn nbsp(s: &ps) { word(s.s, " "); }
 
-fn word_nbsp(s: &ps, w: &istr) { word(s.s, w); nbsp(s); }
+fn word_nbsp(s: &ps, w: &str) { word(s.s, w); nbsp(s); }
 
-fn word_space(s: &ps, w: &istr) { word(s.s, w); space(s.s); }
+fn word_space(s: &ps, w: &str) { word(s.s, w); space(s.s); }
 
-fn popen(s: &ps) { word(s.s, ~"("); }
+fn popen(s: &ps) { word(s.s, "("); }
 
-fn pclose(s: &ps) { word(s.s, ~")"); }
+fn pclose(s: &ps) { word(s.s, ")"); }
 
-fn head(s: &ps, w: &istr) {
+fn head(s: &ps, w: &str) {
     // outer-box is consistent
     cbox(s, indent_unit);
     // head-box is inconsistent
@@ -162,14 +161,14 @@ fn head(s: &ps, w: &istr) {
 }
 
 fn bopen(s: &ps) {
-    word(s.s, ~"{");
+    word(s.s, "{");
     end(s); // close the head-box
 }
 
 fn bclose_(s: &ps, span: codemap::span, indented: uint) {
     maybe_print_comment(s, span.hi);
     break_offset_if_not_bol(s, 1u, -(indented as int));
-    word(s.s, ~"}");
+    word(s.s, "}");
     end(s); // close the outer-box
 }
 fn bclose(s: &ps, span: codemap::span) { bclose_(s, span, indent_unit); }
@@ -204,19 +203,19 @@ fn break_offset_if_not_bol(s: &ps, n: uint, off: int) {
 
 // Synthesizes a comment that was not textually present in the original source
 // file.
-fn synth_comment(s: &ps, text: &istr) {
-    word(s.s, ~"/*");
+fn synth_comment(s: &ps, text: &str) {
+    word(s.s, "/*");
     space(s.s);
     word(s.s, text);
     space(s.s);
-    word(s.s, ~"*/");
+    word(s.s, "*/");
 }
 
 fn commasep<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN)) {
     box(s, 0u, b);
     let first = true;
     for elt: IN in elts {
-        if first { first = false; } else { word_space(s, ~","); }
+        if first { first = false; } else { word_space(s, ","); }
         op(s, elt);
     }
     end(s);
@@ -233,7 +232,7 @@ fn commasep_cmnt<IN>(s: &ps, b: breaks, elts: &[IN], op: fn(&ps, &IN),
         op(s, elt);
         i += 1u;
         if i < len {
-            word(s.s, ~",");
+            word(s.s, ",");
             maybe_print_trailing_comment(s, get_span(elt),
                                          some(get_span(elts[i]).hi));
             space_if_not_bol(s);
@@ -268,53 +267,51 @@ fn print_type(s: &ps, ty: &@ast::ty) {
     maybe_print_comment(s, ty.span.lo);
     ibox(s, 0u);
     alt ty.node {
-      ast::ty_nil. { word(s.s, ~"()"); }
-      ast::ty_bool. { word(s.s, ~"bool"); }
-      ast::ty_bot. { word(s.s, ~"!"); }
-      ast::ty_int. { word(s.s, ~"int"); }
-      ast::ty_uint. { word(s.s, ~"uint"); }
-      ast::ty_float. { word(s.s, ~"float"); }
-      ast::ty_machine(tm) {
-        word(s.s, ast_util::ty_mach_to_str(tm));
-      }
-      ast::ty_char. { word(s.s, ~"char"); }
-      ast::ty_istr. { word(s.s, ~"str"); }
-      ast::ty_box(mt) { word(s.s, ~"@"); print_mt(s, mt); }
+      ast::ty_nil. { word(s.s, "()"); }
+      ast::ty_bool. { word(s.s, "bool"); }
+      ast::ty_bot. { word(s.s, "!"); }
+      ast::ty_int. { word(s.s, "int"); }
+      ast::ty_uint. { word(s.s, "uint"); }
+      ast::ty_float. { word(s.s, "float"); }
+      ast::ty_machine(tm) { word(s.s, ast_util::ty_mach_to_str(tm)); }
+      ast::ty_char. { word(s.s, "char"); }
+      ast::ty_istr. { word(s.s, "str"); }
+      ast::ty_box(mt) { word(s.s, "@"); print_mt(s, mt); }
       ast::ty_vec(mt) {
-        word(s.s, ~"[");
+        word(s.s, "[");
         alt mt.mut {
-          ast::mut. { word_space(s, ~"mutable"); }
-          ast::maybe_mut. { word_space(s, ~"mutable?"); }
+          ast::mut. { word_space(s, "mutable"); }
+          ast::maybe_mut. { word_space(s, "mutable?"); }
           ast::imm. { }
         }
         print_type(s, mt.ty);
-        word(s.s, ~"]");
+        word(s.s, "]");
       }
-      ast::ty_ptr(mt) { word(s.s, ~"*"); print_mt(s, mt); }
-      ast::ty_task. { word(s.s, ~"task"); }
+      ast::ty_ptr(mt) { word(s.s, "*"); print_mt(s, mt); }
+      ast::ty_task. { word(s.s, "task"); }
       ast::ty_port(t) {
-        word(s.s, ~"port<");
+        word(s.s, "port<");
         print_type(s, t);
-        word(s.s, ~">");
+        word(s.s, ">");
       }
       ast::ty_chan(t) {
-        word(s.s, ~"chan<");
+        word(s.s, "chan<");
         print_type(s, t);
-        word(s.s, ~">");
+        word(s.s, ">");
       }
       ast::ty_rec(fields) {
-        word(s.s, ~"{");
+        word(s.s, "{");
         fn print_field(s: &ps, f: &ast::ty_field) {
             cbox(s, indent_unit);
             print_mutability(s, f.node.mt.mut);
             word(s.s, f.node.ident);
-            word_space(s, ~":");
+            word_space(s, ":");
             print_type(s, f.node.mt.ty);
             end(s);
         }
         fn get_span(f: &ast::ty_field) -> codemap::span { ret f.span; }
         commasep_cmnt(s, consistent, fields, print_field, get_span);
-        word(s.s, ~"}");
+        word(s.s, "}");
       }
       ast::ty_tup(elts) {
         popen(s);
@@ -322,10 +319,10 @@ fn print_type(s: &ps, ty: &@ast::ty) {
         pclose(s);
       }
       ast::ty_fn(proto, inputs, output, cf, constrs) {
-        print_ty_fn(s, proto, none::<istr>, inputs, output, cf, constrs);
+        print_ty_fn(s, proto, none::<str>, inputs, output, cf, constrs);
       }
       ast::ty_obj(methods) {
-        head(s, ~"obj");
+        head(s, "obj");
         bopen(s);
         for m: ast::ty_method in methods {
             hardbreak_if_not_bol(s);
@@ -333,13 +330,13 @@ fn print_type(s: &ps, ty: &@ast::ty) {
             maybe_print_comment(s, m.span.lo);
             print_ty_fn(s, m.node.proto, some(m.node.ident), m.node.inputs,
                         m.node.output, m.node.cf, m.node.constrs);
-            word(s.s, ~";");
+            word(s.s, ";");
             end(s);
         }
         bclose(s, ty.span);
       }
       ast::ty_path(path, _) { print_path(s, path, false); }
-      ast::ty_type. { word(s.s, ~"type"); }
+      ast::ty_type. { word(s.s, "type"); }
       ast::ty_constr(t, cs) {
         print_type(s, t);
         space(s.s);
@@ -357,29 +354,26 @@ fn print_native_item(s: &ps, item: &@ast::native_item) {
       ast::native_item_ty. {
         ibox(s, indent_unit);
         ibox(s, 0u);
-        word_nbsp(s, ~"type");
+        word_nbsp(s, "type");
         word(s.s, item.ident);
         end(s); // end the inner ibox
-        word(s.s, ~";");
+        word(s.s, ";");
         end(s); // end the outer ibox
 
       }
 
 
 
+
       ast::native_item_fn(lname, decl, typarams) {
         print_fn(s, decl, ast::proto_fn, item.ident, typarams,
                  decl.constraints);
         alt lname {
           none. { }
-          some(ss) {
-            space(s.s);
-            word_space(s, ~"=");
-            print_string(s, ss);
-          }
+          some(ss) { space(s.s); word_space(s, "="); print_string(s, ss); }
         }
         end(s); // end head-ibox
-        word(s.s, ~";");
+        word(s.s, ";");
         end(s); // end the outer fn box
       }
     }
@@ -393,46 +387,46 @@ fn print_item(s: &ps, item: &@ast::item) {
     s.ann.pre(ann_node);
     alt item.node {
       ast::item_const(ty, expr) {
-        head(s, ~"const");
-        word_space(s, item.ident + ~":");
+        head(s, "const");
+        word_space(s, item.ident + ":");
         print_type(s, ty);
         space(s.s);
         end(s); // end the head-ibox
 
-        word_space(s, ~"=");
+        word_space(s, "=");
         print_expr(s, expr);
-        word(s.s, ~";");
+        word(s.s, ";");
         end(s); // end the outer cbox
 
       }
       ast::item_fn(_fn, typarams) {
         print_fn(s, _fn.decl, _fn.proto, item.ident, typarams,
                  _fn.decl.constraints);
-        word(s.s, ~" ");
+        word(s.s, " ");
         print_block(s, _fn.body);
       }
       ast::item_mod(_mod) {
-        head(s, ~"mod");
+        head(s, "mod");
         word_nbsp(s, item.ident);
         bopen(s);
         print_mod(s, _mod, item.attrs);
         bclose(s, item.span);
       }
       ast::item_native_mod(nmod) {
-        head(s, ~"native");
+        head(s, "native");
         alt nmod.abi {
-          ast::native_abi_llvm. { word_nbsp(s, ~"\"llvm\""); }
-          ast::native_abi_rust. { word_nbsp(s, ~"\"rust\""); }
-          ast::native_abi_cdecl. { word_nbsp(s, ~"\"cdecl\""); }
+          ast::native_abi_llvm. { word_nbsp(s, "\"llvm\""); }
+          ast::native_abi_rust. { word_nbsp(s, "\"rust\""); }
+          ast::native_abi_cdecl. { word_nbsp(s, "\"cdecl\""); }
           ast::native_abi_rust_intrinsic. {
-            word_nbsp(s, ~"\"rust-intrinsic\"");
+            word_nbsp(s, "\"rust-intrinsic\"");
           }
-          ast::native_abi_x86stdcall. { word_nbsp(s, ~"\"x86stdcall\""); }
+          ast::native_abi_x86stdcall. { word_nbsp(s, "\"x86stdcall\""); }
         }
-        word_nbsp(s, ~"mod");
+        word_nbsp(s, "mod");
         word_nbsp(s, item.ident);
         if !str::eq(nmod.native_name, item.ident) {
-            word_space(s, ~"=");
+            word_space(s, "=");
             print_string(s, nmod.native_name);
             nbsp(s);
         }
@@ -443,15 +437,15 @@ fn print_item(s: &ps, item: &@ast::item) {
       ast::item_ty(ty, params) {
         ibox(s, indent_unit);
         ibox(s, 0u);
-        word_nbsp(s, ~"type");
+        word_nbsp(s, "type");
         word(s.s, item.ident);
         print_type_params(s, params);
         end(s); // end the inner ibox
 
         space(s.s);
-        word_space(s, ~"=");
+        word_space(s, "=");
         print_type(s, ty);
-        word(s.s, ~";");
+        word(s.s, ";");
         end(s); // end the outer ibox
       }
       ast::item_tag(variants, params) {
@@ -461,15 +455,15 @@ fn print_item(s: &ps, item: &@ast::item) {
                 vec::len(variants[0].node.args) == 1u;
         if newtype {
             ibox(s, indent_unit);
-            word_space(s, ~"tag");
-        } else { head(s, ~"tag"); }
+            word_space(s, "tag");
+        } else { head(s, "tag"); }
         word(s.s, item.ident);
         print_type_params(s, params);
         space(s.s);
         if newtype {
-            word_space(s, ~"=");
+            word_space(s, "=");
             print_type(s, variants[0].node.args[0].ty);
-            word(s.s, ~";");
+            word(s.s, ";");
             end(s);
         } else {
             bopen(s);
@@ -485,21 +479,21 @@ fn print_item(s: &ps, item: &@ast::item) {
                     commasep(s, consistent, v.node.args, print_variant_arg);
                     pclose(s);
                 }
-                word(s.s, ~";");
+                word(s.s, ";");
                 maybe_print_trailing_comment(s, v.span, none::<uint>);
             }
             bclose(s, item.span);
         }
       }
       ast::item_obj(_obj, params, _) {
-        head(s, ~"obj");
+        head(s, "obj");
         word(s.s, item.ident);
         print_type_params(s, params);
         popen(s);
         fn print_field(s: &ps, field: &ast::obj_field) {
             ibox(s, indent_unit);
             print_mutability(s, field.mut);
-            word_space(s, field.ident + ~":");
+            word_space(s, field.ident + ":");
             print_type(s, field.ty);
             end(s);
         }
@@ -514,17 +508,17 @@ fn print_item(s: &ps, item: &@ast::item) {
             maybe_print_comment(s, meth.span.lo);
             print_fn(s, meth.node.meth.decl, meth.node.meth.proto,
                      meth.node.ident, typarams, []);
-            word(s.s, ~" ");
+            word(s.s, " ");
             print_block(s, meth.node.meth.body);
         }
         bclose(s, item.span);
       }
       ast::item_res(dt, dt_id, tps, ct_id) {
-        head(s, ~"resource");
+        head(s, "resource");
         word(s.s, item.ident);
         print_type_params(s, tps);
         popen(s);
-        word_space(s, dt.decl.inputs[0].ident + ~":");
+        word_space(s, dt.decl.inputs[0].ident + ":");
         print_type(s, dt.decl.inputs[0].ty);
         pclose(s);
         space(s.s);
@@ -551,7 +545,7 @@ fn print_inner_attributes(s: &ps, attrs: &[ast::attribute]) {
         alt attr.node.style {
           ast::attr_inner. {
             print_attribute(s, attr);
-            word(s.s, ~";");
+            word(s.s, ";");
             count += 1;
           }
           _ {/* fallthrough */ }
@@ -563,9 +557,9 @@ fn print_inner_attributes(s: &ps, attrs: &[ast::attribute]) {
 fn print_attribute(s: &ps, attr: &ast::attribute) {
     hardbreak_if_not_bol(s);
     maybe_print_comment(s, attr.span.lo);
-    word(s.s, ~"#[");
+    word(s.s, "#[");
     print_meta_item(s, @attr.node.value);
-    word(s.s, ~"]");
+    word(s.s, "]");
 }
 
 fn print_stmt(s: &ps, st: &ast::stmt) {
@@ -574,7 +568,7 @@ fn print_stmt(s: &ps, st: &ast::stmt) {
       ast::stmt_decl(decl, _) { print_decl(s, decl); }
       ast::stmt_expr(expr, _) { space_if_not_bol(s); print_expr(s, expr); }
     }
-    if parse::parser::stmt_ends_with_semi(st) { word(s.s, ~";"); }
+    if parse::parser::stmt_ends_with_semi(st) { word(s.s, ";"); }
     maybe_print_trailing_comment(s, st.span, none::<uint>);
 }
 
@@ -586,16 +580,13 @@ tag embed_type { block_macro; block_block_fn; block_normal; }
 
 fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type,
                                  indented: uint) {
-    alt blk.node.rules {
-      ast::unchecked. { word(s.s, ~"unchecked"); }
-      _ {}
-    }
+    alt blk.node.rules { ast::unchecked. { word(s.s, "unchecked"); } _ { } }
 
     maybe_print_comment(s, blk.span.lo);
     let ann_node = node_block(s, blk);
     s.ann.pre(ann_node);
     alt embedded {
-      block_macro. { word(s.s, ~"#{"); end(s); }
+      block_macro. { word(s.s, "#{"); end(s); }
       block_block_fn. { end(s); }
       block_normal. { bopen(s); }
     }
@@ -649,7 +640,7 @@ fn print_possibly_embedded_block(s: &ps, blk: &ast::blk, embedded: embed_type,
               _ { false }
             };
 
-        if last_expr_is_block && next_expr_is_ambig { word(s.s, ~";"); }
+        if last_expr_is_block && next_expr_is_ambig { word(s.s, ";"); }
 
         fn expr_is_ambig(ex: @ast::expr) -> bool {
             // We're going to walk the expression to the 'left' looking for
@@ -712,8 +703,8 @@ fn print_maybe_parens_discrim(s: &ps, e: &@ast::expr) {
 
 fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
             elseopt: &option::t<@ast::expr>, chk: bool) {
-    head(s, ~"if");
-    if chk { word_nbsp(s, ~"check"); }
+    head(s, "if");
+    if chk { word_nbsp(s, "check"); }
     print_maybe_parens_discrim(s, test);
     space(s.s);
     print_block(s, blk);
@@ -723,11 +714,12 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
             alt _else.node {
 
 
+
               // "another else-if"
               ast::expr_if(i, t, e) {
                 cbox(s, indent_unit - 1u);
                 ibox(s, 0u);
-                word(s.s, ~" else if ");
+                word(s.s, " else if ");
                 print_expr(s, i);
                 space(s.s);
                 print_block(s, t);
@@ -735,11 +727,12 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
               }
 
 
+
               // "final else"
               ast::expr_block(b) {
                 cbox(s, indent_unit - 1u);
                 ibox(s, 0u);
-                word(s.s, ~" else ");
+                word(s.s, " else ");
                 print_block(s, b);
               }
             }
@@ -753,21 +746,21 @@ fn print_if(s: &ps, test: &@ast::expr, blk: &ast::blk,
 fn print_mac(s: &ps, m: &ast::mac) {
     alt m.node {
       ast::mac_invoc(path, arg, body) {
-        word(s.s, ~"#");
+        word(s.s, "#");
         print_path(s, path, false);
-        alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, ~" "); } }
+        alt arg.node { ast::expr_vec(_, _) { } _ { word(s.s, " "); } }
         print_expr(s, arg);
         // FIXME: extension 'body'
       }
       ast::mac_embed_type(ty) {
-        word(s.s, ~"#<");
+        word(s.s, "#<");
         print_type(s, ty);
-        word(s.s, ~">");
+        word(s.s, ">");
       }
       ast::mac_embed_block(blk) {
         print_possibly_embedded_block(s, blk, block_normal, indent_unit);
       }
-      ast::mac_ellipsis. { word(s.s, ~"..."); }
+      ast::mac_ellipsis. { word(s.s, "..."); }
     }
 }
 
@@ -779,38 +772,38 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
     alt expr.node {
       ast::expr_vec(exprs, mut) {
         ibox(s, indent_unit);
-        word(s.s, ~"[");
+        word(s.s, "[");
         if mut == ast::mut {
-            word(s.s, ~"mutable");
+            word(s.s, "mutable");
             if vec::len(exprs) > 0u { nbsp(s); }
         }
         commasep_exprs(s, inconsistent, exprs);
-        word(s.s, ~"]");
+        word(s.s, "]");
         end(s);
       }
       ast::expr_rec(fields, wth) {
         fn print_field(s: &ps, field: &ast::field) {
             ibox(s, indent_unit);
-            if field.node.mut == ast::mut { word_nbsp(s, ~"mutable"); }
+            if field.node.mut == ast::mut { word_nbsp(s, "mutable"); }
             word(s.s, field.node.ident);
-            word_space(s, ~":");
+            word_space(s, ":");
             print_expr(s, field.node.expr);
             end(s);
         }
         fn get_span(field: &ast::field) -> codemap::span { ret field.span; }
-        word(s.s, ~"{");
+        word(s.s, "{");
         commasep_cmnt(s, consistent, fields, print_field, get_span);
         alt wth {
           some(expr) {
             if vec::len(fields) > 0u { space(s.s); }
             ibox(s, indent_unit);
-            word_space(s, ~"with");
+            word_space(s, "with");
             print_expr(s, expr);
             end(s);
           }
           _ { }
         }
-        word(s.s, ~"}");
+        word(s.s, "}");
       }
       ast::expr_tup(exprs) {
         popen(s);
@@ -824,17 +817,17 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
         pclose(s);
       }
       ast::expr_self_method(ident) {
-        word(s.s, ~"self.");
+        word(s.s, "self.");
         print_ident(s, ident);
       }
       ast::expr_bind(func, args) {
         fn print_opt(s: &ps, expr: &option::t<@ast::expr>) {
             alt expr {
               some(expr) { print_expr(s, expr); }
-              _ { word(s.s, ~"_"); }
+              _ { word(s.s, "_"); }
             }
         }
-        word_nbsp(s, ~"bind");
+        word_nbsp(s, "bind");
         print_expr(s, func);
         popen(s);
         commasep(s, inconsistent, args, print_opt);
@@ -855,7 +848,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
       ast::expr_cast(expr, ty) {
         print_maybe_parens(s, expr, parse::parser::as_prec);
         space(s.s);
-        word_space(s, ~"as");
+        word_space(s, "as");
         print_type(s, ty);
       }
       ast::expr_if(test, blk, elseopt) {
@@ -867,42 +860,42 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
       ast::expr_ternary(test, then, els) {
         print_expr(s, test);
         space(s.s);
-        word_space(s, ~"?");
+        word_space(s, "?");
         print_expr(s, then);
         space(s.s);
-        word_space(s, ~":");
+        word_space(s, ":");
         print_expr(s, els);
       }
       ast::expr_while(test, blk) {
-        head(s, ~"while");
+        head(s, "while");
         print_maybe_parens_discrim(s, test);
         space(s.s);
         print_block(s, blk);
       }
       ast::expr_for(decl, expr, blk) {
-        head(s, ~"for");
+        head(s, "for");
         print_for_decl(s, decl, expr);
         space(s.s);
         print_block(s, blk);
       }
       ast::expr_for_each(decl, expr, blk) {
-        head(s, ~"for each");
+        head(s, "for each");
         print_for_decl(s, decl, expr);
         space(s.s);
         print_block(s, blk);
       }
       ast::expr_do_while(blk, expr) {
-        head(s, ~"do");
+        head(s, "do");
         space(s.s);
         print_block(s, blk);
         space(s.s);
-        word_space(s, ~"while");
+        word_space(s, "while");
         print_expr(s, expr);
       }
       ast::expr_alt(expr, arms) {
         cbox(s, alt_indent_unit);
         ibox(s, 4u);
-        word_nbsp(s, ~"alt");
+        word_nbsp(s, "alt");
         print_maybe_parens_discrim(s, expr);
         space(s.s);
         bopen(s);
@@ -914,17 +907,13 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
             for p: @ast::pat in arm.pats {
                 if first {
                     first = false;
-                } else { space(s.s); word_space(s, ~"|"); }
+                } else { space(s.s); word_space(s, "|"); }
                 print_pat(s, p);
             }
             space(s.s);
             alt arm.guard {
-              some(e) {
-                word_space(s, ~"when");
-                print_expr(s, e);
-                space(s.s);
-              }
-              none. {}
+              some(e) { word_space(s, "when"); print_expr(s, e); space(s.s); }
+              none. { }
             }
             print_possibly_embedded_block(s, arm.body, block_normal,
                                           alt_indent_unit);
@@ -940,7 +929,7 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
             cbox(s, indent_unit);
             // head-box, will be closed by print-block at start
             ibox(s, 0u);
-            word(s.s, ~"{");
+            word(s.s, "{");
             print_fn_block_args(s, f.decl);
             print_possibly_embedded_block(s, f.body, block_block_fn,
                                           indent_unit);
@@ -958,102 +947,100 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
         ibox(s, 0u);
         print_block(s, blk);
       }
-      ast::expr_copy(e) { word_space(s, ~"copy"); print_expr(s, e); }
+      ast::expr_copy(e) { word_space(s, "copy"); print_expr(s, e); }
       ast::expr_move(lhs, rhs) {
         print_expr(s, lhs);
         space(s.s);
-        word_space(s, ~"<-");
+        word_space(s, "<-");
         print_expr(s, rhs);
       }
       ast::expr_assign(lhs, rhs) {
         print_expr(s, lhs);
         space(s.s);
-        word_space(s, ~"=");
+        word_space(s, "=");
         print_expr(s, rhs);
       }
       ast::expr_swap(lhs, rhs) {
         print_expr(s, lhs);
         space(s.s);
-        word_space(s, ~"<->");
+        word_space(s, "<->");
         print_expr(s, rhs);
       }
       ast::expr_assign_op(op, lhs, rhs) {
         print_expr(s, lhs);
         space(s.s);
         word(s.s, ast_util::binop_to_str(op));
-        word_space(s, ~"=");
+        word_space(s, "=");
         print_expr(s, rhs);
       }
       ast::expr_field(expr, id) {
         print_expr_parens_if_unary(s, expr);
-        word(s.s, ~".");
+        word(s.s, ".");
         word(s.s, id);
       }
       ast::expr_index(expr, index) {
         print_expr_parens_if_unary(s, expr);
-        word(s.s, ~"[");
+        word(s.s, "[");
         print_expr(s, index);
-        word(s.s, ~"]");
+        word(s.s, "]");
       }
       ast::expr_path(path) { print_path(s, path, true); }
       ast::expr_fail(maybe_fail_val) {
-        word(s.s, ~"fail");
+        word(s.s, "fail");
         alt maybe_fail_val {
-          some(expr) { word(s.s, ~" "); print_expr(s, expr); }
+          some(expr) { word(s.s, " "); print_expr(s, expr); }
           _ { }
         }
       }
-      ast::expr_break. { word(s.s, ~"break"); }
-      ast::expr_cont. { word(s.s, ~"cont"); }
+      ast::expr_break. { word(s.s, "break"); }
+      ast::expr_cont. { word(s.s, "cont"); }
       ast::expr_ret(result) {
-        word(s.s, ~"ret");
+        word(s.s, "ret");
         alt result {
-          some(expr) { word(s.s, ~" "); print_expr(s, expr); }
+          some(expr) { word(s.s, " "); print_expr(s, expr); }
           _ { }
         }
       }
       ast::expr_put(result) {
-        word(s.s, ~"put");
+        word(s.s, "put");
         alt result {
-          some(expr) { word(s.s, ~" "); print_expr(s, expr); }
+          some(expr) { word(s.s, " "); print_expr(s, expr); }
           _ { }
         }
       }
-      ast::expr_be(result) { word_nbsp(s, ~"be"); print_expr(s, result); }
+      ast::expr_be(result) { word_nbsp(s, "be"); print_expr(s, result); }
       ast::expr_log(lvl, expr) {
-        alt lvl {
-          1 { word_nbsp(s, ~"log"); } 0 { word_nbsp(s, ~"log_err"); }
-        }
+        alt lvl { 1 { word_nbsp(s, "log"); } 0 { word_nbsp(s, "log_err"); } }
         print_expr(s, expr);
       }
       ast::expr_check(m, expr) {
         alt m {
-          ast::unchecked. { word_nbsp(s, ~"claim"); }
-          ast::checked. { word_nbsp(s, ~"check"); }
+          ast::unchecked. { word_nbsp(s, "claim"); }
+          ast::checked. { word_nbsp(s, "check"); }
         }
         popen(s);
         print_expr(s, expr);
         pclose(s);
       }
       ast::expr_assert(expr) {
-        word_nbsp(s, ~"assert");
+        word_nbsp(s, "assert");
         popen(s);
         print_expr(s, expr);
         pclose(s);
       }
       ast::expr_mac(m) { print_mac(s, m); }
       ast::expr_anon_obj(anon_obj) {
-        head(s, ~"obj");
+        head(s, "obj");
 
         // Fields
         popen(s);
         fn print_field(s: &ps, field: &ast::anon_obj_field) {
             ibox(s, indent_unit);
             print_mutability(s, field.mut);
-            word_space(s, field.ident + ~":");
+            word_space(s, field.ident + ":");
             print_type(s, field.ty);
             space(s.s);
-            word_space(s, ~"=");
+            word_space(s, "=");
             print_expr(s, field.expr);
             end(s);
         }
@@ -1077,18 +1064,18 @@ fn print_expr(s: &ps, expr: &@ast::expr) {
             maybe_print_comment(s, meth.span.lo);
             print_fn(s, meth.node.meth.decl, meth.node.meth.proto,
                      meth.node.ident, typarams, []);
-            word(s.s, ~" ");
+            word(s.s, " ");
             print_block(s, meth.node.meth.body);
         }
 
         // With object
         alt anon_obj.inner_obj {
           none. { }
-          some(e) { space(s.s); word_space(s, ~"with"); print_expr(s, e); }
+          some(e) { space(s.s); word_space(s, "with"); print_expr(s, e); }
         }
         bclose(s, expr.span);
       }
-      ast::expr_uniq(expr) { word(s.s, ~"~"); print_expr(s, expr); }
+      ast::expr_uniq(expr) { word(s.s, "~"); print_expr(s, expr); }
     }
     s.ann.post(ann_node);
     end(s);
@@ -1105,7 +1092,7 @@ fn print_local_decl(s: &ps, loc: &@ast::local) {
     print_pat(s, loc.node.pat);
     alt loc.node.ty.node {
       ast::ty_infer. { }
-      _ { word_space(s, ~":"); print_type(s, loc.node.ty); }
+      _ { word_space(s, ":"); print_type(s, loc.node.ty); }
     }
 }
 
@@ -1115,7 +1102,7 @@ fn print_decl(s: &ps, decl: &@ast::decl) {
       ast::decl_local(locs) {
         space_if_not_bol(s);
         ibox(s, indent_unit);
-        word_nbsp(s, ~"let");
+        word_nbsp(s, "let");
         fn print_local(s: &ps, loc: &@ast::local) {
             ibox(s, indent_unit);
             print_local_decl(s, loc);
@@ -1124,8 +1111,8 @@ fn print_decl(s: &ps, decl: &@ast::decl) {
               some(init) {
                 nbsp(s);
                 alt init.op {
-                  ast::init_assign. { word_space(s, ~"="); }
-                  ast::init_move. { word_space(s, ~"<-"); }
+                  ast::init_assign. { word_space(s, "="); }
+                  ast::init_move. { word_space(s, "<-"); }
                 }
                 print_expr(s, init.expr);
               }
@@ -1139,30 +1126,28 @@ fn print_decl(s: &ps, decl: &@ast::decl) {
     }
 }
 
-fn print_ident(s: &ps, ident: &ast::ident) {
-    word(s.s, ident);
-}
+fn print_ident(s: &ps, ident: &ast::ident) { word(s.s, ident); }
 
 fn print_for_decl(s: &ps, loc: &@ast::local, coll: &@ast::expr) {
     print_local_decl(s, loc);
     space(s.s);
-    word_space(s, ~"in");
+    word_space(s, "in");
     print_expr(s, coll);
 }
 
 fn print_path(s: &ps, path: &ast::path, colons_before_params: bool) {
     maybe_print_comment(s, path.span.lo);
-    if path.node.global { word(s.s, ~"::"); }
+    if path.node.global { word(s.s, "::"); }
     let first = true;
     for id: ast::ident in path.node.idents {
-        if first { first = false; } else { word(s.s, ~"::"); }
+        if first { first = false; } else { word(s.s, "::"); }
         word(s.s, id);
     }
     if vec::len(path.node.types) > 0u {
-        if colons_before_params { word(s.s, ~"::"); }
-        word(s.s, ~"<");
+        if colons_before_params { word(s.s, "::"); }
+        word(s.s, "<");
         commasep(s, inconsistent, path.node.types, print_type);
-        word(s.s, ~">");
+        word(s.s, ">");
     }
 }
 
@@ -1171,7 +1156,7 @@ fn print_pat(s: &ps, pat: &@ast::pat) {
     let ann_node = node_pat(s, pat);
     s.ann.pre(ann_node);
     alt pat.node {
-      ast::pat_wild. { word(s.s, ~"_"); }
+      ast::pat_wild. { word(s.s, "_"); }
       ast::pat_bind(id) { word(s.s, id); }
       ast::pat_lit(lit) { print_literal(s, lit); }
       ast::pat_tag(path, args) {
@@ -1180,31 +1165,31 @@ fn print_pat(s: &ps, pat: &@ast::pat) {
             popen(s);
             commasep(s, inconsistent, args, print_pat);
             pclose(s);
-        } else { word(s.s, ~"."); }
+        } else { word(s.s, "."); }
       }
       ast::pat_rec(fields, etc) {
-        word(s.s, ~"{");
+        word(s.s, "{");
         fn print_field(s: &ps, f: &ast::field_pat) {
             cbox(s, indent_unit);
             word(s.s, f.ident);
-            word_space(s, ~":");
+            word_space(s, ":");
             print_pat(s, f.pat);
             end(s);
         }
         fn get_span(f: &ast::field_pat) -> codemap::span { ret f.pat.span; }
         commasep_cmnt(s, consistent, fields, print_field, get_span);
         if etc {
-            if vec::len(fields) != 0u { word_space(s, ~","); }
-            word(s.s, ~"_");
+            if vec::len(fields) != 0u { word_space(s, ","); }
+            word(s.s, "_");
         }
-        word(s.s, ~"}");
+        word(s.s, "}");
       }
       ast::pat_tup(elts) {
         popen(s);
         commasep(s, inconsistent, elts, print_pat);
         pclose(s);
       }
-      ast::pat_box(inner) { word(s.s, ~"@"); print_pat(s, inner); }
+      ast::pat_box(inner) { word(s.s, "@"); print_pat(s, inner); }
     }
     s.ann.post(ann_node);
 }
@@ -1213,7 +1198,7 @@ fn print_fn(s: &ps, decl: ast::fn_decl, proto: ast::proto, name: &ast::ident,
             typarams: &[ast::ty_param], constrs: [@ast::constr]) {
     alt decl.purity {
       ast::impure_fn. { head(s, proto_to_str(proto)); }
-      _ { head(s, ~"pure fn"); }
+      _ { head(s, "pure fn"); }
     }
     word(s.s, name);
     print_type_params(s, typarams);
@@ -1225,7 +1210,7 @@ fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl,
     popen(s);
     fn print_arg(s: &ps, x: &ast::arg) {
         ibox(s, indent_unit);
-        word_space(s, x.ident + ~":");
+        word_space(s, x.ident + ":");
         print_alias(s, x.mode);
         print_type(s, x.ty);
         end(s);
@@ -1236,13 +1221,13 @@ fn print_fn_args_and_ret(s: &ps, decl: &ast::fn_decl,
     maybe_print_comment(s, decl.output.span.lo);
     if decl.output.node != ast::ty_nil {
         space_if_not_bol(s);
-        word_space(s, ~"->");
+        word_space(s, "->");
         print_type(s, decl.output);
     }
 }
 
 fn print_fn_block_args(s: &ps, decl: &ast::fn_decl) {
-    word(s.s, ~"|");
+    word(s.s, "|");
     fn print_arg(s: &ps, x: &ast::arg) {
         ibox(s, indent_unit);
         print_alias(s, x.mode);
@@ -1250,36 +1235,36 @@ fn print_fn_block_args(s: &ps, decl: &ast::fn_decl) {
         end(s);
     }
     commasep(s, inconsistent, decl.inputs, print_arg);
-    word(s.s, ~"|");
+    word(s.s, "|");
     maybe_print_comment(s, decl.output.span.lo);
 }
 
 fn print_alias(s: &ps, m: ast::mode) {
     alt m {
-      ast::alias(true) { word_space(s, ~"&mutable"); }
-      ast::alias(false) { word(s.s, ~"&"); }
-      ast::move. { word(s.s, ~"-"); }
+      ast::alias(true) { word_space(s, "&mutable"); }
+      ast::alias(false) { word(s.s, "&"); }
+      ast::move. { word(s.s, "-"); }
       ast::val. { }
     }
 }
 
 fn print_kind(s: &ps, kind: ast::kind) {
     alt kind {
-      ast::kind_unique. { word(s.s, ~"~"); }
-      ast::kind_shared. { word(s.s, ~"@"); }
+      ast::kind_unique. { word(s.s, "~"); }
+      ast::kind_shared. { word(s.s, "@"); }
       _ {/* fallthrough */ }
     }
 }
 
 fn print_type_params(s: &ps, params: &[ast::ty_param]) {
     if vec::len(params) > 0u {
-        word(s.s, ~"<");
+        word(s.s, "<");
         fn printParam(s: &ps, param: &ast::ty_param) {
             print_kind(s, param.kind);
             word(s.s, param.ident);
         }
         commasep(s, inconsistent, params, printParam);
-        word(s.s, ~">");
+        word(s.s, ">");
     }
 }
 
@@ -1289,7 +1274,7 @@ fn print_meta_item(s: &ps, item: &@ast::meta_item) {
       ast::meta_word(name) { word(s.s, name); }
       ast::meta_name_value(name, value) {
         word_space(s, name);
-        word_space(s, ~"=");
+        word_space(s, "=");
         print_literal(s, @value);
       }
       ast::meta_list(name, items) {
@@ -1307,7 +1292,7 @@ fn print_view_item(s: &ps, item: &@ast::view_item) {
     maybe_print_comment(s, item.span.lo);
     alt item.node {
       ast::view_item_use(id, mta, _) {
-        head(s, ~"use");
+        head(s, "use");
         word(s.s, id);
         if vec::len(mta) > 0u {
             popen(s);
@@ -1316,47 +1301,43 @@ fn print_view_item(s: &ps, item: &@ast::view_item) {
         }
       }
       ast::view_item_import(id, ids, _) {
-        head(s, ~"import");
+        head(s, "import");
         if !str::eq(id, ids[vec::len(ids) - 1u]) {
             word_space(s, id);
-            word_space(s, ~"=");
+            word_space(s, "=");
         }
         let first = true;
         for elt: ast::ident in ids {
-            if first { first = false; } else { word(s.s, ~"::"); }
+            if first { first = false; } else { word(s.s, "::"); }
             word(s.s, elt);
         }
       }
       ast::view_item_import_from(mod_path, idents, _) {
-        head(s, ~"import");
-        for elt: ast::ident in mod_path {
-            word(s.s, elt); word(s.s, ~"::");
-        }
-        word(s.s, ~"{");
+        head(s, "import");
+        for elt: ast::ident in mod_path { word(s.s, elt); word(s.s, "::"); }
+        word(s.s, "{");
         commasep(s, inconsistent, idents,
                  fn (s: &ps, w: &ast::import_ident) {
                      word(s.s, w.node.name)
                  });
-        word(s.s, ~"}");
+        word(s.s, "}");
       }
       ast::view_item_import_glob(ids, _) {
-        head(s, ~"import");
+        head(s, "import");
         let first = true;
         for elt: ast::ident in ids {
-            if first { first = false; } else { word(s.s, ~"::"); }
+            if first { first = false; } else { word(s.s, "::"); }
             word(s.s, elt);
         }
-        word(s.s, ~"::*");
+        word(s.s, "::*");
       }
       ast::view_item_export(ids, _) {
-        head(s, ~"export");
+        head(s, "export");
         commasep(s, inconsistent, ids,
-                 fn (s: &ps, w: &ast::ident) {
-                     word(s.s, w)
-                 });
+                 fn (s: &ps, w: &ast::ident) { word(s.s, w) });
       }
     }
-    word(s.s, ~";");
+    word(s.s, ";");
     end(s); // end inner head-block
 
     end(s); // end outer head-block
@@ -1380,6 +1361,7 @@ fn need_parens(expr: &@ast::expr, outer_prec: int) -> bool {
       ast::expr_ternary(_, _, _) { parse::parser::ternary_prec < outer_prec }
 
 
+
       // This may be too conservative in some cases
       ast::expr_assign(_, _) {
         true
@@ -1406,8 +1388,8 @@ fn print_maybe_parens(s: &ps, expr: &@ast::expr, outer_prec: int) {
 
 fn print_mutability(s: &ps, mut: &ast::mutability) {
     alt mut {
-      ast::mut. { word_nbsp(s, ~"mutable"); }
-      ast::maybe_mut. { word_nbsp(s, ~"mutable?"); }
+      ast::mut. { word_nbsp(s, "mutable"); }
+      ast::maybe_mut. { word_nbsp(s, "mutable?"); }
       ast::imm. {/* nothing */ }
     }
 }
@@ -1422,13 +1404,7 @@ fn print_ty_fn(s: &ps, proto: &ast::proto, id: &option::t<ast::ident>,
                cf: &ast::controlflow, constrs: &[@ast::constr]) {
     ibox(s, indent_unit);
     word(s.s, proto_to_str(proto));
-    alt id {
-      some(id) {
-        word(s.s, ~" ");
-        word(s.s, id);
-      }
-      _ { }
-    }
+    alt id { some(id) { word(s.s, " "); word(s.s, id); } _ { } }
     zerobreak(s.s);
     popen(s);
     fn print_arg(s: &ps, input: &ast::ty_arg) {
@@ -1441,10 +1417,10 @@ fn print_ty_fn(s: &ps, proto: &ast::proto, id: &option::t<ast::ident>,
     if output.node != ast::ty_nil {
         space_if_not_bol(s);
         ibox(s, indent_unit);
-        word_space(s, ~"->");
+        word_space(s, "->");
         alt cf {
           ast::return. { print_type(s, output); }
-          ast::noreturn. { word_nbsp(s, ~"!"); }
+          ast::noreturn. { word_nbsp(s, "!"); }
         }
         end(s);
     }
@@ -1495,25 +1471,19 @@ fn print_literal(s: &ps, lit: &@ast::lit) {
     maybe_print_comment(s, lit.span.lo);
     alt next_lit(s) {
       some(lt) {
-        if lt.pos == lit.span.lo {
-            word(s.s, lt.lit);
-            s.cur_lit += 1u;
-            ret;
-        }
+        if lt.pos == lit.span.lo { word(s.s, lt.lit); s.cur_lit += 1u; ret; }
       }
       _ { }
     }
     alt lit.node {
-      ast::lit_str(st) {
-        print_string(s, st);
-      }
+      ast::lit_str(st) { print_string(s, st); }
       ast::lit_char(ch) {
         word(s.s,
-             ~"'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') +
-                 ~"'");
+             "'" + escape_str(str::unsafe_from_bytes([ch as u8]), '\'') +
+                 "'");
       }
       ast::lit_int(val) { word(s.s, int::str(val)); }
-      ast::lit_uint(val) { word(s.s, uint::str(val) + ~"u"); }
+      ast::lit_uint(val) { word(s.s, uint::str(val) + "u"); }
       ast::lit_float(fstr) { word(s.s, fstr); }
       ast::lit_mach_int(mach, val) {
         word(s.s, int::str(val as int));
@@ -1524,14 +1494,14 @@ fn print_literal(s: &ps, lit: &@ast::lit) {
         word(s.s, val);
         word(s.s, ast_util::ty_mach_to_str(mach));
       }
-      ast::lit_nil. { word(s.s, ~"()"); }
+      ast::lit_nil. { word(s.s, "()"); }
       ast::lit_bool(val) {
-        if val { word(s.s, ~"true"); } else { word(s.s, ~"false"); }
+        if val { word(s.s, "true"); } else { word(s.s, "false"); }
       }
     }
 }
 
-fn lit_to_str(l: &@ast::lit) -> istr { be to_str(l, print_literal); }
+fn lit_to_str(l: &@ast::lit) -> str { be to_str(l, print_literal); }
 
 fn next_lit(s: &ps) -> option::t<lexer::lit> {
     alt s.literals {
@@ -1568,26 +1538,22 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
       }
       lexer::isolated. {
         pprust::hardbreak_if_not_bol(s);
-        for line: istr in cmnt.lines {
+        for line: str in cmnt.lines {
             // Don't print empty lines because they will end up as trailing
             // whitespace
-            if str::is_not_empty(line) {
-                word(s.s, line);
-            }
+            if str::is_not_empty(line) { word(s.s, line); }
             hardbreak(s.s);
         }
       }
       lexer::trailing. {
-        word(s.s, ~" ");
+        word(s.s, " ");
         if vec::len(cmnt.lines) == 1u {
             word(s.s, cmnt.lines[0]);
             hardbreak(s.s);
         } else {
             ibox(s, 0u);
-            for line: istr in cmnt.lines {
-                if str::is_not_empty(line) {
-                    word(s.s, line);
-                }
+            for line: str in cmnt.lines {
+                if str::is_not_empty(line) { word(s.s, line); }
                 hardbreak(s.s);
             }
             end(s);
@@ -1597,7 +1563,7 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
         // We need to do at least one, possibly two hardbreaks.
         let is_semi =
             alt s.s.last_token() {
-              pp::STRING(s, _) { s == ~";" }
+              pp::STRING(s, _) { s == ";" }
               _ { false }
             };
         if is_semi || is_begin(s) || is_end(s) { hardbreak(s.s) }
@@ -1606,24 +1572,24 @@ fn print_comment(s: &ps, cmnt: lexer::cmnt) {
     }
 }
 
-fn print_string(s: &ps, st: &istr) {
-    word(s.s, ~"\"");
+fn print_string(s: &ps, st: &str) {
+    word(s.s, "\"");
     word(s.s, escape_str(st, '"'));
-    word(s.s, ~"\"");
+    word(s.s, "\"");
 }
 
-fn escape_str(st: &istr, to_escape: char) -> istr {
-    let out: istr = ~"";
+fn escape_str(st: &str, to_escape: char) -> str {
+    let out: str = "";
     let len = str::byte_len(st);
     let i = 0u;
     while i < len {
         alt st[i] as char {
-          '\n' { out += ~"\\n"; }
-          '\t' { out += ~"\\t"; }
-          '\r' { out += ~"\\r"; }
-          '\\' { out += ~"\\\\"; }
+          '\n' { out += "\\n"; }
+          '\t' { out += "\\t"; }
+          '\r' { out += "\\r"; }
+          '\\' { out += "\\\\"; }
           cur {
-            if cur == to_escape { out += ~"\\"; }
+            if cur == to_escape { out += "\\"; }
             // FIXME some (or all?) non-ascii things should be escaped
 
             str::push_char(out, cur);
@@ -1634,7 +1600,7 @@ fn escape_str(st: &istr, to_escape: char) -> istr {
     ret out;
 }
 
-fn to_str<T>(t: &T, f: fn(&ps, &T)) -> istr {
+fn to_str<T>(t: &T, f: fn(&ps, &T)) -> str {
     let writer = io::string_writer();
     let s = rust_printer(writer.get_writer());
     f(s, t);
@@ -1655,23 +1621,22 @@ fn next_comment(s: &ps) -> option::t<lexer::cmnt> {
 
 // Removing the aliases from the type of f in the next two functions
 // triggers memory corruption, but I haven't isolated the bug yet. FIXME
-fn constr_args_to_str<T>(f: &fn(&T) -> istr, args: &[@ast::sp_constr_arg<T>])
-   -> istr {
+fn constr_args_to_str<T>(f: &fn(&T) -> str, args: &[@ast::sp_constr_arg<T>])
+   -> str {
     let comma = false;
-    let s = ~"(";
+    let s = "(";
     for a: @ast::sp_constr_arg<T> in args {
-        if comma { s += ~", "; } else { comma = true; }
+        if comma { s += ", "; } else { comma = true; }
         s += constr_arg_to_str::<T>(f, a.node);
     }
-    s += ~")";
+    s += ")";
     ret s;
 }
 
-fn constr_arg_to_str<T>(f: &fn(&T) -> istr,
-                        c: &ast::constr_arg_general_<T>) ->
-   istr {
+fn constr_arg_to_str<T>(f: &fn(&T) -> str, c: &ast::constr_arg_general_<T>) ->
+   str {
     alt c {
-      ast::carg_base. { ret ~"*"; }
+      ast::carg_base. { ret "*"; }
       ast::carg_ident(i) { ret f(i); }
       ast::carg_lit(l) { ret lit_to_str(l); }
     }
@@ -1680,56 +1645,56 @@ fn constr_arg_to_str<T>(f: &fn(&T) -> istr,
 // needed b/c constr_args_to_str needs
 // something that takes an alias
 // (argh)
-fn uint_to_str(i: &uint) -> istr { ret uint::str(i); }
+fn uint_to_str(i: &uint) -> str { ret uint::str(i); }
 
-fn ast_ty_fn_constr_to_str(c: &@ast::constr) -> istr {
+fn ast_ty_fn_constr_to_str(c: &@ast::constr) -> str {
     ret path_to_str(c.node.path) +
             constr_args_to_str(uint_to_str, c.node.args);
 }
 
 // FIXME: fix repeated code
-fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> istr {
-    let s = ~"";
+fn ast_ty_fn_constrs_str(constrs: &[@ast::constr]) -> str {
+    let s = "";
     let colon = true;
     for c: @ast::constr in constrs {
-        if colon { s += ~" : "; colon = false; } else { s += ~", "; }
+        if colon { s += " : "; colon = false; } else { s += ", "; }
         s += ast_ty_fn_constr_to_str(c);
     }
     ret s;
 }
 
-fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> istr {
+fn fn_arg_idx_to_str(decl: &ast::fn_decl, idx: &uint) -> str {
     decl.inputs[idx].ident
 }
 
-fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> istr {
+fn ast_fn_constr_to_str(decl: &ast::fn_decl, c: &@ast::constr) -> str {
     let arg_to_str = bind fn_arg_idx_to_str(decl, _);
     ret path_to_str(c.node.path) +
             constr_args_to_str(arg_to_str, c.node.args);
 }
 
 // FIXME: fix repeated code
-fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> istr {
-    let s = ~"";
+fn ast_fn_constrs_str(decl: &ast::fn_decl, constrs: &[@ast::constr]) -> str {
+    let s = "";
     let colon = true;
     for c: @ast::constr in constrs {
-        if colon { s += ~" : "; colon = false; } else { s += ~", "; }
+        if colon { s += " : "; colon = false; } else { s += ", "; }
         s += ast_fn_constr_to_str(decl, c);
     }
     ret s;
 }
 
-fn proto_to_str(p: &ast::proto) -> istr {
+fn proto_to_str(p: &ast::proto) -> str {
     ret alt p {
-          ast::proto_fn. { ~"fn" }
-          ast::proto_iter. { ~"iter" }
-          ast::proto_block. { ~"block" }
-          ast::proto_closure. { ~"lambda" }
+          ast::proto_fn. { "fn" }
+          ast::proto_iter. { "iter" }
+          ast::proto_block. { "block" }
+          ast::proto_closure. { "lambda" }
         };
 }
 
-fn ty_constr_to_str(c: &@ast::ty_constr) -> istr {
-    fn ty_constr_path_to_str(p: &ast::path) -> istr { ~"*." + path_to_str(p) }
+fn ty_constr_to_str(c: &@ast::ty_constr) -> str {
+    fn ty_constr_path_to_str(p: &ast::path) -> str { "*." + path_to_str(p) }
 
     ret path_to_str(c.node.path) +
             constr_args_to_str::<ast::path>(ty_constr_path_to_str,
@@ -1737,11 +1702,11 @@ fn ty_constr_to_str(c: &@ast::ty_constr) -> istr {
 }
 
 
-fn ast_ty_constrs_str(constrs: &[@ast::ty_constr]) -> istr {
-    let s = ~"";
+fn ast_ty_constrs_str(constrs: &[@ast::ty_constr]) -> str {
+    let s = "";
     let colon = true;
     for c: @ast::ty_constr in constrs {
-        if colon { s += ~" : "; colon = false; } else { s += ~", "; }
+        if colon { s += " : "; colon = false; } else { s += ", "; }
         s += ty_constr_to_str(c);
     }
     ret s;
diff --git a/src/comp/util/common.rs b/src/comp/util/common.rs
index 822cdbe0533..ba86b99261f 100644
--- a/src/comp/util/common.rs
+++ b/src/comp/util/common.rs
@@ -104,10 +104,7 @@ fn local_rhs_span(l: &@ast::local, def: &span) -> span {
 fn lit_eq(l: &@ast::lit, m: &@ast::lit) -> bool {
     alt l.node {
       ast::lit_str(s) {
-        alt m.node {
-          ast::lit_str(t) { ret s == t }
-          _ { ret false; }
-        }
+        alt m.node { ast::lit_str(t) { ret s == t } _ { ret false; } }
       }
       ast::lit_char(c) {
         alt m.node { ast::lit_char(d) { ret c == d; } _ { ret false; } }
@@ -144,28 +141,28 @@ fn lit_eq(l: &@ast::lit, m: &@ast::lit) -> bool {
 
 tag call_kind { kind_call; kind_spawn; kind_bind; kind_for_each; }
 
-fn call_kind_str(c: call_kind) -> istr {
+fn call_kind_str(c: call_kind) -> str {
     alt c {
-      kind_call. { ~"Call" }
-      kind_spawn. { ~"Spawn" }
-      kind_bind. { ~"Bind" }
-      kind_for_each. { ~"For-Each" }
+      kind_call. { "Call" }
+      kind_spawn. { "Spawn" }
+      kind_bind. { "Bind" }
+      kind_for_each. { "For-Each" }
     }
 }
 
 fn is_main_name(path: &[ast::ident]) -> bool {
-    str::eq(option::get(std::vec::last(path)), ~"main")
+    str::eq(option::get(std::vec::last(path)), "main")
 }
 
 // FIXME mode this to std::float when editing the stdlib no longer
 // requires a snapshot
-fn float_to_str(num: float, digits: uint) -> istr {
-    let accum = if num < 0.0 { num = -num; ~"-" } else { ~"" };
+fn float_to_str(num: float, digits: uint) -> str {
+    let accum = if num < 0.0 { num = -num; "-" } else { "" };
     let trunc = num as uint;
     let frac = num - (trunc as float);
     accum += uint::str(trunc);
     if frac == 0.0 || digits == 0u { ret accum; }
-    accum += ~".";
+    accum += ".";
     while digits > 0u && frac > 0.0 {
         frac *= 10.0;
         let digit = frac as uint;
diff --git a/src/comp/util/ppaux.rs b/src/comp/util/ppaux.rs
index f227836f492..8846d5c5380 100644
--- a/src/comp/util/ppaux.rs
+++ b/src/comp/util/ppaux.rs
@@ -21,32 +21,31 @@ import syntax::ast;
 import middle::ast_map;
 import metadata::csearch;
 
-fn mode_str(m: &ty::mode) -> istr {
+fn mode_str(m: &ty::mode) -> str {
     alt m {
-      mo_val. { ~"" }
-      mo_alias(false) { ~"&" }
-      mo_alias(true) { ~"&mutable " }
-      mo_move. { ~"-" }
+      mo_val. { "" }
+      mo_alias(false) { "&" }
+      mo_alias(true) { "&mutable " }
+      mo_move. { "-" }
     }
 }
 
-fn mode_str_1(m: &ty::mode) -> istr {
-    alt m { mo_val. { ~"val" } _ { mode_str(m) } }
+fn mode_str_1(m: &ty::mode) -> str {
+    alt m { mo_val. { "val" } _ { mode_str(m) } }
 }
 
-fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> istr {
-    ret alt i {
-      none. { ~"anon" + int::str(id) }
-      some(s) { s }
-    };
+fn fn_ident_to_string(id: ast::node_id, i: &ast::fn_ident) -> str {
+    ret alt i { none. { "anon" + int::str(id) } some(s) { s } };
 }
 
-fn get_id_ident(cx: &ctxt, id: ast::def_id) -> istr {
+fn get_id_ident(cx: &ctxt, id: ast::def_id) -> str {
     if id.crate != ast::local_crate {
         alt cx.ext_map.find(id) {
-          some(j) { str::connect(j, ~"::") }
-          _ { fail (~"get_id_ident: can't find item in ext_map, id.crate = "
-                    + int::str(id.crate)) }
+          some(j) { str::connect(j, "::") }
+          _ {
+            fail "get_id_ident: can't find item in ext_map, id.crate = " +
+                     int::str(id.crate)
+          }
         }
     } else {
         alt cx.items.find(id.node) {
@@ -56,90 +55,79 @@ fn get_id_ident(cx: &ctxt, id: ast::def_id) -> istr {
     }
 }
 
-fn ty_to_str(cx: &ctxt, typ: &t) -> istr {
+fn ty_to_str(cx: &ctxt, typ: &t) -> str {
     fn fn_input_to_str(cx: &ctxt, input: &{mode: middle::ty::mode, ty: t}) ->
-       istr {
+       str {
         let s = mode_str(input.mode);
         ret s + ty_to_str(cx, input.ty);
     }
     fn fn_to_str(cx: &ctxt, proto: ast::proto, ident: option::t<ast::ident>,
                  inputs: &[arg], output: t, cf: ast::controlflow,
-                 constrs: &[@constr]) -> istr {
+                 constrs: &[@constr]) -> str {
         let s = proto_to_str(proto);
-        alt ident {
-          some(i) {
-            s += ~" ";
-            s += i;
-          }
-          _ { }
-        }
-        s += ~"(";
+        alt ident { some(i) { s += " "; s += i; } _ { } }
+        s += "(";
         let strs = [];
         for a: arg in inputs { strs += [fn_input_to_str(cx, a)]; }
-        s += str::connect(strs, ~", ");
-        s += ~")";
+        s += str::connect(strs, ", ");
+        s += ")";
         if struct(cx, output) != ty_nil {
             alt cf {
-              ast::noreturn. { s += ~" -> !"; }
-              ast::return. { s += ~" -> " + ty_to_str(cx, output); }
+              ast::noreturn. { s += " -> !"; }
+              ast::return. { s += " -> " + ty_to_str(cx, output); }
             }
         }
         s += constrs_str(constrs);
         ret s;
     }
-    fn method_to_str(cx: &ctxt, m: &method) -> istr {
+    fn method_to_str(cx: &ctxt, m: &method) -> str {
         ret fn_to_str(cx, m.proto, some::<ast::ident>(m.ident), m.inputs,
-                      m.output, m.cf, m.constrs) + ~";";
+                      m.output, m.cf, m.constrs) + ";";
     }
-    fn field_to_str(cx: &ctxt, f: &field) -> istr {
-        ret f.ident + ~": " + mt_to_str(cx, f.mt);
+    fn field_to_str(cx: &ctxt, f: &field) -> str {
+        ret f.ident + ": " + mt_to_str(cx, f.mt);
     }
-    fn mt_to_str(cx: &ctxt, m: &mt) -> istr {
+    fn mt_to_str(cx: &ctxt, m: &mt) -> str {
         let mstr;
         alt m.mut {
-          ast::mut. { mstr = ~"mutable "; }
-          ast::imm. { mstr = ~""; }
-          ast::maybe_mut. { mstr = ~"mutable? "; }
+          ast::mut. { mstr = "mutable "; }
+          ast::imm. { mstr = ""; }
+          ast::maybe_mut. { mstr = "mutable? "; }
         }
         ret mstr + ty_to_str(cx, m.ty);
     }
-    alt cname(cx, typ) {
-      some(cs) {
-        ret cs;
-      }
-      _ { }
-    }
+    alt cname(cx, typ) { some(cs) { ret cs; } _ { } }
     ret alt struct(cx, typ) {
-          ty_native(_) { ~"native" }
-          ty_nil. { ~"()" }
-          ty_bot. { ~"_|_" }
-          ty_bool. { ~"bool" }
-          ty_int. { ~"int" }
-          ty_float. { ~"float" }
-          ty_uint. { ~"uint" }
+          ty_native(_) { "native" }
+          ty_nil. { "()" }
+          ty_bot. { "_|_" }
+          ty_bool. { "bool" }
+          ty_int. { "int" }
+          ty_float. { "float" }
+          ty_uint. { "uint" }
           ty_machine(tm) { ty_mach_to_str(tm) }
-          ty_char. { ~"char" }
-          ty_istr. { ~"istr" }
-          ty_box(tm) { ~"@" + mt_to_str(cx, tm) }
-          ty_uniq(t) { ~"~" + ty_to_str(cx, t) }
-          ty_vec(tm) { ~"[" + mt_to_str(cx, tm) + ~"]" }
-          ty_type. { ~"type" }
+          ty_char. { "char" }
+          ty_istr. { "istr" }
+          ty_box(tm) { "@" + mt_to_str(cx, tm) }
+          ty_uniq(t) { "~" + ty_to_str(cx, t) }
+          ty_vec(tm) { "[" + mt_to_str(cx, tm) + "]" }
+          ty_type. { "type" }
           ty_rec(elems) {
-            let strs: [istr] = [];
+            let strs: [str] = [];
             for fld: field in elems { strs += [field_to_str(cx, fld)]; }
-            ~"{" + str::connect(strs, ~",") + ~"}"
+            "{" + str::connect(strs, ",") + "}"
           }
           ty_tup(elems) {
             let strs = [];
             for elem in elems { strs += [ty_to_str(cx, elem)]; }
-            ~"(" + str::connect(strs, ~",") + ~")"
+            "(" + str::connect(strs, ",") + ")"
           }
           ty_tag(id, tps) {
             let s = get_id_ident(cx, id);
             if vec::len::<t>(tps) > 0u {
-                let strs: [istr] = [];
+                let strs: [str] = [];
                 for typ: t in tps { strs += [ty_to_str(cx, typ)]; }
-                s += ~"[" + str::connect(strs, ~",") + ~"]";
+                s += "[" + str::connect(strs, ",") + "]";
             }
             s
           }
@@ -153,42 +141,42 @@ fn ty_to_str(cx: &ctxt, typ: &t) -> istr {
           ty_obj(meths) {
             let strs = [];
             for m: method in meths { strs += [method_to_str(cx, m)]; }
-            ~"obj {\n\t" + str::connect(strs, ~"\n\t") + ~"\n}"
+            "obj {\n\t" + str::connect(strs, "\n\t") + "\n}"
           }
           ty_res(id, _, _) { get_id_ident(cx, id) }
-          ty_var(v) { ~"<T" + int::str(v) + ~">" }
+          ty_var(v) { "<T" + int::str(v) + ">" }
           ty_param(id, _) {
-            ~"'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)])
+            "'" + str::unsafe_from_bytes([('a' as u8) + (id as u8)])
           }
           _ { ty_to_short_str(cx, typ) }
         }
 }
 
-fn ty_to_short_str(cx: &ctxt, typ: t) -> istr {
+fn ty_to_short_str(cx: &ctxt, typ: t) -> str {
     let s = encoder::encoded_ty(cx, typ);
     if str::byte_len(s) >= 32u { s = str::substr(s, 0u, 32u); }
     ret s;
 }
 
-fn constr_to_str(c: &@constr) -> istr {
+fn constr_to_str(c: &@constr) -> str {
     ret path_to_str(c.node.path) +
-        pprust::constr_args_to_str(pprust::uint_to_str, c.node.args);
+            pprust::constr_args_to_str(pprust::uint_to_str, c.node.args);
 }
 
-fn constrs_str(constrs: &[@constr]) -> istr {
-    let s = ~"";
+fn constrs_str(constrs: &[@constr]) -> str {
+    let s = "";
     let colon = true;
     for c: @constr in constrs {
-        if colon { s += ~" : "; colon = false; } else { s += ~", "; }
+        if colon { s += " : "; colon = false; } else { s += ", "; }
         s += constr_to_str(c);
     }
     ret s;
 }
 
 fn ty_constr_to_str<Q>(c: &@ast::spanned<ast::constr_general_<ast::path, Q>>)
-   -> istr {
+   -> str {
     ret path_to_str(c.node.path) +
-        constr_args_to_str::<ast::path>(path_to_str, c.node.args);
+            constr_args_to_str::<ast::path>(path_to_str, c.node.args);
 }
 
 // Local Variables:
diff --git a/src/fuzzer/fuzzer.rs b/src/fuzzer/fuzzer.rs
index b8a70dd1c9c..30128731782 100644
--- a/src/fuzzer/fuzzer.rs
+++ b/src/fuzzer/fuzzer.rs
@@ -20,28 +20,28 @@ import rustc::syntax::codemap;
 import rustc::syntax::parse::parser;
 import rustc::syntax::print::pprust;
 
-fn write_file(filename: &istr, content: &istr) {
+fn write_file(filename: &str, content: &str) {
     io::file_writer(filename, [io::create, io::truncate]).write_str(content);
     // Work around https://github.com/graydon/rust/issues/726
-    std::run::run_program(~"chmod", [~"644", filename]);
+    std::run::run_program("chmod", ["644", filename]);
 }
 
-fn file_contains(filename: &istr, needle: &istr) -> bool {
+fn file_contains(filename: &str, needle: &str) -> bool {
     let contents = io::read_whole_file_str(filename);
     ret str::find(contents, needle) != -1;
 }
 
-fn contains(haystack: &istr, needle: &istr) -> bool {
+fn contains(haystack: &str, needle: &str) -> bool {
     str::find(haystack, needle) != -1
 }
 
-fn find_rust_files(files: &mutable [istr], path: &istr) {
-    if str::ends_with(path, ~".rs") {
-        if file_contains(path, ~"xfail-test") {
+fn find_rust_files(files: &mutable [str], path: &str) {
+    if str::ends_with(path, ".rs") {
+        if file_contains(path, "xfail-test") {
             //log_err "Skipping " + path + " because it is marked as xfail-test";
         } else { files += [path]; }
     } else if fs::file_is_dir(path)
-        && str::find(path, ~"compile-fail") == -1 {
+        && str::find(path, "compile-fail") == -1 {
         for p in fs::list_dir(path) {
             find_rust_files(files, p);
         }
@@ -150,28 +150,28 @@ iter under(n: uint) -> uint {
 
 fn devnull() -> io::writer { std::io::string_writer().get_writer() }
 
-fn as_str(f: fn(io::writer)) -> istr {
+fn as_str(f: fn(io::writer)) -> str {
     let w = std::io::string_writer();
     f(w.get_writer());
     ret w.get_str();
 }
 
 fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap,
-                         filename: &istr) {
+                         filename: &str) {
     let exprs = steal_exprs(crate);
     let exprsL = vec::len(exprs);
     if exprsL < 100u {
         for each i: uint in under(uint::min(exprsL, 20u)) {
-            log_err ~"Replacing... " + pprust::expr_to_str(@exprs[i]);
+            log_err "Replacing... " + pprust::expr_to_str(@exprs[i]);
             for each j: uint in under(uint::min(exprsL, 5u)) {
-                log_err ~"With... " + pprust::expr_to_str(@exprs[j]);
+                log_err "With... " + pprust::expr_to_str(@exprs[j]);
                 let crate2 = @replace_expr_in_crate(crate, i, exprs[j].node);
                 // It would be best to test the *crate* for stability, but testing the
                 // string for stability is easier and ok for now.
                 let str3 =
                     as_str(bind pprust::print_crate(codemap, crate2,
                                                     filename,
-                                                    io::string_reader(~""), _,
+                                                    io::string_reader(""), _,
                                                     pprust::no_ann()));
                 // 1u would be sane here, but the pretty-printer currently has lots of whitespace and paren issues,
                 // and https://github.com/graydon/rust/issues/766 is hilarious.
@@ -186,61 +186,61 @@ fn check_variants_of_ast(crate: &ast::crate, codemap: &codemap::codemap,
 // - that would find many "false positives" or unimportant bugs
 // - that would be tricky, requiring use of tasks or serialization or randomness.
 // This seems to find plenty of bugs as it is :)
-fn check_whole_compiler(code: &istr) {
-    let filename = ~"test.rs";
+fn check_whole_compiler(code: &str) {
+    let filename = "test.rs";
     write_file(filename, code);
     let p =
         std::run::program_output(
-            ~"/Users/jruderman/code/rust/build/stage1/rustc",
-            [~"-c", filename]);
+            "/Users/jruderman/code/rust/build/stage1/rustc",
+            ["-c", filename]);
 
     //log_err #fmt("Status: %d", p.status);
     //log_err "Output: " + p.out;
-    if p.err != ~"" {
-        if contains(p.err, ~"argument of incompatible type") {
+    if p.err != "" {
+        if contains(p.err, "argument of incompatible type") {
             log_err "https://github.com/graydon/rust/issues/769";
         } else if contains(p.err,
-                           ~"Cannot create binary operator with two operands of differing type")
+                           "Cannot create binary operator with two operands of differing type")
          {
             log_err "https://github.com/graydon/rust/issues/770";
-        } else if contains(p.err, ~"May only branch on boolean predicates!") {
+        } else if contains(p.err, "May only branch on boolean predicates!") {
             log_err "https://github.com/graydon/rust/issues/770 or https://github.com/graydon/rust/issues/776";
-        } else if contains(p.err, ~"Invalid constantexpr cast!") &&
-                      contains(code, ~"!") {
+        } else if contains(p.err, "Invalid constantexpr cast!") &&
+                      contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/777";
         } else if contains(p.err,
-                           ~"Both operands to ICmp instruction are not of the same type!")
-                      && contains(code, ~"!") {
+                           "Both operands to ICmp instruction are not of the same type!")
+                      && contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/777 #issuecomment-1678487";
-        } else if contains(p.err, ~"Ptr must be a pointer to Val type!") &&
-                      contains(code, ~"!") {
+        } else if contains(p.err, "Ptr must be a pointer to Val type!") &&
+                      contains(code, "!") {
             log_err "https://github.com/graydon/rust/issues/779";
-        } else if contains(p.err, ~"Calling a function with bad signature!") &&
-                      (contains(code, ~"iter") || contains(code, ~"range")) {
+        } else if contains(p.err, "Calling a function with bad signature!") &&
+                      (contains(code, "iter") || contains(code, "range")) {
             log_err "https://github.com/graydon/rust/issues/771 - calling an iter fails";
-        } else if contains(p.err, ~"Calling a function with a bad signature!")
-                      && contains(code, ~"empty") {
+        } else if contains(p.err, "Calling a function with a bad signature!")
+                      && contains(code, "empty") {
             log_err "https://github.com/graydon/rust/issues/775 - possibly a modification of run-pass/import-glob-crate.rs";
-        } else if contains(p.err, ~"Invalid type for pointer element!") &&
-                      contains(code, ~"put") {
+        } else if contains(p.err, "Invalid type for pointer element!") &&
+                      contains(code, "put") {
             log_err "https://github.com/graydon/rust/issues/773 - put put ()";
-        } else if contains(p.err, ~"pointer being freed was not allocated") &&
-                      contains(p.out, ~"Out of stack space, sorry") {
+        } else if contains(p.err, "pointer being freed was not allocated") &&
+                      contains(p.out, "Out of stack space, sorry") {
             log_err "https://github.com/graydon/rust/issues/768 + https://github.com/graydon/rust/issues/778"
         } else {
-            log_err ~"Stderr: " + p.err;
+            log_err "Stderr: " + p.err;
             fail "Unfamiliar error message";
         }
-    } else if contains(p.out, ~"non-exhaustive match failure") &&
-                  contains(p.out, ~"alias.rs") {
+    } else if contains(p.out, "non-exhaustive match failure") &&
+                  contains(p.out, "alias.rs") {
         log_err "https://github.com/graydon/rust/issues/772";
-    } else if contains(p.out, ~"non-exhaustive match failure") &&
-                  contains(p.out, ~"trans.rs") && contains(code, ~"put") {
+    } else if contains(p.out, "non-exhaustive match failure") &&
+                  contains(p.out, "trans.rs") && contains(code, "put") {
         log_err "https://github.com/graydon/rust/issues/774";
-    } else if contains(p.out, ~"Out of stack space, sorry") {
+    } else if contains(p.out, "Out of stack space, sorry") {
         log_err "Possibly a variant of https://github.com/graydon/rust/issues/768";
     } else if p.status == 256 {
-        if !contains(p.out, ~"error:") {
+        if !contains(p.out, "error:") {
             fail "Exited with status 256 without a span-error";
         }
     } else if p.status == 11 {
@@ -248,8 +248,8 @@ fn check_whole_compiler(code: &istr) {
     } else if p.status != 0 { fail "Unfamiliar status code"; }
 }
 
-fn parse_and_print(code: &istr) -> istr {
-    let filename = ~"tmp.rs";
+fn parse_and_print(code: &str) -> str {
+    let filename = "tmp.rs";
     let sess = @{cm: codemap::new_codemap(), mutable next_id: 0};
     //write_file(filename, code);
     let crate = parser::parse_crate_from_source_str(
@@ -260,19 +260,19 @@ fn parse_and_print(code: &istr) -> istr {
                                         pprust::no_ann()));
 }
 
-fn content_is_dangerous_to_modify(code: &istr) -> bool {
+fn content_is_dangerous_to_modify(code: &str) -> bool {
     let dangerous_patterns =
-        [~"obj", // not safe to steal; https://github.com/graydon/rust/issues/761
-         ~"#macro", // not safe to steal things inside of it, because they have a special syntax
-         ~"#", // strange representation of the arguments to #fmt, for example
-         ~" be ", // don't want to replace its child with a non-call: "Non-call expression in tail call"
-         ~"@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768
+        ["obj", // not safe to steal; https://github.com/graydon/rust/issues/761
+         "#macro", // not safe to steal things inside of it, because they have a special syntax
+         "#", // strange representation of the arguments to #fmt, for example
+         " be ", // don't want to replace its child with a non-call: "Non-call expression in tail call"
+         "@"]; // hangs when compiling: https://github.com/graydon/rust/issues/768
 
-    for p: istr in dangerous_patterns { if contains(code, p) { ret true; } }
+    for p: str in dangerous_patterns { if contains(code, p) { ret true; } }
     ret false;
 }
 
-fn content_is_confusing(code: &istr) ->
+fn content_is_confusing(code: &str) ->
    bool { // https://github.com/graydon/rust/issues/671
           // https://github.com/graydon/rust/issues/669
           // https://github.com/graydon/rust/issues/669
@@ -282,16 +282,16 @@ fn content_is_confusing(code: &istr) ->
           // more precedence issues?
 
     let confusing_patterns =
-        [~"#macro", ~"][]", ~"][mutable]", ~"][mutable ]", ~"self", ~"spawn",
-         ~"bind", ~"\n\n\n\n\n", // https://github.com/graydon/rust/issues/759
-         ~" : ", // https://github.com/graydon/rust/issues/760
-         ~"if ret", ~"alt ret", ~"if fail", ~"alt fail"];
+        ["#macro", "][]", "][mutable]", "][mutable ]", "self", "spawn",
+         "bind", "\n\n\n\n\n", // https://github.com/graydon/rust/issues/759
+         " : ", // https://github.com/graydon/rust/issues/760
+         "if ret", "alt ret", "if fail", "alt fail"];
 
-    for p: istr in confusing_patterns { if contains(code, p) { ret true; } }
+    for p: str in confusing_patterns { if contains(code, p) { ret true; } }
     ret false;
 }
 
-fn file_is_confusing(filename: &istr) -> bool {
+fn file_is_confusing(filename: &str) -> bool {
 
     // https://github.com/graydon/rust/issues/674
 
@@ -302,16 +302,16 @@ fn file_is_confusing(filename: &istr) -> bool {
     // which i can't reproduce using "rustc
     // --pretty normal"???
     let confusing_files =
-        [~"block-expr-precedence.rs", ~"nil-pattern.rs",
-         ~"syntax-extension-fmt.rs",
-         ~"newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670
+        ["block-expr-precedence.rs", "nil-pattern.rs",
+         "syntax-extension-fmt.rs",
+         "newtype.rs"]; // modifying it hits something like https://github.com/graydon/rust/issues/670
 
     for f in confusing_files { if contains(filename, f) { ret true; } }
 
     ret false;
 }
 
-fn check_roundtrip_convergence(code: &istr, maxIters: uint) {
+fn check_roundtrip_convergence(code: &str, maxIters: uint) {
 
     let i = 0u;
     let new = code;
@@ -329,16 +329,16 @@ fn check_roundtrip_convergence(code: &istr, maxIters: uint) {
         log_err #fmt["Converged after %u iterations", i];
     } else {
         log_err #fmt["Did not converge after %u iterations!", i];
-        write_file(~"round-trip-a.rs", old);
-        write_file(~"round-trip-b.rs", new);
-        std::run::run_program(~"diff",
-                              [~"-w", ~"-u", ~"round-trip-a.rs",
-                               ~"round-trip-b.rs"]);
+        write_file("round-trip-a.rs", old);
+        write_file("round-trip-b.rs", new);
+        std::run::run_program("diff",
+                              ["-w", "-u", "round-trip-a.rs",
+                               "round-trip-b.rs"]);
         fail "Mismatch";
     }
 }
 
-fn check_convergence(files: &[istr]) {
+fn check_convergence(files: &[str]) {
     log_err #fmt["pp convergence tests: %u files", vec::len(files)];
     for file in files {
         if !file_is_confusing(file) {
@@ -352,14 +352,14 @@ fn check_convergence(files: &[istr]) {
     }
 }
 
-fn check_variants(files: &[istr]) {
+fn check_variants(files: &[str]) {
     for file in files {
         if !file_is_confusing(file) {
             let s = io::read_whole_file_str(file);
             if content_is_dangerous_to_modify(s) || content_is_confusing(s) {
                 cont;
             }
-            log_err ~"check_variants: " + file;
+            log_err "check_variants: " + file;
             let sess = @{cm: codemap::new_codemap(), mutable next_id: 0};
             let crate =
                 parser::parse_crate_from_source_str(
@@ -374,7 +374,7 @@ fn check_variants(files: &[istr]) {
     }
 }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     if vec::len(args) != 2u {
         log_err #fmt["usage: %s <testdir>", args[0]];
         ret;
diff --git a/src/fuzzer/ivec_fuzz.rs b/src/fuzzer/ivec_fuzz.rs
index 3dd24875c52..56d0d2ad97d 100644
--- a/src/fuzzer/ivec_fuzz.rs
+++ b/src/fuzzer/ivec_fuzz.rs
@@ -64,6 +64,7 @@ fn vec_edits<T>(v: &[T], xs: &[T]) -> [[T]] {
                   //if (Lv >= 3u) { edits += ~[vec_reverse(v)]; }
 
 
+
     }
     for each i: uint in ix(0u, 1u, Lv) { edits += [vec_omit(v, i)]; }
     for each i: uint in ix(0u, 1u, Lv) { edits += [vec_dup(v, i)]; }
diff --git a/src/lib/aio.rs b/src/lib/aio.rs
index cdb0e3fb90d..8d8b036933d 100644
--- a/src/lib/aio.rs
+++ b/src/lib/aio.rs
@@ -45,6 +45,7 @@ tag request {
 type ctx = chan<request>;
 
 fn ip_to_sbuf(ip: net::ip_addr) -> *u8 {
+
     // FIXME: This is broken. We're creating a vector, getting a pointer
     // to its buffer, then dropping the vector. On top of that, the vector
     // created by str::bytes is not null-terminated.
@@ -97,8 +98,7 @@ fn accept_task(client: client, events: chan<server_event>) {
 fn server_task(ip: net::ip_addr, portnum: int, events: chan<server_event>,
                server: chan<server>) {
     let accepter = port();
-    send(server,
-         rustrt::aio_serve(ip_to_sbuf(ip), portnum, chan(accepter)));
+    send(server, rustrt::aio_serve(ip_to_sbuf(ip), portnum, chan(accepter)));
 
     let client: client;
     while true {
diff --git a/src/lib/bitv.rs b/src/lib/bitv.rs
index 87eba87ce49..019aa32f36a 100644
--- a/src/lib/bitv.rs
+++ b/src/lib/bitv.rs
@@ -151,11 +151,9 @@ fn to_vec(v: &t) -> [uint] {
     ret vec::init_fn::<uint>(sub, v.nbits);
 }
 
-fn to_str(v: &t) -> istr {
-    let rs = ~"";
-    for i: uint in to_vec(v) {
-        if i == 1u { rs += ~"1"; } else { rs += ~"0"; }
-    }
+fn to_str(v: &t) -> str {
+    let rs = "";
+    for i: uint in to_vec(v) { if i == 1u { rs += "1"; } else { rs += "0"; } }
     ret rs;
 }
 
diff --git a/src/lib/comm.rs b/src/lib/comm.rs
index b5d1d3c7e93..f1ea9d485bc 100644
--- a/src/lib/comm.rs
+++ b/src/lib/comm.rs
@@ -12,8 +12,8 @@ native "rust" mod rustrt {
     type void;
     type rust_port;
 
-    fn chan_id_send<~T>(target_task: task::task,
-                        target_port: port_id, data: -T);
+    fn chan_id_send<~T>(target_task: task::task, target_port: port_id,
+                        data: -T);
 
     fn new_port(unit_sz: uint) -> *rust_port;
     fn del_port(po: *rust_port);
diff --git a/src/lib/deque.rs b/src/lib/deque.rs
index 5b2d8db418b..3cc75e2f3b6 100644
--- a/src/lib/deque.rs
+++ b/src/lib/deque.rs
@@ -27,6 +27,7 @@ fn create<@T>() -> t<T> {
 
 
 
+
     fn grow<@T>(nelts: uint, lo: uint, elts: &[mutable cell<T>]) ->
        [mutable cell<T>] {
         assert (nelts == vec::len(elts));
diff --git a/src/lib/ebml.rs b/src/lib/ebml.rs
index d48fc67b43b..09d0bee1a60 100644
--- a/src/lib/ebml.rs
+++ b/src/lib/ebml.rs
@@ -67,7 +67,7 @@ fn get_doc(d: doc, tg: uint) -> doc {
     alt maybe_get_doc(d, tg) {
       some(d) { ret d; }
       none. {
-        log_err ~"failed to find block with tag " + uint::to_str(tg, 10u);
+        log_err "failed to find block with tag " + uint::to_str(tg, 10u);
         fail;
       }
     }
diff --git a/src/lib/extfmt.rs b/src/lib/extfmt.rs
index 7f363b661da..edd99120872 100644
--- a/src/lib/extfmt.rs
+++ b/src/lib/extfmt.rs
@@ -67,30 +67,30 @@ mod ct {
 
 
     // A fragment of the output sequence
-    tag piece { piece_string(istr); piece_conv(conv); }
-    type error_fn = fn(&istr) -> ! ;
+    tag piece { piece_string(str); piece_conv(conv); }
+    type error_fn = fn(&str) -> ! ;
 
-    fn parse_fmt_string(s: &istr, error: error_fn) -> [piece] {
+    fn parse_fmt_string(s: &str, error: error_fn) -> [piece] {
         let pieces: [piece] = [];
         let lim = str::byte_len(s);
-        let buf = ~"";
-        fn flush_buf(buf: &istr, pieces: &mutable [piece]) -> istr {
+        let buf = "";
+        fn flush_buf(buf: &str, pieces: &mutable [piece]) -> str {
             if str::byte_len(buf) > 0u {
                 let piece = piece_string(buf);
                 pieces += [piece];
             }
-            ret ~"";
+            ret "";
         }
         let i = 0u;
         while i < lim {
             let curr = str::substr(s, i, 1u);
-            if str::eq(curr, ~"%") {
+            if str::eq(curr, "%") {
                 i += 1u;
                 if i >= lim {
-                    error(~"unterminated conversion at end of string");
+                    error("unterminated conversion at end of string");
                 }
                 let curr2 = str::substr(s, i, 1u);
-                if str::eq(curr2, ~"%") {
+                if str::eq(curr2, "%") {
                     i += 1u;
                 } else {
                     buf = flush_buf(buf, pieces);
@@ -103,7 +103,7 @@ mod ct {
         buf = flush_buf(buf, pieces);
         ret pieces;
     }
-    fn peek_num(s: &istr, i: uint, lim: uint) ->
+    fn peek_num(s: &str, i: uint, lim: uint) ->
        option::t<{num: uint, next: uint}> {
         if i >= lim { ret none; }
         let c = s[i];
@@ -118,7 +118,7 @@ mod ct {
               }
             };
     }
-    fn parse_conversion(s: &istr, i: uint, lim: uint, error: error_fn) ->
+    fn parse_conversion(s: &str, i: uint, lim: uint, error: error_fn) ->
        {piece: piece, next: uint} {
         let parm = parse_parameter(s, i, lim);
         let flags = parse_flags(s, parm.next, lim);
@@ -133,7 +133,7 @@ mod ct {
                              ty: ty.ty}),
              next: ty.next};
     }
-    fn parse_parameter(s: &istr, i: uint, lim: uint) ->
+    fn parse_parameter(s: &str, i: uint, lim: uint) ->
        {param: option::t<int>, next: uint} {
         if i >= lim { ret {param: none, next: i}; }
         let num = peek_num(s, i, lim);
@@ -148,14 +148,14 @@ mod ct {
               }
             };
     }
-    fn parse_flags(s: &istr, i: uint, lim: uint) ->
+    fn parse_flags(s: &str, i: uint, lim: uint) ->
        {flags: [flag], next: uint} {
         let noflags: [flag] = [];
         if i >= lim { ret {flags: noflags, next: i}; }
 
         // FIXME: This recursion generates illegal instructions if the return
         // value isn't boxed. Only started happening after the ivec conversion
-        fn more_(f: flag, s: &istr, i: uint, lim: uint) ->
+        fn more_(f: flag, s: &str, i: uint, lim: uint) ->
            @{flags: [flag], next: uint} {
             let next = parse_flags(s, i + 1u, lim);
             let rest = next.flags;
@@ -177,8 +177,8 @@ mod ct {
                 *more(flag_alternate)
             } else { {flags: noflags, next: i} };
     }
-    fn parse_count(s: &istr, i: uint,
-                   lim: uint) -> {count: count, next: uint} {
+    fn parse_count(s: &str, i: uint, lim: uint) ->
+       {count: count, next: uint} {
         ret if i >= lim {
                 {count: count_implied, next: i}
             } else if s[i] == '*' as u8 {
@@ -198,7 +198,7 @@ mod ct {
                 }
             };
     }
-    fn parse_precision(s: &istr, i: uint, lim: uint) ->
+    fn parse_precision(s: &str, i: uint, lim: uint) ->
        {count: count, next: uint} {
         ret if i >= lim {
                 {count: count_implied, next: i}
@@ -214,32 +214,32 @@ mod ct {
                 }
             } else { {count: count_implied, next: i} };
     }
-    fn parse_type(s: &istr, i: uint, lim: uint, error: error_fn) ->
+    fn parse_type(s: &str, i: uint, lim: uint, error: error_fn) ->
        {ty: ty, next: uint} {
-        if i >= lim { error(~"missing type in conversion"); }
+        if i >= lim { error("missing type in conversion"); }
         let tstr = str::substr(s, i, 1u);
         // TODO: Do we really want two signed types here?
         // How important is it to be printf compatible?
         let t =
-            if str::eq(tstr, ~"b") {
+            if str::eq(tstr, "b") {
                 ty_bool
-            } else if str::eq(tstr, ~"s") {
+            } else if str::eq(tstr, "s") {
                 ty_str
-            } else if str::eq(tstr, ~"c") {
+            } else if str::eq(tstr, "c") {
                 ty_char
-            } else if str::eq(tstr, ~"d") || str::eq(tstr, ~"i") {
+            } else if str::eq(tstr, "d") || str::eq(tstr, "i") {
                 ty_int(signed)
-            } else if str::eq(tstr, ~"u") {
+            } else if str::eq(tstr, "u") {
                 ty_int(unsigned)
-            } else if str::eq(tstr, ~"x") {
+            } else if str::eq(tstr, "x") {
                 ty_hex(case_lower)
-            } else if str::eq(tstr, ~"X") {
+            } else if str::eq(tstr, "X") {
                 ty_hex(case_upper)
-            } else if str::eq(tstr, ~"t") {
+            } else if str::eq(tstr, "t") {
                 ty_bits
-            } else if str::eq(tstr, ~"o") {
+            } else if str::eq(tstr, "o") {
                 ty_octal
-            } else { error(~"unknown type in conversion: " + tstr) };
+            } else { error("unknown type in conversion: " + tstr) };
         ret {ty: t, next: i + 1u};
     }
 }
@@ -270,20 +270,20 @@ mod rt {
     // instead just use a bool per flag
     type conv = {flags: [flag], width: count, precision: count, ty: ty};
 
-    fn conv_int(cv: &conv, i: int) -> istr {
+    fn conv_int(cv: &conv, i: int) -> str {
         let radix = 10u;
         let prec = get_int_precision(cv);
         let s = int_to_str_prec(i, radix, prec);
         if 0 <= i {
             if have_flag(cv.flags, flag_sign_always) {
-                s = ~"+" + s;
+                s = "+" + s;
             } else if have_flag(cv.flags, flag_space_for_sign) {
-                s = ~" " + s;
+                s = " " + s;
             }
         }
         ret pad(cv, s, pad_signed);
     }
-    fn conv_uint(cv: &conv, u: uint) -> istr {
+    fn conv_uint(cv: &conv, u: uint) -> str {
         let prec = get_int_precision(cv);
         let rs =
             alt cv.ty {
@@ -295,17 +295,17 @@ mod rt {
             };
         ret pad(cv, rs, pad_unsigned);
     }
-    fn conv_bool(cv: &conv, b: bool) -> istr {
-        let s = if b { ~"true" } else { ~"false" };
+    fn conv_bool(cv: &conv, b: bool) -> str {
+        let s = if b { "true" } else { "false" };
         // run the boolean conversion through the string conversion logic,
         // giving it the same rules for precision, etc.
 
         ret conv_str(cv, s);
     }
-    fn conv_char(cv: &conv, c: char) -> istr {
+    fn conv_char(cv: &conv, c: char) -> str {
         ret pad(cv, str::from_char(c), pad_nozero);
     }
-    fn conv_str(cv: &conv, s: &istr) -> istr {
+    fn conv_str(cv: &conv, s: &str) -> str {
         // For strings, precision is the maximum characters
         // displayed
 
@@ -324,18 +324,18 @@ mod rt {
 
     // Convert an int to string with minimum number of digits. If precision is
     // 0 and num is 0 then the result is the empty string.
-    fn int_to_str_prec(num: int, radix: uint, prec: uint) -> istr {
+    fn int_to_str_prec(num: int, radix: uint, prec: uint) -> str {
         ret if num < 0 {
-                ~"-" + uint_to_str_prec(-num as uint, radix, prec)
+                "-" + uint_to_str_prec(-num as uint, radix, prec)
             } else { uint_to_str_prec(num as uint, radix, prec) };
     }
 
     // Convert a uint to string with a minimum number of digits.  If precision
     // is 0 and num is 0 then the result is the empty string. Could move this
     // to uint: but it doesn't seem all that useful.
-    fn uint_to_str_prec(num: uint, radix: uint, prec: uint) -> istr {
+    fn uint_to_str_prec(num: uint, radix: uint, prec: uint) -> str {
         ret if prec == 0u && num == 0u {
-                ~""
+                ""
             } else {
                 let s = uint::to_str(num, radix);
                 let len = str::char_len(s);
@@ -354,13 +354,13 @@ mod rt {
     }
 
     // FIXME: This might be useful in str: but needs to be utf8 safe first
-    fn str_init_elt(c: char, n_elts: uint) -> istr {
+    fn str_init_elt(c: char, n_elts: uint) -> str {
         let svec = vec::init_elt::<u8>(c as u8, n_elts);
 
         ret str::unsafe_from_bytes(svec);
     }
     tag pad_mode { pad_signed; pad_unsigned; pad_nozero; }
-    fn pad(cv: &conv, s: &istr, mode: pad_mode) -> istr {
+    fn pad(cv: &conv, s: &str, mode: pad_mode) -> str {
         let uwidth;
         alt cv.width {
           count_implied. { ret s; }
diff --git a/src/lib/fs.rs b/src/lib/fs.rs
index 745c30c80b3..3ab6d3f5786 100644
--- a/src/lib/fs.rs
+++ b/src/lib/fs.rs
@@ -6,15 +6,15 @@ native "rust" mod rustrt {
     fn rust_file_is_dir(path: str::sbuf) -> int;
 }
 
-fn path_sep() -> istr { ret str::from_char(os_fs::path_sep); }
+fn path_sep() -> str { ret str::from_char(os_fs::path_sep); }
 
-type path = istr;
+type path = str;
 
 fn dirname(p: &path) -> path {
     let i: int = str::rindex(p, os_fs::path_sep as u8);
     if i == -1 {
         i = str::rindex(p, os_fs::alt_path_sep as u8);
-        if i == -1 { ret ~"."; }
+        if i == -1 { ret "."; }
     }
     ret str::substr(p, 0u, i as uint);
 }
@@ -42,36 +42,28 @@ fn connect(pre: &path, post: &path) -> path {
 }
 
 fn file_is_dir(p: &path) -> bool {
-    ret str::as_buf(p, { |buf|
-        rustrt::rust_file_is_dir(buf) != 0
-    });
+    ret str::as_buf(p, {|buf| rustrt::rust_file_is_dir(buf) != 0 });
 }
 
-fn list_dir(p: &path) -> [istr] {
+fn list_dir(p: &path) -> [str] {
     let p = p;
     let pl = str::byte_len(p);
     if pl == 0u || p[pl - 1u] as char != os_fs::path_sep { p += path_sep(); }
-    let full_paths: [istr] = [];
-    for filename: istr in os_fs::list_dir(p) {
-        if !str::eq(filename, ~".") {
-            if !str::eq(filename, ~"..") { full_paths += [p + filename]; }
+    let full_paths: [str] = [];
+    for filename: str in os_fs::list_dir(p) {
+        if !str::eq(filename, ".") {
+            if !str::eq(filename, "..") { full_paths += [p + filename]; }
         }
     }
     ret full_paths;
 }
 
-fn path_is_absolute(p: &path) -> bool {
-    ret os_fs::path_is_absolute(p);
-}
+fn path_is_absolute(p: &path) -> bool { ret os_fs::path_is_absolute(p); }
 
 // FIXME: under Windows, we should prepend the current drive letter to paths
 // that start with a slash.
 fn make_absolute(p: &path) -> path {
-    if path_is_absolute(p) {
-        ret p;
-    } else {
-        ret connect(getcwd(), p);
-    }
+    if path_is_absolute(p) { ret p; } else { ret connect(getcwd(), p); }
 }
 
 // Local Variables:
diff --git a/src/lib/fun_treemap.rs b/src/lib/fun_treemap.rs
index 30ce4bc1b09..3d4894c4367 100644
--- a/src/lib/fun_treemap.rs
+++ b/src/lib/fun_treemap.rs
@@ -29,53 +29,41 @@ type treemap<@K, @V> = @tree_node<K, V>;
 
 fn init<@K, @V>() -> treemap<K, V> { @empty }
 
-fn insert<@K, @V>(m : &treemap<K, V>, k : &K, v : &V) -> treemap<K,V> {
+fn insert<@K, @V>(m: &treemap<K, V>, k: &K, v: &V) -> treemap<K, V> {
     @alt m {
-      @empty. {
-        node(@k, @v, @empty, @empty)
-      }
-      @node(@kk, vv, left, right) {
-        if k < kk {
-            node(@kk, vv, insert(left, k, v), right)
-        } else if k == kk {
-            node(@kk, @v, left, right)
-        } else {
-            node(@kk, vv, left, insert(right, k, v))
-        }
-      }
-    }
+       @empty. { node(@k, @v, @empty, @empty) }
+       @node(@kk, vv, left, right) {
+         if k < kk {
+             node(@kk, vv, insert(left, k, v), right)
+         } else if k == kk {
+             node(@kk, @v, left, right)
+         } else { node(@kk, vv, left, insert(right, k, v)) }
+       }
+     }
 }
 
-fn find<@K, @V>(m : &treemap<K, V>, k : &K) -> option<V> {
-  alt *m {
-    empty. { none }
-    node(@kk, @v, left, right) {
-      if k == kk { some(v) }
-      else if k < kk { find(left, k) }
-      else { find(right, k) }
+fn find<@K, @V>(m: &treemap<K, V>, k: &K) -> option<V> {
+    alt *m {
+      empty. { none }
+      node(@kk, @v, left, right) {
+        if k == kk {
+            some(v)
+        } else if k < kk { find(left, k) } else { find(right, k) }
+      }
     }
-  }
 }
 
 
 // Performs an in-order traversal
-fn traverse<@K, @V>(m : &treemap<K, V>, f : fn(&K, &V)) {
-  alt *m {
-    empty. { }
-    node(@k, @v, _, _) {
-      // copy v to make aliases work out
-      let v1 = v;
-      alt *m {
-        node(_, _, left, _) {
-          traverse(left, f);
-        }
-      }
-      f(k, v1);
-      alt *m {
-        node(_, _, _, right) {
-          traverse(right, f);
-        }
+fn traverse<@K, @V>(m: &treemap<K, V>, f: fn(&K, &V)) {
+    alt *m {
+      empty. { }
+      node(@k, @v, _, _) {
+        // copy v to make aliases work out
+        let v1 = v;
+        alt *m { node(_, _, left, _) { traverse(left, f); } }
+        f(k, v1);
+        alt *m { node(_, _, _, right) { traverse(right, f); } }
       }
     }
-  }
 }
diff --git a/src/lib/generic_os.rs b/src/lib/generic_os.rs
index 169548d106a..8a34f76a387 100644
--- a/src/lib/generic_os.rs
+++ b/src/lib/generic_os.rs
@@ -3,40 +3,45 @@ import str::sbuf;
 
 #[cfg(target_os = "linux")]
 #[cfg(target_os = "macos")]
-fn getenv(n: &istr) -> option::t<istr> {
-    let s = str::as_buf(n, { |buf|
-        os::libc::getenv(buf)
-    });
+fn getenv(n: &str) -> option::t<str> {
+    let s = str::as_buf(n, {|buf| os::libc::getenv(buf) });
     ret if unsafe::reinterpret_cast(s) == 0 {
-        option::none::<istr>
-    } else {
-        let s = unsafe::reinterpret_cast(s);
-        option::some::<istr>(str::str_from_cstr(s))
-    };
+            option::none::<str>
+        } else {
+            let s = unsafe::reinterpret_cast(s);
+            option::some::<str>(str::str_from_cstr(s))
+        };
 }
 
 #[cfg(target_os = "linux")]
 #[cfg(target_os = "macos")]
-fn setenv(n: &istr, v: &istr) {
+fn setenv(n: &str, v: &str) {
     // FIXME (868)
-    let _: () = str::as_buf(n, { |nbuf|
-        // FIXME (868)
-        let _: () = str::as_buf(v, { |vbuf|
-            os::libc::setenv(nbuf, vbuf, 1);
-        });
-    });
+    let _: () =
+        str::as_buf(n,
+                    // FIXME (868)
+                    {|nbuf|
+                        let _: () =
+                            str::as_buf(v,
+                                        {|vbuf|
+                                            os::libc::setenv(nbuf, vbuf, 1);
+                                        });
+                    });
 }
 
 #[cfg(target_os = "win32")]
-fn getenv(n: &istr) -> option::t<istr> {
+fn getenv(n: &str) -> option::t<str> {
     let nsize = 256u;
     while true {
         let v: [u8] = [];
         vec::reserve(v, nsize);
-        let res = str::as_buf(n, { |nbuf|
-            let vbuf = vec::to_ptr(v);
-            os::kernel32::GetEnvironmentVariableA(nbuf, vbuf, nsize)
-        });
+        let res =
+            str::as_buf(n,
+                        {|nbuf|
+                            let vbuf = vec::to_ptr(v);
+                            os::kernel32::GetEnvironmentVariableA(nbuf, vbuf,
+                                                                  nsize)
+                        });
         if res == 0u {
             ret option::none;
         } else if res < nsize {
@@ -48,10 +53,10 @@ fn getenv(n: &istr) -> option::t<istr> {
 }
 
 #[cfg(target_os = "win32")]
-fn setenv(n: &istr, v: &istr) {
+fn setenv(n: &str, v: &str) {
     // FIXME (868)
-    let _: () = str::as_buf(n, { |nbuf|
-        let _: () = str::as_buf(v, { |vbuf|
+    let _: () = str::as_buf(n, {|nbuf|
+        let _: () = str::as_buf(v, {|vbuf|
             os::kernel32::SetEnvironmentVariableA(nbuf, vbuf);
         });
     });
diff --git a/src/lib/getopts.rs b/src/lib/getopts.rs
index 3df28220651..c36f766a5dc 100644
--- a/src/lib/getopts.rs
+++ b/src/lib/getopts.rs
@@ -29,7 +29,7 @@ export opt_strs;
 export opt_maybe_str;
 export opt_default;
 
-tag name { long(istr); short(char); }
+tag name { long(str); short(char); }
 
 tag hasarg { yes; no; maybe; }
 
@@ -37,41 +37,41 @@ tag occur { req; optional; multi; }
 
 type opt = {name: name, hasarg: hasarg, occur: occur};
 
-fn mkname(nm: &istr) -> name {
+fn mkname(nm: &str) -> name {
     ret if str::char_len(nm) == 1u {
             short(str::char_at(nm, 0u))
         } else { long(nm) };
 }
 
-fn reqopt(name: &istr) -> opt {
+fn reqopt(name: &str) -> opt {
     ret {name: mkname(name), hasarg: yes, occur: req};
 }
 
-fn optopt(name: &istr) -> opt {
+fn optopt(name: &str) -> opt {
     ret {name: mkname(name), hasarg: yes, occur: optional};
 }
 
-fn optflag(name: &istr) -> opt {
+fn optflag(name: &str) -> opt {
     ret {name: mkname(name), hasarg: no, occur: optional};
 }
 
-fn optflagopt(name: &istr) -> opt {
+fn optflagopt(name: &str) -> opt {
     ret {name: mkname(name), hasarg: maybe, occur: optional};
 }
 
-fn optmulti(name: &istr) -> opt {
+fn optmulti(name: &str) -> opt {
     ret {name: mkname(name), hasarg: yes, occur: multi};
 }
 
-tag optval { val(istr); given; }
+tag optval { val(str); given; }
 
-type match = {opts: [opt], vals: [mutable [optval]], free: [istr]};
+type match = {opts: [opt], vals: [mutable [optval]], free: [str]};
 
-fn is_arg(arg: &istr) -> bool {
+fn is_arg(arg: &str) -> bool {
     ret str::byte_len(arg) > 1u && arg[0] == '-' as u8;
 }
 
-fn name_str(nm: &name) -> istr {
+fn name_str(nm: &name) -> str {
     ret alt nm { short(ch) { str::from_char(ch) } long(s) { s } };
 }
 
@@ -83,36 +83,34 @@ fn find_opt(opts: &[opt], nm: &name) -> option::t<uint> {
 }
 
 tag fail_ {
-    argument_missing(istr);
-    unrecognized_option(istr);
-    option_missing(istr);
-    option_duplicated(istr);
-    unexpected_argument(istr);
+    argument_missing(str);
+    unrecognized_option(str);
+    option_missing(str);
+    option_duplicated(str);
+    unexpected_argument(str);
 }
 
-fn fail_str(f: &fail_) -> istr {
+fn fail_str(f: &fail_) -> str {
     ret alt f {
-          argument_missing(nm) {
-            ~"Argument to option '" + nm + ~"' missing." }
-          unrecognized_option(nm) {
-            ~"Unrecognized option: '" + nm + ~"'." }
-          option_missing(nm) { ~"Required option '" + nm + ~"' missing." }
+          argument_missing(nm) { "Argument to option '" + nm + "' missing." }
+          unrecognized_option(nm) { "Unrecognized option: '" + nm + "'." }
+          option_missing(nm) { "Required option '" + nm + "' missing." }
           option_duplicated(nm) {
-            ~"Option '" + nm + ~"' given more than once."
+            "Option '" + nm + "' given more than once."
           }
           unexpected_argument(nm) {
-            ~"Option " + nm + ~" does not take an argument."
+            "Option " + nm + " does not take an argument."
           }
         };
 }
 
 tag result { success(match); failure(fail_); }
 
-fn getopts(args: &[istr], opts: &[opt]) -> result {
+fn getopts(args: &[str], opts: &[opt]) -> result {
     let n_opts = vec::len::<opt>(opts);
     fn f(_x: uint) -> [optval] { ret []; }
     let vals = vec::init_fn_mut::<[optval]>(f, n_opts);
-    let free: [istr] = [];
+    let free: [str] = [];
     let l = vec::len(args);
     let i = 0u;
     while i < l {
@@ -120,13 +118,13 @@ fn getopts(args: &[istr], opts: &[opt]) -> result {
         let curlen = str::byte_len(cur);
         if !is_arg(cur) {
             free += [cur];
-        } else if str::eq(cur, ~"--") {
+        } else if str::eq(cur, "--") {
             let j = i + 1u;
             while j < l { free += [args[j]]; j += 1u; }
             break;
         } else {
             let names;
-            let i_arg = option::none::<istr>;
+            let i_arg = option::none::<str>;
             if cur[1] == '-' as u8 {
                 let tail = str::slice(cur, 2u, curlen);
                 let eq = str::index(tail, '=' as u8);
@@ -135,9 +133,9 @@ fn getopts(args: &[istr], opts: &[opt]) -> result {
                 } else {
                     names = [long(str::slice(tail, 0u, eq as uint))];
                     i_arg =
-                        option::some::<istr>(str::slice(tail,
-                                                        (eq as uint) + 1u,
-                                                        curlen - 2u));
+                        option::some::<str>(str::slice(tail,
+                                                       (eq as uint) + 1u,
+                                                       curlen - 2u));
                 }
             } else {
                 let j = 1u;
@@ -158,13 +156,13 @@ fn getopts(args: &[istr], opts: &[opt]) -> result {
                 }
                 alt opts[optid].hasarg {
                   no. {
-                    if !option::is_none::<istr>(i_arg) {
+                    if !option::is_none::<str>(i_arg) {
                         ret failure(unexpected_argument(name_str(nm)));
                     }
                     vals[optid] += [given];
                   }
                   maybe. {
-                    if !option::is_none::<istr>(i_arg) {
+                    if !option::is_none::<str>(i_arg) {
                         vals[optid] += [val(option::get(i_arg))];
                     } else if name_pos < vec::len::<name>(names) ||
                                   i + 1u == l || is_arg(args[i + 1u]) {
@@ -172,8 +170,8 @@ fn getopts(args: &[istr], opts: &[opt]) -> result {
                     } else { i += 1u; vals[optid] += [val(args[i])]; }
                   }
                   yes. {
-                    if !option::is_none::<istr>(i_arg) {
-                        vals[optid] += [val(option::get::<istr>(i_arg))];
+                    if !option::is_none::<str>(i_arg) {
+                        vals[optid] += [val(option::get::<str>(i_arg))];
                     } else if i + 1u == l {
                         ret failure(argument_missing(name_str(nm)));
                     } else { i += 1u; vals[optid] += [val(args[i])]; }
@@ -202,45 +200,45 @@ fn getopts(args: &[istr], opts: &[opt]) -> result {
     ret success({opts: opts, vals: vals, free: free});
 }
 
-fn opt_vals(m: &match, nm: &istr) -> [optval] {
+fn opt_vals(m: &match, nm: &str) -> [optval] {
     ret alt find_opt(m.opts, mkname(nm)) {
           some(id) { m.vals[id] }
-          none. { log_err ~"No option '" + nm + ~"' defined."; fail }
+          none. { log_err "No option '" + nm + "' defined."; fail }
         };
 }
 
-fn opt_val(m: &match, nm: &istr) -> optval { ret opt_vals(m, nm)[0]; }
+fn opt_val(m: &match, nm: &str) -> optval { ret opt_vals(m, nm)[0]; }
 
-fn opt_present(m: &match, nm: &istr) -> bool {
+fn opt_present(m: &match, nm: &str) -> bool {
     ret vec::len::<optval>(opt_vals(m, nm)) > 0u;
 }
 
-fn opt_str(m: &match, nm: &istr) -> istr {
+fn opt_str(m: &match, nm: &str) -> str {
     ret alt opt_val(m, nm) { val(s) { s } _ { fail } };
 }
 
-fn opt_strs(m: &match, nm: &istr) -> [istr] {
-    let acc: [istr] = [];
+fn opt_strs(m: &match, nm: &str) -> [str] {
+    let acc: [str] = [];
     for v: optval in opt_vals(m, nm) {
         alt v { val(s) { acc += [s]; } _ { } }
     }
     ret acc;
 }
 
-fn opt_maybe_str(m: &match, nm: &istr) -> option::t<istr> {
+fn opt_maybe_str(m: &match, nm: &str) -> option::t<str> {
     let vals = opt_vals(m, nm);
-    if vec::len::<optval>(vals) == 0u { ret none::<istr>; }
-    ret alt vals[0] { val(s) { some::<istr>(s) } _ { none::<istr> } };
+    if vec::len::<optval>(vals) == 0u { ret none::<str>; }
+    ret alt vals[0] { val(s) { some::<str>(s) } _ { none::<str> } };
 }
 
 
 /// Returns none if the option was not present, `def` if the option was
 /// present but no argument was provided, and the argument if the option was
 /// present and an argument was provided.
-fn opt_default(m: &match, nm: &istr, def: &istr) -> option::t<istr> {
+fn opt_default(m: &match, nm: &str, def: &str) -> option::t<str> {
     let vals = opt_vals(m, nm);
-    if vec::len::<optval>(vals) == 0u { ret none::<istr>; }
-    ret alt vals[0] { val(s) { some::<istr>(s) } _ { some::<istr>(def) } }
+    if vec::len::<optval>(vals) == 0u { ret none::<str>; }
+    ret alt vals[0] { val(s) { some::<str>(s) } _ { some::<str>(def) } }
 }
 // Local Variables:
 // mode: rust;
diff --git a/src/lib/int.rs b/src/lib/int.rs
index 162cf727c49..ef80852c8d3 100644
--- a/src/lib/int.rs
+++ b/src/lib/int.rs
@@ -41,13 +41,13 @@ iter range(lo: int, hi: int) -> int {
     while lo_ < hi { put lo_; lo_ += 1; }
 }
 
-fn to_str(n: int, radix: uint) -> istr {
+fn to_str(n: int, radix: uint) -> str {
     assert (0u < radix && radix <= 16u);
     ret if n < 0 {
-            ~"-" + uint::to_str(-n as uint, radix)
+            "-" + uint::to_str(-n as uint, radix)
         } else { uint::to_str(n as uint, radix) };
 }
-fn str(i: int) -> istr { ret to_str(i, 10u); }
+fn str(i: int) -> str { ret to_str(i, 10u); }
 
 fn pow(base: int, exponent: uint) -> int {
     ret if exponent == 0u {
diff --git a/src/lib/io.rs b/src/lib/io.rs
index 57ebb806f52..0889d3ec454 100644
--- a/src/lib/io.rs
+++ b/src/lib/io.rs
@@ -40,8 +40,8 @@ type reader =
         fn read_bytes(uint) -> [u8];
         fn read_char() -> char;
         fn eof() -> bool;
-        fn read_line() -> istr;
-        fn read_c_str() -> istr;
+        fn read_line() -> str;
+        fn read_c_str() -> str;
         fn read_le_uint(uint) -> uint;
         fn read_le_int(uint) -> int;
         fn read_be_uint(uint) -> uint;
@@ -60,8 +60,8 @@ obj FILE_buf_reader(f: os::libc::FILE, res: option::t<@FILE_res>) {
     fn read(len: uint) -> [u8] {
         let buf = [];
         vec::reserve::<u8>(buf, len);
-        let read = os::libc::fread(vec::unsafe::to_ptr::<u8>(buf),
-                                   1u, len, f);
+        let read =
+            os::libc::fread(vec::unsafe::to_ptr::<u8>(buf), 1u, len, f);
         vec::unsafe::set_len::<u8>(buf, read);
         ret buf;
     }
@@ -106,7 +106,7 @@ obj new_reader(rdr: buf_reader) {
         ret val as char;
     }
     fn eof() -> bool { ret rdr.eof(); }
-    fn read_line() -> istr {
+    fn read_line() -> str {
         let buf: [u8] = [];
         // No break yet in rustc
 
@@ -119,7 +119,7 @@ obj new_reader(rdr: buf_reader) {
         }
         ret str::unsafe_from_bytes(buf);
     }
-    fn read_c_str() -> istr {
+    fn read_c_str() -> str {
         let buf: [u8] = [];
         let go_on = true;
         while go_on {
@@ -174,13 +174,16 @@ fn stdin() -> reader {
     ret new_reader(FILE_buf_reader(rustrt::rust_get_stdin(), option::none));
 }
 
-fn file_reader(path: &istr) -> reader {
-    let f = str::as_buf(path, { |pathbuf|
-        str::as_buf(~"r", { |modebuf|
-            os::libc::fopen(pathbuf, modebuf)
-        })
-    });
-    if f as uint == 0u { log_err ~"error opening " + path; fail; }
+fn file_reader(path: &str) -> reader {
+    let f =
+        str::as_buf(path,
+                    {|pathbuf|
+                        str::as_buf("r",
+                                    {|modebuf|
+                                        os::libc::fopen(pathbuf, modebuf)
+                                    })
+                    });
+    if f as uint == 0u { log_err "error opening " + path; fail; }
     ret new_reader(FILE_buf_reader(f, option::some(@FILE_res(f))));
 }
 
@@ -219,7 +222,7 @@ fn new_byte_buf_reader(buf: &[u8]) -> buf_reader {
     ret byte_buf_reader(@{buf: buf, mutable pos: 0u});
 }
 
-fn string_reader(s: &istr) -> reader {
+fn string_reader(s: &str) -> reader {
     ret new_reader(new_byte_buf_reader(str::bytes(s)));
 }
 
@@ -279,7 +282,7 @@ obj fd_buf_writer(fd: int, res: option::t<@fd_res>) {
     }
 }
 
-fn file_buf_writer(path: &istr, flags: &[fileflag]) -> buf_writer {
+fn file_buf_writer(path: &str, flags: &[fileflag]) -> buf_writer {
     let fflags: int =
         os::libc_constants::O_WRONLY() | os::libc_constants::O_BINARY();
     for f: fileflag in flags {
@@ -290,11 +293,13 @@ fn file_buf_writer(path: &istr, flags: &[fileflag]) -> buf_writer {
           none. { }
         }
     }
-    let fd = str::as_buf(path, { |pathbuf|
-        os::libc::open(pathbuf, fflags,
-                       os::libc_constants::S_IRUSR() |
-                           os::libc_constants::S_IWUSR())
-    });
+    let fd =
+        str::as_buf(path,
+                    {|pathbuf|
+                        os::libc::open(pathbuf, fflags,
+                                       os::libc_constants::S_IRUSR() |
+                                           os::libc_constants::S_IWUSR())
+                    });
     if fd < 0 {
         log_err "error opening file for writing";
         log_err sys::rustrt::last_os_error();
@@ -308,8 +313,8 @@ type writer =
     // function will be provided for general encoded string output
     obj {
         fn get_buf_writer() -> buf_writer;
-        fn write_str(&istr);
-        fn write_line(&istr);
+        fn write_str(&str);
+        fn write_line(&str);
         fn write_char(char);
         fn write_int(int);
         fn write_uint(uint);
@@ -334,20 +339,18 @@ fn uint_to_be_bytes(n: uint, size: uint) -> [u8] {
 
 obj new_writer(out: buf_writer) {
     fn get_buf_writer() -> buf_writer { ret out; }
-    fn write_str(s: &istr) { out.write(str::bytes(s)); }
-    fn write_line(s: &istr) {
+    fn write_str(s: &str) { out.write(str::bytes(s)); }
+    fn write_line(s: &str) {
         out.write(str::bytes(s));
-        out.write(str::bytes(~"\n"));
+        out.write(str::bytes("\n"));
     }
     fn write_char(ch: char) {
         // FIXME needlessly consy
 
         out.write(str::bytes(str::from_char(ch)));
     }
-    fn write_int(n: int) { out.write(str::bytes(
-        int::to_str(n, 10u))); }
-    fn write_uint(n: uint) { out.write(str::bytes(
-        uint::to_str(n, 10u))); }
+    fn write_int(n: int) { out.write(str::bytes(int::to_str(n, 10u))); }
+    fn write_uint(n: uint) { out.write(str::bytes(uint::to_str(n, 10u))); }
     fn write_bytes(bytes: &[u8]) { out.write(bytes); }
     fn write_le_uint(n: uint, size: uint) {
         out.write(uint_to_le_bytes(n, size));
@@ -360,19 +363,22 @@ obj new_writer(out: buf_writer) {
     }
 }
 
-fn file_writer(path: &istr, flags: &[fileflag]) -> writer {
+fn file_writer(path: &str, flags: &[fileflag]) -> writer {
     ret new_writer(file_buf_writer(path, flags));
 }
 
 
 // FIXME: fileflags
-fn buffered_file_buf_writer(path: &istr) -> buf_writer {
-    let f = str::as_buf(path, { |pathbuf|
-        str::as_buf(~"w", { |modebuf|
-            os::libc::fopen(pathbuf, modebuf)
-        })
-    });
-    if f as uint == 0u { log_err ~"error opening " + path; fail; }
+fn buffered_file_buf_writer(path: &str) -> buf_writer {
+    let f =
+        str::as_buf(path,
+                    {|pathbuf|
+                        str::as_buf("w",
+                                    {|modebuf|
+                                        os::libc::fopen(pathbuf, modebuf)
+                                    })
+                    });
+    if f as uint == 0u { log_err "error opening " + path; fail; }
     ret FILE_writer(f, option::some(@FILE_res(f)));
 }
 
@@ -384,7 +390,7 @@ fn stderr() -> writer { ret new_writer(fd_buf_writer(2, option::none)); }
 type str_writer =
     obj {
         fn get_writer() -> writer;
-        fn get_str() -> istr;
+        fn get_str() -> str;
     };
 
 type mutable_byte_buf = @{mutable buf: [mutable u8], mutable pos: uint};
@@ -427,7 +433,7 @@ fn string_writer() -> str_writer {
     let buf: mutable_byte_buf = @{mutable buf: b, mutable pos: 0u};
     obj str_writer_wrap(wr: writer, buf: mutable_byte_buf) {
         fn get_writer() -> writer { ret wr; }
-        fn get_str() -> istr { ret str::unsafe_from_bytes(buf.buf); }
+        fn get_str() -> str { ret str::unsafe_from_bytes(buf.buf); }
     }
     ret str_writer_wrap(new_writer(byte_buf_writer(buf)), buf);
 }
@@ -447,11 +453,11 @@ fn seek_in_buf(offset: int, pos: uint, len: uint, whence: seek_style) ->
     ret bpos as uint;
 }
 
-fn read_whole_file_str(file: &istr) -> istr {
+fn read_whole_file_str(file: &str) -> str {
     str::unsafe_from_bytes(read_whole_file(file))
 }
 
-fn read_whole_file(file: &istr) -> [u8] {
+fn read_whole_file(file: &str) -> [u8] {
 
     // FIXME: There's a lot of copying here
     file_reader(file).read_whole_stream()
diff --git a/src/lib/linux_os.rs b/src/lib/linux_os.rs
index 0081aa18265..b393d9a1e08 100644
--- a/src/lib/linux_os.rs
+++ b/src/lib/linux_os.rs
@@ -50,11 +50,11 @@ mod libc_constants {
     fn S_IWUSR() -> uint { ret 128u; }
 }
 
-fn exec_suffix() -> istr { ret ~""; }
+fn exec_suffix() -> str { ret ""; }
 
-fn target_os() -> istr { ret ~"linux"; }
+fn target_os() -> str { ret "linux"; }
 
-fn dylib_filename(base: &istr) -> istr { ret ~"lib" + base + ~".so"; }
+fn dylib_filename(base: &str) -> str { ret "lib" + base + ".so"; }
 
 fn pipe() -> {in: int, out: int} {
     let fds = {mutable in: 0, mutable out: 0};
@@ -63,9 +63,7 @@ fn pipe() -> {in: int, out: int} {
 }
 
 fn fd_FILE(fd: int) -> libc::FILE {
-    ret str::as_buf(~"r", { |modebuf|
-        libc::fdopen(fd, modebuf)
-    });
+    ret str::as_buf("r", {|modebuf| libc::fdopen(fd, modebuf) });
 }
 
 fn waitpid(pid: int) -> int {
@@ -75,12 +73,10 @@ fn waitpid(pid: int) -> int {
 }
 
 native "rust" mod rustrt {
-    fn rust_getcwd() -> istr;
+    fn rust_getcwd() -> str;
 }
 
-fn getcwd() -> istr {
-    ret rustrt::rust_getcwd();
-}
+fn getcwd() -> str { ret rustrt::rust_getcwd(); }
 
 
 // Local Variables:
diff --git a/src/lib/macos_os.rs b/src/lib/macos_os.rs
index 2c244048113..e18fdd5b32f 100644
--- a/src/lib/macos_os.rs
+++ b/src/lib/macos_os.rs
@@ -47,11 +47,11 @@ mod libc_constants {
     fn S_IWUSR() -> uint { ret 512u; }
 }
 
-fn exec_suffix() -> istr { ret ~""; }
+fn exec_suffix() -> str { ret ""; }
 
-fn target_os() -> istr { ret ~"macos"; }
+fn target_os() -> str { ret "macos"; }
 
-fn dylib_filename(base: &istr) -> istr { ret ~"lib" + base + ~".dylib"; }
+fn dylib_filename(base: &str) -> str { ret "lib" + base + ".dylib"; }
 
 fn pipe() -> {in: int, out: int} {
     let fds = {mutable in: 0, mutable out: 0};
@@ -60,9 +60,7 @@ fn pipe() -> {in: int, out: int} {
 }
 
 fn fd_FILE(fd: int) -> libc::FILE {
-    ret str::as_buf(~"r", { |modebuf|
-        libc::fdopen(fd, modebuf)
-    });
+    ret str::as_buf("r", {|modebuf| libc::fdopen(fd, modebuf) });
 }
 
 fn waitpid(pid: int) -> int {
@@ -72,12 +70,10 @@ fn waitpid(pid: int) -> int {
 }
 
 native "rust" mod rustrt {
-    fn rust_getcwd() -> istr;
+    fn rust_getcwd() -> str;
 }
 
-fn getcwd() -> istr {
-    ret rustrt::rust_getcwd();
-}
+fn getcwd() -> str { ret rustrt::rust_getcwd(); }
 
 
 // Local Variables:
diff --git a/src/lib/map.rs b/src/lib/map.rs
index a608e7b877b..d54eae03d10 100644
--- a/src/lib/map.rs
+++ b/src/lib/map.rs
@@ -194,7 +194,7 @@ fn mk_hashmap<@K, @V>(hasher: &hashfn<K>, eqer: &eqfn<K>) -> hashmap<K, V> {
 
 // Hash map constructors for basic types
 
-fn new_str_hash<@V>() -> hashmap<istr, V> {
+fn new_str_hash<@V>() -> hashmap<str, V> {
     ret mk_hashmap(str::hash, str::eq);
 }
 
diff --git a/src/lib/net.rs b/src/lib/net.rs
index 246574dd07b..be778d9858e 100644
--- a/src/lib/net.rs
+++ b/src/lib/net.rs
@@ -3,7 +3,7 @@ import uint;
 
 tag ip_addr { ipv4(u8, u8, u8, u8); }
 
-fn format_addr(ip: ip_addr) -> istr {
+fn format_addr(ip: ip_addr) -> str {
     alt ip {
       ipv4(a, b, c, d) {
         #fmt["%u.%u.%u.%u", a as uint, b as uint, c as uint, d as uint]
@@ -12,10 +12,8 @@ fn format_addr(ip: ip_addr) -> istr {
     }
 }
 
-fn parse_addr(ip: &istr) -> ip_addr {
-    let parts = vec::map(
-        { |&s| uint::from_str(s) },
-        str::split(ip, ~"."[0]));
+fn parse_addr(ip: &str) -> ip_addr {
+    let parts = vec::map({|&s| uint::from_str(s) }, str::split(ip, "."[0]));
     if vec::len(parts) != 4u { fail "Too many dots in IP address"; }
     for i in parts { if i > 255u { fail "Invalid IP Address part."; } }
     ipv4(parts[0] as u8, parts[1] as u8, parts[2] as u8, parts[3] as u8)
diff --git a/src/lib/posix_fs.rs b/src/lib/posix_fs.rs
index b31f9ca8637..8b4f06a6a9b 100644
--- a/src/lib/posix_fs.rs
+++ b/src/lib/posix_fs.rs
@@ -1,9 +1,9 @@
 
 native "rust" mod rustrt {
-    fn rust_list_files(path: &istr) -> [istr];
+    fn rust_list_files(path: &str) -> [str];
 }
 
-fn list_dir(path: &istr) -> [istr] {
+fn list_dir(path: &str) -> [str] {
     ret rustrt::rust_list_files(path);
 
     // FIXME: No idea why, but this appears to corrupt memory on OSX. I
@@ -30,7 +30,7 @@ fn list_dir(path: &istr) -> [istr] {
 
 }
 
-fn path_is_absolute(p: &istr) -> bool { ret str::char_at(p, 0u) == '/'; }
+fn path_is_absolute(p: &str) -> bool { ret str::char_at(p, 0u) == '/'; }
 
 const path_sep: char = '/';
 
diff --git a/src/lib/run_program.rs b/src/lib/run_program.rs
index 3558da2388a..a4adaace38a 100644
--- a/src/lib/run_program.rs
+++ b/src/lib/run_program.rs
@@ -12,29 +12,27 @@ native "rust" mod rustrt {
        int;
 }
 
-fn arg_vec(prog: &istr, args: &[@istr]) -> [sbuf] {
-    let argptrs = str::as_buf(prog, { |buf| [buf] });
-    for arg in args {
-        argptrs += str::as_buf(*arg, { |buf| [buf] });
-    }
+fn arg_vec(prog: &str, args: &[@str]) -> [sbuf] {
+    let argptrs = str::as_buf(prog, {|buf| [buf] });
+    for arg in args { argptrs += str::as_buf(*arg, {|buf| [buf] }); }
     argptrs += [unsafe::reinterpret_cast(0)];
     ret argptrs;
 }
 
-fn spawn_process(prog: &istr, args: &[istr], in_fd: int, out_fd: int,
+fn spawn_process(prog: &str, args: &[str], in_fd: int, out_fd: int,
                  err_fd: int) -> int {
     // Note: we have to hold on to these vector references while we hold a
     // pointer to their buffers
     let prog = prog;
-    let args = vec::map({ |&arg| @arg }, args);
+    let args = vec::map({|&arg| @arg }, args);
     let argv = arg_vec(prog, args);
     let pid =
-        rustrt::rust_run_program(vec::unsafe::to_ptr(argv),
-                                 in_fd, out_fd, err_fd);
+        rustrt::rust_run_program(vec::unsafe::to_ptr(argv), in_fd, out_fd,
+                                 err_fd);
     ret pid;
 }
 
-fn run_program(prog: &istr, args: &[istr]) -> int {
+fn run_program(prog: &str, args: &[str]) -> int {
     ret os::waitpid(spawn_process(prog, args, 0, 0, 0));
 }
 
@@ -51,7 +49,7 @@ type program =
 
 resource program_res(p: program) { p.destroy(); }
 
-fn start_program(prog: &istr, args: &[istr]) -> @program_res {
+fn start_program(prog: &str, args: &[str]) -> @program_res {
     let pipe_input = os::pipe();
     let pipe_output = os::pipe();
     let pipe_err = os::pipe();
@@ -102,8 +100,8 @@ fn start_program(prog: &istr, args: &[istr]) -> @program_res {
                                  os::fd_FILE(pipe_err.in), false));
 }
 
-fn read_all(rd: &io::reader) -> istr {
-    let buf = ~"";
+fn read_all(rd: &io::reader) -> str {
+    let buf = "";
     while !rd.eof() {
         let bytes = rd.read_bytes(4096u);
         buf += str::unsafe_from_bytes(bytes);
@@ -111,8 +109,8 @@ fn read_all(rd: &io::reader) -> istr {
     ret buf;
 }
 
-fn program_output(prog: &istr, args: &[istr]) ->
-   {status: int, out: istr, err: istr} {
+fn program_output(prog: &str, args: &[str]) ->
+   {status: int, out: str, err: str} {
     let pr = start_program(prog, args);
     pr.close_input();
     ret {status: pr.finish(),
diff --git a/src/lib/sha1.rs b/src/lib/sha1.rs
index b1c1a2ac229..25003a4b128 100644
--- a/src/lib/sha1.rs
+++ b/src/lib/sha1.rs
@@ -6,20 +6,21 @@
 export sha1;
 export mk_sha1;
 
-type sha1 = obj {
+type sha1 =
     // Provide message input as bytes
-    fn input(&[u8]);
     // Provide message input as string
-    fn input_str(&istr);
     // Read the digest as a vector of 20 bytes. After calling this no further
     // input may provided until reset is called
-    fn result() -> [u8];
     // Same as above, just a hex-string version.
-    fn result_str() -> istr;
     // Reset the sha1 state for reuse. This is called
     // automatically during construction
-    fn reset();
-};
+    obj {
+        fn input(&[u8]);
+        fn input_str(&str);
+        fn result() -> [u8];
+        fn result_str() -> str;
+        fn reset();
+    };
 
 
 // Some unexported constants
@@ -215,14 +216,12 @@ fn mk_sha1() -> sha1 {
             st.computed = false;
         }
         fn input(msg: &[u8]) { add_input(st, msg); }
-        fn input_str(msg: &istr) { add_input(st, str::bytes(msg)); }
+        fn input_str(msg: &str) { add_input(st, str::bytes(msg)); }
         fn result() -> [u8] { ret mk_result(st); }
-        fn result_str() -> istr {
+        fn result_str() -> str {
             let r = mk_result(st);
-            let s = ~"";
-            for b: u8 in r {
-                s += uint::to_str(b as uint, 16u);
-            }
+            let s = "";
+            for b: u8 in r { s += uint::to_str(b as uint, 16u); }
             ret s;
         }
     }
diff --git a/src/lib/str.rs b/src/lib/str.rs
index 662d0d0c228..a20c3f205ab 100644
--- a/src/lib/str.rs
+++ b/src/lib/str.rs
@@ -1,20 +1,20 @@
-export eq, lteq, hash, is_empty, is_not_empty, is_whitespace, byte_len,
-index, rindex, find, starts_with, ends_with, substr, slice, split,
-concat, connect, to_upper, replace, char_slice, trim_left, trim_right, trim,
-unshift_char, shift_char, pop_char, push_char, is_utf8, from_chars, to_chars,
-char_len, char_at, bytes, is_ascii, shift_byte, pop_byte, unsafe_from_byte,
-unsafe_from_bytes, from_char, char_range_at, str_from_cstr, sbuf,
-as_buf, push_byte, utf8_char_width, safe_slice;
+export eq, lteq, hash, is_empty, is_not_empty, is_whitespace, byte_len, index,
+       rindex, find, starts_with, ends_with, substr, slice, split, concat,
+       connect, to_upper, replace, char_slice, trim_left, trim_right, trim,
+       unshift_char, shift_char, pop_char, push_char, is_utf8, from_chars,
+       to_chars, char_len, char_at, bytes, is_ascii, shift_byte, pop_byte,
+       unsafe_from_byte, unsafe_from_bytes, from_char, char_range_at,
+       str_from_cstr, sbuf, as_buf, push_byte, utf8_char_width, safe_slice;
 
 native "rust" mod rustrt {
-    fn rust_istr_push(s: &mutable istr, ch: u8);
+    fn rust_istr_push(s: &mutable str, ch: u8);
 }
 
-fn eq(a: &istr, b: &istr) -> bool { a == b }
+fn eq(a: &str, b: &str) -> bool { a == b }
 
-fn lteq(a: &istr, b: &istr) -> bool { a <= b }
+fn lteq(a: &str, b: &str) -> bool { a <= b }
 
-fn hash(s: &istr) -> uint {
+fn hash(s: &str) -> uint {
     // djb hash.
     // FIXME: replace with murmur.
 
@@ -54,23 +54,19 @@ fn is_utf8(v: &[u8]) -> bool {
     ret true;
 }
 
-fn is_ascii(s: &istr) -> bool {
+fn is_ascii(s: &str) -> bool {
     let i: uint = byte_len(s);
     while i > 0u { i -= 1u; if s[i] & 128u8 != 0u8 { ret false; } }
     ret true;
 }
 
 /// Returns true if the string has length 0
-pure fn is_empty(s: &istr) -> bool {
-    for c: u8 in s { ret false; } ret true;
-}
+pure fn is_empty(s: &str) -> bool { for c: u8 in s { ret false; } ret true; }
 
 /// Returns true if the string has length greater than 0
-pure fn is_not_empty(s: &istr) -> bool {
-    !is_empty(s)
-}
+pure fn is_not_empty(s: &str) -> bool { !is_empty(s) }
 
-fn is_whitespace(s: &istr) -> bool {
+fn is_whitespace(s: &str) -> bool {
     let i = 0u;
     let len = char_len(s);
     while i < len {
@@ -80,74 +76,68 @@ fn is_whitespace(s: &istr) -> bool {
     ret true;
 }
 
-fn byte_len(s: &istr) -> uint {
+fn byte_len(s: &str) -> uint {
     let v: [u8] = unsafe::reinterpret_cast(s);
     let vlen = vec::len(v);
     unsafe::leak(v);
     // There should always be a null terminator
-    assert vlen > 0u;
+    assert (vlen > 0u);
     ret vlen - 1u;
 }
 
-fn bytes(s: &istr) -> [u8] {
+fn bytes(s: &str) -> [u8] {
     let v = unsafe::reinterpret_cast(s);
     let vcopy = vec::slice(v, 0u, vec::len(v) - 1u);
     unsafe::leak(v);
     ret vcopy;
 }
 
-fn unsafe_from_bytes(v: &[mutable? u8]) -> istr {
+fn unsafe_from_bytes(v: &[mutable? u8]) -> str {
     let vcopy: [u8] = v + [0u8];
-    let scopy: istr = unsafe::reinterpret_cast(vcopy);
+    let scopy: str = unsafe::reinterpret_cast(vcopy);
     unsafe::leak(vcopy);
     ret scopy;
 }
 
-fn unsafe_from_byte(u: u8) -> istr {
-    unsafe_from_bytes([u])
-}
+fn unsafe_from_byte(u: u8) -> str { unsafe_from_bytes([u]) }
 
-fn push_utf8_bytes(s: &mutable istr, ch: char) {
+fn push_utf8_bytes(s: &mutable str, ch: char) {
     let code = ch as uint;
-    let bytes = if code < max_one_b {
-        [code as u8]
-    } else if code < max_two_b {
-        [(code >> 6u & 31u | tag_two_b) as u8,
-         (code & 63u | tag_cont) as u8]
-    } else if code < max_three_b {
-        [(code >> 12u & 15u | tag_three_b) as u8,
-         (code >> 6u & 63u | tag_cont) as u8,
-         (code & 63u | tag_cont) as u8]
-    } else if code < max_four_b {
-        [(code >> 18u & 7u | tag_four_b) as u8,
-         (code >> 12u & 63u | tag_cont) as u8,
-         (code >> 6u & 63u | tag_cont) as u8,
-         (code & 63u | tag_cont) as u8]
-    } else if code < max_five_b {
-        [(code >> 24u & 3u | tag_five_b) as u8,
-         (code >> 18u & 63u | tag_cont) as u8,
-         (code >> 12u & 63u | tag_cont) as u8,
-         (code >> 6u & 63u | tag_cont) as u8,
-         (code & 63u | tag_cont) as u8]
-    } else {
-        [(code >> 30u & 1u | tag_six_b) as u8,
-         (code >> 24u & 63u | tag_cont) as u8,
-         (code >> 18u & 63u | tag_cont) as u8,
-         (code >> 12u & 63u | tag_cont) as u8,
-         (code >> 6u & 63u | tag_cont) as u8,
-         (code & 63u | tag_cont) as u8]
-    };
+    let bytes =
+        if code < max_one_b {
+            [code as u8]
+        } else if code < max_two_b {
+            [code >> 6u & 31u | tag_two_b as u8, code & 63u | tag_cont as u8]
+        } else if code < max_three_b {
+            [code >> 12u & 15u | tag_three_b as u8,
+             code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8]
+        } else if code < max_four_b {
+            [code >> 18u & 7u | tag_four_b as u8,
+             code >> 12u & 63u | tag_cont as u8,
+             code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8]
+        } else if code < max_five_b {
+            [code >> 24u & 3u | tag_five_b as u8,
+             code >> 18u & 63u | tag_cont as u8,
+             code >> 12u & 63u | tag_cont as u8,
+             code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8]
+        } else {
+            [code >> 30u & 1u | tag_six_b as u8,
+             code >> 24u & 63u | tag_cont as u8,
+             code >> 18u & 63u | tag_cont as u8,
+             code >> 12u & 63u | tag_cont as u8,
+             code >> 6u & 63u | tag_cont as u8, code & 63u | tag_cont as u8]
+        };
     push_bytes(s, bytes);
 }
 
-fn from_char(ch: char) -> istr {
-    let buf = ~"";
+fn from_char(ch: char) -> str {
+    let buf = "";
     push_utf8_bytes(buf, ch);
     ret buf;
 }
 
-fn from_chars(chs: &[char]) -> istr {
-    let buf = ~"";
+fn from_chars(chs: &[char]) -> str {
+    let buf = "";
     for ch: char in chs { push_utf8_bytes(buf, ch); }
     ret buf;
 }
@@ -166,7 +156,7 @@ fn utf8_char_width(b: u8) -> uint {
     ret 6u;
 }
 
-fn char_range_at(s: &istr, i: uint) -> {ch: char, next: uint} {
+fn char_range_at(s: &str, i: uint) -> {ch: char, next: uint} {
     let b0 = s[i];
     let w = utf8_char_width(b0);
     assert (w != 0u);
@@ -188,9 +178,9 @@ fn char_range_at(s: &istr, i: uint) -> {ch: char, next: uint} {
     ret {ch: val as char, next: i};
 }
 
-fn char_at(s: &istr, i: uint) -> char { ret char_range_at(s, i).ch; }
+fn char_at(s: &str, i: uint) -> char { ret char_range_at(s, i).ch; }
 
-fn char_len(s: &istr) -> uint {
+fn char_len(s: &str) -> uint {
     let i = 0u;
     let len = 0u;
     let total = byte_len(s);
@@ -204,7 +194,7 @@ fn char_len(s: &istr) -> uint {
     ret len;
 }
 
-fn to_chars(s: &istr) -> [char] {
+fn to_chars(s: &str) -> [char] {
     let buf: [char] = [];
     let i = 0u;
     let len = byte_len(s);
@@ -216,9 +206,9 @@ fn to_chars(s: &istr) -> [char] {
     ret buf;
 }
 
-fn push_char(s: &mutable istr, ch: char) { s += from_char(ch); }
+fn push_char(s: &mutable str, ch: char) { s += from_char(ch); }
 
-fn pop_char(s: &mutable istr) -> char {
+fn pop_char(s: &mutable str) -> char {
     let end = byte_len(s);
     while end > 0u && s[end - 1u] & 192u8 == tag_cont_u8 { end -= 1u; }
     assert (end > 0u);
@@ -227,31 +217,31 @@ fn pop_char(s: &mutable istr) -> char {
     ret ch;
 }
 
-fn shift_char(s: &mutable istr) -> char {
+fn shift_char(s: &mutable str) -> char {
     let r = char_range_at(s, 0u);
     s = substr(s, r.next, byte_len(s) - r.next);
     ret r.ch;
 }
 
-fn unshift_char(s: &mutable istr, ch: char) { s = from_char(ch) + s; }
+fn unshift_char(s: &mutable str, ch: char) { s = from_char(ch) + s; }
 
-fn index(s: &istr, c: u8) -> int {
+fn index(s: &str, c: u8) -> int {
     let i: int = 0;
     for k: u8 in s { if k == c { ret i; } i += 1; }
     ret -1;
 }
 
-fn rindex(s: &istr, c: u8) -> int {
+fn rindex(s: &str, c: u8) -> int {
     let n: int = byte_len(s) as int;
     while n >= 0 { if s[n] == c { ret n; } n -= 1; }
     ret n;
 }
 
-fn find(haystack: &istr, needle: &istr) -> int {
+fn find(haystack: &str, needle: &str) -> int {
     let haystack_len: int = byte_len(haystack) as int;
     let needle_len: int = byte_len(needle) as int;
     if needle_len == 0 { ret 0; }
-    fn match_at(haystack: &istr, needle: &istr, i: int) -> bool {
+    fn match_at(haystack: &str, needle: &str, i: int) -> bool {
         let j: int = i;
         for c: u8 in needle { if haystack[j] != c { ret false; } j += 1; }
         ret true;
@@ -264,7 +254,7 @@ fn find(haystack: &istr, needle: &istr) -> int {
     ret -1;
 }
 
-fn starts_with(haystack: &istr, needle: &istr) -> bool {
+fn starts_with(haystack: &str, needle: &str) -> bool {
     let haystack_len: uint = byte_len(haystack);
     let needle_len: uint = byte_len(needle);
     if needle_len == 0u { ret true; }
@@ -272,7 +262,7 @@ fn starts_with(haystack: &istr, needle: &istr) -> bool {
     ret eq(substr(haystack, 0u, needle_len), needle);
 }
 
-fn ends_with(haystack: &istr, needle: &istr) -> bool {
+fn ends_with(haystack: &str, needle: &str) -> bool {
     let haystack_len: uint = byte_len(haystack);
     let needle_len: uint = byte_len(needle);
     ret if needle_len == 0u {
@@ -285,11 +275,11 @@ fn ends_with(haystack: &istr, needle: &istr) -> bool {
         };
 }
 
-fn substr(s: &istr, begin: uint, len: uint) -> istr {
+fn substr(s: &str, begin: uint, len: uint) -> str {
     ret slice(s, begin, begin + len);
 }
 
-fn slice(s: &istr, begin: uint, end: uint) -> istr {
+fn slice(s: &str, begin: uint, end: uint) -> str {
     // FIXME: Typestate precondition
     assert (begin <= end);
     assert (end <= byte_len(s));
@@ -298,19 +288,18 @@ fn slice(s: &istr, begin: uint, end: uint) -> istr {
     let v2 = vec::slice(v, begin, end);
     unsafe::leak(v);
     v2 += [0u8];
-    let s2: istr = unsafe::reinterpret_cast(v2);
+    let s2: str = unsafe::reinterpret_cast(v2);
     unsafe::leak(v2);
     ret s2;
 }
 
-fn safe_slice(s: &istr, begin: uint, end: uint)
-    : uint::le(begin, end) -> istr {
+fn safe_slice(s: &str, begin: uint, end: uint) : uint::le(begin, end) -> str {
     // would need some magic to make this a precondition
     assert (end <= byte_len(s));
     ret slice(s, begin, end);
 }
 
-fn shift_byte(s: &mutable istr) -> u8 {
+fn shift_byte(s: &mutable str) -> u8 {
     let len = byte_len(s);
     assert (len > 0u);
     let b = s[0];
@@ -318,7 +307,7 @@ fn shift_byte(s: &mutable istr) -> u8 {
     ret b;
 }
 
-fn pop_byte(s: &mutable istr) -> u8 {
+fn pop_byte(s: &mutable str) -> u8 {
     let len = byte_len(s);
     assert (len > 0u);
     let b = s[len - 1u];
@@ -326,24 +315,20 @@ fn pop_byte(s: &mutable istr) -> u8 {
     ret b;
 }
 
-fn push_byte(s: &mutable istr, b: u8) {
-    rustrt::rust_istr_push(s, b);
-}
+fn push_byte(s: &mutable str, b: u8) { rustrt::rust_istr_push(s, b); }
 
-fn push_bytes(s: &mutable istr, bytes: &[u8]) {
-    for byte in bytes {
-        rustrt::rust_istr_push(s, byte);
-    }
+fn push_bytes(s: &mutable str, bytes: &[u8]) {
+    for byte in bytes { rustrt::rust_istr_push(s, byte); }
 }
 
-fn split(s: &istr, sep: u8) -> [istr] {
-    let v: [istr] = [];
-    let accum: istr = ~"";
+fn split(s: &str, sep: u8) -> [str] {
+    let v: [str] = [];
+    let accum: str = "";
     let ends_with_sep: bool = false;
     for c: u8 in s {
         if c == sep {
             v += [accum];
-            accum = ~"";
+            accum = "";
             ends_with_sep = true;
         } else { accum += unsafe_from_byte(c); ends_with_sep = false; }
     }
@@ -351,16 +336,16 @@ fn split(s: &istr, sep: u8) -> [istr] {
     ret v;
 }
 
-fn concat(v: &[istr]) -> istr {
-    let s: istr = ~"";
-    for ss: istr in v { s += ss; }
+fn concat(v: &[str]) -> str {
+    let s: str = "";
+    for ss: str in v { s += ss; }
     ret s;
 }
 
-fn connect(v: &[istr], sep: &istr) -> istr {
-    let s: istr = ~"";
+fn connect(v: &[str], sep: &str) -> str {
+    let s: str = "";
     let first: bool = true;
-    for ss: istr in v {
+    for ss: str in v {
         if first { first = false; } else { s += sep; }
         s += ss;
     }
@@ -368,8 +353,8 @@ fn connect(v: &[istr], sep: &istr) -> istr {
 }
 
 // FIXME: This only handles ASCII
-fn to_upper(s: &istr) -> istr {
-    let outstr = ~"";
+fn to_upper(s: &str) -> str {
+    let outstr = "";
     let ascii_a = 'a' as u8;
     let ascii_z = 'z' as u8;
     let diff = 32u8;
@@ -384,11 +369,11 @@ fn to_upper(s: &istr) -> istr {
 }
 
 // FIXME: This is super-inefficient
-fn replace(s: &istr, from: &istr, to: &istr) : is_not_empty(from) -> istr {
+fn replace(s: &str, from: &str, to: &str) : is_not_empty(from) -> str {
     // FIXME (694): Shouldn't have to check this
     check (is_not_empty(from));
     if byte_len(s) == 0u {
-        ret ~"";
+        ret "";
     } else if starts_with(s, from) {
         ret to + replace(slice(s, byte_len(from), byte_len(s)), from, to);
     } else {
@@ -398,11 +383,11 @@ fn replace(s: &istr, from: &istr, to: &istr) : is_not_empty(from) -> istr {
 }
 
 // FIXME: Also not efficient
-fn char_slice(s: &istr, begin: uint, end: uint) -> istr {
+fn char_slice(s: &str, begin: uint, end: uint) -> str {
     from_chars(vec::slice(to_chars(s), begin, end))
 }
 
-fn trim_left(s: &istr) -> istr {
+fn trim_left(s: &str) -> str {
     fn count_whities(s: &[char]) -> uint {
         let i = 0u;
         while i < vec::len(s) {
@@ -416,7 +401,7 @@ fn trim_left(s: &istr) -> istr {
     ret from_chars(vec::slice(chars, whities, vec::len(chars)));
 }
 
-fn trim_right(s: &istr) -> istr {
+fn trim_right(s: &str) -> str {
     fn count_whities(s: &[char]) -> uint {
         let i = vec::len(s);
         while 0u < i {
@@ -430,26 +415,21 @@ fn trim_right(s: &istr) -> istr {
     ret from_chars(vec::slice(chars, 0u, whities));
 }
 
-fn trim(s: &istr) -> istr {
-    trim_left(trim_right(s))
-}
+fn trim(s: &str) -> str { trim_left(trim_right(s)) }
 
 type sbuf = *u8;
 
-fn buf(s: &istr) -> sbuf {
+fn buf(s: &str) -> sbuf {
     let saddr = ptr::addr_of(s);
     let vaddr: *[u8] = unsafe::reinterpret_cast(saddr);
     let buf = vec::to_ptr(*vaddr);
     ret buf;
 }
 
-fn as_buf<T>(s: &istr, f: &block(sbuf) -> T) -> T {
-    let buf = buf(s);
-    f(buf)
-}
+fn as_buf<T>(s: &str, f: &block(sbuf) -> T) -> T { let buf = buf(s); f(buf) }
 
-fn str_from_cstr(cstr: sbuf) -> istr {
-    let res = ~"";
+fn str_from_cstr(cstr: sbuf) -> str {
+    let res = "";
     let start = cstr;
     let curr = start;
     let i = 0u;
@@ -459,4 +439,4 @@ fn str_from_cstr(cstr: sbuf) -> istr {
         curr = ptr::offset(start, i);
     }
     ret res;
-}
\ No newline at end of file
+}
diff --git a/src/lib/task.rs b/src/lib/task.rs
index 71032bbcd64..fc7116f58b9 100644
--- a/src/lib/task.rs
+++ b/src/lib/task.rs
@@ -122,7 +122,7 @@ fn spawn_inner(thunk: -fn(), notify: option<comm::chan<task_notification>>) ->
     // set up the task pointer
     let task_ptr = rust_task_ptr(rustrt::get_task_pointer(id));
     let regs = ptr::addr_of((**task_ptr).ctx.regs);
-    (*regs).edx = cast(*task_ptr);
+    (*regs).edx = cast(*task_ptr);;
     (*regs).esp = cast((**task_ptr).stack_ptr);
 
     assert (ptr::null() != (**task_ptr).stack_ptr);
diff --git a/src/lib/term.rs b/src/lib/term.rs
index f5189c49a43..cfec5ff6b8f 100644
--- a/src/lib/term.rs
+++ b/src/lib/term.rs
@@ -48,10 +48,10 @@ fn reset(writer: io::buf_writer) {
 }
 
 fn color_supported() -> bool {
-    let supported_terms = [~"xterm-color", ~"xterm", ~"screen-bce"];
-    ret alt generic_os::getenv(~"TERM") {
+    let supported_terms = ["xterm-color", "xterm", "screen-bce"];
+    ret alt generic_os::getenv("TERM") {
           option::some(env) {
-            for term: istr in supported_terms {
+            for term: str in supported_terms {
                 if str::eq(term, env) { ret true; }
             }
             false
diff --git a/src/lib/test.rs b/src/lib/test.rs
index e8ab05a46ba..37fec12e9ce 100644
--- a/src/lib/test.rs
+++ b/src/lib/test.rs
@@ -35,7 +35,7 @@ native "rust" mod rustrt {
 // paths, i.e it should be a series of identifiers seperated by double
 // colons. This way if some test runner wants to arrange the tests
 // heirarchically it may.
-type test_name = istr;
+type test_name = str;
 
 // A function that runs a test. If the function returns successfully,
 // the test succeeds; if the function fails then the test fails. We
@@ -49,7 +49,7 @@ type test_desc = {name: test_name, fn: test_fn, ignore: bool};
 
 // The default console test runner. It accepts the command line
 // arguments and a vector of test_descs (generated at compile time).
-fn test_main(args: &[istr], tests: &[test_desc]) {
+fn test_main(args: &[str], tests: &[test_desc]) {
     check (vec::is_not_empty(args));
     let opts =
         alt parse_opts(args) {
@@ -59,21 +59,19 @@ fn test_main(args: &[istr], tests: &[test_desc]) {
     if !run_tests_console(opts, tests) { fail "Some tests failed"; }
 }
 
-type test_opts = {filter: option::t<istr>, run_ignored: bool};
+type test_opts = {filter: option::t<str>, run_ignored: bool};
 
-type opt_res = either::t<test_opts, istr>;
+type opt_res = either::t<test_opts, str>;
 
 // Parses command line arguments into test options
-fn parse_opts(args: &[istr]) : vec::is_not_empty(args) -> opt_res {
+fn parse_opts(args: &[str]) : vec::is_not_empty(args) -> opt_res {
 
     let args_ = vec::tail(args);
-    let opts = [getopts::optflag(~"ignored")];
+    let opts = [getopts::optflag("ignored")];
     let match =
         alt getopts::getopts(args_, opts) {
           getopts::success(m) { m }
-          getopts::failure(f) {
-            ret either::right(getopts::fail_str(f))
-          }
+          getopts::failure(f) { ret either::right(getopts::fail_str(f)) }
         };
 
     let filter =
@@ -81,7 +79,7 @@ fn parse_opts(args: &[istr]) : vec::is_not_empty(args) -> opt_res {
             option::some(match.free[0])
         } else { option::none };
 
-    let run_ignored = getopts::opt_present(match, ~"ignored");
+    let run_ignored = getopts::opt_present(match, "ignored");
 
     let test_opts = {filter: filter, run_ignored: run_ignored};
 
@@ -119,30 +117,26 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
         alt event {
           te_filtered(filtered_tests) {
             st.total = vec::len(filtered_tests);
-            st.out.write_line(
-                #fmt["\nrunning %u tests", st.total]);
-          }
-          te_wait(test) {
-            st.out.write_str(
-                #fmt["test %s ... ", test.name]);
+            st.out.write_line(#fmt["\nrunning %u tests", st.total]);
           }
+          te_wait(test) { st.out.write_str(#fmt["test %s ... ", test.name]); }
           te_result(test, result) {
             alt result {
               tr_ok. {
                 st.passed += 1u;
                 write_ok(st.out, st.use_color);
-                st.out.write_line(~"");
+                st.out.write_line("");
               }
               tr_failed. {
                 st.failed += 1u;
                 write_failed(st.out, st.use_color);
-                st.out.write_line(~"");
+                st.out.write_line("");
                 st.failures += [test];
               }
               tr_ignored. {
                 st.ignored += 1u;
                 write_ignored(st.out, st.use_color);
-                st.out.write_line(~"");
+                st.out.write_line("");
               }
             }
           }
@@ -164,7 +158,7 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
     let success = st.failed == 0u;
 
     if !success {
-        st.out.write_line(~"\nfailures:");
+        st.out.write_line("\nfailures:");
         for test: test_desc in st.failures {
             let testname = test.name; // Satisfy alias analysis
             st.out.write_line(#fmt["    %s", testname]);
@@ -176,25 +170,24 @@ fn run_tests_console_(opts: &test_opts, tests: &[test_desc],
         // There's no parallelism at this point so it's safe to use color
         write_ok(st.out, true);
     } else { write_failed(st.out, true); }
-    st.out.write_str(
-            #fmt[". %u passed; %u failed; %u ignored\n\n", st.passed,
+    st.out.write_str(#fmt[". %u passed; %u failed; %u ignored\n\n", st.passed,
                           st.failed, st.ignored]);
 
     ret success;
 
     fn write_ok(out: &io::writer, use_color: bool) {
-        write_pretty(out, ~"ok", term::color_green, use_color);
+        write_pretty(out, "ok", term::color_green, use_color);
     }
 
     fn write_failed(out: &io::writer, use_color: bool) {
-        write_pretty(out, ~"FAILED", term::color_red, use_color);
+        write_pretty(out, "FAILED", term::color_red, use_color);
     }
 
     fn write_ignored(out: &io::writer, use_color: bool) {
-        write_pretty(out, ~"ignored", term::color_yellow, use_color);
+        write_pretty(out, "ignored", term::color_yellow, use_color);
     }
 
-    fn write_pretty(out: &io::writer, word: &istr, color: u8,
+    fn write_pretty(out: &io::writer, word: &str, color: u8,
                     use_color: bool) {
         if use_color && term::color_supported() {
             term::fg(out.get_buf_writer(), color);
@@ -259,11 +252,11 @@ fn filter_tests(opts: &test_opts, tests: &[test_desc]) -> [test_desc] {
             let filter_str =
                 alt opts.filter {
                   option::some(f) { f }
-                  option::none. { ~"" }
+                  option::none. { "" }
                 };
 
             let filter =
-                bind fn (test: &test_desc, filter_str: &istr) ->
+                bind fn (test: &test_desc, filter_str: &str) ->
                         option::t<test_desc> {
                          if str::find(test.name, filter_str) >= 0 {
                              ret option::some(test);
diff --git a/src/lib/treemap.rs b/src/lib/treemap.rs
index 8323bcfa67a..cdf9a67042b 100644
--- a/src/lib/treemap.rs
+++ b/src/lib/treemap.rs
@@ -17,82 +17,49 @@ export insert;
 export find;
 export traverse;
 
-tag tree_node<@K, @V> {
-    empty;
-    node(@K, @V, treemap<K, V>, treemap<K, V>);
-}
+tag tree_node<@K, @V> { empty; node(@K, @V, treemap<K, V>, treemap<K, V>); }
 
 type treemap<@K, @V> = @mutable tree_node<K, V>;
 
-fn init<@K, @V>() -> treemap<K,V> { @mutable empty }
+fn init<@K, @V>() -> treemap<K, V> { @mutable empty }
 
-fn insert<@K, @V>(m : &treemap<K, V>, k : &K, v : &V) {
+fn insert<@K, @V>(m: &treemap<K, V>, k: &K, v: &V) {
     alt m {
-      @empty. {
-        *m = node(@k, @v, @mutable empty, @mutable empty);
-      }
+      @empty. { *m = node(@k, @v, @mutable empty, @mutable empty); }
       @node(@kk, _, _, _) {
+
         // We have to name left and right individually, because
         // otherwise the alias checker complains.
         if k < kk {
-            alt m {
-              @node(_, _, left, _) {
-                insert(left, k, v);
-              }
-            }
-        }
-        else {
-            alt m {
-              @node(_, _, _, right) {
-                insert(right, k, v);
-              }
-            }
-        }
+            alt m { @node(_, _, left, _) { insert(left, k, v); } }
+        } else { alt m { @node(_, _, _, right) { insert(right, k, v); } } }
       }
     }
 }
 
-fn find<@K, @V>(m : &treemap<K, V>, k : &K) -> option<V> {
-  alt *m {
-    empty. { none }
-    node(@kk, @v, _, _) {
-      if k == kk { some(v) }
-      // Again, ugliness to unpack left and right individually.
-      else if k < kk {
-          alt *m {
-            node(_, _, left, _) {
-              find(left, k)
-            }
-          }
-      }
-      else {
-          alt *m {
-            node(_, _, _, right) {
-              find(right, k)
-            }
-          }
+fn find<@K, @V>(m: &treemap<K, V>, k: &K) -> option<V> {
+    alt *m {
+      empty. { none }
+      node(@kk, @v, _, _) {
+        if k == kk {
+            some(v)
+        } else if k < kk {
+            // Again, ugliness to unpack left and right individually.
+            alt *m { node(_, _, left, _) { find(left, k) } }
+        } else { alt *m { node(_, _, _, right) { find(right, k) } } }
       }
     }
-  }
 }
 
 // Performs an in-order traversal
-fn traverse<@K, @V>(m : &treemap<K, V>, f : fn(&K, &V)) {
-  alt *m {
-    empty. { }
-    node(k, v, _, _) {
-      let k1 = k, v1 = v;
-      alt *m {
-        node(_, _, left, _) {
-          traverse(left, f);
-        }
-      }
-      f(*k1, *v1);
-      alt *m {
-        node(_, _, _, right) {
-          traverse(right, f);
-        }
+fn traverse<@K, @V>(m: &treemap<K, V>, f: fn(&K, &V)) {
+    alt *m {
+      empty. { }
+      node(k, v, _, _) {
+        let k1 = k, v1 = v;
+        alt *m { node(_, _, left, _) { traverse(left, f); } }
+        f(*k1, *v1);
+        alt *m { node(_, _, _, right) { traverse(right, f); } }
       }
     }
-  }
 }
diff --git a/src/lib/u64.rs b/src/lib/u64.rs
index 0d4c0d3f74b..8082f7aef0d 100644
--- a/src/lib/u64.rs
+++ b/src/lib/u64.rs
@@ -1,36 +1,36 @@
-fn to_str(n: u64, radix: uint) -> istr {
+fn to_str(n: u64, radix: uint) -> str {
     assert (0u < radix && radix <= 16u);
 
     let r64 = radix as u64;
 
-    fn digit(n: u64) -> istr {
+    fn digit(n: u64) -> str {
         ret alt n {
-              0u64 { ~"0" }
-              1u64 { ~"1" }
-              2u64 { ~"2" }
-              3u64 { ~"3" }
-              4u64 { ~"4" }
-              5u64 { ~"5" }
-              6u64 { ~"6" }
-              7u64 { ~"7" }
-              8u64 { ~"8" }
-              9u64 { ~"9" }
-              10u64 { ~"a" }
-              11u64 { ~"b" }
-              12u64 { ~"c" }
-              13u64 { ~"d" }
-              14u64 { ~"e" }
-              15u64 { ~"f" }
+              0u64 { "0" }
+              1u64 { "1" }
+              2u64 { "2" }
+              3u64 { "3" }
+              4u64 { "4" }
+              5u64 { "5" }
+              6u64 { "6" }
+              7u64 { "7" }
+              8u64 { "8" }
+              9u64 { "9" }
+              10u64 { "a" }
+              11u64 { "b" }
+              12u64 { "c" }
+              13u64 { "d" }
+              14u64 { "e" }
+              15u64 { "f" }
               _ { fail }
             };
     }
 
-    if n == 0u64 { ret ~"0"; }
+    if n == 0u64 { ret "0"; }
 
-    let s = ~"";
+    let s = "";
 
     while n > 0u64 { s = digit(n % r64) + s; n /= r64; }
     ret s;
 }
 
-fn str(n: u64) -> istr { ret to_str(n, 10u); }
+fn str(n: u64) -> str { ret to_str(n, 10u); }
diff --git a/src/lib/uint.rs b/src/lib/uint.rs
index e7f85074ef2..3553dc7e2cf 100644
--- a/src/lib/uint.rs
+++ b/src/lib/uint.rs
@@ -56,9 +56,9 @@ fn parse_buf(buf: &[u8], radix: uint) -> uint {
     fail;
 }
 
-fn from_str(s: &istr) -> uint { parse_buf(str::bytes(s), 10u) }
+fn from_str(s: &str) -> uint { parse_buf(str::bytes(s), 10u) }
 
-fn to_str(num: uint, radix: uint) -> istr {
+fn to_str(num: uint, radix: uint) -> str {
     let n = num;
     assert (0u < radix && radix <= 16u);
     fn digit(n: uint) -> char {
@@ -82,18 +82,18 @@ fn to_str(num: uint, radix: uint) -> istr {
               _ { fail }
             };
     }
-    if n == 0u { ret ~"0"; }
-    let s: istr = ~"";
+    if n == 0u { ret "0"; }
+    let s: str = "";
     while n != 0u {
         s += str::unsafe_from_byte(digit(n % radix) as u8);
         n /= radix;
     }
-    let s1: istr = ~"";
+    let s1: str = "";
     let len: uint = str::byte_len(s);
     while len != 0u { len -= 1u; s1 += str::unsafe_from_byte(s[len]); }
     ret s1;
 }
-fn str(i: uint) -> istr { ret to_str(i, 10u); }
+fn str(i: uint) -> str { ret to_str(i, 10u); }
 
 // Local Variables:
 // mode: rust;
diff --git a/src/lib/unsafe.rs b/src/lib/unsafe.rs
index 0d382655b41..79e409d27fc 100644
--- a/src/lib/unsafe.rs
+++ b/src/lib/unsafe.rs
@@ -11,6 +11,4 @@ native "rust" mod rustrt {
 // Casts the value at `src` to U. The two types must have the same length.
 fn reinterpret_cast<T, @U>(src: &T) -> U { ret rusti::cast(src); }
 
-fn leak<@T>(thing: -T) {
-    rustrt::leak(thing);
-}
\ No newline at end of file
+fn leak<@T>(thing: -T) { rustrt::leak(thing); }
diff --git a/src/lib/vec.rs b/src/lib/vec.rs
index 40ad520998f..1ec736c6e87 100644
--- a/src/lib/vec.rs
+++ b/src/lib/vec.rs
@@ -262,8 +262,8 @@ fn position_pred<T>(f: fn(&T) -> bool, v: &[T]) -> option::t<uint> {
 }
 
 pure fn same_length<T, U>(xs: &[T], ys: &[U]) -> bool {
-    let xlen = unchecked { vec::len(xs) };
-    let ylen = unchecked { vec::len(ys) };
+    let xlen = unchecked{ vec::len(xs) };
+    let ylen = unchecked{ vec::len(ys) };
     xlen == ylen
 }
 
@@ -311,39 +311,28 @@ fn reversed<@T>(v: &[T]) -> [T] {
 }
 
 // Generating vecs.
-fn enum_chars(start:u8, end:u8) : u8::le(start, end) -> [char] {
+fn enum_chars(start: u8, end: u8) : u8::le(start, end) -> [char] {
     let i = start;
     let r = [];
-    while (i <= end) {
-        r += [i as char];
-        i += (1u as u8);
-    }
+    while i <= end { r += [i as char]; i += 1u as u8; }
     ret r;
 }
 
-fn enum_uints(start:uint, end:uint) : uint::le(start, end) -> [uint] {
+fn enum_uints(start: uint, end: uint) : uint::le(start, end) -> [uint] {
     let i = start;
     let r = [];
-    while (i <= end) {
-        r += [i];
-        i += 1u;
-    }
+    while i <= end { r += [i]; i += 1u; }
     ret r;
 }
 
 // Iterate over a list with with the indexes
 iter iter2<@T>(v: &[T]) -> (uint, T) {
     let i = 0u;
-    for x in v {
-        put (i, x);
-        i += 1u;
-    }
+    for x in v { put (i, x); i += 1u; }
 }
 
 mod unsafe {
-    type vec_repr = {mutable fill: uint,
-                     mutable alloc: uint,
-                     data: u8};
+    type vec_repr = {mutable fill: uint, mutable alloc: uint, data: u8};
 
     fn from_buf<T>(ptr: *T, elts: uint) -> [T] {
         ret rustrt::vec_from_buf_shared(ptr, elts);
@@ -360,9 +349,7 @@ mod unsafe {
     }
 }
 
-fn to_ptr<T>(v: &[T]) -> *T {
-    ret unsafe::to_ptr(v);
-}
+fn to_ptr<T>(v: &[T]) -> *T { ret unsafe::to_ptr(v); }
 
 // Local Variables:
 // mode: rust;
diff --git a/src/lib/win32_fs.rs b/src/lib/win32_fs.rs
index 3633a014ca4..8052d0280fe 100644
--- a/src/lib/win32_fs.rs
+++ b/src/lib/win32_fs.rs
@@ -1,16 +1,16 @@
 
 
 native "rust" mod rustrt {
-    fn rust_list_files(path: &istr) -> [istr];
+    fn rust_list_files(path: &str) -> [str];
     fn rust_file_is_dir(path: str) -> int;
 }
 
-fn list_dir(path: &istr) -> [istr] {
-    let path = path + ~"*";
+fn list_dir(path: &str) -> [str] {
+    let path = path + "*";
     ret rustrt::rust_list_files(path);
 }
 
-fn path_is_absolute(p: &istr) -> bool {
+fn path_is_absolute(p: &str) -> bool {
     ret str::char_at(p, 0u) == '/' ||
             str::char_at(p, 1u) == ':' && str::char_at(p, 2u) == '\\';
 }
diff --git a/src/lib/win32_os.rs b/src/lib/win32_os.rs
index 9dccbcc679d..bf94439099f 100644
--- a/src/lib/win32_os.rs
+++ b/src/lib/win32_os.rs
@@ -40,16 +40,16 @@ mod libc_constants {
 }
 
 native "x86stdcall" mod kernel32 {
-    fn GetEnvironmentVariableA(n: str::sbuf, v: str::sbuf,
-                               nsize: uint) -> uint;
+    fn GetEnvironmentVariableA(n: str::sbuf, v: str::sbuf, nsize: uint) ->
+       uint;
     fn SetEnvironmentVariableA(n: str::sbuf, v: str::sbuf) -> int;
 }
 
-fn exec_suffix() -> istr { ret ~".exe"; }
+fn exec_suffix() -> str { ret ".exe"; }
 
-fn target_os() -> istr { ret ~"win32"; }
+fn target_os() -> str { ret "win32"; }
 
-fn dylib_filename(base: &istr) -> istr { ret base + ~".dll"; }
+fn dylib_filename(base: &str) -> str { ret base + ".dll"; }
 
 fn pipe() -> {in: int, out: int} {
     // Windows pipes work subtly differently than unix pipes, and their
@@ -69,21 +69,17 @@ fn pipe() -> {in: int, out: int} {
 }
 
 fn fd_FILE(fd: int) -> libc::FILE {
-    ret str::as_buf(~"r", { |modebuf|
-        libc::_fdopen(fd, modebuf)
-    });
+    ret str::as_buf("r", {|modebuf| libc::_fdopen(fd, modebuf) });
 }
 
 native "rust" mod rustrt {
     fn rust_process_wait(handle: int) -> int;
-    fn rust_getcwd() -> istr;
+    fn rust_getcwd() -> str;
 }
 
 fn waitpid(pid: int) -> int { ret rustrt::rust_process_wait(pid); }
 
-fn getcwd() -> istr {
-    ret rustrt::rust_getcwd();
-}
+fn getcwd() -> str { ret rustrt::rust_getcwd(); }
 
 // Local Variables:
 // mode: rust;
diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs
index fea1420f8bb..a1a3e1b984a 100644
--- a/src/test/bench/99bob-iter.rs
+++ b/src/test/bench/99bob-iter.rs
@@ -8,28 +8,28 @@ use std;
 import std::int;
 import std::str;
 
-fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; }
+fn b1() -> str { ret "# of beer on the wall, # of beer."; }
 
-fn b2() -> istr {
-    ret ~"Take one down and pass it around, # of beer on the wall.";
+fn b2() -> str {
+    ret "Take one down and pass it around, # of beer on the wall.";
 }
 
-fn b7() -> istr {
-    ret ~"No more bottles of beer on the wall, no more bottles of beer.";
+fn b7() -> str {
+    ret "No more bottles of beer on the wall, no more bottles of beer.";
 }
 
-fn b8() -> istr {
-    ret ~"Go to the store and buy some more, # of beer on the wall.";
+fn b8() -> str {
+    ret "Go to the store and buy some more, # of beer on the wall.";
 }
 
-fn sub(t: &istr, n: int) -> istr {
-    let b: istr = ~"";
+fn sub(t: &str, n: int) -> str {
+    let b: str = "";
     let i: uint = 0u;
-    let ns: istr;
+    let ns: str;
     alt n {
-      0 { ns = ~"no more bottles"; }
-      1 { ns = ~"1 bottle"; }
-      _ { ns = int::to_str(n, 10u) + ~" bottles"; }
+      0 { ns = "no more bottles"; }
+      1 { ns = "1 bottle"; }
+      _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
         if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs
index a13015fb4f7..fdfce9dfae5 100644
--- a/src/test/bench/99bob-pattern.rs
+++ b/src/test/bench/99bob-pattern.rs
@@ -29,12 +29,11 @@ fn show(b: bottle) {
                 "1 bottle of beer on the wall.";
       }
       multiple(n) {
-        let nb: istr = int::to_str(n, 10u);
-        let mb: istr = int::to_str(n - 1, 10u);
-        log nb + ~" bottles of beer on the wall, " + nb +
-            ~" bottles of beer,";
-        log ~"Take one down and pass it around, " + mb +
-                ~" bottles of beer on the wall.";
+        let nb: str = int::to_str(n, 10u);
+        let mb: str = int::to_str(n - 1, 10u);
+        log nb + " bottles of beer on the wall, " + nb + " bottles of beer,";
+        log "Take one down and pass it around, " + mb +
+                " bottles of beer on the wall.";
       }
     }
 }
diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs
index 30518c63e2d..ae1c30fb9ec 100644
--- a/src/test/bench/99bob-simple.rs
+++ b/src/test/bench/99bob-simple.rs
@@ -8,28 +8,28 @@ use std;
 import std::int;
 import std::str;
 
-fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; }
+fn b1() -> str { ret "# of beer on the wall, # of beer."; }
 
-fn b2() -> istr {
-    ret ~"Take one down and pass it around, # of beer on the wall.";
+fn b2() -> str {
+    ret "Take one down and pass it around, # of beer on the wall.";
 }
 
-fn b7() -> istr {
-    ret ~"No more bottles of beer on the wall, no more bottles of beer.";
+fn b7() -> str {
+    ret "No more bottles of beer on the wall, no more bottles of beer.";
 }
 
-fn b8() -> istr {
-    ret ~"Go to the store and buy some more, # of beer on the wall.";
+fn b8() -> str {
+    ret "Go to the store and buy some more, # of beer on the wall.";
 }
 
-fn sub(t: &istr, n: int) -> istr {
-    let b: istr = ~"";
+fn sub(t: &str, n: int) -> str {
+    let b: str = "";
     let i: uint = 0u;
-    let ns: istr;
+    let ns: str;
     alt n {
-      0 { ns = ~"no more bottles"; }
-      1 { ns = ~"1 bottle"; }
-      _ { ns = int::to_str(n, 10u) + ~" bottles"; }
+      0 { ns = "no more bottles"; }
+      1 { ns = "1 bottle"; }
+      _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
         if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs
index 9ab8973cbce..af5e22f48ea 100644
--- a/src/test/bench/99bob-tail.rs
+++ b/src/test/bench/99bob-tail.rs
@@ -8,12 +8,11 @@ import std::str;
 
 fn main() {
     fn multiple(n: int) {
-        let nb: istr = int::to_str(n, 10u);
-        let mb: istr = int::to_str(n - 1, 10u);
-        log nb + ~" bottles of beer on the wall, " + nb +
-            ~" bottles of beer,";
-        log ~"Take one down and pass it around, " + mb +
-            ~" bottles of beer on the wall.";
+        let nb: str = int::to_str(n, 10u);
+        let mb: str = int::to_str(n - 1, 10u);
+        log nb + " bottles of beer on the wall, " + nb + " bottles of beer,";
+        log "Take one down and pass it around, " + mb +
+                " bottles of beer on the wall.";
         log "";
         if n > 3 { be multiple(n - 1); } else { be dual(); }
     }
diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs
index fa4a17180ae..8e7b2cbe269 100644
--- a/src/test/bench/shootout-fannkuchredux.rs
+++ b/src/test/bench/shootout-fannkuchredux.rs
@@ -56,7 +56,7 @@ fn fannkuch(n: int) -> int {
     ret flips;
 }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let n = 7;
     log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)];
 }
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index cd29838b378..99b06a98416 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -43,32 +43,31 @@ fn select_random(r: u32, genelist: &[aminoacids]) -> char {
     ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r);
 }
 
-fn make_random_fasta(id: &istr, desc: &istr,
-                     genelist: &[aminoacids], n: int) {
-    log ~">" + id + ~" " + desc;
+fn make_random_fasta(id: &str, desc: &str, genelist: &[aminoacids], n: int) {
+    log ">" + id + " " + desc;
     let rng = myrandom(std::rand::mk_rng().next());
-    let op: istr = ~"";
+    let op: str = "";
     for each i: uint in uint::range(0u, n as uint) {
         str::push_byte(op, select_random(rng.next(100u32), genelist) as u8);
-        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; }
+        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
 }
 
-fn make_repeat_fasta(id: &istr, desc: &istr, s: &istr, n: int) {
-    log ~">" + id + ~" " + desc;
-    let op: istr = ~"";
+fn make_repeat_fasta(id: &str, desc: &str, s: &str, n: int) {
+    log ">" + id + " " + desc;
+    let op: str = "";
     let sl: uint = str::byte_len(s);
     for each i: uint in uint::range(0u, n as uint) {
         str::push_byte(op, s[i % sl]);
-        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; }
+        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
 }
 
 fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let iub: [aminoacids] =
         make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
                          acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
@@ -78,17 +77,16 @@ fn main(args: [istr]) {
     let homosapiens: [aminoacids] =
         make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
                          acid('t', 30u32)]);
-    let alu: istr =
-        ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
-            ~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
-            ~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
-            ~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
-            ~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
-            ~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
-            ~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+    let alu: str =
+        "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+            "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+            "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+            "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+            "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+            "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+            "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
     let n: int = 512;
-    make_repeat_fasta(~"ONE", ~"Homo sapiens alu", alu, n * 2);
-    make_random_fasta(~"TWO", ~"IUB ambiguity codes", iub, n * 3);
-    make_random_fasta(~"THREE", ~"Homo sapiens frequency",
-                      homosapiens, n * 5);
+    make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2);
+    make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3);
+    make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5);
 }
diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs
index 6a9a5348c2e..9551aa6b982 100644
--- a/src/test/bench/shootout-pfib.rs
+++ b/src/test/bench/shootout-pfib.rs
@@ -49,14 +49,14 @@ fn fib(n: int) -> int {
 
 type config = {stress: bool};
 
-fn parse_opts(argv: &[istr]) -> config {
-    let opts = [getopts::optflag(~"stress")];
+fn parse_opts(argv: &[str]) -> config {
+    let opts = [getopts::optflag("stress")];
 
     let opt_args = vec::slice(argv, 1u, vec::len(argv));
 
 
     alt getopts::getopts(opt_args, opts) {
-      getopts::success(m) { ret {stress: getopts::opt_present(m, ~"stress")} }
+      getopts::success(m) { ret {stress: getopts::opt_present(m, "stress")} }
       getopts::failure(_) { fail; }
     }
 }
@@ -79,7 +79,7 @@ fn stress(num_tasks: int) {
     for t in tasks { task::join(t); }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) == 1u {
         assert (fib(8) == 21);
         log fib(8);
@@ -105,9 +105,8 @@ fn main(argv: [istr]) {
 
                     let elapsed = stop - start;
 
-                    out.write_line(
-                            #fmt["%d\t%d\t%s", n, fibn,
-                                 u64::str(elapsed)]);
+                    out.write_line(#fmt["%d\t%d\t%s", n, fibn,
+                                        u64::str(elapsed)]);
                 }
             }
         }
diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs
index 941f0183031..ebe1abc493b 100644
--- a/src/test/bench/task-perf-spawnalot.rs
+++ b/src/test/bench/task-perf-spawnalot.rs
@@ -8,12 +8,14 @@ fn f(n: uint) {
     let i = 0u;
     while i < n {
         let thunk = g;
-        task::join(task::spawn_joinable(thunk)); i += 1u; }
+        task::join(task::spawn_joinable(thunk));
+        i += 1u;
+    }
 }
 
 fn g() { }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let n =
         if vec::len(args) < 2u {
             10u
diff --git a/src/test/bench/task-perf-vector-party.rs b/src/test/bench/task-perf-vector-party.rs
index fd650df660b..b70bd24828a 100644
--- a/src/test/bench/task-perf-vector-party.rs
+++ b/src/test/bench/task-perf-vector-party.rs
@@ -16,13 +16,10 @@ fn f(n: uint) {
     }
 }
 
-fn main(args: [istr]) {
-    let n = if vec::len(args) < 2u {
-        100u
-    } else {
-        uint::parse_buf(str::bytes(args[1]), 10u)
-    };
-    for each i in uint::range(0u, 100u) {
-        task::spawn(bind f(n));
-    }
-}
\ No newline at end of file
+fn main(args: [str]) {
+    let n =
+        if vec::len(args) < 2u {
+            100u
+        } else { uint::parse_buf(str::bytes(args[1]), 10u) };
+    for each i in uint::range(0u, 100u) { task::spawn(bind f(n)); }
+}
diff --git a/src/test/bench/task-perf-word-count-generic.rs b/src/test/bench/task-perf-word-count-generic.rs
index 3a8f643bc37..adb5040fa25 100644
--- a/src/test/bench/task-perf-word-count-generic.rs
+++ b/src/test/bench/task-perf-word-count-generic.rs
@@ -70,9 +70,10 @@ mod map_reduce {
 
     tag reduce_proto<~V> { emit_val(V); done; ref; release; }
 
-    fn start_mappers<~K1, ~K2, ~V>(map : mapper<K1, K2, V>,
-                             ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1])
-        -> [joinable_task] {
+    fn start_mappers<~K1, ~K2,
+                     ~V>(map: mapper<K1, K2, V>,
+                         ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1]) ->
+       [joinable_task] {
         let tasks = [];
         for i in inputs {
             let m = map, c = ctrl, ii = i;
@@ -81,18 +82,18 @@ mod map_reduce {
         ret tasks;
     }
 
-    fn map_task<~K1, ~K2, ~V>(map : -mapper<K1,K2,V>,
-                              ctrl: -chan<ctrl_proto<K2,V>>, input: -K1) {
+    fn map_task<~K1, ~K2,
+                ~V>(map: -mapper<K1, K2, V>, ctrl: -chan<ctrl_proto<K2, V>>,
+                    input: -K1) {
         // log_err "map_task " + input;
         let intermediates = treemap::init();
 
-        fn emit<~K2, ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>,
-                         ctrl: &chan<ctrl_proto<K2,V>>, key: &K2, val: &V) {
+        fn emit<~K2,
+                ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>,
+                    ctrl: &chan<ctrl_proto<K2, V>>, key: &K2, val: &V) {
             let c;
             alt treemap::find(im, key) {
-              some(_c) {
-                c = _c
-              }
+              some(_c) { c = _c }
               none. {
                 let p = port();
                 send(ctrl, find_reducer(key, chan(p)));
@@ -106,15 +107,16 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) {
+        fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) {
             send(v, release);
         }
         treemap::traverse(intermediates, finish);
         send(ctrl, mapper_done);
     }
 
-    fn reduce_task<~K, ~V>(reduce : -reducer<K,V>,
-                           key: -K, out: -chan<chan<reduce_proto<V>>>) {
+    fn reduce_task<~K,
+                   ~V>(reduce: -reducer<K, V>, key: -K,
+                       out: -chan<chan<reduce_proto<V>>>) {
         let p = port();
 
         send(out, chan(p));
@@ -123,7 +125,7 @@ mod map_reduce {
         let is_done = false;
 
         fn get<~V>(p: &port<reduce_proto<V>>, ref_count: &mutable int,
-               is_done: &mutable bool) -> option<V> {
+                   is_done: &mutable bool) -> option<V> {
             while !is_done || ref_count > 0 {
                 alt recv(p) {
                   emit_val(v) {
@@ -144,9 +146,9 @@ mod map_reduce {
         reduce(key, bind get(p, ref_count, is_done));
     }
 
-    fn map_reduce<~K1, ~K2, ~V>(map : mapper<K1,K2,V>,
-                               reduce : reducer<K2, V>,
-                               inputs: &[K1]) {
+    fn map_reduce<~K1, ~K2,
+                  ~V>(map: mapper<K1, K2, V>, reduce: reducer<K2, V>,
+                      inputs: &[K1]) {
         let ctrl = port();
 
         // This task becomes the master control task. It task::_spawns
@@ -177,8 +179,8 @@ mod map_reduce {
                     let p = port();
                     let r = reduce, kk = k;
                     tasks +=
-                        [task::spawn_joinable(bind reduce_task(r,
-                                                               kk, chan(p)))];
+                        [task::spawn_joinable(bind reduce_task(r, kk,
+                                                               chan(p)))];
                     c = recv(p);
                     treemap::insert(reducers, k, c);
                   }
@@ -188,21 +190,18 @@ mod map_reduce {
             }
         }
 
-        fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) {
-            send(v, done);
-        }
+        fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) { send(v, done); }
         treemap::traverse(reducers, finish);
 
         for t in tasks { task::join(t); }
     }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(
-            #fmt["Usage: %s <filename> ...", argv[0]]);
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
@@ -227,12 +226,11 @@ fn main(argv: [istr]) {
     let elapsed = stop - start;
     elapsed /= 1000000u64;
 
-    log_err ~"MapReduce completed in " +
-        u64::str(elapsed) + ~"ms";
+    log_err "MapReduce completed in " + u64::str(elapsed) + "ms";
 }
 
-fn read_word(r: io::reader) -> option<istr> {
-    let w = ~"";
+fn read_word(r: io::reader) -> option<str> {
+    let w = "";
 
     while !r.eof() {
         let c = r.read_char();
@@ -240,7 +238,7 @@ fn read_word(r: io::reader) -> option<istr> {
 
         if is_word_char(c) {
             w += str::from_char(c);
-        } else { if w != ~"" { ret some(w); } }
+        } else { if w != "" { ret some(w); } }
     }
     ret none;
 }
diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs
index c62ebc73b5d..a90abd9e526 100644
--- a/src/test/bench/task-perf-word-count.rs
+++ b/src/test/bench/task-perf-word-count.rs
@@ -29,7 +29,7 @@ import std::comm::port;
 import std::comm::recv;
 import std::comm::send;
 
-fn map(filename: &istr, emit: map_reduce::putter) {
+fn map(filename: &str, emit: map_reduce::putter) {
     let f = io::file_reader(filename);
 
 
@@ -38,7 +38,7 @@ fn map(filename: &istr, emit: map_reduce::putter) {
     }
 }
 
-fn reduce(word: &istr, get: map_reduce::getter) {
+fn reduce(word: &str, get: map_reduce::getter) {
     let count = 0;
 
 
@@ -52,36 +52,36 @@ mod map_reduce {
     export reducer;
     export map_reduce;
 
-    type putter = fn(&istr, int);
+    type putter = fn(&str, int);
 
-    type mapper = fn(&istr, putter);
+    type mapper = fn(&str, putter);
 
     type getter = fn() -> option<int>;
 
-    type reducer = fn(&istr, getter);
+    type reducer = fn(&str, getter);
 
     tag ctrl_proto {
-        find_reducer(istr, chan<chan<reduce_proto>>);
+        find_reducer(str, chan<chan<reduce_proto>>);
         mapper_done;
     }
 
     tag reduce_proto { emit_val(int); done; ref; release; }
 
-    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[istr])
-        -> [joinable_task] {
+    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[str]) ->
+       [joinable_task] {
         let tasks = [];
-        for i: istr in inputs {
+        for i: str in inputs {
             tasks += [task::spawn_joinable(bind map_task(ctrl, i))];
         }
         ret tasks;
     }
 
-    fn map_task(ctrl: chan<ctrl_proto>, input: &istr) {
+    fn map_task(ctrl: chan<ctrl_proto>, input: &str) {
         // log_err "map_task " + input;
         let intermediates = map::new_str_hash();
 
-        fn emit(im: &map::hashmap<istr, chan<reduce_proto>>,
-                ctrl: chan<ctrl_proto>, key: &istr, val: int) {
+        fn emit(im: &map::hashmap<str, chan<reduce_proto>>,
+                ctrl: chan<ctrl_proto>, key: &str, val: int) {
             let c;
             alt im.find(key) {
               some(_c) {
@@ -101,7 +101,7 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        for each kv: @{key: istr, val: chan<reduce_proto>} in
+        for each kv: @{key: str, val: chan<reduce_proto>} in
                  intermediates.items() {
             send(kv.val, release);
         }
@@ -109,7 +109,7 @@ mod map_reduce {
         send(ctrl, mapper_done);
     }
 
-    fn reduce_task(key: &istr, out: chan<chan<reduce_proto>>) {
+    fn reduce_task(key: &str, out: chan<chan<reduce_proto>>) {
         let p = port();
 
         send(out, chan(p));
@@ -139,13 +139,13 @@ mod map_reduce {
         reduce(key, bind get(p, ref_count, is_done));
     }
 
-    fn map_reduce(inputs: &[istr]) {
+    fn map_reduce(inputs: &[str]) {
         let ctrl = port::<ctrl_proto>();
 
         // This task becomes the master control task. It task::_spawns
         // to do the rest.
 
-        let reducers: map::hashmap<istr, chan<reduce_proto>>;
+        let reducers: map::hashmap<str, chan<reduce_proto>>;
 
         reducers = map::new_str_hash();
 
@@ -171,8 +171,7 @@ mod map_reduce {
                     // log_err "creating new reducer for " + k;
                     let p = port();
                     tasks +=
-                        [task::spawn_joinable(
-                            bind reduce_task(k, chan(p)))];
+                        [task::spawn_joinable(bind reduce_task(k, chan(p)))];
                     c = recv(p);
                     reducers.insert(k, c);
                   }
@@ -182,7 +181,7 @@ mod map_reduce {
             }
         }
 
-        for each kv: @{key: istr, val: chan<reduce_proto>} in reducers.items()
+        for each kv: @{key: str, val: chan<reduce_proto>} in reducers.items()
                  {
             send(kv.val, done);
         }
@@ -191,12 +190,11 @@ mod map_reduce {
     }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(
-            #fmt["Usage: %s <filename> ...", argv[0]]);
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
@@ -216,11 +214,11 @@ fn main(argv: [istr]) {
     let elapsed = stop - start;
     elapsed /= 1000000u64;
 
-    log_err ~"MapReduce completed in " + u64::str(elapsed) + ~"ms";
+    log_err "MapReduce completed in " + u64::str(elapsed) + "ms";
 }
 
-fn read_word(r: io::reader) -> option<istr> {
-    let w = ~"";
+fn read_word(r: io::reader) -> option<str> {
+    let w = "";
 
     while !r.eof() {
         let c = r.read_char();
@@ -228,7 +226,7 @@ fn read_word(r: io::reader) -> option<istr> {
 
         if is_word_char(c) {
             w += str::from_char(c);
-        } else { if w != ~"" { ret some(w); } }
+        } else { if w != "" { ret some(w); } }
     }
     ret none;
 }
diff --git a/src/test/compile-fail/bad-expr-path.rs b/src/test/compile-fail/bad-expr-path.rs
index e3cb4873ebc..7c97308c538 100644
--- a/src/test/compile-fail/bad-expr-path.rs
+++ b/src/test/compile-fail/bad-expr-path.rs
@@ -2,4 +2,4 @@
 
 mod m1 { }
 
-fn main(args: [istr]) { log m1::a; }
+fn main(args: [str]) { log m1::a; }
diff --git a/src/test/compile-fail/bad-expr-path2.rs b/src/test/compile-fail/bad-expr-path2.rs
index b779b459bf1..e6596f17b6e 100644
--- a/src/test/compile-fail/bad-expr-path2.rs
+++ b/src/test/compile-fail/bad-expr-path2.rs
@@ -4,4 +4,4 @@ mod m1 {
     mod a { }
 }
 
-fn main(args: [istr]) { log m1::a; }
+fn main(args: [str]) { log m1::a; }
diff --git a/src/test/compile-fail/block-require-return.rs b/src/test/compile-fail/block-require-return.rs
index 6a64bd44daa..f2796296da4 100644
--- a/src/test/compile-fail/block-require-return.rs
+++ b/src/test/compile-fail/block-require-return.rs
@@ -1,5 +1,3 @@
 // error-pattern: not all control paths return
 fn force(f: &block() -> int) -> int { f() }
-fn main() {
-    log_err force({| | });
-}
+fn main() { log_err force({ | | }); }
diff --git a/src/test/compile-fail/extenv-too-many-args.rs b/src/test/compile-fail/extenv-too-many-args.rs
index f6fb13cbc33..945546fd6cb 100644
--- a/src/test/compile-fail/extenv-too-many-args.rs
+++ b/src/test/compile-fail/extenv-too-many-args.rs
@@ -1,3 +1,3 @@
 // error-pattern:malformed #env call
 
-fn main() { #env[~"one", ~"two"]; }
+fn main() { #env["one", "two"]; }
diff --git a/src/test/compile-fail/fn-constraint.rs b/src/test/compile-fail/fn-constraint.rs
index dec1df5d458..bd6cd7b8ff1 100644
--- a/src/test/compile-fail/fn-constraint.rs
+++ b/src/test/compile-fail/fn-constraint.rs
@@ -5,5 +5,5 @@ import std::str::*;
 fn main() {
     let a: uint = 4u;
     let b: uint = 1u;
-    log_err safe_slice(~"kitties", a, b);
+    log_err safe_slice("kitties", a, b);
 }
diff --git a/src/test/compile-fail/import.rs b/src/test/compile-fail/import.rs
index 68147568cd9..f4375eaade3 100644
--- a/src/test/compile-fail/import.rs
+++ b/src/test/compile-fail/import.rs
@@ -4,4 +4,4 @@ import zed::baz;
 mod zed {
     fn bar() { log "bar"; }
 }
-fn main(args: [istr]) { bar(); }
+fn main(args: [str]) { bar(); }
diff --git a/src/test/compile-fail/import2.rs b/src/test/compile-fail/import2.rs
index 4d1043af563..89532f61fb1 100644
--- a/src/test/compile-fail/import2.rs
+++ b/src/test/compile-fail/import2.rs
@@ -4,4 +4,4 @@ mod baz { }
 mod zed {
     fn bar() { log "bar3"; }
 }
-fn main(args: [istr]) { bar(); }
+fn main(args: [str]) { bar(); }
diff --git a/src/test/compile-fail/import3.rs b/src/test/compile-fail/import3.rs
index 13b193162a3..680804c97b0 100644
--- a/src/test/compile-fail/import3.rs
+++ b/src/test/compile-fail/import3.rs
@@ -1,4 +1,4 @@
 // error-pattern: unresolved modulename
 import main::bar;
 
-fn main(args: [istr]) { log "foo"; }
+fn main(args: [str]) { log "foo"; }
diff --git a/src/test/compile-fail/import4.rs b/src/test/compile-fail/import4.rs
index 80a540e165f..6daed215ddb 100644
--- a/src/test/compile-fail/import4.rs
+++ b/src/test/compile-fail/import4.rs
@@ -3,4 +3,4 @@
 import zed::bar;
 import bar::zed;
 
-fn main(args: [istr]) { log "loop"; }
+fn main(args: [str]) { log "loop"; }
diff --git a/src/test/compile-fail/no-constraint-prop.rs b/src/test/compile-fail/no-constraint-prop.rs
index c01b20042fa..65e21baf78b 100644
--- a/src/test/compile-fail/no-constraint-prop.rs
+++ b/src/test/compile-fail/no-constraint-prop.rs
@@ -16,5 +16,5 @@ fn main() {
     // the next statement, since it's not true in the
     // prestate.
     let d <- a;
-    log safe_slice(~"kitties", b, d);
+    log safe_slice("kitties", b, d);
 }
diff --git a/src/test/compile-fail/nonsense-constraints.rs b/src/test/compile-fail/nonsense-constraints.rs
index 9ed12810ab5..47809cdcaf2 100644
--- a/src/test/compile-fail/nonsense-constraints.rs
+++ b/src/test/compile-fail/nonsense-constraints.rs
@@ -3,16 +3,11 @@
 use std;
 import std::uint;
 
-fn enum_chars(start:u8, end:u8) : uint::le(start, end) -> [char] {
+fn enum_chars(start: u8, end: u8) : uint::le(start, end) -> [char] {
     let i = start;
     let r = [];
-    while (i <= end) {
-        r += [i as char];
-        i += (1u as u8);
-    }
+    while i <= end { r += [i as char]; i += 1u as u8; }
     ret r;
 }
 
-fn main() {
-    log (enum_chars('a' as u8, 'z' as u8));
-}
\ No newline at end of file
+fn main() { log enum_chars('a' as u8, 'z' as u8); }
diff --git a/src/test/compile-fail/not-a-pred-2.rs b/src/test/compile-fail/not-a-pred-2.rs
index 852db46e9df..2226c5cbf32 100644
--- a/src/test/compile-fail/not-a-pred-2.rs
+++ b/src/test/compile-fail/not-a-pred-2.rs
@@ -8,4 +8,5 @@ fn main() {
                    // is not a manifest call
 
 
+
 }
diff --git a/src/test/compile-fail/zip-missing-check.rs b/src/test/compile-fail/zip-missing-check.rs
index 554a670fab4..51028a03623 100644
--- a/src/test/compile-fail/zip-missing-check.rs
+++ b/src/test/compile-fail/zip-missing-check.rs
@@ -7,11 +7,11 @@ import std::vec::*;
 fn main() {
     let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 10u;
     // Silly, but necessary
-    check u8::le(a, j);
-    check uint::le(k, l);
+    check (u8::le(a, j));
+    check (uint::le(k, l));
     let chars = enum_chars(a, j);
-    let ints  = enum_uints(k, l);
+    let ints = enum_uints(k, l);
 
     let ps = zip(chars, ints);
     fail "the impossible happened";
-}
\ No newline at end of file
+}
diff --git a/src/test/compiletest/common.rs b/src/test/compiletest/common.rs
index c43db38247d..ab0415fd7c1 100644
--- a/src/test/compiletest/common.rs
+++ b/src/test/compiletest/common.rs
@@ -16,17 +16,17 @@ type config =
     // for running under valgrind
     // Flags to pass to the compiler
     // Explain what's going on
-    {compile_lib_path: istr,
-     run_lib_path: istr,
-     rustc_path: istr,
-     src_base: istr,
-     build_base: istr,
-     stage_id: istr,
+    {compile_lib_path: str,
+     run_lib_path: str,
+     rustc_path: str,
+     src_base: str,
+     build_base: str,
+     stage_id: str,
      mode: mode,
      run_ignored: bool,
-     filter: option::t<istr>,
-     runtool: option::t<istr>,
-     rustcflags: option::t<istr>,
+     filter: option::t<str>,
+     runtool: option::t<str>,
+     rustcflags: option::t<str>,
      verbose: bool};
 
 type cx = {config: config, procsrv: procsrv::handle};
diff --git a/src/test/compiletest/compiletest.rs b/src/test/compiletest/compiletest.rs
index 5f3fd1944dd..c931369cfc7 100644
--- a/src/test/compiletest/compiletest.rs
+++ b/src/test/compiletest/compiletest.rs
@@ -21,58 +21,50 @@ import common::mode_pretty;
 import common::mode;
 import util::logv;
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let config = parse_config(args);
     log_config(config);
     run_tests(config);
 }
 
-fn parse_config(args: &[istr]) -> config {
+fn parse_config(args: &[str]) -> config {
     let opts =
-        [getopts::reqopt(~"compile-lib-path"),
-         getopts::reqopt(~"run-lib-path"),
-         getopts::reqopt(~"rustc-path"),
-         getopts::reqopt(~"src-base"),
-         getopts::reqopt(~"build-base"),
-         getopts::reqopt(~"stage-id"),
-         getopts::reqopt(~"mode"),
-         getopts::optflag(~"ignored"),
-         getopts::optopt(~"runtool"),
-         getopts::optopt(~"rustcflags"),
-         getopts::optflag(~"verbose")];
+        [getopts::reqopt("compile-lib-path"), getopts::reqopt("run-lib-path"),
+         getopts::reqopt("rustc-path"), getopts::reqopt("src-base"),
+         getopts::reqopt("build-base"), getopts::reqopt("stage-id"),
+         getopts::reqopt("mode"), getopts::optflag("ignored"),
+         getopts::optopt("runtool"), getopts::optopt("rustcflags"),
+         getopts::optflag("verbose")];
 
     check (vec::is_not_empty(args));
     let args_ = vec::tail(args);
     let match =
         alt getopts::getopts(args_, opts) {
           getopts::success(m) { m }
-          getopts::failure(f) {
-            fail getopts::fail_str(f)
-          }
+          getopts::failure(f) { fail getopts::fail_str(f) }
         };
 
-    ret {compile_lib_path: getopts::opt_str(match, ~"compile-lib-path"),
-         run_lib_path: getopts::opt_str(match, ~"run-lib-path"),
-         rustc_path: getopts::opt_str(match, ~"rustc-path"),
-         src_base: getopts::opt_str(match, ~"src-base"),
-         build_base: getopts::opt_str(match, ~"build-base"),
-         stage_id: getopts::opt_str(match, ~"stage-id"),
-         mode: str_mode(getopts::opt_str(match, ~"mode")),
-         run_ignored: getopts::opt_present(match, ~"ignored"),
+    ret {compile_lib_path: getopts::opt_str(match, "compile-lib-path"),
+         run_lib_path: getopts::opt_str(match, "run-lib-path"),
+         rustc_path: getopts::opt_str(match, "rustc-path"),
+         src_base: getopts::opt_str(match, "src-base"),
+         build_base: getopts::opt_str(match, "build-base"),
+         stage_id: getopts::opt_str(match, "stage-id"),
+         mode: str_mode(getopts::opt_str(match, "mode")),
+         run_ignored: getopts::opt_present(match, "ignored"),
          filter:
              if vec::len(match.free) > 0u {
                  option::some(match.free[0])
              } else { option::none },
-         runtool: getopts::opt_maybe_str(match, ~"runtool"),
-         rustcflags: getopts::opt_maybe_str(match, ~"rustcflags"),
-         verbose: getopts::opt_present(match, ~"verbose")};
+         runtool: getopts::opt_maybe_str(match, "runtool"),
+         rustcflags: getopts::opt_maybe_str(match, "rustcflags"),
+         verbose: getopts::opt_present(match, "verbose")};
 }
 
 fn log_config(config: &config) {
     let c = config;
     logv(c, #fmt["configuration:"]);
-    logv(c, #fmt["compile_lib_path: %s",
-                 config.compile_lib_path]);
+    logv(c, #fmt["compile_lib_path: %s", config.compile_lib_path]);
     logv(c, #fmt["run_lib_path: %s", config.run_lib_path]);
     logv(c, #fmt["rustc_path: %s", config.rustc_path]);
     logv(c, #fmt["src_base: %s", config.src_base]);
@@ -87,33 +79,30 @@ fn log_config(config: &config) {
     logv(c, #fmt["\n"]);
 }
 
-fn opt_str(maybestr: option::t<istr>) -> istr {
-    alt maybestr {
-      option::some(s) { s }
-      option::none. { ~"(none)" }
-    }
+fn opt_str(maybestr: option::t<str>) -> str {
+    alt maybestr { option::some(s) { s } option::none. { "(none)" } }
 }
 
-fn str_opt(maybestr: &istr) -> option::t<istr> {
-    if maybestr != ~"(none)" { option::some(maybestr) } else { option::none }
+fn str_opt(maybestr: &str) -> option::t<str> {
+    if maybestr != "(none)" { option::some(maybestr) } else { option::none }
 }
 
-fn str_mode(s: &istr) -> mode {
+fn str_mode(s: &str) -> mode {
     alt s {
-      ~"compile-fail" { mode_compile_fail }
-      ~"run-fail" { mode_run_fail }
-      ~"run-pass" { mode_run_pass }
-      ~"pretty" { mode_pretty }
+      "compile-fail" { mode_compile_fail }
+      "run-fail" { mode_run_fail }
+      "run-pass" { mode_run_pass }
+      "pretty" { mode_pretty }
       _ { fail "invalid mode" }
     }
 }
 
-fn mode_str(mode: mode) -> istr {
+fn mode_str(mode: mode) -> str {
     alt mode {
-      mode_compile_fail. { ~"compile-fail" }
-      mode_run_fail. { ~"run-fail" }
-      mode_run_pass. { ~"run-pass" }
-      mode_pretty. { ~"pretty" }
+      mode_compile_fail. { "compile-fail" }
+      mode_run_fail. { "run-fail" }
+      mode_run_pass. { "run-pass" }
+      mode_pretty. { "pretty" }
     }
 }
 
@@ -126,13 +115,12 @@ fn run_tests(config: &config) {
 }
 
 fn test_opts(config: &config) -> test::test_opts {
-    {
-        filter: alt config.filter {
-          option::some(s) { option::some(s) }
-          option::none. { option::none }
-        },
-        run_ignored: config.run_ignored
-    }
+    {filter:
+         alt config.filter {
+           option::some(s) { option::some(s) }
+           option::none. { option::none }
+         },
+     run_ignored: config.run_ignored}
 }
 
 type tests_and_conv_fn =
@@ -142,7 +130,7 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn {
     log #fmt["making tests from %s", cx.config.src_base];
     let configport = port::<[u8]>();
     let tests = [];
-    for file: istr in fs::list_dir(cx.config.src_base) {
+    for file: str in fs::list_dir(cx.config.src_base) {
         let file = file;
         log #fmt["inspecting file %s", file];
         if is_test(cx.config, file) {
@@ -152,13 +140,11 @@ fn make_tests(cx: &cx) -> tests_and_conv_fn {
     ret {tests: tests, to_task: bind closure_to_task(cx, configport, _)};
 }
 
-fn is_test(config: &config, testfile: &istr) -> bool {
+fn is_test(config: &config, testfile: &str) -> bool {
     // Pretty-printer does not work with .rc files yet
-    let valid_extensions = alt config.mode {
-      mode_pretty. { [~".rs"] }
-      _ { [~".rc", ~".rs"] }
-    };
-    let invalid_prefixes = [~".", ~"#", ~"~"];
+    let valid_extensions =
+        alt config.mode { mode_pretty. { [".rs"] } _ { [".rc", ".rs"] } };
+    let invalid_prefixes = [".", "#", "~"];
     let name = fs::basename(testfile);
 
     let valid = false;
@@ -174,14 +160,14 @@ fn is_test(config: &config, testfile: &istr) -> bool {
     ret valid;
 }
 
-fn make_test(cx: &cx, testfile: &istr, configport: &port<[u8]>) ->
+fn make_test(cx: &cx, testfile: &str, configport: &port<[u8]>) ->
    test::test_desc {
     {name: make_test_name(cx.config, testfile),
      fn: make_test_closure(testfile, chan(configport)),
      ignore: header::is_test_ignored(cx.config, testfile)}
 }
 
-fn make_test_name(config: &config, testfile: &istr) -> istr {
+fn make_test_name(config: &config, testfile: &str) -> str {
     #fmt["[%s] %s", mode_str(config.mode), testfile]
 }
 
@@ -204,12 +190,12 @@ up. Then we'll spawn that data into another task and return the task.
 Really convoluted. Need to think up of a better definition for tests.
 */
 
-fn make_test_closure(testfile: &istr, configchan: chan<[u8]>) ->
+fn make_test_closure(testfile: &str, configchan: chan<[u8]>) ->
    test::test_fn {
     bind send_config(testfile, configchan)
 }
 
-fn send_config(testfile: istr, configchan: chan<[u8]>) {
+fn send_config(testfile: str, configchan: chan<[u8]>) {
     send(configchan, str::bytes(testfile));
 }
 
@@ -243,26 +229,17 @@ fn closure_to_task(cx: cx, configport: port<[u8]>, testfn: &fn()) ->
     let chan = cx.procsrv.chan;
 
     let testthunk =
-        bind run_test_task(compile_lib_path, run_lib_path,
-                           rustc_path, src_base,
-                           build_base, stage_id,
-                           mode,
-                           run_ignored,
-                           filter,
-                           runtool,
-                           rustcflags,
-                           verbose,
-                           chan,
+        bind run_test_task(compile_lib_path, run_lib_path, rustc_path,
+                           src_base, build_base, stage_id, mode, run_ignored,
+                           filter, runtool, rustcflags, verbose, chan,
                            testfile);
     ret task::spawn_joinable(testthunk);
 }
 
-fn run_test_task(compile_lib_path: -istr, run_lib_path: -istr,
-                 rustc_path: -istr,
-                 src_base: -istr, build_base: -istr, stage_id: -istr,
-                 mode: -istr,
-                 run_ignored: -bool, opt_filter: -istr, opt_runtool: -istr,
-                 opt_rustcflags: -istr, verbose: -bool,
+fn run_test_task(compile_lib_path: -str, run_lib_path: -str, rustc_path: -str,
+                 src_base: -str, build_base: -str, stage_id: -str, mode: -str,
+                 run_ignored: -bool, opt_filter: -str, opt_runtool: -str,
+                 opt_rustcflags: -str, verbose: -bool,
                  procsrv_chan: -procsrv::reqchan, testfile: -[u8]) {
 
     test::configure_test_task();
diff --git a/src/test/compiletest/header.rs b/src/test/compiletest/header.rs
index d891e87f5dd..8a03378742b 100644
--- a/src/test/compiletest/header.rs
+++ b/src/test/compiletest/header.rs
@@ -11,24 +11,24 @@ export is_test_ignored;
 
 type test_props = {
     // Lines that should be expected, in order, on standard out
-    error_patterns: [istr],
+    error_patterns: [str],
     // Extra flags to pass to the compiler
-    compile_flags: option::t<istr>,
+    compile_flags: option::t<str>,
     // If present, the name of a file that this test should match when
     // pretty-printed
-    pp_exact: option::t<istr>,
+    pp_exact: option::t<str>,
     // FIXME: no-valgrind is a temporary directive until all of run-fail
     // is valgrind-clean
     no_valgrind: bool
 };
 
 // Load any test directives embedded in the file
-fn load_props(testfile: &istr) -> test_props {
+fn load_props(testfile: &str) -> test_props {
     let error_patterns = [];
     let compile_flags = option::none;
     let pp_exact = option::none;
     let no_valgrind = false;
-    for each ln: istr in iter_header(testfile) {
+    for each ln: str in iter_header(testfile) {
         alt parse_error_pattern(ln) {
           option::some(ep) { error_patterns += [ep]; }
           option::none. { }
@@ -43,7 +43,7 @@ fn load_props(testfile: &istr) -> test_props {
         }
 
         if no_valgrind == false {
-            no_valgrind = parse_name_directive(ln, ~"no-valgrind");
+            no_valgrind = parse_name_directive(ln, "no-valgrind");
         }
     }
     ret {
@@ -54,19 +54,19 @@ fn load_props(testfile: &istr) -> test_props {
     };
 }
 
-fn is_test_ignored(config: &config, testfile: &istr) -> bool {
+fn is_test_ignored(config: &config, testfile: &str) -> bool {
     let found = false;
-    for each ln: istr in iter_header(testfile) {
+    for each ln: str in iter_header(testfile) {
         // FIXME: Can't return or break from iterator
-        found = found || parse_name_directive(ln, ~"xfail-test");
+        found = found || parse_name_directive(ln, "xfail-test");
         if (config.mode == common::mode_pretty) {
-            found = found || parse_name_directive(ln, ~"xfail-pretty");
+            found = found || parse_name_directive(ln, "xfail-pretty");
         }
     }
     ret found;
 }
 
-iter iter_header(testfile: &istr) -> istr {
+iter iter_header(testfile: &str) -> str {
     let rdr = io::file_reader(testfile);
     while !rdr.eof() {
         let ln = rdr.read_line();
@@ -74,26 +74,26 @@ iter iter_header(testfile: &istr) -> istr {
         // Assume that any directives will be found before the first
         // module or function. This doesn't seem to be an optimization
         // with a warm page cache. Maybe with a cold one.
-        if str::starts_with(ln, ~"fn")
-            || str::starts_with(ln, ~"mod") {
+        if str::starts_with(ln, "fn")
+            || str::starts_with(ln, "mod") {
             break;
         } else { put ln; }
     }
 }
 
-fn parse_error_pattern(line: &istr) -> option::t<istr> {
-    parse_name_value_directive(line, ~"error-pattern")
+fn parse_error_pattern(line: &str) -> option::t<str> {
+    parse_name_value_directive(line, "error-pattern")
 }
 
-fn parse_compile_flags(line: &istr) -> option::t<istr> {
-    parse_name_value_directive(line, ~"compile-flags")
+fn parse_compile_flags(line: &str) -> option::t<str> {
+    parse_name_value_directive(line, "compile-flags")
 }
 
-fn parse_pp_exact(line: &istr, testfile: &istr) -> option::t<istr> {
-    alt parse_name_value_directive(line, ~"pp-exact") {
+fn parse_pp_exact(line: &str, testfile: &str) -> option::t<str> {
+    alt parse_name_value_directive(line, "pp-exact") {
       option::some(s) { option::some(s) }
       option::none. {
-        if parse_name_directive(line, ~"pp-exact") {
+        if parse_name_directive(line, "pp-exact") {
             option::some(fs::basename(testfile))
         } else {
             option::none
@@ -102,13 +102,13 @@ fn parse_pp_exact(line: &istr, testfile: &istr) -> option::t<istr> {
     }
 }
 
-fn parse_name_directive(line: &istr, directive: &istr) -> bool {
+fn parse_name_directive(line: &str, directive: &str) -> bool {
     str::find(line, directive) >= 0
 }
 
-fn parse_name_value_directive(line: &istr,
-                              directive: &istr) -> option::t<istr> {
-    let keycolon = directive + ~":";
+fn parse_name_value_directive(line: &str,
+                              directive: &str) -> option::t<str> {
+    let keycolon = directive + ":";
     if str::find(line, keycolon) >= 0 {
         let colon = str::find(line, keycolon) as uint;
         let value =
diff --git a/src/test/compiletest/procsrv.rs b/src/test/compiletest/procsrv.rs
index eb6d4676711..63a3807f6a5 100644
--- a/src/test/compiletest/procsrv.rs
+++ b/src/test/compiletest/procsrv.rs
@@ -27,8 +27,9 @@ export reqchan;
 
 type reqchan = chan<request>;
 
-type handle = {task: option::t<(task::task, port<task::task_notification>)>,
-    chan: reqchan};
+type handle =
+    {task: option::t<(task::task, port<task::task_notification>)>,
+     chan: reqchan};
 
 tag request { exec([u8], [u8], [[u8]], chan<response>); stop; }
 
@@ -38,11 +39,11 @@ fn mk() -> handle {
     let setupport = port();
     let task =
         task::spawn_joinable(bind fn (setupchan: chan<chan<request>>) {
-            let reqport = port();
-            let reqchan = chan(reqport);
-            send(setupchan, reqchan);
-            worker(reqport);
-        }(chan(setupport)));
+                                      let reqport = port();
+                                      let reqchan = chan(reqport);
+                                      send(setupchan, reqchan);
+                                      worker(reqport);
+                                  }(chan(setupport)));
     ret {task: option::some(task), chan: recv(setupport)};
 }
 
@@ -53,8 +54,8 @@ fn close(handle: &handle) {
     task::join(option::get(handle.task));
 }
 
-fn run(handle: &handle, lib_path: &istr, prog: &istr, args: &[istr],
-       input: &option::t<istr>) -> {status: int, out: istr, err: istr} {
+fn run(handle: &handle, lib_path: &str, prog: &str, args: &[str],
+       input: &option::t<str>) -> {status: int, out: str, err: str} {
     let p = port();
     let ch = chan(p);
     send(handle.chan,
@@ -69,7 +70,7 @@ fn run(handle: &handle, lib_path: &istr, prog: &istr, args: &[istr],
     ret {status: status, out: output, err: errput};
 }
 
-fn writeclose(fd: int, s: &option::t<istr>) {
+fn writeclose(fd: int, s: &option::t<str>) {
     if option::is_some(s) {
         let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(option::get(s));
@@ -78,11 +79,11 @@ fn writeclose(fd: int, s: &option::t<istr>) {
     os::libc::close(fd);
 }
 
-fn readclose(fd: int) -> istr {
+fn readclose(fd: int) -> str {
     // Copied from run::program_output
     let file = os::fd_FILE(fd);
     let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
-    let buf = ~"";
+    let buf = "";
     while !reader.eof() {
         let bytes = reader.read_bytes(4096u);
         buf += str::unsafe_from_bytes(bytes);
@@ -128,8 +129,7 @@ fn worker(p: port<request>) {
         let pipe_out = os::pipe();
         let pipe_err = os::pipe();
         let spawnproc =
-            bind run::spawn_process(execparms.prog,
-                                    execparms.args,
+            bind run::spawn_process(execparms.prog, execparms.args,
                                     pipe_in.in, pipe_out.out, pipe_err.out);
         let pid = with_lib_path(execparms.lib_path, spawnproc);
 
@@ -151,7 +151,7 @@ fn worker(p: port<request>) {
     }
 }
 
-fn with_lib_path<@T>(path: &istr, f: fn() -> T) -> T {
+fn with_lib_path<@T>(path: &str, f: fn() -> T) -> T {
     let maybe_oldpath = getenv(util::lib_path_env_var());
     append_lib_path(path);
     let res = f();
@@ -159,26 +159,22 @@ fn with_lib_path<@T>(path: &istr, f: fn() -> T) -> T {
         export_lib_path(option::get(maybe_oldpath));
     } else {
         // FIXME: This should really be unset but we don't have that yet
-        export_lib_path(~"");
+        export_lib_path("");
     }
     ret res;
 }
 
-fn append_lib_path(path: &istr) {
-    export_lib_path(util::make_new_path(path));
-}
+fn append_lib_path(path: &str) { export_lib_path(util::make_new_path(path)); }
 
-fn export_lib_path(path: &istr) {
-    setenv(util::lib_path_env_var(), path);
-}
+fn export_lib_path(path: &str) { setenv(util::lib_path_env_var(), path); }
 
-fn clone_vecstr(v: &[istr]) -> [[u8]] {
+fn clone_vecstr(v: &[str]) -> [[u8]] {
     let r = [];
-    for t: istr in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; }
+    for t: str in vec::slice(v, 0u, vec::len(v)) { r += [str::bytes(t)]; }
     ret r;
 }
 
-fn clone_vecu8str(v: &[[u8]]) -> [istr] {
+fn clone_vecu8str(v: &[[u8]]) -> [str] {
     let r = [];
     for t in vec::slice(v, 0u, vec::len(v)) {
         r += [str::unsafe_from_bytes(t)];
diff --git a/src/test/compiletest/runtest.rs b/src/test/compiletest/runtest.rs
index 9128160855b..87ae7750e03 100644
--- a/src/test/compiletest/runtest.rs
+++ b/src/test/compiletest/runtest.rs
@@ -22,7 +22,7 @@ fn run(cx: &cx, _testfile: -[u8]) {
     let testfile = str::unsafe_from_bytes(_testfile);
     if cx.config.verbose {
         // We're going to be dumping a lot of info. Start on a new line.
-        io::stdout().write_str(~"\n\n");
+        io::stdout().write_str("\n\n");
     }
     log #fmt["running %s", testfile];
     let props = load_props(testfile);
@@ -34,25 +34,25 @@ fn run(cx: &cx, _testfile: -[u8]) {
     }
 }
 
-fn run_cfail_test(cx: &cx, props: &test_props, testfile: &istr) {
+fn run_cfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres(~"compile-fail test compiled successfully!", procres);
+        fatal_procres("compile-fail test compiled successfully!", procres);
     }
 
     check_error_patterns(props, testfile, procres);
 }
 
-fn run_rfail_test(cx: &cx, props: &test_props, testfile: &istr) {
+fn run_rfail_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 { fatal_procres(~"compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
     if procres.status == 0 {
-        fatal_procres(~"run-fail test didn't produce an error!", procres);
+        fatal_procres("run-fail test didn't produce an error!", procres);
     }
 
     // This is the value valgrind returns on failure
@@ -61,27 +61,27 @@ fn run_rfail_test(cx: &cx, props: &test_props, testfile: &istr) {
     // exit code on the command-line (137)?
     const valgrind_err: int = 9;
     if procres.status == valgrind_err {
-        fatal_procres(~"run-fail test isn't valgrind-clean!", procres);
+        fatal_procres("run-fail test isn't valgrind-clean!", procres);
     }
 
     check_error_patterns(props, testfile, procres);
 }
 
-fn run_rpass_test(cx: &cx, props: &test_props, testfile: &istr) {
+fn run_rpass_test(cx: &cx, props: &test_props, testfile: &str) {
     let procres = compile_test(cx, props, testfile);
 
-    if procres.status != 0 { fatal_procres(~"compilation failed!", procres); }
+    if procres.status != 0 { fatal_procres("compilation failed!", procres); }
 
     procres = exec_compiled_test(cx, props, testfile);
 
 
-    if procres.status != 0 { fatal_procres(~"test run failed!", procres); }
+    if procres.status != 0 { fatal_procres("test run failed!", procres); }
 }
 
-fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) {
+fn run_pretty_test(cx: &cx, props: &test_props, testfile: &str) {
     if option::is_some(props.pp_exact) {
-        logv(cx.config, ~"testing for exact pretty-printing");
-    } else { logv(cx.config, ~"testing for converging pretty-printing"); }
+        logv(cx.config, "testing for exact pretty-printing");
+    } else { logv(cx.config, "testing for converging pretty-printing"); }
 
     let rounds =
         alt props.pp_exact { option::some(_) { 1 } option::none. { 2 } };
@@ -94,9 +94,8 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) {
         let procres = print_source(cx, testfile, srcs[round]);
 
         if procres.status != 0 {
-            fatal_procres(
-                    #fmt["pretty-printing failed in round %d", round],
-                    procres);
+            fatal_procres(#fmt["pretty-printing failed in round %d", round],
+                          procres);
         }
 
         srcs += [procres.stdout];
@@ -115,10 +114,10 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) {
 
     if option::is_some(props.pp_exact) {
         // Now we have to care about line endings
-        let cr = ~"\r";
+        let cr = "\r";
         check (str::is_not_empty(cr));
-        actual = str::replace(actual, cr, ~"");
-        expected = str::replace(expected, cr, ~"");
+        actual = str::replace(actual, cr, "");
+        expected = str::replace(expected, cr, "");
     }
 
     compare_source(expected, actual);
@@ -127,25 +126,25 @@ fn run_pretty_test(cx: &cx, props: &test_props, testfile: &istr) {
     let procres = typecheck_source(cx, testfile, actual);
 
     if procres.status != 0 {
-        fatal_procres(~"pretty-printed source does not typecheck", procres);
+        fatal_procres("pretty-printed source does not typecheck", procres);
     }
 
     ret;
 
-    fn print_source(cx: &cx, testfile: &istr, src: &istr) -> procres {
+    fn print_source(cx: &cx, testfile: &str, src: &str) -> procres {
         compose_and_run(cx, testfile, make_pp_args,
                         cx.config.compile_lib_path, option::some(src))
     }
 
-    fn make_pp_args(config: &config, _testfile: &istr) -> procargs {
+    fn make_pp_args(config: &config, _testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = [~"-", ~"--pretty", ~"normal"];
+        let args = ["-", "--pretty", "normal"];
         ret {prog: prog, args: args};
     }
 
-    fn compare_source(expected: &istr, actual: &istr) {
+    fn compare_source(expected: &str, actual: &str) {
         if expected != actual {
-            error(~"pretty-printed source does match expected source");
+            error("pretty-printed source does match expected source");
             let msg =
                 #fmt["\n\
 expected:\n\
@@ -157,41 +156,39 @@ actual:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-                     expected,
-                      actual];
+                     expected, actual];
             io::stdout().write_str(msg);
             fail;
         }
     }
 
-    fn typecheck_source(cx: &cx, testfile: &istr, src: &istr) -> procres {
+    fn typecheck_source(cx: &cx, testfile: &str, src: &str) -> procres {
         compose_and_run(cx, testfile, make_typecheck_args,
                         cx.config.compile_lib_path, option::some(src))
     }
 
-    fn make_typecheck_args(config: &config, _testfile: &istr) -> procargs {
+    fn make_typecheck_args(config: &config, _testfile: &str) -> procargs {
         let prog = config.rustc_path;
-        let args = [~"-", ~"--no-trans", ~"--lib"];
+        let args = ["-", "--no-trans", "--lib"];
         ret {prog: prog, args: args};
     }
 }
 
-fn check_error_patterns(props: &test_props, testfile: &istr,
+fn check_error_patterns(props: &test_props, testfile: &str,
                         procres: &procres) {
     if vec::is_empty(props.error_patterns) {
-        fatal(~"no error pattern specified in " + testfile);
+        fatal("no error pattern specified in " + testfile);
     }
 
     if procres.status == 0 {
-        fatal(~"process did not return an error status");
+        fatal("process did not return an error status");
     }
 
     let next_err_idx = 0u;
     let next_err_pat = props.error_patterns[next_err_idx];
-    for line: istr in str::split(procres.stdout, '\n' as u8) {
+    for line: str in str::split(procres.stdout, '\n' as u8) {
         if str::find(line, next_err_pat) > 0 {
-            log #fmt["found error pattern %s",
-                      next_err_pat];
+            log #fmt["found error pattern %s", next_err_pat];
             next_err_idx += 1u;
             if next_err_idx == vec::len(props.error_patterns) {
                 log "found all error patterns";
@@ -205,83 +202,83 @@ fn check_error_patterns(props: &test_props, testfile: &istr,
         vec::slice(props.error_patterns, next_err_idx,
                    vec::len(props.error_patterns));
     if vec::len(missing_patterns) == 1u {
-        fatal_procres(
-            #fmt["error pattern '%s' not found!",
-                  missing_patterns[0]], procres);
+        fatal_procres(#fmt["error pattern '%s' not found!",
+                           missing_patterns[0]], procres);
     } else {
-        for pattern: istr in missing_patterns {
-            error(#fmt["error pattern '%s' not found!",
-                        pattern]);
+        for pattern: str in missing_patterns {
+            error(#fmt["error pattern '%s' not found!", pattern]);
         }
-        fatal_procres(~"multiple error patterns not found", procres);
+        fatal_procres("multiple error patterns not found", procres);
     }
 }
 
-type procargs = {prog: istr, args: [istr]};
+type procargs = {prog: str, args: [str]};
 
-type procres = {status: int, stdout: istr, stderr: istr, cmdline: istr};
+type procres = {status: int, stdout: str, stderr: str, cmdline: str};
 
-fn compile_test(cx: &cx, props: &test_props, testfile: &istr) -> procres {
+fn compile_test(cx: &cx, props: &test_props, testfile: &str) -> procres {
     compose_and_run(cx, testfile, bind make_compile_args(_, props, _),
                     cx.config.compile_lib_path, option::none)
 }
 
-fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &istr) ->
+fn exec_compiled_test(cx: &cx, props: &test_props, testfile: &str) ->
    procres {
     compose_and_run(cx, testfile, bind make_run_args(_, props, _),
                     cx.config.run_lib_path, option::none)
 }
 
-fn compose_and_run(cx: &cx, testfile: &istr,
-                   make_args: fn(&config, &istr) -> procargs,
-                   lib_path: &istr,
-                   input: option::t<istr>) -> procres {
+fn compose_and_run(cx: &cx, testfile: &str,
+                   make_args: fn(&config, &str) -> procargs, lib_path: &str,
+                   input: option::t<str>) -> procres {
     let procargs = make_args(cx.config, testfile);
     ret program_output(cx, testfile, lib_path, procargs.prog, procargs.args,
                        input);
 }
 
-fn make_compile_args(config: &config, props: &test_props, testfile: &istr) ->
+fn make_compile_args(config: &config, props: &test_props, testfile: &str) ->
    procargs {
     let prog = config.rustc_path;
-    let args = [testfile, ~"-o", make_exe_name(config, testfile)];
-    let rustcflags = alt config.rustcflags {
-      option::some(s) { option::some(s) }
-      option::none. { option::none }
-    };
+    let args = [testfile, "-o", make_exe_name(config, testfile)];
+    let rustcflags =
+        alt config.rustcflags {
+          option::some(s) { option::some(s) }
+          option::none. { option::none }
+        };
     args += split_maybe_args(rustcflags);
     args += split_maybe_args(props.compile_flags);
     ret {prog: prog, args: args};
 }
 
-fn make_exe_name(config: &config, testfile: &istr) -> istr {
+fn make_exe_name(config: &config, testfile: &str) -> str {
     output_base_name(config, testfile) + os::exec_suffix()
 }
 
-fn make_run_args(config: &config, props: &test_props, testfile: &istr) ->
+fn make_run_args(config: &config, props: &test_props, testfile: &str) ->
    procargs {
-    let toolargs = if !props.no_valgrind {
-        // If we've got another tool to run under (valgrind),
-        // then split apart its command
-        let runtool = alt config.runtool {
-          option::some(s) { option::some(s) }
-          option::none. { option::none }
-        };
-        split_maybe_args(runtool)
-    } else { [] };
+    let toolargs =
+        if !props.no_valgrind {
+            // If we've got another tool to run under (valgrind),
+            // then split apart its command
+            let runtool =
+                alt config.runtool {
+                  option::some(s) { option::some(s) }
+                  option::none. { option::none }
+                };
+            split_maybe_args(runtool)
+        } else { [] };
 
     let args = toolargs + [make_exe_name(config, testfile)];
     ret {prog: args[0], args: vec::slice(args, 1u, vec::len(args))};
 }
 
-fn split_maybe_args(argstr: &option::t<istr>) -> [istr] {
-    fn rm_whitespace(v: &[istr]) -> [istr] {
-        fn flt(s: &istr) -> option::t<istr> {
+fn split_maybe_args(argstr: &option::t<str>) -> [str] {
+    fn rm_whitespace(v: &[str]) -> [str] {
+        fn flt(s: &str) -> option::t<str> {
             if !is_whitespace(s) { option::some(s) } else { option::none }
         }
 
         // FIXME: This should be in std
-        fn is_whitespace(s: &istr) -> bool {
+        fn is_whitespace(s: &str) -> bool {
             for c: u8 in s { if c != ' ' as u8 { ret false; } }
             ret true;
         }
@@ -294,13 +291,12 @@ fn split_maybe_args(argstr: &option::t<istr>) -> [istr] {
     }
 }
 
-fn program_output(cx: &cx, testfile: &istr, lib_path: &istr, prog: &istr,
-                  args: &[istr], input: option::t<istr>) -> procres {
+fn program_output(cx: &cx, testfile: &str, lib_path: &str, prog: &str,
+                  args: &[str], input: option::t<str>) -> procres {
     let cmdline =
         {
             let cmdline = make_cmdline(lib_path, prog, args);
-            logv(cx.config, #fmt["executing %s",
-                                  cmdline]);
+            logv(cx.config, #fmt["executing %s", cmdline]);
             cmdline
         };
     let res = procsrv::run(cx.procsrv, lib_path, prog, args, input);
@@ -311,66 +307,58 @@ fn program_output(cx: &cx, testfile: &istr, lib_path: &istr, prog: &istr,
          cmdline: cmdline};
 }
 
-fn make_cmdline(libpath: &istr, prog: &istr, args: &[istr]) -> istr {
-    #fmt["%s %s %s",
-          lib_path_cmd_prefix(libpath),
-          prog,
-          str::connect(args, ~" ")]
+fn make_cmdline(libpath: &str, prog: &str, args: &[str]) -> str {
+    #fmt["%s %s %s", lib_path_cmd_prefix(libpath), prog,
+         str::connect(args, " ")]
 }
 
 // Build the LD_LIBRARY_PATH variable as it would be seen on the command line
 // for diagnostic purposes
-fn lib_path_cmd_prefix(path: &istr) -> istr {
-        #fmt["%s=\"%s\"",
-              util::lib_path_env_var(),
-              util::make_new_path(path)]
+fn lib_path_cmd_prefix(path: &str) -> str {
+    #fmt["%s=\"%s\"", util::lib_path_env_var(), util::make_new_path(path)]
 }
 
-fn dump_output(config: &config, testfile: &istr, out: &istr, err: &istr) {
-    dump_output_file(config, testfile, out, ~"out");
-    dump_output_file(config, testfile, err, ~"err");
+fn dump_output(config: &config, testfile: &str, out: &str, err: &str) {
+    dump_output_file(config, testfile, out, "out");
+    dump_output_file(config, testfile, err, "err");
     maybe_dump_to_stdout(config, out, err);
 }
 
 #[cfg(target_os = "win32")]
 #[cfg(target_os = "linux")]
-fn dump_output_file(config: &config, testfile: &istr, out: &istr,
-                    extension: &istr) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
     let outfile = make_out_name(config, testfile, extension);
-    let writer = io::file_writer(outfile,
-                                 [io::create, io::truncate]);
+    let writer = io::file_writer(outfile, [io::create, io::truncate]);
     writer.write_str(out);
 }
 
 // FIXME (726): Can't use file_writer on mac
 #[cfg(target_os = "macos")]
-fn dump_output_file(config: &config, testfile: &istr, out: &istr,
-                    extension: &istr) {
+fn dump_output_file(config: &config, testfile: &str, out: &str,
+                    extension: &str) {
 }
 
-fn make_out_name(config: &config, testfile: &istr,
-                 extension: &istr) -> istr {
-    output_base_name(config, testfile) + ~"." + extension
+fn make_out_name(config: &config, testfile: &str, extension: &str) -> str {
+    output_base_name(config, testfile) + "." + extension
 }
 
-fn output_base_name(config: &config, testfile: &istr) -> istr {
+fn output_base_name(config: &config, testfile: &str) -> str {
     let base = config.build_base;
     let filename =
         {
-            let parts = str::split(fs::basename(testfile),
-                                    '.' as u8);
+            let parts = str::split(fs::basename(testfile), '.' as u8);
             parts = vec::slice(parts, 0u, vec::len(parts) - 1u);
-            str::connect(parts, ~".")
+            str::connect(parts, ".")
         };
-    #fmt["%s%s.%s", base, filename,
-                        config.stage_id]
+    #fmt["%s%s.%s", base, filename, config.stage_id]
 }
 
-fn maybe_dump_to_stdout(config: &config, out: &istr, err: &istr) {
+fn maybe_dump_to_stdout(config: &config, out: &str, err: &str) {
     if config.verbose {
-        let sep1 = #fmt["------%s------------------------------", ~"stdout"];
-        let sep2 = #fmt["------%s------------------------------", ~"stderr"];
-        let sep3 = ~"------------------------------------------";
+        let sep1 = #fmt["------%s------------------------------", "stdout"];
+        let sep2 = #fmt["------%s------------------------------", "stderr"];
+        let sep3 = "------------------------------------------";
         io::stdout().write_line(sep1);
         io::stdout().write_line(out);
         io::stdout().write_line(sep2);
@@ -379,13 +367,11 @@ fn maybe_dump_to_stdout(config: &config, out: &istr, err: &istr) {
     }
 }
 
-fn error(err: &istr) {
-    io::stdout().write_line(#fmt["\nerror: %s", err]);
-}
+fn error(err: &str) { io::stdout().write_line(#fmt["\nerror: %s", err]); }
 
-fn fatal(err: &istr) -> ! { error(err); fail; }
+fn fatal(err: &str) -> ! { error(err); fail; }
 
-fn fatal_procres(err: &istr, procres: procres) -> ! {
+fn fatal_procres(err: &str, procres: procres) -> ! {
     let msg =
         #fmt["\n\
 error: %s\n\
@@ -399,10 +385,7 @@ stderr:\n\
 %s\n\
 ------------------------------------------\n\
 \n",
-                             err,
-                             procres.cmdline,
-                             procres.stdout,
-                             procres.stderr];
+             err, procres.cmdline, procres.stdout, procres.stderr];
     io::stdout().write_str(msg);
     fail;
 }
diff --git a/src/test/compiletest/util.rs b/src/test/compiletest/util.rs
index b15e16b5d4d..769b409ea43 100644
--- a/src/test/compiletest/util.rs
+++ b/src/test/compiletest/util.rs
@@ -5,29 +5,26 @@ import std::str;
 
 import common::config;
 
-fn make_new_path(path: &istr) -> istr {
+fn make_new_path(path: &str) -> str {
 
     // Windows just uses PATH as the library search path, so we have to
     // maintain the current value while adding our own
     alt getenv(lib_path_env_var()) {
-      option::some(curr) {
-        #fmt["%s:%s", path, curr] }
+      option::some(curr) { #fmt["%s:%s", path, curr] }
       option::none. { path }
     }
 }
 
 #[cfg(target_os = "linux")]
-fn lib_path_env_var() -> istr { ~"LD_LIBRARY_PATH" }
+fn lib_path_env_var() -> str { "LD_LIBRARY_PATH" }
 
 #[cfg(target_os = "macos")]
-fn lib_path_env_var() -> istr { ~"DYLD_LIBRARY_PATH" }
+fn lib_path_env_var() -> str { "DYLD_LIBRARY_PATH" }
 
 #[cfg(target_os = "win32")]
-fn lib_path_env_var() -> istr { ~"PATH" }
+fn lib_path_env_var() -> str { "PATH" }
 
-fn logv(config: &config, s: &istr) {
+fn logv(config: &config, s: &str) {
     log s;
-    if config.verbose {
-        io::stdout().write_line(s);
-    }
+    if config.verbose { io::stdout().write_line(s); }
 }
diff --git a/src/test/run-fail/explicit-fail-msg.rs b/src/test/run-fail/explicit-fail-msg.rs
index 56937260b54..b45e443759c 100644
--- a/src/test/run-fail/explicit-fail-msg.rs
+++ b/src/test/run-fail/explicit-fail-msg.rs
@@ -1,3 +1,3 @@
 // error-pattern:wooooo
 // no-valgrind
-fn main() { let a = 1; if 1 == 1 { a = 2; } fail ~"woooo" + ~"o"; }
+fn main() { let a = 1; if 1 == 1 { a = 2; } fail "woooo" + "o"; }
diff --git a/src/test/run-fail/fmt-fail.rs b/src/test/run-fail/fmt-fail.rs
index 2791db07446..90256271fd2 100644
--- a/src/test/run-fail/fmt-fail.rs
+++ b/src/test/run-fail/fmt-fail.rs
@@ -2,4 +2,4 @@
 // no-valgrind
 use std;
 
-fn main() { let str_var: istr = ~"meh"; fail #fmt["%s", str_var]; }
+fn main() { let str_var: str = "meh"; fail #fmt["%s", str_var]; }
diff --git a/src/test/run-fail/fn-constraint.rs b/src/test/run-fail/fn-constraint.rs
index f55772d2def..3499d44ceff 100644
--- a/src/test/run-fail/fn-constraint.rs
+++ b/src/test/run-fail/fn-constraint.rs
@@ -7,5 +7,5 @@ fn main() {
     let a: uint = 4u;
     let b: uint = 1u;
     check (le(a, b));
-    log_err safe_slice(~"kitties", a, b);
+    log_err safe_slice("kitties", a, b);
 }
diff --git a/src/test/run-fail/zip-different-lengths.rs b/src/test/run-fail/zip-different-lengths.rs
index 95991e31243..dcc86fdd3c9 100644
--- a/src/test/run-fail/zip-different-lengths.rs
+++ b/src/test/run-fail/zip-different-lengths.rs
@@ -9,12 +9,12 @@ import std::vec::*;
 fn main() {
     let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 9u;
     // Silly, but necessary
-    check u8::le(a, j);
-    check uint::le(k, l);
+    check (u8::le(a, j));
+    check (uint::le(k, l));
     let chars = enum_chars(a, j);
-    let ints  = enum_uints(k, l);
+    let ints = enum_uints(k, l);
 
-    check same_length(chars, ints);
+    check (same_length(chars, ints));
     let ps = zip(chars, ints);
     fail "the impossible happened";
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/alt-str.rs b/src/test/run-pass/alt-str.rs
index 57e68552e80..e51263db804 100644
--- a/src/test/run-pass/alt-str.rs
+++ b/src/test/run-pass/alt-str.rs
@@ -1,31 +1,21 @@
 // Issue #53
 
 fn main() {
-    alt ~"test" {
-      ~"not-test" { fail; }
-      ~"test" { }
-      _ { fail; }
-    }
+    alt "test" { "not-test" { fail; } "test" { } _ { fail; } }
 
-    tag t { tag1(istr); tag2; }
+    tag t { tag1(str); tag2; }
 
 
-    alt tag1(~"test") {
+    alt tag1("test") {
       tag2. { fail; }
-      tag1(~"not-test") { fail; }
-      tag1(~"test") { }
+      tag1("not-test") { fail; }
+      tag1("test") { }
       _ { fail; }
     }
 
-    let x = alt ~"a" {
-      ~"a" { 1 }
-      ~"b" { 2 }
-    };
-    assert x == 1;
+    let x = alt "a" { "a" { 1 } "b" { 2 } };
+    assert (x == 1);
 
-    alt ~"a" {
-      ~"a" { }
-      ~"b" { }
-    }
+    alt "a" { "a" { } "b" { } }
 
 }
diff --git a/src/test/run-pass/argv.rs b/src/test/run-pass/argv.rs
index 4ed753c8333..0bb536086ba 100644
--- a/src/test/run-pass/argv.rs
+++ b/src/test/run-pass/argv.rs
@@ -1,5 +1,5 @@
-fn main(args: [istr]) {
-    let vs: [istr] = [~"hi", ~"there", ~"this", ~"is", ~"a", ~"vec"];
-    let vvs: [[istr]] = [args, vs];
-    for vs: [istr] in vvs { for s: istr in vs { log s; } }
+fn main(args: [str]) {
+    let vs: [str] = ["hi", "there", "this", "is", "a", "vec"];
+    let vvs: [[str]] = [args, vs];
+    for vs: [str] in vvs { for s: str in vs { log s; } }
 }
diff --git a/src/test/run-pass/bug-862.rs b/src/test/run-pass/bug-862.rs
index e3cddda3f8a..0c4c49a0a3d 100644
--- a/src/test/run-pass/bug-862.rs
+++ b/src/test/run-pass/bug-862.rs
@@ -4,8 +4,4 @@ fn f(i: int, j: int) : p(j) -> int { j }
 
 fn g(i: int, j: int) : p(j) -> int { f(i, j) }
 
-fn main() {
-    let x = 1;
-    check p(x);
-    log g(x, x);
-}
\ No newline at end of file
+fn main() { let x = 1; check (p(x)); log g(x, x); }
diff --git a/src/test/run-pass/check-pattern-bound.rs b/src/test/run-pass/check-pattern-bound.rs
index 0ebaf84b96d..32c6ac2475b 100644
--- a/src/test/run-pass/check-pattern-bound.rs
+++ b/src/test/run-pass/check-pattern-bound.rs
@@ -1,16 +1,10 @@
 use std;
 import std::option::*;
 
-pure fn p(x:int) -> bool { true }
+pure fn p(x: int) -> bool { true }
 
-fn f(x:int) : p(x) { }
+fn f(x: int) : p(x) { }
 
 fn main() {
-    alt some(5) {
-      some(y) {
-        check p(y);
-        f(y);
-      }
-      _ { fail "yuck"; }
-    }
+    alt some(5) { some(y) { check (p(y)); f(y); } _ { fail "yuck"; } }
 }
diff --git a/src/test/run-pass/child-outlives-parent.rs b/src/test/run-pass/child-outlives-parent.rs
index c902809e447..9a54dbd5c90 100644
--- a/src/test/run-pass/child-outlives-parent.rs
+++ b/src/test/run-pass/child-outlives-parent.rs
@@ -3,6 +3,6 @@
 use std;
 import std::task;
 
-fn child2(s: -istr) { }
+fn child2(s: -str) { }
 
-fn main() { let x = task::spawn(bind child2(~"hi")); }
+fn main() { let x = task::spawn(bind child2("hi")); }
diff --git a/src/test/run-pass/command-line-args.rs b/src/test/run-pass/command-line-args.rs
index b044af7d839..efd5d2bb04c 100644
--- a/src/test/run-pass/command-line-args.rs
+++ b/src/test/run-pass/command-line-args.rs
@@ -1,3 +1,3 @@
 
 
-fn main(args: [istr]) { log args[0]; }
+fn main(args: [str]) { log args[0]; }
diff --git a/src/test/run-pass/constraint-prop-expr-move.rs b/src/test/run-pass/constraint-prop-expr-move.rs
index a8f4f976872..56ebc914b93 100644
--- a/src/test/run-pass/constraint-prop-expr-move.rs
+++ b/src/test/run-pass/constraint-prop-expr-move.rs
@@ -8,5 +8,5 @@ fn main() {
     let c: uint = 17u;
     check (le(a, b));
     c <- a;
-    log safe_slice(~"kitties", c, b);
+    log safe_slice("kitties", c, b);
 }
diff --git a/src/test/run-pass/constraint-prop-move.rs b/src/test/run-pass/constraint-prop-move.rs
index b691fb75dbd..97285adae0c 100644
--- a/src/test/run-pass/constraint-prop-move.rs
+++ b/src/test/run-pass/constraint-prop-move.rs
@@ -7,5 +7,5 @@ fn main() {
     let b: uint = 4u;
     check (le(a, b));
     let c <- a;
-    log safe_slice(~"kitties", c, b);
+    log safe_slice("kitties", c, b);
 }
diff --git a/src/test/run-pass/constraint-prop-swap.rs b/src/test/run-pass/constraint-prop-swap.rs
index 5814f095f66..7b96a89bb16 100644
--- a/src/test/run-pass/constraint-prop-swap.rs
+++ b/src/test/run-pass/constraint-prop-swap.rs
@@ -7,5 +7,5 @@ fn main() {
     let b: uint = 1u;
     check (le(b, a));
     b <-> a;
-    log safe_slice(~"kitties", a, b);
+    log safe_slice("kitties", a, b);
 }
diff --git a/src/test/run-pass/constraint-prop.rs b/src/test/run-pass/constraint-prop.rs
index c0a5903f69c..71f151f5260 100644
--- a/src/test/run-pass/constraint-prop.rs
+++ b/src/test/run-pass/constraint-prop.rs
@@ -7,5 +7,5 @@ fn main() {
     let b: uint = 4u;
     check (le(a, b));
     let c = b;
-    log safe_slice(~"kitties", a, c);
+    log safe_slice("kitties", a, c);
 }
diff --git a/src/test/run-pass/fn-constraint.rs b/src/test/run-pass/fn-constraint.rs
index 5e2dac48eab..f9ea572a735 100644
--- a/src/test/run-pass/fn-constraint.rs
+++ b/src/test/run-pass/fn-constraint.rs
@@ -6,5 +6,5 @@ fn main() {
     let a: uint = 1u;
     let b: uint = 4u;
     check (le(a, b));
-    log safe_slice(~"kitties", a, b);
+    log safe_slice("kitties", a, b);
 }
diff --git a/src/test/run-pass/guards.rs b/src/test/run-pass/guards.rs
index 49e7fd3b7fe..2da4a0296fd 100644
--- a/src/test/run-pass/guards.rs
+++ b/src/test/run-pass/guards.rs
@@ -1,16 +1,13 @@
 fn main() {
-    let a = alt 10 {
-      x when x < 7 { 1 }
-      x when x < 11 { 2 }
-      10 { 3 }
-      _ { 4 }
-    };
-    assert a == 2;
+    let a =
+        alt 10 { x when x < 7 { 1 } x when x < 11 { 2 } 10 { 3 } _ { 4 } };
+    assert (a == 2);
 
-    let b = alt {x: 10, y: 20} {
-        x when x.x < 5 && x.y < 5 { 1 }
-        {x, y} when x == 10 && y == 20 { 2 }
-        {x, y} { 3 }
-    };
-    assert b == 2;
+    let b =
+        alt {x: 10, y: 20} {
+          x when x.x < 5 && x.y < 5 { 1 }
+          {x: x, y: y} when x == 10 && y == 20 { 2 }
+          {x: x, y: y} { 3 }
+        };
+    assert (b == 2);
 }
diff --git a/src/test/run-pass/hashmap-memory.rs b/src/test/run-pass/hashmap-memory.rs
index 81c827bfb22..6d5203f4884 100644
--- a/src/test/run-pass/hashmap-memory.rs
+++ b/src/test/run-pass/hashmap-memory.rs
@@ -19,31 +19,29 @@ import std::comm::send;
 import std::comm::recv;
 import std::comm;
 
-fn map(filename: &istr, emit: map_reduce::putter) { emit(filename, ~"1"); }
+fn map(filename: &str, emit: map_reduce::putter) { emit(filename, "1"); }
 
 mod map_reduce {
     export putter;
     export mapper;
     export map_reduce;
 
-    type putter = fn(&istr, &istr);
+    type putter = fn(&str, &str);
 
-    type mapper = fn(&istr, putter);
+    type mapper = fn(&str, putter);
 
     tag ctrl_proto { find_reducer([u8], chan<int>); mapper_done; }
 
-    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[istr]) {
-        for i: istr in inputs {
-            task::spawn(bind map_task(ctrl, i));
-        }
+    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[str]) {
+        for i: str in inputs { task::spawn(bind map_task(ctrl, i)); }
     }
 
-    fn map_task(ctrl: chan<ctrl_proto>, input: -istr) {
+    fn map_task(ctrl: chan<ctrl_proto>, input: -str) {
 
         let intermediates = map::new_str_hash();
 
-        fn emit(im: &map::hashmap<istr, int>, ctrl: chan<ctrl_proto>,
-                key: &istr, val: &istr) {
+        fn emit(im: &map::hashmap<str, int>, ctrl: chan<ctrl_proto>,
+                key: &str, val: &str) {
             let c;
             alt im.find(key) {
               some(_c) { c = _c }
@@ -63,13 +61,13 @@ mod map_reduce {
         send(ctrl, mapper_done);
     }
 
-    fn map_reduce(inputs: &[istr]) {
+    fn map_reduce(inputs: &[str]) {
         let ctrl = port();
 
         // This task becomes the master control task. It spawns others
         // to do the rest.
 
-        let reducers: map::hashmap<istr, int>;
+        let reducers: map::hashmap<str, int>;
 
         reducers = map::new_str_hash();
 
@@ -94,5 +92,5 @@ mod map_reduce {
 }
 
 fn main() {
-    map_reduce::map_reduce([~"../src/test/run-pass/hashmap-memory.rs"]);
+    map_reduce::map_reduce(["../src/test/run-pass/hashmap-memory.rs"]);
 }
diff --git a/src/test/run-pass/import4.rs b/src/test/run-pass/import4.rs
index 20b60a41e24..9e263b73413 100644
--- a/src/test/run-pass/import4.rs
+++ b/src/test/run-pass/import4.rs
@@ -5,4 +5,4 @@ mod zed {
     fn bar() { log "bar"; }
 }
 
-fn main(args: [istr]) { let zed = 42; bar(); }
+fn main(args: [str]) { let zed = 42; bar(); }
diff --git a/src/test/run-pass/import5.rs b/src/test/run-pass/import5.rs
index 14dbd577361..9f3ec6d2b45 100644
--- a/src/test/run-pass/import5.rs
+++ b/src/test/run-pass/import5.rs
@@ -7,4 +7,4 @@ mod foo {
     }
 }
 
-fn main(args: [istr]) { bar(); }
+fn main(args: [str]) { bar(); }
diff --git a/src/test/run-pass/import7.rs b/src/test/run-pass/import7.rs
index a50dcff79d1..40c3d2357bf 100644
--- a/src/test/run-pass/import7.rs
+++ b/src/test/run-pass/import7.rs
@@ -12,4 +12,4 @@ mod bar {
         mod zed { }
     }
 }
-fn main(args: [istr]) { baz(); }
+fn main(args: [str]) { baz(); }
diff --git a/src/test/run-pass/issue-687.rs b/src/test/run-pass/issue-687.rs
index 65cdfd899a8..0306326e824 100644
--- a/src/test/run-pass/issue-687.rs
+++ b/src/test/run-pass/issue-687.rs
@@ -36,8 +36,7 @@ fn packager(cb: chan<chan<[u8]>>, msg: chan<msg>) {
 fn main() {
     let p: port<msg> = port();
     let recv_reader: port<chan<[u8]>> = port();
-    let pack =
-        task::spawn(bind packager(chan(recv_reader), chan(p)));
+    let pack = task::spawn(bind packager(chan(recv_reader), chan(p)));
 
     let source_chan: chan<[u8]> = recv(recv_reader);
     let prod = task::spawn(bind producer(source_chan));
diff --git a/src/test/run-pass/istr.rs b/src/test/run-pass/istr.rs
index 8b0eb0ddc05..affdbd06f17 100644
--- a/src/test/run-pass/istr.rs
+++ b/src/test/run-pass/istr.rs
@@ -1,60 +1,53 @@
 fn test_stack_assign() {
-    let s: istr = ~"a";
+    let s: str = "a";
     log s;
-    let t: istr = ~"a";
-    assert s == t;
-    let u: istr = ~"b";
-    assert s != u;
+    let t: str = "a";
+    assert (s == t);
+    let u: str = "b";
+    assert (s != u);
 }
 
-fn test_heap_lit() {
-    ~"a big string";
-}
+fn test_heap_lit() { "a big string"; }
 
 fn test_heap_assign() {
-    let s: istr = ~"a big ol' string";
-    let t: istr = ~"a big ol' string";
-    assert s == t;
-    let u: istr = ~"a bad ol' string";
-    assert s != u;
+    let s: str = "a big ol' string";
+    let t: str = "a big ol' string";
+    assert (s == t);
+    let u: str = "a bad ol' string";
+    assert (s != u);
 }
 
-fn test_heap_log() {
-    let s = ~"a big ol' string";
-    log s;
-}
+fn test_heap_log() { let s = "a big ol' string"; log s; }
 
 fn test_stack_add() {
-    assert ~"a" + ~"b" == ~"ab";
-    let s: istr = ~"a";
-    assert s + s == ~"aa";
-    assert ~"" + ~"" == ~"";
+    assert ("a" + "b" == "ab");
+    let s: str = "a";
+    assert (s + s == "aa");
+    assert ("" + "" == "");
 }
 
-fn test_stack_heap_add() {
-    assert ~"a" + ~"bracadabra" == ~"abracadabra";
-}
+fn test_stack_heap_add() { assert ("a" + "bracadabra" == "abracadabra"); }
 
 fn test_heap_add() {
-    assert ~"this should" + ~" totally work" == ~"this should totally work";
+    assert ("this should" + " totally work" == "this should totally work");
 }
 
 fn test_append() {
-    let s = ~"";
-    s += ~"a";
-    assert s == ~"a";
+    let s = "";
+    s += "a";
+    assert (s == "a");
 
-    let s = ~"a";
-    s += ~"b";
+    let s = "a";
+    s += "b";
     log s;
-    assert s == ~"ab";
+    assert (s == "ab");
 
-    let s = ~"c";
-    s += ~"offee";
-    assert s == ~"coffee";
+    let s = "c";
+    s += "offee";
+    assert (s == "coffee");
 
-    s += ~"&tea";
-    assert s == ~"coffee&tea";
+    s += "&tea";
+    assert (s == "coffee&tea");
 }
 
 fn main() {
@@ -66,4 +59,4 @@ fn main() {
     test_stack_heap_add();
     test_heap_add();
     test_append();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/item-attributes.rs b/src/test/run-pass/item-attributes.rs
index dd5fb0b18b3..3701d229059 100644
--- a/src/test/run-pass/item-attributes.rs
+++ b/src/test/run-pass/item-attributes.rs
@@ -167,7 +167,7 @@ mod test_distinguish_syntax_ext {
     use std;
 
     fn f() {
-        #fmt["test%s", ~"s"];
+        #fmt["test%s", "s"];
         #[attr = "val"]
         fn g() { }
     }
diff --git a/src/test/run-pass/iter-ret.rs b/src/test/run-pass/iter-ret.rs
index 25f350680ba..b450a34c411 100644
--- a/src/test/run-pass/iter-ret.rs
+++ b/src/test/run-pass/iter-ret.rs
@@ -4,4 +4,4 @@ iter x() -> int { }
 
 fn f() -> bool { for each i: int in x() { ret true; } ret false; }
 
-fn main(args: [istr]) { f(); }
+fn main(args: [str]) { f(); }
diff --git a/src/test/run-pass/main-ivec.rs b/src/test/run-pass/main-ivec.rs
index 376374f68eb..ec2403a9151 100644
--- a/src/test/run-pass/main-ivec.rs
+++ b/src/test/run-pass/main-ivec.rs
@@ -1,3 +1 @@
-fn main(args: [istr]) {
-    for s in args { log s }
-}
+fn main(args: [str]) { for s in args { log s } }
diff --git a/src/test/run-pass/native2.rs b/src/test/run-pass/native2.rs
index 2840c6a3a78..c0340387cfe 100644
--- a/src/test/run-pass/native2.rs
+++ b/src/test/run-pass/native2.rs
@@ -14,4 +14,4 @@ native "cdecl" mod libc = "" {
 
 native "cdecl" mod baz = "" { }
 
-fn main(args: [istr]) { }
+fn main(args: [str]) { }
diff --git a/src/test/run-pass/non-boolean-pure-fns.rs b/src/test/run-pass/non-boolean-pure-fns.rs
index 61477258bb4..9478735d932 100644
--- a/src/test/run-pass/non-boolean-pure-fns.rs
+++ b/src/test/run-pass/non-boolean-pure-fns.rs
@@ -3,30 +3,23 @@ use std;
 import std::list::*;
 
 pure fn pure_length_go<@T>(ls: &list<T>, acc: uint) -> uint {
-    alt ls {
-      nil. { acc }
-      cons(_, tl) { pure_length_go(*tl, acc + 1u) }
-    }
+    alt ls { nil. { acc } cons(_, tl) { pure_length_go(*tl, acc + 1u) } }
 }
 
-pure fn pure_length<@T>(ls: &list<T>) -> uint {
-    pure_length_go(ls, 0u)
-}
+pure fn pure_length<@T>(ls: &list<T>) -> uint { pure_length_go(ls, 0u) }
 
-pure fn nonempty_list<@T>(ls: &list<T>) -> bool {
-    pure_length(ls) > 0u
-}
+pure fn nonempty_list<@T>(ls: &list<T>) -> bool { pure_length(ls) > 0u }
 
- // Of course, the compiler can't take advantage of the
-    // knowledge that ls is a cons node. Future work.
-    // Also, this is pretty contrived since nonempty_list
-    // could be a "tag refinement", if we implement those.
+// Of course, the compiler can't take advantage of the
+// knowledge that ls is a cons node. Future work.
+// Also, this is pretty contrived since nonempty_list
+// could be a "tag refinement", if we implement those.
 fn safe_head<@T>(ls: &list<T>) : nonempty_list(ls) -> T { car(ls) }
 
 fn main() {
     let mylist = cons(@1u, @nil);
     // Again, a way to eliminate such "obvious" checks seems
     // desirable. (Tags could have postconditions.)
-    check(nonempty_list(mylist));
-    assert (*(safe_head(mylist)) == 1u);
-}
\ No newline at end of file
+    check (nonempty_list(mylist));
+    assert (*safe_head(mylist) == 1u);
+}
diff --git a/src/test/run-pass/path.rs b/src/test/run-pass/path.rs
index 0cac07f3c99..4fe43d18121 100644
--- a/src/test/run-pass/path.rs
+++ b/src/test/run-pass/path.rs
@@ -4,4 +4,4 @@ mod foo {
     fn bar(offset: uint) { }
 }
 
-fn main(args: [istr]) { foo::bar(0u); }
+fn main(args: [str]) { foo::bar(0u); }
diff --git a/src/test/run-pass/sio-client.rs b/src/test/run-pass/sio-client.rs
index f3eefbcaef9..14e5e2e44cf 100644
--- a/src/test/run-pass/sio-client.rs
+++ b/src/test/run-pass/sio-client.rs
@@ -13,9 +13,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) {
 fn main() {
   let cx: sio::ctx = sio::new();
   let srv: sio::server = sio::create_server(
-       cx, net::parse_addr(~"0.0.0.0"), 9090);
+       cx, net::parse_addr("0.0.0.0"), 9090);
   let child = task::_spawn(bind connectTask(cx,
-                                            net::parse_addr(~"127.0.0.1"),
+                                            net::parse_addr("127.0.0.1"),
                                             9090));
   let client: sio::client = sio::accept_from(srv);
   task::join_id(child);
diff --git a/src/test/run-pass/sio-read.rs b/src/test/run-pass/sio-read.rs
index 9f7272e6d92..0085f4983f2 100644
--- a/src/test/run-pass/sio-read.rs
+++ b/src/test/run-pass/sio-read.rs
@@ -15,9 +15,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) {
 fn main() {
   let cx: sio::ctx = sio::new();
   let srv: sio::server = sio::create_server(
-          cx, net::parse_addr(~"0.0.0.0"), 9090);
+          cx, net::parse_addr("0.0.0.0"), 9090);
   let child = task::_spawn(bind connectTask(cx,
-                                            net::parse_addr(~"127.0.0.1"),
+                                            net::parse_addr("127.0.0.1"),
                                             9090));
   let client: sio::client = sio::accept_from(srv);
   sio::write_data(client, str::bytes("hello, world\n"));
diff --git a/src/test/run-pass/sio-srv.rs b/src/test/run-pass/sio-srv.rs
index c51a2c0d9d4..1171971427e 100644
--- a/src/test/run-pass/sio-srv.rs
+++ b/src/test/run-pass/sio-srv.rs
@@ -6,7 +6,7 @@ import std::net;
 fn main() {
   let cx: sio::ctx = sio::new();
   let srv: sio::server = sio::create_server(cx,
-                                            net::parse_addr(~"127.0.0.1"),
+                                            net::parse_addr("127.0.0.1"),
                                             9090);
   sio::close_server(srv);
   sio::destroy(cx);
diff --git a/src/test/run-pass/sio-write.rs b/src/test/run-pass/sio-write.rs
index 63e1cf4f3b1..cc372bc916d 100644
--- a/src/test/run-pass/sio-write.rs
+++ b/src/test/run-pass/sio-write.rs
@@ -13,9 +13,9 @@ fn connectTask(cx: sio::ctx, ip: net::ip_addr, portnum: int) {
 
 fn main() {
   let cx: sio::ctx = sio::new();
-  let srv: sio::server = sio::create_server(cx, net::parse_addr(~"0.0.0.0"),
+  let srv: sio::server = sio::create_server(cx, net::parse_addr("0.0.0.0"),
                                             9090);
-  let child = task::_spawn(bind connectTask(cx, net::parse_addr(~"127.0.0.1"),
+  let child = task::_spawn(bind connectTask(cx, net::parse_addr("127.0.0.1"),
                                             9090));
   let client: sio::client = sio::accept_from(srv);
   sio::write_data(client, str::bytes("hello, world\n"));
diff --git a/src/test/run-pass/spawn-fn.rs b/src/test/run-pass/spawn-fn.rs
index bfaba60bcd1..612fdecb4ab 100644
--- a/src/test/run-pass/spawn-fn.rs
+++ b/src/test/run-pass/spawn-fn.rs
@@ -4,12 +4,12 @@ use std;
 import std::task::yield;
 import std::task;
 
-fn x(s: -istr, n: int) { log s; log n; }
+fn x(s: -str, n: int) { log s; log n; }
 
 fn main() {
-    task::spawn(bind x(~"hello from first spawned fn", 65));
-    task::spawn(bind x(~"hello from second spawned fn", 66));
-    task::spawn(bind x(~"hello from third spawned fn", 67));
+    task::spawn(bind x("hello from first spawned fn", 65));
+    task::spawn(bind x("hello from second spawned fn", 66));
+    task::spawn(bind x("hello from third spawned fn", 67));
     let i: int = 30;
     while i > 0 { i = i - 1; log "parent sleeping"; yield(); }
 }
diff --git a/src/test/run-pass/spawn-module-qualified.rs b/src/test/run-pass/spawn-module-qualified.rs
index e5775550c44..38bf6afe1e5 100644
--- a/src/test/run-pass/spawn-module-qualified.rs
+++ b/src/test/run-pass/spawn-module-qualified.rs
@@ -2,10 +2,7 @@ use std;
 import std::task::join;
 import std::task::spawn_joinable;
 
-fn main() {
-    let x = spawn_joinable(bind m::child(10));
-    join(x);
-}
+fn main() { let x = spawn_joinable(bind m::child(10)); join(x); }
 
 mod m {
     fn child(i: int) { log i; }
diff --git a/src/test/run-pass/spawn-types.rs b/src/test/run-pass/spawn-types.rs
index 33ac76300a7..3a4ce18f3a2 100644
--- a/src/test/run-pass/spawn-types.rs
+++ b/src/test/run-pass/spawn-types.rs
@@ -12,9 +12,9 @@ import std::task;
 
 type ctx = comm::chan<int>;
 
-fn iotask(cx: ctx, ip: -istr) { assert (str::eq(ip, ~"localhost")); }
+fn iotask(cx: ctx, ip: -str) { assert (str::eq(ip, "localhost")); }
 
 fn main() {
     let p = comm::port::<int>();
-    task::spawn(bind iotask(comm::chan(p), ~"localhost"));
+    task::spawn(bind iotask(comm::chan(p), "localhost"));
 }
diff --git a/src/test/run-pass/spawn.rs b/src/test/run-pass/spawn.rs
index 9086b7d0e37..50c599f42af 100644
--- a/src/test/run-pass/spawn.rs
+++ b/src/test/run-pass/spawn.rs
@@ -4,10 +4,7 @@ use std;
 
 import std::task;
 
-fn main() {
-    let t = task::spawn_joinable(bind child(10));
-    task::join(t);
-}
+fn main() { let t = task::spawn_joinable(bind child(10)); task::join(t); }
 
 fn child(i: int) { log_err i; assert (i == 10); }
 
diff --git a/src/test/run-pass/str-append.rs b/src/test/run-pass/str-append.rs
index 5677f562a2f..e1fa92738cb 100644
--- a/src/test/run-pass/str-append.rs
+++ b/src/test/run-pass/str-append.rs
@@ -5,8 +5,8 @@ use std;
 import std::str;
 
 fn test1() {
-    let s: istr = ~"hello";
-    s += ~"world";
+    let s: str = "hello";
+    s += "world";
     log s;
     assert (s[9] == 'd' as u8);
 }
@@ -14,13 +14,13 @@ fn test1() {
 fn test2() {
     // This tests for issue #163
 
-    let ff: istr = ~"abc";
-    let a: istr = ff + ~"ABC" + ff;
-    let b: istr = ~"ABC" + ff + ~"ABC";
+    let ff: str = "abc";
+    let a: str = ff + "ABC" + ff;
+    let b: str = "ABC" + ff + "ABC";
     log a;
     log b;
-    assert (str::eq(a, ~"abcABCabc"));
-    assert (str::eq(b, ~"ABCabcABC"));
+    assert (str::eq(a, "abcABCabc"));
+    assert (str::eq(b, "ABCabcABC"));
 }
 
 fn main() { test1(); test2(); }
diff --git a/src/test/run-pass/str-multiline.rs b/src/test/run-pass/str-multiline.rs
index 3df1a7d926f..15a13083321 100644
--- a/src/test/run-pass/str-multiline.rs
+++ b/src/test/run-pass/str-multiline.rs
@@ -5,13 +5,13 @@ use std;
 import std::str;
 
 fn main() {
-    let a: istr = ~"this \
+    let a: str = "this \
 is a test";
-    let b: istr =
-        ~"this \
+    let b: str =
+        "this \
                is \
                another \
                test";
-    assert (str::eq(a, ~"this is a test"));
-    assert (str::eq(b, ~"this is another test"));
+    assert (str::eq(a, "this is a test"));
+    assert (str::eq(b, "this is another test"));
 }
diff --git a/src/test/run-pass/string-self-append.rs b/src/test/run-pass/string-self-append.rs
index 29bef1379bb..94a9696adf0 100644
--- a/src/test/run-pass/string-self-append.rs
+++ b/src/test/run-pass/string-self-append.rs
@@ -3,7 +3,7 @@ import std::str;
 
 fn main() {
     // Make sure we properly handle repeated self-appends.
-    let a: istr = ~"A";
+    let a: str = "A";
     let i = 20;
     let expected_len = 1u;
     while i > 0 {
diff --git a/src/test/run-pass/syntax-extension-fmt.rs b/src/test/run-pass/syntax-extension-fmt.rs
index 77ae154085f..88204cfffeb 100644
--- a/src/test/run-pass/syntax-extension-fmt.rs
+++ b/src/test/run-pass/syntax-extension-fmt.rs
@@ -1,17 +1,17 @@
 use std;
 import std::str;
 
-fn test(actual: &istr, expected: &istr) {
+fn test(actual: &str, expected: &str) {
     log actual;
     log expected;
     assert (str::eq(actual, expected));
 }
 
 fn main() {
-    test(#fmt[~"hello %d friends and %s things", 10, ~"formatted"],
-         ~"hello 10 friends and formatted things");
+    test(#fmt["hello %d friends and %s things", 10, "formatted"],
+         "hello 10 friends and formatted things");
 
-    test(#fmt[~"test"], ~"test");
+    test(#fmt["test"], "test");
 
     // a quadratic optimization in LLVM (jump-threading) makes this test a
     // bit slow to compile unless we break it up
@@ -26,192 +26,192 @@ fn main() {
 fn part1() {
     // Simple tests for types
 
-    test(#fmt[~"%d", 1], ~"1");
-    test(#fmt[~"%i", 2], ~"2");
-    test(#fmt[~"%i", -1], ~"-1");
-    test(#fmt[~"%u", 10u], ~"10");
-    test(#fmt[~"%s", ~"test"], ~"test");
-    test(#fmt[~"%b", true], ~"true");
-    test(#fmt[~"%b", false], ~"false");
-    test(#fmt[~"%c", 'A'], ~"A");
-    test(#fmt[~"%x", 0xff_u], ~"ff");
-    test(#fmt[~"%X", 0x12ab_u], ~"12AB");
-    test(#fmt[~"%o", 10u], ~"12");
-    test(#fmt[~"%t", 0b11010101_u], ~"11010101");
+    test(#fmt["%d", 1], "1");
+    test(#fmt["%i", 2], "2");
+    test(#fmt["%i", -1], "-1");
+    test(#fmt["%u", 10u], "10");
+    test(#fmt["%s", "test"], "test");
+    test(#fmt["%b", true], "true");
+    test(#fmt["%b", false], "false");
+    test(#fmt["%c", 'A'], "A");
+    test(#fmt["%x", 0xff_u], "ff");
+    test(#fmt["%X", 0x12ab_u], "12AB");
+    test(#fmt["%o", 10u], "12");
+    test(#fmt["%t", 0b11010101_u], "11010101");
     // 32-bit limits
 
-    test(#fmt[~"%i", -2147483648], ~"-2147483648");
-    test(#fmt[~"%i", 2147483647], ~"2147483647");
-    test(#fmt[~"%u", 4294967295u], ~"4294967295");
-    test(#fmt[~"%x", 0xffffffff_u], ~"ffffffff");
-    test(#fmt[~"%o", 0xffffffff_u], ~"37777777777");
-    test(#fmt[~"%t", 0xffffffff_u], ~"11111111111111111111111111111111");
+    test(#fmt["%i", -2147483648], "-2147483648");
+    test(#fmt["%i", 2147483647], "2147483647");
+    test(#fmt["%u", 4294967295u], "4294967295");
+    test(#fmt["%x", 0xffffffff_u], "ffffffff");
+    test(#fmt["%o", 0xffffffff_u], "37777777777");
+    test(#fmt["%t", 0xffffffff_u], "11111111111111111111111111111111");
 }
 fn part2() {
     // Widths
 
-    test(#fmt[~"%1d", 500], ~"500");
-    test(#fmt[~"%10d", 500], ~"       500");
-    test(#fmt[~"%10d", -500], ~"      -500");
-    test(#fmt[~"%10u", 500u], ~"       500");
-    test(#fmt[~"%10s", ~"test"], ~"      test");
-    test(#fmt[~"%10b", true], ~"      true");
-    test(#fmt[~"%10x", 0xff_u], ~"        ff");
-    test(#fmt[~"%10X", 0xff_u], ~"        FF");
-    test(#fmt[~"%10o", 10u], ~"        12");
-    test(#fmt[~"%10t", 0xff_u], ~"  11111111");
-    test(#fmt[~"%10c", 'A'], ~"         A");
+    test(#fmt["%1d", 500], "500");
+    test(#fmt["%10d", 500], "       500");
+    test(#fmt["%10d", -500], "      -500");
+    test(#fmt["%10u", 500u], "       500");
+    test(#fmt["%10s", "test"], "      test");
+    test(#fmt["%10b", true], "      true");
+    test(#fmt["%10x", 0xff_u], "        ff");
+    test(#fmt["%10X", 0xff_u], "        FF");
+    test(#fmt["%10o", 10u], "        12");
+    test(#fmt["%10t", 0xff_u], "  11111111");
+    test(#fmt["%10c", 'A'], "         A");
     // Left justify
 
-    test(#fmt[~"%-10d", 500], ~"500       ");
-    test(#fmt[~"%-10d", -500], ~"-500      ");
-    test(#fmt[~"%-10u", 500u], ~"500       ");
-    test(#fmt[~"%-10s", ~"test"], ~"test      ");
-    test(#fmt[~"%-10b", true], ~"true      ");
-    test(#fmt[~"%-10x", 0xff_u], ~"ff        ");
-    test(#fmt[~"%-10X", 0xff_u], ~"FF        ");
-    test(#fmt[~"%-10o", 10u], ~"12        ");
-    test(#fmt[~"%-10t", 0xff_u], ~"11111111  ");
-    test(#fmt[~"%-10c", 'A'], ~"A         ");
+    test(#fmt["%-10d", 500], "500       ");
+    test(#fmt["%-10d", -500], "-500      ");
+    test(#fmt["%-10u", 500u], "500       ");
+    test(#fmt["%-10s", "test"], "test      ");
+    test(#fmt["%-10b", true], "true      ");
+    test(#fmt["%-10x", 0xff_u], "ff        ");
+    test(#fmt["%-10X", 0xff_u], "FF        ");
+    test(#fmt["%-10o", 10u], "12        ");
+    test(#fmt["%-10t", 0xff_u], "11111111  ");
+    test(#fmt["%-10c", 'A'], "A         ");
 }
 
 fn part3() {
     // Precision
 
-    test(#fmt[~"%.d", 0], ~"");
-    test(#fmt[~"%.u", 0u], ~"");
-    test(#fmt[~"%.x", 0u], ~"");
-    test(#fmt[~"%.t", 0u], ~"");
-    test(#fmt[~"%.d", 10], ~"10");
-    test(#fmt[~"%.d", -10], ~"-10");
-    test(#fmt[~"%.u", 10u], ~"10");
-    test(#fmt[~"%.s", ~"test"], ~"");
-    test(#fmt[~"%.x", 127u], ~"7f");
-    test(#fmt[~"%.o", 10u], ~"12");
-    test(#fmt[~"%.t", 3u], ~"11");
-    test(#fmt[~"%.c", 'A'], ~"A");
-    test(#fmt[~"%.0d", 0], ~"");
-    test(#fmt[~"%.0u", 0u], ~"");
-    test(#fmt[~"%.0x", 0u], ~"");
-    test(#fmt[~"%.0t", 0u], ~"");
-    test(#fmt[~"%.0d", 10], ~"10");
-    test(#fmt[~"%.0d", -10], ~"-10");
-    test(#fmt[~"%.0u", 10u], ~"10");
-    test(#fmt[~"%.0s", ~"test"], ~"");
-    test(#fmt[~"%.0x", 127u], ~"7f");
-    test(#fmt[~"%.0o", 10u], ~"12");
-    test(#fmt[~"%.0t", 3u], ~"11");
-    test(#fmt[~"%.0c", 'A'], ~"A");
-    test(#fmt[~"%.1d", 0], ~"0");
-    test(#fmt[~"%.1u", 0u], ~"0");
-    test(#fmt[~"%.1x", 0u], ~"0");
-    test(#fmt[~"%.1t", 0u], ~"0");
-    test(#fmt[~"%.1d", 10], ~"10");
-    test(#fmt[~"%.1d", -10], ~"-10");
-    test(#fmt[~"%.1u", 10u], ~"10");
-    test(#fmt[~"%.1s", ~"test"], ~"t");
-    test(#fmt[~"%.1x", 127u], ~"7f");
-    test(#fmt[~"%.1o", 10u], ~"12");
-    test(#fmt[~"%.1t", 3u], ~"11");
-    test(#fmt[~"%.1c", 'A'], ~"A");
+    test(#fmt["%.d", 0], "");
+    test(#fmt["%.u", 0u], "");
+    test(#fmt["%.x", 0u], "");
+    test(#fmt["%.t", 0u], "");
+    test(#fmt["%.d", 10], "10");
+    test(#fmt["%.d", -10], "-10");
+    test(#fmt["%.u", 10u], "10");
+    test(#fmt["%.s", "test"], "");
+    test(#fmt["%.x", 127u], "7f");
+    test(#fmt["%.o", 10u], "12");
+    test(#fmt["%.t", 3u], "11");
+    test(#fmt["%.c", 'A'], "A");
+    test(#fmt["%.0d", 0], "");
+    test(#fmt["%.0u", 0u], "");
+    test(#fmt["%.0x", 0u], "");
+    test(#fmt["%.0t", 0u], "");
+    test(#fmt["%.0d", 10], "10");
+    test(#fmt["%.0d", -10], "-10");
+    test(#fmt["%.0u", 10u], "10");
+    test(#fmt["%.0s", "test"], "");
+    test(#fmt["%.0x", 127u], "7f");
+    test(#fmt["%.0o", 10u], "12");
+    test(#fmt["%.0t", 3u], "11");
+    test(#fmt["%.0c", 'A'], "A");
+    test(#fmt["%.1d", 0], "0");
+    test(#fmt["%.1u", 0u], "0");
+    test(#fmt["%.1x", 0u], "0");
+    test(#fmt["%.1t", 0u], "0");
+    test(#fmt["%.1d", 10], "10");
+    test(#fmt["%.1d", -10], "-10");
+    test(#fmt["%.1u", 10u], "10");
+    test(#fmt["%.1s", "test"], "t");
+    test(#fmt["%.1x", 127u], "7f");
+    test(#fmt["%.1o", 10u], "12");
+    test(#fmt["%.1t", 3u], "11");
+    test(#fmt["%.1c", 'A'], "A");
 }
 fn part4() {
-    test(#fmt[~"%.5d", 0], ~"00000");
-    test(#fmt[~"%.5u", 0u], ~"00000");
-    test(#fmt[~"%.5x", 0u], ~"00000");
-    test(#fmt[~"%.5t", 0u], ~"00000");
-    test(#fmt[~"%.5d", 10], ~"00010");
-    test(#fmt[~"%.5d", -10], ~"-00010");
-    test(#fmt[~"%.5u", 10u], ~"00010");
-    test(#fmt[~"%.5s", ~"test"], ~"test");
-    test(#fmt[~"%.5x", 127u], ~"0007f");
-    test(#fmt[~"%.5o", 10u], ~"00012");
-    test(#fmt[~"%.5t", 3u], ~"00011");
-    test(#fmt[~"%.5c", 'A'], ~"A");
+    test(#fmt["%.5d", 0], "00000");
+    test(#fmt["%.5u", 0u], "00000");
+    test(#fmt["%.5x", 0u], "00000");
+    test(#fmt["%.5t", 0u], "00000");
+    test(#fmt["%.5d", 10], "00010");
+    test(#fmt["%.5d", -10], "-00010");
+    test(#fmt["%.5u", 10u], "00010");
+    test(#fmt["%.5s", "test"], "test");
+    test(#fmt["%.5x", 127u], "0007f");
+    test(#fmt["%.5o", 10u], "00012");
+    test(#fmt["%.5t", 3u], "00011");
+    test(#fmt["%.5c", 'A'], "A");
     // Bool precision. I'm not sure if it's good or bad to have bool
     // conversions support precision - it's not standard printf so we
     // can do whatever. For now I'm making it behave the same as string
     // conversions.
 
-    test(#fmt[~"%.b", true], ~"");
-    test(#fmt[~"%.0b", true], ~"");
-    test(#fmt[~"%.1b", true], ~"t");
+    test(#fmt["%.b", true], "");
+    test(#fmt["%.0b", true], "");
+    test(#fmt["%.1b", true], "t");
 }
 
 fn part5() {
     // Explicit + sign. Only for signed conversions
 
-    test(#fmt[~"%+d", 0], ~"+0");
-    test(#fmt[~"%+d", 1], ~"+1");
-    test(#fmt[~"%+d", -1], ~"-1");
+    test(#fmt["%+d", 0], "+0");
+    test(#fmt["%+d", 1], "+1");
+    test(#fmt["%+d", -1], "-1");
     // Leave space for sign
 
-    test(#fmt[~"% d", 0], ~" 0");
-    test(#fmt[~"% d", 1], ~" 1");
-    test(#fmt[~"% d", -1], ~"-1");
+    test(#fmt["% d", 0], " 0");
+    test(#fmt["% d", 1], " 1");
+    test(#fmt["% d", -1], "-1");
     // Plus overrides space
 
-    test(#fmt[~"% +d", 0], ~"+0");
-    test(#fmt[~"%+ d", 0], ~"+0");
+    test(#fmt["% +d", 0], "+0");
+    test(#fmt["%+ d", 0], "+0");
     // 0-padding
 
-    test(#fmt[~"%05d", 0], ~"00000");
-    test(#fmt[~"%05d", 1], ~"00001");
-    test(#fmt[~"%05d", -1], ~"-0001");
-    test(#fmt[~"%05u", 1u], ~"00001");
-    test(#fmt[~"%05x", 127u], ~"0007f");
-    test(#fmt[~"%05X", 127u], ~"0007F");
-    test(#fmt[~"%05o", 10u], ~"00012");
-    test(#fmt[~"%05t", 3u], ~"00011");
+    test(#fmt["%05d", 0], "00000");
+    test(#fmt["%05d", 1], "00001");
+    test(#fmt["%05d", -1], "-0001");
+    test(#fmt["%05u", 1u], "00001");
+    test(#fmt["%05x", 127u], "0007f");
+    test(#fmt["%05X", 127u], "0007F");
+    test(#fmt["%05o", 10u], "00012");
+    test(#fmt["%05t", 3u], "00011");
     // 0-padding a string is undefined but glibc does this:
 
-    test(#fmt[~"%05s", ~"test"], ~" test");
-    test(#fmt[~"%05c", 'A'], ~"    A");
-    test(#fmt[~"%05b", true], ~" true");
+    test(#fmt["%05s", "test"], " test");
+    test(#fmt["%05c", 'A'], "    A");
+    test(#fmt["%05b", true], " true");
     // Left-justify overrides 0-padding
 
-    test(#fmt[~"%-05d", 0], ~"0    ");
-    test(#fmt[~"%-05d", 1], ~"1    ");
-    test(#fmt[~"%-05d", -1], ~"-1   ");
-    test(#fmt[~"%-05u", 1u], ~"1    ");
-    test(#fmt[~"%-05x", 127u], ~"7f   ");
-    test(#fmt[~"%-05X", 127u], ~"7F   ");
-    test(#fmt[~"%-05o", 10u], ~"12   ");
-    test(#fmt[~"%-05t", 3u], ~"11   ");
-    test(#fmt[~"%-05s", ~"test"], ~"test ");
-    test(#fmt[~"%-05c", 'A'], ~"A    ");
-    test(#fmt[~"%-05b", true], ~"true ");
+    test(#fmt["%-05d", 0], "0    ");
+    test(#fmt["%-05d", 1], "1    ");
+    test(#fmt["%-05d", -1], "-1   ");
+    test(#fmt["%-05u", 1u], "1    ");
+    test(#fmt["%-05x", 127u], "7f   ");
+    test(#fmt["%-05X", 127u], "7F   ");
+    test(#fmt["%-05o", 10u], "12   ");
+    test(#fmt["%-05t", 3u], "11   ");
+    test(#fmt["%-05s", "test"], "test ");
+    test(#fmt["%-05c", 'A'], "A    ");
+    test(#fmt["%-05b", true], "true ");
 }
 fn part6() {
     // Precision overrides 0-padding
 
-    test(#fmt[~"%06.5d", 0], ~" 00000");
-    test(#fmt[~"%06.5u", 0u], ~" 00000");
-    test(#fmt[~"%06.5x", 0u], ~" 00000");
-    test(#fmt[~"%06.5d", 10], ~" 00010");
-    test(#fmt[~"%06.5d", -10], ~"-00010");
-    test(#fmt[~"%06.5u", 10u], ~" 00010");
-    test(#fmt[~"%06.5s", ~"test"], ~"  test");
-    test(#fmt[~"%06.5c", 'A'], ~"     A");
-    test(#fmt[~"%06.5x", 127u], ~" 0007f");
-    test(#fmt[~"%06.5X", 127u], ~" 0007F");
-    test(#fmt[~"%06.5o", 10u], ~" 00012");
+    test(#fmt["%06.5d", 0], " 00000");
+    test(#fmt["%06.5u", 0u], " 00000");
+    test(#fmt["%06.5x", 0u], " 00000");
+    test(#fmt["%06.5d", 10], " 00010");
+    test(#fmt["%06.5d", -10], "-00010");
+    test(#fmt["%06.5u", 10u], " 00010");
+    test(#fmt["%06.5s", "test"], "  test");
+    test(#fmt["%06.5c", 'A'], "     A");
+    test(#fmt["%06.5x", 127u], " 0007f");
+    test(#fmt["%06.5X", 127u], " 0007F");
+    test(#fmt["%06.5o", 10u], " 00012");
     // Signed combinations
 
-    test(#fmt[~"% 5d", 1], ~"    1");
-    test(#fmt[~"% 5d", -1], ~"   -1");
-    test(#fmt[~"%+5d", 1], ~"   +1");
-    test(#fmt[~"%+5d", -1], ~"   -1");
-    test(#fmt[~"% 05d", 1], ~" 0001");
-    test(#fmt[~"% 05d", -1], ~"-0001");
-    test(#fmt[~"%+05d", 1], ~"+0001");
-    test(#fmt[~"%+05d", -1], ~"-0001");
-    test(#fmt[~"%- 5d", 1], ~" 1   ");
-    test(#fmt[~"%- 5d", -1], ~"-1   ");
-    test(#fmt[~"%-+5d", 1], ~"+1   ");
-    test(#fmt[~"%-+5d", -1], ~"-1   ");
-    test(#fmt[~"%- 05d", 1], ~" 1   ");
-    test(#fmt[~"%- 05d", -1], ~"-1   ");
-    test(#fmt[~"%-+05d", 1], ~"+1   ");
-    test(#fmt[~"%-+05d", -1], ~"-1   ");
+    test(#fmt["% 5d", 1], "    1");
+    test(#fmt["% 5d", -1], "   -1");
+    test(#fmt["%+5d", 1], "   +1");
+    test(#fmt["%+5d", -1], "   -1");
+    test(#fmt["% 05d", 1], " 0001");
+    test(#fmt["% 05d", -1], "-0001");
+    test(#fmt["%+05d", 1], "+0001");
+    test(#fmt["%+05d", -1], "-0001");
+    test(#fmt["%- 5d", 1], " 1   ");
+    test(#fmt["%- 5d", -1], "-1   ");
+    test(#fmt["%-+5d", 1], "+1   ");
+    test(#fmt["%-+5d", -1], "-1   ");
+    test(#fmt["%- 05d", 1], " 1   ");
+    test(#fmt["%- 05d", -1], "-1   ");
+    test(#fmt["%-+05d", 1], "+1   ");
+    test(#fmt["%-+05d", -1], "-1   ");
 }
diff --git a/src/test/run-pass/tag-in-block.rs b/src/test/run-pass/tag-in-block.rs
index c84bfeacee5..d76ee9ed12a 100644
--- a/src/test/run-pass/tag-in-block.rs
+++ b/src/test/run-pass/tag-in-block.rs
@@ -6,4 +6,4 @@ fn foo() {
     fn baz() { zed(nil); }
 }
 
-fn main(args: [istr]) { }
+fn main(args: [str]) { }
diff --git a/src/test/run-pass/tag.rs b/src/test/run-pass/tag.rs
index 12ac2614efe..d0022341f8d 100644
--- a/src/test/run-pass/tag.rs
+++ b/src/test/run-pass/tag.rs
@@ -4,10 +4,6 @@
 // -*- rust -*-
 tag colour { red(int, int); green; }
 
-fn f() {
-    let x = red(1, 2);
-    let y = green;
-    assert (x != y);
-}
+fn f() { let x = red(1, 2); let y = green; assert (x != y); }
 
 fn main() { f(); }
diff --git a/src/test/run-pass/task-life-0.rs b/src/test/run-pass/task-life-0.rs
index b8c78ecd12b..d272410be80 100644
--- a/src/test/run-pass/task-life-0.rs
+++ b/src/test/run-pass/task-life-0.rs
@@ -1,6 +1,6 @@
 use std;
 import std::task;
-fn main() { task::spawn(bind child(~"Hello")); }
+fn main() { task::spawn(bind child("Hello")); }
 
 fn child(s: -str) {
 
diff --git a/src/test/run-pass/terminate-in-initializer.rs b/src/test/run-pass/terminate-in-initializer.rs
index 4e6bda36845..8e032197085 100644
--- a/src/test/run-pass/terminate-in-initializer.rs
+++ b/src/test/run-pass/terminate-in-initializer.rs
@@ -3,41 +3,21 @@
 
 use std;
 
-fn test_break() {
-    while true {
-        let x: @int = break;
-    }
-}
+fn test_break() { while true { let x: @int = break; } }
 
-fn test_cont() {
-    let i = 0;
-    while i < 1 {
-        i += 1;
-        let x: @int = cont;
-    }
-}
+fn test_cont() { let i = 0; while i < 1 { i += 1; let x: @int = cont; } }
 
-fn test_ret() {
-    let x: @int = ret;
-}
+fn test_ret() { let x: @int = ret; }
 
 fn test_fail() {
-    fn f() {
-        std::task::unsupervise();
-        let x: @int = fail;
-    }
+    fn f() { std::task::unsupervise(); let x: @int = fail; }
     let g = f;
     std::task::spawn(g);
 }
 
 fn test_fail_indirect() {
-    fn f() -> ! {
-        fail;
-    }
-    fn g() {
-        std::task::unsupervise();
-        let x: @int = f();
-    }
+    fn f() -> ! { fail; }
+    fn g() { std::task::unsupervise(); let x: @int = f(); }
     let h = g;
     std::task::spawn(h);
 }
@@ -48,4 +28,4 @@ fn main() {
     test_ret();
     test_fail();
     test_fail_indirect();
-}
\ No newline at end of file
+}
diff --git a/src/test/run-pass/type-param.rs b/src/test/run-pass/type-param.rs
index 1ad437ed67f..be55ba86cac 100644
--- a/src/test/run-pass/type-param.rs
+++ b/src/test/run-pass/type-param.rs
@@ -2,4 +2,4 @@
 
 type lteq<T> = fn(&T) -> bool;
 
-fn main(args: [istr]) { }
+fn main(args: [str]) { }
diff --git a/src/test/run-pass/type-ptr.rs b/src/test/run-pass/type-ptr.rs
index 000fb1a1558..e608a9f9836 100644
--- a/src/test/run-pass/type-ptr.rs
+++ b/src/test/run-pass/type-ptr.rs
@@ -2,4 +2,4 @@ fn f(a: *int) -> *int { ret a; }
 
 fn g(a: *int) -> *int { let b = f(a); ret b; }
 
-fn main(args: [istr]) { ret; }
+fn main(args: [str]) { ret; }
diff --git a/src/test/run-pass/unchecked-predicates.rs b/src/test/run-pass/unchecked-predicates.rs
index 56b7dcc7837..d456f1f2e90 100644
--- a/src/test/run-pass/unchecked-predicates.rs
+++ b/src/test/run-pass/unchecked-predicates.rs
@@ -6,35 +6,28 @@ import std::list::*;
 // Can't easily be written as a "pure fn" because there's
 // no syntax for specifying that f is pure.
 fn pure_foldl<@T, @U>(ls: &list<T>, u: &U, f: &block(&T, &U) -> U) -> U {
-    alt ls {
-      nil. { u }
-      cons(hd, tl) { f(hd, pure_foldl(*tl, f(hd, u), f)) }
-    }
+    alt ls { nil. { u } cons(hd, tl) { f(hd, pure_foldl(*tl, f(hd, u), f)) } }
 }
 
 // Shows how to use an "unchecked" block to call a general
 // fn from a pure fn
 pure fn pure_length<@T>(ls: &list<T>) -> uint {
     fn count<T>(_t: &T, u: &uint) -> uint { u + 1u }
-    unchecked {
-        pure_foldl(ls, 0u, count)
-    }
+    unchecked{ pure_foldl(ls, 0u, count) }
 }
 
-pure fn nonempty_list<@T>(ls: &list<T>) -> bool {
-    pure_length(ls) > 0u
-}
+pure fn nonempty_list<@T>(ls: &list<T>) -> bool { pure_length(ls) > 0u }
 
- // Of course, the compiler can't take advantage of the
-    // knowledge that ls is a cons node. Future work.
-    // Also, this is pretty contrived since nonempty_list
-    // could be a "tag refinement", if we implement those.
+// Of course, the compiler can't take advantage of the
+// knowledge that ls is a cons node. Future work.
+// Also, this is pretty contrived since nonempty_list
+// could be a "tag refinement", if we implement those.
 fn safe_head<@T>(ls: &list<T>) : nonempty_list(ls) -> T { car(ls) }
 
 fn main() {
     let mylist = cons(@1u, @nil);
     // Again, a way to eliminate such "obvious" checks seems
     // desirable. (Tags could have postconditions.)
-    check(nonempty_list(mylist));
-    assert (*(safe_head(mylist)) == 1u);
-}
\ No newline at end of file
+    check (nonempty_list(mylist));
+    assert (*safe_head(mylist) == 1u);
+}
diff --git a/src/test/run-pass/utf8_chars.rs b/src/test/run-pass/utf8_chars.rs
index 4b292d1ba86..e7f7f9a1524 100644
--- a/src/test/run-pass/utf8_chars.rs
+++ b/src/test/run-pass/utf8_chars.rs
@@ -5,7 +5,7 @@ import std::vec;
 fn main() {
     // Chars of 1, 2, 3, and 4 bytes
     let chs: [char] = ['e', 'é', '€', 0x10000 as char];
-    let s: istr = str::from_chars(chs);
+    let s: str = str::from_chars(chs);
 
     assert (str::byte_len(s) == 10u);
     assert (str::char_len(s) == 4u);
@@ -19,13 +19,13 @@ fn main() {
     assert (!str::is_utf8([0xc0_u8]));
     assert (!str::is_utf8([0xc0_u8, 0x10_u8]));
 
-    let stack = ~"a×c€";
+    let stack = "a×c€";
     assert (str::pop_char(stack) == '€');
     assert (str::pop_char(stack) == 'c');
     str::push_char(stack, 'u');
-    assert (str::eq(stack, ~"a×u"));
+    assert (str::eq(stack, "a×u"));
     assert (str::shift_char(stack) == 'a');
     assert (str::shift_char(stack) == '×');
     str::unshift_char(stack, 'ß');
-    assert (str::eq(stack, ~"ßu"));
+    assert (str::eq(stack, "ßu"));
 }
diff --git a/src/test/run-pass/vec-self-append.rs b/src/test/run-pass/vec-self-append.rs
index 47e9f27686b..8e023cf03da 100644
--- a/src/test/run-pass/vec-self-append.rs
+++ b/src/test/run-pass/vec-self-append.rs
@@ -5,17 +5,17 @@ fn test_heap_to_heap() {
     // a spills onto the heap
     let a = [0, 1, 2, 3, 4];
     a += a;
-    assert vec::len(a) == 10u;
-    assert a[0] == 0;
-    assert a[1] == 1;
-    assert a[2] == 2;
-    assert a[3] == 3;
-    assert a[4] == 4;
-    assert a[5] == 0;
-    assert a[6] == 1;
-    assert a[7] == 2;
-    assert a[8] == 3;
-    assert a[9] == 4;
+    assert (vec::len(a) == 10u);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 2);
+    assert (a[3] == 3);
+    assert (a[4] == 4);
+    assert (a[5] == 0);
+    assert (a[6] == 1);
+    assert (a[7] == 2);
+    assert (a[8] == 3);
+    assert (a[9] == 4);
 }
 
 fn test_stack_to_heap() {
@@ -23,13 +23,13 @@ fn test_stack_to_heap() {
     let a = [0, 1, 2];
     // a spills to the heap
     a += a;
-    assert vec::len(a) == 6u;
-    assert a[0] == 0;
-    assert a[1] == 1;
-    assert a[2] == 2;
-    assert a[3] == 0;
-    assert a[4] == 1;
-    assert a[5] == 2;
+    assert (vec::len(a) == 6u);
+    assert (a[0] == 0);
+    assert (a[1] == 1);
+    assert (a[2] == 2);
+    assert (a[3] == 0);
+    assert (a[4] == 1);
+    assert (a[5] == 2);
 }
 
 fn test_loop() {
@@ -46,8 +46,4 @@ fn test_loop() {
     }
 }
 
-fn main() {
-    test_heap_to_heap();
-    test_stack_to_heap();
-    test_loop();
-}
+fn main() { test_heap_to_heap(); test_stack_to_heap(); test_loop(); }
diff --git a/src/test/run-pass/while-cont.rs b/src/test/run-pass/while-cont.rs
index 78c4163c3bd..6a2e9acfda3 100644
--- a/src/test/run-pass/while-cont.rs
+++ b/src/test/run-pass/while-cont.rs
@@ -1,10 +1,2 @@
 // Issue #825: Should recheck the loop contition after continuing
-fn main() {
-    let i = 1;
-    while i > 0 {
-        assert i > 0;
-        log i;
-        i -= 1;
-        cont;
-    }
-}
\ No newline at end of file
+fn main() { let i = 1; while i > 0 { assert (i > 0); log i; i -= 1; cont; } }
diff --git a/src/test/run-pass/zip-same-length.rs b/src/test/run-pass/zip-same-length.rs
index 5427f548d35..b2ccf093883 100644
--- a/src/test/run-pass/zip-same-length.rs
+++ b/src/test/run-pass/zip-same-length.rs
@@ -9,15 +9,15 @@ import std::vec::*;
 fn main() {
     let a = 'a' as u8, j = 'j' as u8, k = 1u, l = 10u;
     // Silly, but necessary
-    check u8::le(a, j);
-    check uint::le(k, l);
+    check (u8::le(a, j));
+    check (uint::le(k, l));
     let chars = enum_chars(a, j);
-    let ints  = enum_uints(k, l);
+    let ints = enum_uints(k, l);
 
-    check same_length(chars, ints);
+    check (same_length(chars, ints));
     let ps = zip(chars, ints);
 
-    check is_not_empty(ps);
+    check (is_not_empty(ps));
     assert (head(ps) == ('a', 1u));
     assert (last_total(ps) == (j as char, 10u));
 }
diff --git a/src/test/stdtest/comm.rs b/src/test/stdtest/comm.rs
index 1fafd1a0375..9c31c5e6f72 100644
--- a/src/test/stdtest/comm.rs
+++ b/src/test/stdtest/comm.rs
@@ -2,10 +2,7 @@ use std;
 import std::comm;
 
 #[test]
-fn create_port_and_chan() {
-    let p = comm::port::<int>();
-    comm::chan(p);
-}
+fn create_port_and_chan() { let p = comm::port::<int>(); comm::chan(p); }
 
 #[test]
 fn send_recv_fn() {
diff --git a/src/test/stdtest/fs.rs b/src/test/stdtest/fs.rs
index f2e49232800..36e8ae23c5d 100644
--- a/src/test/stdtest/fs.rs
+++ b/src/test/stdtest/fs.rs
@@ -5,28 +5,26 @@ import std::fs;
 #[test]
 fn test_connect() {
     let slash = fs::path_sep();
-    log_err fs::connect(~"a", ~"b");
-    assert (fs::connect(~"a", ~"b") == ~"a" + slash + ~"b");
-    assert (fs::connect(~"a" + slash, ~"b") == ~"a" + slash + ~"b");
+    log_err fs::connect("a", "b");
+    assert (fs::connect("a", "b") == "a" + slash + "b");
+    assert (fs::connect("a" + slash, "b") == "a" + slash + "b");
 }
 
 // Issue #712
 #[test]
-fn test_list_dir_no_invalid_memory_access() { fs::list_dir(~"."); }
+fn test_list_dir_no_invalid_memory_access() { fs::list_dir("."); }
 
 #[test]
 fn list_dir() {
-    let dirs = fs::list_dir(~".");
+    let dirs = fs::list_dir(".");
     // Just assuming that we've got some contents in the current directory
-    assert std::vec::len(dirs) > 0u;
+    assert (std::vec::len(dirs) > 0u);
 
-    for dir in dirs {
-        log dir;
-    }
+    for dir in dirs { log dir; }
 }
 
 #[test]
 fn file_is_dir() {
-    assert fs::file_is_dir(~".");
-    assert !fs::file_is_dir(~"test/stdtest/fs.rs");
-}
\ No newline at end of file
+    assert (fs::file_is_dir("."));
+    assert (!fs::file_is_dir("test/stdtest/fs.rs"));
+}
diff --git a/src/test/stdtest/getopts.rs b/src/test/stdtest/getopts.rs
index 332ec484c95..55d67729129 100644
--- a/src/test/stdtest/getopts.rs
+++ b/src/test/stdtest/getopts.rs
@@ -27,13 +27,13 @@ fn check_fail_type(f: opt::fail_, ft: fail_type) {
 // Tests for reqopt
 #[test]
 fn test_reqopt_long() {
-    let args = [~"--test=20"];
-    let opts = [opt::reqopt(~"test")];
+    let args = ["--test=20"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"test"));
-        assert (opt::opt_str(m, ~"test") == ~"20");
+        assert (opt::opt_present(m, "test"));
+        assert (opt::opt_str(m, "test") == "20");
       }
       _ { fail; }
     }
@@ -41,8 +41,8 @@ fn test_reqopt_long() {
 
 #[test]
 fn test_reqopt_long_missing() {
-    let args = [~"blah"];
-    let opts = [opt::reqopt(~"test")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -52,8 +52,8 @@ fn test_reqopt_long_missing() {
 
 #[test]
 fn test_reqopt_long_no_arg() {
-    let args = [~"--test"];
-    let opts = [opt::reqopt(~"test")];
+    let args = ["--test"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -63,8 +63,8 @@ fn test_reqopt_long_no_arg() {
 
 #[test]
 fn test_reqopt_long_multi() {
-    let args = [~"--test=20", ~"--test=30"];
-    let opts = [opt::reqopt(~"test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::reqopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -74,13 +74,13 @@ fn test_reqopt_long_multi() {
 
 #[test]
 fn test_reqopt_short() {
-    let args = [~"-t", ~"20"];
-    let opts = [opt::reqopt(~"t")];
+    let args = ["-t", "20"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"t"));
-        assert (opt::opt_str(m, ~"t") == ~"20");
+        assert (opt::opt_present(m, "t"));
+        assert (opt::opt_str(m, "t") == "20");
       }
       _ { fail; }
     }
@@ -88,8 +88,8 @@ fn test_reqopt_short() {
 
 #[test]
 fn test_reqopt_short_missing() {
-    let args = [~"blah"];
-    let opts = [opt::reqopt(~"t")];
+    let args = ["blah"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_missing); }
@@ -99,8 +99,8 @@ fn test_reqopt_short_missing() {
 
 #[test]
 fn test_reqopt_short_no_arg() {
-    let args = [~"-t"];
-    let opts = [opt::reqopt(~"t")];
+    let args = ["-t"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -110,8 +110,8 @@ fn test_reqopt_short_no_arg() {
 
 #[test]
 fn test_reqopt_short_multi() {
-    let args = [~"-t", ~"20", ~"-t", ~"30"];
-    let opts = [opt::reqopt(~"t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::reqopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -123,13 +123,13 @@ fn test_reqopt_short_multi() {
 // Tests for optopt
 #[test]
 fn test_optopt_long() {
-    let args = [~"--test=20"];
-    let opts = [opt::optopt(~"test")];
+    let args = ["--test=20"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"test"));
-        assert (opt::opt_str(m, ~"test") == ~"20");
+        assert (opt::opt_present(m, "test"));
+        assert (opt::opt_str(m, "test") == "20");
       }
       _ { fail; }
     }
@@ -137,19 +137,19 @@ fn test_optopt_long() {
 
 #[test]
 fn test_optopt_long_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optopt(~"test")];
+    let args = ["blah"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"test")); }
+      opt::success(m) { assert (!opt::opt_present(m, "test")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optopt_long_no_arg() {
-    let args = [~"--test"];
-    let opts = [opt::optopt(~"test")];
+    let args = ["--test"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -159,8 +159,8 @@ fn test_optopt_long_no_arg() {
 
 #[test]
 fn test_optopt_long_multi() {
-    let args = [~"--test=20", ~"--test=30"];
-    let opts = [opt::optopt(~"test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optopt("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -170,13 +170,13 @@ fn test_optopt_long_multi() {
 
 #[test]
 fn test_optopt_short() {
-    let args = [~"-t", ~"20"];
-    let opts = [opt::optopt(~"t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"t"));
-        assert (opt::opt_str(m, ~"t") == ~"20");
+        assert (opt::opt_present(m, "t"));
+        assert (opt::opt_str(m, "t") == "20");
       }
       _ { fail; }
     }
@@ -184,19 +184,19 @@ fn test_optopt_short() {
 
 #[test]
 fn test_optopt_short_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optopt(~"t")];
+    let args = ["blah"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"t")); }
+      opt::success(m) { assert (!opt::opt_present(m, "t")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optopt_short_no_arg() {
-    let args = [~"-t"];
-    let opts = [opt::optopt(~"t")];
+    let args = ["-t"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -206,8 +206,8 @@ fn test_optopt_short_no_arg() {
 
 #[test]
 fn test_optopt_short_multi() {
-    let args = [~"-t", ~"20", ~"-t", ~"30"];
-    let opts = [opt::optopt(~"t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optopt("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -219,30 +219,30 @@ fn test_optopt_short_multi() {
 // Tests for optflag
 #[test]
 fn test_optflag_long() {
-    let args = [~"--test"];
-    let opts = [opt::optflag(~"test")];
+    let args = ["--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (opt::opt_present(m, ~"test")); }
+      opt::success(m) { assert (opt::opt_present(m, "test")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optflag_long_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optflag(~"test")];
+    let args = ["blah"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"test")); }
+      opt::success(m) { assert (!opt::opt_present(m, "test")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optflag_long_arg() {
-    let args = [~"--test=20"];
-    let opts = [opt::optflag(~"test")];
+    let args = ["--test=20"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) {
@@ -255,8 +255,8 @@ fn test_optflag_long_arg() {
 
 #[test]
 fn test_optflag_long_multi() {
-    let args = [~"--test", ~"--test"];
-    let opts = [opt::optflag(~"test")];
+    let args = ["--test", "--test"];
+    let opts = [opt::optflag("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -266,36 +266,36 @@ fn test_optflag_long_multi() {
 
 #[test]
 fn test_optflag_short() {
-    let args = [~"-t"];
-    let opts = [opt::optflag(~"t")];
+    let args = ["-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (opt::opt_present(m, ~"t")); }
+      opt::success(m) { assert (opt::opt_present(m, "t")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optflag_short_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optflag(~"t")];
+    let args = ["blah"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"t")); }
+      opt::success(m) { assert (!opt::opt_present(m, "t")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optflag_short_arg() {
-    let args = [~"-t", ~"20"];
-    let opts = [opt::optflag(~"t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
         // The next variable after the flag is just a free argument
 
-        assert (m.free[0] == ~"20");
+        assert (m.free[0] == "20");
       }
       _ { fail; }
     }
@@ -303,8 +303,8 @@ fn test_optflag_short_arg() {
 
 #[test]
 fn test_optflag_short_multi() {
-    let args = [~"-t", ~"-t"];
-    let opts = [opt::optflag(~"t")];
+    let args = ["-t", "-t"];
+    let opts = [opt::optflag("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, option_duplicated); }
@@ -316,13 +316,13 @@ fn test_optflag_short_multi() {
 // Tests for optmulti
 #[test]
 fn test_optmulti_long() {
-    let args = [~"--test=20"];
-    let opts = [opt::optmulti(~"test")];
+    let args = ["--test=20"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"test"));
-        assert (opt::opt_str(m, ~"test") == ~"20");
+        assert (opt::opt_present(m, "test"));
+        assert (opt::opt_str(m, "test") == "20");
       }
       _ { fail; }
     }
@@ -330,19 +330,19 @@ fn test_optmulti_long() {
 
 #[test]
 fn test_optmulti_long_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optmulti(~"test")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"test")); }
+      opt::success(m) { assert (!opt::opt_present(m, "test")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optmulti_long_no_arg() {
-    let args = [~"--test"];
-    let opts = [opt::optmulti(~"test")];
+    let args = ["--test"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -352,15 +352,15 @@ fn test_optmulti_long_no_arg() {
 
 #[test]
 fn test_optmulti_long_multi() {
-    let args = [~"--test=20", ~"--test=30"];
-    let opts = [opt::optmulti(~"test")];
+    let args = ["--test=20", "--test=30"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"test"));
-        assert (opt::opt_str(m, ~"test") == ~"20");
-        assert (opt::opt_strs(m, ~"test")[0] == ~"20");
-        assert (opt::opt_strs(m, ~"test")[1] == ~"30");
+        assert (opt::opt_present(m, "test"));
+        assert (opt::opt_str(m, "test") == "20");
+        assert (opt::opt_strs(m, "test")[0] == "20");
+        assert (opt::opt_strs(m, "test")[1] == "30");
       }
       _ { fail; }
     }
@@ -368,13 +368,13 @@ fn test_optmulti_long_multi() {
 
 #[test]
 fn test_optmulti_short() {
-    let args = [~"-t", ~"20"];
-    let opts = [opt::optmulti(~"t")];
+    let args = ["-t", "20"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"t"));
-        assert (opt::opt_str(m, ~"t") == ~"20");
+        assert (opt::opt_present(m, "t"));
+        assert (opt::opt_str(m, "t") == "20");
       }
       _ { fail; }
     }
@@ -382,19 +382,19 @@ fn test_optmulti_short() {
 
 #[test]
 fn test_optmulti_short_missing() {
-    let args = [~"blah"];
-    let opts = [opt::optmulti(~"t")];
+    let args = ["blah"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
-      opt::success(m) { assert (!opt::opt_present(m, ~"t")); }
+      opt::success(m) { assert (!opt::opt_present(m, "t")); }
       _ { fail; }
     }
 }
 
 #[test]
 fn test_optmulti_short_no_arg() {
-    let args = [~"-t"];
-    let opts = [opt::optmulti(~"t")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, argument_missing); }
@@ -404,15 +404,15 @@ fn test_optmulti_short_no_arg() {
 
 #[test]
 fn test_optmulti_short_multi() {
-    let args = [~"-t", ~"20", ~"-t", ~"30"];
-    let opts = [opt::optmulti(~"t")];
+    let args = ["-t", "20", "-t", "30"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (opt::opt_present(m, ~"t"));
-        assert (opt::opt_str(m, ~"t") == ~"20");
-        assert (opt::opt_strs(m, ~"t")[0] == ~"20");
-        assert (opt::opt_strs(m, ~"t")[1] == ~"30");
+        assert (opt::opt_present(m, "t"));
+        assert (opt::opt_str(m, "t") == "20");
+        assert (opt::opt_strs(m, "t")[0] == "20");
+        assert (opt::opt_strs(m, "t")[1] == "30");
       }
       _ { fail; }
     }
@@ -420,8 +420,8 @@ fn test_optmulti_short_multi() {
 
 #[test]
 fn test_unrecognized_option_long() {
-    let args = [~"--untest"];
-    let opts = [opt::optmulti(~"t")];
+    let args = ["--untest"];
+    let opts = [opt::optmulti("t")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -431,8 +431,8 @@ fn test_unrecognized_option_long() {
 
 #[test]
 fn test_unrecognized_option_short() {
-    let args = [~"-t"];
-    let opts = [opt::optmulti(~"test")];
+    let args = ["-t"];
+    let opts = [opt::optmulti("test")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::failure(f) { check_fail_type(f, unrecognized_option); }
@@ -443,25 +443,24 @@ fn test_unrecognized_option_short() {
 #[test]
 fn test_combined() {
     let args =
-        [~"prog", ~"free1", ~"-s", ~"20", ~"free2", ~"--flag",
-         ~"--long=30", ~"-f", ~"-m", ~"40", ~"-m", ~"50"];
+        ["prog", "free1", "-s", "20", "free2", "--flag", "--long=30", "-f",
+         "-m", "40", "-m", "50"];
     let opts =
-        [opt::optopt(~"s"), opt::optflag(~"flag"), opt::reqopt(~"long"),
-         opt::optflag(~"f"), opt::optmulti(~"m"),
-         opt::optopt(~"notpresent")];
+        [opt::optopt("s"), opt::optflag("flag"), opt::reqopt("long"),
+         opt::optflag("f"), opt::optmulti("m"), opt::optopt("notpresent")];
     let rs = opt::getopts(args, opts);
     alt rs {
       opt::success(m) {
-        assert (m.free[0] == ~"prog");
-        assert (m.free[1] == ~"free1");
-        assert (opt::opt_str(m, ~"s") == ~"20");
-        assert (m.free[2] == ~"free2");
-        assert (opt::opt_present(m, ~"flag"));
-        assert (opt::opt_str(m, ~"long") == ~"30");
-        assert (opt::opt_present(m, ~"f"));
-        assert (opt::opt_strs(m, ~"m")[0] == ~"40");
-        assert (opt::opt_strs(m, ~"m")[1] == ~"50");
-        assert (!opt::opt_present(m, ~"notpresent"));
+        assert (m.free[0] == "prog");
+        assert (m.free[1] == "free1");
+        assert (opt::opt_str(m, "s") == "20");
+        assert (m.free[2] == "free2");
+        assert (opt::opt_present(m, "flag"));
+        assert (opt::opt_str(m, "long") == "30");
+        assert (opt::opt_present(m, "f"));
+        assert (opt::opt_strs(m, "m")[0] == "40");
+        assert (opt::opt_strs(m, "m")[1] == "50");
+        assert (!opt::opt_present(m, "notpresent"));
       }
       _ { fail; }
     }
diff --git a/src/test/stdtest/int.rs b/src/test/stdtest/int.rs
index bc13e248d0b..61d3448a175 100644
--- a/src/test/stdtest/int.rs
+++ b/src/test/stdtest/int.rs
@@ -5,11 +5,11 @@ import std::str::eq;
 
 #[test]
 fn test_to_str() {
-    assert (eq(int::to_str(0, 10u), ~"0"));
-    assert (eq(int::to_str(1, 10u), ~"1"));
-    assert (eq(int::to_str(-1, 10u), ~"-1"));
-    assert (eq(int::to_str(255, 16u), ~"ff"));
-    assert (eq(int::to_str(100, 10u), ~"100"));
+    assert (eq(int::to_str(0, 10u), "0"));
+    assert (eq(int::to_str(1, 10u), "1"));
+    assert (eq(int::to_str(-1, 10u), "-1"));
+    assert (eq(int::to_str(255, 16u), "ff"));
+    assert (eq(int::to_str(100, 10u), "100"));
 }
 
 #[test]
diff --git a/src/test/stdtest/io.rs b/src/test/stdtest/io.rs
index a66b3bab464..08330c619fc 100644
--- a/src/test/stdtest/io.rs
+++ b/src/test/stdtest/io.rs
@@ -7,9 +7,9 @@ import std::str;
 #[cfg(target_os = "win32")]
 #[test]
 fn test_simple() {
-    let tmpfile: istr = ~"test/run-pass/lib-io-test-simple.tmp";
+    let tmpfile: str = "test/run-pass/lib-io-test-simple.tmp";
     log tmpfile;
-    let frood: istr = ~"A hoopy frood who really knows where his towel is.";
+    let frood: str = "A hoopy frood who really knows where his towel is.";
     log frood;
     {
         let out: io::writer =
@@ -17,7 +17,7 @@ fn test_simple() {
         out.write_str(frood);
     }
     let inp: io::reader = io::file_reader(tmpfile);
-    let frood2: istr = inp.read_c_str();
+    let frood2: str = inp.read_c_str();
     log frood2;
     assert (str::eq(frood, frood2));
 }
diff --git a/src/test/stdtest/map.rs b/src/test/stdtest/map.rs
index 585bae03cc9..67240a7c69b 100644
--- a/src/test/stdtest/map.rs
+++ b/src/test/stdtest/map.rs
@@ -14,8 +14,8 @@ fn test_simple() {
     fn eq_uint(x: &uint, y: &uint) -> bool { ret x == y; }
     let hasher_uint: map::hashfn<uint> = util::id;
     let eqer_uint: map::eqfn<uint> = eq_uint;
-    let hasher_str: map::hashfn<istr> = str::hash;
-    let eqer_str: map::eqfn<istr> = str::eq;
+    let hasher_str: map::hashfn<str> = str::hash;
+    let eqer_str: map::eqfn<str> = str::eq;
     log "uint -> uint";
     let hm_uu: map::hashmap<uint, uint> =
         map::mk_hashmap::<uint, uint>(hasher_uint, eqer_uint);
@@ -29,49 +29,49 @@ fn test_simple() {
     assert (hm_uu.get(12u) == 14u);
     assert (!hm_uu.insert(12u, 12u));
     assert (hm_uu.get(12u) == 12u);
-    let ten: istr = ~"ten";
-    let eleven: istr = ~"eleven";
-    let twelve: istr = ~"twelve";
+    let ten: str = "ten";
+    let eleven: str = "eleven";
+    let twelve: str = "twelve";
     log "str -> uint";
-    let hm_su: map::hashmap<istr, uint> =
-        map::mk_hashmap::<istr, uint>(hasher_str, eqer_str);
-    assert (hm_su.insert(~"ten", 12u));
+    let hm_su: map::hashmap<str, uint> =
+        map::mk_hashmap::<str, uint>(hasher_str, eqer_str);
+    assert (hm_su.insert("ten", 12u));
     assert (hm_su.insert(eleven, 13u));
-    assert (hm_su.insert(~"twelve", 14u));
+    assert (hm_su.insert("twelve", 14u));
     assert (hm_su.get(eleven) == 13u);
-    assert (hm_su.get(~"eleven") == 13u);
-    assert (hm_su.get(~"twelve") == 14u);
-    assert (hm_su.get(~"ten") == 12u);
-    assert (!hm_su.insert(~"twelve", 14u));
-    assert (hm_su.get(~"twelve") == 14u);
-    assert (!hm_su.insert(~"twelve", 12u));
-    assert (hm_su.get(~"twelve") == 12u);
+    assert (hm_su.get("eleven") == 13u);
+    assert (hm_su.get("twelve") == 14u);
+    assert (hm_su.get("ten") == 12u);
+    assert (!hm_su.insert("twelve", 14u));
+    assert (hm_su.get("twelve") == 14u);
+    assert (!hm_su.insert("twelve", 12u));
+    assert (hm_su.get("twelve") == 12u);
     log "uint -> str";
-    let hm_us: map::hashmap<uint, istr> =
-        map::mk_hashmap::<uint, istr>(hasher_uint, eqer_uint);
-    assert (hm_us.insert(10u, ~"twelve"));
-    assert (hm_us.insert(11u, ~"thirteen"));
-    assert (hm_us.insert(12u, ~"fourteen"));
-    assert (str::eq(hm_us.get(11u), ~"thirteen"));
-    assert (str::eq(hm_us.get(12u), ~"fourteen"));
-    assert (str::eq(hm_us.get(10u), ~"twelve"));
-    assert (!hm_us.insert(12u, ~"fourteen"));
-    assert (str::eq(hm_us.get(12u), ~"fourteen"));
-    assert (!hm_us.insert(12u, ~"twelve"));
-    assert (str::eq(hm_us.get(12u), ~"twelve"));
+    let hm_us: map::hashmap<uint, str> =
+        map::mk_hashmap::<uint, str>(hasher_uint, eqer_uint);
+    assert (hm_us.insert(10u, "twelve"));
+    assert (hm_us.insert(11u, "thirteen"));
+    assert (hm_us.insert(12u, "fourteen"));
+    assert (str::eq(hm_us.get(11u), "thirteen"));
+    assert (str::eq(hm_us.get(12u), "fourteen"));
+    assert (str::eq(hm_us.get(10u), "twelve"));
+    assert (!hm_us.insert(12u, "fourteen"));
+    assert (str::eq(hm_us.get(12u), "fourteen"));
+    assert (!hm_us.insert(12u, "twelve"));
+    assert (str::eq(hm_us.get(12u), "twelve"));
     log "str -> str";
-    let hm_ss: map::hashmap<istr, istr> =
-        map::mk_hashmap::<istr, istr>(hasher_str, eqer_str);
-    assert (hm_ss.insert(ten, ~"twelve"));
-    assert (hm_ss.insert(eleven, ~"thirteen"));
-    assert (hm_ss.insert(twelve, ~"fourteen"));
-    assert (str::eq(hm_ss.get(~"eleven"), ~"thirteen"));
-    assert (str::eq(hm_ss.get(~"twelve"), ~"fourteen"));
-    assert (str::eq(hm_ss.get(~"ten"), ~"twelve"));
-    assert (!hm_ss.insert(~"twelve", ~"fourteen"));
-    assert (str::eq(hm_ss.get(~"twelve"), ~"fourteen"));
-    assert (!hm_ss.insert(~"twelve", ~"twelve"));
-    assert (str::eq(hm_ss.get(~"twelve"), ~"twelve"));
+    let hm_ss: map::hashmap<str, str> =
+        map::mk_hashmap::<str, str>(hasher_str, eqer_str);
+    assert (hm_ss.insert(ten, "twelve"));
+    assert (hm_ss.insert(eleven, "thirteen"));
+    assert (hm_ss.insert(twelve, "fourteen"));
+    assert (str::eq(hm_ss.get("eleven"), "thirteen"));
+    assert (str::eq(hm_ss.get("twelve"), "fourteen"));
+    assert (str::eq(hm_ss.get("ten"), "twelve"));
+    assert (!hm_ss.insert("twelve", "fourteen"));
+    assert (str::eq(hm_ss.get("twelve"), "fourteen"));
+    assert (!hm_ss.insert("twelve", "twelve"));
+    assert (str::eq(hm_ss.get("twelve"), "twelve"));
     log "*** finished test_simple";
 }
 
@@ -92,14 +92,14 @@ fn test_growth() {
     let i: uint = 0u;
     while i < num_to_insert {
         assert (hm_uu.insert(i, i * i));
-        log ~"inserting " + uint::to_str(i, 10u) + ~" -> " +
+        log "inserting " + uint::to_str(i, 10u) + " -> " +
                 uint::to_str(i * i, 10u);
         i += 1u;
     }
     log "-----";
     i = 0u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm_uu.get(i), 10u);
         assert (hm_uu.get(i) == i * i);
         i += 1u;
@@ -110,44 +110,42 @@ fn test_growth() {
     hm_uu.rehash();
     i = 0u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm_uu.get(i), 10u);
         assert (hm_uu.get(i) == i * i);
         i += 1u;
     }
     log "str -> str";
-    let hasher_str: map::hashfn<istr> = str::hash;
-    let eqer_str: map::eqfn<istr> = str::eq;
-    let hm_ss: map::hashmap<istr, istr> =
-        map::mk_hashmap::<istr, istr>(hasher_str, eqer_str);
+    let hasher_str: map::hashfn<str> = str::hash;
+    let eqer_str: map::eqfn<str> = str::eq;
+    let hm_ss: map::hashmap<str, str> =
+        map::mk_hashmap::<str, str>(hasher_str, eqer_str);
     i = 0u;
     while i < num_to_insert {
-        assert (hm_ss.insert(uint::to_str(i, 2u),
-                             uint::to_str(i * i, 2u)));
-        log ~"inserting \"" + uint::to_str(i, 2u) + ~"\" -> \"" +
-                uint::to_str(i * i, 2u) + ~"\"";
+        assert (hm_ss.insert(uint::to_str(i, 2u), uint::to_str(i * i, 2u)));
+        log "inserting \"" + uint::to_str(i, 2u) + "\" -> \"" +
+                uint::to_str(i * i, 2u) + "\"";
         i += 1u;
     }
     log "-----";
     i = 0u;
     while i < num_to_insert {
-        log ~"get(\"" + uint::to_str(i, 2u) + ~"\") = \"" +
-                hm_ss.get(uint::to_str(i, 2u)) + ~"\"";
+        log "get(\"" + uint::to_str(i, 2u) + "\") = \"" +
+                hm_ss.get(uint::to_str(i, 2u)) + "\"";
         assert (str::eq(hm_ss.get(uint::to_str(i, 2u)),
                         uint::to_str(i * i, 2u)));
         i += 1u;
     }
     assert (hm_ss.insert(uint::to_str(num_to_insert, 2u),
                          uint::to_str(17u, 2u)));
-    assert (str::eq(hm_ss.get(
-        uint::to_str(num_to_insert, 2u)),
+    assert (str::eq(hm_ss.get(uint::to_str(num_to_insert, 2u)),
                     uint::to_str(17u, 2u)));
     log "-----";
     hm_ss.rehash();
     i = 0u;
     while i < num_to_insert {
-        log ~"get(\"" + uint::to_str(i, 2u) + ~"\") = \"" +
-                hm_ss.get(uint::to_str(i, 2u)) + ~"\"";
+        log "get(\"" + uint::to_str(i, 2u) + "\") = \"" +
+                hm_ss.get(uint::to_str(i, 2u)) + "\"";
         assert (str::eq(hm_ss.get(uint::to_str(i, 2u)),
                         uint::to_str(i * i, 2u)));
         i += 1u;
@@ -176,7 +174,7 @@ fn test_removal() {
     let i: uint = 0u;
     while i < num_to_insert {
         assert (hm.insert(i, i * i));
-        log ~"inserting " + uint::to_str(i, 10u) + ~" -> " +
+        log "inserting " + uint::to_str(i, 10u) + " -> " +
                 uint::to_str(i * i, 10u);
         i += 1u;
     }
@@ -186,10 +184,8 @@ fn test_removal() {
     i = 0u;
     while i < num_to_insert {
         let v = hm.remove(i);
-        alt (v) {
-          option::some(u) {
-            assert (u == (i * i));
-          }
+        alt v {
+          option::some(u) { assert (u == i * i); }
           option::none. { fail; }
         }
         i += 2u;
@@ -198,7 +194,7 @@ fn test_removal() {
     log "-----";
     i = 1u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm.get(i), 10u);
         assert (hm.get(i) == i * i);
         i += 2u;
@@ -209,7 +205,7 @@ fn test_removal() {
     log "-----";
     i = 1u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm.get(i), 10u);
         assert (hm.get(i) == i * i);
         i += 2u;
@@ -218,7 +214,7 @@ fn test_removal() {
     i = 0u;
     while i < num_to_insert {
         assert (hm.insert(i, i * i));
-        log ~"inserting " + uint::to_str(i, 10u) + ~" -> " +
+        log "inserting " + uint::to_str(i, 10u) + " -> " +
                 uint::to_str(i * i, 10u);
         i += 2u;
     }
@@ -226,7 +222,7 @@ fn test_removal() {
     log "-----";
     i = 0u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm.get(i), 10u);
         assert (hm.get(i) == i * i);
         i += 1u;
@@ -238,7 +234,7 @@ fn test_removal() {
     assert (hm.size() == num_to_insert);
     i = 0u;
     while i < num_to_insert {
-        log ~"get(" + uint::to_str(i, 10u) + ~") = " +
+        log "get(" + uint::to_str(i, 10u) + ") = " +
                 uint::to_str(hm.get(i), 10u);
         assert (hm.get(i) == i * i);
         i += 1u;
@@ -248,18 +244,18 @@ fn test_removal() {
 
 #[test]
 fn test_contains_key() {
-    let key = ~"k";
-    let map = map::mk_hashmap::<istr, istr>(str::hash, str::eq);
+    let key = "k";
+    let map = map::mk_hashmap::<str, str>(str::hash, str::eq);
     assert (!map.contains_key(key));
-    map.insert(key, ~"val");
+    map.insert(key, "val");
     assert (map.contains_key(key));
 }
 
 #[test]
 fn test_find() {
-    let key = ~"k";
-    let map = map::mk_hashmap::<istr, istr>(str::hash, str::eq);
+    let key = "k";
+    let map = map::mk_hashmap::<str, str>(str::hash, str::eq);
     assert (std::option::is_none(map.find(key)));
-    map.insert(key, ~"val");
-    assert (std::option::get(map.find(key)) == ~"val");
+    map.insert(key, "val");
+    assert (std::option::get(map.find(key)) == "val");
 }
diff --git a/src/test/stdtest/net.rs b/src/test/stdtest/net.rs
index d2f185a4fde..9da7a12a060 100644
--- a/src/test/stdtest/net.rs
+++ b/src/test/stdtest/net.rs
@@ -3,12 +3,10 @@ import std::net;
 
 #[test]
 fn test_format_ip() {
-    assert (net::format_addr(net::ipv4(
-        127u8, 0u8, 0u8, 1u8)) == ~"127.0.0.1")
+    assert (net::format_addr(net::ipv4(127u8, 0u8, 0u8, 1u8)) == "127.0.0.1")
 }
 
 #[test]
 fn test_parse_ip() {
-    assert (net::parse_addr(~"127.0.0.1")
-            == net::ipv4(127u8, 0u8, 0u8, 1u8));
+    assert (net::parse_addr("127.0.0.1") == net::ipv4(127u8, 0u8, 0u8, 1u8));
 }
diff --git a/src/test/stdtest/os.rs b/src/test/stdtest/os.rs
index fc508595329..49ebb217dbf 100644
--- a/src/test/stdtest/os.rs
+++ b/src/test/stdtest/os.rs
@@ -6,26 +6,26 @@ import std::option;
 fn test_setenv() {
     // NB: Each test of setenv needs to use different variable names or the
     // tests will not be threadsafe
-    setenv(~"NAME1", ~"VALUE");
-    assert (getenv(~"NAME1") == option::some(~"VALUE"));
+    setenv("NAME1", "VALUE");
+    assert (getenv("NAME1") == option::some("VALUE"));
 }
 
 #[test]
 fn test_setenv_overwrite() {
-    setenv(~"NAME2", ~"1");
-    setenv(~"NAME2", ~"2");
-    assert (getenv(~"NAME2") == option::some(~"2"));
+    setenv("NAME2", "1");
+    setenv("NAME2", "2");
+    assert (getenv("NAME2") == option::some("2"));
 }
 
 // Windows GetEnvironmentVariable requires some extra work to make sure
 // the buffer the variable is copied into is the right size
 #[test]
 fn test_getenv_big() {
-    let s = ~"";
+    let s = "";
     let i = 0;
-    while i < 100 { s += ~"aaaaaaaaaa"; i += 1; }
-    setenv(~"NAME3", s);
-    assert (getenv(~"NAME3") == option::some(s));
+    while i < 100 { s += "aaaaaaaaaa"; i += 1; }
+    setenv("NAME3", s);
+    assert (getenv("NAME3") == option::some(s));
 }
 
 // Local Variables:
diff --git a/src/test/stdtest/path.rs b/src/test/stdtest/path.rs
index 82fe54413d9..911bc6b0dd9 100644
--- a/src/test/stdtest/path.rs
+++ b/src/test/stdtest/path.rs
@@ -8,10 +8,10 @@ import std::os;
 
 #[test]
 fn test() {
-    assert (!fs::path_is_absolute(~"test-path"));
+    assert (!fs::path_is_absolute("test-path"));
 
-    log ~"Current working directory: " + os::getcwd();
+    log "Current working directory: " + os::getcwd();
 
-    log fs::make_absolute(~"test-path");
-    log fs::make_absolute(~"/usr/bin");
+    log fs::make_absolute("test-path");
+    log fs::make_absolute("/usr/bin");
 }
diff --git a/src/test/stdtest/qsort.rs b/src/test/stdtest/qsort.rs
index 32109dc1caa..609adf3afe4 100644
--- a/src/test/stdtest/qsort.rs
+++ b/src/test/stdtest/qsort.rs
@@ -51,8 +51,8 @@ fn test_simple() {
 
     let immut_names = vec::from_mut(names);
 
- // Silly, but what else can we do?
-    check vec::same_length(expected, immut_names);
+    // Silly, but what else can we do?
+    check (vec::same_length(expected, immut_names));
     let pairs = vec::zip(expected, immut_names);
     for (a, b) in pairs { log #fmt["%d %d", a, b]; assert (a == b); }
 }
diff --git a/src/test/stdtest/run.rs b/src/test/stdtest/run.rs
index 5c62ed3eb0e..b60a3935500 100644
--- a/src/test/stdtest/run.rs
+++ b/src/test/stdtest/run.rs
@@ -11,9 +11,9 @@ import std::vec;
 #[cfg(target_os = "macos")]
 #[test]
 fn test_leaks() {
-    run::run_program(~"echo", []);
-    run::start_program(~"echo", []);
-    run::program_output(~"echo", []);
+    run::run_program("echo", []);
+    run::start_program("echo", []);
+    run::program_output("echo", []);
 }
 
 // FIXME
@@ -29,14 +29,13 @@ fn test_pipes() {
     let pipe_err = os::pipe();
 
     let pid =
-        run::spawn_process(~"cat", [],
-                           pipe_in.in, pipe_out.out, pipe_err.out);
+        run::spawn_process("cat", [], pipe_in.in, pipe_out.out, pipe_err.out);
     os::libc::close(pipe_in.in);
     os::libc::close(pipe_out.out);
     os::libc::close(pipe_err.out);
 
     if pid == -1 { fail; }
-    let expected = ~"test";
+    let expected = "test";
     writeclose(pipe_in.out, expected);
     let actual = readclose(pipe_out.in);
     readclose(pipe_err.in);
@@ -46,18 +45,18 @@ fn test_pipes() {
     log actual;
     assert (expected == actual);
 
-    fn writeclose(fd: int, s: &istr) {
+    fn writeclose(fd: int, s: &str) {
         let writer = io::new_writer(io::fd_buf_writer(fd, option::none));
         writer.write_str(s);
 
         os::libc::close(fd);
     }
 
-    fn readclose(fd: int) -> istr {
+    fn readclose(fd: int) -> str {
         // Copied from run::program_output
         let file = os::fd_FILE(fd);
         let reader = io::new_reader(io::FILE_buf_reader(file, option::none));
-        let buf = ~"";
+        let buf = "";
         while !reader.eof() {
             let bytes = reader.read_bytes(4096u);
             buf += str::unsafe_from_bytes(bytes);
diff --git a/src/test/stdtest/sha1.rs b/src/test/stdtest/sha1.rs
index a66b898ddfa..6b72be20dd5 100644
--- a/src/test/stdtest/sha1.rs
+++ b/src/test/stdtest/sha1.rs
@@ -9,24 +9,24 @@ import std::str;
 
 #[test]
 fn test() {
-    type test = {input: istr, output: [u8]};
+    type test = {input: str, output: [u8]};
 
-    fn a_million_letter_a() -> istr {
+    fn a_million_letter_a() -> str {
         let i = 0;
-        let rs = ~"";
-        while i < 100000 { rs += ~"aaaaaaaaaa"; i += 1; }
+        let rs = "";
+        while i < 100000 { rs += "aaaaaaaaaa"; i += 1; }
         ret rs;
     }
     // Test messages from FIPS 180-1
 
     let fips_180_1_tests: [test] =
-        [{input: ~"abc",
+        [{input: "abc",
           output:
               [0xA9u8, 0x99u8, 0x3Eu8, 0x36u8, 0x47u8, 0x06u8, 0x81u8, 0x6Au8,
                0xBAu8, 0x3Eu8, 0x25u8, 0x71u8, 0x78u8, 0x50u8, 0xC2u8, 0x6Cu8,
                0x9Cu8, 0xD0u8, 0xD8u8, 0x9Du8]},
-         {input: ~"abcdbcdecdefdefgefghfghighij"
-             + ~"hijkijkljklmklmnlmnomnopnopq",
+         {input:
+              "abcdbcdecdefdefgefghfghighij" + "hijkijkljklmklmnlmnomnopnopq",
           output:
               [0x84u8, 0x98u8, 0x3Eu8, 0x44u8, 0x1Cu8, 0x3Bu8, 0xD2u8, 0x6Eu8,
                0xBAu8, 0xAEu8, 0x4Au8, 0xA1u8, 0xF9u8, 0x51u8, 0x29u8, 0xE5u8,
@@ -39,12 +39,12 @@ fn test() {
     // Examples from wikipedia
 
     let wikipedia_tests: [test] =
-        [{input: ~"The quick brown fox jumps over the lazy dog",
+        [{input: "The quick brown fox jumps over the lazy dog",
           output:
               [0x2fu8, 0xd4u8, 0xe1u8, 0xc6u8, 0x7au8, 0x2du8, 0x28u8, 0xfcu8,
                0xedu8, 0x84u8, 0x9eu8, 0xe1u8, 0xbbu8, 0x76u8, 0xe7u8, 0x39u8,
                0x1bu8, 0x93u8, 0xebu8, 0x12u8]},
-         {input: ~"The quick brown fox jumps over the lazy cog",
+         {input: "The quick brown fox jumps over the lazy cog",
           output:
               [0xdeu8, 0x9fu8, 0x2cu8, 0x7fu8, 0xd2u8, 0x5eu8, 0x1bu8, 0x3au8,
                0xfau8, 0xd3u8, 0xe8u8, 0x5au8, 0x0bu8, 0xd1u8, 0x7du8, 0x9bu8,
diff --git a/src/test/stdtest/str.rs b/src/test/stdtest/str.rs
index a559b61d3f2..2852822f8d4 100644
--- a/src/test/stdtest/str.rs
+++ b/src/test/stdtest/str.rs
@@ -3,105 +3,103 @@ import std::vec;
 
 #[test]
 fn test_eq() {
-    assert str::eq(~"", ~"");
-    assert str::eq(~"foo", ~"foo");
-    assert !str::eq(~"foo", ~"bar");
+    assert (str::eq("", ""));
+    assert (str::eq("foo", "foo"));
+    assert (!str::eq("foo", "bar"));
 }
 
 #[test]
 fn test_lteq() {
-    assert str::lteq(~"", ~"");
-    assert str::lteq(~"", ~"foo");
-    assert str::lteq(~"foo", ~"foo");
-    assert !str::eq(~"foo", ~"bar");
+    assert (str::lteq("", ""));
+    assert (str::lteq("", "foo"));
+    assert (str::lteq("foo", "foo"));
+    assert (!str::eq("foo", "bar"));
 }
 
 #[test]
 fn test_bytes_len() {
-    assert (str::byte_len(~"") == 0u);
-    assert (str::byte_len(~"hello world") == 11u);
-    assert (str::byte_len(~"\x63") == 1u);
-    assert (str::byte_len(~"\xa2") == 2u);
-    assert (str::byte_len(~"\u03c0") == 2u);
-    assert (str::byte_len(~"\u2620") == 3u);
-    assert (str::byte_len(~"\U0001d11e") == 4u);
+    assert (str::byte_len("") == 0u);
+    assert (str::byte_len("hello world") == 11u);
+    assert (str::byte_len("\x63") == 1u);
+    assert (str::byte_len("\xa2") == 2u);
+    assert (str::byte_len("\u03c0") == 2u);
+    assert (str::byte_len("\u2620") == 3u);
+    assert (str::byte_len("\U0001d11e") == 4u);
 }
 
 #[test]
 fn test_index_and_rindex() {
-    assert (str::index(~"hello", 'e' as u8) == 1);
-    assert (str::index(~"hello", 'o' as u8) == 4);
-    assert (str::index(~"hello", 'z' as u8) == -1);
-    assert (str::rindex(~"hello", 'l' as u8) == 3);
-    assert (str::rindex(~"hello", 'h' as u8) == 0);
-    assert (str::rindex(~"hello", 'z' as u8) == -1);
+    assert (str::index("hello", 'e' as u8) == 1);
+    assert (str::index("hello", 'o' as u8) == 4);
+    assert (str::index("hello", 'z' as u8) == -1);
+    assert (str::rindex("hello", 'l' as u8) == 3);
+    assert (str::rindex("hello", 'h' as u8) == 0);
+    assert (str::rindex("hello", 'z' as u8) == -1);
 }
 
 #[test]
 fn test_split() {
-    fn t(s: &istr, c: char, i: int, k: &istr) {
-        log ~"splitting: " + s;
+    fn t(s: &str, c: char, i: int, k: &str) {
+        log "splitting: " + s;
         log i;
         let v = str::split(s, c as u8);
-        log ~"split to: ";
-        for z: istr in v { log z; }
-        log ~"comparing: " + v[i] + ~" vs. " + k;
+        log "split to: ";
+        for z: str in v { log z; }
+        log "comparing: " + v[i] + " vs. " + k;
         assert (str::eq(v[i], k));
     }
-    t(~"abc.hello.there", '.', 0, ~"abc");
-    t(~"abc.hello.there", '.', 1, ~"hello");
-    t(~"abc.hello.there", '.', 2, ~"there");
-    t(~".hello.there", '.', 0, ~"");
-    t(~".hello.there", '.', 1, ~"hello");
-    t(~"...hello.there.", '.', 3, ~"hello");
-    t(~"...hello.there.", '.', 5, ~"");
+    t("abc.hello.there", '.', 0, "abc");
+    t("abc.hello.there", '.', 1, "hello");
+    t("abc.hello.there", '.', 2, "there");
+    t(".hello.there", '.', 0, "");
+    t(".hello.there", '.', 1, "hello");
+    t("...hello.there.", '.', 3, "hello");
+    t("...hello.there.", '.', 5, "");
 }
 
 #[test]
 fn test_find() {
-    fn t(haystack: &istr, needle: &istr, i: int) {
+    fn t(haystack: &str, needle: &str, i: int) {
         let j: int = str::find(haystack, needle);
-        log ~"searched for " + needle;
+        log "searched for " + needle;
         log j;
         assert (i == j);
     }
-    t(~"this is a simple", ~"is a", 5);
-    t(~"this is a simple", ~"is z", -1);
-    t(~"this is a simple", ~"", 0);
-    t(~"this is a simple", ~"simple", 10);
-    t(~"this", ~"simple", -1);
+    t("this is a simple", "is a", 5);
+    t("this is a simple", "is z", -1);
+    t("this is a simple", "", 0);
+    t("this is a simple", "simple", 10);
+    t("this", "simple", -1);
 }
 
 #[test]
 fn test_substr() {
-    fn t(a: &istr, b: &istr, start: int) {
-        assert (str::eq(str::substr(a, start as uint,
-                                      str::byte_len(b)), b));
+    fn t(a: &str, b: &str, start: int) {
+        assert (str::eq(str::substr(a, start as uint, str::byte_len(b)), b));
     }
-    t(~"hello", ~"llo", 2);
-    t(~"hello", ~"el", 1);
-    t(~"substr should not be a challenge", ~"not", 14);
+    t("hello", "llo", 2);
+    t("hello", "el", 1);
+    t("substr should not be a challenge", "not", 14);
 }
 
 #[test]
 fn test_concat() {
-    fn t(v: &[istr], s: &istr) { assert (str::eq(str::concat(v), s)); }
-    t([~"you", ~"know", ~"I'm", ~"no", ~"good"], ~"youknowI'mnogood");
-    let v: [istr] = [];
-    t(v, ~"");
-    t([~"hi"], ~"hi");
+    fn t(v: &[str], s: &str) { assert (str::eq(str::concat(v), s)); }
+    t(["you", "know", "I'm", "no", "good"], "youknowI'mnogood");
+    let v: [str] = [];
+    t(v, "");
+    t(["hi"], "hi");
 }
 
 #[test]
 fn test_connect() {
-    fn t(v: &[istr], sep: &istr, s: &istr) {
+    fn t(v: &[str], sep: &str, s: &str) {
         assert (str::eq(str::connect(v, sep), s));
     }
-    t([~"you", ~"know", ~"I'm", ~"no", ~"good"], ~" ",
-      ~"you know I'm no good");
-    let v: [istr] = [];
-    t(v, ~" ", ~"");
-    t([~"hi"], ~" ", ~"hi");
+    t(["you", "know", "I'm", "no", "good"], " ", "you know I'm no good");
+    let v: [str] = [];
+    t(v, " ", "");
+    t(["hi"], " ", "hi");
 }
 
 #[test]
@@ -109,28 +107,28 @@ fn test_to_upper() {
     // to_upper doesn't understand unicode yet,
     // but we need to at least preserve it
 
-    let unicode = ~"\u65e5\u672c";
-    let input = ~"abcDEF" + unicode + ~"xyz:.;";
-    let expected = ~"ABCDEF" + unicode + ~"XYZ:.;";
+    let unicode = "\u65e5\u672c";
+    let input = "abcDEF" + unicode + "xyz:.;";
+    let expected = "ABCDEF" + unicode + "XYZ:.;";
     let actual = str::to_upper(input);
     assert (str::eq(expected, actual));
 }
 
 #[test]
 fn test_slice() {
-    assert (str::eq(~"ab", str::slice(~"abc", 0u, 2u)));
-    assert (str::eq(~"bc", str::slice(~"abc", 1u, 3u)));
-    assert (str::eq(~"", str::slice(~"abc", 1u, 1u)));
-    fn a_million_letter_a() -> istr {
+    assert (str::eq("ab", str::slice("abc", 0u, 2u)));
+    assert (str::eq("bc", str::slice("abc", 1u, 3u)));
+    assert (str::eq("", str::slice("abc", 1u, 1u)));
+    fn a_million_letter_a() -> str {
         let i = 0;
-        let rs = ~"";
-        while i < 100000 { rs += ~"aaaaaaaaaa"; i += 1; }
+        let rs = "";
+        while i < 100000 { rs += "aaaaaaaaaa"; i += 1; }
         ret rs;
     }
-    fn half_a_million_letter_a() -> istr {
+    fn half_a_million_letter_a() -> str {
         let i = 0;
-        let rs = ~"";
-        while i < 100000 { rs += ~"aaaaa"; i += 1; }
+        let rs = "";
+        while i < 100000 { rs += "aaaaa"; i += 1; }
         ret rs;
     }
     assert (str::eq(half_a_million_letter_a(),
@@ -139,123 +137,122 @@ fn test_slice() {
 
 #[test]
 fn test_starts_with() {
-    assert (str::starts_with(~"", ~""));
-    assert (str::starts_with(~"abc", ~""));
-    assert (str::starts_with(~"abc", ~"a"));
-    assert (!str::starts_with(~"a", ~"abc"));
-    assert (!str::starts_with(~"", ~"abc"));
+    assert (str::starts_with("", ""));
+    assert (str::starts_with("abc", ""));
+    assert (str::starts_with("abc", "a"));
+    assert (!str::starts_with("a", "abc"));
+    assert (!str::starts_with("", "abc"));
 }
 
 #[test]
 fn test_ends_with() {
-    assert (str::ends_with(~"", ~""));
-    assert (str::ends_with(~"abc", ~""));
-    assert (str::ends_with(~"abc", ~"c"));
-    assert (!str::ends_with(~"a", ~"abc"));
-    assert (!str::ends_with(~"", ~"abc"));
+    assert (str::ends_with("", ""));
+    assert (str::ends_with("abc", ""));
+    assert (str::ends_with("abc", "c"));
+    assert (!str::ends_with("a", "abc"));
+    assert (!str::ends_with("", "abc"));
 }
 
 #[test]
 fn test_is_empty() {
-    assert (str::is_empty(~""));
-    assert (!str::is_empty(~"a"));
+    assert (str::is_empty(""));
+    assert (!str::is_empty("a"));
 }
 
 #[test]
 fn test_is_not_empty() {
-    assert (str::is_not_empty(~"a"));
-    assert (!str::is_not_empty(~""));
+    assert (str::is_not_empty("a"));
+    assert (!str::is_not_empty(""));
 }
 
 #[test]
 fn test_replace() {
-    let a = ~"a";
+    let a = "a";
     check (str::is_not_empty(a));
-    assert (str::replace(~"", a, ~"b") == ~"");
-    assert (str::replace(~"a", a, ~"b") == ~"b");
-    assert (str::replace(~"ab", a, ~"b") == ~"bb");
-    let test = ~"test";
+    assert (str::replace("", a, "b") == "");
+    assert (str::replace("a", a, "b") == "b");
+    assert (str::replace("ab", a, "b") == "bb");
+    let test = "test";
     check (str::is_not_empty(test));
-    assert (str::replace(~" test test ", test, ~"toast")
-            == ~" toast toast ");
-    assert (str::replace(~" test test ", test, ~"") == ~"   ");
+    assert (str::replace(" test test ", test, "toast") == " toast toast ");
+    assert (str::replace(" test test ", test, "") == "   ");
 }
 
 #[test]
 fn test_char_slice() {
-    assert (str::eq(~"ab", str::char_slice(~"abc", 0u, 2u)));
-    assert (str::eq(~"bc", str::char_slice(~"abc", 1u, 3u)));
-    assert (str::eq(~"", str::char_slice(~"abc", 1u, 1u)));
-    assert (str::eq(~"\u65e5", str::char_slice(~"\u65e5\u672c", 0u, 1u)));
+    assert (str::eq("ab", str::char_slice("abc", 0u, 2u)));
+    assert (str::eq("bc", str::char_slice("abc", 1u, 3u)));
+    assert (str::eq("", str::char_slice("abc", 1u, 1u)));
+    assert (str::eq("\u65e5", str::char_slice("\u65e5\u672c", 0u, 1u)));
 }
 
 #[test]
 fn trim_left() {
-    assert (str::trim_left(~"") == ~"");
-    assert (str::trim_left(~"a") == ~"a");
-    assert (str::trim_left(~"    ") == ~"");
-    assert (str::trim_left(~"     blah") == ~"blah");
-    assert (str::trim_left(~"   \u3000  wut") == ~"wut");
-    assert (str::trim_left(~"hey ") == ~"hey ");
+    assert (str::trim_left("") == "");
+    assert (str::trim_left("a") == "a");
+    assert (str::trim_left("    ") == "");
+    assert (str::trim_left("     blah") == "blah");
+    assert (str::trim_left("   \u3000  wut") == "wut");
+    assert (str::trim_left("hey ") == "hey ");
 }
 
 #[test]
 fn trim_right() {
-    assert (str::trim_right(~"") == ~"");
-    assert (str::trim_right(~"a") == ~"a");
-    assert (str::trim_right(~"    ") == ~"");
-    assert (str::trim_right(~"blah     ") == ~"blah");
-    assert (str::trim_right(~"wut   \u3000  ") == ~"wut");
-    assert (str::trim_right(~" hey") == ~" hey");
+    assert (str::trim_right("") == "");
+    assert (str::trim_right("a") == "a");
+    assert (str::trim_right("    ") == "");
+    assert (str::trim_right("blah     ") == "blah");
+    assert (str::trim_right("wut   \u3000  ") == "wut");
+    assert (str::trim_right(" hey") == " hey");
 }
 
 #[test]
 fn trim() {
-    assert (str::trim(~"") == ~"");
-    assert (str::trim(~"a") == ~"a");
-    assert (str::trim(~"    ") == ~"");
-    assert (str::trim(~"    blah     ") == ~"blah");
-    assert (str::trim(~"\nwut   \u3000  ") == ~"wut");
-    assert (str::trim(~" hey dude ") == ~"hey dude");
+    assert (str::trim("") == "");
+    assert (str::trim("a") == "a");
+    assert (str::trim("    ") == "");
+    assert (str::trim("    blah     ") == "blah");
+    assert (str::trim("\nwut   \u3000  ") == "wut");
+    assert (str::trim(" hey dude ") == "hey dude");
 }
 
 #[test]
 fn is_whitespace() {
-    assert (str::is_whitespace(~""));
-    assert (str::is_whitespace(~" "));
-    assert (str::is_whitespace(~"\u2009")); // Thin space
-    assert (str::is_whitespace(~"  \n\t   "));
-    assert (!str::is_whitespace(~"   _   "));
+    assert (str::is_whitespace(""));
+    assert (str::is_whitespace(" "));
+    assert (str::is_whitespace("\u2009")); // Thin space
+    assert (str::is_whitespace("  \n\t   "));
+    assert (!str::is_whitespace("   _   "));
 }
 
 #[test]
 fn is_ascii() {
-    assert str::is_ascii(~"");
-    assert str::is_ascii(~"a");
-    assert !str::is_ascii(~"\u2009");
+    assert (str::is_ascii(""));
+    assert (str::is_ascii("a"));
+    assert (!str::is_ascii("\u2009"));
 }
 
 #[test]
 fn shift_byte() {
-    let s = ~"ABC";
+    let s = "ABC";
     let b = str::shift_byte(s);
-    assert s == ~"BC";
-    assert b == 65u8;
+    assert (s == "BC");
+    assert (b == 65u8);
 }
 
 #[test]
 fn pop_byte() {
-    let s = ~"ABC";
+    let s = "ABC";
     let b = str::pop_byte(s);
-    assert s == ~"AB";
-    assert b == 67u8;
+    assert (s == "AB");
+    assert (b == 67u8);
 }
 
 #[test]
 fn unsafe_from_bytes() {
     let a = [65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 65u8];
     let b = str::unsafe_from_bytes(a);
-    assert b == ~"AAAAAAA";
+    assert (b == "AAAAAAA");
 }
 
 #[test]
@@ -263,43 +260,37 @@ fn str_from_cstr() {
     let a = [65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 65u8, 0u8];
     let b = vec::to_ptr(a);
     let c = str::str_from_cstr(b);
-    assert c == ~"AAAAAAA";
+    assert (c == "AAAAAAA");
 }
 
 #[test]
 fn as_buf() {
-    let a = ~"Abcdefg";
-    let b = str::as_buf(a, { |buf|
-        assert *buf == 65u8;
-        100
-    });
-    assert b == 100;
+    let a = "Abcdefg";
+    let b = str::as_buf(a, {|buf| assert (*buf == 65u8); 100 });
+    assert (b == 100);
 }
 
 #[test]
 fn as_buf_small() {
-    let a = ~"A";
-    let b = str::as_buf(a, { |buf|
-        assert *buf == 65u8;
-        100
-    });
-    assert b == 100;
+    let a = "A";
+    let b = str::as_buf(a, {|buf| assert (*buf == 65u8); 100 });
+    assert (b == 100);
 }
 
 #[test]
 fn as_buf2() {
-    let s = ~"hello";
-    let sb = str::as_buf(s, { |b| b });
+    let s = "hello";
+    let sb = str::as_buf(s, {|b| b });
     let s_cstr = str::str_from_cstr(sb);
     assert (str::eq(s_cstr, s));
 }
 
 #[test]
 fn vec_str_conversions() {
-    let s1: istr = ~"All mimsy were the borogoves";
+    let s1: str = "All mimsy were the borogoves";
 
     let v: [u8] = str::bytes(s1);
-    let s2: istr = str::unsafe_from_bytes(v);
+    let s2: str = str::unsafe_from_bytes(v);
     let i: uint = 0u;
     let n1: uint = str::byte_len(s1);
     let n2: uint = vec::len::<u8>(v);
diff --git a/src/test/stdtest/sys.rs b/src/test/stdtest/sys.rs
index 006aaaa8f5e..56cafe9217a 100644
--- a/src/test/stdtest/sys.rs
+++ b/src/test/stdtest/sys.rs
@@ -1,6 +1,4 @@
 import std::sys;
 
 #[test]
-fn last_os_error() {
-    log sys::rustrt::last_os_error();
-}
\ No newline at end of file
+fn last_os_error() { log sys::rustrt::last_os_error(); }
diff --git a/src/test/stdtest/task.rs b/src/test/stdtest/task.rs
index 1984202fd93..8c1776aa36f 100644
--- a/src/test/stdtest/task.rs
+++ b/src/test/stdtest/task.rs
@@ -67,12 +67,10 @@ fn test_join_convenient() {
 
 #[test]
 fn spawn_polymorphic() {
-    fn foo<~T>(x : -T) {
-        log_err x;
-    }
+    fn foo<~T>(x: -T) { log_err x; }
 
     let fb = bind foo(true);
 
     task::spawn(fb);
     task::spawn(bind foo(42));
-}
\ No newline at end of file
+}
diff --git a/src/test/stdtest/test.rs b/src/test/stdtest/test.rs
index cb4b9313029..eaecb80ba6b 100644
--- a/src/test/stdtest/test.rs
+++ b/src/test/stdtest/test.rs
@@ -9,7 +9,7 @@ fn do_not_run_ignored_tests() {
     let ran = @mutable false;
     let f = bind fn (ran: @mutable bool) { *ran = true; }(ran);
 
-    let desc = {name: ~"whatever", fn: f, ignore: true};
+    let desc = {name: "whatever", fn: f, ignore: true};
 
     test::run_test(desc, test::default_test_to_task);
 
@@ -19,22 +19,22 @@ fn do_not_run_ignored_tests() {
 #[test]
 fn ignored_tests_result_in_ignored() {
     fn f() { }
-    let desc = {name: ~"whatever", fn: f, ignore: true};
+    let desc = {name: "whatever", fn: f, ignore: true};
     let res = test::run_test(desc, test::default_test_to_task).wait();
     assert (res == test::tr_ignored);
 }
 
 #[test]
 fn first_free_arg_should_be_a_filter() {
-    let args = [~"progname", ~"filter"];
+    let args = ["progname", "filter"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
-    assert (str::eq(~"filter", option::get(opts.filter)));
+    assert (str::eq("filter", option::get(opts.filter)));
 }
 
 #[test]
 fn parse_ignored_flag() {
-    let args = [~"progname", ~"filter", ~"--ignored"];
+    let args = ["progname", "filter", "--ignored"];
     check (vec::is_not_empty(args));
     let opts = alt test::parse_opts(args) { either::left(o) { o } };
     assert (opts.run_ignored);
@@ -47,12 +47,12 @@ fn filter_for_ignored_option() {
 
     let opts = {filter: option::none, run_ignored: true};
     let tests =
-        [{name: ~"1", fn: fn () { }, ignore: true},
-         {name: ~"2", fn: fn () { }, ignore: false}];
+        [{name: "1", fn: fn () { }, ignore: true},
+         {name: "2", fn: fn () { }, ignore: false}];
     let filtered = test::filter_tests(opts, tests);
 
     assert (vec::len(filtered) == 1u);
-    assert (filtered[0].name == ~"1");
+    assert (filtered[0].name == "1");
     assert (filtered[0].ignore == false);
 }
 
@@ -61,17 +61,17 @@ fn sort_tests() {
     let opts = {filter: option::none, run_ignored: false};
 
     let names =
-        [~"sha1::test", ~"int::test_to_str", ~"int::test_pow",
-         ~"test::do_not_run_ignored_tests",
-         ~"test::ignored_tests_result_in_ignored",
-         ~"test::first_free_arg_should_be_a_filter",
-         ~"test::parse_ignored_flag", ~"test::filter_for_ignored_option",
-         ~"test::sort_tests"];
+        ["sha1::test", "int::test_to_str", "int::test_pow",
+         "test::do_not_run_ignored_tests",
+         "test::ignored_tests_result_in_ignored",
+         "test::first_free_arg_should_be_a_filter",
+         "test::parse_ignored_flag", "test::filter_for_ignored_option",
+         "test::sort_tests"];
     let tests =
         {
             let testfn = fn () { };
             let tests = [];
-            for name: istr in names {
+            for name: str in names {
                 let test = {name: name, fn: testfn, ignore: false};
                 tests += [test];
             }
@@ -80,15 +80,13 @@ fn sort_tests() {
     let filtered = test::filter_tests(opts, tests);
 
     let expected =
-        [~"int::test_pow", ~"int::test_to_str", ~"sha1::test",
-         ~"test::do_not_run_ignored_tests",
-         ~"test::filter_for_ignored_option",
-         ~"test::first_free_arg_should_be_a_filter",
-         ~"test::ignored_tests_result_in_ignored",
-         ~"test::parse_ignored_flag",
-         ~"test::sort_tests"];
-
-    check vec::same_length(expected, filtered);
+        ["int::test_pow", "int::test_to_str", "sha1::test",
+         "test::do_not_run_ignored_tests", "test::filter_for_ignored_option",
+         "test::first_free_arg_should_be_a_filter",
+         "test::ignored_tests_result_in_ignored", "test::parse_ignored_flag",
+         "test::sort_tests"];
+
+    check (vec::same_length(expected, filtered));
     let pairs = vec::zip(expected, filtered);
 
 
diff --git a/src/test/stdtest/treemap.rs b/src/test/stdtest/treemap.rs
index 9a2ef1e8e68..0f4119c6c3d 100644
--- a/src/test/stdtest/treemap.rs
+++ b/src/test/stdtest/treemap.rs
@@ -5,41 +5,29 @@ import std::option::none;
 import std::str;
 
 #[test]
-fn init_treemap() {
-    let m = init::<int, int>();
-}
+fn init_treemap() { let m = init::<int, int>(); }
 
 #[test]
-fn insert_one() {
-    let m = init();
-    insert(m, 1, 2);
-}
+fn insert_one() { let m = init(); insert(m, 1, 2); }
 
 #[test]
-fn insert_two() {
-    let m = init();
-    insert(m, 1, 2);
-    insert(m, 3, 4);
-}
+fn insert_two() { let m = init(); insert(m, 1, 2); insert(m, 3, 4); }
 
 #[test]
 fn insert_find() {
     let m = init();
     insert(m, 1, 2);
-    assert(find(m, 1) == some(2));
+    assert (find(m, 1) == some(2));
 }
 
 #[test]
-fn find_empty() {
-    let m = init::<int, int>();
-    assert(find(m, 1) == none);
-}
+fn find_empty() { let m = init::<int, int>(); assert (find(m, 1) == none); }
 
 #[test]
 fn find_not_found() {
     let m = init();
     insert(m, 1, 2);
-    assert(find(m, 2) == none);
+    assert (find(m, 2) == none);
 }
 
 #[test]
@@ -52,10 +40,7 @@ fn traverse_in_order() {
     insert(m, 1, ());
 
     let n = 0;
-    fn t(n : &mutable int, k : &int, v : &()) {
-        assert(n == k);
-        n += 1;
-    }
+    fn t(n: &mutable int, k: &int, v: &()) { assert (n == k); n += 1; }
     traverse(m, bind t(n, _, _));
 }
 
@@ -63,12 +48,12 @@ fn traverse_in_order() {
 fn u8_map() {
     let m = init();
 
-    let k1 = str::bytes(~"foo");
-    let k2 = str::bytes(~"bar");
+    let k1 = str::bytes("foo");
+    let k2 = str::bytes("bar");
 
-    insert(m, k1, ~"foo");
-    insert(m, k2, ~"bar");
+    insert(m, k1, "foo");
+    insert(m, k2, "bar");
 
-    assert(find(m, k2) == some(~"bar"));
-    assert(find(m, k1) == some(~"foo"));
+    assert (find(m, k2) == some("bar"));
+    assert (find(m, k1) == some("foo"));
 }
diff --git a/src/test/stdtest/vec.rs b/src/test/stdtest/vec.rs
index 3d1df459067..6194c461c15 100644
--- a/src/test/stdtest/vec.rs
+++ b/src/test/stdtest/vec.rs
@@ -303,7 +303,7 @@ fn test_zip_unzip() {
     let v1 = [1, 2, 3];
     let v2 = [4, 5, 6];
 
-    check same_length(v1, v2); // Silly, but what else can we do?
+    check (same_length(v1, v2)); // Silly, but what else can we do?
     let z1 = vec::zip(v1, v2);
 
     assert ((1, 4) == z1[0]);
@@ -351,7 +351,7 @@ fn reverse_and_reversed() {
     // Make sure they work with 0-length vectors too.
 
     let v4 = vec::reversed::<int>([]);
-    assert v4 == [];
+    assert (v4 == []);
     let v3: [mutable int] = [mutable];
     vec::reverse::<int>(v3);
 }