diff options
| author | bors <bors@rust-lang.org> | 2013-05-30 04:49:37 -0700 |
|---|---|---|
| committer | bors <bors@rust-lang.org> | 2013-05-30 04:49:37 -0700 |
| commit | 682afcac5200019b363310f56cfabb78edea9397 (patch) | |
| tree | 8d765b5e139ce63eab13d3d838903a7cf577ba70 /src | |
| parent | ca74cbdc5cc7747e429a985b7b5fb5c4e4a5d4d5 (diff) | |
| parent | 1720d9f663c07422b91cbb5fc857b625d120155c (diff) | |
auto merge of #6829 : dotdash/rust/allocs, r=sanxiyn
Diffstat (limited to 'src')
27 files changed, 83 insertions, 91 deletions
diff --git a/src/compiletest/header.rs b/src/compiletest/header.rs index 2bfc92bc704..b147dc806e2 100644 --- a/src/compiletest/header.rs +++ b/src/compiletest/header.rs @@ -99,7 +99,7 @@ pub fn is_test_ignored(config: &config, testfile: &Path) -> bool { return false; fn xfail_target() -> ~str { - ~"xfail-" + str::to_owned(os::SYSNAME) + ~"xfail-" + os::SYSNAME } } @@ -173,7 +173,7 @@ fn parse_name_directive(line: &str, directive: &str) -> bool { fn parse_name_value_directive(line: &str, directive: ~str) -> Option<~str> { - let keycolon = directive + ~":"; + let keycolon = directive + ":"; match str::find_str(line, keycolon) { Some(colon) => { let value = str::slice(line, colon + str::len(keycolon), diff --git a/src/compiletest/procsrv.rs b/src/compiletest/procsrv.rs index 57a6dc8037e..8285986d67e 100644 --- a/src/compiletest/procsrv.rs +++ b/src/compiletest/procsrv.rs @@ -24,12 +24,12 @@ fn target_env(lib_path: &str, prog: &str) -> ~[(~str,~str)] { let mut env = os::env(); // Make sure we include the aux directory in the path - assert!(prog.ends_with(~".exe")); - let aux_path = prog.slice(0u, prog.len() - 4u).to_owned() + ~".libaux"; + assert!(prog.ends_with(".exe")); + let aux_path = prog.slice(0u, prog.len() - 4u).to_owned() + ".libaux"; env = do vec::map(env) |pair| { let (k,v) = *pair; - if k == ~"PATH" { (~"PATH", v + ~";" + lib_path + ~";" + aux_path) } + if k == ~"PATH" { (~"PATH", v + ";" + lib_path + ";" + aux_path) } else { (k,v) } }; if str::ends_with(prog, "rustc.exe") { diff --git a/src/compiletest/runtest.rs b/src/compiletest/runtest.rs index 4db1fa6d0a0..f0f6469e923 100644 --- a/src/compiletest/runtest.rs +++ b/src/compiletest/runtest.rs @@ -378,7 +378,7 @@ fn check_expected_errors(expected_errors: ~[errors::ExpectedError], was_expected = true; } - if !was_expected && is_compiler_error_or_warning(str::to_owned(line)) { + if !was_expected && is_compiler_error_or_warning(line) { fatal_ProcRes(fmt!("unexpected compiler error or warning: '%s'", line), ProcRes); @@ -596,8 +596,7 @@ fn make_lib_name(config: &config, auxfile: &Path, testfile: &Path) -> Path { } fn make_exe_name(config: &config, testfile: &Path) -> Path { - Path(output_base_name(config, testfile).to_str() + - str::to_owned(os::EXE_SUFFIX)) + Path(output_base_name(config, testfile).to_str() + os::EXE_SUFFIX) } fn make_run_args(config: &config, _props: &TestProps, testfile: &Path) -> @@ -606,7 +605,7 @@ fn make_run_args(config: &config, _props: &TestProps, testfile: &Path) -> // then split apart its command let toolargs = split_maybe_args(&config.runtool); - let mut args = toolargs + ~[make_exe_name(config, testfile).to_str()]; + let mut args = toolargs + [make_exe_name(config, testfile).to_str()]; let prog = args.shift(); return ProcArgs {prog: prog, args: args}; } @@ -655,7 +654,7 @@ fn make_cmdline(_libpath: &str, prog: &str, args: &[~str]) -> ~str { #[cfg(target_os = "win32")] fn make_cmdline(libpath: &str, prog: &str, args: &[~str]) -> ~str { fmt!("%s %s %s", lib_path_cmd_prefix(libpath), prog, - str::connect(args, ~" ")) + str::connect(args, " ")) } // Build the LD_LIBRARY_PATH variable as it would be seen on the command line @@ -776,8 +775,8 @@ fn _arm_exec_compiled_test(config: &config, props: &TestProps, for args.args.each |tv| { newcmd_out.push_str(" "); newcmd_err.push_str(" "); - newcmd_out.push_str(tv.to_owned()); - newcmd_err.push_str(tv.to_owned()); + newcmd_out.push_str(*tv); + newcmd_err.push_str(*tv); } newcmd_out.push_str(" 2>/dev/null"); diff --git a/src/libextra/getopts.rs b/src/libextra/getopts.rs index 294b8fec042..678d795d8f8 100644 --- a/src/libextra/getopts.rs +++ b/src/libextra/getopts.rs @@ -110,10 +110,11 @@ pub struct Opt { } fn mkname(nm: &str) -> Name { - let unm = str::to_owned(nm); - return if nm.len() == 1u { - Short(str::char_at(unm, 0u)) - } else { Long(unm) }; + if nm.len() == 1u { + Short(str::char_at(nm, 0u)) + } else { + Long(nm.to_owned()) + } } /// Create an option that is required and takes an argument @@ -195,19 +196,19 @@ pub enum Fail_ { pub fn fail_str(f: Fail_) -> ~str { return match f { ArgumentMissing(ref nm) => { - ~"Argument to option '" + *nm + "' missing." + fmt!("Argument to option '%s' missing.", *nm) } UnrecognizedOption(ref nm) => { - ~"Unrecognized option: '" + *nm + "'." + fmt!("Unrecognized option: '%s'.", *nm) } OptionMissing(ref nm) => { - ~"Required option '" + *nm + "' missing." + fmt!("Required option '%s' missing.", *nm) } OptionDuplicated(ref nm) => { - ~"Option '" + *nm + "' given more than once." + fmt!("Option '%s' given more than once.", *nm) } UnexpectedArgument(ref nm) => { - ~"Option " + *nm + " does not take an argument." + fmt!("Option '%s' does not take an argument.", *nm) } }; } @@ -245,11 +246,11 @@ pub fn getopts(args: &[~str], opts: &[Opt]) -> Result { let mut names; let mut i_arg = None; if cur[1] == '-' as u8 { - let tail = str::slice(cur, 2, curlen).to_owned(); + let tail = str::slice(cur, 2, curlen); let mut tail_eq = ~[]; for str::each_splitn_char(tail, '=', 1) |s| { tail_eq.push(s.to_owned()) } if tail_eq.len() <= 1 { - names = ~[Long(tail)]; + names = ~[Long(tail.to_owned())]; } else { names = ~[Long(copy tail_eq[0])]; diff --git a/src/libextra/net_ip.rs b/src/libextra/net_ip.rs index e92523726df..160d06ec20d 100644 --- a/src/libextra/net_ip.rs +++ b/src/libextra/net_ip.rs @@ -230,7 +230,7 @@ pub mod v4 { let input_is_inaddr_none = result::get(&ip_rep_result).as_u32() == INADDR_NONE; - let new_addr = uv_ip4_addr(str::to_owned(ip), 22); + let new_addr = uv_ip4_addr(ip, 22); let reformatted_name = uv_ip4_name(&new_addr); debug!("try_parse_addr: input ip: %s reparsed ip: %s", ip, reformatted_name); @@ -259,7 +259,6 @@ pub mod v6 { use uv_ip6_name = uv::ll::ip6_name; use core::result; - use core::str; /** * Convert a str to `ip_addr` @@ -285,7 +284,7 @@ pub mod v6 { pub fn try_parse_addr(ip: &str) -> result::Result<IpAddr,ParseAddrErr> { unsafe { // need to figure out how to establish a parse failure.. - let new_addr = uv_ip6_addr(str::to_owned(ip), 22); + let new_addr = uv_ip6_addr(ip, 22); let reparsed_name = uv_ip6_name(&new_addr); debug!("v6::try_parse_addr ip: '%s' reparsed '%s'", ip, reparsed_name); diff --git a/src/libextra/net_url.rs b/src/libextra/net_url.rs index fa7295923a0..80957a8c8ef 100644 --- a/src/libextra/net_url.rs +++ b/src/libextra/net_url.rs @@ -585,7 +585,7 @@ fn get_path(rawurl: &str, authority: bool) -> } } - return Ok((decode_component(str::slice(rawurl, 0, end).to_owned()), + return Ok((decode_component(str::slice(rawurl, 0, end)), str::slice(rawurl, end, len).to_owned())); } @@ -596,14 +596,13 @@ fn get_query_fragment(rawurl: &str) -> if str::starts_with(rawurl, "#") { let f = decode_component(str::slice(rawurl, 1, - str::len(rawurl)).to_owned()); + str::len(rawurl))); return Ok((~[], Some(f))); } else { return Ok((~[], None)); } } - let (q, r) = split_char_first(str::slice(rawurl, 1, - str::len(rawurl)).to_owned(), '#'); + let (q, r) = split_char_first(str::slice(rawurl, 1, rawurl.len()), '#'); let f = if str::len(r) != 0 { Some(decode_component(r)) } else { None }; return Ok((query_from_str(q), f)); diff --git a/src/libextra/sha1.rs b/src/libextra/sha1.rs index e970d34ff91..80b4ab02e5f 100644 --- a/src/libextra/sha1.rs +++ b/src/libextra/sha1.rs @@ -399,8 +399,7 @@ mod tests { let mut left = len; while left > 0u { let take = (left + 1u) / 2u; - sh.input_str(str::slice(t.input, len - left, - take + len - left).to_owned()); + sh.input_str(t.input.slice(len - left, take + len - left)); left = left - take; } let out = sh.result(); diff --git a/src/libextra/time.rs b/src/libextra/time.rs index 8603d0f814a..e3289d01750 100644 --- a/src/libextra/time.rs +++ b/src/libextra/time.rs @@ -293,7 +293,7 @@ priv fn do_strptime(s: &str, format: &str) -> Result<Tm, ~str> { let mut i = 0u; while i < digits { - let range = str::char_range_at(str::to_owned(ss), pos); + let range = str::char_range_at(ss, pos); pos = range.next; match range.ch { @@ -632,7 +632,7 @@ priv fn do_strptime(s: &str, format: &str) -> Result<Tm, ~str> { } } - do io::with_str_reader(str::to_owned(format)) |rdr| { + do io::with_str_reader(format) |rdr| { let mut tm = Tm { tm_sec: 0_i32, tm_min: 0_i32, @@ -844,7 +844,7 @@ priv fn do_strftime(format: &str, tm: &Tm) -> ~str { let mut buf = ~""; - do io::with_str_reader(str::to_owned(format)) |rdr| { + do io::with_str_reader(format) |rdr| { while !rdr.eof() { match rdr.read_char() { '%' => buf += parse_type(rdr.read_char(), tm), diff --git a/src/libextra/workcache.rs b/src/libextra/workcache.rs index 19913fb92f4..47a717a56a5 100644 --- a/src/libextra/workcache.rs +++ b/src/libextra/workcache.rs @@ -201,7 +201,7 @@ struct Logger { pub impl Logger { fn info(&self, i: &str) { - io::println(~"workcache: " + i.to_owned()); + io::println(~"workcache: " + i); } } diff --git a/src/librustc/back/link.rs b/src/librustc/back/link.rs index 785b79f66b9..02c0b19e565 100644 --- a/src/librustc/back/link.rs +++ b/src/librustc/back/link.rs @@ -741,7 +741,6 @@ pub fn mangle_internal_name_by_seq(ccx: @CrateContext, flav: &str) -> ~str { pub fn output_dll_filename(os: session::os, lm: LinkMeta) -> ~str { - let libname = fmt!("%s-%s-%s", lm.name, lm.extras_hash, lm.vers); let (dll_prefix, dll_suffix) = match os { session::os_win32 => (win32::DLL_PREFIX, win32::DLL_SUFFIX), session::os_macos => (macos::DLL_PREFIX, macos::DLL_SUFFIX), @@ -749,8 +748,7 @@ pub fn output_dll_filename(os: session::os, lm: LinkMeta) -> ~str { session::os_android => (android::DLL_PREFIX, android::DLL_SUFFIX), session::os_freebsd => (freebsd::DLL_PREFIX, freebsd::DLL_SUFFIX), }; - return str::to_owned(dll_prefix) + libname + - str::to_owned(dll_suffix); + fmt!("%s%s-%s-%s%s", dll_prefix, lm.name, lm.extras_hash, lm.vers, dll_suffix) } // If the user wants an exe generated we need to invoke diff --git a/src/librustc/lib/llvm.rs b/src/librustc/lib/llvm.rs index 49a682e68f1..b664abef343 100644 --- a/src/librustc/lib/llvm.rs +++ b/src/librustc/lib/llvm.rs @@ -2014,7 +2014,7 @@ pub fn type_to_str_inner(names: @TypeNames, outer0: &[TypeRef], ty: TypeRef) let mut first: bool = true; for tys.each |t| { if first { first = false; } else { s += ", "; } - s += type_to_str_inner(names, outer, *t).to_owned(); + s += type_to_str_inner(names, outer, *t); } // [Note at-str] FIXME #2543: Could rewrite this without the copy, // but need better @str support. diff --git a/src/librustc/metadata/loader.rs b/src/librustc/metadata/loader.rs index 5c64bd43943..182f1e9078c 100644 --- a/src/librustc/metadata/loader.rs +++ b/src/librustc/metadata/loader.rs @@ -268,8 +268,7 @@ pub fn list_file_metadata(intr: @ident_interner, match get_metadata_section(os, path) { option::Some(bytes) => decoder::list_crate_metadata(intr, bytes, out), option::None => { - out.write_str(~"could not find metadata in " - + path.to_str() + ".\n"); + out.write_str(fmt!("could not find metadata in %s.\n", path.to_str())) } } } diff --git a/src/librustc/metadata/tyencode.rs b/src/librustc/metadata/tyencode.rs index 42423b4df29..eb76b15dd28 100644 --- a/src/librustc/metadata/tyencode.rs +++ b/src/librustc/metadata/tyencode.rs @@ -89,8 +89,7 @@ pub fn enc_ty(w: @io::Writer, cx: @ctxt, t: ty::t) { let abbrev_len = 3u + estimate_sz(pos) + estimate_sz(len); if abbrev_len < len { // I.e. it's actually an abbreviation. - let s = ~"#" + uint::to_str_radix(pos, 16u) + ":" + - uint::to_str_radix(len, 16u) + "#"; + let s = fmt!("#%x:%x#", pos, len); let a = ty_abbrev { pos: pos, len: len, s: @s }; abbrevs.insert(t, a); } diff --git a/src/librustc/middle/trans/asm.rs b/src/librustc/middle/trans/asm.rs index bfcd6b16857..ac92ea75963 100644 --- a/src/librustc/middle/trans/asm.rs +++ b/src/librustc/middle/trans/asm.rs @@ -98,7 +98,8 @@ pub fn trans_inline_asm(bcx: block, ia: &ast::inline_asm) -> block { // Add the clobbers to our constraints list if clobbers != ~"" && constraints != ~"" { - constraints += ~"," + clobbers; + constraints += ","; + constraints += clobbers; } else { constraints += clobbers; } diff --git a/src/librustc/middle/trans/base.rs b/src/librustc/middle/trans/base.rs index a36eb39c049..6a49ae4cbc6 100644 --- a/src/librustc/middle/trans/base.rs +++ b/src/librustc/middle/trans/base.rs @@ -2906,8 +2906,7 @@ pub fn decl_crate_map(sess: session::Session, mapmeta: LinkMeta, let cstore = sess.cstore; while cstore::have_crate_data(cstore, n_subcrates) { n_subcrates += 1; } let mapname = if *sess.building_library { - mapmeta.name.to_owned() + "_" + mapmeta.vers.to_owned() + "_" - + mapmeta.extras_hash.to_owned() + fmt!("%s_%s_%s", mapmeta.name, mapmeta.vers, mapmeta.extras_hash) } else { ~"toplevel" }; diff --git a/src/librustc/middle/trans/cabi.rs b/src/librustc/middle/trans/cabi.rs index c6f4d230419..629d9ca629b 100644 --- a/src/librustc/middle/trans/cabi.rs +++ b/src/librustc/middle/trans/cabi.rs @@ -60,8 +60,8 @@ pub impl FnType { fn build_shim_args(&self, bcx: block, arg_tys: &[TypeRef], llargbundle: ValueRef) -> ~[ValueRef] { - let mut atys = /*bad*/copy self.arg_tys; - let mut attrs = /*bad*/copy self.attrs; + let mut atys: &[LLVMType] = self.arg_tys; + let mut attrs: &[option::Option<Attribute>] = self.attrs; let mut llargvals = ~[]; let mut i = 0u; @@ -71,8 +71,8 @@ pub impl FnType { let llretptr = GEPi(bcx, llargbundle, [0u, n]); let llretloc = Load(bcx, llretptr); llargvals = ~[llretloc]; - atys = vec::to_owned(atys.tail()); - attrs = vec::to_owned(attrs.tail()); + atys = atys.tail(); + attrs = attrs.tail(); } while i < n { @@ -133,12 +133,12 @@ pub impl FnType { ret_ty: TypeRef, llwrapfn: ValueRef, llargbundle: ValueRef) { - let mut atys = /*bad*/copy self.arg_tys; - let mut attrs = /*bad*/copy self.attrs; + let mut atys: &[LLVMType] = self.arg_tys; + let mut attrs: &[option::Option<Attribute>] = self.attrs; let mut j = 0u; let llretptr = if self.sret { - atys = vec::to_owned(atys.tail()); - attrs = vec::to_owned(attrs.tail()); + atys = atys.tail(); + attrs = attrs.tail(); j = 1u; get_param(llwrapfn, 0u) } else if self.ret_ty.cast { diff --git a/src/librustc/middle/typeck/check/mod.rs b/src/librustc/middle/typeck/check/mod.rs index 7ba759e63ee..61da263e843 100644 --- a/src/librustc/middle/typeck/check/mod.rs +++ b/src/librustc/middle/typeck/check/mod.rs @@ -3661,8 +3661,8 @@ pub fn check_intrinsic_type(ccx: @mut CrateCtxt, it: @ast::foreign_item) { ~"bswap64" => (0, ~[ ty::mk_i64() ], ty::mk_i64()), ref other => { tcx.sess.span_err(it.span, - ~"unrecognized intrinsic function: `" + - (*other) + "`"); + fmt!("unrecognized intrinsic function: `%s`", + *other)); return; } }; diff --git a/src/librustc/middle/typeck/mod.rs b/src/librustc/middle/typeck/mod.rs index 5cb4928d514..5aa19ed5875 100644 --- a/src/librustc/middle/typeck/mod.rs +++ b/src/librustc/middle/typeck/mod.rs @@ -323,8 +323,8 @@ fn check_main_fn_ty(ccx: @mut CrateCtxt, } _ => { tcx.sess.span_bug(main_span, - ~"main has a non-function type: found `" + - ppaux::ty_to_str(tcx, main_t) + "`"); + fmt!("main has a non-function type: found `%s`", + ppaux::ty_to_str(tcx, main_t))); } } } @@ -372,8 +372,8 @@ fn check_start_fn_ty(ccx: @mut CrateCtxt, } _ => { tcx.sess.span_bug(start_span, - ~"start has a non-function type: found `" + - ppaux::ty_to_str(tcx, start_t) + "`"); + fmt!("start has a non-function type: found `%s`", + ppaux::ty_to_str(tcx, start_t))); } } } diff --git a/src/librustc/util/ppaux.rs b/src/librustc/util/ppaux.rs index dcf631f0f7b..69e0f85522a 100644 --- a/src/librustc/util/ppaux.rs +++ b/src/librustc/util/ppaux.rs @@ -416,7 +416,7 @@ pub fn ty_to_str(cx: ctxt, typ: t) -> ~str { ty_rptr(r, ref tm) => { region_to_str_space(cx, "&", r) + mt_to_str(cx, tm) } - ty_unboxed_vec(ref tm) => { ~"unboxed_vec<" + mt_to_str(cx, tm) + ">" } + ty_unboxed_vec(ref tm) => { fmt!("unboxed_vec<%s>", mt_to_str(cx, tm)) } ty_type => ~"type", ty_tup(ref elems) => { let strs = elems.map(|elem| ty_to_str(cx, *elem)); diff --git a/src/librusti/rusti.rc b/src/librusti/rusti.rc index d17379a2193..ff8b4092fab 100644 --- a/src/librusti/rusti.rc +++ b/src/librusti/rusti.rc @@ -272,12 +272,11 @@ fn run_cmd(repl: &mut Repl, _in: @io::Reader, _out: @io::Writer, } ~"help" => { println( - ~":{\\n ..lines.. \\n:}\\n - execute multiline command\n" + - ":load <crate> ... - \ - loads given crates as dynamic libraries\n" + - ":clear - clear the bindings\n" + - ":exit - exit from the repl\n" + - ":help - show this message"); + ":{\\n ..lines.. \\n:}\\n - execute multiline command\n\ + :load <crate> ... - loads given crates as dynamic libraries\n\ + :clear - clear the bindings\n\ + :exit - exit from the repl\n\ + :help - show this message"); } ~"load" => { let mut loaded_crates: ~[~str] = ~[]; diff --git a/src/libstd/os.rs b/src/libstd/os.rs index cc36dcb92a2..446804f7b30 100644 --- a/src/libstd/os.rs +++ b/src/libstd/os.rs @@ -145,7 +145,7 @@ pub mod win32 { pub fn as_utf16_p<T>(s: &str, f: &fn(*u16) -> T) -> T { let mut t = str::to_utf16(s); // Null terminate before passing on. - t += ~[0u16]; + t += [0u16]; vec::as_imm_buf(t, |buf, _len| f(buf)) } } @@ -437,8 +437,7 @@ fn dup2(src: c_int, dst: c_int) -> c_int { /// Returns the proper dll filename for the given basename of a file. pub fn dll_filename(base: &str) -> ~str { - return str::to_owned(DLL_PREFIX) + str::to_owned(base) + - str::to_owned(DLL_SUFFIX) + fmt!("%s%s%s", DLL_PREFIX, base, DLL_SUFFIX) } /// Optionally returns the filesystem path to the current executable which is diff --git a/src/libsyntax/parse/lexer.rs b/src/libsyntax/parse/lexer.rs index 4a9ef2faa54..0e04e719020 100644 --- a/src/libsyntax/parse/lexer.rs +++ b/src/libsyntax/parse/lexer.rs @@ -448,7 +448,8 @@ fn scan_number(c: char, rdr: @mut StringReader) -> token::Token { is_float = true; bump(rdr); let dec_part = scan_digits(rdr, 10u); - num_str += ~"." + dec_part; + num_str += "."; + num_str += dec_part; } if is_float { match base { diff --git a/src/test/bench/shootout-chameneos-redux.rs b/src/test/bench/shootout-chameneos-redux.rs index 58b8a9cd47b..dcde474ace3 100644 --- a/src/test/bench/shootout-chameneos-redux.rs +++ b/src/test/bench/shootout-chameneos-redux.rs @@ -26,8 +26,8 @@ fn print_complements() { let all = ~[Blue, Red, Yellow]; for vec::each(all) |aa| { for vec::each(all) |bb| { - io::println(show_color(*aa) + ~" + " + show_color(*bb) + - ~" -> " + show_color(transform(*aa, *bb))); + io::println(show_color(*aa) + " + " + show_color(*bb) + + " -> " + show_color(transform(*aa, *bb))); } } } @@ -50,7 +50,7 @@ fn show_color(cc: color) -> ~str { fn show_color_list(set: ~[color]) -> ~str { let mut out = ~""; for vec::eachi(set) |_ii, col| { - out += ~" "; + out += " "; out += show_color(*col); } return out; @@ -82,7 +82,7 @@ fn show_number(nn: uint) -> ~str { while num != 0 { dig = num % 10; num = num / 10; - out = show_digit(dig) + ~" " + out; + out = show_digit(dig) + " " + out; } return out; @@ -131,8 +131,8 @@ fn creature( } option::None => { // log creatures met and evil clones of self - let report = fmt!("%u", creatures_met) + ~" " + - show_number(evil_clones_met); + let report = fmt!("%u %s", + creatures_met, show_number(evil_clones_met)); to_rendezvous_log.send(report); break; } diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs index 78a37f06bb9..3cff8baa829 100644 --- a/src/test/bench/shootout-fasta.rs +++ b/src/test/bench/shootout-fasta.rs @@ -49,7 +49,7 @@ fn make_cumulative(aa: ~[AminoAcids]) -> ~[AminoAcids] { let mut ans: ~[AminoAcids] = ~[]; for aa.each |a| { cp += a.prob; - ans += ~[AminoAcids {ch: a.ch, prob: cp}]; + ans += [AminoAcids {ch: a.ch, prob: cp}]; } return ans; } @@ -72,7 +72,7 @@ fn make_random_fasta(wr: @io::Writer, desc: ~str, genelist: ~[AminoAcids], n: int) { - wr.write_line(~">" + id + ~" " + desc); + wr.write_line(~">" + id + " " + desc); let mut rng = rand::rng(); let rng = @mut MyRandom { last: rng.next() @@ -91,7 +91,7 @@ fn make_random_fasta(wr: @io::Writer, fn make_repeat_fasta(wr: @io::Writer, id: ~str, desc: ~str, s: ~str, n: int) { unsafe { - wr.write_line(~">" + id + ~" " + desc); + wr.write_line(~">" + id + " " + desc); let mut op: ~str = ~""; let sl: uint = str::len(s); for uint::range(0u, n as uint) |i| { @@ -139,13 +139,13 @@ fn main() { make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), acid('t', 30u32)]); let alu: ~str = - ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + - ~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + - ~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + - ~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + - ~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + - ~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + - ~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ + GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ + CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ + ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ + GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ + AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ + AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2); make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3); make_random_fasta(writer, ~"THREE", diff --git a/src/test/bench/sudoku.rs b/src/test/bench/sudoku.rs index dbce9d60af7..8f12f2bd58e 100644 --- a/src/test/bench/sudoku.rs +++ b/src/test/bench/sudoku.rs @@ -103,7 +103,7 @@ pub impl Sudoku { for u8::range(0u8, 9u8) |row| { for u8::range(0u8, 9u8) |col| { let color = self.grid[row][col]; - if color == 0u8 { work += ~[(row, col)]; } + if color == 0u8 { work += [(row, col)]; } } } diff --git a/src/test/bench/task-perf-alloc-unwind.rs b/src/test/bench/task-perf-alloc-unwind.rs index a0363bd568a..7a04a06d6a6 100644 --- a/src/test/bench/task-perf-alloc-unwind.rs +++ b/src/test/bench/task-perf-alloc-unwind.rs @@ -96,7 +96,7 @@ fn recurse_or_fail(depth: int, st: Option<State>) { fn_box: || @Cons((), fn_box()), tuple: (@Cons((), st.tuple.first()), ~Cons((), @*st.tuple.second())), - vec: st.vec + ~[@Cons((), *st.vec.last())], + vec: st.vec + [@Cons((), *st.vec.last())], res: r(@Cons((), st.res._l)) } } diff --git a/src/test/run-pass/trait-to-str.rs b/src/test/run-pass/trait-to-str.rs index ff01efc027e..9b94b785125 100644 --- a/src/test/run-pass/trait-to-str.rs +++ b/src/test/run-pass/trait-to-str.rs @@ -26,7 +26,7 @@ impl to_str for int { impl<T:to_str> to_str for ~[T] { fn to_str(&self) -> ~str { - ~"[" + str::connect(vec::map(*self, |e| e.to_str() ), ~", ") + ~"]" + ~"[" + str::connect(vec::map(*self, |e| e.to_str() ), ", ") + "]" } } |
