Reformat. Issue #855

11 files changed, 126 insertions, 136 deletions

diff --git a/src/test/bench/99bob-iter.rs b/src/test/bench/99bob-iter.rs
index fea1420f8bb..a1a3e1b984a 100644
--- a/src/test/bench/99bob-iter.rs
+++ b/src/test/bench/99bob-iter.rs
@@ -8,28 +8,28 @@ use std;
 import std::int;
 import std::str;
 
-fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; }
+fn b1() -> str { ret "# of beer on the wall, # of beer."; }
 
-fn b2() -> istr {
-    ret ~"Take one down and pass it around, # of beer on the wall.";
+fn b2() -> str {
+    ret "Take one down and pass it around, # of beer on the wall.";
 }
 
-fn b7() -> istr {
-    ret ~"No more bottles of beer on the wall, no more bottles of beer.";
+fn b7() -> str {
+    ret "No more bottles of beer on the wall, no more bottles of beer.";
 }
 
-fn b8() -> istr {
-    ret ~"Go to the store and buy some more, # of beer on the wall.";
+fn b8() -> str {
+    ret "Go to the store and buy some more, # of beer on the wall.";
 }
 
-fn sub(t: &istr, n: int) -> istr {
-    let b: istr = ~"";
+fn sub(t: &str, n: int) -> str {
+    let b: str = "";
     let i: uint = 0u;
-    let ns: istr;
+    let ns: str;
     alt n {
-      0 { ns = ~"no more bottles"; }
-      1 { ns = ~"1 bottle"; }
-      _ { ns = int::to_str(n, 10u) + ~" bottles"; }
+      0 { ns = "no more bottles"; }
+      1 { ns = "1 bottle"; }
+      _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
         if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
diff --git a/src/test/bench/99bob-pattern.rs b/src/test/bench/99bob-pattern.rs
index a13015fb4f7..fdfce9dfae5 100644
--- a/src/test/bench/99bob-pattern.rs
+++ b/src/test/bench/99bob-pattern.rs
@@ -29,12 +29,11 @@ fn show(b: bottle) {
                 "1 bottle of beer on the wall.";
       }
       multiple(n) {
-        let nb: istr = int::to_str(n, 10u);
-        let mb: istr = int::to_str(n - 1, 10u);
-        log nb + ~" bottles of beer on the wall, " + nb +
-            ~" bottles of beer,";
-        log ~"Take one down and pass it around, " + mb +
-                ~" bottles of beer on the wall.";
+        let nb: str = int::to_str(n, 10u);
+        let mb: str = int::to_str(n - 1, 10u);
+        log nb + " bottles of beer on the wall, " + nb + " bottles of beer,";
+        log "Take one down and pass it around, " + mb +
+                " bottles of beer on the wall.";
       }
     }
 }
diff --git a/src/test/bench/99bob-simple.rs b/src/test/bench/99bob-simple.rs
index 30518c63e2d..ae1c30fb9ec 100644
--- a/src/test/bench/99bob-simple.rs
+++ b/src/test/bench/99bob-simple.rs
@@ -8,28 +8,28 @@ use std;
 import std::int;
 import std::str;
 
-fn b1() -> istr { ret ~"# of beer on the wall, # of beer."; }
+fn b1() -> str { ret "# of beer on the wall, # of beer."; }
 
-fn b2() -> istr {
-    ret ~"Take one down and pass it around, # of beer on the wall.";
+fn b2() -> str {
+    ret "Take one down and pass it around, # of beer on the wall.";
 }
 
-fn b7() -> istr {
-    ret ~"No more bottles of beer on the wall, no more bottles of beer.";
+fn b7() -> str {
+    ret "No more bottles of beer on the wall, no more bottles of beer.";
 }
 
-fn b8() -> istr {
-    ret ~"Go to the store and buy some more, # of beer on the wall.";
+fn b8() -> str {
+    ret "Go to the store and buy some more, # of beer on the wall.";
 }
 
-fn sub(t: &istr, n: int) -> istr {
-    let b: istr = ~"";
+fn sub(t: &str, n: int) -> str {
+    let b: str = "";
     let i: uint = 0u;
-    let ns: istr;
+    let ns: str;
     alt n {
-      0 { ns = ~"no more bottles"; }
-      1 { ns = ~"1 bottle"; }
-      _ { ns = int::to_str(n, 10u) + ~" bottles"; }
+      0 { ns = "no more bottles"; }
+      1 { ns = "1 bottle"; }
+      _ { ns = int::to_str(n, 10u) + " bottles"; }
     }
     while i < str::byte_len(t) {
         if t[i] == '#' as u8 { b += ns; } else { str::push_byte(b, t[i]); }
diff --git a/src/test/bench/99bob-tail.rs b/src/test/bench/99bob-tail.rs
index 9ab8973cbce..af5e22f48ea 100644
--- a/src/test/bench/99bob-tail.rs
+++ b/src/test/bench/99bob-tail.rs
@@ -8,12 +8,11 @@ import std::str;
 
 fn main() {
     fn multiple(n: int) {
-        let nb: istr = int::to_str(n, 10u);
-        let mb: istr = int::to_str(n - 1, 10u);
-        log nb + ~" bottles of beer on the wall, " + nb +
-            ~" bottles of beer,";
-        log ~"Take one down and pass it around, " + mb +
-            ~" bottles of beer on the wall.";
+        let nb: str = int::to_str(n, 10u);
+        let mb: str = int::to_str(n - 1, 10u);
+        log nb + " bottles of beer on the wall, " + nb + " bottles of beer,";
+        log "Take one down and pass it around, " + mb +
+                " bottles of beer on the wall.";
         log "";
         if n > 3 { be multiple(n - 1); } else { be dual(); }
     }
diff --git a/src/test/bench/shootout-fannkuchredux.rs b/src/test/bench/shootout-fannkuchredux.rs
index fa4a17180ae..8e7b2cbe269 100644
--- a/src/test/bench/shootout-fannkuchredux.rs
+++ b/src/test/bench/shootout-fannkuchredux.rs
@@ -56,7 +56,7 @@ fn fannkuch(n: int) -> int {
     ret flips;
 }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let n = 7;
     log #fmt["Pfannkuchen(%d) = %d", n, fannkuch(n)];
 }
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index cd29838b378..99b06a98416 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -43,32 +43,31 @@ fn select_random(r: u32, genelist: &[aminoacids]) -> char {
     ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r);
 }
 
-fn make_random_fasta(id: &istr, desc: &istr,
-                     genelist: &[aminoacids], n: int) {
-    log ~">" + id + ~" " + desc;
+fn make_random_fasta(id: &str, desc: &str, genelist: &[aminoacids], n: int) {
+    log ">" + id + " " + desc;
     let rng = myrandom(std::rand::mk_rng().next());
-    let op: istr = ~"";
+    let op: str = "";
     for each i: uint in uint::range(0u, n as uint) {
         str::push_byte(op, select_random(rng.next(100u32), genelist) as u8);
-        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; }
+        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
 }
 
-fn make_repeat_fasta(id: &istr, desc: &istr, s: &istr, n: int) {
-    log ~">" + id + ~" " + desc;
-    let op: istr = ~"";
+fn make_repeat_fasta(id: &str, desc: &str, s: &str, n: int) {
+    log ">" + id + " " + desc;
+    let op: str = "";
     let sl: uint = str::byte_len(s);
     for each i: uint in uint::range(0u, n as uint) {
         str::push_byte(op, s[i % sl]);
-        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ~""; }
+        if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; }
     }
     if str::byte_len(op) > 0u { log op; }
 }
 
 fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let iub: [aminoacids] =
         make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
                          acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
@@ -78,17 +77,16 @@ fn main(args: [istr]) {
     let homosapiens: [aminoacids] =
         make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
                          acid('t', 30u32)]);
-    let alu: istr =
-        ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
-            ~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
-            ~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
-            ~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
-            ~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
-            ~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
-            ~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+    let alu: str =
+        "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+            "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+            "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+            "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+            "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+            "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+            "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
     let n: int = 512;
-    make_repeat_fasta(~"ONE", ~"Homo sapiens alu", alu, n * 2);
-    make_random_fasta(~"TWO", ~"IUB ambiguity codes", iub, n * 3);
-    make_random_fasta(~"THREE", ~"Homo sapiens frequency",
-                      homosapiens, n * 5);
+    make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2);
+    make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3);
+    make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5);
 }
diff --git a/src/test/bench/shootout-pfib.rs b/src/test/bench/shootout-pfib.rs
index 6a9a5348c2e..9551aa6b982 100644
--- a/src/test/bench/shootout-pfib.rs
+++ b/src/test/bench/shootout-pfib.rs
@@ -49,14 +49,14 @@ fn fib(n: int) -> int {
 
 type config = {stress: bool};
 
-fn parse_opts(argv: &[istr]) -> config {
-    let opts = [getopts::optflag(~"stress")];
+fn parse_opts(argv: &[str]) -> config {
+    let opts = [getopts::optflag("stress")];
 
     let opt_args = vec::slice(argv, 1u, vec::len(argv));
 
 
     alt getopts::getopts(opt_args, opts) {
-      getopts::success(m) { ret {stress: getopts::opt_present(m, ~"stress")} }
+      getopts::success(m) { ret {stress: getopts::opt_present(m, "stress")} }
       getopts::failure(_) { fail; }
     }
 }
@@ -79,7 +79,7 @@ fn stress(num_tasks: int) {
     for t in tasks { task::join(t); }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) == 1u {
         assert (fib(8) == 21);
         log fib(8);
@@ -105,9 +105,8 @@ fn main(argv: [istr]) {
 
                     let elapsed = stop - start;
 
-                    out.write_line(
-                            #fmt["%d\t%d\t%s", n, fibn,
-                                 u64::str(elapsed)]);
+                    out.write_line(#fmt["%d\t%d\t%s", n, fibn,
+                                        u64::str(elapsed)]);
                 }
             }
         }
diff --git a/src/test/bench/task-perf-spawnalot.rs b/src/test/bench/task-perf-spawnalot.rs
index 941f0183031..ebe1abc493b 100644
--- a/src/test/bench/task-perf-spawnalot.rs
+++ b/src/test/bench/task-perf-spawnalot.rs
@@ -8,12 +8,14 @@ fn f(n: uint) {
     let i = 0u;
     while i < n {
         let thunk = g;
-        task::join(task::spawn_joinable(thunk)); i += 1u; }
+        task::join(task::spawn_joinable(thunk));
+        i += 1u;
+    }
 }
 
 fn g() { }
 
-fn main(args: [istr]) {
+fn main(args: [str]) {
     let n =
         if vec::len(args) < 2u {
             10u
diff --git a/src/test/bench/task-perf-vector-party.rs b/src/test/bench/task-perf-vector-party.rs
index fd650df660b..b70bd24828a 100644
--- a/src/test/bench/task-perf-vector-party.rs
+++ b/src/test/bench/task-perf-vector-party.rs
@@ -16,13 +16,10 @@ fn f(n: uint) {
     }
 }
 
-fn main(args: [istr]) {
-    let n = if vec::len(args) < 2u {
-        100u
-    } else {
-        uint::parse_buf(str::bytes(args[1]), 10u)
-    };
-    for each i in uint::range(0u, 100u) {
-        task::spawn(bind f(n));
-    }
-}
\ No newline at end of file
+fn main(args: [str]) {
+    let n =
+        if vec::len(args) < 2u {
+            100u
+        } else { uint::parse_buf(str::bytes(args[1]), 10u) };
+    for each i in uint::range(0u, 100u) { task::spawn(bind f(n)); }
+}
diff --git a/src/test/bench/task-perf-word-count-generic.rs b/src/test/bench/task-perf-word-count-generic.rs
index 3a8f643bc37..adb5040fa25 100644
--- a/src/test/bench/task-perf-word-count-generic.rs
+++ b/src/test/bench/task-perf-word-count-generic.rs
@@ -70,9 +70,10 @@ mod map_reduce {
 
     tag reduce_proto<~V> { emit_val(V); done; ref; release; }
 
-    fn start_mappers<~K1, ~K2, ~V>(map : mapper<K1, K2, V>,
-                             ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1])
-        -> [joinable_task] {
+    fn start_mappers<~K1, ~K2,
+                     ~V>(map: mapper<K1, K2, V>,
+                         ctrl: chan<ctrl_proto<K2, V>>, inputs: &[K1]) ->
+       [joinable_task] {
         let tasks = [];
         for i in inputs {
             let m = map, c = ctrl, ii = i;
@@ -81,18 +82,18 @@ mod map_reduce {
         ret tasks;
     }
 
-    fn map_task<~K1, ~K2, ~V>(map : -mapper<K1,K2,V>,
-                              ctrl: -chan<ctrl_proto<K2,V>>, input: -K1) {
+    fn map_task<~K1, ~K2,
+                ~V>(map: -mapper<K1, K2, V>, ctrl: -chan<ctrl_proto<K2, V>>,
+                    input: -K1) {
         // log_err "map_task " + input;
         let intermediates = treemap::init();
 
-        fn emit<~K2, ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>,
-                         ctrl: &chan<ctrl_proto<K2,V>>, key: &K2, val: &V) {
+        fn emit<~K2,
+                ~V>(im: &treemap::treemap<K2, chan<reduce_proto<V>>>,
+                    ctrl: &chan<ctrl_proto<K2, V>>, key: &K2, val: &V) {
             let c;
             alt treemap::find(im, key) {
-              some(_c) {
-                c = _c
-              }
+              some(_c) { c = _c }
               none. {
                 let p = port();
                 send(ctrl, find_reducer(key, chan(p)));
@@ -106,15 +107,16 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) {
+        fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) {
             send(v, release);
         }
         treemap::traverse(intermediates, finish);
         send(ctrl, mapper_done);
     }
 
-    fn reduce_task<~K, ~V>(reduce : -reducer<K,V>,
-                           key: -K, out: -chan<chan<reduce_proto<V>>>) {
+    fn reduce_task<~K,
+                   ~V>(reduce: -reducer<K, V>, key: -K,
+                       out: -chan<chan<reduce_proto<V>>>) {
         let p = port();
 
         send(out, chan(p));
@@ -123,7 +125,7 @@ mod map_reduce {
         let is_done = false;
 
         fn get<~V>(p: &port<reduce_proto<V>>, ref_count: &mutable int,
-               is_done: &mutable bool) -> option<V> {
+                   is_done: &mutable bool) -> option<V> {
             while !is_done || ref_count > 0 {
                 alt recv(p) {
                   emit_val(v) {
@@ -144,9 +146,9 @@ mod map_reduce {
         reduce(key, bind get(p, ref_count, is_done));
     }
 
-    fn map_reduce<~K1, ~K2, ~V>(map : mapper<K1,K2,V>,
-                               reduce : reducer<K2, V>,
-                               inputs: &[K1]) {
+    fn map_reduce<~K1, ~K2,
+                  ~V>(map: mapper<K1, K2, V>, reduce: reducer<K2, V>,
+                      inputs: &[K1]) {
         let ctrl = port();
 
         // This task becomes the master control task. It task::_spawns
@@ -177,8 +179,8 @@ mod map_reduce {
                     let p = port();
                     let r = reduce, kk = k;
                     tasks +=
-                        [task::spawn_joinable(bind reduce_task(r,
-                                                               kk, chan(p)))];
+                        [task::spawn_joinable(bind reduce_task(r, kk,
+                                                               chan(p)))];
                     c = recv(p);
                     treemap::insert(reducers, k, c);
                   }
@@ -188,21 +190,18 @@ mod map_reduce {
             }
         }
 
-        fn finish<~K, ~V>(k : &K, v : &chan<reduce_proto<V>>) {
-            send(v, done);
-        }
+        fn finish<~K, ~V>(k: &K, v: &chan<reduce_proto<V>>) { send(v, done); }
         treemap::traverse(reducers, finish);
 
         for t in tasks { task::join(t); }
     }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(
-            #fmt["Usage: %s <filename> ...", argv[0]]);
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
@@ -227,12 +226,11 @@ fn main(argv: [istr]) {
     let elapsed = stop - start;
     elapsed /= 1000000u64;
 
-    log_err ~"MapReduce completed in " +
-        u64::str(elapsed) + ~"ms";
+    log_err "MapReduce completed in " + u64::str(elapsed) + "ms";
 }
 
-fn read_word(r: io::reader) -> option<istr> {
-    let w = ~"";
+fn read_word(r: io::reader) -> option<str> {
+    let w = "";
 
     while !r.eof() {
         let c = r.read_char();
@@ -240,7 +238,7 @@ fn read_word(r: io::reader) -> option<istr> {
 
         if is_word_char(c) {
             w += str::from_char(c);
-        } else { if w != ~"" { ret some(w); } }
+        } else { if w != "" { ret some(w); } }
     }
     ret none;
 }
diff --git a/src/test/bench/task-perf-word-count.rs b/src/test/bench/task-perf-word-count.rs
index c62ebc73b5d..a90abd9e526 100644
--- a/src/test/bench/task-perf-word-count.rs
+++ b/src/test/bench/task-perf-word-count.rs
@@ -29,7 +29,7 @@ import std::comm::port;
 import std::comm::recv;
 import std::comm::send;
 
-fn map(filename: &istr, emit: map_reduce::putter) {
+fn map(filename: &str, emit: map_reduce::putter) {
     let f = io::file_reader(filename);
 
 
@@ -38,7 +38,7 @@ fn map(filename: &istr, emit: map_reduce::putter) {
     }
 }
 
-fn reduce(word: &istr, get: map_reduce::getter) {
+fn reduce(word: &str, get: map_reduce::getter) {
     let count = 0;
 
 
@@ -52,36 +52,36 @@ mod map_reduce {
     export reducer;
     export map_reduce;
 
-    type putter = fn(&istr, int);
+    type putter = fn(&str, int);
 
-    type mapper = fn(&istr, putter);
+    type mapper = fn(&str, putter);
 
     type getter = fn() -> option<int>;
 
-    type reducer = fn(&istr, getter);
+    type reducer = fn(&str, getter);
 
     tag ctrl_proto {
-        find_reducer(istr, chan<chan<reduce_proto>>);
+        find_reducer(str, chan<chan<reduce_proto>>);
         mapper_done;
     }
 
     tag reduce_proto { emit_val(int); done; ref; release; }
 
-    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[istr])
-        -> [joinable_task] {
+    fn start_mappers(ctrl: chan<ctrl_proto>, inputs: &[str]) ->
+       [joinable_task] {
         let tasks = [];
-        for i: istr in inputs {
+        for i: str in inputs {
             tasks += [task::spawn_joinable(bind map_task(ctrl, i))];
         }
         ret tasks;
     }
 
-    fn map_task(ctrl: chan<ctrl_proto>, input: &istr) {
+    fn map_task(ctrl: chan<ctrl_proto>, input: &str) {
         // log_err "map_task " + input;
         let intermediates = map::new_str_hash();
 
-        fn emit(im: &map::hashmap<istr, chan<reduce_proto>>,
-                ctrl: chan<ctrl_proto>, key: &istr, val: int) {
+        fn emit(im: &map::hashmap<str, chan<reduce_proto>>,
+                ctrl: chan<ctrl_proto>, key: &str, val: int) {
             let c;
             alt im.find(key) {
               some(_c) {
@@ -101,7 +101,7 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        for each kv: @{key: istr, val: chan<reduce_proto>} in
+        for each kv: @{key: str, val: chan<reduce_proto>} in
                  intermediates.items() {
             send(kv.val, release);
         }
@@ -109,7 +109,7 @@ mod map_reduce {
         send(ctrl, mapper_done);
     }
 
-    fn reduce_task(key: &istr, out: chan<chan<reduce_proto>>) {
+    fn reduce_task(key: &str, out: chan<chan<reduce_proto>>) {
         let p = port();
 
         send(out, chan(p));
@@ -139,13 +139,13 @@ mod map_reduce {
         reduce(key, bind get(p, ref_count, is_done));
     }
 
-    fn map_reduce(inputs: &[istr]) {
+    fn map_reduce(inputs: &[str]) {
         let ctrl = port::<ctrl_proto>();
 
         // This task becomes the master control task. It task::_spawns
         // to do the rest.
 
-        let reducers: map::hashmap<istr, chan<reduce_proto>>;
+        let reducers: map::hashmap<str, chan<reduce_proto>>;
 
         reducers = map::new_str_hash();
 
@@ -171,8 +171,7 @@ mod map_reduce {
                     // log_err "creating new reducer for " + k;
                     let p = port();
                     tasks +=
-                        [task::spawn_joinable(
-                            bind reduce_task(k, chan(p)))];
+                        [task::spawn_joinable(bind reduce_task(k, chan(p)))];
                     c = recv(p);
                     reducers.insert(k, c);
                   }
@@ -182,7 +181,7 @@ mod map_reduce {
             }
         }
 
-        for each kv: @{key: istr, val: chan<reduce_proto>} in reducers.items()
+        for each kv: @{key: str, val: chan<reduce_proto>} in reducers.items()
                  {
             send(kv.val, done);
         }
@@ -191,12 +190,11 @@ mod map_reduce {
     }
 }
 
-fn main(argv: [istr]) {
+fn main(argv: [str]) {
     if vec::len(argv) < 2u {
         let out = io::stdout();
 
-        out.write_line(
-            #fmt["Usage: %s <filename> ...", argv[0]]);
+        out.write_line(#fmt["Usage: %s <filename> ...", argv[0]]);
 
         // TODO: run something just to make sure the code hasn't
         // broken yet. This is the unit test mode of this program.
@@ -216,11 +214,11 @@ fn main(argv: [istr]) {
     let elapsed = stop - start;
     elapsed /= 1000000u64;
 
-    log_err ~"MapReduce completed in " + u64::str(elapsed) + ~"ms";
+    log_err "MapReduce completed in " + u64::str(elapsed) + "ms";
 }
 
-fn read_word(r: io::reader) -> option<istr> {
-    let w = ~"";
+fn read_word(r: io::reader) -> option<str> {
+    let w = "";
 
     while !r.eof() {
         let c = r.read_char();
@@ -228,7 +226,7 @@ fn read_word(r: io::reader) -> option<istr> {
 
         if is_word_char(c) {
             w += str::from_char(c);
-        } else { if w != ~"" { ret some(w); } }
+        } else { if w != "" { ret some(w); } }
     }
     ret none;
 }